#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CCDC186	55088	broad.mit.edu	37	10	115891831	115891831	+	Silent	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr10:115891831G>A	ENST00000369287.3	-	11	2034	c.1768C>T	c.(1768-1770)Ctg>Ttg	p.L590L	C10orf118_ENST00000543782.1_Silent_p.L188L|C10orf118_ENST00000497592.1_5'Flank	NM_018017.2	NP_060487.2	Q7Z3E2	CC186_HUMAN		590								p.L590L(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(2)	24		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		TCTGTAAACAGCAGCAGCTCA	0.358																																					p.L590L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1768T	10						.						117.0	108.0	111.0					10																	115891831		2203	4300	6503	115881821	SO:0001819	synonymous_variant	55088	exon11																														ENST00000369287.3:c.1768C>T	10.37:g.115891831G>A		Somatic		Capture	Illumina HiSeq	Phase_I	115881821	NM_018017	Q2M2V6|Q3ZB81|Q6NS91|Q7RTP1|Q8N117|Q8N3G3|Q8N6C2|Q9NWA3	Silent	SNP	ENST00000369287.3	37	CCDS7587.1	.	.	.	.	.	.	.	.	.	.	G	5.818	0.335256	0.11013	.	.	ENSG00000165813	ENST00000428953	.	.	.	5.79	1.79	0.24919	.	.	.	.	.	T	0.21347	0.0514	.	.	.	0.21386	N	0.999708	.	.	.	.	.	.	T	0.20571	-1.0271	4	.	.	.	.	1.3499	0.02171	0.216:0.1142:0.4117:0.258	.	.	.	.	V	218	.	.	A	-	2	0	C10orf118	115881821	0.984000	0.35163	0.015000	0.15790	0.940000	0.58332	2.451000	0.44952	0.360000	0.24265	0.650000	0.86243	GCT		C10orf118-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050455.1		
ARMC4	55130	broad.mit.edu	37	10	28284046	28284046	+	Missense_Mutation	SNP	G	G	A	rs181484327		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr10:28284046G>A	ENST00000305242.5	-	2	118	c.26C>T	c.(25-27)aCg>aTg	p.T9M		NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	9					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.T9M(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						AGTCCACTGCGTCAATTTCCT	0.478													G|||	1	0.000199681	0.0	0.0	5008	,	,		18255	0.001		0.0	False		,,,				2504	0.0				p.T9M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C26T	10						.																																			28324052	SO:0001583	missense	55130	exon2			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.26C>T	10.37:g.28284046G>A	ENSP00000306410:p.Thr9Met	Somatic		Capture	Illumina HiSeq	Phase_I	28324052	NM_018076	A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	ENST00000305242.5	37	CCDS7157.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	12.50	1.955734	0.34471	.	.	ENSG00000169126	ENST00000305242	T	0.30182	1.54	4.86	3.95	0.45737	.	0.264379	0.36409	N	0.002613	T	0.17450	0.0419	N	0.08118	0	0.50171	D	0.999858	B	0.19200	0.034	B	0.08055	0.003	T	0.04281	-1.0963	10	0.87932	D	0	0.0254	12.9399	0.58337	0.0798:0.0:0.9202:0.0	.	9	Q5T2S8	ARMC4_HUMAN	M	9	ENSP00000306410:T9M	ENSP00000306410:T9M	T	-	2	0	ARMC4	28324052	0.277000	0.24220	0.003000	0.11579	0.002000	0.02628	1.906000	0.39887	1.022000	0.39626	0.585000	0.79938	ACG		ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076	
C10orf71	118461	broad.mit.edu	37	10	50532657	50532657	+	Silent	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr10:50532657G>A	ENST00000374144.3	+	3	2355	c.2067G>A	c.(2065-2067)caG>caA	p.Q689Q	C10orf71_ENST00000323868.4_Silent_p.Q689Q			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	689								p.Q689Q(2)		endometrium(1)	1						CAGGACTTCAGAACACACATT	0.502																																					p.Q689Q												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2067A	10						.						44.0	45.0	45.0					10																	50532657		1868	4097	5965	50202663	SO:0001819	synonymous_variant	118461	exon3			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.2067G>A	10.37:g.50532657G>A		Somatic		Capture	Illumina HiSeq	Phase_I	50202663	NM_001135196	A0AVL8	Silent	SNP	ENST00000374144.3	37	CCDS44387.1																																																																																				C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
PCDH15	65217	broad.mit.edu	37	10	55626440	55626440	+	Missense_Mutation	SNP	C	C	T	rs368127988		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr10:55626440C>T	ENST00000320301.6	-	27	4073	c.3679G>A	c.(3679-3681)Gac>Aac	p.D1227N	PCDH15_ENST00000437009.1_Missense_Mutation_p.D1156N|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395432.2_Missense_Mutation_p.D1190N|PCDH15_ENST00000395445.1_Missense_Mutation_p.D1234N|PCDH15_ENST00000361849.3_Missense_Mutation_p.D1227N|PCDH15_ENST00000395433.1_Missense_Mutation_p.D1205N|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373965.2_Missense_Mutation_p.D1234N|PCDH15_ENST00000409834.1_Missense_Mutation_p.D838N|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395430.1_Missense_Mutation_p.D1227N|PCDH15_ENST00000395438.1_Missense_Mutation_p.D1227N|PCDH15_ENST00000414778.1_Missense_Mutation_p.D1232N|PCDH15_ENST00000463095.1_5'UTR	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1227	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.D1232N(1)|p.D1227N(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TTCCCATAGTCGTCAGTTGCA	0.413										HNSCC(58;0.16)																											p.D1190N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3568A	10						.	C	ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP	0,4406		0,0,2203	123.0	106.0	112.0		3694,3679,3466,3679,3568,3613,3715,3679,3694,3679,3613,3679	0.5	0.7	10		112	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	PCDH15	NM_001142763.1,NM_001142764.1,NM_001142765.1,NM_001142766.1,NM_001142767.1,NM_001142768.1,NM_001142769.1,NM_001142770.1,NM_001142771.1,NM_001142772.1,NM_001142773.1,NM_033056.3	23,23,23,23,23,23,23,23,23,23,23,23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	1232/1963,1227/1958,1156/1887,1227/1953,1190/1916,1205/1936,1239/1791,1227/1540,1232/1683,1227/1678,1205/1933,1227/1956	55626440	1,13005	2203	4300	6503	55296446	SO:0001583	missense	65217	exon26			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.3679G>A	10.37:g.55626440C>T	ENSP00000322604:p.Asp1227Asn	Somatic		Capture	Illumina HiSeq	Phase_I	55296446	NM_001142767	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	9.303	1.053676	0.19907	0.0	1.16E-4	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78	5.47	0.506	0.16961	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.20210	0.0486	N	0.03891	-0.335	0.44162	D	0.99696	B;B;B;B;B;B;B;B;B;B;B;B;B	0.25809	0.05;0.089;0.089;0.025;0.08;0.089;0.05;0.088;0.135;0.135;0.068;0.003;0.052	B;B;B;B;B;B;B;B;B;B;B;B;B	0.30251	0.08;0.037;0.037;0.015;0.113;0.08;0.08;0.113;0.104;0.104;0.047;0.009;0.02	T	0.17961	-1.0352	9	0.06099	T	0.92	.	10.0187	0.42029	0.0:0.5885:0.0:0.4115	.	1205;1227;1227;1232;1156;1190;1227;1227;1234;1234;1227;1232;1227	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	N	1234;1232;1227;1227;838;1234;1190;1227;1205;1227;1227;1232;1156	ENSP00000363076:D1234N;ENSP00000410304:D1232N;ENSP00000378826:D1227N;ENSP00000386693:D838N;ENSP00000378832:D1234N;ENSP00000378820:D1190N;ENSP00000354950:D1227N;ENSP00000378821:D1205N;ENSP00000322604:D1227N;ENSP00000378818:D1227N;ENSP00000412628:D1156N	ENSP00000322604:D1227N	D	-	1	0	PCDH15	55296446	0.002000	0.14202	0.719000	0.30619	0.932000	0.56968	0.033000	0.13754	-0.162000	0.10964	-0.244000	0.11960	GAC		PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
GRID1	2894	broad.mit.edu	37	10	87484326	87484326	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr10:87484326C>A	ENST00000327946.7	-	11	1726	c.1641G>T	c.(1639-1641)aaG>aaT	p.K547N	GRID1_ENST00000536331.1_Missense_Mutation_p.K118N	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	547					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.K547N(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						TCTCCTCGGGCTTCTTAATTA	0.512										Multiple Myeloma(13;0.14)																											p.K547N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1641T	10						.						70.0	69.0	69.0					10																	87484326		2203	4300	6503	87474306	SO:0001583	missense	2894	exon11			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1641G>T	10.37:g.87484326C>A	ENSP00000330148:p.Lys547Asn	Somatic		Capture	Illumina HiSeq	Phase_I	87474306	NM_017551	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	C	13.11	2.138150	0.37728	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.32753	1.44;1.44	5.83	3.97	0.46021	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.087086	0.85682	D	0.000000	T	0.47911	0.1471	M	0.80422	2.495	0.58432	D	0.999999	P	0.49307	0.922	P	0.50270	0.636	T	0.53746	-0.8395	10	0.87932	D	0	.	14.7847	0.69793	0.0:0.8685:0.0:0.1315	.	547	Q9ULK0	GRID1_HUMAN	N	547;118	ENSP00000330148:K547N;ENSP00000444455:K118N	ENSP00000330148:K547N	K	-	3	2	GRID1	87474306	0.998000	0.40836	0.997000	0.53966	0.207000	0.24258	0.656000	0.24948	0.387000	0.25024	-0.813000	0.03139	AAG		GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
MTG1	92170	broad.mit.edu	37	10	135212714	135212714	+	Missense_Mutation	SNP	G	G	A	rs540025351		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr10:135212714G>A	ENST00000317502.6	+	5	454	c.404G>A	c.(403-405)cGc>cAc	p.R135H	RP11-108K14.8_ENST00000468317.2_Missense_Mutation_p.R140H|MTG1_ENST00000477902.2_Missense_Mutation_p.R94H	NM_138384.2	NP_612393.2	Q9BT17	MTG1_HUMAN	mitochondrial ribosome-associated GTPase 1	135	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R135H(1)		endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)		AGAAGCCACCGCTACCACCGA	0.627													g|||	1	0.000199681	0.0	0.0	5008	,	,		16320	0.0		0.0	False		,,,				2504	0.001				p.R135H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G404A	10						.						69.0	60.0	63.0					10																	135212714		2203	4300	6503	135062704	SO:0001583	missense	92170	exon5				CCDS31320.1	10q26.3	2013-05-24	2013-05-24	2006-01-09	ENSG00000148824	ENSG00000148824			32159	protein-coding gene	gene with protein product			"""GTP-binding protein 7"", ""GTP-binding protein 7 (putative)"", ""mitochondrial GTPase 1 homolog (S. cerevisiae)"""	GTPBP7		12808030, 23396448	Standard	NM_138384		Approved		uc001lnd.3	Q9BT17	OTTHUMG00000166564	ENST00000317502.6:c.404G>A	10.37:g.135212714G>A	ENSP00000323047:p.Arg135His	Somatic		Capture	Illumina HiSeq	Phase_I	135062704	NM_138384	Q5VWX8|Q6PIY9|Q8IYJ4|Q8NC48|Q9BVU8	Missense_Mutation	SNP	ENST00000317502.6	37	CCDS31320.1	.	.	.	.	.	.	.	.	.	.	g	11.88	1.769476	0.31320	.	.	ENSG00000254536;ENSG00000148824;ENSG00000148824;ENSG00000148824	ENST00000468317;ENST00000317502;ENST00000432508;ENST00000537620	T;T;T	0.13778	2.56;2.56;2.56	4.58	3.68	0.42216	.	0.240601	0.43110	N	0.000607	T	0.26085	0.0636	M	0.87180	2.865	0.80722	D	1	P;P	0.49253	0.921;0.877	P;B	0.45971	0.499;0.384	T	0.14476	-1.0471	10	0.87932	D	0	0.1033	10.751	0.46209	0.096:0.0:0.904:0.0	.	135;135	E7EVK2;Q9BT17	.;MTG1_HUMAN	H	140;135;135;94	ENSP00000436767:R140H;ENSP00000323047:R135H;ENSP00000393480:R135H	ENSP00000323047:R135H	R	+	2	0	AL360181.1;MTG1	135062704	1.000000	0.71417	0.998000	0.56505	0.089000	0.18198	5.746000	0.68681	1.060000	0.40578	-0.158000	0.13435	CGC		MTG1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051166.1	NM_138384	
C11orf16	56673	broad.mit.edu	37	11	8948528	8948528	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr11:8948528C>T	ENST00000326053.5	-	4	624	c.518G>A	c.(517-519)gGc>gAc	p.G173D	C11orf16_ENST00000528998.1_5'Flank|C11orf16_ENST00000525780.1_Missense_Mutation_p.G173D	NM_020643.2	NP_065694.2	Q9NQ32	CK016_HUMAN	chromosome 11 open reading frame 16	173								p.G173D(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	22				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		AAGAACAGTGCCAGGGCCATA	0.552																																					p.G173D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G518A	11						.						84.0	79.0	80.0					11																	8948528		2201	4296	6497	8905104	SO:0001583	missense	56673	exon4			AJ400877	CCDS7794.1	11p15.3	2008-06-25			ENSG00000176029	ENSG00000176029			1169	protein-coding gene	gene with protein product						11528127	Standard	NM_020643		Approved		uc001mhb.4	Q9NQ32	OTTHUMG00000165654	ENST00000326053.5:c.518G>A	11.37:g.8948528C>T	ENSP00000318999:p.Gly173Asp	Somatic		Capture	Illumina HiSeq	Phase_I	8905104	NM_020643	Q53FB2|Q8N6Y9	Missense_Mutation	SNP	ENST00000326053.5	37	CCDS7794.1	.	.	.	.	.	.	.	.	.	.	C	15.43	2.832369	0.50845	.	.	ENSG00000176029	ENST00000525780;ENST00000326053	T;T	0.51574	0.7;0.7	5.62	4.7	0.59300	.	0.000000	0.64402	D	0.000006	T	0.67401	0.2889	M	0.71581	2.175	0.39666	D	0.970684	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.99	T	0.73408	-0.3992	10	0.87932	D	0	-21.3385	14.8589	0.70362	0.0:0.8566:0.1434:0.0	.	173;173	Q9NQ32-2;Q9NQ32	.;CK016_HUMAN	D	173	ENSP00000436818:G173D;ENSP00000318999:G173D	ENSP00000318999:G173D	G	-	2	0	C11orf16	8905104	1.000000	0.71417	1.000000	0.80357	0.072000	0.16883	2.842000	0.48230	1.343000	0.45638	0.591000	0.81541	GGC		C11orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385626.1	NM_020643	
OR4A15	81328	broad.mit.edu	37	11	55135594	55135594	+	Missense_Mutation	SNP	G	G	A	rs545781371	byFrequency	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr11:55135594G>A	ENST00000314706.3	+	1	235	c.235G>A	c.(235-237)Gcc>Acc	p.A79T		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A79T(1)		NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						GACCATCATGGCCAGCCAGTC	0.428													.|||	2	0.000399361	0.0	0.0	5008	,	,		18689	0.0		0.0	False		,,,				2504	0.002				p.A79T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G235A	11						.						100.0	94.0	96.0					11																	55135594		2201	4296	6497	54892170	SO:0001583	missense	81328	exon1			AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.235G>A	11.37:g.55135594G>A	ENSP00000325065:p.Ala79Thr	Somatic		Capture	Illumina HiSeq	Phase_I	54892170	NM_001005275	Q6IFL4|Q96R65	Missense_Mutation	SNP	ENST00000314706.3	37	CCDS31500.1	.	.	.	.	.	.	.	.	.	.	g	9.003	0.980547	0.18812	.	.	ENSG00000181958	ENST00000314706	T	0.01240	5.12	3.48	0.146	0.14833	GPCR, rhodopsin-like superfamily (1);	0.622148	0.14035	N	0.345819	T	0.00580	0.0019	N	0.02916	-0.46	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.48234	-0.9053	10	0.05525	T	0.97	.	4.5106	0.11910	0.1199:0.0:0.3346:0.5455	.	79	Q8NGL6	O4A15_HUMAN	T	79	ENSP00000325065:A79T	ENSP00000325065:A79T	A	+	1	0	OR4A15	54892170	0.000000	0.05858	0.020000	0.16555	0.365000	0.29674	-2.389000	0.01058	0.630000	0.30394	0.492000	0.49549	GCC		OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391161.1	NM_001005275	
OR4A15	81328	broad.mit.edu	37	11	55136369	55136369	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr11:55136369C>G	ENST00000314706.3	+	1	1010	c.1010C>G	c.(1009-1011)gCt>gGt	p.A337G		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	337						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A337G(1)		NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						GTAAGCTTAGCTGGGAAATGG	0.363																																					p.A337G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1010G	11						.						80.0	81.0	81.0					11																	55136369		2201	4296	6497	54892945	SO:0001583	missense	81328	exon1			AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.1010C>G	11.37:g.55136369C>G	ENSP00000325065:p.Ala337Gly	Somatic		Capture	Illumina HiSeq	Phase_I	54892945	NM_001005275	Q6IFL4|Q96R65	Missense_Mutation	SNP	ENST00000314706.3	37	CCDS31500.1	.	.	.	.	.	.	.	.	.	.	-	0.224	-1.026455	0.02045	.	.	ENSG00000181958	ENST00000314706	T	0.18502	2.21	2.3	-4.6	0.03390	.	2.204880	0.02218	N	0.063740	T	0.05410	0.0143	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.27536	-1.0071	10	0.07482	T	0.82	.	0.7705	0.01023	0.2295:0.3768:0.2219:0.1718	.	337	Q8NGL6	O4A15_HUMAN	G	337	ENSP00000325065:A337G	ENSP00000325065:A337G	A	+	2	0	OR4A15	54892945	.	.	0.000000	0.03702	0.003000	0.03518	.	.	-3.201000	0.00217	-0.454000	0.05498	GCT		OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391161.1	NM_001005275	
GRIK4	2900	broad.mit.edu	37	11	120776004	120776004	+	Silent	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr11:120776004C>T	ENST00000527524.2	+	13	1565	c.1278C>T	c.(1276-1278)aaC>aaT	p.N426N	GRIK4_ENST00000438375.2_Silent_p.N426N	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	426					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.N426N(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		TGCAGGAGAACCCATATTTAA	0.582																																					p.N426N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1278T	11						.						154.0	157.0	156.0					11																	120776004		2203	4299	6502	120281214	SO:0001819	synonymous_variant	2900	exon11			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1278C>T	11.37:g.120776004C>T		Somatic		Capture	Illumina HiSeq	Phase_I	120281214	NM_014619	A8K9L1	Silent	SNP	ENST00000527524.2	37	CCDS8433.1																																																																																				GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619	
EID3	493861	broad.mit.edu	37	12	104698464	104698464	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr12:104698464C>A	ENST00000527879.1	+	1	948	c.752C>A	c.(751-753)tCt>tAt	p.S251Y	TXNRD1_ENST00000526390.1_Intron|TXNRD1_ENST00000529546.1_Intron|TXNRD1_ENST00000354940.6_Intron|TXNRD1_ENST00000525566.1_Intron|TXNRD1_ENST00000524698.1_Intron|TXNRD1_ENST00000378070.4_Intron|TXNRD1_ENST00000388854.3_Intron|TXNRD1_ENST00000542918.1_Intron|TXNRD1_ENST00000503506.2_Intron|TXNRD1_ENST00000429002.2_Intron|TXNRD1_ENST00000540716.1_Intron|TXNRD1_ENST00000526691.1_Intron|TXNRD1_ENST00000397736.2_Intron	NM_001008394.2	NP_001008395.1			EP300 interacting inhibitor of differentiation 3									p.S251Y(1)		large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						GATCCAAACTCTTTTTCTCGT	0.348																																					p.S251Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C752A	12						.						65.0	61.0	62.0					12																	104698464		1817	4082	5899	103222594	SO:0001583	missense	493861	exon1			BC027612	CCDS53822.1	12q23.3	2006-11-24				ENSG00000255150			32961	protein-coding gene	gene with protein product		612986				15987788, 15752197	Standard	NM_001008394		Approved	FLJ25832, NSMCE4B, NSE4B	uc001tkw.3	Q8N140		ENST00000527879.1:c.752C>A	12.37:g.104698464C>A	ENSP00000435619:p.Ser251Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	103222594	NM_001008394		Missense_Mutation	SNP	ENST00000527879.1	37	CCDS53822.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.298283	0.60195	.	.	ENSG00000255150	ENST00000527879	T	0.70399	-0.48	4.45	3.56	0.40772	.	.	.	.	.	T	0.81645	0.4866	M	0.77486	2.375	0.39763	D	0.972059	D	0.89917	1.0	D	0.91635	0.999	T	0.83170	-0.0094	9	0.87932	D	0	.	8.814	0.34985	0.0:0.8966:0.0:0.1034	.	251	Q8N140	EID3_HUMAN	Y	251	ENSP00000435619:S251Y	ENSP00000435619:S251Y	S	+	2	0	EID3	103222594	0.996000	0.38824	0.975000	0.42487	0.986000	0.74619	5.101000	0.64566	1.239000	0.43787	0.555000	0.69702	TCT		EID3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387034.1	NM_001008394	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
KMT2D	8085	broad.mit.edu	37	12	49447406	49447406	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr12:49447406A>C	ENST00000301067.7	-	6	691	c.692T>G	c.(691-693)gTg>gGg	p.V231G		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	231	Cys-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.V231G(1)									CCCCTCACACACTGCACAGCG	0.572																																					p.V231G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T692G	12						.						32.0	35.0	34.0					12																	49447406		2129	4222	6351	47733673	SO:0001583	missense	8085	exon6			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.692T>G	12.37:g.49447406A>C	ENSP00000301067:p.Val231Gly	Somatic		Capture	Illumina HiSeq	Phase_I	47733673	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	A	12.01	1.808917	0.31961	.	.	ENSG00000167548	ENST00000301067	D	0.89485	-2.52	4.9	4.9	0.64082	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.32055	N	0.006644	D	0.93025	0.7780	M	0.68952	2.095	0.51767	D	0.999938	D	0.76494	0.999	D	0.70227	0.968	D	0.93735	0.7045	10	0.87932	D	0	.	13.536	0.61646	1.0:0.0:0.0:0.0	.	231	O14686	MLL2_HUMAN	G	231	ENSP00000301067:V231G	ENSP00000301067:V231G	V	-	2	0	MLL2	47733673	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.399000	0.79935	1.842000	0.53543	0.459000	0.35465	GTG		KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KRT1	3848	broad.mit.edu	37	12	53072355	53072355	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr12:53072355C>T	ENST00000252244.3	-	2	835	c.777G>A	c.(775-777)atG>atA	p.M259I		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	259	Coil 1B.|Rod.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)	p.M259I(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						CCATGTCCTGCATGTTCTTCA	0.438																																					p.M259I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G777A	12						.						180.0	161.0	168.0					12																	53072355		2203	4300	6503	51358622	SO:0001583	missense	3848	exon2			X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.777G>A	12.37:g.53072355C>T	ENSP00000252244:p.Met259Ile	Somatic		Capture	Illumina HiSeq	Phase_I	51358622	NM_006121	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Missense_Mutation	SNP	ENST00000252244.3	37	CCDS8836.1	.	.	.	.	.	.	.	.	.	.	C	15.01	2.705015	0.48412	.	.	ENSG00000167768	ENST00000252244	D	0.88431	-2.38	4.98	4.07	0.47477	Filament (1);	.	.	.	.	D	0.91164	0.7217	M	0.79343	2.45	0.35402	D	0.791659	P	0.43024	0.798	P	0.53988	0.739	D	0.92346	0.5885	9	0.62326	D	0.03	.	5.2082	0.15302	0.1407:0.5631:0.2195:0.0767	.	259	P04264	K2C1_HUMAN	I	259	ENSP00000252244:M259I	ENSP00000252244:M259I	M	-	3	0	KRT1	51358622	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	1.326000	0.33735	1.197000	0.43143	0.655000	0.94253	ATG		KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	
CDK4	1019	broad.mit.edu	37	12	58142985	58142985	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr12:58142985A>G	ENST00000257904.6	-	7	1164	c.799T>C	c.(799-801)Tcg>Ccg	p.S267P	CDK4_ENST00000540325.1_Missense_Mutation_p.S147P|CDK4_ENST00000549606.1_Missense_Mutation_p.S4P|CDK4_ENST00000312990.6_3'UTR|CDK4_ENST00000551888.1_5'UTR|TSPAN31_ENST00000547992.1_3'UTR	NM_000075.3	NP_000066.1	P11802	CDK4_HUMAN	cyclin-dependent kinase 4	267	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell division (GO:0051301)|circadian rhythm (GO:0007623)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell cycle arrest (GO:0071157)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell size (GO:0045793)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of translation (GO:0045727)|protein phosphorylation (GO:0006468)|regulation of gene expression (GO:0010468)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to lead ion (GO:0010288)|response to testosterone (GO:0033574)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)	chromatin (GO:0000785)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.S267P(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	21	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			TGTGCTCCCGACTCCTCCATC	0.607			Mis			melanoma			Hereditary Melanoma																												p.S267P		yes	Dom		Familial malignant melanoma	12	12q14	1019	cyclin-dependent kinase 4		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T799C	12						.						65.0	72.0	70.0					12																	58142985		2203	4300	6503	56429252	SO:0001583	missense	1019	exon7	Familial Cancer Database	Familial Atypical Multiple Mole Melanoma sydrome, FAMMM, Familial Dysplastic Nevus syndrome	M14505	CCDS8953.1	12q13	2014-09-17				ENSG00000135446		"""Cyclin-dependent kinases"""	1773	protein-coding gene	gene with protein product		123829				8275715	Standard	NM_000075		Approved	PSK-J3	uc001spv.3	P11802		ENST00000257904.6:c.799T>C	12.37:g.58142985A>G	ENSP00000257904:p.Ser267Pro	Somatic		Capture	Illumina HiSeq	Phase_I	56429252	NM_000075	B2R9A0|B4DNF9|O00576|Q6FG61	Missense_Mutation	SNP	ENST00000257904.6	37	CCDS8953.1	.	.	.	.	.	.	.	.	.	.	A	11.43	1.636030	0.29068	.	.	ENSG00000135446	ENST00000257904;ENST00000549606;ENST00000540325;ENST00000546489	T;T;T;T	0.66638	-0.22;0.92;-0.22;-0.22	4.44	3.27	0.37495	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.582640	0.18126	N	0.150888	T	0.46908	0.1417	N	0.25647	0.755	0.54753	D	0.99998	B	0.02656	0.0	B	0.06405	0.002	T	0.35871	-0.9771	10	0.33141	T	0.24	.	3.7483	0.08556	0.7111:0.0:0.0985:0.1904	.	267	P11802	CDK4_HUMAN	P	267;4;147;193	ENSP00000257904:S267P;ENSP00000447005:S4P;ENSP00000439076:S147P;ENSP00000447779:S193P	ENSP00000257904:S267P	S	-	1	0	CDK4	56429252	0.000000	0.05858	0.998000	0.56505	0.985000	0.73830	0.133000	0.15912	1.007000	0.39238	0.533000	0.62120	TCG		CDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408790.2	NM_000075	
NCOR2	9612	broad.mit.edu	37	12	124821696	124821696	+	Silent	SNP	C	C	T	rs2229842	byFrequency	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr12:124821696C>T	ENST00000405201.1	-	38	5718	c.5718G>A	c.(5716-5718)ccG>ccA	p.P1906P	NCOR2_ENST00000397355.1_Silent_p.P1897P|NCOR2_ENST00000404621.1_Silent_p.P1896P|NCOR2_ENST00000429285.2_Silent_p.P1896P|NCOR2_ENST00000356219.3_Silent_p.P1913P|NCOR2_ENST00000404121.2_Silent_p.P1467P			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1917					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.P1906P(1)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		ATGTGGCAGCCGGGCGAACGG	0.672													c|||	1279	0.255391	0.1694	0.245	5008	,	,		14363	0.5079		0.1302	False		,,,				2504	0.2474				p.P1913P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5739A	12						.		,,	552,3316		30,492,1412	11.0	16.0	14.0		5688,5688,5718	-8.7	0.3	12	dbSNP_98	14	1024,6994		60,904,3045	no	coding-synonymous,coding-synonymous,coding-synonymous	NCOR2	NM_001077261.3,NM_001206654.1,NM_006312.5	,,	90,1396,4457	TT,TC,CC		12.7713,14.2709,13.2593	,,	1896/2459,1896/2505,1906/2515	124821696	1576,10310	1934	4009	5943	123387649	SO:0001819	synonymous_variant	9612	exon40			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5718G>A	12.37:g.124821696C>T		Somatic		Capture	Illumina HiSeq	Phase_I	123387649	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2	519	0.23763736263736263	71	0.1443089430894309	74	0.20441988950276244	271	0.4737762237762238	103	0.1358839050131926	c	7.338	0.620237	0.14193	0.142709	0.127713	ENSG00000196498	ENST00000440187	.	.	.	4.36	-8.71	0.00848	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.24333	P	0.99499456	.	.	.	.	.	.	T	0.40701	-0.9549	3	.	.	.	-13.2026	4.7644	0.13125	0.1575:0.1151:0.121:0.6065	rs2229842;rs3741511	.	.	.	S	141	.	.	G	-	1	0	NCOR2	123387649	0.000000	0.05858	0.343000	0.25615	0.797000	0.45037	-4.763000	0.00189	-1.562000	0.01682	-0.265000	0.10407	GGC		NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
CRYL1	51084	broad.mit.edu	37	13	20987513	20987513	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr13:20987513G>A	ENST00000298248.7	-	6	709	c.647C>T	c.(646-648)tCt>tTt	p.S216F	CRYL1_ENST00000382812.1_Missense_Mutation_p.S194F	NM_015974.2	NP_057058.2	Q9Y2S2	CRYL1_HUMAN	crystallin, lambda 1	216					fatty acid metabolic process (GO:0006631)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|L-gulonate 3-dehydrogenase activity (GO:0050104)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)	p.S216F(1)		NS(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		GTCACTAGGAGACACGATTCC	0.463																																					p.S216F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C647T	13						.						113.0	110.0	111.0					13																	20987513		1968	4150	6118	19885513	SO:0001583	missense	51084	exon6			AF077049	CCDS41871.1	13q11	2008-07-18			ENSG00000165475	ENSG00000165475			18246	protein-coding gene	gene with protein product	"""crystallin, lamda 1"", ""L-gulonate 3-dehydrogenase"", ""lambda-crystallin homolog"""	609877				12527201	Standard	NM_015974		Approved	GDH, lambda-CRY, MGC149525, MGC149526	uc001une.3	Q9Y2S2	OTTHUMG00000016516	ENST00000298248.7:c.647C>T	13.37:g.20987513G>A	ENSP00000298248:p.Ser216Phe	Somatic		Capture	Illumina HiSeq	Phase_I	19885513	NM_015974	A0PJ43|B3KN92|Q0VDI1|Q7Z4Z9|Q9P0G7	Missense_Mutation	SNP	ENST00000298248.7	37	CCDS41871.1	.	.	.	.	.	.	.	.	.	.	G	12.26	1.885358	0.33255	.	.	ENSG00000165475	ENST00000298248;ENST00000382812	D;D	0.90444	-2.67;-2.67	5.11	5.11	0.69529	3-hydroxyacyl-CoA dehydrogenase, C-terminal (1);Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.000000	0.85682	D	0.000000	D	0.96531	0.8868	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.97620	1.0135	10	0.87932	D	0	-22.0848	17.3171	0.87227	0.0:0.0:1.0:0.0	.	216	Q9Y2S2	CRYL1_HUMAN	F	216;194	ENSP00000298248:S216F;ENSP00000372262:S194F	ENSP00000298248:S216F	S	-	2	0	CRYL1	19885513	1.000000	0.71417	0.978000	0.43139	0.097000	0.18754	6.105000	0.71505	2.371000	0.80710	0.561000	0.74099	TCT		CRYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044071.1	NM_015974	
FRY	10129	broad.mit.edu	37	13	32676113	32676113	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr13:32676113C>T	ENST00000380250.3	+	3	780	c.284C>T	c.(283-285)aCa>aTa	p.T95I		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	95						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.T95I(1)		NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		AAGCCATTGACAAAATCTCTG	0.313																																					p.T95I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C284T	13						.						100.0	99.0	99.0					13																	32676113		1826	4073	5899	31574113	SO:0001583	missense	10129	exon3			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.284C>T	13.37:g.32676113C>T	ENSP00000369600:p.Thr95Ile	Somatic		Capture	Illumina HiSeq	Phase_I	31574113	NM_023037	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	C	14.54	2.566278	0.45694	.	.	ENSG00000073910	ENST00000380250;ENST00000436046;ENST00000267067	T	0.21932	1.98	5.15	5.15	0.70609	.	0.054125	0.64402	D	0.000001	T	0.25195	0.0612	L	0.56769	1.78	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.03695	-1.1012	10	0.87932	D	0	.	15.6974	0.77512	0.0:1.0:0.0:0.0	.	95	Q5TBA9	FRY_HUMAN	I	95;92;61	ENSP00000369600:T95I	ENSP00000267067:T61I	T	+	2	0	FRY	31574113	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.249000	0.65427	2.547000	0.85894	0.655000	0.94253	ACA		FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
MYH6	4624	broad.mit.edu	37	14	23858159	23858159	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr14:23858159C>T	ENST00000356287.3	-	28	4113	c.4084G>A	c.(4084-4086)Gtc>Atc	p.V1362I	MIR208A_ENST00000362287.1_RNA|MYH6_ENST00000405093.3_Missense_Mutation_p.V1362I			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1362					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.V1362I(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TTGGACAGGACGCGCTGCAGC	0.652																																					p.V1362I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4084A	14						.						73.0	65.0	68.0					14																	23858159		2203	4300	6503	22927999	SO:0001583	missense	4624	exon29			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.4084G>A	14.37:g.23858159C>T	ENSP00000348634:p.Val1362Ile	Somatic		Capture	Illumina HiSeq	Phase_I	22927999	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	N	11.46	1.644263	0.29246	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	T;T	0.77877	-1.13;-1.13	4.74	3.86	0.44501	Myosin tail (1);	.	.	.	.	T	0.54615	0.1869	N	0.04508	-0.205	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.45293	-0.9271	9	0.51188	T	0.08	.	4.8919	0.13731	0.1518:0.612:0.0:0.2362	.	1362	P13533	MYH6_HUMAN	I	1362	ENSP00000386041:V1362I;ENSP00000348634:V1362I	ENSP00000348634:V1362I	V	-	1	0	MYH6	22927999	0.000000	0.05858	0.990000	0.47175	0.823000	0.46562	-0.194000	0.09559	1.124000	0.41980	-0.142000	0.14014	GTC		MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
SYT16	83851	broad.mit.edu	37	14	62567295	62567295	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr14:62567295G>A	ENST00000430451.2	+	6	2005	c.1808G>A	c.(1807-1809)cGt>cAt	p.R603H	RP11-355I22.2_ENST00000554252.1_lincRNA	NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	603	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)			p.R583H(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		ACTATGAAGCGTAAAGAGATG	0.483																																					p.R603H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1808A	14						.						104.0	105.0	105.0					14																	62567295		2036	4182	6218	61637048	SO:0001583	missense	83851	exon6			BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.1808G>A	14.37:g.62567295G>A	ENSP00000394700:p.Arg603His	Somatic		Capture	Illumina HiSeq	Phase_I	61637048	NM_031914	B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Missense_Mutation	SNP	ENST00000430451.2	37	CCDS45121.1	.	.	.	.	.	.	.	.	.	.	G	34	5.351401	0.95830	.	.	ENSG00000139973	ENST00000430451	T	0.73152	-0.72	5.37	5.37	0.77165	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.84284	0.5438	M	0.78223	2.4	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.83168	-0.0095	10	0.36615	T	0.2	.	19.1089	0.93309	0.0:0.0:1.0:0.0	.	603	Q17RD7	SYT16_HUMAN	H	603	ENSP00000394700:R603H	ENSP00000394700:R603H	R	+	2	0	SYT16	61637048	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.507000	0.81676	2.520000	0.84964	0.655000	0.94253	CGT		SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000411700.1	NM_031914	
PGF	5228	broad.mit.edu	37	14	75415222	75415222	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr14:75415222C>T	ENST00000405431.2	-	4	379	c.380G>A	c.(379-381)cGc>cAc	p.R127H	PGF_ENST00000553716.1_Missense_Mutation_p.R127H|PGF_ENST00000238607.6_Missense_Mutation_p.R126H|PGF_ENST00000555567.1_Missense_Mutation_p.R127H			P49763	PLGF_HUMAN	placental growth factor	127					branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|regulation of morphogenesis of a branching structure (GO:0060688)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)	p.R127H(1)		kidney(1)|large_intestine(3)|lung(3)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(234;0.00668)	Aflibercept(DB08885)	GCATTCGCAGCGAACGTGCTG	0.602																																					p.R127H	GBM(127;389 2301 5452 48547)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G380A	14						.						54.0	52.0	53.0					14																	75415222		2203	4300	6503	74484975	SO:0001583	missense	5228	exon4			S72960	CCDS9835.1, CCDS55932.1, CCDS73664.1	14q24.3	2013-02-18	2008-03-20		ENSG00000119630	ENSG00000119630			8893	protein-coding gene	gene with protein product	"""placenta growth factor"""	601121	"""placental growth factor-like"", ""placental growth factor, vascular endothelial growth factor-related protein"""	PGFL		7681160	Standard	NM_002632		Approved	PLGF, PlGF-2, PlGF, SHGC-10760, D12S1900	uc001xqz.3	P49763	OTTHUMG00000171496	ENST00000405431.2:c.380G>A	14.37:g.75415222C>T	ENSP00000385365:p.Arg127His	Somatic		Capture	Illumina HiSeq	Phase_I	74484975	NM_002632	Q07101|Q9BV78|Q9Y6S8	Missense_Mutation	SNP	ENST00000405431.2	37	CCDS9835.1	.	.	.	.	.	.	.	.	.	.	C	7.401	0.632700	0.14322	.	.	ENSG00000119630	ENST00000555567;ENST00000553716;ENST00000238607;ENST00000405431	.	.	.	5.06	0.398	0.16319	Platelet-derived growth factor (PDGF) (3);	0.748873	0.13068	N	0.416346	T	0.30823	0.0777	L	0.49126	1.545	0.09310	N	1	B;B;B;B	0.24823	0.036;0.112;0.052;0.01	B;B;B;B	0.15484	0.009;0.013;0.008;0.005	T	0.24941	-1.0146	9	0.59425	D	0.04	.	3.6718	0.08277	0.2351:0.3781:0.0:0.3869	.	127;127;126;127	P49763;P49763-2;G3XA84;Q53XY6	PLGF_HUMAN;.;.;.	H	127;127;126;127	.	ENSP00000238607:R127H	R	-	2	0	PGF	74484975	0.007000	0.16637	0.005000	0.12908	0.018000	0.09664	-0.033000	0.12246	-0.245000	0.09625	-0.471000	0.05019	CGC		PGF-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414064.1	NM_002632	
OCA2	4948	broad.mit.edu	37	15	28260069	28260069	+	Silent	SNP	C	C	T	rs149191701		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr15:28260069C>T	ENST00000354638.3	-	9	1052	c.897G>A	c.(895-897)acG>acA	p.T299T	OCA2_ENST00000382996.2_Silent_p.T299T|OCA2_ENST00000353809.5_Silent_p.T299T	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	299					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.T299T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		TGATGGACACCGTCTCTCTGC	0.542									Oculocutaneous Albinism																												p.T299T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G897A	15						.	C		0,4406		0,0,2203	108.0	78.0	88.0		897	-10.7	0.0	15	dbSNP_134	88	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	OCA2	NM_000275.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		299/839	28260069	2,13004	2203	4300	6503	25933664	SO:0001819	synonymous_variant	4948	exon9	Familial Cancer Database			CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.897G>A	15.37:g.28260069C>T		Somatic		Capture	Illumina HiSeq	Phase_I	25933664	NM_000275	Q15211|Q15212|Q96EN1|Q9UMI5	Silent	SNP	ENST00000354638.3	37	CCDS10020.1																																																																																				OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275	
DUOX2	50506	broad.mit.edu	37	15	45387683	45387683	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr15:45387683T>G	ENST00000603300.1	-	31	4393	c.4191A>C	c.(4189-4191)aaA>aaC	p.K1397N	DUOX2_ENST00000389039.6_Missense_Mutation_p.K1397N	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	1397					adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)	p.K1397N(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		AGACCAGGTCTTTGAGGATGG	0.532																																					p.K1397N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4191C	15						.						157.0	134.0	142.0					15																	45387683		2198	4298	6496	43174975	SO:0001583	missense	50506	exon31			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.4191A>C	15.37:g.45387683T>G	ENSP00000475084:p.Lys1397Asn	Somatic		Capture	Illumina HiSeq	Phase_I	43174975	NM_014080	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	37	CCDS10117.1	.	.	.	.	.	.	.	.	.	.	T	14.66	2.602018	0.46423	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.84	4.71	0.59529	Ferric reductase, NAD binding (1);	0.000000	0.85682	D	0.000000	T	0.66761	0.2822	M	0.80422	2.495	0.58432	D	0.999998	B	0.29341	0.242	B	0.38880	0.284	T	0.62982	-0.6738	9	0.32370	T	0.25	-11.1406	10.0016	0.41931	0.0:0.1413:0.0:0.8587	.	1397	Q9NRD8	DUOX2_HUMAN	N	1397	.	ENSP00000373691:K1397N	K	-	3	2	DUOX2	43174975	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.800000	0.27042	1.028000	0.39785	0.459000	0.35465	AAA		DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
MYO1E	4643	broad.mit.edu	37	15	59501014	59501014	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr15:59501014C>A	ENST00000288235.4	-	14	1795	c.1396G>T	c.(1396-1398)Gtg>Ttg	p.V466L		NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	466	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)	p.V466L(1)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		GTGGCGCACACGTCATCCAGG	0.537																																					p.V466L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1396T	15						.						123.0	102.0	109.0					15																	59501014		2191	4290	6481	57288306	SO:0001583	missense	4643	exon14			U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.1396G>T	15.37:g.59501014C>A	ENSP00000288235:p.Val466Leu	Somatic		Capture	Illumina HiSeq	Phase_I	57288306	NM_004998	Q14778	Missense_Mutation	SNP	ENST00000288235.4	37	CCDS32254.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.486139	0.84854	.	.	ENSG00000157483	ENST00000288235	D	0.87179	-2.22	5.37	5.37	0.77165	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.93703	0.7988	M	0.89030	3	0.80722	D	1	D	0.54964	0.969	P	0.57283	0.817	D	0.94336	0.7566	10	0.66056	D	0.02	.	19.4857	0.95027	0.0:1.0:0.0:0.0	.	466	Q12965	MYO1E_HUMAN	L	466	ENSP00000288235:V466L	ENSP00000288235:V466L	V	-	1	0	MYO1E	57288306	1.000000	0.71417	0.997000	0.53966	0.647000	0.38526	7.750000	0.85110	2.677000	0.91161	0.561000	0.74099	GTG		MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
BNC1	646	broad.mit.edu	37	15	83932868	83932868	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr15:83932868C>T	ENST00000345382.2	-	4	1220	c.1135G>A	c.(1135-1137)Gtc>Atc	p.V379I	BNC1_ENST00000569704.1_Missense_Mutation_p.V372I|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	379					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V379I(2)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						TTCAAGTGGACGGCATTGTAG	0.517																																					p.V379I												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1135A	15						.						125.0	114.0	118.0					15																	83932868		2203	4300	6503	81723872	SO:0001583	missense	646	exon4			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1135G>A	15.37:g.83932868C>T	ENSP00000307041:p.Val379Ile	Somatic		Capture	Illumina HiSeq	Phase_I	81723872	NM_001717	Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	CCDS10324.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.801416	0.90538	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.28069	1.63	5.75	5.75	0.90469	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.61476	0.2350	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.985	T	0.64419	-0.6412	10	0.87932	D	0	-34.3255	19.9598	0.97242	0.0:1.0:0.0:0.0	.	372;379	F5GY04;Q01954	.;BNC1_HUMAN	I	379;372	ENSP00000307041:V379I	ENSP00000307041:V379I	V	-	1	0	BNC1	81723872	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	7.755000	0.85180	2.716000	0.92895	0.655000	0.94253	GTC		BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717	
NGRN	51335	broad.mit.edu	37	15	90814647	90814656	+	Frame_Shift_Del	DEL	CTGTATCAGG	CTGTATCAGG	-			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	CTGTATCAGG	CTGTATCAGG	CTGTATCAGG	-	CTGTATCAGG	CTGTATCAGG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr15:90814647_90814656delCTGTATCAGG	ENST00000379095.3	+	3	511_520	c.503_512delCTGTATCAGG	c.(502-513)tctgtatcaggcfs	p.SVSG168fs	RP11-697E2.6_ENST00000561573.1_3'UTR|NGRN_ENST00000331497.3_3'UTR	NM_001033088.1	NP_001028260.2	Q9NPE2	NGRN_HUMAN	neugrin, neurite outgrowth associated	168					neuron differentiation (GO:0030182)	extracellular region (GO:0005576)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.V97fs*20(1)|p.V169fs*20(1)		kidney(2)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			GCAGGCCACTCTGTATCAGGCTCTTTGCTT	0.505																																					p.168_171del												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.503_512del	15						.																																			88615660	SO:0001589	frameshift_variant	51335	exon3			AB029315	CCDS32329.1	15q26.1	2008-02-05			ENSG00000182768	ENSG00000182768			18077	protein-coding gene	gene with protein product						11118320	Standard	NR_028052		Approved	DSC92	uc002bpf.1	Q9NPE2	OTTHUMG00000149807	ENST00000379095.3:c.503_512delCTGTATCAGG	15.37:g.90814647_90814656delCTGTATCAGG	ENSP00000368389:p.Ser168fs	Somatic		Capture	Illumina HiSeq	Phase_I	88615651	NM_001033088	B2R6M8|Q4V9L7|Q9HBL4	Frame_Shift_Del	DEL	ENST00000379095.3	37	CCDS32329.1																																																																																				NGRN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313418.1		
CHSY1	22856	broad.mit.edu	37	15	101718592	101718592	+	Silent	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr15:101718592G>A	ENST00000254190.3	-	3	1885	c.1410C>T	c.(1408-1410)caC>caT	p.H470H	CHSY1_ENST00000543813.1_5'UTR	NM_014918.4	NP_055733.2	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	470					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of ossification (GO:0030279)|response to nutrient levels (GO:0031667)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.H470H(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(5)|skin(1)	24	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GTAAATACGCGTGCCTCCTCA	0.502																																					p.H470H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1410T	15						.						46.0	44.0	45.0					15																	101718592		2203	4300	6503	99536115	SO:0001819	synonymous_variant	22856	exon3			AB023207	CCDS10390.1	15q26.3	2013-02-19	2008-01-24	2008-01-24	ENSG00000131873	ENSG00000131873	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	17198	protein-coding gene	gene with protein product		608183	"""carbohydrate (chondroitin) synthase 1"""			11514575	Standard	NM_014918		Approved	KIAA0990, CSS1	uc021sxt.1	Q86X52	OTTHUMG00000149873	ENST00000254190.3:c.1410C>T	15.37:g.101718592G>A		Somatic		Capture	Illumina HiSeq	Phase_I	99536115	NM_014918	Q6UX38|Q7LFU5|Q9Y2J5	Silent	SNP	ENST00000254190.3	37	CCDS10390.1																																																																																				CHSY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313624.1	NM_014918	
CACNG3	10368	broad.mit.edu	37	16	24366271	24366271	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr16:24366271C>T	ENST00000005284.3	+	3	1615	c.413C>T	c.(412-414)gCg>gTg	p.A138V		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	138					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.A138V(2)		NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		ATTCTCAGCGCGGGCATCTTT	0.567																																					p.A138V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C413T	16						.						58.0	53.0	55.0					16																	24366271		2197	4300	6497	24273772	SO:0001583	missense	10368	exon3			AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.413C>T	16.37:g.24366271C>T	ENSP00000005284:p.Ala138Val	Somatic		Capture	Illumina HiSeq	Phase_I	24273772	NM_006539		Missense_Mutation	SNP	ENST00000005284.3	37	CCDS10620.1	.	.	.	.	.	.	.	.	.	.	C	33	5.213030	0.95069	.	.	ENSG00000006116	ENST00000005284	D	0.91068	-2.78	5.41	4.45	0.53987	.	0.112679	0.64402	D	0.000015	D	0.93314	0.7869	M	0.88031	2.925	0.80722	D	1	P	0.51653	0.947	P	0.47827	0.558	D	0.94124	0.7382	10	0.59425	D	0.04	-12.7101	15.2787	0.73764	0.1414:0.8586:0.0:0.0	.	138	O60359	CCG3_HUMAN	V	138	ENSP00000005284:A138V	ENSP00000005284:A138V	A	+	2	0	CACNG3	24273772	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	7.089000	0.76909	1.487000	0.48415	0.561000	0.74099	GCG		CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539	
WDR90	197335	broad.mit.edu	37	16	703387	703387	+	Missense_Mutation	SNP	C	C	A	rs200076568	byFrequency	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr16:703387C>A	ENST00000293879.4	+	11	1169	c.1169C>A	c.(1168-1170)gCg>gAg	p.A390E	WDR90_ENST00000549091.1_Missense_Mutation_p.A390E|LA16c-349E10.1_ENST00000573609.1_RNA			Q96KV7	WDR90_HUMAN	WD repeat domain 90	390								p.A390E(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CCCTGCCATGCGGTCATCGTC	0.706																																					p.A390E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1169A	16						.						26.0	34.0	31.0					16																	703387		2045	4179	6224	643388	SO:0001583	missense	197335	exon11			AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.1169C>A	16.37:g.703387C>A	ENSP00000293879:p.Ala390Glu	Somatic		Capture	Illumina HiSeq	Phase_I	643388	NM_145294	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	37	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.196281	0.78902	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.01279	5.06;5.06	4.8	3.85	0.44370	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.64402	U	0.000006	T	0.05823	0.0152	M	0.77103	2.36	0.80722	D	1	D;D;D	0.76494	0.999;0.994;0.993	D;P;P	0.64687	0.928;0.837;0.875	T	0.51513	-0.8696	10	0.09843	T	0.71	.	12.3984	0.55399	0.0:0.9175:0.0:0.0825	.	390;391;390	Q96KV7;C9JMK1;Q96KV7-3	WDR90_HUMAN;.;.	E	390	ENSP00000448122:A390E;ENSP00000293879:A390E	ENSP00000293879:A390E	A	+	2	0	WDR90	643388	1.000000	0.71417	0.066000	0.19879	0.004000	0.04260	4.542000	0.60677	1.015000	0.39444	0.561000	0.74099	GCG		WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	
SLX4	84464	broad.mit.edu	37	16	3647605	3647605	+	Silent	SNP	A	A	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr16:3647605A>T	ENST00000294008.3	-	7	2098	c.1458T>A	c.(1456-1458)cgT>cgA	p.R486R		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	486	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)	p.R486R(1)		breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GCAGGGCCACACGGTCCTCTA	0.537								Direct reversal of damage																													p.R486R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1458A	16						.						81.0	84.0	83.0					16																	3647605		2197	4300	6497	3587606	SO:0001819	synonymous_variant	84464	exon7			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.1458T>A	16.37:g.3647605A>T		Somatic		Capture	Illumina HiSeq	Phase_I	3587606	NM_032444	Q69YT8|Q8TF15|Q96JP1	Silent	SNP	ENST00000294008.3	37	CCDS10506.2																																																																																				SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
ADCY9	115	broad.mit.edu	37	16	4163980	4163980	+	Silent	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr16:4163980G>A	ENST00000294016.3	-	2	2002	c.1464C>T	c.(1462-1464)gtC>gtT	p.V488V		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	488	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.V488V(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TGTGCACCCCGACTCTCATGT	0.572																																					p.V488V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1464T	16						.						113.0	119.0	117.0					16																	4163980		2197	4300	6497	4103981	SO:0001819	synonymous_variant	115	exon2			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.1464C>T	16.37:g.4163980G>A		Somatic		Capture	Illumina HiSeq	Phase_I	4103981	NM_001116	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Silent	SNP	ENST00000294016.3	37	CCDS32382.1																																																																																				ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
ZNF668	79759	broad.mit.edu	37	16	31073334	31073334	+	Silent	SNP	C	C	T	rs75668104		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr16:31073334C>T	ENST00000538906.1	-	3	1699	c.915G>A	c.(913-915)gtG>gtA	p.V305V	ZNF668_ENST00000539836.3_Silent_p.V328V|ZNF668_ENST00000426488.2_Silent_p.V328V|ZNF668_ENST00000417110.2_Silent_p.F174F|ZNF668_ENST00000300849.4_Silent_p.V305V|ZNF668_ENST00000564456.1_5'Flank|ZNF668_ENST00000394983.2_Silent_p.V305V|ZNF668_ENST00000535577.1_Silent_p.V305V	NM_001172668.1	NP_001166139	Q96K58	ZN668_HUMAN	zinc finger protein 668	305					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V305V(1)		breast(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	27						GGTATGGCTTCACCCCTTCAT	0.692																																					p.V328V	Colon(181;1111 1980 5060 10512 25785)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G984A	16						.						29.0	28.0	28.0					16																	31073334		2195	4294	6489	30980835	SO:0001819	synonymous_variant	79759	exon4				CCDS10701.1, CCDS54003.1	16p11.2	2013-01-08			ENSG00000167394	ENSG00000167394		"""Zinc fingers, C2H2-type"""	25821	protein-coding gene	gene with protein product						12477932	Standard	NM_024706		Approved	FLJ13479	uc021tgt.1	Q96K58	OTTHUMG00000047357	ENST00000538906.1:c.915G>A	16.37:g.31073334C>T		Somatic		Capture	Illumina HiSeq	Phase_I	30980835	NM_001172669	C9JHH8|F5H7E7|Q59EV1|Q8N669|Q9H8L4	Silent	SNP	ENST00000538906.1	37	CCDS10701.1																																																																																				ZNF668-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108516.2	NM_024706	
C16orf70	80262	broad.mit.edu	37	16	67183653	67183653	+	IGR	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr16:67183653G>A	ENST00000219139.3	+	0	2865				B3GNT9_ENST00000449549.3_Missense_Mutation_p.R246W	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70									p.R246W(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		GCCGGGTCCCGCGGCGCCAGG	0.627																																					p.R246W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C736T	16						.						23.0	25.0	24.0					16																	67183653		1973	4142	6115	65741154	SO:0001628	intergenic_variant	84752	exon2			AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510		16.37:g.67183653G>A		Somatic		Capture	Illumina HiSeq	Phase_I	65741154	NM_033309	Q9HA86	Missense_Mutation	SNP	ENST00000219139.3	37	CCDS10828.1	.	.	.	.	.	.	.	.	.	.	g	10.09	1.254687	0.22965	.	.	ENSG00000237172	ENST00000449549	T	0.46063	0.88	5.02	-0.894	0.10563	.	.	.	.	.	T	0.28366	0.0701	L	0.39245	1.2	0.21416	N	0.999697	B	0.33748	0.423	B	0.26517	0.07	T	0.07558	-1.0766	9	0.37606	T	0.19	-9.4826	9.0071	0.36117	0.0722:0.0:0.3527:0.5751	.	246	Q6UX72	B3GN9_HUMAN	W	246	ENSP00000400157:R246W	ENSP00000400157:R246W	R	-	1	2	B3GNT9	65741154	0.922000	0.31269	0.009000	0.14445	0.017000	0.09413	0.677000	0.25262	-0.461000	0.06993	-0.408000	0.06270	CGG		C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268829.2	NM_025187	
PKD1L2	114780	broad.mit.edu	37	16	81197302	81197302	+	RNA	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr16:81197302C>T	ENST00000525539.1	-	0	3379				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)	p.R442Q(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						AAAGTGGCTTCGGGCTGGAAA	0.542																																					p.R1127Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3380A	16						.						35.0	35.0	35.0					16																	81197302		1941	4143	6084	79754803			114780	exon21			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81197302C>T		Somatic		Capture	Illumina HiSeq	Phase_I	79754803	NM_052892	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000525539.1	37																																																																																					PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
PRPF8	10594	broad.mit.edu	37	17	1560022	1560022	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr17:1560022C>T	ENST00000572621.1	-	34	5804	c.5539G>A	c.(5539-5541)Gcc>Acc	p.A1847T	PRPF8_ENST00000304992.6_Missense_Mutation_p.A1847T|PRPF8_ENST00000575116.1_5'Flank			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1847	Involved in interaction with pre-mRNA 5' splice site.|RNase H homology domain.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)	p.A1847T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CGGATCAGGGCGGCCACCTCC	0.522																																					p.A1847T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5539A	17						.						50.0	43.0	45.0					17																	1560022		2203	4300	6503	1506772	SO:0001583	missense	10594	exon35			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.5539G>A	17.37:g.1560022C>T	ENSP00000460348:p.Ala1847Thr	Somatic		Capture	Illumina HiSeq	Phase_I	1506772	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	c	35	5.591930	0.96590	.	.	ENSG00000174231	ENST00000304992;ENST00000540177	D	0.82526	-1.62	5.56	5.56	0.83823	PRP8 domain IV core (1);	0.000000	0.85682	D	0.000000	D	0.93579	0.7950	M	0.92367	3.3	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94541	0.7745	10	0.72032	D	0.01	.	19.5263	0.95208	0.0:1.0:0.0:0.0	.	1847	Q6P2Q9	PRP8_HUMAN	T	1847;372	ENSP00000304350:A1847T	ENSP00000304350:A1847T	A	-	1	0	PRPF8	1506772	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.613000	0.88420	0.655000	0.94253	GCC		PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
OR3A1	4994	broad.mit.edu	37	17	3195402	3195402	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr17:3195402C>T	ENST00000323404.1	-	1	474	c.475G>A	c.(475-477)Gca>Aca	p.A159T	RP11-64J4.2_ENST00000573491.1_RNA	NM_002550.2	NP_002541.2	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A, member 1	159					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A159T(1)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	20						TGGGTCAGTGCGTTGGTGAAA	0.577																																					p.A159T	GBM(20;287 516 18743 28660 36594)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G475A	17						.						181.0	163.0	169.0					17																	3195402		2203	4300	6503	3142152	SO:0001583	missense	4994	exon1			X80391	CCDS11023.1	17p13.3	2012-08-09			ENSG00000180090	ENSG00000180090		"""GPCR / Class A : Olfactory receptors"""	8282	protein-coding gene	gene with protein product						8921386, 8647456	Standard	NM_002550		Approved	OLFRA03, OR40, OR17-40	uc002fvh.1	P47881	OTTHUMG00000090642	ENST00000323404.1:c.475G>A	17.37:g.3195402C>T	ENSP00000313803:p.Ala159Thr	Somatic		Capture	Illumina HiSeq	Phase_I	3142152	NM_002550	Q4VB06|Q6IFM4	Missense_Mutation	SNP	ENST00000323404.1	37	CCDS11023.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.694393	0.48202	.	.	ENSG00000180090	ENST00000323404	T	0.39056	1.1	5.12	4.11	0.48088	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000117	T	0.38134	0.1029	L	0.55990	1.75	0.09310	N	1	P	0.39551	0.678	B	0.38327	0.271	T	0.41466	-0.9507	10	0.54805	T	0.06	-21.4089	11.6891	0.51505	0.3288:0.6712:0.0:0.0	.	159	P47881	OR3A1_HUMAN	T	159	ENSP00000313803:A159T	ENSP00000313803:A159T	A	-	1	0	OR3A1	3142152	0.004000	0.15560	1.000000	0.80357	0.876000	0.50452	0.681000	0.25320	2.652000	0.90054	0.650000	0.86243	GCA		OR3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207302.2		
XYLT2	64132	broad.mit.edu	37	17	48432335	48432335	+	Silent	SNP	C	C	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr17:48432335C>A	ENST00000017003.2	+	4	974	c.925C>A	c.(925-927)Cgg>Agg	p.R309R	XYLT2_ENST00000507602.1_Silent_p.R309R	NM_022167.2	NP_071450.2	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	309					chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.R309R(1)		endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(2)|urinary_tract(1)	12	Breast(11;7.18e-19)					GATGTACCTGCGGAGCATGCG	0.637																																					p.R309R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C925A	17						.						77.0	76.0	76.0					17																	48432335		2203	4300	6503	45787334	SO:0001819	synonymous_variant	64132	exon4			AJ277442	CCDS11563.1	17q21.33	2013-02-25			ENSG00000015532	ENSG00000015532	2.4.2.26		15517	protein-coding gene	gene with protein product	"""protein xylosyltransferase 2"""	608125				11099377	Standard	NM_022167		Approved	XT-II, PXYLT2	uc002iqo.3	Q9H1B5	OTTHUMG00000162057	ENST00000017003.2:c.925C>A	17.37:g.48432335C>A		Somatic		Capture	Illumina HiSeq	Phase_I	45787334	NM_022167	Q6UY41|Q86V00	Silent	SNP	ENST00000017003.2	37	CCDS11563.1																																																																																				XYLT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367046.1	NM_022167	
SDK2	54549	broad.mit.edu	37	17	71398202	71398202	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr17:71398202C>T	ENST00000392650.3	-	19	2563	c.2563G>A	c.(2563-2565)Gtg>Atg	p.V855M	SDK2_ENST00000388726.3_Missense_Mutation_p.V855M	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	855	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.V855M(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						ACGAAGCCCACGTGGATGCTG	0.617																																					p.V855M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2563A	17						.						100.0	74.0	83.0					17																	71398202		2203	4300	6503	68909797	SO:0001583	missense	54549	exon19			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.2563G>A	17.37:g.71398202C>T	ENSP00000376421:p.Val855Met	Somatic		Capture	Illumina HiSeq	Phase_I	68909797	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.508794	0.44660	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.54279	0.58;0.58;1.58	5.08	4.09	0.47781	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.130475	0.51477	N	0.000088	T	0.49474	0.1559	L	0.60455	1.87	0.48632	D	0.999688	B;B;B	0.21753	0.06;0.022;0.017	B;B;B	0.22753	0.04;0.041;0.024	T	0.46442	-0.9191	10	0.34782	T	0.22	.	14.1719	0.65514	0.0:0.9263:0.0:0.0737	.	855;855;855	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	M	479;855;855;31;855	ENSP00000376421:V855M;ENSP00000373378:V855M;ENSP00000407098:V31M	ENSP00000324967:V855M	V	-	1	0	SDK2	68909797	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	2.536000	0.45693	1.261000	0.44149	0.597000	0.82753	GTG		SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
CDH2	1000	broad.mit.edu	37	18	25543412	25543412	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr18:25543412C>T	ENST00000269141.3	-	15	2846	c.2423G>A	c.(2422-2424)cGa>cAa	p.R808Q	CDH2_ENST00000399380.3_Missense_Mutation_p.R777Q|AC015933.2_ENST00000423367.1_RNA	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	808					adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.R808Q(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TTCATCCATTCGTCGGATTCC	0.532																																					p.R808Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2423A	18						.						97.0	77.0	84.0					18																	25543412		2203	4300	6503	23797410	SO:0001583	missense	1000	exon15			S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.2423G>A	18.37:g.25543412C>T	ENSP00000269141:p.Arg808Gln	Somatic		Capture	Illumina HiSeq	Phase_I	23797410	NM_001792	A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	C	36	5.959604	0.97145	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.78246	-1.16;-1.16	6.16	6.16	0.99307	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.88566	0.6471	M	0.72624	2.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.87865	0.2667	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	777;808	A8MWK3;P19022	.;CADH2_HUMAN	Q	808;777	ENSP00000269141:R808Q;ENSP00000382312:R777Q	ENSP00000269141:R808Q	R	-	2	0	CDH2	23797410	1.000000	0.71417	0.924000	0.36721	0.991000	0.79684	7.487000	0.81328	2.937000	0.99478	0.650000	0.86243	CGA		CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792	
DSG2	1829	broad.mit.edu	37	18	29121188	29121188	+	Missense_Mutation	SNP	G	G	A	rs201564919		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr18:29121188G>A	ENST00000261590.8	+	13	2121	c.1912G>A	c.(1912-1914)Gga>Aga	p.G638R	RP11-75N4.2_ENST00000583706.1_RNA	NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	638					apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G638R(1)		breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			GTGCCATTGCGGAAAGGGCGC	0.433																																					p.G638R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1912A	18						.	G	ARG/GLY	0,3828		0,0,1914	126.0	110.0	115.0		1912	5.8	1.0	18		115	2,8266		0,2,4132	yes	missense	DSG2	NM_001943.3	125	0,2,6046	AA,AG,GG		0.0242,0.0,0.0165	probably-damaging	638/1119	29121188	2,12094	1914	4134	6048	27375186	SO:0001583	missense	1829	exon13			Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.1912G>A	18.37:g.29121188G>A	ENSP00000261590:p.Gly638Arg	Somatic		Capture	Illumina HiSeq	Phase_I	27375186	NM_001943	Q4KKU6	Missense_Mutation	SNP	ENST00000261590.8	37	CCDS42423.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483721	0.63962	0.0	2.42E-4	ENSG00000046604	ENST00000261590	T	0.55234	0.53	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000007	T	0.69160	0.3080	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62167	-0.6911	10	0.30854	T	0.27	.	19.335	0.94312	0.0:0.0:1.0:0.0	.	638	Q14126	DSG2_HUMAN	R	638	ENSP00000261590:G638R	ENSP00000261590:G638R	G	+	1	0	DSG2	27375186	1.000000	0.71417	0.991000	0.47740	0.109000	0.19521	5.022000	0.64078	2.890000	0.99128	0.650000	0.86243	GGA		DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447506.1	NM_001943	
ATP13A1	57130	broad.mit.edu	37	19	19764641	19764641	+	Silent	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr19:19764641G>A	ENST00000357324.6	-	15	2078	c.2052C>T	c.(2050-2052)cgC>cgT	p.R684R	ATP13A1_ENST00000496082.1_5'UTR|ATP13A1_ENST00000291503.5_Silent_p.R566R	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	684						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.R684R(1)		central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GCGCCAGGACGCGGGCTCCTT	0.682																																					p.R684R	Esophageal Squamous(142;920 1789 9047 14684 24777)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2052T	19						.						41.0	43.0	42.0					19																	19764641		2181	4265	6446	19625641	SO:0001819	synonymous_variant	57130	exon15			AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.2052C>T	19.37:g.19764641G>A		Somatic		Capture	Illumina HiSeq	Phase_I	19625641	NM_020410	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Silent	SNP	ENST00000357324.6	37	CCDS32970.2																																																																																				ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410	
PAPL	390928	broad.mit.edu	37	19	39589259	39589259	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr19:39589259C>T	ENST00000331256.5	+	3	557	c.283C>T	c.(283-285)Cga>Tga	p.R95*	PAPL_ENST00000594229.1_Nonsense_Mutation_p.R95*	NM_001004318.2	NP_001004318.2	Q6ZNF0	PAPL_HUMAN		95						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)|metal ion binding (GO:0046872)	p.R95*(1)									CTACATACACCGAGTCACGCT	0.647																																					p.R95X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C283T	19						.						33.0	33.0	33.0					19																	39589259		2203	4300	6503	44281099	SO:0001587	stop_gained	390928	exon3																														ENST00000331256.5:c.283C>T	19.37:g.39589259C>T	ENSP00000327557:p.Arg95*	Somatic		Capture	Illumina HiSeq	Phase_I	44281099	NM_001004318	B2RN68	Nonsense_Mutation	SNP	ENST00000331256.5	37	CCDS33018.1	.	.	.	.	.	.	.	.	.	.	C	37	6.023301	0.97211	.	.	ENSG00000183760	ENST00000331256	.	.	.	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.6668	11.2777	0.49176	0.1826:0.8174:0.0:0.0	.	.	.	.	X	95	.	ENSP00000327557:R95X	R	+	1	2	AC011443.1	44281099	1.000000	0.71417	0.866000	0.34008	0.431000	0.31685	1.514000	0.35834	2.394000	0.81467	0.655000	0.94253	CGA		PAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463810.1		
BCKDHA	593	broad.mit.edu	37	19	41916672	41916672	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr19:41916672G>A	ENST00000269980.2	+	2	607	c.239G>A	c.(238-240)cGc>cAc	p.R80H	BCKDHA_ENST00000595085.1_Missense_Mutation_p.R114H|CTC-435M10.3_ENST00000540732.1_Missense_Mutation_p.R114H|BCKDHA_ENST00000457836.2_Missense_Mutation_p.R58H|CTC-435M10.3_ENST00000604424.1_3'UTR	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide	80					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)	p.R80H(1)		central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						CCCATCTACCGCGTCATGGAC	0.622																																					p.R80H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G239A	19						.						67.0	68.0	68.0					19																	41916672		2203	4300	6503	46608512	SO:0001583	missense	593	exon2			J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128	ENST00000269980.2:c.239G>A	19.37:g.41916672G>A	ENSP00000269980:p.Arg80His	Somatic		Capture	Illumina HiSeq	Phase_I	46608512	NM_001164783	B4DP47|E7EW46|Q16034|Q16472	Missense_Mutation	SNP	ENST00000269980.2	37	CCDS12581.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.339254|5.339254	0.95783|0.95783	.|.	.|.	ENSG00000248098|ENSG00000255730;ENSG00000248098;ENSG00000248098;ENSG00000248098;ENSG00000248098	ENST00000541315|ENST00000540732;ENST00000269980;ENST00000542943;ENST00000457836;ENST00000378196	.|D;D;D;D	.|0.99143	.|-5.48;-5.48;-5.48;-5.48	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.98998|0.98998	0.9658|0.9658	L|L	0.53561|0.53561	1.675|1.675	0.80722|0.80722	D|D	1|1	.|D;D;D;P	.|0.89917	.|1.0;0.991;1.0;0.951	.|D;B;D;P	.|0.75484	.|0.986;0.321;0.949;0.449	D|D	0.99906|0.99906	1.1179|1.1179	5|10	.|0.72032	.|D	.|0.01	-25.6892|-25.6892	17.9433|17.9433	0.89031|0.89031	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|58;80;80;114	.|B4DP47;Q59EI3;P12694;F5H5P2	.|.;.;ODBA_HUMAN;.	T|H	16|114;80;80;58;80	.|ENSP00000443246:R114H;ENSP00000269980:R80H;ENSP00000440345:R80H;ENSP00000416000:R58H	.|ENSP00000269980:R80H	A|R	+|+	1|2	0|0	BCKDHA|BCKDHA;CTC-435M10.3	46608512|46608512	1.000000|1.000000	0.71417|0.71417	0.979000|0.979000	0.43373|0.43373	0.992000|0.992000	0.81027|0.81027	7.457000|7.457000	0.80775|0.80775	2.550000|2.550000	0.86006|0.86006	0.643000|0.643000	0.83706|0.83706	GCG|CGC		BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398313.3	NM_000709	
MUC16	94025	broad.mit.edu	37	19	9062338	9062338	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr19:9062338G>T	ENST00000397910.4	-	3	25311	c.25108C>A	c.(25108-25110)Cta>Ata	p.L8370I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8372	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.L8370I(2)|p.L4003I(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGTCAGATAGGACAGAAGAT	0.483																																					p.L8370I												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C25108A	19						.						188.0	182.0	184.0					19																	9062338		2094	4218	6312	8923338	SO:0001583	missense	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.25108C>A	19.37:g.9062338G>T	ENSP00000381008:p.Leu8370Ile	Somatic		Capture	Illumina HiSeq	Phase_I	8923338	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	6.141	0.394156	0.11638	.	.	ENSG00000181143	ENST00000397910	T	0.22336	1.96	2.43	-4.5	0.03493	.	.	.	.	.	T	0.12646	0.0307	L	0.43152	1.355	.	.	.	P	0.44195	0.828	B	0.37304	0.246	T	0.08932	-1.0698	8	0.87932	D	0	.	2.7577	0.05297	0.3931:0.0:0.2392:0.3678	.	8370	B5ME49	.	I	8370	ENSP00000381008:L8370I	ENSP00000381008:L8370I	L	-	1	2	MUC16	8923338	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.254000	0.02874	-1.051000	0.03226	0.400000	0.26472	CTA		MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
TPRX1	284355	broad.mit.edu	37	19	48305387	48305387	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr19:48305387C>T	ENST00000322175.3	-	2	1036	c.881G>A	c.(880-882)cGa>cAa	p.R294Q	TPRX1_ENST00000543508.1_Missense_Mutation_p.R284Q|TPRX1_ENST00000535759.1_Missense_Mutation_p.R391Q	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	294	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R294Q(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		GCCAGGGCTTCGCATCCGGCC	0.647																																					p.R294Q	Esophageal Squamous(123;175 2281 3051 32395)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G881A	19						.						26.0	27.0	26.0					19																	48305387		2203	4300	6503	52997199	SO:0001583	missense	284355	exon2				CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.881G>A	19.37:g.48305387C>T	ENSP00000323455:p.Arg294Gln	Somatic		Capture	Illumina HiSeq	Phase_I	52997199	NM_198479	A5D8Y3|B2RPL5	Missense_Mutation	SNP	ENST00000322175.3	37	CCDS33066.1	.	.	.	.	.	.	.	.	.	.	c	3.251	-0.153312	0.06585	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	D;D	0.91464	-1.67;-2.85	0.468	-0.898	0.10550	.	.	.	.	.	T	0.74351	0.3705	N	0.08118	0	0.09310	N	1	B	0.22211	0.066	B	0.04013	0.001	T	0.60000	-0.7348	8	0.14656	T	0.56	.	.	.	.	.	294	Q8N7U7	TPRX1_HUMAN	Q	294;391;284	ENSP00000323455:R294Q;ENSP00000438832:R391Q	ENSP00000323455:R294Q	R	-	2	0	TPRX1	52997199	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-1.829000	0.01701	-0.347000	0.08299	-0.347000	0.07816	CGA		TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
FLG	2312	broad.mit.edu	37	1	152281130	152281130	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr1:152281130C>T	ENST00000368799.1	-	3	6267	c.6232G>A	c.(6232-6234)Ggc>Agc	p.G2078S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2078	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.G2078S(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTGACTGGCCACGTGCGGAC	0.567									Ichthyosis																												p.G2078S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6232A	1						.						308.0	252.0	271.0					1																	152281130		2203	4300	6503	150547754	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6232G>A	1.37:g.152281130C>T	ENSP00000357789:p.Gly2078Ser	Somatic		Capture	Illumina HiSeq	Phase_I	150547754	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	c	6.769	0.510749	0.12883	.	.	ENSG00000143631	ENST00000368799	T	0.07327	3.2	2.47	-0.656	0.11436	.	.	.	.	.	T	0.03053	0.0090	M	0.79475	2.455	0.09310	N	1	B	0.30584	0.286	B	0.22386	0.039	T	0.34576	-0.9823	9	0.37606	T	0.19	.	5.3128	0.15839	0.0:0.5501:0.0:0.4499	.	2078	P20930	FILA_HUMAN	S	2078	ENSP00000357789:G2078S	ENSP00000357789:G2078S	G	-	1	0	FLG	150547754	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.313000	0.08103	-0.131000	0.11578	-0.350000	0.07774	GGC		FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
AGMAT	79814	broad.mit.edu	37	1	15900149	15900149	+	Silent	SNP	G	G	C			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr1:15900149G>C	ENST00000375826.3	-	7	1198	c.1056C>G	c.(1054-1056)gtC>gtG	p.V352V	DNAJC16_ENST00000483270.1_Intron|DNAJC16_ENST00000375849.1_Intron	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	352					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)	p.V352V(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		ACAAGACTCAGACGGTTGTCA	0.443																																					p.V352V	NSCLC(126;1678 1780 25805 43508 49531)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1056G	1						.						93.0	91.0	91.0					1																	15900149		2203	4300	6503	15772736	SO:0001819	synonymous_variant	79814	exon7			AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.1056C>G	1.37:g.15900149G>C		Somatic		Capture	Illumina HiSeq	Phase_I	15772736	NM_024758	Q5TDH1|Q9H5J3	Silent	SNP	ENST00000375826.3	37	CCDS160.1																																																																																				AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006763.1	NM_024758	
TMEM79	84283	broad.mit.edu	37	1	156256183	156256183	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr1:156256183A>G	ENST00000405535.2	+	3	1061	c.890A>G	c.(889-891)aAc>aGc	p.N297S	TMEM79_ENST00000495881.1_3'UTR|TMEM79_ENST00000295694.5_Missense_Mutation_p.N297S|TMEM79_ENST00000357501.2_Silent_p.Q58Q	NM_032323.2	NP_115699.1	Q9BSE2	TMM79_HUMAN	transmembrane protein 79	297					cornification (GO:0070268)|cuticle development (GO:0042335)|epithelial cell maturation (GO:0002070)|establishment of skin barrier (GO:0061436)|hair follicle morphogenesis (GO:0031069)|positive regulation of epidermis development (GO:0045684)|regulated secretory pathway (GO:0045055)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)		p.N297S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|urinary_tract(1)	21	Hepatocellular(266;0.158)					TACTTCTTCAACCTGGCCGTG	0.587																																					p.N297S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A890G	1						.						159.0	160.0	160.0					1																	156256183		2203	4300	6503	154522807	SO:0001583	missense	84283	exon3			BC005094	CCDS1138.1	1q22	2014-04-22			ENSG00000163472	ENSG00000163472			28196	protein-coding gene	gene with protein product	"""mattrin"""	615531					Standard	NM_032323		Approved	MGC13102, FLJ16057, FLJ32254, MATT	uc009wrw.3	Q9BSE2	OTTHUMG00000019788	ENST00000405535.2:c.890A>G	1.37:g.156256183A>G	ENSP00000384748:p.Asn297Ser	Somatic		Capture	Illumina HiSeq	Phase_I	154522807	NM_032323	B2RE22|D3DVB8	Missense_Mutation	SNP	ENST00000405535.2	37	CCDS1138.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.381238	0.82792	.	.	ENSG00000163472	ENST00000295694;ENST00000405535	T;T	0.50001	0.76;0.76	5.93	5.93	0.95920	.	0.197032	0.56097	D	0.000036	T	0.45617	0.1351	L	0.29908	0.895	0.45464	D	0.998431	D	0.76494	0.999	D	0.69142	0.962	T	0.47611	-0.9104	10	0.44086	T	0.13	-0.1834	13.7665	0.62999	1.0:0.0:0.0:0.0	.	297	Q9BSE2	TMM79_HUMAN	S	297	ENSP00000295694:N297S;ENSP00000384748:N297S	ENSP00000295694:N297S	N	+	2	0	TMEM79	154522807	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	8.600000	0.90860	2.271000	0.75665	0.459000	0.35465	AAC		TMEM79-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052101.1	NM_032323	
GNL2	29889	broad.mit.edu	37	1	38052989	38052989	+	Silent	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr1:38052989G>A	ENST00000373062.3	-	5	590	c.492C>T	c.(490-492)atC>atT	p.I164I		NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	164					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.I164I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				CAGCATTTTCGATAAGAGACT	0.398																																					p.I164I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C492T	1						.						157.0	142.0	147.0					1																	38052989		2203	4300	6503	37825576	SO:0001819	synonymous_variant	29889	exon5			L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.492C>T	1.37:g.38052989G>A		Somatic		Capture	Illumina HiSeq	Phase_I	37825576	NM_013285	Q9BWN7	Silent	SNP	ENST00000373062.3	37	CCDS421.1																																																																																				GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012478.1	NM_013285	
RRAGC	64121	broad.mit.edu	37	1	39317319	39317319	+	Silent	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr1:39317319G>A	ENST00000373001.3	-	5	1043	c.867C>T	c.(865-867)atC>atT	p.I289I		NM_022157.2	NP_071440.1			Ras-related GTP binding C									p.I289I(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)	10	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)				TTACAACATCGATCATGTCAC	0.348																																					p.I289I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C867T	1						.						125.0	118.0	121.0					1																	39317319		2203	4300	6503	39089906	SO:0001819	synonymous_variant	64121	exon5			AF323609	CCDS430.1	1p34	2008-02-05			ENSG00000116954	ENSG00000116954			19902	protein-coding gene	gene with protein product		608267				11073942	Standard	NM_022157		Approved	GTR2, FLJ13311	uc001ccq.3	Q9HB90	OTTHUMG00000000490	ENST00000373001.3:c.867C>T	1.37:g.39317319G>A		Somatic		Capture	Illumina HiSeq	Phase_I	39089906	NM_022157		Silent	SNP	ENST00000373001.3	37	CCDS430.1																																																																																				RRAGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001222.2	NM_022157	
ABCA4	24	broad.mit.edu	37	1	94505621	94505621	+	Silent	SNP	T	T	A	rs149503495		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr1:94505621T>A	ENST00000370225.3	-	24	3671	c.3585A>T	c.(3583-3585)ctA>ctT	p.L1195L		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1195					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.L1195L(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GTTCTGGAGTTAGGTCATCGA	0.552											OREG0013610	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L1195L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3585T	1						.						141.0	113.0	123.0					1																	94505621		2203	4300	6503	94278209	SO:0001819	synonymous_variant	24	exon24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.3585A>T	1.37:g.94505621T>A		Somatic	1306	Capture	Illumina HiSeq	Phase_I	94278209	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	37	CCDS747.1																																																																																				ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
RASSF5	83593	broad.mit.edu	37	1	206711566	206711566	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr1:206711566G>C	ENST00000355294.4	+	2	580	c.523G>C	c.(523-525)Ggt>Cgt	p.G175R	RASSF5_ENST00000367117.3_Missense_Mutation_p.G175R	NM_182663.2	NP_872604.1	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family member 5	175					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein localization to nucleus (GO:1900180)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.G175R(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	8	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			TCAGCAGGAGGGTTTATCCCG	0.542																																					p.G175R	GBM(162;656 1984 11916 22872 31529)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G523C	1						.						144.0	133.0	137.0					1																	206711566		2203	4300	6503	204778189	SO:0001583	missense	83593	exon2			BC004270	CCDS1463.1, CCDS1464.1, CCDS30998.1	1q31	2014-04-10	2008-02-22		ENSG00000136653	ENSG00000266094			17609	protein-coding gene	gene with protein product		607020				11978988, 11965544	Standard	NM_182663		Approved	Maxp1, NORE1, RAPL	uc001hed.3	Q8WWW0	OTTHUMG00000184616	ENST00000355294.4:c.523G>C	1.37:g.206711566G>C	ENSP00000347443:p.Gly175Arg	Somatic		Capture	Illumina HiSeq	Phase_I	204778189	NM_182663	A8K1E6|Q5SY32|Q8WWV9|Q8WXF4|Q9BT99	Missense_Mutation	SNP	ENST00000355294.4	37	CCDS30998.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007339	0.54361	.	.	ENSG00000136653	ENST00000355294;ENST00000367117;ENST00000338603;ENST00000367118	T;T;T	0.14516	3.1;2.51;2.5	5.84	3.98	0.46160	.	0.721236	0.11948	N	0.513963	T	0.16896	0.0406	L	0.44542	1.39	0.23227	N	0.998087	P;B;P	0.50443	0.835;0.022;0.935	P;B;P	0.48114	0.531;0.006;0.567	T	0.10590	-1.0623	10	0.38643	T	0.18	0.3554	8.689	0.34256	0.1734:0.0:0.8266:0.0	.	175;175;177	Q8WWW0-3;Q8WWW0;Q59GG4	.;RASF5_HUMAN;.	R	175	ENSP00000347443:G175R;ENSP00000356084:G175R;ENSP00000342620:G175R	ENSP00000342620:G175R	G	+	1	0	RASSF5	204778189	0.932000	0.31603	0.060000	0.19600	0.803000	0.45373	1.814000	0.38972	0.818000	0.34468	0.563000	0.77884	GGT		RASSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088469.1	NM_031437	
SPTLC3	55304	broad.mit.edu	37	20	13055067	13055067	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr20:13055067T>C	ENST00000399002.2	+	4	803	c.529T>C	c.(529-531)Tat>Cat	p.Y177H	SPTLC3_ENST00000378194.4_Missense_Mutation_p.Y177H	NM_018327.2	NP_060797.2	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base subunit 3	177					small molecule metabolic process (GO:0044281)|sphingoid biosynthetic process (GO:0046520)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)	p.Y177H(1)|p.Y150H(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(14)|skin(1)|urinary_tract(1)	25						TGCAGCCAAGTATGATGAGTC	0.433																																					p.Y177H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T529C	20						.						138.0	136.0	137.0					20																	13055067		1979	4184	6163	13003067	SO:0001583	missense	55304	exon4			AL109983	CCDS13115.2	20p12.1	2011-07-05	2006-12-21	2006-12-21	ENSG00000172296	ENSG00000172296	2.3.1.50		16253	protein-coding gene	gene with protein product		611120	"""chromosome 20 open reading frame 38"", ""serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2)"""	C20orf38, SPTLC2L		17023427	Standard	NM_018327		Approved	LCB2B, FLJ11112, hLCB2b	uc002wod.1	Q9NUV7	OTTHUMG00000031899	ENST00000399002.2:c.529T>C	20.37:g.13055067T>C	ENSP00000381968:p.Tyr177His	Somatic		Capture	Illumina HiSeq	Phase_I	13003067	NM_018327	A2A2I4|B9EK64|Q05DQ8|Q5T1U4|Q9H1L1|Q9H1Z0	Missense_Mutation	SNP	ENST00000399002.2	37	CCDS13115.2	.	.	.	.	.	.	.	.	.	.	T	10.04	1.241205	0.22711	.	.	ENSG00000172296	ENST00000399002;ENST00000378194;ENST00000450297	D;D;D	0.93604	-3.25;-3.25;-3.25	6.17	2.45	0.29901	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.390013	0.29376	N	0.012334	T	0.68970	0.3059	N	0.00079	-2.23	0.09310	N	1	B	0.02656	0.0	B	0.15870	0.014	T	0.67917	-0.5546	10	0.25751	T	0.34	-3.3255	6.2562	0.20876	0.2792:0.0:0.3953:0.3255	.	177	Q9NUV7	SPTC3_HUMAN	H	177;177;150	ENSP00000381968:Y177H;ENSP00000367436:Y177H;ENSP00000409125:Y150H	ENSP00000367436:Y177H	Y	+	1	0	SPTLC3	13003067	0.219000	0.23619	0.002000	0.10522	0.019000	0.09904	2.767000	0.47637	0.529000	0.28599	-0.313000	0.08912	TAT		SPTLC3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254544.1	NM_018327	
GGT7	2686	broad.mit.edu	37	20	33444618	33444618	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr20:33444618C>T	ENST00000336431.5	-	8	1137	c.1093G>A	c.(1093-1095)Gtg>Atg	p.V365M		NM_178026.2	NP_821158.2	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	365					glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.V365M(1)		NS(2)|breast(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	20						CCTCTGTACACGCCACACACA	0.592																																					p.V365M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1093A	20						.						88.0	67.0	74.0					20																	33444618		2203	4300	6503	32908279	SO:0001583	missense	2686	exon8			AL049709	CCDS13242.2	20q11.22	2008-11-24	2008-03-10	2008-03-10	ENSG00000131067	ENSG00000131067		"""Gamma-glutamyltransferases"""	4259	protein-coding gene	gene with protein product		612342	"""gamma-glutamyltransferase-like 3"""	GGTL5, GGTL3		8104871, 18357469	Standard	NM_178026		Approved	D20S101, dJ18C9.2	uc002xay.3	Q9UJ14	OTTHUMG00000032314	ENST00000336431.5:c.1093G>A	20.37:g.33444618C>T	ENSP00000338964:p.Val365Met	Somatic		Capture	Illumina HiSeq	Phase_I	32908279	NM_178026	Q8N899|Q8NF66|Q9BYP5|Q9BYP6	Missense_Mutation	SNP	ENST00000336431.5	37	CCDS13242.2	.	.	.	.	.	.	.	.	.	.	C	11.89	1.774858	0.31411	.	.	ENSG00000131067	ENST00000336431	T	0.06449	3.3	5.35	3.29	0.37713	.	0.513090	0.21679	N	0.070751	T	0.04724	0.0128	N	0.21194	0.64	0.38380	D	0.945108	B;B	0.17268	0.009;0.021	B;B	0.14023	0.01;0.01	T	0.35847	-0.9772	10	0.46703	T	0.11	-24.0133	7.8589	0.29499	0.0:0.697:0.0:0.303	.	365;365	A4FU32;Q9UJ14	.;GGT7_HUMAN	M	365	ENSP00000338964:V365M	ENSP00000338964:V365M	V	-	1	0	GGT7	32908279	0.858000	0.29795	1.000000	0.80357	0.998000	0.95712	0.277000	0.18734	0.716000	0.32124	0.557000	0.71058	GTG		GGT7-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078816.2	NM_178026	
ACSS2	55902	broad.mit.edu	37	20	33514905	33514905	+	Missense_Mutation	SNP	G	G	T	rs372698999		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr20:33514905G>T	ENST00000360596.2	+	18	2205	c.1994G>T	c.(1993-1995)cGa>cTa	p.R665L	ACSS2_ENST00000476922.1_3'UTR|ACSS2_ENST00000336325.4_Missense_Mutation_p.R615L|ACSS2_ENST00000253382.5_Missense_Mutation_p.R678L	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	665					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)	p.R665L(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ATCATGAGGCGAGTGCTTCGG	0.552																																					p.R665L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1994T	20						.						214.0	190.0	198.0					20																	33514905		2203	4300	6503	32978566	SO:0001583	missense	55902	exon18			AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.1994G>T	20.37:g.33514905G>T	ENSP00000353804:p.Arg665Leu	Somatic		Capture	Illumina HiSeq	Phase_I	32978566	NM_018677	A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Missense_Mutation	SNP	ENST00000360596.2	37	CCDS13243.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.207741	0.79240	.	.	ENSG00000131069	ENST00000336325;ENST00000360596;ENST00000374693;ENST00000542204;ENST00000253382	T;T;T	0.53206	0.63;2.7;2.7	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.76140	0.3946	M	0.91663	3.23	0.80722	D	1	D;D	0.76494	0.999;0.993	D;D	0.76071	0.987;0.979	T	0.82000	-0.0674	10	0.87932	D	0	-14.4413	18.7174	0.91680	0.0:0.0:1.0:0.0	.	678;665	Q5QPH3;Q9NR19	.;ACSA_HUMAN	L	615;665;663;373;678	ENSP00000337190:R615L;ENSP00000353804:R665L;ENSP00000253382:R678L	ENSP00000253382:R678L	R	+	2	0	ACSS2	32978566	1.000000	0.71417	1.000000	0.80357	0.602000	0.36980	9.490000	0.97952	2.656000	0.90262	0.498000	0.49722	CGA		ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078823.3	NM_018677	
SAMHD1	25939	broad.mit.edu	37	20	35563507	35563507	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr20:35563507C>T	ENST00000262878.4	-	4	633	c.434G>A	c.(433-435)cGa>cAa	p.R145Q	SAMHD1_ENST00000373694.5_5'UTR	NM_015474.3	NP_056289.2	Q9Y3Z3	SAMH1_HUMAN	SAM domain and HD domain 1	145			R -> Q (in AGS5). {ECO:0000269|PubMed:19525956}.		dATP catabolic process (GO:0046061)|defense response to virus (GO:0051607)|dGTP catabolic process (GO:0006203)|immune response (GO:0006955)|innate immune response (GO:0045087)|protein homotetramerization (GO:0051289)|regulation of innate immune response (GO:0045088)	intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dGTP binding (GO:0032567)|dGTPase activity (GO:0008832)|nucleic acid binding (GO:0003676)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R145Q(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	20		Myeloproliferative disorder(115;0.00878)				TTTGATGTATCGAAGACGTTG	0.438																																					p.R145Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G434A	20						.						135.0	124.0	128.0					20																	35563507		2203	4300	6503	34996921	SO:0001583	missense	25939	exon4			AF228421	CCDS13288.1	20q11.23	2014-09-17			ENSG00000101347	ENSG00000101347		"""Sterile alpha motif (SAM) domain containing"""	15925	protein-coding gene	gene with protein product	"""HD domain containing 1"", ""monocyte protein 5"", ""Aicardi-Goutieres syndrome 5"""	606754				11064105, 11230166	Standard	NM_015474		Approved	SBBI88, Mg11, HDDC1, MOP-5, AGS5	uc002xgh.2	Q9Y3Z3	OTTHUMG00000032402	ENST00000262878.4:c.434G>A	20.37:g.35563507C>T	ENSP00000262878:p.Arg145Gln	Somatic		Capture	Illumina HiSeq	Phase_I	34996921	NM_015474	B4E2A5|E1P5V2|Q5JXG8|Q8N491|Q9H004|Q9H005|Q9H3U9	Missense_Mutation	SNP	ENST00000262878.4	37	CCDS13288.1	.	.	.	.	.	.	.	.	.	.	C	35	5.555109	0.96514	.	.	ENSG00000101347	ENST00000262878	D	0.95853	-3.83	6.05	5.1	0.69264	HD domain (1);	0.000000	0.85682	D	0.000000	D	0.98372	0.9459	H	0.94222	3.51	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.99312	1.0904	10	0.66056	D	0.02	-16.0364	17.3491	0.87318	0.0:0.875:0.125:0.0	.	145	Q9Y3Z3	SAMH1_HUMAN	Q	145	ENSP00000262878:R145Q	ENSP00000262878:R145Q	R	-	2	0	SAMHD1	34996921	1.000000	0.71417	0.899000	0.35326	0.981000	0.71138	6.025000	0.70864	1.549000	0.49425	0.650000	0.86243	CGA		SAMHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079062.2	NM_015474	
PRDM15	63977	broad.mit.edu	37	21	43267283	43267283	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr21:43267283T>C	ENST00000269844.3	-	13	1764	c.1654A>G	c.(1654-1656)Aac>Gac	p.N552D	PRDM15_ENST00000422911.1_Missense_Mutation_p.N223D|PRDM15_ENST00000398548.1_Missense_Mutation_p.N223D|PRDM15_ENST00000538201.1_Missense_Mutation_p.N186D|PRDM15_ENST00000447207.2_Missense_Mutation_p.N186D	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	552					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.N552D(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						GGGGCGCTGTTTTCTGGGGTG	0.587																																					p.N552D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1654G	21						.						22.0	22.0	22.0					21																	43267283		2164	4219	6383	42140352	SO:0001583	missense	63977	exon13			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.1654A>G	21.37:g.43267283T>C	ENSP00000269844:p.Asn552Asp	Somatic		Capture	Illumina HiSeq	Phase_I	42140352	NM_022115	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	ENST00000269844.3	37	CCDS13676.1	.	.	.	.	.	.	.	.	.	.	T	9.687	1.150828	0.21371	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844;ENST00000380489	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	4.52	-0.801	0.10893	.	.	.	.	.	T	0.28928	0.0718	L	0.42245	1.32	0.09310	N	1	B;B;B	0.25105	0.118;0.039;0.012	B;B;B	0.18871	0.023;0.01;0.004	T	0.17289	-1.0374	9	0.32370	T	0.25	-31.5886	5.6309	0.17510	0.0:0.3649:0.1523:0.4828	.	552;223;223	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	D	223;223;186;186;552;186	ENSP00000408592:N223D;ENSP00000381556:N223D;ENSP00000444044:N186D;ENSP00000390245:N186D;ENSP00000269844:N552D	ENSP00000269844:N552D	N	-	1	0	PRDM15	42140352	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.420000	0.21263	-0.434000	0.07275	-0.379000	0.06801	AAC		PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
KRTAP10-7	386675	broad.mit.edu	37	21	46021230	46021230	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr21:46021230G>A	ENST00000380102.2	+	1	734	c.709G>A	c.(709-711)Gtc>Atc	p.V237I	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	237	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						CTGTGTGCCTGTCTGCTGCAA	0.652																																					p.V232I												.	.	0			c.G694A	21						.						131.0	129.0	130.0					21																	46021230		2203	4300	6503	44845658	SO:0001583	missense	386675	exon2			AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.709G>A	21.37:g.46021230G>A	ENSP00000369445:p.Val237Ile	None		Capture	Illumina HiSeq	Phase_I	44845658	NM_198689	Q0VDJ8|Q70LJ2	Missense_Mutation	SNP	ENST00000380102.2	37		.	.	.	.	.	.	.	.	.	.	N	5.579	0.291636	0.10567	.	.	ENSG00000205441	ENST00000380102	T	0.01430	4.9	3.66	1.65	0.23941	.	.	.	.	.	T	0.01421	0.0046	L	0.39467	1.215	0.20873	N	0.999834	P	0.42908	0.793	B	0.34590	0.186	T	0.52268	-0.8598	9	0.24483	T	0.36	.	11.0567	0.47922	0.0:0.3775:0.6225:0.0	.	232	P60409-2	.	I	237	ENSP00000369445:V237I	ENSP00000369445:V237I	V	+	1	0	KRTAP10-7	44845658	0.000000	0.05858	0.039000	0.18376	0.057000	0.15508	-2.649000	0.00858	0.125000	0.18397	0.398000	0.26397	GTC		KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
HPS4	89781	broad.mit.edu	37	22	26853923	26853923	+	Silent	SNP	C	C	T	rs373421312		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr22:26853923C>T	ENST00000398145.2	-	13	2473	c.1857G>A	c.(1855-1857)ccG>ccA	p.P619P	HPS4_ENST00000402105.3_Silent_p.P614P|HPS4_ENST00000398141.1_Silent_p.P632P|HPS4_ENST00000493455.2_5'UTR|HPS4_ENST00000336873.5_Silent_p.P619P	NM_022081.5	NP_071364.4	Q9NQG7	HPS4_HUMAN	Hermansky-Pudlak syndrome 4	619					blood coagulation (GO:0007596)|hemostasis (GO:0007599)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of eye pigmentation (GO:0048075)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|platelet dense granule (GO:0042827)	protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)	p.P619P(1)|p.P632P(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(4)|lung(12)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	32						TGGCCACCTGCGGCAGGTTTG	0.582									Hermansky-Pudlak syndrome																												p.P614P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1842A	22						.	C	,	0,4406		0,0,2203	38.0	36.0	37.0		1857,1842	-10.3	0.0	22		37	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	HPS4	NM_022081.4,NM_152841.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	619/709,614/704	26853923	1,13005	2203	4300	6503	25183923	SO:0001819	synonymous_variant	89781	exon11	Familial Cancer Database	HPS, HPS1-8		CCDS13835.1, CCDS46677.1	22q12.1	2014-09-17			ENSG00000100099	ENSG00000100099			15844	protein-coding gene	gene with protein product		606682				11836498, 12663659	Standard	NM_022081		Approved	KIAA1667, LE	uc003aci.4	Q9NQG7	OTTHUMG00000030459	ENST00000398145.2:c.1857G>A	22.37:g.26853923C>T		Somatic		Capture	Illumina HiSeq	Phase_I	25183923	NM_152841	B1AHQ4|Q5H8V6|Q96LX6|Q9BY93|Q9UH37|Q9UH38	Silent	SNP	ENST00000398145.2	37	CCDS13835.1																																																																																				HPS4-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320778.1	NM_022081	
MCHR1	2847	broad.mit.edu	37	22	41077236	41077236	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr22:41077236G>A	ENST00000249016.4	+	2	1269	c.573G>A	c.(571-573)atG>atA	p.M191I	MCHR1_ENST00000381433.2_Intron|MCHR1_ENST00000498400.1_3'UTR	NM_005297.3	NP_005288.3	Q99705	MCHR1_HUMAN	melanin-concentrating hormone receptor 1	191					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|melanin-concentrating hormone receptor activity (GO:0030273)|neuropeptide receptor activity (GO:0008188)	p.M191I(1)		endometrium(5)|large_intestine(7)|lung(6)|pancreas(1)|urinary_tract(1)	20						TCACGGCCATGGATGCCAATA	0.572																																					p.M191I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G573A	22						.						186.0	164.0	171.0					22																	41077236		2203	4300	6503	39407182	SO:0001583	missense	2847	exon2				CCDS14004.1	22q13.3	2014-06-05	2006-02-15	2006-02-15	ENSG00000128285	ENSG00000128285		"""GPCR / Class A : MCH receptors"""	4479	protein-coding gene	gene with protein product		601751	"""G protein-coupled receptor 24"""	GPR24			Standard	XM_005261581		Approved	SLC1, MCH1R	uc003ayz.3	Q99705	OTTHUMG00000150256	ENST00000249016.4:c.573G>A	22.37:g.41077236G>A	ENSP00000249016:p.Met191Ile	Somatic		Capture	Illumina HiSeq	Phase_I	39407182	NM_005297	B2RBX6|Q5R3J1|Q96S47|Q9BV08	Missense_Mutation	SNP	ENST00000249016.4	37	CCDS14004.1	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452229	0.43531	.	.	ENSG00000128285	ENST00000249016	T	0.34667	1.35	5.23	5.23	0.72850	GPCR, rhodopsin-like superfamily (1);	0.045518	0.85682	D	0.000000	T	0.18467	0.0443	N	0.04508	-0.205	0.80722	D	1	B	0.30634	0.288	B	0.34038	0.174	T	0.14811	-1.0459	10	0.20519	T	0.43	.	11.2599	0.49076	0.0849:0.0:0.9151:0.0	.	191	Q99705	MCHR1_HUMAN	I	191	ENSP00000249016:M191I	ENSP00000249016:M191I	M	+	3	0	MCHR1	39407182	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.796000	0.55507	2.601000	0.87937	0.563000	0.77884	ATG		MCHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317142.1	NM_005297	
TTN	7273	broad.mit.edu	37	2	179439995	179439995	+	Missense_Mutation	SNP	C	C	T	rs72646892		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr2:179439995C>T	ENST00000591111.1	-	276	66165	c.65941G>A	c.(65941-65943)Gtc>Atc	p.V21981I	TTN-AS1_ENST00000586831.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V14749I|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V14682I|TTN_ENST00000460472.2_Missense_Mutation_p.V14557I|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V23622I|TTN_ENST00000342992.6_Missense_Mutation_p.V21054I|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21981	Fibronectin type-III 59. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V21052I(1)|p.V14749I(1)|p.V14557I(1)|p.V14682I(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGACAATGACGGGTCTGCTT	0.478																																					p.P14556P												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.G43668A	2						.	C	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	0,4062		0,0,2031	49.0	51.0	50.0		44245,44044,63160,43669	4.7	0.1	2	dbSNP_130	50	1,8375		0,1,4187	no	missense,missense,missense,missense	TTN	NM_133437.3,NM_133432.3,NM_133378.4,NM_003319.4	29,29,29,29	0,1,6218	TT,TC,CC		0.0119,0.0,0.0080	benign,benign,benign,benign	14749/27119,14682/27052,21054/33424,14557/26927	179439995	1,12437	2031	4188	6219	179148241	SO:0001583	missense	7273	exon154			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.65941G>A	2.37:g.179439995C>T	ENSP00000465570:p.Val21981Ile	Somatic		Capture	Illumina HiSeq	Phase_I	179148241	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	12.01	1.810562	0.32053	0.0	1.19E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.6	4.71	0.59529	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.46229	0.1382	L	0.40543	1.245	0.47659	D	0.999481	B;B;B;B	0.13145	0.003;0.003;0.003;0.007	B;B;B;B	0.08055	0.003;0.003;0.003;0.002	T	0.42649	-0.9439	9	0.87932	D	0	.	14.8741	0.70481	0.0:0.93:0.0:0.07	.	14557;14682;14749;21981	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	21054;14557;14749;14682;14555	ENSP00000343764:V21054I;ENSP00000434586:V14557I;ENSP00000340554:V14749I;ENSP00000352154:V14682I	ENSP00000340554:V14749I	V	-	1	0	TTN	179148241	0.997000	0.39634	0.128000	0.21923	0.971000	0.66376	3.425000	0.52771	1.346000	0.45694	0.585000	0.79938	GTC		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FN1	2335	broad.mit.edu	37	2	216256483	216256483	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr2:216256483C>T	ENST00000359671.1	-	25	4116	c.3851G>A	c.(3850-3852)cGt>cAt	p.R1284H	FN1_ENST00000443816.1_Missense_Mutation_p.R1284H|FN1_ENST00000346544.3_Missense_Mutation_p.R1284H|FN1_ENST00000357009.2_Missense_Mutation_p.R1284H|FN1_ENST00000421182.1_Missense_Mutation_p.R1284H|FN1_ENST00000345488.5_Missense_Mutation_p.R1284H|FN1_ENST00000357867.4_Missense_Mutation_p.R1284H|FN1_ENST00000446046.1_Missense_Mutation_p.R1284H|FN1_ENST00000336916.4_Missense_Mutation_p.R1284H|FN1_ENST00000356005.4_Missense_Mutation_p.R1284H|FN1_ENST00000354785.4_Missense_Mutation_p.R1375H|FN1_ENST00000323926.6_Missense_Mutation_p.R1375H|FN1_ENST00000432072.2_Missense_Mutation_p.R1375H			P02751	FINC_HUMAN	fibronectin 1	1284	Cell-attachment.|Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.R1284H(1)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CCAGGTGACACGCATGGTGTC	0.453																																					p.R1284H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3851A	2						.						113.0	107.0	109.0					2																	216256483		2203	4300	6503	215964728	SO:0001583	missense	2335	exon25				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3851G>A	2.37:g.216256483C>T	ENSP00000352696:p.Arg1284His	Somatic		Capture	Illumina HiSeq	Phase_I	215964728	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	De_novo_Start_OutOfFrame	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	C	14.65	2.599564	0.46318	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41	5.61	4.74	0.60224	.	0.000000	0.64402	D	0.000007	T	0.65943	0.2740	L	0.52759	1.655	0.20074	N	0.999937	D;B;P;D;D;P;D;D;D	0.89917	1.0;0.034;0.849;1.0;1.0;0.66;1.0;1.0;0.996	D;B;B;D;D;B;D;D;P	0.81914	0.98;0.017;0.281;0.97;0.988;0.053;0.995;0.995;0.82	T	0.59747	-0.7396	10	0.41790	T	0.15	.	14.4775	0.67557	0.0:0.9293:0.0:0.0707	.	1375;1375;1284;1284;1284;1284;1284;1284;1375	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.	H	1284;1375;1284;1284;1375;1284;1284;1284;1284;1284;1284;1375;1284;91	ENSP00000394423:R1284H;ENSP00000323534:R1375H;ENSP00000338200:R1284H;ENSP00000350534:R1284H;ENSP00000346839:R1375H;ENSP00000352696:R1284H;ENSP00000265312:R1284H;ENSP00000273049:R1284H;ENSP00000349509:R1284H;ENSP00000410422:R1284H;ENSP00000415018:R1284H;ENSP00000399538:R1375H;ENSP00000348285:R1284H;ENSP00000416139:R91H	ENSP00000323534:R1375H	R	-	2	0	FN1	215964728	0.700000	0.27796	0.984000	0.44739	0.876000	0.50452	1.896000	0.39789	1.379000	0.46325	0.650000	0.86243	CGT		FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
ZNF142	7701	broad.mit.edu	37	2	219507438	219507438	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr2:219507438G>T	ENST00000449707.1	-	8	4222	c.3801C>A	c.(3799-3801)taC>taA	p.Y1267*	ZNF142_ENST00000411696.2_Nonsense_Mutation_p.Y1267*	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	1267					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CATGGCGAAGGTAGCCACTAT	0.537																																					p.Y1267X	Colon(170;867 1942 8995 15834 18053)											.	.	0			c.C3801A	2						.						64.0	71.0	69.0					2																	219507438		2128	4234	6362	219215682	SO:0001587	stop_gained	7701	exon8			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.3801C>A	2.37:g.219507438G>T	ENSP00000408643:p.Tyr1267*	None		Capture	Illumina HiSeq	Phase_I	219215682	NM_001105537	Q92510	Nonsense_Mutation	SNP	ENST00000449707.1	37	CCDS42817.1	.	.	.	.	.	.	.	.	.	.	G	47	13.004119	0.99712	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	.	.	.	5.3	-0.452	0.12205	.	0.111696	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-46.6382	14.3705	0.66836	0.1546:0.0:0.8454:0.0	.	.	.	.	X	1267	.	ENSP00000398798:Y1267X	Y	-	3	2	ZNF142	219215682	1.000000	0.71417	0.990000	0.47175	0.987000	0.75469	2.732000	0.47352	-0.265000	0.09352	-0.320000	0.08662	TAC		ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
FAM228A	653140	broad.mit.edu	37	2	24413338	24413338	+	Silent	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr2:24413338C>T	ENST00000295150.3	+	6	545	c.459C>T	c.(457-459)gcC>gcT	p.A153A		NM_001040710.1	NP_001035800.1	Q86W67	F228A_HUMAN	family with sequence similarity 228, member A	153								p.A153A(1)									AAAAGACGGCCGACCTAAGTC	0.453																																					p.A153A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C459T	2						.						47.0	48.0	48.0					2																	24413338		1875	4097	5972	24266842	SO:0001819	synonymous_variant	653140	exon6				CCDS42659.1	2p23.3	2012-07-04	2012-07-04	2012-07-04	ENSG00000186453	ENSG00000186453			34418	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 84"""	C2orf84			Standard	NM_001040710		Approved	FLJ30851	uc002rfc.3	Q86W67	OTTHUMG00000151903	ENST00000295150.3:c.459C>T	2.37:g.24413338C>T		Somatic		Capture	Illumina HiSeq	Phase_I	24266842	NM_001040710		Silent	SNP	ENST00000295150.3	37	CCDS42659.1	.	.	.	.	.	.	.	.	.	.	C	2.425	-0.332193	0.05314	.	.	ENSG00000186453	ENST00000432434	.	.	.	3.64	-7.29	0.01451	.	.	.	.	.	T	0.28896	0.0717	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28073	-1.0055	4	.	.	.	3.0656	9.8699	0.41168	0.0:0.264:0.0972:0.6388	.	.	.	.	L	191	.	.	P	+	2	0	C2orf84	24266842	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.006000	0.00086	-3.085000	0.00249	-1.884000	0.00543	CCG		FAM228A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324342.1	NM_001040710	
KCNK3	3777	broad.mit.edu	37	2	26951011	26951011	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr2:26951011G>A	ENST00000302909.3	+	2	885	c.760G>A	c.(760-762)Gag>Aag	p.E254K		NM_002246.2	NP_002237.1	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	254					brain development (GO:0007420)|cellular response to hypoxia (GO:0071456)|cellular response to zinc ion (GO:0071294)|cochlea development (GO:0090102)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)|open rectifier potassium channel activity (GO:0005252)|potassium channel activity (GO:0005267)|potassium ion leak channel activity (GO:0022841)|S100 protein binding (GO:0044548)	p.E254K(1)		endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Doxapram(DB00561)|Halothane(DB01159)	CGCCGAGGACGAGAAGCGCGA	0.687																																					p.E254K	GBM(80;1457 1631 27100 45946)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G760A	2						.						46.0	34.0	38.0					2																	26951011		2200	4299	6499	26804515	SO:0001583	missense	3777	exon2			AF006823	CCDS1727.1	2p23	2012-03-07			ENSG00000171303	ENSG00000171303		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6278	protein-coding gene	gene with protein product		603220				9312005, 9721223, 16382106	Standard	NM_002246		Approved	K2p3.1, TASK, TASK-1	uc002rhn.2	O14649	OTTHUMG00000125530	ENST00000302909.3:c.760G>A	2.37:g.26951011G>A	ENSP00000306275:p.Glu254Lys	Somatic		Capture	Illumina HiSeq	Phase_I	26804515	NM_002246	Q53SU2	Missense_Mutation	SNP	ENST00000302909.3	37	CCDS1727.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.902888	0.92035	.	.	ENSG00000171303	ENST00000538762;ENST00000302909	T	0.24350	1.86	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.34077	0.0885	L	0.61218	1.895	0.80722	D	1	D	0.61697	0.99	P	0.47827	0.558	T	0.20974	-1.0259	10	0.72032	D	0.01	.	13.6164	0.62110	0.0:0.0:1.0:0.0	.	254	O14649	KCNK3_HUMAN	K	131;254	ENSP00000306275:E254K	ENSP00000306275:E254K	E	+	1	0	KCNK3	26804515	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.650000	0.98490	2.329000	0.79093	0.511000	0.50034	GAG		KCNK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246861.2	NM_002246	
LHCGR	3973	broad.mit.edu	37	2	48915324	48915324	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr2:48915324C>A	ENST00000294954.7	-	11	1633	c.1612G>T	c.(1612-1614)Gcc>Tcc	p.A538S	LHCGR_ENST00000405626.1_Missense_Mutation_p.A511S|LHCGR_ENST00000401907.1_Intron|LHCGR_ENST00000344775.3_Missense_Mutation_p.A476S|LHCGR_ENST00000403273.1_3'UTR|STON1-GTF2A1L_ENST00000402114.2_Intron	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	538					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)	p.A538S(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	ATGAAGAAGGCCACCACATTG	0.358																																					p.A538S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1612T	2						.						111.0	113.0	112.0					2																	48915324		2203	4300	6503	48768828	SO:0001583	missense	3973	exon11				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.1612G>T	2.37:g.48915324C>A	ENSP00000294954:p.Ala538Ser	Somatic		Capture	Illumina HiSeq	Phase_I	48768828	NM_000233	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	37	CCDS1842.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345596	0.82022	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	T;T;T	0.36699	1.24;1.24;1.24	5.68	5.68	0.88126	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.68879	0.3049	M	0.90252	3.1	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.74150	-0.3758	9	.	.	.	.	18.7926	0.91980	0.0:1.0:0.0:0.0	.	538	P22888	LSHR_HUMAN	S	476;538;511	ENSP00000344301:A476S;ENSP00000294954:A538S;ENSP00000386033:A511S	.	A	-	1	0	LHCGR	48768828	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.818000	0.86416	2.694000	0.91930	0.585000	0.79938	GCC		LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3	
CCDC142	84865	broad.mit.edu	37	2	74709452	74709452	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr2:74709452G>C	ENST00000393965.3	-	1	909	c.513C>G	c.(511-513)atC>atG	p.I171M	CCDC142_ENST00000290418.4_Missense_Mutation_p.I171M|TTC31_ENST00000442235.2_5'Flank|CCDC142_ENST00000471713.1_Intron|TTC31_ENST00000410003.1_5'Flank|TTC31_ENST00000233623.5_5'Flank	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	171								p.I171M(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						CGGCTAGTCCGATGGGGCGCG	0.711																																					p.I171M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C513G	2						.						10.0	14.0	13.0					2																	74709452		2185	4286	6471	74562960	SO:0001583	missense	84865	exon1			AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.513C>G	2.37:g.74709452G>C	ENSP00000377537:p.Ile171Met	Somatic		Capture	Illumina HiSeq	Phase_I	74562960	NM_032779	B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Missense_Mutation	SNP	ENST00000393965.3	37		.	.	.	.	.	.	.	.	.	.	G	12.90	2.075750	0.36662	.	.	ENSG00000135637	ENST00000393965;ENST00000290418	T;T	0.08370	3.1;3.1	4.58	-4.68	0.03309	.	0.760060	0.11574	N	0.550460	T	0.05090	0.0136	N	0.22421	0.69	0.09310	N	1	P;P;P	0.44816	0.844;0.844;0.844	B;B;B	0.44163	0.443;0.443;0.443	T	0.17837	-1.0356	10	0.62326	D	0.03	-3.427	2.5667	0.04784	0.491:0.1254:0.2558:0.1278	.	171;171;171	Q17RM4;Q17RM4-2;Q17RM4-3	CC142_HUMAN;.;.	M	171	ENSP00000377537:I171M;ENSP00000290418:I171M	ENSP00000290418:I171M	I	-	3	3	CCDC142	74562960	0.000000	0.05858	0.008000	0.14137	0.615000	0.37417	-0.130000	0.10498	-0.901000	0.03891	-0.291000	0.09656	ATC		CCDC142-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000328391.1	NM_032779	
TRIP12	9320	broad.mit.edu	37	2	230656627	230656627	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr2:230656627T>C	ENST00000283943.5	-	28	4323	c.4145A>G	c.(4144-4146)aAt>aGt	p.N1382S	TRIP12_ENST00000389044.4_Missense_Mutation_p.N1430S|TRIP12_ENST00000389045.3_Missense_Mutation_p.N1112S	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1382					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)	p.N1382S(1)		breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GCCTAGAGGATTGCTCTCATC	0.388																																					p.N1382S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4145G	2						.						194.0	188.0	190.0					2																	230656627		2203	4300	6503	230364871	SO:0001583	missense	9320	exon28			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.4145A>G	2.37:g.230656627T>C	ENSP00000283943:p.Asn1382Ser	Somatic		Capture	Illumina HiSeq	Phase_I	230364871	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	T	19.41	3.822817	0.71028	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.41065	1.02;1.35;1.01	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.47021	0.1423	L	0.27053	0.805	0.80722	D	1	P;P;P	0.52842	0.956;0.915;0.956	D;P;D	0.65010	0.931;0.703;0.931	T	0.28202	-1.0051	10	0.08837	T	0.75	.	15.9042	0.79406	0.0:0.0:0.0:1.0	.	1112;1430;1382	Q14CF1;Q14CA3;Q14669	.;.;TRIPC_HUMAN	S	1382;1112;1430	ENSP00000283943:N1382S;ENSP00000373697:N1112S;ENSP00000373696:N1430S	ENSP00000283943:N1382S	N	-	2	0	TRIP12	230364871	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.656000	0.83736	2.142000	0.66516	0.477000	0.44152	AAT		TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
FILIP1L	11259	broad.mit.edu	37	3	99567697	99567697	+	Silent	SNP	C	C	T	rs372889125		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr3:99567697C>T	ENST00000354552.3	-	5	3293	c.2823G>A	c.(2821-2823)acG>acA	p.T941T	CMSS1_ENST00000421999.2_Intron|FILIP1L_ENST00000471562.1_Silent_p.T701T|FILIP1L_ENST00000487087.1_Silent_p.T517T|FILIP1L_ENST00000331335.5_Silent_p.T941T|CMSS1_ENST00000496116.1_Intron|FILIP1L_ENST00000476723.1_Intron|FILIP1L_ENST00000383694.2_Silent_p.T701T	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like	941						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.T941T(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						TTTGCTTTGGCGTGCCACAGT	0.468																																					p.T941T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2823A	3						.	C	,,,	1,4081		0,1,2040	271.0	260.0	264.0		2823,2103,,2823	0.0	1.0	3		264	0,8346		0,0,4173	no	coding-synonymous,coding-synonymous,intron,coding-synonymous	FILIP1L,C3orf26	NM_001042459.1,NM_014890.2,NM_032359.3,NM_182909.2	,,,	0,1,6213	TT,TC,CC		0.0,0.0245,0.0080	,,,	941/1134,701/894,,941/1136	99567697	1,12427	2041	4173	6214	101050387	SO:0001819	synonymous_variant	11259	exon5				CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.2823G>A	3.37:g.99567697C>T		Somatic		Capture	Illumina HiSeq	Phase_I	101050387	NM_182909	B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Silent	SNP	ENST00000354552.3	37	CCDS43117.1																																																																																				FILIP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353069.1	NM_014890	
GSK3B	2932	broad.mit.edu	37	3	119582446	119582446	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr3:119582446G>A	ENST00000264235.8	-	9	1898	c.916C>T	c.(916-918)Cga>Tga	p.R306*	GSK3B_ENST00000473886.1_5'UTR|GSK3B_ENST00000316626.5_Nonsense_Mutation_p.R319*	NM_001146156.1|NM_002093.3	NP_001139628.1|NP_002084.2	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta	306	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell migration (GO:0016477)|cellular response to interleukin-3 (GO:0036016)|cellular response to mechanical stimulus (GO:0071260)|circadian rhythm (GO:0007623)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|ER overload response (GO:0006983)|establishment of cell polarity (GO:0030010)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hippocampus development (GO:0021766)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|myoblast fusion (GO:0007520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of type B pancreatic cell development (GO:2000077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein binding (GO:0032092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|protein localization to microtubule (GO:0035372)|protein phosphorylation (GO:0006468)|re-entry into mitotic cell cycle (GO:0000320)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of microtubule-based process (GO:0032886)|regulation of neuronal synaptic plasticity (GO:0048168)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|superior temporal gyrus development (GO:0071109)	beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|kinase activity (GO:0016301)|NF-kappaB binding (GO:0051059)|p53 binding (GO:0002039)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II transcription factor binding (GO:0001085)|tau-protein kinase activity (GO:0050321)|ubiquitin protein ligase binding (GO:0031625)	p.R319*(2)		endometrium(1)|large_intestine(8)|lung(7)|prostate(2)	18				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	GTTCGGGGTCGGAAGACCTGC	0.433																																					p.R319X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C955T	3						.						49.0	45.0	46.0					3																	119582446		2203	4300	6503	121065136	SO:0001587	stop_gained	2932	exon10			BC012760	CCDS2996.1, CCDS54628.1	3q13.3	2008-02-15			ENSG00000082701	ENSG00000082701			4617	protein-coding gene	gene with protein product		605004				10486203	Standard	NM_002093		Approved		uc003edm.3	P49841	OTTHUMG00000133765	ENST00000264235.8:c.916C>T	3.37:g.119582446G>A	ENSP00000264235:p.Arg306*	Somatic		Capture	Illumina HiSeq	Phase_I	121065136	NM_002093	D3DN89|Q9BWH3|Q9UL47	Nonsense_Mutation	SNP	ENST00000264235.8	37	CCDS54628.1	.	.	.	.	.	.	.	.	.	.	G	40	7.949404	0.98577	.	.	ENSG00000082701	ENST00000264235;ENST00000316626;ENST00000539838	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.2345	18.9171	0.92510	0.0:0.0:1.0:0.0	.	.	.	.	X	306;319;23	.	ENSP00000264235:R306X	R	-	1	2	GSK3B	121065136	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.149000	0.71795	2.771000	0.95319	0.650000	0.86243	CGA		GSK3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258240.2		
PLXND1	23129	broad.mit.edu	37	3	129275504	129275504	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr3:129275504C>T	ENST00000324093.4	-	35	5795	c.5617G>A	c.(5617-5619)Gcc>Acc	p.A1873T	PLXND1_ENST00000393239.1_3'UTR|PLXND1_ENST00000504689.1_Missense_Mutation_p.A29T	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1873					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)	p.A1873T(1)	PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						TCTGCCATGGCCACATTGGTG	0.557																																					p.A1873T	Ovarian(97;366 1484 3738 22084 39045)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5617A	3						.						156.0	140.0	146.0					3																	129275504		2203	4300	6503	130758194	SO:0001583	missense	23129	exon35			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.5617G>A	3.37:g.129275504C>T	ENSP00000317128:p.Ala1873Thr	Somatic		Capture	Illumina HiSeq	Phase_I	130758194	NM_015103	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.741775|5.741775	0.96873|0.96873	.|.	.|.	ENSG00000004399|ENSG00000004399	ENST00000324093;ENST00000504689|ENST00000506979	T;T|.	0.24350|.	1.86;1.86|.	5.11|5.11	5.11|5.11	0.69529|0.69529	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84156|0.84156	0.5410|0.5410	M|M	0.88570|0.88570	2.965|2.965	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.997;1.0|.	D;D|.	0.91635|.	0.994;0.999|.	D|D	0.86896|0.86896	0.2051|0.2051	10|5	0.87932|.	D|.	0|.	.|.	18.5668|18.5668	0.91119|0.91119	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	469;1873|.	B4DRU3;Q9Y4D7|.	.;PLXD1_HUMAN|.	T|D	1873;29|216	ENSP00000317128:A1873T;ENSP00000426162:A29T|.	ENSP00000317128:A1873T|.	A|G	-|-	1|2	0|0	PLXND1|PLXND1	130758194|130758194	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.857000|0.857000	0.48899|0.48899	6.085000|6.085000	0.71343|0.71343	2.375000|2.375000	0.81037|0.81037	0.462000|0.462000	0.41574|0.41574	GCC|GGC		PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
COL6A6	131873	broad.mit.edu	37	3	130285812	130285813	+	Missense_Mutation	DNP	GC	GC	TT	rs371953457		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	GC	GC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr3:130285812_130285813GC>TT	ENST00000358511.6	+	4	1580_1581	c.1549_1550GC>TT	c.(1549-1551)GCa>TTa	p.A517L	COL6A6_ENST00000453409.2_Missense_Mutation_p.A517L	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	517	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.A517>?(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						AAACACAGGCGCAGCACTGAAT	0.450																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1549_1550TT	3						.																																			131768503	SO:0001583	missense	131873	exon4			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	Exception_encountered	3.37:g.130285812_130285813delinsTT	ENSP00000351310:p.Ala517Leu	Somatic		Capture	Illumina HiSeq	Phase_I	131768502	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	DNP	ENST00000358511.6	37	CCDS46911.1																																																																																				COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
TRPC1	7220	broad.mit.edu	37	3	142503848	142503848	+	Silent	SNP	A	A	G			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr3:142503848A>G	ENST00000476941.1	+	7	1749	c.1263A>G	c.(1261-1263)gaA>gaG	p.E421E	TRPC1_ENST00000273482.6_Silent_p.E387E	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	421					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)	p.E387E(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						CAGCCCTTGAAAGAATAGACT	0.348																																					p.E387E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1161G	3						.						60.0	62.0	61.0					3																	142503848		2202	4300	6502	143986538	SO:0001819	synonymous_variant	7220	exon6			X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.1263A>G	3.37:g.142503848A>G		Somatic		Capture	Illumina HiSeq	Phase_I	143986538	NM_003304	Q14CE4	Silent	SNP	ENST00000476941.1	37	CCDS58856.1																																																																																				TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354520.1	NM_003304	
PIK3CA	5290	broad.mit.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.H1047R	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,breast,NS,Substitution - Missense,0 	.	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)	c.A3140G	3						.						99.0	89.0	92.0					3																	178952085		1912	4130	6042	180434779	SO:0001583	missense	5290	exon21				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		Capture	Illumina HiSeq	Phase_I	180434779	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT		PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
ZNF385D	79750	broad.mit.edu	37	3	21462765	21462765	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr3:21462765G>A	ENST00000281523.2	-	8	1647	c.1129C>T	c.(1129-1131)Cgg>Tgg	p.R377W		NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	377						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.R377W(1)		NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						GGAGCTGGCCGCAGGAGTGCC	0.532																																					p.R377W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1129T	3						.						50.0	48.0	49.0					3																	21462765		2203	4300	6503	21437769	SO:0001583	missense	79750	exon8			BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.1129C>T	3.37:g.21462765G>A	ENSP00000281523:p.Arg377Trp	Somatic		Capture	Illumina HiSeq	Phase_I	21437769	NM_024697		Missense_Mutation	SNP	ENST00000281523.2	37	CCDS2636.1	.	.	.	.	.	.	.	.	.	.	G	18.46	3.629049	0.67015	.	.	ENSG00000151789	ENST00000281523	T	0.51817	0.69	5.95	3.09	0.35607	.	0.000000	0.85682	D	0.000000	T	0.62877	0.2464	L	0.56199	1.76	0.47374	D	0.999406	D	0.89917	1.0	D	0.71184	0.972	T	0.65187	-0.6229	10	0.87932	D	0	-37.636	15.3696	0.74551	0.0:0.0:0.6371:0.3629	.	377	Q9H6B1	Z385D_HUMAN	W	377	ENSP00000281523:R377W	ENSP00000281523:R377W	R	-	1	2	ZNF385D	21437769	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.780000	0.47742	0.352000	0.24053	0.557000	0.71058	CGG		ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	NM_024697	
TGFBR2	7048	broad.mit.edu	37	3	30715664	30715664	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr3:30715664C>T	ENST00000295754.5	+	5	1704	c.1322C>T	c.(1321-1323)tCc>tTc	p.S441F	TGFBR2_ENST00000359013.4_Missense_Mutation_p.S466F	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	441	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.S441F(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						AATGTTGAGTCCTTCAAGCAG	0.483																																					p.S441F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1322T	3	GRCh37	CM063206	TGFBR2	M		.						153.0	134.0	140.0					3																	30715664		2203	4300	6503	30690668	SO:0001583	missense	7048	exon5				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.1322C>T	3.37:g.30715664C>T	ENSP00000295754:p.Ser441Phe	Somatic		Capture	Illumina HiSeq	Phase_I	30690668	NM_003242	B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	ENST00000295754.5	37	CCDS2648.1	.	.	.	.	.	.	.	.	.	.	C	33	5.262287	0.95368	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	D;D	0.92911	-3.13;-3.13	6.02	6.02	0.97574	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.050018	0.85682	D	0.000000	D	0.93641	0.7969	N	0.25060	0.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.94226	0.7472	10	0.87932	D	0	.	20.547	0.99278	0.0:1.0:0.0:0.0	.	441;466	P37173;D2JYI1	TGFR2_HUMAN;.	F	441;466;271	ENSP00000295754:S441F;ENSP00000351905:S466F	ENSP00000295754:S441F	S	+	2	0	TGFBR2	30690668	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.818000	0.86416	2.850000	0.98022	0.650000	0.86243	TCC		TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2		
CCR3	1232	broad.mit.edu	37	3	46307554	46307554	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr3:46307554C>A	ENST00000357422.2	+	4	1448	c.905C>A	c.(904-906)gCc>gAc	p.A302D	CCR3_ENST00000545097.1_Missense_Mutation_p.A323D|CCR3_ENST00000395942.2_Missense_Mutation_p.A302D|CCR3_ENST00000395940.2_Missense_Mutation_p.A302D|CCR3_ENST00000541018.1_Missense_Mutation_p.A302D			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	302					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)	p.A302D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		GTGATCTACGCCTTTGTTGGA	0.542																																					p.A323D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C968A	3						.						114.0	95.0	101.0					3																	46307554		2203	4300	6503	46282558	SO:0001583	missense	1232	exon3			AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.905C>A	3.37:g.46307554C>A	ENSP00000350003:p.Ala302Asp	Somatic		Capture	Illumina HiSeq	Phase_I	46282558	NM_178328	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	ENST00000357422.2	37	CCDS2738.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.279284	0.59758	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000395942	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000017	T	0.73721	0.3623	M	0.91510	3.215	0.47698	D	0.999498	D;D	0.76494	0.999;0.999	D;D	0.79108	0.992;0.982	T	0.79347	-0.1841	10	0.87932	D	0	.	19.9065	0.97010	0.0:1.0:0.0:0.0	.	323;302	F5GWL6;P51677	.;CCR3_HUMAN	D	302;323;302;302;302	ENSP00000350003:A302D;ENSP00000441600:A323D;ENSP00000440097:A302D;ENSP00000379271:A302D;ENSP00000379273:A302D	ENSP00000350003:A302D	A	+	2	0	CCR3	46282558	0.986000	0.35501	0.996000	0.52242	0.298000	0.27526	2.456000	0.44997	2.696000	0.92011	0.655000	0.94253	GCC		CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257380.2		
QRICH1	54870	broad.mit.edu	37	3	49065254	49065254	+	IGR	SNP	G	G	A	rs530770243	byFrequency	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr3:49065254G>A	ENST00000395443.2	-	0	3549				RP13-131K19.6_ENST00000607245.1_RNA|IMPDH2_ENST00000326739.4_Silent_p.C140C	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1							nucleus (GO:0005634)		p.C140C(1)		breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TTGGGATACCGCAGAAACCAT	0.542													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17560	0.0		0.0	False		,,,				2504	0.0				p.C140C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C420T	3						.						64.0	62.0	63.0					3																	49065254		2203	4300	6503	49040258	SO:0001628	intergenic_variant	3615	exon5				CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772		3.37:g.49065254G>A		Somatic		Capture	Illumina HiSeq	Phase_I	49040258	NM_000884	Q4G0F7|Q7L621|Q8TEA5	Silent	SNP	ENST00000395443.2	37	CCDS2787.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.517813	0.27211	.	.	ENSG00000178035	ENST00000429182	.	.	.	5.96	-8.48	0.00935	.	.	.	.	.	T	0.65154	0.2664	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71823	-0.4476	4	.	.	.	-13.3832	18.3604	0.90372	0.4139:0.0:0.5861:0.0	.	.	.	.	W	72	.	.	R	-	1	2	IMPDH2	49040258	0.013000	0.17824	0.745000	0.31077	0.970000	0.65996	-0.521000	0.06245	-1.396000	0.02071	-0.768000	0.03414	CGG		QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345669.1	NM_017730	
FXR1	8087	broad.mit.edu	37	3	180680684	180680684	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr3:180680684T>C	ENST00000357559.4	+	12	1475	c.1091T>C	c.(1090-1092)cTa>cCa	p.L364P	FXR1_ENST00000445140.2_Missense_Mutation_p.L364P|FXR1_ENST00000491062.1_Missense_Mutation_p.L315P|FXR1_ENST00000480918.1_Missense_Mutation_p.L351P|FXR1_ENST00000305586.7_Missense_Mutation_p.L279P|FXR1_ENST00000468861.1_Missense_Mutation_p.L279P	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	364					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.L364P(1)		breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			GTAGAACAGCTAAGAATGGAA	0.393																																					p.L364P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1091C	3						.						148.0	151.0	150.0					3																	180680684		2203	4300	6503	182163378	SO:0001583	missense	8087	exon12			M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1091T>C	3.37:g.180680684T>C	ENSP00000350170:p.Leu364Pro	Somatic		Capture	Illumina HiSeq	Phase_I	182163378	NM_001013438	A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	ENST00000357559.4	37	CCDS3238.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.267156	0.80469	.	.	ENSG00000114416	ENST00000357559;ENST00000305586;ENST00000491062;ENST00000468861;ENST00000445140;ENST00000480918	T;T;T;T;T;T	0.59224	0.28;0.28;0.28;0.28;0.28;0.28	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.77384	0.4122	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.997	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;0.995	T	0.81068	-0.1100	10	0.87932	D	0	0.049	15.6821	0.77376	0.0:0.0:0.0:1.0	.	351;315;279;279;364;364	B4DXZ6;E9PFF5;E7EU85;E7ERF5;P51114-2;P51114	.;.;.;.;.;FXR1_HUMAN	P	364;279;315;279;364;351	ENSP00000350170:L364P;ENSP00000307633:L279P;ENSP00000420643:L315P;ENSP00000420515:L279P;ENSP00000388828:L364P;ENSP00000418097:L351P	ENSP00000307633:L279P	L	+	2	0	FXR1	182163378	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.330000	0.79181	2.165000	0.68154	0.482000	0.46254	CTA		FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350265.5		
KIAA1109	84162	broad.mit.edu	37	4	123192319	123192319	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr4:123192319G>A	ENST00000264501.4	+	47	8013	c.7640G>A	c.(7639-7641)cGg>cAg	p.R2547Q	KIAA1109_ENST00000388738.3_Missense_Mutation_p.R2547Q|KIAA1109_ENST00000455637.1_Missense_Mutation_p.R2547Q			Q2LD37	K1109_HUMAN	KIAA1109	2547					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R2547Q(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CTCAGCAAGCGGTATTATAAC	0.423																																					p.R2547Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7640A	4						.						191.0	186.0	187.0					4																	123192319		1897	4123	6020	123411769	SO:0001583	missense	84162	exon45			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.7640G>A	4.37:g.123192319G>A	ENSP00000264501:p.Arg2547Gln	Somatic		Capture	Illumina HiSeq	Phase_I	123411769	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.286603|5.286603	0.95517|0.95517	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000446180|ENST00000264501;ENST00000388738;ENST00000455637	.|T;T;T	.|0.25579	.|2.38;2.38;1.79	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.39911|0.39911	0.1096|0.1096	N|N	0.19112|0.19112	0.55|0.55	0.58432|0.58432	D|D	0.999992|0.999992	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.75484	.|0.986;0.986;0.978	T|T	0.32798|0.32798	-0.9893|-0.9893	5|10	.|0.72032	.|D	.|0.01	.|.	20.0951|20.0951	0.97834|0.97834	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|2547;2546;2547	.|Q2LD37-6;Q2LD37-2;Q2LD37	.|.;.;K1109_HUMAN	S|Q	1120|2547	.|ENSP00000264501:R2547Q;ENSP00000373390:R2547Q;ENSP00000389925:R2547Q	.|ENSP00000264501:R2547Q	G|R	+|+	1|2	0|0	KIAA1109|KIAA1109	123411769|123411769	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.982000|0.982000	0.71751|0.71751	9.787000|9.787000	0.99055|0.99055	2.753000|2.753000	0.94483|0.94483	0.467000|0.467000	0.42956|0.42956	GGT|CGG		KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
SLC7A11	23657	broad.mit.edu	37	4	139106336	139106336	+	Missense_Mutation	SNP	T	T	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr4:139106336T>A	ENST00000280612.5	-	7	1133	c.854A>T	c.(853-855)aAt>aTt	p.N285I		NM_014331.3	NP_055146.1	Q9UPY5	XCT_HUMAN	solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11	285					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|brain development (GO:0007420)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|lens fiber cell differentiation (GO:0070306)|leukocyte migration (GO:0050900)|platelet aggregation (GO:0070527)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	cystine:glutamate antiporter activity (GO:0015327)	p.N285I(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)	18	all_hematologic(180;0.166)				Acetylcysteine(DB06151)|L-Cystine(DB00138)|Riluzole(DB00740)|Rosuvastatin(DB01098)|Sulfasalazine(DB00795)|Tauroursodeoxycholic acid(DB08834)	GTAGGCCACATTTGTCAGCAC	0.413																																					p.N285I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A854T	4						.						171.0	139.0	150.0					4																	139106336		2203	4300	6503	139325786	SO:0001583	missense	23657	exon7			AB026891	CCDS3742.1	4q28-q32	2013-05-22	2011-07-12		ENSG00000151012	ENSG00000151012		"""Solute carriers"""	11059	protein-coding gene	gene with protein product		607933				10206947, 12763038	Standard	XM_005262875		Approved	xCT	uc021xrw.1	Q9UPY5	OTTHUMG00000133396	ENST00000280612.5:c.854A>T	4.37:g.139106336T>A	ENSP00000280612:p.Asn285Ile	Somatic		Capture	Illumina HiSeq	Phase_I	139325786	NM_014331	A8K2U4	Missense_Mutation	SNP	ENST00000280612.5	37	CCDS3742.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.669254	0.88348	.	.	ENSG00000151012	ENST00000280612	D	0.90620	-2.7	5.71	5.71	0.89125	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.95708	0.8604	M	0.84773	2.715	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.96308	0.9226	10	0.87932	D	0	.	15.9869	0.80160	0.0:0.0:0.0:1.0	.	285	Q9UPY5	XCT_HUMAN	I	285	ENSP00000280612:N285I	ENSP00000280612:N285I	N	-	2	0	SLC7A11	139325786	1.000000	0.71417	0.323000	0.25347	0.997000	0.91878	7.904000	0.87408	2.171000	0.68590	0.533000	0.62120	AAT		SLC7A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257251.2		
EDNRA	1909	broad.mit.edu	37	4	148453812	148453812	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr4:148453812C>G	ENST00000324300.5	+	4	1218	c.703C>G	c.(703-705)Cag>Gag	p.Q235E	EDNRA_ENST00000503721.1_3'UTR|EDNRA_ENST00000511804.1_Missense_Mutation_p.Q10E|EDNRA_ENST00000339690.5_3'UTR|EDNRA_ENST00000358556.4_Intron|EDNRA_ENST00000506066.1_Intron	NM_001957.3	NP_001948.1	P25101	EDNRA_HUMAN	endothelin receptor type A	235					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|glomerular filtration (GO:0003094)|glucose transport (GO:0015758)|head development (GO:0060322)|heart development (GO:0007507)|histamine secretion (GO:0001821)|in utero embryonic development (GO:0001701)|maternal process involved in parturition (GO:0060137)|metabolic process (GO:0008152)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP biosynthetic process (GO:0030818)|neural crest cell development (GO:0014032)|patterning of blood vessels (GO:0001569)|penile erection (GO:0043084)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of kidney development (GO:0090184)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of odontogenesis (GO:0042482)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|Rho protein signal transduction (GO:0007266)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|smooth muscle cell proliferation (GO:0048659)|smooth muscle contraction (GO:0006939)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	endothelin receptor activity (GO:0004962)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.Q235E(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)	17	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Acetylsalicylic acid(DB00945)|Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	TAGGGGTGAACAGCATAAAAC	0.443																																					p.Q235E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C703G	4						.						160.0	150.0	154.0					4																	148453812		2203	4300	6503	148673262	SO:0001583	missense	1909	exon4			D90348	CCDS3769.1, CCDS54810.1, CCDS58927.1	4q31.22	2013-09-20			ENSG00000151617	ENSG00000151617		"""GPCR / Class A : Endothelin receptors"""	3179	protein-coding gene	gene with protein product		131243				1659806	Standard	NM_001957		Approved		uc003iky.3	P25101	OTTHUMG00000161354	ENST00000324300.5:c.703C>G	4.37:g.148453812C>G	ENSP00000315011:p.Gln235Glu	Somatic		Capture	Illumina HiSeq	Phase_I	148673262	NM_001957	B2R723|B4E2V6|B7Z9G6|D3DP03|E7ER36|O43441|Q16432|Q16433|Q8TBH2	Missense_Mutation	SNP	ENST00000324300.5	37	CCDS3769.1	.	.	.	.	.	.	.	.	.	.	C	1.197	-0.633549	0.03584	.	.	ENSG00000151617	ENST00000324300;ENST00000511804	T;T	0.36157	1.27;1.27	5.55	3.76	0.43208	GPCR, rhodopsin-like superfamily (1);	0.488463	0.23824	N	0.044212	T	0.18087	0.0434	N	0.17379	0.485	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.07424	-1.0773	10	0.05436	T	0.98	-0.9912	9.8066	0.40797	0.1315:0.3638:0.5048:0.0	.	235	P25101	EDNRA_HUMAN	E	235;10	ENSP00000315011:Q235E;ENSP00000425354:Q10E	ENSP00000315011:Q235E	Q	+	1	0	EDNRA	148673262	0.019000	0.18553	0.999000	0.59377	0.747000	0.42532	0.500000	0.22562	1.321000	0.45227	-0.312000	0.09012	CAG		EDNRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364635.1		
LIMCH1	22998	broad.mit.edu	37	4	41621301	41621301	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr4:41621301C>T	ENST00000313860.7	+	8	833	c.779C>T	c.(778-780)cCg>cTg	p.P260L	LIMCH1_ENST00000396595.3_Missense_Mutation_p.P106L|LIMCH1_ENST00000514096.1_Missense_Mutation_p.P113L|LIMCH1_ENST00000509454.1_Missense_Mutation_p.P108L|LIMCH1_ENST00000512946.1_Missense_Mutation_p.P260L|LIMCH1_ENST00000512820.1_Missense_Mutation_p.P260L|LIMCH1_ENST00000509638.1_Missense_Mutation_p.P101L|LIMCH1_ENST00000503057.1_Missense_Mutation_p.P101L|LIMCH1_ENST00000381753.4_Missense_Mutation_p.P106L|LIMCH1_ENST00000512632.1_Missense_Mutation_p.P260L|LIMCH1_ENST00000513024.1_Missense_Mutation_p.P101L|LIMCH1_ENST00000509277.1_Missense_Mutation_p.P106L|LIMCH1_ENST00000511496.1_Missense_Mutation_p.P101L|LIMCH1_ENST00000508501.1_Missense_Mutation_p.P260L	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1	260					actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)	p.P260L(1)|p.P101L(1)		central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						CATGGTGAGCCGAAATCAGCA	0.537																																					p.P106L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C317T	4						.						147.0	149.0	148.0					4																	41621301		2203	4300	6503	41316058	SO:0001583	missense	22998	exon3			AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.779C>T	4.37:g.41621301C>T	ENSP00000316891:p.Pro260Leu	Somatic		Capture	Illumina HiSeq	Phase_I	41316058	NM_001112720	A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	Missense_Mutation	SNP	ENST00000313860.7	37	CCDS33977.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.661|9.661	1.144267|1.144267	0.21205|0.21205	.|.	.|.	ENSG00000064042|ENSG00000064042	ENST00000513024;ENST00000509638;ENST00000508501;ENST00000512946;ENST00000313860;ENST00000512632;ENST00000512820;ENST00000446625;ENST00000503057;ENST00000511496;ENST00000313875;ENST00000514096;ENST00000509277;ENST00000509454;ENST00000396595;ENST00000381753|ENST00000508466	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.50548|.	1.47;1.47;1.47;1.47;1.47;1.47;1.47;1.47;0.74;1.47;1.47;1.47;1.47;1.47;1.47|.	5.59|5.59	4.75|4.75	0.60458|0.60458	.|.	0.348037|.	0.34853|.	N|.	0.003637|.	T|.	0.54679|.	0.1873|.	L|L	0.41492|0.41492	1.28|1.28	0.46356|0.46356	D|D	0.999001|0.999001	B;B;B;B;B;B;P;B;B;B;B;B|.	0.35821|.	0.052;0.003;0.063;0.012;0.012;0.017;0.523;0.005;0.026;0.006;0.01;0.001|.	B;B;B;B;B;B;B;B;B;B;B;B|.	0.32393|.	0.022;0.005;0.014;0.019;0.019;0.004;0.145;0.012;0.009;0.004;0.009;0.003|.	T|.	0.51694|.	-0.8673|.	10|.	0.35671|.	T|.	0.21|.	-7.0308|-7.0308	9.8714|9.8714	0.41177|0.41177	0.1379:0.7917:0.0:0.0704|0.1379:0.7917:0.0:0.0704	.|.	11;106;260;106;106;108;101;101;260;260;260;260|.	B7Z3G0;E9PDJ9;D6RD46;Q9UPQ0-9;Q9UPQ0-6;Q6NVB9;G5EA03;Q9UPQ0-5;Q9UPQ0-4;E9PHM7;Q9UPQ0-2;Q9UPQ0|.	.;.;.;.;.;.;.;.;.;.;.;LIMC1_HUMAN|.	L|X	101;101;260;260;260;260;260;101;101;101;100;113;106;108;106;106|95	ENSP00000425222:P101L;ENSP00000427311:P101L;ENSP00000424825:P260L;ENSP00000424645:P260L;ENSP00000316891:P260L;ENSP00000427045:P260L;ENSP00000424437:P260L;ENSP00000411020:P101L;ENSP00000425631:P101L;ENSP00000421242:P101L;ENSP00000426334:P113L;ENSP00000422864:P106L;ENSP00000423355:P108L;ENSP00000379840:P106L;ENSP00000371172:P106L|.	ENSP00000316891:P260L|.	P|R	+|+	2|1	0|2	LIMCH1|LIMCH1	41316058|41316058	0.992000|0.992000	0.36948|0.36948	0.933000|0.933000	0.37362|0.37362	0.031000|0.031000	0.12232|0.12232	2.225000|2.225000	0.42954|0.42954	1.494000|1.494000	0.48533|0.48533	0.563000|0.563000	0.77884|0.77884	CCG|CGA		LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361249.2	NM_014988	
CCSER1	401145	broad.mit.edu	37	4	91229611	91229611	+	Missense_Mutation	SNP	G	G	A	rs200969775		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr4:91229611G>A	ENST00000509176.1	+	2	464	c.176G>A	c.(175-177)cGg>cAg	p.R59Q	CCSER1_ENST00000432775.2_Missense_Mutation_p.R59Q|CCSER1_ENST00000333691.8_Missense_Mutation_p.R59Q	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	59	Ser-rich.							p.G59D(1)									ACAGGTAAACGGAGGAGCATA	0.463																																					p.R59Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G176A	4						.	G	GLN/ARG,GLN/ARG	0,4004		0,0,2002	141.0	132.0	135.0		176,176	5.2	1.0	4		135	2,8326		0,2,4162	no	missense,missense	FAM190A	NM_001145065.1,NM_207491.2	43,43	0,2,6164	AA,AG,GG		0.024,0.0,0.0162	probably-damaging,probably-damaging	59/901,59/678	91229611	2,12330	2002	4164	6166	91448634	SO:0001583	missense	401145	exon2				CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.176G>A	4.37:g.91229611G>A	ENSP00000425040:p.Arg59Gln	Somatic		Capture	Illumina HiSeq	Phase_I	91448634	NM_001145065	Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	37	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037716	0.93630	0.0	2.4E-4	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.65364	0.28;-0.15;0.28	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.75591	0.3870	L	0.48642	1.525	0.47009	D	0.999284	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.999	T	0.77013	-0.2745	10	0.87932	D	0	-15.4609	19.5936	0.95526	0.0:0.0:1.0:0.0	.	59;59;59	Q9C0I3-2;Q9C0I3;E7EUW0	.;F190A_HUMAN;.	Q	59	ENSP00000425040:R59Q;ENSP00000389283:R59Q;ENSP00000329482:R59Q	ENSP00000329482:R59Q	R	+	2	0	FAM190A	91448634	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.125000	0.94402	2.793000	0.96121	0.655000	0.94253	CGG		CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
FNIP2	57600	broad.mit.edu	37	4	159789770	159789770	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr4:159789770G>A	ENST00000264433.6	+	13	2057	c.1982G>A	c.(1981-1983)gGc>gAc	p.G661D	FNIP2_ENST00000379346.3_Missense_Mutation_p.G684D	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	661	Interaction with PRKAA1.				intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G661D(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		CCGCAAGATGGCTCTTCAAGA	0.522																																					p.G661D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1982A	4						.						32.0	37.0	36.0					4																	159789770		1933	4137	6070	160009220	SO:0001583	missense	57600	exon13			AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.1982G>A	4.37:g.159789770G>A	ENSP00000264433:p.Gly661Asp	Somatic		Capture	Illumina HiSeq	Phase_I	160009220	NM_020840	Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	ENST00000264433.6	37	CCDS47155.1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.839657	0.32513	.	.	ENSG00000052795	ENST00000264433;ENST00000379346	T;T	0.23552	1.91;1.9	5.81	-1.03	0.10102	.	.	.	.	.	T	0.11367	0.0277	N	0.12831	0.26	0.09310	N	1	B	0.15141	0.012	B	0.13407	0.009	T	0.35574	-0.9783	8	.	.	.	.	5.6331	0.17522	0.4982:0.0:0.369:0.1328	.	661	Q9P278	FNIP2_HUMAN	D	661;684	ENSP00000264433:G661D;ENSP00000368651:G684D	.	G	+	2	0	FNIP2	160009220	.	.	0.000000	0.03702	0.003000	0.03518	.	.	-0.153000	0.11137	-0.150000	0.13652	GGC		FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	
CTNND2	1501	broad.mit.edu	37	5	11364829	11364829	+	Missense_Mutation	SNP	C	C	T	rs150121479		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr5:11364829C>T	ENST00000304623.8	-	8	1540	c.1351G>A	c.(1351-1353)Ggc>Agc	p.G451S	CTNND2_ENST00000503622.1_Missense_Mutation_p.G114S|CTNND2_ENST00000359640.2_Missense_Mutation_p.G451S|CTNND2_ENST00000458100.2_Missense_Mutation_p.G18S|CTNND2_ENST00000511377.1_Missense_Mutation_p.G360S|CTNND2_ENST00000495388.2_5'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	451					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.G451S(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						CGGTAGGTGCCGGTGTGTGCT	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		16920	0.001		0.0	False		,,,				2504	0.0				p.G451S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1351A	5						.						33.0	37.0	36.0					5																	11364829		2203	4300	6503	11417829	SO:0001583	missense	1501	exon8			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1351G>A	5.37:g.11364829C>T	ENSP00000307134:p.Gly451Ser	Somatic		Capture	Illumina HiSeq	Phase_I	11417829	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	15.41	2.826812	0.50739	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622;ENST00000502551	T;T;T;T;T	0.78003	-1.02;-1.07;-1.03;-1.14;-1.14	5.17	4.3	0.51218	.	0.691568	0.13735	N	0.366411	T	0.65396	0.2687	L	0.34521	1.04	0.32759	N	0.505382	B;B;B	0.25312	0.001;0.002;0.123	B;B;B	0.10450	0.001;0.002;0.005	T	0.65356	-0.6188	10	0.24483	T	0.36	-20.5831	10.1292	0.42669	0.0:0.8463:0.0:0.1537	.	114;18;451	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	S	451;451;360;18;114;191	ENSP00000307134:G451S;ENSP00000352661:G451S;ENSP00000426510:G360S;ENSP00000391155:G18S;ENSP00000426887:G114S	ENSP00000307134:G451S	G	-	1	0	CTNND2	11417829	0.989000	0.36119	0.999000	0.59377	0.991000	0.79684	2.599000	0.46231	1.309000	0.44985	0.655000	0.94253	GGC		CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
APC	324	broad.mit.edu	37	5	112173704	112173704	+	Nonsense_Mutation	SNP	C	C	T	rs587779783		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr5:112173704C>T	ENST00000457016.1	+	16	2793	c.2413C>T	c.(2413-2415)Cga>Tga	p.R805*	APC_ENST00000508376.2_Nonsense_Mutation_p.R805*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.R805*			P25054	APC_HUMAN	adenomatous polyposis coli	805	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R805*(10)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGACACCAATCGACATGATGA	0.373		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R787X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,right,Substitution - Nonsense,0 	.	11	Substitution - Nonsense(10)|Unknown(1)	large_intestine(10)|skin(1)	c.C2359T	5	GRCh37	CM960067	APC	M		.						77.0	78.0	78.0					5																	112173704		2202	4300	6502	112201603	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2413C>T	5.37:g.112173704C>T	ENSP00000413133:p.Arg805*	Somatic		Capture	Illumina HiSeq	Phase_I	112201603	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	36	5.853935	0.97030	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	6.16	4.36	0.52297	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-10.8016	14.7295	0.69372	0.4961:0.5038:0.0:0.0	.	.	.	.	X	805;787;805;805;805	.	ENSP00000257430:R805X	R	+	1	2	APC	112201603	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.615000	0.36922	0.896000	0.36366	-0.188000	0.12872	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
JAKMIP2	9832	broad.mit.edu	37	5	147023659	147023659	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr5:147023659C>A	ENST00000265272.5	-	7	1653	c.1186G>T	c.(1186-1188)Gtc>Ttc	p.V396F	JAKMIP2_ENST00000333010.6_Missense_Mutation_p.V354F|JAKMIP2_ENST00000507386.1_Missense_Mutation_p.V396F	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	396						Golgi apparatus (GO:0005794)		p.V396F(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTCAATGACCTGAAGTTTT	0.378																																					p.V396F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1186T	5						.						146.0	134.0	138.0					5																	147023659		2203	4300	6503	147003852	SO:0001583	missense	9832	exon7			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.1186G>T	5.37:g.147023659C>A	ENSP00000265272:p.Val396Phe	Somatic		Capture	Illumina HiSeq	Phase_I	147003852	NM_014790	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.034460	0.93575	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.35048	1.33;1.33;1.33	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.61949	0.2388	M	0.72118	2.19	0.80722	D	1	D;D;D;D	0.64830	0.994;0.994;0.994;0.994	D;D;D;D	0.73380	0.98;0.98;0.98;0.98	T	0.62992	-0.6736	10	0.66056	D	0.02	.	19.7462	0.96252	0.0:1.0:0.0:0.0	.	354;396;396;396	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	F	396;396;354;396	ENSP00000421398:V396F;ENSP00000265272:V396F;ENSP00000328989:V354F	ENSP00000265272:V396F	V	-	1	0	JAKMIP2	147003852	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.433000	0.80362	2.736000	0.93811	0.655000	0.94253	GTC		JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
MRPS36	92259	broad.mit.edu	37	5	68525036	68525036	+	Splice_Site	SNP	G	G	A	rs141558961	byFrequency	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr5:68525036G>A	ENST00000256441.4	+	4	366	c.296G>A	c.(295-297)cGt>cAt	p.R99H	MRPS36_ENST00000602380.1_Splice_Site_p.R34H|MRPS36_ENST00000512880.1_Splice_Site_p.R34H|MRPS36_ENST00000507022.1_3'UTR	NM_033281.5	NP_150597.1	P82909	RT36_HUMAN	mitochondrial ribosomal protein S36	99					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)	p.R99H(1)		NS(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(1)|urinary_tract(1)	7		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.04e-56)|Epithelial(20;8.79e-53)|all cancers(19;2.01e-48)|Lung(70;0.0176)		CCTTTTCAGCGTGGAGGTCCT	0.328																																					p.R99H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G296A	5						.	G	HIS/ARG	0,4406		0,0,2203	115.0	107.0	110.0		296	5.6	1.0	5	dbSNP_134	110	2,8598	2.2+/-6.3	0,2,4298	yes	missense-near-splice	MRPS36	NM_033281.5	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	99/104	68525036	2,13004	2203	4300	6503	68560792	SO:0001630	splice_region_variant	92259	exon4				CCDS34174.1	5q13.2	2013-09-20			ENSG00000134056	ENSG00000134056		"""Mitochondrial ribosomal proteins / small subunits"""	16631	protein-coding gene	gene with protein product		611996				11279123	Standard	NM_033281		Approved	DC47, MRP-S36	uc003jvq.3	P82909	OTTHUMG00000162443	ENST00000256441.4:c.295-1G>A	5.37:g.68525036G>A		Somatic		Capture	Illumina HiSeq	Phase_I	68560792	NM_033281	Q9H2H4	Missense_Mutation	SNP	ENST00000256441.4	37	CCDS34174.1	.	.	.	.	.	.	.	.	.	.	G	17.46	3.394280	0.62066	0.0	2.33E-4	ENSG00000134056	ENST00000256441;ENST00000512880	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	T	0.69762	0.3147	L	0.39245	1.2	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.71682	-0.4519	8	0.87932	D	0	-22.53	17.2309	0.86984	0.0:0.0:1.0:0.0	.	99	P82909	RT36_HUMAN	H	99;34	.	ENSP00000256441:R99H	R	+	2	0	MRPS36	68560792	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	5.766000	0.68843	2.667000	0.90743	0.558000	0.71614	CGT		MRPS36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368940.1	NM_033281	Missense_Mutation
LSM11	134353	broad.mit.edu	37	5	157178439	157178439	+	Missense_Mutation	SNP	C	C	T	rs141199540		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr5:157178439C>T	ENST00000286307.5	+	2	546	c.490C>T	c.(490-492)Cgt>Tgt	p.R164C		NM_173491.2	NP_775762.1	P83369	LSM11_HUMAN	LSM11, U7 small nuclear RNA associated	164					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	histone pre-mRNA 3'end processing complex (GO:0071204)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U7 snRNP (GO:0005683)	U7 snRNA binding (GO:0071209)	p.R164C(1)		breast(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	7	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCGCTGTATCCGTGAGGGGGT	0.493																																					p.R164C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C490T	5						.	C	CYS/ARG	0,4406		0,0,2203	118.0	109.0	112.0		490	4.9	1.0	5	dbSNP_134	112	1,8599	1.2+/-3.3	0,1,4299	no	missense	LSM11	NM_173491.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	164/361	157178439	1,13005	2203	4300	6503	157111017	SO:0001583	missense	134353	exon2			AK095592	CCDS4342.1	5q33.3	2008-02-05	2004-04-28		ENSG00000155858	ENSG00000155858			30860	protein-coding gene	gene with protein product			"""LSM11 homolog, U7 small nuclear RNA associated (S. cerevisiae)"""			12975319	Standard	NM_173491		Approved	FLJ38273	uc003lxe.1	P83369	OTTHUMG00000130255	ENST00000286307.5:c.490C>T	5.37:g.157178439C>T	ENSP00000286307:p.Arg164Cys	Somatic		Capture	Illumina HiSeq	Phase_I	157111017	NM_173491	A0AVQ1|Q7Z7P0|Q8N975	Missense_Mutation	SNP	ENST00000286307.5	37	CCDS4342.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.270466	0.80469	0.0	1.16E-4	ENSG00000155858	ENST00000286307	.	.	.	5.76	4.88	0.63580	Like-Sm ribonucleoprotein (LSM)-related domain (2);	0.344924	0.31872	N	0.006934	T	0.68348	0.2991	L	0.43923	1.385	0.50632	D	0.999884	D	0.89917	1.0	D	0.64506	0.926	T	0.72434	-0.4295	9	0.87932	D	0	-7.7138	16.4463	0.83935	0.1325:0.8675:0.0:0.0	.	164	P83369	LSM11_HUMAN	C	164	.	ENSP00000286307:R164C	R	+	1	0	LSM11	157111017	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.510000	0.35790	1.550000	0.49438	0.655000	0.94253	CGT		LSM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252580.2	NM_173491	
GRIK2	2898	broad.mit.edu	37	6	102134227	102134227	+	Splice_Site	SNP	C	C	T	rs118175062		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr6:102134227C>T	ENST00000421544.1	+	6	1440	c.950C>T	c.(949-951)aCg>aTg	p.T317M	GRIK2_ENST00000369138.1_Splice_Site_p.T317M|GRIK2_ENST00000369137.3_Splice_Site_p.T317M|GRIK2_ENST00000369134.4_Splice_Site_p.T268M|GRIK2_ENST00000358361.3_Splice_Site_p.T317M|GRIK2_ENST00000413795.1_Splice_Site_p.T317M|GRIK2_ENST00000318991.6_Splice_Site_p.T317M	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	317					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.T317M(2)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GGATTTATGACGGTATGAATA	0.383													C|||	1	0.000199681	0.0	0.0	5008	,	,		17401	0.0		0.001	False		,,,				2504	0.0				p.T317M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C950T	6						.	C	MET/THR,MET/THR,MET/THR	0,4406		0,0,2203	80.0	81.0	81.0		950,950,950	5.8	1.0	6	dbSNP_133	81	1,8599	1.2+/-3.3	0,1,4299	yes	missense-near-splice,missense-near-splice,missense-near-splice	GRIK2	NM_001166247.1,NM_021956.4,NM_175768.3	81,81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	317/893,317/909,317/870	102134227	1,13005	2203	4300	6503	102240920	SO:0001630	splice_region_variant	2898	exon6				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.951+1C>T	6.37:g.102134227C>T		Somatic		Capture	Illumina HiSeq	Phase_I	102240920	NM_021956	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	37	CCDS5048.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	23.1	4.370643	0.82573	0.0	1.16E-4	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000358361;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076	T;T;T;T;T;T;T	0.30448	1.92;1.92;1.92;1.53;1.92;1.92;1.92	5.84	5.84	0.93424	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.32585	0.0834	L	0.49455	1.56	0.58432	D	0.999997	D;D;D	0.62365	0.988;0.991;0.988	P;P;P	0.51453	0.634;0.67;0.634	T	0.00920	-1.1514	10	0.37606	T	0.19	.	20.1551	0.98106	0.0:1.0:0.0:0.0	.	317;317;317	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	M	317;317;317;317;317;317;317;268;279	ENSP00000397026:T317M;ENSP00000405596:T317M;ENSP00000358134:T317M;ENSP00000351128:T317M;ENSP00000358133:T317M;ENSP00000313276:T317M;ENSP00000358130:T268M	ENSP00000313276:T317M	T	+	2	0	GRIK2	102240920	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.772000	0.68889	2.760000	0.94817	0.655000	0.94253	ACG		GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		Missense_Mutation
PKIB	5570	broad.mit.edu	37	6	123039016	123039016	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr6:123039016G>A	ENST00000368448.1	+	5	704	c.77G>A	c.(76-78)cGc>cAc	p.R26H	PKIB_ENST00000368452.2_Missense_Mutation_p.R26H|PKIB_ENST00000392491.2_Missense_Mutation_p.R26H|PKIB_ENST00000258014.3_Missense_Mutation_p.R33H|PKIB_ENST00000354275.2_Missense_Mutation_p.R26H|PKIB_ENST00000392490.1_Missense_Mutation_p.R26H|PKIB_ENST00000368446.1_Missense_Mutation_p.R35H			Q9C010	IPKB_HUMAN	protein kinase (cAMP-dependent, catalytic) inhibitor beta	26		Important for inhibition. {ECO:0000250}.					cAMP-dependent protein kinase inhibitor activity (GO:0004862)	p.R26H(1)		large_intestine(3)|lung(1)	4				GBM - Glioblastoma multiforme(226;0.164)		AGGGCAGGCCGCCGGAATGCC	0.498																																					p.R26H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G77A	6						.						108.0	103.0	105.0					6																	123039016		2203	4300	6503	123080715	SO:0001583	missense	5570	exon3				CCDS5126.1, CCDS59033.1	6q21-q22.1	2008-05-27			ENSG00000135549	ENSG00000135549			9018	protein-coding gene	gene with protein product		606914		PRKACN2		10880337	Standard	NM_181795		Approved		uc003pzc.4	Q9C010	OTTHUMG00000015488	ENST00000368448.1:c.77G>A	6.37:g.123039016G>A	ENSP00000357433:p.Arg26His	Somatic		Capture	Illumina HiSeq	Phase_I	123080715	NM_032471	B2RCK2|Q567T9|Q5T0Z7	Missense_Mutation	SNP	ENST00000368448.1	37	CCDS5126.1	.	.	.	.	.	.	.	.	.	.	G	32	5.144133	0.94603	.	.	ENSG00000135549	ENST00000392491;ENST00000368452;ENST00000368448;ENST00000392490;ENST00000258014;ENST00000354275;ENST00000368446	.	.	.	5.43	5.43	0.79202	.	0.080072	0.48286	N	0.000190	T	0.81475	0.4830	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82790	-0.0283	8	0.87932	D	0	-10.3522	19.4279	0.94751	0.0:0.0:1.0:0.0	.	33;26	Q5T0Z7;Q9C010	.;IPKB_HUMAN	H	26;26;26;26;33;26;35	.	ENSP00000258014:R33H	R	+	2	0	PKIB	123080715	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.567000	0.82357	2.824000	0.97209	0.655000	0.94253	CGC		PKIB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042035.1		
PCMT1	5110	broad.mit.edu	37	6	150071059	150071059	+	Missense_Mutation	SNP	G	G	C	rs200097071		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr6:150071059G>C	ENST00000367380.5	+	1	229	c.22G>C	c.(22-24)Gcc>Ccc	p.A8P	NUP43_ENST00000463048.3_5'Flank|PCMT1_ENST00000544496.1_Missense_Mutation_p.A8P|PCMT1_ENST00000367378.1_Missense_Mutation_p.A66P|PCMT1_ENST00000367384.2_Missense_Mutation_p.A66P|PCMT1_ENST00000464889.1_Missense_Mutation_p.A66P	NM_001252049.1|NM_001252050.1|NM_001252051.1|NM_001252052.1|NM_005389.2	NP_001238978.1|NP_001238979.1|NP_001238980.1|NP_001238981.1|NP_005380.2	P22061	PIMT_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase	8					protein methylation (GO:0006479)|protein repair (GO:0030091)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		ATCCGGCGGCGCCAGCCACTC	0.647																																					p.A66P												.	.	0			c.G196C	6						.						26.0	30.0	29.0					6																	150071059		2202	4298	6500	150112752	SO:0001583	missense	5110	exon1				CCDS5219.1, CCDS5219.2, CCDS59041.1, CCDS75533.1, CCDS75534.1	6q22.3-q24	2008-02-05			ENSG00000120265	ENSG00000120265	2.1.1.77		8728	protein-coding gene	gene with protein product		176851				1478665, 10343128	Standard	NM_005389		Approved		uc003qne.3	P22061	OTTHUMG00000015794	ENST00000367380.5:c.22G>C	6.37:g.150071059G>C	ENSP00000356350:p.Ala8Pro	None		Capture	Illumina HiSeq	Phase_I	150112752	NM_005389	A8K109|J3KP72|Q14661|Q16556|Q5VYC1|Q5VYC2|Q93061|Q96II9|Q99625|Q9BQV7|Q9BQV8|Q9NP03	Missense_Mutation	SNP	ENST00000367380.5	37		.	.	.	.	.	.	.	.	.	.	G	21.2	4.111214	0.77210	.	.	ENSG00000120265	ENST00000367384;ENST00000367378;ENST00000464889;ENST00000367380;ENST00000544496	T;T;T;T;T	0.51071	0.94;0.94;0.94;0.94;0.72	5.34	4.46	0.54185	.	0.062472	0.64402	D	0.000007	T	0.50171	0.1600	L	0.60455	1.87	0.51767	D	0.999938	P;D;B;B;D;P	0.71674	0.879;0.998;0.297;0.049;0.998;0.47	P;D;B;B;D;B	0.64237	0.452;0.923;0.114;0.068;0.923;0.269	T	0.49624	-0.8920	10	0.34782	T	0.22	-8.53	13.8891	0.63726	0.0738:0.0:0.9262:0.0	.	8;66;8;66;66;8	B7Z972;F8WAX2;P22061-2;F8WAV5;F8WDT3;P22061	.;.;.;.;.;PIMT_HUMAN	P	66;66;66;8;8	ENSP00000356354:A66P;ENSP00000356348:A66P;ENSP00000420813:A66P;ENSP00000356350:A8P;ENSP00000438247:A8P	ENSP00000356348:A66P	A	+	1	0	PCMT1	150112752	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.084000	0.50143	1.230000	0.43646	0.655000	0.94253	GCC		PCMT1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
SYNE1	23345	broad.mit.edu	37	6	152708214	152708214	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr6:152708214A>C	ENST00000367255.5	-	54	9081	c.8480T>G	c.(8479-8481)gTt>gGt	p.V2827G	SYNE1_ENST00000423061.1_Missense_Mutation_p.V2834G|SYNE1_ENST00000341594.5_Missense_Mutation_p.V2866G|SYNE1_ENST00000265368.4_Missense_Mutation_p.V2827G|SYNE1_ENST00000448038.1_Missense_Mutation_p.V2834G	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2827					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.V2827G(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AACCTTGGCAACAGTCATTAT	0.343										HNSCC(10;0.0054)																											p.V2834G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T8501G	6						.						95.0	91.0	92.0					6																	152708214		2203	4300	6503	152749907	SO:0001583	missense	23345	exon54			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.8480T>G	6.37:g.152708214A>C	ENSP00000356224:p.Val2827Gly	Somatic		Capture	Illumina HiSeq	Phase_I	152749907	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	A	13.96	2.393635	0.42410	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.54675	0.65;0.66;0.56;0.66;0.77	5.82	5.82	0.92795	.	0.106801	0.41396	D	0.000890	T	0.56470	0.1987	M	0.65975	2.015	0.80722	D	1	D;B;B;B	0.71674	0.998;0.209;0.209;0.259	P;B;B;B	0.58721	0.844;0.075;0.075;0.067	T	0.54214	-0.8327	10	0.24483	T	0.36	.	16.1839	0.81934	1.0:0.0:0.0:0.0	.	2810;2827;2827;2834	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	G	2827;2834;2827;2834;2866	ENSP00000356224:V2827G;ENSP00000396024:V2834G;ENSP00000265368:V2827G;ENSP00000390975:V2834G;ENSP00000341887:V2866G	ENSP00000265368:V2827G	V	-	2	0	SYNE1	152749907	1.000000	0.71417	0.993000	0.49108	0.992000	0.81027	8.962000	0.93254	2.222000	0.72286	0.533000	0.62120	GTT		SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
AGPAT4	56895	broad.mit.edu	37	6	161574428	161574428	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr6:161574428A>G	ENST00000320285.4	-	5	826	c.614T>C	c.(613-615)tTg>tCg	p.L205S	AGPAT4_ENST00000366908.5_3'UTR|AGPAT4_ENST00000366911.5_3'UTR|AGPAT4_ENST00000457520.2_Intron	NM_020133.2	NP_064518.1	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	205					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.L205S(1)		endometrium(1)|large_intestine(10)|lung(10)|ovary(2)|skin(2)	25		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		GGTTCGTGGCAACAGGTGATG	0.602											OREG0017775	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L205S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T614C	6						.						97.0	70.0	79.0					6																	161574428		2203	4300	6503	161494418	SO:0001583	missense	56895	exon5			AF156776	CCDS5280.1	6q25.3	2013-02-05	2013-02-05		ENSG00000026652	ENSG00000026652	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20885	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, delta"""	614795	"""1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)"""				Standard	XM_005267052		Approved	LPAAT-delta, dJ473J16.2	uc003qtr.1	Q9NRZ5	OTTHUMG00000015966	ENST00000320285.4:c.614T>C	6.37:g.161574428A>G	ENSP00000314036:p.Leu205Ser	Somatic	1817	Capture	Illumina HiSeq	Phase_I	161494418	NM_020133	B4DSF9|Q5TEF0	Missense_Mutation	SNP	ENST00000320285.4	37	CCDS5280.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.861741	0.91433	.	.	ENSG00000026652	ENST00000320285	D	0.98090	-4.71	4.82	4.82	0.62117	Phospholipid/glycerol acyltransferase (2);	0.077817	0.53938	D	0.000050	D	0.97974	0.9333	M	0.86178	2.8	0.80722	D	1	D	0.54397	0.966	P	0.54431	0.752	D	0.98655	1.0681	10	0.87932	D	0	-12.4365	14.5952	0.68400	1.0:0.0:0.0:0.0	.	205	Q9NRZ5	PLCD_HUMAN	S	205	ENSP00000314036:L205S	ENSP00000314036:L205S	L	-	2	0	AGPAT4	161494418	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.955000	0.93058	2.043000	0.60533	0.454000	0.30748	TTG		AGPAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042983.1	NM_020133	
T	6862	broad.mit.edu	37	6	166580961	166580961	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr6:166580961C>T	ENST00000296946.2	-	2	587	c.119G>A	c.(118-120)cGc>cAc	p.R40H	T_ENST00000366871.3_Missense_Mutation_p.R40H	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)	40					anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R40H(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		GCGCAGTTCGCGCTCTGTGGG	0.652									Chordoma, Familial Clustering of																												p.R40H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G119A	6						.						48.0	40.0	42.0					6																	166580961		2203	4300	6503	166500951	SO:0001583	missense	6862	exon2	Familial Cancer Database		AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.119G>A	6.37:g.166580961C>T	ENSP00000296946:p.Arg40His	Somatic		Capture	Illumina HiSeq	Phase_I	166500951	NM_003181	E7ERD6|Q4KMP4	Missense_Mutation	SNP	ENST00000296946.2	37	CCDS5290.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.079831	0.76528	.	.	ENSG00000164458	ENST00000366876;ENST00000296946;ENST00000366871	D;D;D	0.83837	-1.76;-1.77;-1.73	3.63	3.63	0.41609	.	0.152222	0.36374	N	0.002633	T	0.75796	0.3898	L	0.54323	1.7	0.49389	D	0.999788	P;D;P	0.54601	0.941;0.967;0.941	P;P;P	0.49361	0.485;0.608;0.608	T	0.78593	-0.2144	10	0.59425	D	0.04	.	8.6908	0.34264	0.0:0.891:0.0:0.109	.	40;40;40	E7ERD6;O15178;Q4KMP4	.;BRAC_HUMAN;.	H	40	ENSP00000355841:R40H;ENSP00000296946:R40H;ENSP00000355836:R40H	ENSP00000296946:R40H	R	-	2	0	T	166500951	0.347000	0.24853	1.000000	0.80357	0.844000	0.47949	0.672000	0.25187	1.739000	0.51704	0.491000	0.48974	CGC		T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043037.2	NM_003181	
CUL9	23113	broad.mit.edu	37	6	43190322	43190322	+	Silent	SNP	G	G	A	rs150159860		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr6:43190322G>A	ENST00000252050.4	+	37	7059	c.6975G>A	c.(6973-6975)ccG>ccA	p.P2325P	CUL9_ENST00000372647.2_Silent_p.P2297P|CUL9_ENST00000354495.3_Silent_p.P2215P|RP3-330M21.5_ENST00000500590.1_RNA	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	2325					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)	p.P2325P(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						AAGTGCCCCCGCCCAGATCCT	0.612																																					p.P2325P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G6975A	6						.	G		2,4404	4.2+/-10.8	0,2,2201	61.0	59.0	60.0		6975	-6.0	0.9	6	dbSNP_134	60	0,8600		0,0,4300	no	coding-synonymous	CUL9	NM_015089.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		2325/2518	43190322	2,13004	2203	4300	6503	43298300	SO:0001819	synonymous_variant	23113	exon37			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.6975G>A	6.37:g.43190322G>A		Somatic		Capture	Illumina HiSeq	Phase_I	43298300	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	37	CCDS4890.1																																																																																				CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
DST	667	broad.mit.edu	37	6	56392378	56392378	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr6:56392378C>T	ENST00000361203.3	-	63	16882	c.16875G>A	c.(16873-16875)tgG>tgA	p.W5625*	DST_ENST00000312431.6_3'UTR|DST_ENST00000340834.4_5'UTR|DST_ENST00000421834.2_Nonsense_Mutation_p.W3648*|DST_ENST00000244364.6_Nonsense_Mutation_p.W3322*|DST_ENST00000370788.2_Nonsense_Mutation_p.W3539*|DST_ENST00000370754.5_Nonsense_Mutation_p.W5914*|DST_ENST00000370769.4_Nonsense_Mutation_p.W5736*|DST_ENST00000446842.2_Nonsense_Mutation_p.W5410*			Q03001	DYST_HUMAN	dystonin	5625					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.W5736*(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTTTGTCCAGCCAGGTACACA	0.478																																					p.W3322X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G9966A	6						.						127.0	118.0	120.0					6																	56392378		1963	4155	6118	56500337	SO:0001587	stop_gained	667	exon49			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.16875G>A	6.37:g.56392378C>T	ENSP00000354508:p.Trp5625*	Somatic		Capture	Illumina HiSeq	Phase_I	56500337	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Nonsense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	C	56	26.889732	0.99970	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	.	.	.	5.62	5.62	0.85841	.	0.000000	0.49305	D	0.000156	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.6632	0.95882	0.0:1.0:0.0:0.0	.	.	.	.	X	3322;5914;5736;3648;5410;3539;5625	.	ENSP00000244364:W3322X	W	-	3	0	DST	56500337	1.000000	0.71417	1.000000	0.80357	0.304000	0.27724	7.818000	0.86416	2.625000	0.88918	0.655000	0.94253	TGG		DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
THBS2	7058	broad.mit.edu	37	6	169640559	169640559	+	Silent	SNP	C	C	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr6:169640559C>A	ENST00000366787.3	-	7	1269	c.1020G>T	c.(1018-1020)acG>acT	p.T340T	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	340	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.T340T(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		TGCAGGTACACGTGGTGCAGC	0.572																																					p.T340T	Esophageal Squamous(91;219 1934 18562 44706)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1020T	6						.						99.0	92.0	95.0					6																	169640559		2203	4300	6503	169382484	SO:0001819	synonymous_variant	7058	exon7				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.1020G>T	6.37:g.169640559C>A		Somatic		Capture	Illumina HiSeq	Phase_I	169382484	NM_003247	A6H8N1|A7E232|Q5RI52	Silent	SNP	ENST00000366787.3	37	CCDS34574.1																																																																																				THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
FOXK1	221937	broad.mit.edu	37	7	4801940	4801940	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr7:4801940A>C	ENST00000328914.4	+	9	2047	c.2047A>C	c.(2047-2049)Acc>Ccc	p.T683P	FOXK1_ENST00000446823.1_Missense_Mutation_p.T520P	NM_001037165.1	NP_001032242.1			forkhead box K1									p.T683P(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		ggccaccaccaccccagccac	0.697																																					p.T683P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2047C	7						.						18.0	16.0	17.0					7																	4801940		1969	3817	5786	4768466	SO:0001583	missense	221937	exon9			BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.2047A>C	7.37:g.4801940A>C	ENSP00000328720:p.Thr683Pro	Somatic		Capture	Illumina HiSeq	Phase_I	4768466	NM_001037165		Missense_Mutation	SNP	ENST00000328914.4	37	CCDS34591.1	.	.	.	.	.	.	.	.	.	.	a	8.689	0.907046	0.17833	.	.	ENSG00000164916	ENST00000446823;ENST00000450194;ENST00000328914	D;D	0.95853	-3.4;-3.83	2.47	0.0854	0.14441	.	0.758588	0.11304	N	0.577941	D	0.87136	0.6102	N	0.22421	0.69	0.09310	N	1	P;B	0.36733	0.567;0.434	B;B	0.31869	0.137;0.067	T	0.78417	-0.2212	10	0.20519	T	0.43	.	4.2812	0.10833	0.629:0.0:0.371:0.0	.	683;520	P85037;P85037-2	FOXK1_HUMAN;.	P	520;439;683	ENSP00000394442:T520P;ENSP00000328720:T683P	ENSP00000328720:T683P	T	+	1	0	FOXK1	4768466	0.005000	0.15991	0.018000	0.16275	0.611000	0.37282	-0.420000	0.07062	0.021000	0.15133	0.454000	0.30748	ACC		FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2		
HDAC9	9734	broad.mit.edu	37	7	18875163	18875163	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr7:18875163G>A	ENST00000432645.2	+	19	2531	c.2531G>A	c.(2530-2532)cGc>cAc	p.R844H	HDAC9_ENST00000401921.1_Missense_Mutation_p.R803H|HDAC9_ENST00000441542.2_Missense_Mutation_p.R847H|HDAC9_ENST00000406451.4_Missense_Mutation_p.R844H	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	844	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.R847H(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	TCACTCCATCGCTATGATGAA	0.453																																					p.R844H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2531A	7						.						71.0	71.0	71.0					7																	18875163		2095	4267	6362	18841688	SO:0001583	missense	9734	exon20			AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.2531G>A	7.37:g.18875163G>A	ENSP00000410337:p.Arg844His	Somatic		Capture	Illumina HiSeq	Phase_I	18841688	NM_178423	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337003	0.81801	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58	5.81	5.81	0.92471	Histone deacetylase domain (2);	0.000000	0.64402	D	0.000012	D	0.90140	0.6919	H	0.96805	3.885	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.994;0.999;0.954;0.954;0.951;0.954	D	0.92828	0.6278	10	0.87932	D	0	-38.4246	19.0503	0.93041	0.0:0.0:1.0:0.0	.	844;92;803;847;844;844	Q9UKV0-4;Q8N926;Q9UKV0-6;Q9UKV0-7;Q9UKV0;Q9UKV0-5	.;.;.;.;HDAC9_HUMAN;.	H	844;803;844;847;756	ENSP00000384657:R844H;ENSP00000383912:R803H;ENSP00000410337:R844H;ENSP00000408617:R847H	ENSP00000339165:R756H	R	+	2	0	HDAC9	18841688	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.884000	0.87274	2.750000	0.94351	0.655000	0.94253	CGC		HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
INHBA	3624	broad.mit.edu	37	7	41729886	41729886	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr7:41729886T>C	ENST00000242208.4	-	3	889	c.643A>G	c.(643-645)Aag>Gag	p.K215E	INHBA_ENST00000442711.1_Missense_Mutation_p.K215E|INHBA_ENST00000464515.1_5'UTR|AC005027.3_ENST00000416150.1_RNA	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	215					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.K215E(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CAGGTGCTCTTCCGAGCGTCT	0.592										TSP Lung(11;0.080)																											p.K215E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A643G	7						.						64.0	59.0	60.0					7																	41729886		2203	4300	6503	41696411	SO:0001583	missense	3624	exon3				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.643A>G	7.37:g.41729886T>C	ENSP00000242208:p.Lys215Glu	Somatic		Capture	Illumina HiSeq	Phase_I	41696411	NM_002192	Q14599	Missense_Mutation	SNP	ENST00000242208.4	37	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	.	17.29	3.351742	0.61183	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.62105	0.05;0.05	6.06	6.06	0.98353	Transforming growth factor-beta, N-terminal (1);	0.105878	0.64402	N	0.000005	T	0.54647	0.1871	N	0.25647	0.755	0.52501	D	0.999954	P	0.45768	0.866	P	0.48873	0.593	T	0.52946	-0.8507	10	0.02654	T	1	-26.6365	16.6093	0.84858	0.0:0.0:0.0:1.0	.	215	P08476	INHBA_HUMAN	E	215	ENSP00000242208:K215E;ENSP00000397197:K215E	ENSP00000242208:K215E	K	-	1	0	INHBA	41696411	1.000000	0.71417	0.990000	0.47175	0.997000	0.91878	5.391000	0.66266	2.324000	0.78689	0.533000	0.62120	AAG		INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1		
CHCHD2	51142	broad.mit.edu	37	7	56169552	56169552	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr7:56169552A>C	ENST00000395422.3	-	4	610	c.448T>G	c.(448-450)Ttg>Gtg	p.L150V	snoU13_ENST00000458988.1_RNA	NM_016139.2	NP_057223.1	Q9Y6H1	CHCH2_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 2	150						mitochondrion (GO:0005739)		p.L150V(1)		endometrium(1)|large_intestine(1)|lung(3)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CATTAGGCCAATCCTGCAAAC	0.353																																					p.L150V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T448G	7						.						89.0	91.0	90.0					7																	56169552		2203	4300	6503	56137046	SO:0001583	missense	51142	exon4			AF078845	CCDS5526.1	7p11.2	2014-07-14	2004-01-19	2004-01-21	ENSG00000106153	ENSG00000106153		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	21645	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 17"""	C7orf17		23303788	Standard	NM_016139		Approved		uc003tsa.3	Q9Y6H1	OTTHUMG00000129429	ENST00000395422.3:c.448T>G	7.37:g.56169552A>C	ENSP00000378812:p.Leu150Val	Somatic		Capture	Illumina HiSeq	Phase_I	56137046	NM_016139	Q498C3|Q6NZ50	Missense_Mutation	SNP	ENST00000395422.3	37	CCDS5526.1	.	.	.	.	.	.	.	.	.	.	A	6.595	0.478103	0.12521	.	.	ENSG00000106153	ENST00000395422	T	0.50001	0.76	4.19	3.02	0.34903	.	0.891913	0.09471	N	0.797671	T	0.39708	0.1088	L	0.50919	1.6	0.51012	D	0.999904	P	0.36438	0.553	B	0.34242	0.178	T	0.17837	-1.0356	10	0.42905	T	0.14	.	6.3171	0.21196	0.886:0.0:0.114:0.0	.	150	Q9Y6H1	CHCH2_HUMAN	V	150	ENSP00000378812:L150V	ENSP00000378812:L150V	L	-	1	2	CHCHD2	56137046	0.795000	0.28851	0.373000	0.26003	0.077000	0.17291	1.435000	0.34969	0.762000	0.33152	0.455000	0.32223	TTG		CHCHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251589.1	NM_016139	
GTF2IRD1	9569	broad.mit.edu	37	7	73944220	73944220	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr7:73944220G>A	ENST00000265755.3	+	9	1640	c.1247G>A	c.(1246-1248)cGc>cAc	p.R416H	GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.R416H|GTF2IRD1_ENST00000489094.1_3'UTR|GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.R416H|GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.R448H	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	416					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R416H(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CTGGAGGAGCGCCATAGTATC	0.607																																					p.R416H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1247A	7						.						40.0	41.0	41.0					7																	73944220		2203	4300	6503	73582156	SO:0001583	missense	9569	exon9			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.1247G>A	7.37:g.73944220G>A	ENSP00000265755:p.Arg416His	Somatic		Capture	Illumina HiSeq	Phase_I	73582156	NM_005685	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	ENST00000265755.3	37	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	g	20.4	3.976174	0.74360	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.61489	0.2351	L	0.59436	1.845	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.995;1.0;0.995	D;P;D;D	0.91635	0.999;0.836;0.978;0.919	T	0.65672	-0.6111	10	0.72032	D	0.01	-13.5246	16.6134	0.84900	0.0:0.0:1.0:0.0	.	448;416;416;416	Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2	.;.;GT2D1_HUMAN;.	H	416;448;416;416	ENSP00000265755:R416H;ENSP00000397566:R448H;ENSP00000408477:R416H;ENSP00000418383:R416H	ENSP00000265755:R416H	R	+	2	0	GTF2IRD1	73582156	1.000000	0.71417	0.906000	0.35671	0.199000	0.23934	7.246000	0.78247	2.250000	0.74265	0.457000	0.33378	CGC		GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328	
PCLO	27445	broad.mit.edu	37	7	82784522	82784522	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr7:82784522G>A	ENST00000333891.9	-	2	1772	c.1435C>T	c.(1435-1437)Ccc>Tcc	p.P479S	PCLO_ENST00000423517.2_Missense_Mutation_p.P479S	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.P479S(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGAGGTGGGGGCTTTGCTGGG	0.602																																					p.P479S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1435T	7						.						64.0	73.0	70.0					7																	82784522		1971	4142	6113	82622458	SO:0001583	missense	27445	exon2			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.1435C>T	7.37:g.82784522G>A	ENSP00000334319:p.Pro479Ser	Somatic		Capture	Illumina HiSeq	Phase_I	82622458	NM_033026		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	0.827	-0.746432	0.03065	.	.	ENSG00000186472	ENST00000333891;ENST00000423517	T;T	0.17213	2.29;2.29	4.09	-1.65	0.08291	.	.	.	.	.	T	0.11110	0.0271	L	0.32530	0.975	0.09310	N	1	B;B	0.26809	0.16;0.16	B;B	0.25291	0.059;0.059	T	0.28870	-1.0030	9	0.87932	D	0	.	4.2866	0.10858	0.0701:0.2223:0.2563:0.4513	.	479;479	Q9Y6V0-5;Q9Y6V0-6	.;.	S	479	ENSP00000334319:P479S;ENSP00000388393:P479S	ENSP00000334319:P479S	P	-	1	0	PCLO	82622458	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.647000	0.05397	-0.654000	0.05394	-1.591000	0.00844	CCC		PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
ASNS	440	broad.mit.edu	37	7	97488566	97488566	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr7:97488566G>A	ENST00000394309.3	-	5	1103	c.632C>T	c.(631-633)cCc>cTc	p.P211L	ASNS_ENST00000444334.1_Missense_Mutation_p.P190L|ASNS_ENST00000394308.3_Missense_Mutation_p.P211L|ASNS_ENST00000437628.1_Missense_Mutation_p.P128L|ASNS_ENST00000455086.1_Missense_Mutation_p.P128L|ASNS_ENST00000175506.4_Missense_Mutation_p.P211L|ASNS_ENST00000422745.1_Missense_Mutation_p.P190L	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	211					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)	p.P211L(1)		ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	GGCGTGCAGGGGTACATCCCG	0.443																																					p.P211L	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C632T	7						.						104.0	107.0	106.0					7																	97488566		2203	4300	6503	97326502	SO:0001583	missense	440	exon6			M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.632C>T	7.37:g.97488566G>A	ENSP00000377846:p.Pro211Leu	Somatic		Capture	Illumina HiSeq	Phase_I	97326502	NM_183356	A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Missense_Mutation	SNP	ENST00000394309.3	37	CCDS5652.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.103082	0.56183	.	.	ENSG00000070669	ENST00000175506;ENST00000394309;ENST00000437628;ENST00000394308;ENST00000422745;ENST00000455086;ENST00000444334;ENST00000442734	T;T;T;T;T;T;T;T	0.51071	0.82;0.82;0.81;0.82;0.83;0.81;0.83;0.72	4.29	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.55130	0.1901	L	0.34521	1.04	0.80722	D	1	D	0.71674	0.998	D	0.63597	0.916	T	0.59690	-0.7407	10	0.66056	D	0.02	-2.2981	14.6189	0.68569	0.0:0.0:1.0:0.0	.	211	P08243	ASNS_HUMAN	L	211;211;128;211;190;128;190;211	ENSP00000175506:P211L;ENSP00000377846:P211L;ENSP00000414379:P128L;ENSP00000377845:P211L;ENSP00000414901:P190L;ENSP00000408472:P128L;ENSP00000406994:P190L;ENSP00000400422:P211L	ENSP00000175506:P211L	P	-	2	0	ASNS	97326502	1.000000	0.71417	0.828000	0.32881	0.013000	0.08279	8.831000	0.92068	2.126000	0.65437	0.655000	0.94253	CCC		ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356	
STAG3	10734	broad.mit.edu	37	7	99780412	99780412	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr7:99780412C>A	ENST00000426455.1	+	4	693	c.286C>A	c.(286-288)Cca>Aca	p.P96T	STAG3_ENST00000394018.2_Missense_Mutation_p.P96T|STAG3_ENST00000317296.5_Missense_Mutation_p.P96T	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	96					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)		p.P96T(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTCAGAGCCACCAGCCAATGA	0.423																																					p.P96T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C286A	7						.						209.0	215.0	213.0					7																	99780412		2203	4300	6503	99618348	SO:0001583	missense	10734	exon4			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.286C>A	7.37:g.99780412C>A	ENSP00000400359:p.Pro96Thr	Somatic		Capture	Illumina HiSeq	Phase_I	99618348	NM_012447	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Missense_Mutation	SNP	ENST00000426455.1	37	CCDS34703.1	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639865	0.29157	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000416412;ENST00000339784;ENST00000317296;ENST00000422690;ENST00000439782	T;T;T	0.26518	1.99;1.73;1.99	5.32	1.44	0.22558	.	0.163302	0.29266	N	0.012649	T	0.18593	0.0446	L	0.49126	1.545	0.09310	N	1	B;B	0.26935	0.164;0.006	B;B	0.19946	0.027;0.005	T	0.16100	-1.0414	10	0.54805	T	0.06	0.0074	4.4459	0.11597	0.1471:0.532:0.0:0.3209	.	96;96	B4DZ10;Q9UJ98	.;STAG3_HUMAN	T	96	ENSP00000400359:P96T;ENSP00000377586:P96T;ENSP00000319318:P96T	ENSP00000319318:P96T	P	+	1	0	STAG3	99618348	0.001000	0.12720	0.757000	0.31301	0.855000	0.48748	0.358000	0.20216	0.381000	0.24851	-0.225000	0.12378	CCA		STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447	
OR2A14	135941	broad.mit.edu	37	7	143827100	143827100	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr7:143827100G>A	ENST00000408899.2	+	1	950	c.895G>A	c.(895-897)Gcc>Acc	p.A299T		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A299T(1)		large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					GGTCAAGGGCGCCCTGAGGAG	0.512																																					p.A299T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G895A	7						.						115.0	119.0	117.0					7																	143827100		1911	4119	6030	143458033	SO:0001583	missense	135941	exon1				CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.895G>A	7.37:g.143827100G>A	ENSP00000386137:p.Ala299Thr	Somatic		Capture	Illumina HiSeq	Phase_I	143458033	NM_001001659	Q6IF41|Q8NGT8	Missense_Mutation	SNP	ENST00000408899.2	37	CCDS43672.1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.190108	0.38707	.	.	ENSG00000221938	ENST00000408899	T	0.42131	0.98	4.18	4.18	0.49190	.	0.000000	0.32314	U	0.006271	T	0.43590	0.1254	M	0.63208	1.945	0.33823	D	0.629223	D	0.59767	0.986	P	0.44946	0.465	T	0.64300	-0.6440	10	0.66056	D	0.02	-10.5544	12.1908	0.54270	0.0:0.0:1.0:0.0	.	299	Q96R47	O2A14_HUMAN	T	299	ENSP00000386137:A299T	ENSP00000386137:A299T	A	+	1	0	OR2A14	143458033	0.367000	0.25023	0.441000	0.26858	0.009000	0.06853	1.078000	0.30754	2.303000	0.77524	0.561000	0.74099	GCC		OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1		
ZNF517	340385	broad.mit.edu	37	8	146032684	146032685	+	Frame_Shift_Ins	INS	-	-	G	rs113318407	byFrequency	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr8:146032684_146032685insG	ENST00000531720.1	+	4	428_429	c.383_384insG	c.(382-387)gtggggfs	p.VG128fs	ZNF517_ENST00000359971.3_Frame_Shift_Ins_p.VG128fs|ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000525105.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	128					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H131fs*12(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GGGCACCCTGTGGGGGGGCACC	0.698																																					p.V128fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.383_384insG	8						.																																			146003489	SO:0001589	frameshift_variant	340385	exon5			AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.390dupG	8.37:g.146032691_146032691dupG	ENSP00000436103:p.Val128fs	Somatic		Capture	Illumina HiSeq	Phase_I	146003488	NM_213605		Frame_Shift_Ins	INS	ENST00000531720.1	37	CCDS6434.1																																																																																				ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
USP17L2	377630	broad.mit.edu	37	8	11994864	11994864	+	Nonsense_Mutation	SNP	G	G	T	rs201297814		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr8:11994864G>T	ENST00000333796.3	-	1	1722	c.1406C>A	c.(1405-1407)tCg>tAg	p.S469*	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	469	Mediates interaction with SUDS3.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.S469*(1)		central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						CTTGTATTTCGATTGATGAAT	0.478																																					p.S469X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1406A	8						.						57.0	62.0	60.0					8																	11994864		1360	2948	4308	12032273	SO:0001587	stop_gained	377630	exon1			BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.1406C>A	8.37:g.11994864G>T	ENSP00000333329:p.Ser469*	Somatic		Capture	Illumina HiSeq	Phase_I	12032273	NM_201402		Nonsense_Mutation	SNP	ENST00000333796.3	37	CCDS43713.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.001732	0.74932	.	.	ENSG00000223443	ENST00000333796	.	.	.	0.745	-0.386	0.12466	.	0.695495	0.11311	U	0.577127	.	.	.	.	.	.	0.52501	D	0.999955	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.5857	0.07970	0.315:0.0:0.685:0.0	.	.	.	.	X	469	.	ENSP00000333329:S469X	S	-	2	0	USP17L2	12032273	0.025000	0.19082	0.001000	0.08648	0.005000	0.04900	-0.013000	0.12678	-0.140000	0.11394	-0.576000	0.04144	TCG		USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383303.2	NM_201402	
TMEM74	157753	broad.mit.edu	37	8	109796954	109796954	+	Missense_Mutation	SNP	C	C	T	rs372486464		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr8:109796954C>T	ENST00000297459.3	-	2	552	c.374G>A	c.(373-375)cGg>cAg	p.R125Q	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	125					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.R125Q(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			TGGCGAGCTCCGGTTCCGCTG	0.473																																					p.R125Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G374A	8						.	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	79.0	82.0	81.0		374	-3.8	0.0	8		81	0,8600		0,0,4300	no	missense	TMEM74	NM_153015.1	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	125/306	109796954	1,13005	2203	4300	6503	109866130	SO:0001583	missense	157753	exon2			AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.374G>A	8.37:g.109796954C>T	ENSP00000297459:p.Arg125Gln	Somatic		Capture	Illumina HiSeq	Phase_I	109866130	NM_153015		Missense_Mutation	SNP	ENST00000297459.3	37	CCDS6310.1	.	.	.	.	.	.	.	.	.	.	C	0.993	-0.693283	0.03303	2.27E-4	0.0	ENSG00000164841	ENST00000297459	.	.	.	5.81	-3.81	0.04294	.	0.569350	0.18161	N	0.149795	T	0.13243	0.0321	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24905	-1.0147	9	0.15952	T	0.53	-0.0133	7.5214	0.27631	0.1103:0.3532:0.0:0.5365	.	125	Q96NL1	TMM74_HUMAN	Q	125	.	ENSP00000297459:R125Q	R	-	2	0	TMEM74	109866130	0.000000	0.05858	0.004000	0.12327	0.055000	0.15305	-1.216000	0.02982	-0.935000	0.03728	-0.137000	0.14449	CGG		TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380755.1	NM_153015	
CSMD1	64478	broad.mit.edu	37	8	2813222	2813222	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr8:2813222C>T	ENST00000520002.1	-	65	10441	c.9886G>A	c.(9886-9888)Ggc>Agc	p.G3296S	CSMD1_ENST00000400186.3_Missense_Mutation_p.G3119S|CSMD1_ENST00000542608.1_Missense_Mutation_p.G3118S|CSMD1_ENST00000537824.1_Missense_Mutation_p.G3295S|CSMD1_ENST00000602723.1_Missense_Mutation_p.G3119S|CSMD1_ENST00000602557.1_Missense_Mutation_p.G3296S			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3296	Sushi 28. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.G3024S(1)|p.G3295S(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AAGGTGTAGCCGAAAGTAGGA	0.507																																					p.R3295Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G9884A	8						.						157.0	151.0	153.0					8																	2813222		1969	4165	6134	2800629	SO:0001583	missense	64478	exon64					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9886G>A	8.37:g.2813222C>T	ENSP00000430733:p.Gly3296Ser	Somatic		Capture	Illumina HiSeq	Phase_I	2800629	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.9|26.9	4.781098|4.781098	0.90282|0.90282	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	T;T;T;T|.	0.72394|.	-0.65;-0.65;-0.65;-0.65|.	5.64|5.64	5.64|5.64	0.86602|0.86602	Complement control module (2);Sushi/SCR/CCP (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84279|0.84279	0.5437|0.5437	M|M	0.87758|0.87758	2.905|2.905	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;0.999;1.0|.	D|D	0.85588|0.85588	0.1244|0.1244	10|5	0.56958|.	D|.	0.05|.	.|.	19.7147|19.7147	0.96110|0.96110	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	3296;3296;3118|.	E5RIG2;Q96PZ7;F5H2I8|.	.;CSMD1_HUMAN;.|.	S|Q	3119;3296;3157;3295;3118|2712	ENSP00000383047:G3119S;ENSP00000430733:G3296S;ENSP00000441462:G3295S;ENSP00000446243:G3118S|.	ENSP00000320445:G3157S|.	G|R	-|-	1|2	0|0	CSMD1|CSMD1	2800629|2800629	1.000000|1.000000	0.71417|0.71417	0.804000|0.804000	0.32291|0.32291	0.510000|0.510000	0.34073|0.34073	7.642000|7.642000	0.83385|0.83385	2.656000|2.656000	0.90262|0.90262	0.460000|0.460000	0.39030|0.39030	GGC|CGG		CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CSMD1	64478	broad.mit.edu	37	8	3855604	3855604	+	Silent	SNP	G	G	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr8:3855604G>A	ENST00000520002.1	-	5	1194	c.639C>T	c.(637-639)cgC>cgT	p.R213R	CSMD1_ENST00000539096.1_Silent_p.R213R|CSMD1_ENST00000400186.3_Silent_p.R213R|CSMD1_ENST00000542608.1_Silent_p.R213R|CSMD1_ENST00000537824.1_Silent_p.R213R|CSMD1_ENST00000602723.1_Silent_p.R213R|CSMD1_ENST00000602557.1_Silent_p.R213R			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	213	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.R213R(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGCTGGTCCCGCGTAAGGTTC	0.567																																					p.R213R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C639T	8						.						32.0	34.0	33.0					8																	3855604		2083	4252	6335	3843012	SO:0001819	synonymous_variant	64478	exon5					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.639C>T	8.37:g.3855604G>A		Somatic		Capture	Illumina HiSeq	Phase_I	3843012	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37																																																																																					CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
TNKS	8658	broad.mit.edu	37	8	9588473	9588473	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr8:9588473C>T	ENST00000310430.6	+	14	2101	c.2075C>T	c.(2074-2076)gCa>gTa	p.A692V	TNKS_ENST00000518281.1_Missense_Mutation_p.A455V	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	692					mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)	p.A692V(2)		NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		CACTTCGCAGCAGGCTACAAC	0.502																																					p.A692V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2075T	8						.						121.0	103.0	109.0					8																	9588473		2203	4300	6503	9625883	SO:0001583	missense	8658	exon14			AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.2075C>T	8.37:g.9588473C>T	ENSP00000311579:p.Ala692Val	Somatic		Capture	Illumina HiSeq	Phase_I	9625883	NM_003747	O95272|Q4G0F2	Missense_Mutation	SNP	ENST00000310430.6	37	CCDS5974.1	.	.	.	.	.	.	.	.	.	.	C	36	5.748185	0.96882	.	.	ENSG00000173273	ENST00000310430;ENST00000518281	T;T	0.70516	-0.49;-0.49	5.76	5.76	0.90799	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.77308	0.4111	L	0.45285	1.41	0.80722	D	1	D	0.61080	0.989	P	0.55824	0.785	T	0.78705	-0.2100	10	0.87932	D	0	.	19.9738	0.97296	0.0:1.0:0.0:0.0	.	692	O95271	TNKS1_HUMAN	V	692;455	ENSP00000311579:A692V;ENSP00000429890:A455V	ENSP00000311579:A692V	A	+	2	0	TNKS	9625883	1.000000	0.71417	0.995000	0.50966	0.580000	0.36256	7.818000	0.86416	2.732000	0.93576	0.655000	0.94253	GCA		TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	NM_003747	
C8orf86	389649	broad.mit.edu	37	8	38370080	38370080	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr8:38370080C>T	ENST00000358138.1	-	3	521	c.497G>A	c.(496-498)aGt>aAt	p.S166N	C8orf86_ENST00000437935.2_Silent_p.Q108Q	NM_207412.1	NP_997295.1	Q6ZUL3	CH086_HUMAN	chromosome 8 open reading frame 86	166								p.S166N(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						gcagagaggactgcggaggct	0.537																																					p.S166N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G497A	8						.						76.0	78.0	77.0					8																	38370080		2203	4300	6503	38489237	SO:0001583	missense	389649	exon3			BC137511	CCDS6108.1	8p12-p11.23	2009-03-03			ENSG00000196166	ENSG00000196166			33774	protein-coding gene	gene with protein product							Standard	NM_207412		Approved	FLJ43582	uc003xlx.1	Q6ZUL3	OTTHUMG00000163992	ENST00000358138.1:c.497G>A	8.37:g.38370080C>T	ENSP00000350856:p.Ser166Asn	Somatic		Capture	Illumina HiSeq	Phase_I	38489237	NM_207412	A4QPB7	Missense_Mutation	SNP	ENST00000358138.1	37	CCDS6108.1	.	.	.	.	.	.	.	.	.	.	C	6.024	0.372809	0.11409	.	.	ENSG00000196166	ENST00000358138	T	0.54675	0.56	2.82	-3.09	0.05331	.	.	.	.	.	T	0.24314	0.0589	N	0.08118	0	0.09310	N	1	B	0.26195	0.144	B	0.21546	0.035	T	0.14309	-1.0477	9	0.87932	D	0	.	0.9606	0.01395	0.169:0.2634:0.3334:0.2342	.	166	Q6ZUL3	CH086_HUMAN	N	166	ENSP00000350856:S166N	ENSP00000350856:S166N	S	-	2	0	C8orf86	38489237	0.000000	0.05858	0.000000	0.03702	0.096000	0.18686	-0.790000	0.04604	-0.808000	0.04387	0.561000	0.74099	AGT		C8orf86-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376668.1	NM_207412	
CYP7A1	1581	broad.mit.edu	37	8	59410903	59410903	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr8:59410903C>T	ENST00000301645.3	-	2	343	c.206G>A	c.(205-207)tGc>tAc	p.C69Y		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	69					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.C69Y(1)		breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				CATTAGTTTGCAGGTAAAAAC	0.378									Neonatal Giant Cell Hepatitis																												p.C69Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G206A	8						.						144.0	144.0	144.0					8																	59410903		2203	4300	6503	59573457	SO:0001583	missense	1581	exon2	Familial Cancer Database	Neonatal Hemochromatosis	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.206G>A	8.37:g.59410903C>T	ENSP00000301645:p.Cys69Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	59573457	NM_000780	P78454|Q3MIL8|Q7KZ19	Missense_Mutation	SNP	ENST00000301645.3	37	CCDS6171.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.783247	0.90282	.	.	ENSG00000167910	ENST00000301645	T	0.68331	-0.32	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.82692	0.5092	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.83196	-0.0081	10	0.72032	D	0.01	-19.8961	20.2704	0.98474	0.0:1.0:0.0:0.0	.	69	P22680	CP7A1_HUMAN	Y	69	ENSP00000301645:C69Y	ENSP00000301645:C69Y	C	-	2	0	CYP7A1	59573457	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.818000	0.86416	2.793000	0.96121	0.591000	0.81541	TGC		CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378190.1	NM_000780	
ZNF34	80778	broad.mit.edu	37	8	145999391	145999391	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr8:145999391T>C	ENST00000343459.4	-	6	1008	c.943A>G	c.(943-945)Aca>Gca	p.T315A	ZNF34_ENST00000429371.2_Missense_Mutation_p.T294A			Q8IZ26	ZNF34_HUMAN	zinc finger protein 34	315					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.T315A(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)		CGGGTGAATGTCTTCCCACAC	0.547																																					p.T315A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A943G	8						.						43.0	47.0	46.0					8																	145999391		2179	4286	6465	145970195	SO:0001583	missense	80778	exon6			BC028136	CCDS47945.1, CCDS69562.1	8q24	2013-01-08	2006-05-11					"""Zinc fingers, C2H2-type"", ""-"""	13098	protein-coding gene	gene with protein product		194526	"""zinc finger protein 34 (KOX 32)"""			8104631, 2014798	Standard	XM_005272349		Approved	KOX32	uc003zdy.4	Q8IZ26		ENST00000343459.4:c.943A>G	8.37:g.145999391T>C	ENSP00000341528:p.Thr315Ala	Somatic		Capture	Illumina HiSeq	Phase_I	145970195	NM_030580	D3DWN1|Q9BSZ0	Missense_Mutation	SNP	ENST00000343459.4	37	CCDS47945.1	.	.	.	.	.	.	.	.	.	.	T	0.010	-1.751714	0.00663	.	.	ENSG00000196378	ENST00000449516;ENST00000527190;ENST00000343459;ENST00000429371;ENST00000534337	T;T;T	0.18502	2.21;2.21;2.21	3.56	1.18	0.20946	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33419	N	0.004933	T	0.04588	0.0125	N	0.04387	-0.21	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.04013	0.001;0.001	T	0.38265	-0.9669	10	0.02654	T	1	.	2.5274	0.04695	0.3039:0.2228:0.0:0.4733	.	274;315	E7EN25;Q8IZ26	.;ZNF34_HUMAN	A	274;244;315;294;254	ENSP00000341528:T315A;ENSP00000396894:T294A;ENSP00000434049:T254A	ENSP00000341528:T315A	T	-	1	0	ZNF34	145970195	0.000000	0.05858	0.879000	0.34478	0.507000	0.33981	-2.655000	0.00854	0.240000	0.21263	0.533000	0.62120	ACA		ZNF34-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382936.1	NM_030580	
MPDZ	8777	broad.mit.edu	37	9	13150632	13150632	+	Nonsense_Mutation	SNP	G	G	A	rs200131423		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr9:13150632G>A	ENST00000319217.7	-	25	3755	c.3508C>T	c.(3508-3510)Cga>Tga	p.R1170*	MPDZ_ENST00000538841.1_Nonsense_Mutation_p.R62*|MPDZ_ENST00000381015.4_Nonsense_Mutation_p.R1170*|MPDZ_ENST00000536827.1_Nonsense_Mutation_p.R1170*|MPDZ_ENST00000546205.1_Nonsense_Mutation_p.R1184*|MPDZ_ENST00000381022.2_Nonsense_Mutation_p.R1170*|MPDZ_ENST00000447879.1_Nonsense_Mutation_p.R1170*|MPDZ_ENST00000541718.1_Nonsense_Mutation_p.R1170*	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1170	PDZ 7. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.R1170*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		CCCATCCCTCGTCCACCAACA	0.418																																					p.R1170X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3508T	9						.	G	stop/ARG	1,3777		0,1,1888	95.0	93.0	93.0		3508	5.1	1.0	9		93	0,8262		0,0,4131	yes	stop-gained	MPDZ	NM_003829.3		0,1,6019	AA,AG,GG		0.0,0.0265,0.0083		1170/2042	13150632	1,12039	1889	4131	6020	13140632	SO:0001587	stop_gained	8777	exon24			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.3508C>T	9.37:g.13150632G>A	ENSP00000320006:p.Arg1170*	Somatic		Capture	Illumina HiSeq	Phase_I	13140632	NM_003829	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Nonsense_Mutation	SNP	ENST00000319217.7	37		.	.	.	.	.	.	.	.	.	.	G	26.5	4.744547	0.89663	2.65E-4	0.0	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000545857;ENST00000538841;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205;ENST00000433359;ENST00000542239	.	.	.	5.95	5.05	0.67936	.	0.000000	0.38326	N	0.001721	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.6315	0.85035	0.0:0.0:0.869:0.131	.	.	.	.	X	1170;1170;1170;176;62;1170;1170;1170;1120;1184;62;62	.	ENSP00000320006:R1170X	R	-	1	2	MPDZ	13140632	1.000000	0.71417	0.997000	0.53966	0.212000	0.24457	3.556000	0.53734	1.509000	0.48786	0.655000	0.94253	CGA		MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829	
MPDZ	8777	broad.mit.edu	37	9	13221378	13221378	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr9:13221378G>T	ENST00000319217.7	-	7	1116	c.869C>A	c.(868-870)gCt>gAt	p.A290D	MPDZ_ENST00000381015.4_Missense_Mutation_p.A290D|MPDZ_ENST00000536827.1_Missense_Mutation_p.A290D|MPDZ_ENST00000546205.1_Missense_Mutation_p.A290D|MPDZ_ENST00000381022.2_Missense_Mutation_p.A290D|MPDZ_ENST00000447879.1_Missense_Mutation_p.A290D|MPDZ_ENST00000541718.1_Missense_Mutation_p.A290D	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	290	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.A290D(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TACCTGATCAGCTACTCCTCC	0.368																																					p.A290D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C869A	9						.						126.0	119.0	121.0					9																	13221378		1900	4120	6020	13211378	SO:0001583	missense	8777	exon6			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.869C>A	9.37:g.13221378G>T	ENSP00000320006:p.Ala290Asp	Somatic		Capture	Illumina HiSeq	Phase_I	13211378	NM_003829	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37		.	.	.	.	.	.	.	.	.	.	G	27.9	4.871715	0.91587	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4	5.51	5.51	0.81932	.	0.000000	0.46758	D	0.000275	D	0.91264	0.7246	H	0.99811	4.8	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.95029	0.8167	10	0.87932	D	0	.	19.7838	0.96428	0.0:0.0:1.0:0.0	.	290;290;290	B7ZMI4;O75970-3;O75970-2	.;.;.	D	290	ENSP00000320006:A290D;ENSP00000439807:A290D;ENSP00000370410:A290D;ENSP00000444151:A290D;ENSP00000415208:A290D;ENSP00000370403:A290D;ENSP00000446358:A290D	ENSP00000320006:A290D	A	-	2	0	MPDZ	13211378	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	9.173000	0.94815	2.755000	0.94549	0.650000	0.86243	GCT		MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829	
ECM2	1842	broad.mit.edu	37	9	95263043	95263043	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr9:95263043G>T	ENST00000344604.5	-	9	2046	c.1897C>A	c.(1897-1899)Cta>Ata	p.L633I	CENPP_ENST00000375587.3_Intron|ECM2_ENST00000444490.2_Missense_Mutation_p.L611I	NM_001197295.1|NM_001393.3	NP_001184224.1|NP_001384.1	O94769	ECM2_HUMAN	extracellular matrix protein 2, female organ and adipocyte specific	633					cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.L611I(1)|p.L633I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27						AGAAAATGTAGTGCTTTCATT	0.348																																					p.L633I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1897A	9						.						79.0	83.0	82.0					9																	95263043		2203	4300	6503	94302864	SO:0001583	missense	1842	exon9			AB011792	CCDS6698.1, CCDS56578.1	9q22.3	2008-07-21			ENSG00000106823	ENSG00000106823			3154	protein-coding gene	gene with protein product	"""matrix glycoprotein SC1/ECM2"""	603479				9790758	Standard	NM_001393		Approved		uc011lty.2	O94769	OTTHUMG00000020226	ENST00000344604.5:c.1897C>A	9.37:g.95263043G>T	ENSP00000344758:p.Leu633Ile	Somatic		Capture	Illumina HiSeq	Phase_I	94302864	NM_001393	B2R730|E2PU11|Q5T9F2|Q7Z3D0	Missense_Mutation	SNP	ENST00000344604.5	37	CCDS6698.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305980	0.60305	.	.	ENSG00000106823	ENST00000444490;ENST00000344604	D;D	0.81659	-1.52;-1.52	5.12	1.16	0.20824	.	0.000000	0.64402	D	0.000001	D	0.88489	0.6450	M	0.84846	2.72	0.44337	D	0.997228	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.86724	0.1944	10	0.66056	D	0.02	.	9.8081	0.40805	0.2827:0.0:0.7173:0.0	.	633;611;611	O94769;B4DK93;O94769-2	ECM2_HUMAN;.;.	I	611;633	ENSP00000393971:L611I;ENSP00000344758:L633I	ENSP00000344758:L633I	L	-	1	2	ECM2	94302864	0.998000	0.40836	0.947000	0.38551	0.996000	0.88848	0.711000	0.25764	0.013000	0.14918	0.591000	0.81541	CTA		ECM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053091.1	NM_001393	
ERCC6L2	375748	broad.mit.edu	37	9	98683538	98683538	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chr9:98683538C>T	ENST00000288985.7	+	7	1578	c.1273C>T	c.(1273-1275)Caa>Taa	p.Q425*	ERCC6L2_ENST00000437817.1_Nonsense_Mutation_p.Q236*|ERCC6L2_ENST00000466840.1_3'UTR	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	425					DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)	p.Q425*(2)									TTTGATACTTCAATCTTCTGA	0.348																																					p.Q425X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|lung(1)	c.C1273T	9						.						114.0	115.0	114.0					9																	98683538		2203	4300	6503	97723359	SO:0001587	stop_gained	375748	exon7			BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.1273C>T	9.37:g.98683538C>T	ENSP00000288985:p.Gln425*	Somatic		Capture	Illumina HiSeq	Phase_I	97723359	NM_001010895	A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Nonsense_Mutation	SNP	ENST00000288985.7	37	CCDS35072.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.942365	0.73672	.	.	ENSG00000182150	ENST00000405401;ENST00000288985;ENST00000437817	.	.	.	5.51	0.954	0.19595	.	1.102450	0.07095	N	0.839415	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	0.5024	16.0778	0.80979	0.5557:0.4443:0.0:0.0	.	.	.	.	X	107;425;236	.	ENSP00000288985:Q425X	Q	+	1	0	C9orf102	97723359	0.000000	0.05858	0.200000	0.23457	0.900000	0.52787	0.565000	0.23578	0.271000	0.22005	0.585000	0.79938	CAA		ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053247.2	NM_001010895	
ARL13A	392509	broad.mit.edu	37	X	100242527	100242527	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chrX:100242527A>G	ENST00000450049.2	+	6	748	c.635A>G	c.(634-636)gAa>gGa	p.E212G		NM_001162491.1	NP_001155963.1	Q5H913	AR13A_HUMAN	ADP-ribosylation factor-like 13A	212					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(1)|ovary(1)	2						GGCTCTGGAGAAAGATGCTCA	0.473																																					p.E212G												.	.	0			c.A635G	X						.						98.0	85.0	89.0					X																	100242527		1917	4118	6035	100129183	SO:0001583	missense	392509	exon6				CCDS55463.1	Xq22.1	2014-05-09	2005-11-18	2005-11-18	ENSG00000174225	ENSG00000174225		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	31709	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 13"""	ARL13			Standard	NM_001162491		Approved		uc011mrf.2	Q5H913	OTTHUMG00000022013	ENST00000450049.2:c.635A>G	X.37:g.100242527A>G	ENSP00000398637:p.Glu212Gly	Somatic		Capture	Illumina HiSeq	Phase_I	100129183	NM_001012990	B2RTT6|B4DX50	Missense_Mutation	SNP	ENST00000450049.2	37	CCDS55463.1	.	.	.	.	.	.	.	.	.	.	A	5.183	0.219306	0.09863	.	.	ENSG00000174225	ENST00000450049;ENST00000372953	T	0.61274	0.12	4.43	0.664	0.17890	.	0.428702	0.26200	N	0.025758	T	0.34832	0.0911	L	0.29908	0.895	0.09310	N	1	P;B	0.39282	0.666;0.002	B;B	0.35859	0.212;0.005	T	0.32693	-0.9897	10	0.87932	D	0	.	0.9729	0.01420	0.497:0.1988:0.1088:0.1953	.	212;212	B2RTT6;Q5H913	.;AR13A_HUMAN	G	212;86	ENSP00000398637:E212G	ENSP00000362044:E86G	E	+	2	0	ARL13A	100129183	0.043000	0.20138	0.001000	0.08648	0.088000	0.18126	0.404000	0.20999	0.011000	0.14865	0.417000	0.27973	GAA		ARL13A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000057504.2	XM_373358	
AMER1	139285	broad.mit.edu	37	X	63411318	63411318	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chrX:63411318C>A	ENST00000330258.3	-	2	2121	c.1849G>T	c.(1849-1851)Gaa>Taa	p.E617*	AMER1_ENST00000403336.1_Nonsense_Mutation_p.E617*|AMER1_ENST00000374869.3_Nonsense_Mutation_p.E617*	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	617					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.E617*(2)									CCATGAGCTTCCCAAGTGTGG	0.637																																					p.E617X												.	.	69	Whole gene deletion(67)|Substitution - Nonsense(2)	kidney(65)|large_intestine(3)|ovary(1)	c.G1849T	X						.						29.0	25.0	27.0					X																	63411318		2203	4300	6503	63328043	SO:0001587	stop_gained	139285	exon2			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1849G>T	X.37:g.63411318C>A	ENSP00000329117:p.Glu617*	Somatic		Capture	Illumina HiSeq	Phase_I	63328043	NM_152424	A2IB86|Q8N885	Nonsense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	C	26.1	4.706247	0.89018	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	.	.	.	3.91	3.04	0.35103	.	0.430791	0.19818	N	0.105369	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-6.2044	6.683	0.23131	0.0:0.7105:0.18:0.1096	.	.	.	.	X	617	.	ENSP00000329117:E617X	E	-	1	0	FAM123B	63328043	0.172000	0.23043	0.009000	0.14445	0.056000	0.15407	0.982000	0.29539	0.998000	0.38996	0.600000	0.82982	GAA		AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
AFF2	2334	broad.mit.edu	37	X	147743525	147743525	+	Missense_Mutation	SNP	C	C	T	rs200850740		TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-A6-3808-01A-01W-0995-10	TCGA-A6-3808-11A-01W-0995-10	g.chrX:147743525C>T	ENST00000370460.2	+	3	756	c.277C>T	c.(277-279)Cac>Tac	p.H93Y	AFF2_ENST00000370458.1_Missense_Mutation_p.H89Y|AFF2_ENST00000342251.3_Missense_Mutation_p.H89Y|AFF2_ENST00000370457.5_Missense_Mutation_p.H89Y	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	93					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.H93Y(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TAATCAGAATCACCTAGTGGG	0.388													C|||	1	0.000264901	0.0	0.0	3775	,	,		14595	0.0		0.001	False		,,,				2504	0.0				p.H93Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C277T	X						.						133.0	135.0	134.0					X																	147743525		2203	4300	6503	147551217	SO:0001583	missense	2334	exon3			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.277C>T	X.37:g.147743525C>T	ENSP00000359489:p.His93Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	147551217	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	1	6.027727546714888E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	19.82	3.897626	0.72639	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.73385	0.3580	L	0.41492	1.28	0.80722	D	1	D;D;D;D;D;D	0.76494	0.991;0.991;0.991;0.991;0.993;0.999	P;P;P;P;D;D	0.71184	0.889;0.889;0.889;0.889;0.932;0.972	T	0.75918	-0.3148	10	0.87932	D	0	.	18.7174	0.91680	0.0:1.0:0.0:0.0	.	93;89;89;89;93;89	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	Y	93;89;89;89	ENSP00000359489:H93Y;ENSP00000359486:H89Y;ENSP00000345459:H89Y;ENSP00000359487:H89Y	ENSP00000345459:H89Y	H	+	1	0	AFF2	147551217	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.525000	0.81892	2.365000	0.80145	0.600000	0.82982	CAC		AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
