#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NUP205	23165	hgsc.bcm.edu	37	7	135292026	135292026	+	Silent	SNP	C	C	T			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr7:135292026C>T	ENST00000285968.6	+	22	3128	c.3102C>T	c.(3100-3102)caC>caT	p.H1034H		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1034					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.H1034H(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						CATGCCTTCACGCCATTCTAA	0.458																																					p.H1034H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3102T	7						.						113.0	105.0	108.0					7																	135292026		2203	4300	6503	134942566	SO:0001819	synonymous_variant	23165	exon22			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.3102C>T	7.37:g.135292026C>T		Somatic		Capture	SOLID	Phase_I	134942566	NM_015135	A6H8X3|Q86YC1	Silent	SNP	ENST00000285968.6	37	CCDS34759.1																																																																																				NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
ATRN	8455	hgsc.bcm.edu	37	20	3527991	3527991	+	Silent	SNP	C	C	T	rs369774374		TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr20:3527991C>T	ENST00000262919.5	+	5	866	c.798C>T	c.(796-798)agC>agT	p.S266S	ATRN_ENST00000446916.2_Silent_p.S266S	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	266					cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.S266S(1)		breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						GTAATAGCAGCGATACTGTTG	0.408																																					p.S266S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C798T	20						.	C	,,	0,4406		0,0,2203	215.0	189.0	198.0		450,798,798	3.3	0.3	20		198	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	ATRN	NM_001207047.1,NM_139321.2,NM_139322.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	150/1157,266/1430,266/1273	3527991	1,13005	2203	4300	6503	3475991	SO:0001819	synonymous_variant	8455	exon5			AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.798C>T	20.37:g.3527991C>T		Somatic		Capture	SOLID	Phase_I	3475991	NM_139322	A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Silent	SNP	ENST00000262919.5	37	CCDS13053.1																																																																																				ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077740.2	NM_139321	
CD22	933	hgsc.bcm.edu	37	19	35831956	35831956	+	Silent	SNP	C	C	T	rs199643177		TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr19:35831956C>T	ENST00000085219.5	+	7	1488	c.1422C>T	c.(1420-1422)aaC>aaT	p.N474N	CD22_ENST00000544992.2_Silent_p.N474N|CD22_ENST00000270311.6_Silent_p.N354N|CD22_ENST00000419549.2_Silent_p.N302N|CD22_ENST00000341773.6_Silent_p.N297N|CD22_ENST00000594250.1_Silent_p.N297N|CD22_ENST00000536635.2_Silent_p.N386N	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	474	Ig-like C2-type 4.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.N474N(2)		breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			AGATCCAAAACGTTGGCTGGG	0.567																																					p.N474N	Ovarian(42;1009 1133 23674 26041)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1422T	19						.						97.0	86.0	90.0					19																	35831956		2203	4300	6503	40523796	SO:0001819	synonymous_variant	933	exon7			X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.1422C>T	19.37:g.35831956C>T		Somatic		Capture	SOLID	Phase_I	40523796	NM_001185100	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Silent	SNP	ENST00000085219.5	37	CCDS12457.1																																																																																				CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771	
PSG8	440533	hgsc.bcm.edu	37	19	43269717	43269717	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr19:43269717G>A	ENST00000306511.4	-	1	114	c.17C>T	c.(16-18)gCc>gTc	p.A6V	PSG8_ENST00000406636.3_Missense_Mutation_p.A6V|PSG8_ENST00000404209.4_Missense_Mutation_p.A6V|PSG8_ENST00000401467.2_Intron	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	6						extracellular region (GO:0005576)		p.A6V(2)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GCAGGGAGGGGCTGAGAGGAG	0.592																																					p.A6V												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C17T	19						.						130.0	122.0	125.0					19																	43269717		1511	2709	4220	47961557	SO:0001583	missense	440533	exon1			M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.17C>T	19.37:g.43269717G>A	ENSP00000305005:p.Ala6Val	Somatic		Capture	SOLID	Phase_I	47961557	NM_001130168	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	ENST00000306511.4	37	CCDS33037.1	.	.	.	.	.	.	.	.	.	.	g	9.241	1.038295	0.19669	.	.	ENSG00000124467	ENST00000404209;ENST00000406636;ENST00000401467;ENST00000407488;ENST00000306511	T;T;T;T	0.35421	2.15;1.31;3.24;2.16	1.35	0.156	0.14910	.	.	.	.	.	T	0.48059	0.1479	L	0.52823	1.66	0.09310	N	1	D;P;B	0.89917	1.0;0.903;0.04	D;P;B	0.87578	0.998;0.505;0.052	T	0.27839	-1.0062	9	0.54805	T	0.06	.	5.2323	0.15428	0.0:0.3722:0.6278:0.0	.	6;6;6	Q9UQ74-2;Q9UQ74;A5PKV3	.;PSG8_HUMAN;.	V	6	ENSP00000385869:A6V;ENSP00000385081:A6V;ENSP00000386090:A6V;ENSP00000305005:A6V	ENSP00000305005:A6V	A	-	2	0	PSG8	47961557	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.271000	0.01166	0.112000	0.17975	0.184000	0.17185	GCC		PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1		
PNMAL1	55228	hgsc.bcm.edu	37	19	46973171	46973171	+	Silent	SNP	G	G	A	rs554785521		TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr19:46973171G>A	ENST00000313683.10	-	2	1427	c.1122C>T	c.(1120-1122)taC>taT	p.Y374Y	PNMAL1_ENST00000438932.2_Intron|PNMAL1_ENST00000602246.1_Intron	NM_001103149.1|NM_018215.3	NP_001096619.1|NP_060685.2	Q86V59	PNML1_HUMAN	paraneoplastic Ma antigen family-like 1	374								p.Y374Y(1)		cervix(1)|endometrium(2)|large_intestine(8)|lung(8)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		CAACCAAGACGTAGGAGACAG	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		17641	0.0		0.0	False		,,,				2504	0.001				p.Y374Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1122T	19						.						101.0	104.0	103.0					19																	46973171		2203	4300	6503	51665011	SO:0001819	synonymous_variant	55228	exon2			BC026026	CCDS33059.1, CCDS46124.1	19q13.32	2014-02-12	2012-02-09			ENSG00000182013		"""Paraneoplastic Ma antigens"""	25578	protein-coding gene	gene with protein product			"""PNMA-like 1"""			12477932	Standard	NM_018215		Approved	KIAA1183L, FLJ10781	uc002peq.4	Q86V59		ENST00000313683.10:c.1122C>T	19.37:g.46973171G>A		Somatic		Capture	SOLID	Phase_I	51665011	NM_018215	A8K2F3|Q5U638|Q8N3H4|Q9NVE8	Silent	SNP	ENST00000313683.10	37	CCDS33059.1																																																																																				PNMAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403929.1	NM_018215	
DLC1	10395	hgsc.bcm.edu	37	8	12952306	12952306	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr8:12952306G>A	ENST00000276297.4	-	12	3897	c.3488C>T	c.(3487-3489)aCg>aTg	p.T1163M	DLC1_ENST00000520226.1_Missense_Mutation_p.T652M|DLC1_ENST00000512044.2_Missense_Mutation_p.T760M|DLC1_ENST00000358919.2_Missense_Mutation_p.T726M|DLC1_ENST00000510318.1_5'UTR	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1163	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.T1163M(1)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						GAGTTTGTTCGTCATTAGTGG	0.448																																					p.T1163M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3488T	8						.						114.0	106.0	109.0					8																	12952306		2203	4300	6503	12996677	SO:0001583	missense	10395	exon12			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.3488C>T	8.37:g.12952306G>A	ENSP00000276297:p.Thr1163Met	Somatic		Capture	SOLID	Phase_I	12996677	NM_182643	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.855254	0.91355	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	4.97	4.97	0.65823	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.050390	0.85682	D	0.000000	T	0.79028	0.4377	H	0.95645	3.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.994;0.998;0.983	D	0.85375	0.1116	10	0.87932	D	0	.	18.8143	0.92071	0.0:0.0:1.0:0.0	.	1163;760;726	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	M	1163;726;102;760;652	ENSP00000276297:T1163M;ENSP00000351797:T726M;ENSP00000422595:T760M;ENSP00000428028:T652M	ENSP00000276297:T1163M	T	-	2	0	DLC1	12996677	1.000000	0.71417	0.964000	0.40570	0.857000	0.48899	9.651000	0.98493	2.761000	0.94854	0.650000	0.86243	ACG		DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
OPRK1	4986	hgsc.bcm.edu	37	8	54147500	54147500	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr8:54147500G>T	ENST00000265572.3	-	3	726	c.429C>A	c.(427-429)ttC>ttA	p.F143L	RP11-162D9.3_ENST00000524425.1_RNA|OPRK1_ENST00000520287.1_Missense_Mutation_p.F143L|OPRK1_ENST00000524278.1_Missense_Mutation_p.F54L	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	143					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)	p.F143L(1)		NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	AGATGCTGGTGAACATGTTGT	0.493																																					p.F143L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C429A	8						.						146.0	120.0	129.0					8																	54147500		2203	4300	6503	54310053	SO:0001583	missense	4986	exon3				CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.429C>A	8.37:g.54147500G>T	ENSP00000265572:p.Phe143Leu	Somatic		Capture	SOLID	Phase_I	54310053	NM_000912	E5RHC9|Q499G4	Missense_Mutation	SNP	ENST00000265572.3	37	CCDS6152.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.360913	0.82353	.	.	ENSG00000082556	ENST00000265572;ENST00000524278;ENST00000520287;ENST00000396798	T;T;T	0.15834	2.39;2.39;2.39	5.95	-3.56	0.04626	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.38957	0.1060	M	0.81179	2.53	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.46359	-0.9197	10	0.87932	D	0	.	14.7713	0.69681	0.8571:0.0:0.1429:0.0	.	143	P41145	OPRK_HUMAN	L	143;54;143;129	ENSP00000265572:F143L;ENSP00000430923:F54L;ENSP00000429706:F143L	ENSP00000265572:F143L	F	-	3	2	OPRK1	54310053	1.000000	0.71417	0.980000	0.43619	0.995000	0.86356	1.089000	0.30890	-0.514000	0.06488	-0.142000	0.14014	TTC		OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1		
COL22A1	169044	hgsc.bcm.edu	37	8	139833440	139833440	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr8:139833440T>A	ENST00000303045.6	-	7	1630	c.1184A>T	c.(1183-1185)aAc>aTc	p.N395I	COL22A1_ENST00000435777.1_Missense_Mutation_p.N395I	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	395	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.N395I(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GATGTCAATGTTCTCCCGTTC	0.597										HNSCC(7;0.00092)																											p.N395I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1184T	8						.						213.0	148.0	170.0					8																	139833440		2203	4300	6503	139902622	SO:0001583	missense	169044	exon7			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1184A>T	8.37:g.139833440T>A	ENSP00000303153:p.Asn395Ile	Somatic		Capture	SOLID	Phase_I	139902622	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.625329	0.87560	.	.	ENSG00000169436	ENST00000303045;ENST00000435777	T;T	0.02015	4.5;4.5	5.21	5.21	0.72293	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.53938	D	0.000046	T	0.07818	0.0196	L	0.48362	1.52	0.50632	D	0.999887	D	0.71674	0.998	D	0.64687	0.928	T	0.35599	-0.9782	9	.	.	.	.	14.6215	0.68588	0.0:0.0:0.0:1.0	.	395	Q8NFW1	COMA1_HUMAN	I	395	ENSP00000303153:N395I;ENSP00000387655:N395I	.	N	-	2	0	COL22A1	139902622	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.713000	0.84693	2.114000	0.64651	0.456000	0.33151	AAC		COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
UBXN10	127733	hgsc.bcm.edu	37	1	20517451	20517451	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr1:20517451G>A	ENST00000375099.3	+	2	481	c.397G>A	c.(397-399)Gtt>Att	p.V133I		NM_152376.3	NP_689589.1	Q96LJ8	UBX10_HUMAN	UBX domain protein 10	133								p.V133I(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|skin(2)	14						TGTGGAAACCGTTGCCAAAAA	0.522																																					p.V133I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G397A	1						.						40.0	44.0	43.0					1																	20517451		2203	4300	6503	20390038	SO:0001583	missense	127733	exon2			AK058158	CCDS205.1	1p36.13	2008-07-25	2008-07-25	2008-07-25	ENSG00000162543	ENSG00000162543		"""UBX domain containing"""	26354	protein-coding gene	gene with protein product			"""UBX domain containing 3"""	UBXD3		12477932	Standard	NM_152376		Approved	FLJ25429	uc001bdb.3	Q96LJ8	OTTHUMG00000002708	ENST00000375099.3:c.397G>A	1.37:g.20517451G>A	ENSP00000364240:p.Val133Ile	Somatic		Capture	SOLID	Phase_I	20390038	NM_152376	Q5R386	Missense_Mutation	SNP	ENST00000375099.3	37	CCDS205.1	.	.	.	.	.	.	.	.	.	.	G	6.212	0.407246	0.11754	.	.	ENSG00000162543	ENST00000375099	.	.	.	5.03	4.12	0.48240	.	0.343274	0.21282	N	0.077132	T	0.40448	0.1117	L	0.59436	1.845	0.09310	N	1	B	0.28470	0.213	B	0.15052	0.012	T	0.27938	-1.0059	9	0.38643	T	0.18	-5.576	10.0497	0.42208	0.0942:0.0:0.9058:0.0	.	133	Q96LJ8	UBX10_HUMAN	I	133	.	ENSP00000364240:V133I	V	+	1	0	UBXN10	20390038	0.000000	0.05858	0.009000	0.14445	0.003000	0.03518	-0.140000	0.10342	1.112000	0.41740	0.655000	0.94253	GTT		UBXN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007693.1	NM_152376	
LPPR4	9890	hgsc.bcm.edu	37	1	99766506	99766506	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr1:99766506C>T	ENST00000370185.3	+	5	1273	c.776C>T	c.(775-777)gCa>gTa	p.A259V	LPPR4_ENST00000457765.1_Missense_Mutation_p.A259V|LPPR4_ENST00000370184.1_Missense_Mutation_p.A101V	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		259					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.A259V(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		GCTGCCTTTGCAGCTGTGTAT	0.398																																					p.A259V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C776T	1						.						288.0	262.0	271.0					1																	99766506		2203	4300	6503	99539094	SO:0001583	missense	9890	exon5																														ENST00000370185.3:c.776C>T	1.37:g.99766506C>T	ENSP00000359204:p.Ala259Val	Somatic		Capture	SOLID	Phase_I	99539094	NM_014839	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	CCDS757.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.779186	0.90195	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178;ENST00000370184	T;T;T	0.76060	-0.99;-0.85;-0.99	5.31	5.31	0.75309	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83161	0.5194	M	0.64630	1.985	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.84339	0.0526	10	0.87932	D	0	-22.9835	19.3304	0.94283	0.0:1.0:0.0:0.0	.	259;259	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	V	259;259;259;101	ENSP00000359204:A259V;ENSP00000394913:A259V;ENSP00000359203:A101V	ENSP00000263178:A259V	A	+	2	0	RP4-788L13.1	99539094	1.000000	0.71417	0.999000	0.59377	0.602000	0.36980	7.776000	0.85560	2.645000	0.89757	0.591000	0.81541	GCA		LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2		
OR51G2	81282	hgsc.bcm.edu	37	11	4935994	4935994	+	Missense_Mutation	SNP	C	C	A	rs148865672		TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr11:4935994C>A	ENST00000322013.3	-	1	928	c.900G>T	c.(898-900)aaG>aaT	p.K300N	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005238.1	NP_001005238.1	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G, member 2	300						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K300K(2)|p.K300N(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(9)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCTGTTTGGTCTTCACACTGT	0.493																																					p.K300N												.	.	3	Substitution - coding silent(2)|Substitution - Missense(1)	large_intestine(1)|lung(1)|skin(1)	c.G900T	11						.						96.0	80.0	85.0					11																	4935994		2201	4298	6499	4892570	SO:0001583	missense	81282	exon1			AB065794	CCDS31365.1	11p15.4	2012-08-09			ENSG00000176893	ENSG00000176893		"""GPCR / Class A : Olfactory receptors"""	15198	protein-coding gene	gene with protein product							Standard	NM_001005238		Approved		uc001lzr.1	Q8NGK0	OTTHUMG00000066501	ENST00000322013.3:c.900G>T	11.37:g.4935994C>A	ENSP00000322593:p.Lys300Asn	Somatic		Capture	SOLID	Phase_I	4892570	NM_001005238	Q6IFH7	Missense_Mutation	SNP	ENST00000322013.3	37	CCDS31365.1	.	.	.	.	.	.	.	.	.	.	C	16.01	3.002601	0.54254	.	.	ENSG00000176893	ENST00000322013	T	0.37584	1.19	5.23	5.23	0.72850	.	0.000000	0.48286	D	0.000182	T	0.45276	0.1334	M	0.86953	2.85	0.32262	N	0.569956	P	0.48911	0.917	P	0.44477	0.451	T	0.66110	-0.6005	10	0.72032	D	0.01	.	7.7773	0.29046	0.0:0.8334:0.0:0.1666	.	300	Q8NGK0	O51G2_HUMAN	N	300	ENSP00000322593:K300N	ENSP00000322593:K300N	K	-	3	2	OR51G2	4892570	0.977000	0.34250	1.000000	0.80357	0.960000	0.62799	0.778000	0.26732	2.729000	0.93468	0.650000	0.86243	AAG		OR51G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142174.1	NM_001005238	
TUB	7275	hgsc.bcm.edu	37	11	8122138	8122138	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr11:8122138G>A	ENST00000299506.2	+	10	1354	c.1205G>A	c.(1204-1206)cGc>cAc	p.R402H	TUB_ENST00000305253.4_Missense_Mutation_p.R457H|TUB_ENST00000534099.1_Missense_Mutation_p.R408H	NM_177972.2	NP_813977.1	P50607	TUB_HUMAN	tubby bipartite transcription factor	402					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)	p.R457H(1)		breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		GTCTCTATCCGCCCCCGCAAC	0.532																																					p.R402H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1205A	11						.						148.0	117.0	127.0					11																	8122138		2201	4296	6497	8078714	SO:0001583	missense	7275	exon10			U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000299506.2:c.1205G>A	11.37:g.8122138G>A	ENSP00000299506:p.Arg402His	Somatic		Capture	SOLID	Phase_I	8078714	NM_177972	D3DQU4|O00293|Q6B007	Missense_Mutation	SNP	ENST00000299506.2	37	CCDS7787.1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.071074	0.55646	.	.	ENSG00000166402	ENST00000534099;ENST00000305253;ENST00000299506	D;D;D	0.96459	-4.02;-4.02;-4.02	4.59	3.4	0.38934	Tubby, C-terminal (3);	0.111909	0.64402	D	0.000014	D	0.94029	0.8087	M	0.70842	2.15	0.58432	D	0.999998	B;B;B	0.32409	0.345;0.37;0.32	B;B;B	0.26202	0.029;0.067;0.059	D	0.93366	0.6731	10	0.46703	T	0.11	-15.6685	11.4517	0.50156	0.1303:0.0:0.8697:0.0	.	408;402;457	E9PQR4;P50607;P50607-2	.;TUB_HUMAN;.	H	408;457;402	ENSP00000434400:R408H;ENSP00000305426:R457H;ENSP00000299506:R402H	ENSP00000299506:R402H	R	+	2	0	TUB	8078714	1.000000	0.71417	0.997000	0.53966	0.905000	0.53344	4.976000	0.63785	2.277000	0.76020	0.563000	0.77884	CGC		TUB-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385823.1	NM_003320	
ANO3	63982	hgsc.bcm.edu	37	11	26529767	26529767	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr11:26529767T>G	ENST00000256737.3	+	5	1401	c.549T>G	c.(547-549)ttT>ttG	p.F183L	ANO3_ENST00000525139.1_Missense_Mutation_p.F167L|ANO3_ENST00000531568.1_Missense_Mutation_p.F37L|ANO3_ENST00000537978.1_Missense_Mutation_p.F167L|ANO3_ENST00000531646.1_Missense_Mutation_p.F183L	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	183					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)	p.F183L(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						GAAACACATTTGAAAAGAACC	0.338																																					p.F183L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T549G	11						.						69.0	72.0	71.0					11																	26529767		2203	4300	6503	26486343	SO:0001583	missense	63982	exon5			AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.549T>G	11.37:g.26529767T>G	ENSP00000256737:p.Phe183Leu	Somatic		Capture	SOLID	Phase_I	26486343	NM_031418	B7Z3F5	Missense_Mutation	SNP	ENST00000256737.3	37	CCDS31447.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.511084	0.85389	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000531646;ENST00000538001;ENST00000531568	T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;0.04;-0.24	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.80874	0.4707	M	0.79475	2.455	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.64687	0.928;0.928	D	0.83565	0.0109	10	0.87932	D	0	.	15.0092	0.71536	0.0:0.0:0.0:1.0	.	100;183	B7Z7Y6;Q9BYT9	.;ANO3_HUMAN	L	167;167;183;183;100;37	ENSP00000440737:F167L;ENSP00000432576:F167L;ENSP00000256737:F183L;ENSP00000435275:F183L;ENSP00000432394:F37L	ENSP00000256737:F183L	F	+	3	2	ANO3	26486343	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.807000	0.47955	2.244000	0.73946	0.477000	0.44152	TTT		ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1	NM_031418	
OR5T2	219464	hgsc.bcm.edu	37	11	56000491	56000491	+	Silent	SNP	T	T	G			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr11:56000491T>G	ENST00000313264.4	-	1	246	c.171A>C	c.(169-171)acA>acC	p.T57T		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	57						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T57T(1)		endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					CAAGATTGTCTGTGAAGCCCT	0.358																																					p.T57T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A171C	11						.						69.0	61.0	64.0					11																	56000491		2201	4296	6497	55757067	SO:0001819	synonymous_variant	219464	exon1			AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.171A>C	11.37:g.56000491T>G		Somatic		Capture	SOLID	Phase_I	55757067	NM_001004746	B9EGX5|Q6IFC8	Silent	SNP	ENST00000313264.4	37	CCDS31523.1																																																																																				OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746	
OR8B8	26493	hgsc.bcm.edu	37	11	124310957	124310957	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr11:124310957C>T	ENST00000328064.2	-	1	97	c.25G>A	c.(25-27)Gtg>Atg	p.V9M		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	9					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V9M(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		AACTGTGTCACGAAGGAGGAA	0.507																																					p.V9M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G25A	11						.						38.0	39.0	39.0					11																	124310957		2201	4299	6500	123816167	SO:0001583	missense	26493	exon1			AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.25G>A	11.37:g.124310957C>T	ENSP00000330280:p.Val9Met	Somatic		Capture	SOLID	Phase_I	123816167	NM_012378	A1L446|Q96RC8	Missense_Mutation	SNP	ENST00000328064.2	37	CCDS8446.1	.	.	.	.	.	.	.	.	.	.	C	9.308	1.054842	0.19907	.	.	ENSG00000197125	ENST00000328064	T	0.00892	5.57	4.08	-0.938	0.10412	.	0.585786	0.14115	N	0.340468	T	0.01523	0.0049	M	0.78916	2.43	0.09310	N	1	B	0.30709	0.291	B	0.28011	0.085	T	0.32295	-0.9912	10	0.72032	D	0.01	.	7.2124	0.25941	0.0:0.5332:0.2354:0.2314	.	9	Q15620	OR8B8_HUMAN	M	9	ENSP00000330280:V9M	ENSP00000330280:V9M	V	-	1	0	OR8B8	123816167	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.991000	0.03728	-0.167000	0.10871	-1.431000	0.01090	GTG		OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1	NM_012378	
SLC35D3	340146	hgsc.bcm.edu	37	6	137243677	137243677	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr6:137243677G>T	ENST00000331858.4	+	1	276	c.111G>T	c.(109-111)caG>caT	p.Q37H		NM_001008783.1	NP_001008783.1	Q5M8T2	S35D3_HUMAN	solute carrier family 35, member D3	37					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)		p.Q37H(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	13	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000136)|OV - Ovarian serous cystadenocarcinoma(155;0.00365)		GCCGCTACCAGTTCTCCTTCC	0.682																																					p.Q37H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G111T	6						.						44.0	39.0	41.0					6																	137243677		2201	4296	6497	137285370	SO:0001583	missense	340146	exon1				CCDS34544.1	6q23.2	2013-05-22			ENSG00000182747	ENSG00000182747		"""Solute carriers"""	15621	protein-coding gene	gene with protein product		612519		FRCL1			Standard	NM_001008783		Approved		uc003qhe.3	Q5M8T2	OTTHUMG00000015651	ENST00000331858.4:c.111G>T	6.37:g.137243677G>T	ENSP00000333591:p.Gln37His	Somatic		Capture	SOLID	Phase_I	137285370	NM_001008783	B4DI58|Q5QNZ6|Q6NX71	Missense_Mutation	SNP	ENST00000331858.4	37	CCDS34544.1	.	.	.	.	.	.	.	.	.	.	G	11.50	1.658212	0.29425	.	.	ENSG00000182747	ENST00000331858	T	0.53857	0.6	4.53	3.61	0.41365	.	0.263836	0.35805	N	0.002964	T	0.10165	0.0249	N	0.01352	-0.895	0.40258	D	0.978143	B	0.02656	0.0	B	0.01281	0.0	T	0.06534	-1.0821	10	0.31617	T	0.26	-10.6402	9.0922	0.36619	0.0:0.3079:0.5596:0.1325	.	37	Q5M8T2	S35D3_HUMAN	H	37	ENSP00000333591:Q37H	ENSP00000333591:Q37H	Q	+	3	2	SLC35D3	137285370	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.267000	0.43329	2.074000	0.62210	0.491000	0.48974	CAG		SLC35D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042389.2	XM_294017	
ACOT13	55856	hgsc.bcm.edu	37	6	24701794	24701794	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr6:24701794C>G	ENST00000230048.4	+	3	567	c.374C>G	c.(373-375)aCa>aGa	p.T125R	ACOT13_ENST00000476436.1_3'UTR|ACOT13_ENST00000537591.1_Missense_Mutation_p.T102R|RP1-30M3.5_ENST00000607014.1_RNA	NM_018473.3	NP_060943.1	Q9NPJ3	ACO13_HUMAN	acyl-CoA thioesterase 13	125					metabolic process (GO:0008152)|protein homotetramerization (GO:0051289)	cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA hydrolase activity (GO:0047617)	p.T125R(1)		large_intestine(1)	1						AACAAGGCCACAGGAAAATTA	0.393																																					p.T102R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C305G	6						.						160.0	161.0	161.0					6																	24701794		2203	4300	6503	24809773	SO:0001583	missense	55856	exon4			AF220186	CCDS4558.1, CCDS54972.1	6p22.1	2009-11-20	2009-05-05	2009-05-05	ENSG00000112304	ENSG00000112304		"""Acyl CoA thioesterases"""	20999	protein-coding gene	gene with protein product		615652	"""thioesterase superfamily member 2"""	THEM2		16934754, 19405909	Standard	NM_018473		Approved	HT012	uc003nek.3	Q9NPJ3	OTTHUMG00000014359	ENST00000230048.4:c.374C>G	6.37:g.24701794C>G	ENSP00000230048:p.Thr125Arg	Somatic		Capture	SOLID	Phase_I	24809773	NM_001160094	F5H2L4|O95549	Missense_Mutation	SNP	ENST00000230048.4	37	CCDS4558.1	.	.	.	.	.	.	.	.	.	.	C	19.95	3.922317	0.73213	.	.	ENSG00000112304	ENST00000537591;ENST00000230048	T;T	0.21932	1.98;1.98	5.51	4.61	0.57282	Thioesterase superfamily (1);Phenylacetic acid degradation-related protein (1);	0.169164	0.52532	D	0.000068	T	0.26882	0.0658	L	0.55213	1.73	0.42913	D	0.994266	D;D	0.54772	0.968;0.967	P;P	0.60609	0.481;0.877	T	0.01771	-1.1277	10	0.39692	T	0.17	-16.093	15.7444	0.77926	0.1376:0.8624:0.0:0.0	.	102;125	F5H2L4;Q9NPJ3	.;ACO13_HUMAN	R	102;125	ENSP00000445552:T102R;ENSP00000230048:T125R	ENSP00000230048:T125R	T	+	2	0	ACOT13	24809773	1.000000	0.71417	0.967000	0.41034	0.969000	0.65631	5.581000	0.67471	1.397000	0.46682	0.655000	0.94253	ACA		ACOT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040010.2	NM_018473	
MUC21	394263	hgsc.bcm.edu	37	6	30955218	30955218	+	Silent	SNP	T	T	C			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr6:30955218T>C	ENST00000376296.3	+	2	1507	c.1266T>C	c.(1264-1266)aaT>aaC	p.N422N	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	422	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N422N(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CTGCCACCAATTCTGAGTCCA	0.612																																					p.N422N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1266C	6						.						138.0	133.0	135.0					6																	30955218		2203	4300	6503	31063197	SO:0001819	synonymous_variant	394263	exon2			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1266T>C	6.37:g.30955218T>C		Somatic		Capture	SOLID	Phase_I	31063197	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																				MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
DNAH8	1769	hgsc.bcm.edu	37	6	38885110	38885110	+	Silent	SNP	A	A	G			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr6:38885110A>G	ENST00000359357.3	+	67	9839	c.9585A>G	c.(9583-9585)caA>caG	p.Q3195Q	DNAH8_ENST00000441566.1_Silent_p.Q3159Q|DNAH8_ENST00000449981.2_Silent_p.Q3412Q			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3195	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Q3195Q(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TACTATTTCAAAAGAAAATTG	0.358																																					p.Q3195Q												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A9585G	6						.						132.0	122.0	125.0					6																	38885110		2203	4300	6503	38993088	SO:0001819	synonymous_variant	1769	exon67			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.9585A>G	6.37:g.38885110A>G		Somatic		Capture	SOLID	Phase_I	38993088	NM_001371	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37																																																																																					DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
SYNE1	23345	hgsc.bcm.edu	37	6	152652716	152652716	+	Silent	SNP	G	G	A	rs574053671		TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr6:152652716G>A	ENST00000367255.5	-	78	13705	c.13104C>T	c.(13102-13104)gcC>gcT	p.A4368A	SYNE1_ENST00000448038.1_Silent_p.A4297A|SYNE1_ENST00000265368.4_Silent_p.A4368A|SYNE1_ENST00000341594.5_Silent_p.A4233A|SYNE1_ENST00000423061.1_Silent_p.A4297A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4368					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.A4368A(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TAAGGGCCTCGGCGATGTTGG	0.522										HNSCC(10;0.0054)																											p.A4297A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C12891T	6						.						122.0	121.0	121.0					6																	152652716		2203	4300	6503	152694409	SO:0001819	synonymous_variant	23345	exon77			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.13104C>T	6.37:g.152652716G>A		Somatic		Capture	SOLID	Phase_I	152694409	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																				SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
CRYBA1	1411	hgsc.bcm.edu	37	17	27581241	27581241	+	Silent	SNP	T	T	C			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr17:27581241T>C	ENST00000225387.3	+	6	523	c.522T>C	c.(520-522)ccT>ccC	p.P174P		NM_005208.4	NP_005199.2	P05813	CRBA1_HUMAN	crystallin, beta A1	174	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.			QYP -> HYL (in Ref. 1; AAA52107). {ECO:0000305}.	lens development in camera-type eye (GO:0002088)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)	p.P174P(1)		breast(1)|large_intestine(2)|lung(1)|prostate(1)	5			BRCA - Breast invasive adenocarcinoma(11;3.3e-05)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			ACCAATATCCTGGATATCGTG	0.413																																					p.P174P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T522C	17						.						132.0	127.0	128.0					17																	27581241		2203	4300	6503	24605367	SO:0001819	synonymous_variant	1411	exon6				CCDS11249.1	17q11.2-q12	2008-07-18			ENSG00000108255	ENSG00000108255			2394	protein-coding gene	gene with protein product	"""eye lens structural protein"""	123610		CRYB1		3745196, 3770741	Standard	NM_005208		Approved		uc002hdw.3	P05813	OTTHUMG00000132729	ENST00000225387.3:c.522T>C	17.37:g.27581241T>C		Somatic		Capture	SOLID	Phase_I	24605367	NM_005208	Q13633|Q14CM9	Silent	SNP	ENST00000225387.3	37	CCDS11249.1																																																																																				CRYBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256071.2	NM_005208	
GRN	2896	hgsc.bcm.edu	37	17	42427634	42427634	+	Nonsense_Mutation	SNP	C	C	T	rs63749801		TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr17:42427634C>T	ENST00000053867.3	+	5	450	c.388C>T	c.(388-390)Cag>Tag	p.Q130*	GRN_ENST00000589265.1_Nonsense_Mutation_p.Q130*	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	130					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)	p.Q130*(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CCCTGATAGTCAGTTCGAATG	0.582																																					p.Q130X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C388T	17	GRCh37	CD063534	GRN	D	rs63749801	.						231.0	196.0	208.0					17																	42427634		2203	4300	6503	39783160	SO:0001587	stop_gained	2896	exon5			M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.388C>T	17.37:g.42427634C>T	ENSP00000053867:p.Gln130*	Somatic		Capture	SOLID	Phase_I	39783160	NM_002087	D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Nonsense_Mutation	SNP	ENST00000053867.3	37	CCDS11483.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.428734	0.43122	.	.	ENSG00000030582	ENST00000053867;ENST00000357351	.	.	.	4.22	2.02	0.26589	.	0.522349	0.17163	N	0.184591	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	-6.1474	7.4811	0.27406	0.1753:0.4828:0.3419:0.0	.	.	.	.	X	130	.	ENSP00000053867:Q130X	Q	+	1	0	GRN	39783160	0.000000	0.05858	0.038000	0.18304	0.003000	0.03518	0.203000	0.17315	0.944000	0.37579	0.462000	0.41574	CAG		GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457766.1	NM_002087	
TP53	7157	hgsc.bcm.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	C	T	rs28934575|rs397516437		TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr17:7577548C>T	ENST00000269305.4	-	7	922	c.733G>A	c.(733-735)Ggc>Agc	p.G245S	TP53_ENST00000359597.4_Missense_Mutation_p.G245S|TP53_ENST00000445888.2_Missense_Mutation_p.G245S|TP53_ENST00000413465.2_Missense_Mutation_p.G245S|TP53_ENST00000420246.2_Missense_Mutation_p.G245S|TP53_ENST00000455263.2_Missense_Mutation_p.G245S|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGTTCATGCCGCCCATGCAG	0.577	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.G245S	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,0	.	420	Substitution - Missense(390)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)|Insertion - Frameshift(1)	large_intestine(119)|lung(51)|breast(38)|ovary(29)|central_nervous_system(27)|upper_aerodigestive_tract(25)|stomach(25)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(22)|urinary_tract(14)|skin(9)|liver(7)|prostate(7)|biliary_tract(5)|bone(5)|pancreas(4)|soft_tissue(3)|vulva(2)|endometrium(2)|kidney(1)|cervix(1)|salivary_gland(1)	c.G733A	17	GRCh37	CM010463|CM900210|CM920674	TP53	M	rs28934575	.	C	SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	149.0	112.0	125.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	733,733,733,733,337,337,337	4.6	1.0	17	dbSNP_125	125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	56,56,56,56,56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	245/394,245/394,245/347,245/342,113/262,113/210,113/215	7577548	1,13005	2203	4300	6503	7518273	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.733G>A	17.37:g.7577548C>T	ENSP00000269305:p.Gly245Ser	Somatic		Capture	SOLID	Phase_I	7518273	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	33	5.259904	0.95368	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99878	0.9942	M	0.84585	2.705	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.976;0.992;0.999;0.999;1.0	D	0.96039	0.9023	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	rs28934575	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245S;ENSP00000352610:G245S;ENSP00000269305:G245S;ENSP00000398846:G245S;ENSP00000391127:G245S;ENSP00000391478:G245S;ENSP00000425104:G113S;ENSP00000423862:G152S	ENSP00000269305:G245S	G	-	1	0	TP53	7518273	1.000000	0.71417	0.965000	0.40720	0.974000	0.67602	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CANT1	124583	hgsc.bcm.edu	37	17	76989698	76989698	+	Silent	SNP	G	G	A			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr17:76989698G>A	ENST00000302345.2	-	4	1634	c.1140C>T	c.(1138-1140)gaC>gaT	p.D380D	CANT1_ENST00000392446.5_Silent_p.D380D|CANT1_ENST00000591773.1_Silent_p.D380D	NM_001159773.1|NM_138793.3	NP_001153245.1|NP_620148.1	Q8WVQ1	CANT1_HUMAN	calcium activated nucleotidase 1	380					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|proteoglycan biosynthetic process (GO:0030166)|signal transduction (GO:0007165)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|signal transducer activity (GO:0004871)|uridine-diphosphatase activity (GO:0045134)	p.D380D(1)	CANT1/ETV4(3)	cervix(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			GGAAGCGCCCGTCCAGCGTGA	0.542			T	ETV4	prostate						OREG0024788	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D380D			Dom	yes		17	17q25	124583	calcium activated nucleotidase 1		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1140T	17						.						89.0	73.0	78.0					17																	76989698		2203	4300	6503	74501293	SO:0001819	synonymous_variant	124583	exon5			AJ312208	CCDS11760.1	17q25.3	2008-02-05	2004-10-12	2004-10-15		ENSG00000171302			19721	protein-coding gene	gene with protein product	"""Soluble Ca-Activated Nucleotidase, isozyme 1"""	613165				12167635	Standard	NM_138793		Approved	SHAPY, SCAN-1	uc002jwk.3	Q8WVQ1		ENST00000302345.2:c.1140C>T	17.37:g.76989698G>A		Somatic	1172	Capture	SOLID	Phase_I	74501293	NM_001159773	B4DJ54|Q7Z2J7|Q8NG05|Q8NHP0|Q9BSD5	Silent	SNP	ENST00000302345.2	37	CCDS11760.1																																																																																				CANT1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437723.2	NM_138793	
RHO	6010	hgsc.bcm.edu	37	3	129251484	129251484	+	Missense_Mutation	SNP	G	G	A	rs200894277		TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr3:129251484G>A	ENST00000296271.3	+	4	899	c.805G>A	c.(805-807)Gcc>Acc	p.A269T		NM_000539.3	NP_000530.1	P08100	OPSD_HUMAN	rhodopsin	269					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|protein phosphorylation (GO:0006468)|protein-chromophore linkage (GO:0018298)|red, far-red light phototransduction (GO:0009585)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|retinoid metabolic process (GO:0001523)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cell-cell junction (GO:0005911)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor inner segment membrane (GO:0060342)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|rough endoplasmic reticulum membrane (GO:0030867)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)|photoreceptor activity (GO:0009881)|retinal binding (GO:0016918)	p.A269T(1)		breast(1)|endometrium(1)|large_intestine(10)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	22		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)	GGTGCCCTACGCCAGCGTGGC	0.572																																					p.A269T	Esophageal Squamous(118;214 1623 30842 43234 46940)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G805A	3						.						201.0	152.0	169.0					3																	129251484		2203	4300	6503	130734174	SO:0001583	missense	6010	exon4			AB065668	CCDS3063.1	3q21-q24	2014-01-28	2008-04-16		ENSG00000163914	ENSG00000163914		"""GPCR / Class A : Opsin receptors"""	10012	protein-coding gene	gene with protein product	"""opsin 2, rod pigment"""	180380	"""retinitis pigmentosa 4, autosomal dominant"""	RP4		2016091	Standard	NM_000539		Approved	OPN2, CSNBAD1	uc003emt.3	P08100	OTTHUMG00000159542	ENST00000296271.3:c.805G>A	3.37:g.129251484G>A	ENSP00000296271:p.Ala269Thr	Somatic		Capture	SOLID	Phase_I	130734174	NM_000539	Q16414|Q2M249	Missense_Mutation	SNP	ENST00000296271.3	37	CCDS3063.1	.	.	.	.	.	.	.	.	.	.	G	31	5.068105	0.93950	.	.	ENSG00000163914	ENST00000296271	T	0.37915	1.17	5.51	5.51	0.81932	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.67496	0.2899	M	0.86573	2.825	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.73272	-0.4035	10	0.87932	D	0	.	19.0257	0.92931	0.0:0.0:1.0:0.0	.	269	P08100	OPSD_HUMAN	T	269	ENSP00000296271:A269T	ENSP00000296271:A269T	A	+	1	0	RHO	130734174	1.000000	0.71417	0.451000	0.26982	0.723000	0.41478	9.863000	0.99569	2.595000	0.87683	0.561000	0.74099	GCC		RHO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356101.1	NM_000539	
CPB1	1360	hgsc.bcm.edu	37	3	148577718	148577718	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr3:148577718C>T	ENST00000491148.1	+	12	1517	c.1183C>T	c.(1183-1185)Cgg>Tgg	p.R395W	CPB1_ENST00000282957.4_Missense_Mutation_p.R395W|CPB1_ENST00000498639.1_3'UTR|RP11-680B3.2_ENST00000488190.1_RNA			P15086	CBPB1_HUMAN	carboxypeptidase B1 (tissue)	395						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.R395W(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	38			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			ATCCCAGATCCGGGCTACCTG	0.483																																					p.R395W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1183T	3						.						80.0	80.0	80.0					3																	148577718		2203	4300	6503	150060408	SO:0001583	missense	1360	exon11			AJ224866	CCDS33874.1	3q24	2012-02-10			ENSG00000153002	ENSG00000153002	3.4.17.2		2299	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase B"", ""tissue carboxypeptidase B"", ""protaminase"""	114852					Standard	XM_005247124		Approved		uc003ewl.3	P15086	OTTHUMG00000159520	ENST00000491148.1:c.1183C>T	3.37:g.148577718C>T	ENSP00000417222:p.Arg395Trp	Somatic		Capture	SOLID	Phase_I	150060408	NM_001871	O60834|Q53XJ0|Q96BQ8	Missense_Mutation	SNP	ENST00000491148.1	37	CCDS33874.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679803	0.47886	.	.	ENSG00000153002	ENST00000491148;ENST00000282957	T;T	0.11169	2.8;2.8	5.75	2.65	0.31530	Peptidase M14, carboxypeptidase A (2);	0.414552	0.27581	N	0.018732	T	0.23410	0.0566	M	0.64567	1.98	0.24449	N	0.994497	D	0.76494	0.999	P	0.57204	0.815	T	0.04537	-1.0944	10	0.72032	D	0.01	.	13.6331	0.62206	0.6842:0.3158:0.0:0.0	.	395	P15086	CBPB1_HUMAN	W	395	ENSP00000417222:R395W;ENSP00000282957:R395W	ENSP00000282957:R395W	R	+	1	2	CPB1	150060408	0.310000	0.24527	0.439000	0.26833	0.181000	0.23173	1.954000	0.40362	0.751000	0.32900	0.655000	0.94253	CGG		CPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355928.1	NM_001871	
RTP1	132112	hgsc.bcm.edu	37	3	186917725	186917725	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr3:186917725C>T	ENST00000312295.4	+	2	689	c.659C>T	c.(658-660)gCg>gTg	p.A220V	RP11-208N14.4_ENST00000356133.3_RNA	NM_153708.2	NP_714919.2	P59025	RTP1_HUMAN	receptor (chemosensory) transporter protein 1	220					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)	p.A220V(2)		breast(2)|endometrium(4)|large_intestine(5)|lung(6)|ovary(3)|skin(2)	22	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		TTCTCCCGGGCGCCCAGCCCC	0.647																																					p.A220V												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.C659T	3						.						49.0	47.0	48.0					3																	186917725		2203	4300	6503	188400419	SO:0001583	missense	132112	exon2			BC034744	CCDS3287.2	3q27.3	2014-02-20	2006-11-21		ENSG00000175077	ENSG00000175077		"""Receptor transporter proteins"""	28580	protein-coding gene	gene with protein product	"""receptor transporting protein 1"", ""zinc finger, 3CxxC-type 1"""	609137	"""receptor transporter protein 1"""			16271481, 15550249, 16720576	Standard	NM_153708		Approved	MGC35450, Z3CXXC1	uc003frg.3	P59025	OTTHUMG00000149886	ENST00000312295.4:c.659C>T	3.37:g.186917725C>T	ENSP00000311712:p.Ala220Val	Somatic		Capture	SOLID	Phase_I	188400419	NM_153708		Missense_Mutation	SNP	ENST00000312295.4	37	CCDS3287.2	.	.	.	.	.	.	.	.	.	.	C	15.45	2.838673	0.51057	.	.	ENSG00000175077	ENST00000312295	T	0.16743	2.32	5.74	4.87	0.63330	.	0.160521	0.41823	D	0.000813	T	0.10809	0.0264	L	0.29908	0.895	0.24462	N	0.994432	P	0.45078	0.85	B	0.33392	0.163	T	0.16188	-1.0411	10	0.54805	T	0.06	.	10.5722	0.45206	0.0:0.9117:0.0:0.0883	.	220	P59025	RTP1_HUMAN	V	220	ENSP00000311712:A220V	ENSP00000311712:A220V	A	+	2	0	RTP1	188400419	0.742000	0.28228	0.914000	0.36105	0.847000	0.48162	1.078000	0.30754	1.440000	0.47531	0.655000	0.94253	GCG		RTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313731.2	NM_153708	
NR4A1	3164	hgsc.bcm.edu	37	12	52449880	52449880	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr12:52449880C>T	ENST00000243050.1	+	4	1257	c.943C>T	c.(943-945)Cgg>Tgg	p.R315W	NR4A1_ENST00000545748.1_Missense_Mutation_p.R369W|NR4A1_ENST00000394824.2_Missense_Mutation_p.R315W|NR4A1_ENST00000394825.1_Missense_Mutation_p.R315W|RP11-1100L3.8_ENST00000564363.1_lincRNA|NR4A1_ENST00000550082.1_Missense_Mutation_p.R328W|NR4A1_ENST00000360284.3_Missense_Mutation_p.R328W	NM_002135.4	NP_002126.2	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	315					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell chemotaxis (GO:0035767)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.R315W(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)	16				BRCA - Breast invasive adenocarcinoma(357;0.0967)		GGACAAGAGGCGGCGAAACCG	0.627																																					p.R315W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C943T	12						.						86.0	81.0	83.0					12																	52449880		2203	4300	6503	50736147	SO:0001583	missense	3164	exon4			L13740	CCDS8818.1, CCDS55828.1, CCDS73471.1	12q13	2013-01-16			ENSG00000123358	ENSG00000123358		"""Nuclear hormone receptors"""	7980	protein-coding gene	gene with protein product		139139		HMR, GFRP1		2626032	Standard	NM_002135		Approved	TR3, N10, NAK-1, NGFIB, NUR77	uc001rzt.3	P22736	OTTHUMG00000150393	ENST00000243050.1:c.943C>T	12.37:g.52449880C>T	ENSP00000243050:p.Arg315Trp	Somatic		Capture	SOLID	Phase_I	50736147	NM_002135	B4DML7|Q15627|Q53Y00|Q6IBU8	Missense_Mutation	SNP	ENST00000243050.1	37	CCDS8818.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.067094	0.76301	.	.	ENSG00000123358	ENST00000360284;ENST00000545748;ENST00000550082;ENST00000243050;ENST00000394825;ENST00000394824	D;D;D;D;D;D	0.97430	-4.38;-4.38;-4.38;-4.38;-4.38;-4.38	4.27	3.35	0.38373	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.000000	0.85682	D	0.000000	D	0.98544	0.9514	M	0.91872	3.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.99368	1.0919	10	0.87932	D	0	.	13.0225	0.58796	0.1633:0.8367:0.0:0.0	.	328;315	B4DML7;P22736	.;NR4A1_HUMAN	W	328;369;328;315;315;315	ENSP00000353427:R328W;ENSP00000440864:R369W;ENSP00000449539:R328W;ENSP00000243050:R315W;ENSP00000378302:R315W;ENSP00000378301:R315W	ENSP00000243050:R315W	R	+	1	2	NR4A1	50736147	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.040000	0.49799	1.348000	0.45733	0.561000	0.74099	CGG		NR4A1-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317922.2		
ERBB3	2065	hgsc.bcm.edu	37	12	56482606	56482606	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr12:56482606A>G	ENST00000267101.3	+	9	1503	c.1063A>G	c.(1063-1065)Acc>Gcc	p.T355A	ERBB3_ENST00000415288.2_Missense_Mutation_p.T296A|ERBB3_ENST00000450146.2_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	355					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)	p.T355A(1)		central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			TGTGAACTGCACCAAGATCCT	0.552																																					p.T355A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1063G	12						.						152.0	138.0	143.0					12																	56482606		2203	4300	6503	54768873	SO:0001583	missense	2065	exon9			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.1063A>G	12.37:g.56482606A>G	ENSP00000267101:p.Thr355Ala	Somatic		Capture	SOLID	Phase_I	54768873	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	37	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	A	29.0	4.968800	0.92855	.	.	ENSG00000065361	ENST00000267101;ENST00000415288	D;D	0.82081	-1.57;-1.57	5.52	5.52	0.82312	EGF receptor, L domain (1);	0.000000	0.64402	D	0.000004	D	0.93390	0.7892	H	0.94658	3.565	0.80722	D	1	D;D	0.89917	0.99;1.0	P;D	0.85130	0.861;0.997	D	0.94972	0.8118	10	0.87932	D	0	.	14.7594	0.69593	1.0:0.0:0.0:0.0	.	35;355	O75810;P21860	.;ERBB3_HUMAN	A	355;296	ENSP00000267101:T355A;ENSP00000408340:T296A	ENSP00000267101:T355A	T	+	1	0	ERBB3	54768873	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	8.668000	0.91158	2.317000	0.78254	0.460000	0.39030	ACC		ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
RAB3IP	117177	hgsc.bcm.edu	37	12	70194021	70194021	+	Silent	SNP	G	G	A			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr12:70194021G>A	ENST00000247833.7	+	7	1297	c.921G>A	c.(919-921)ttG>ttA	p.L307L	RAB3IP_ENST00000553099.1_Silent_p.L101L|RAB3IP_ENST00000483530.2_Silent_p.L307L|RAB3IP_ENST00000550847.1_Silent_p.L14L|AC025263.3_ENST00000550437.1_5'Flank|RAB3IP_ENST00000550536.1_Silent_p.L323L|RAB3IP_ENST00000362025.5_Silent_p.L323L|RAB3IP_ENST00000325555.9_Silent_p.L101L|RAB3IP_ENST00000551641.1_Silent_p.L101L					RAB3A interacting protein									p.L323L(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22	Esophageal squamous(21;0.187)		Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)			AATTCCGATTGTGGAAGGATG	0.348																																					p.L307L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G921A	12						.						110.0	102.0	105.0					12																	70194021		2203	4300	6503	68480288	SO:0001819	synonymous_variant	117177	exon7				CCDS8993.1, CCDS8995.1, CCDS8996.1, CCDS41811.1, CCDS44942.1	12q15	2013-01-22	2013-01-22		ENSG00000127328	ENSG00000127328			16508	protein-coding gene	gene with protein product	"""rabin3"""	608686					Standard	NM_175623		Approved	RABIN3	uc001svm.3	Q96QF0	OTTHUMG00000169437	ENST00000247833.7:c.921G>A	12.37:g.70194021G>A		Somatic		Capture	SOLID	Phase_I	68480288	NM_175624		Silent	SNP	ENST00000247833.7	37	CCDS8995.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.522|6.522	0.464584|0.464584	0.12402|0.12402	.|.	.|.	ENSG00000127328|ENSG00000127328	ENST00000526994|ENST00000550647	.|.	.|.	.|.	5.36|5.36	4.22|4.22	0.49857|0.49857	.|.	.|.	.|.	.|.	.|.	T|T	0.47930|0.47930	0.1472|0.1472	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.41645|0.41645	-0.9497|-0.9497	4|4	.|.	.|.	.|.	.|.	3.9353|3.9353	0.09304|0.09304	0.125:0.0724:0.1396:0.663|0.125:0.0724:0.1396:0.663	.|.	.|.	.|.	.|.	Y|M	39|197	.|.	.|.	C|V	+|+	2|1	0|0	RAB3IP|RAB3IP	68480288|68480288	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.811000|0.811000	0.45836|0.45836	0.818000|0.818000	0.27295|0.27295	0.887000|0.887000	0.36136|0.36136	0.305000|0.305000	0.20034|0.20034	TGT|GTG		RAB3IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280671.2	NM_022456	
PAH	5053	hgsc.bcm.edu	37	12	103306635	103306635	+	Silent	SNP	G	G	T			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr12:103306635G>T	ENST00000553106.1	-	2	574	c.102C>A	c.(100-102)gcC>gcA	p.A34A	PAH_ENST00000307000.2_Silent_p.A29A|PAH_ENST00000551988.1_5'UTR	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	34					catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)	p.A34A(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	TCAGTGATATGGCACCATTTT	0.368																																					p.A34A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C102A	12						.						233.0	203.0	213.0					12																	103306635		2203	4300	6503	101830765	SO:0001819	synonymous_variant	5053	exon2			U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.102C>A	12.37:g.103306635G>T		Somatic		Capture	SOLID	Phase_I	101830765	NM_000277	Q16717|Q8TC14	Silent	SNP	ENST00000553106.1	37	CCDS9092.1																																																																																				PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406692.1		
IREB2	3658	hgsc.bcm.edu	37	15	78758705	78758705	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr15:78758705G>T	ENST00000258886.8	+	5	652	c.503G>T	c.(502-504)tGc>tTc	p.C168F	IREB2_ENST00000559427.1_3'UTR|IREB2_ENST00000560440.1_Missense_Mutation_p.C168F	NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	168					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)	p.C168F(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		AAGCTTCCCTGCAGAGGCCAG	0.488																																					p.C168F	NSCLC(200;764 2208 35157 49871 50830)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G503T	15						.						84.0	82.0	83.0					15																	78758705		2196	4293	6489	76545760	SO:0001583	missense	3658	exon5			M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.503G>T	15.37:g.78758705G>T	ENSP00000258886:p.Cys168Phe	Somatic		Capture	SOLID	Phase_I	76545760	NM_004136	A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	ENST00000258886.8	37	CCDS10302.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.549946	0.86127	.	.	ENSG00000136381	ENST00000258886	T	0.18657	2.2	6.08	6.08	0.98989	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (1);	0.042198	0.85682	D	0.000000	T	0.40015	0.1100	L	0.32530	0.975	0.80722	D	1	D;D	0.76494	0.999;0.996	D;P	0.80764	0.994;0.896	T	0.08086	-1.0739	10	0.87932	D	0	.	20.6721	0.99693	0.0:0.0:1.0:0.0	.	168;168	P48200;Q8WVK6	IREB2_HUMAN;.	F	168	ENSP00000258886:C168F	ENSP00000258886:C168F	C	+	2	0	IREB2	76545760	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.148000	0.89630	2.894000	0.99253	0.591000	0.81541	TGC		IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290109.3	NM_004136	
CORIN	10699	hgsc.bcm.edu	37	4	47663763	47663763	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr4:47663763T>C	ENST00000273857.4	-	12	1699	c.1700A>G	c.(1699-1701)aAt>aGt	p.N567S	CORIN_ENST00000502252.1_Missense_Mutation_p.N500S|CORIN_ENST00000504584.1_Missense_Mutation_p.N530S|CORIN_ENST00000508498.1_Missense_Mutation_p.N428S|CORIN_ENST00000505909.1_Missense_Mutation_p.N530S	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	567	FZ 2. {ECO:0000255|PROSITE- ProRule:PRU00090}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)	p.N567S(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						GCAGGTTTGATTGTCTGAATT	0.403																																					p.N567S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1700G	4						.						119.0	113.0	115.0					4																	47663763		2203	4300	6503	47358520	SO:0001583	missense	10699	exon12			AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.1700A>G	4.37:g.47663763T>C	ENSP00000273857:p.Asn567Ser	Somatic		Capture	SOLID	Phase_I	47358520	NM_006587	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	ENST00000273857.4	37	CCDS3477.1	.	.	.	.	.	.	.	.	.	.	T	16.23	3.063321	0.55432	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909;ENST00000504584	T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93;-0.93	5.9	4.71	0.59529	Frizzled domain (5);	0.000000	0.85682	D	0.000000	T	0.81711	0.4880	M	0.67700	2.07	0.38218	D	0.940675	D;B;D;D	0.76494	0.998;0.125;0.993;0.999	D;B;P;D	0.72625	0.953;0.053;0.875;0.978	T	0.79688	-0.1699	10	0.12766	T	0.61	.	12.1161	0.53866	0.0:0.0671:0.0:0.9329	.	530;530;500;567	B7Z4R1;B4E2W9;B4E1Y7;Q9Y5Q5	.;.;.;CORIN_HUMAN	S	567;428;500;530;530	ENSP00000273857:N567S;ENSP00000425597:N428S;ENSP00000424212:N500S;ENSP00000425401:N530S;ENSP00000423216:N530S	ENSP00000273857:N567S	N	-	2	0	CORIN	47358520	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	4.435000	0.59941	1.055000	0.40461	0.528000	0.53228	AAT		CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2		
EPHA5	2044	hgsc.bcm.edu	37	4	66286211	66286211	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr4:66286211G>C	ENST00000273854.3	-	6	2075	c.1475C>G	c.(1474-1476)cCa>cGa	p.P492R	EPHA5_ENST00000511294.1_Missense_Mutation_p.P492R|EPHA5_ENST00000432638.2_Missense_Mutation_p.P328R|EPHA5_ENST00000354839.4_Missense_Mutation_p.P492R	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	492	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.P492R(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						GGGACGATCTGGTTCTTGCCA	0.343										TSP Lung(17;0.13)																											p.P492R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1475G	4						.						181.0	169.0	173.0					4																	66286211		2203	4300	6503	65968806	SO:0001583	missense	2044	exon6			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1475C>G	4.37:g.66286211G>C	ENSP00000273854:p.Pro492Arg	Somatic		Capture	SOLID	Phase_I	65968806	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.462359	0.84425	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;D;T;T	0.91351	-0.87;-2.83;-0.87;-0.87	5.17	5.17	0.71159	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000038	D	0.97776	0.9270	H	0.99582	4.64	0.80722	D	1	D;P;D;D	0.89917	1.0;0.828;1.0;1.0	D;P;D;D	0.97110	1.0;0.838;1.0;1.0	D	0.99828	1.1052	10	0.87932	D	0	.	18.6738	0.91521	0.0:0.0:1.0:0.0	.	492;492;492;492	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	R	492;328;492;492	ENSP00000273854:P492R;ENSP00000389208:P328R;ENSP00000346899:P492R;ENSP00000427638:P492R	ENSP00000273854:P492R	P	-	2	0	EPHA5	65968806	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.824000	0.99380	2.417000	0.82017	0.467000	0.42956	CCA		EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
FAT4	79633	hgsc.bcm.edu	37	4	126371089	126371089	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr4:126371089T>G	ENST00000394329.3	+	9	8931	c.8918T>G	c.(8917-8919)aTa>aGa	p.I2973R	FAT4_ENST00000335110.5_Missense_Mutation_p.I1271R	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2973	Cadherin 28. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I2973R(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ACCATCAATATAGTGGACAGT	0.348																																					p.I2973R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T8918G	4						.						65.0	67.0	66.0					4																	126371089		2203	4299	6502	126590539	SO:0001583	missense	79633	exon9			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.8918T>G	4.37:g.126371089T>G	ENSP00000377862:p.Ile2973Arg	Somatic		Capture	SOLID	Phase_I	126590539	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	T	12.63	1.996290	0.35226	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.59083	0.29;0.29	5.34	-3.29	0.05017	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.561269	0.13053	U	0.417495	T	0.68393	0.2996	M	0.85630	2.765	0.26555	N	0.973832	P;P;P	0.40619	0.573;0.724;0.677	B;P;P	0.48770	0.277;0.589;0.453	T	0.70070	-0.4973	10	0.87932	D	0	.	14.9884	0.71365	0.0:0.1274:0.0:0.8726	.	1271;2973;2973	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	R	2973;1271	ENSP00000377862:I2973R;ENSP00000335169:I1271R	ENSP00000335169:I1271R	I	+	2	0	FAT4	126590539	0.971000	0.33674	0.003000	0.11579	0.727000	0.41649	1.897000	0.39799	-0.648000	0.05437	-0.250000	0.11733	ATA		FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
MAGEE2	139599	hgsc.bcm.edu	37	X	75004320	75004320	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chrX:75004320C>G	ENST00000373359.2	-	1	759	c.567G>C	c.(565-567)ttG>ttC	p.L189F		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	189	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.L189F(1)		autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGTTCCCATTCAAGAGGATGT	0.507																																					p.L189F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G567C	X						.						54.0	48.0	50.0					X																	75004320		2203	4300	6503	74921045	SO:0001583	missense	139599	exon1			AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.567G>C	X.37:g.75004320C>G	ENSP00000362457:p.Leu189Phe	Somatic		Capture	SOLID	Phase_I	74921045	NM_138703	Q5JSI5	Missense_Mutation	SNP	ENST00000373359.2	37	CCDS14431.1	.	.	.	.	.	.	.	.	.	.	C	7.108	0.575375	0.13623	.	.	ENSG00000186675	ENST00000373359	T	0.06218	3.33	3.1	2.23	0.28157	.	.	.	.	.	T	0.18800	0.0451	M	0.81942	2.565	0.09310	N	1	D	0.65815	0.995	P	0.60949	0.881	T	0.06320	-1.0833	9	0.72032	D	0.01	.	5.315	0.15850	0.0:0.8377:0.0:0.1623	.	189	Q8TD90	MAGE2_HUMAN	F	189	ENSP00000362457:L189F	ENSP00000362457:L189F	L	-	3	2	MAGEE2	74921045	1.000000	0.71417	0.024000	0.17045	0.136000	0.21042	0.595000	0.24029	0.689000	0.31550	0.422000	0.28245	TTG		MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057288.1	NM_138703	
COL4A5	1287	hgsc.bcm.edu	37	X	107827719	107827719	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chrX:107827719A>C	ENST00000361603.2	+	18	1240	c.996A>C	c.(994-996)caA>caC	p.Q332H	COL4A5_ENST00000328300.6_Missense_Mutation_p.Q332H	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	332	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.Q332H(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						AACAGGGCCAAAAAGGTGACA	0.333									Alport syndrome with Diffuse Leiomyomatosis																												p.Q332H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A996C	X						.						72.0	71.0	72.0					X																	107827719		2203	4300	6503	107714375	SO:0001583	missense	1287	exon18	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.996A>C	X.37:g.107827719A>C	ENSP00000354505:p.Gln332His	Somatic		Capture	SOLID	Phase_I	107714375	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	A	11.85	1.761568	0.31228	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.94092	-3.35;-3.35	5.06	0.171	0.15026	.	0.528179	0.19393	N	0.115371	D	0.90143	0.6920	N	0.26130	0.795	0.35539	D	0.802884	P;P	0.48998	0.918;0.918	P;P	0.52267	0.694;0.694	D	0.88863	0.3327	10	0.56958	D	0.05	.	9.4546	0.38747	0.6105:0.0:0.3895:0.0	.	332;332	E7EVY4;P29400	.;CO4A5_HUMAN	H	332	ENSP00000331902:Q332H;ENSP00000354505:Q332H	ENSP00000331902:Q332H	Q	+	3	2	COL4A5	107714375	0.999000	0.42202	0.998000	0.56505	0.760000	0.43138	0.645000	0.24782	0.021000	0.15133	-1.155000	0.01812	CAA		COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
ZNF804A	91752	hgsc.bcm.edu	37	2	185800866	185800866	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr2:185800866G>T	ENST00000302277.6	+	4	1337	c.743G>T	c.(742-744)aGa>aTa	p.R248I		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	248							metal ion binding (GO:0046872)	p.R248I(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GGATTTAGCAGAAAAAGTAGA	0.428																																					p.R248I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G743T	2						.						93.0	88.0	90.0					2																	185800866		2203	4299	6502	185509111	SO:0001583	missense	91752	exon4			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.743G>T	2.37:g.185800866G>T	ENSP00000303252:p.Arg248Ile	Somatic		Capture	SOLID	Phase_I	185509111	NM_194250	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.003980	0.74932	.	.	ENSG00000170396	ENST00000302277	T	0.08193	3.12	5.42	5.42	0.78866	.	0.244842	0.30565	N	0.009347	T	0.28333	0.0700	M	0.61703	1.905	0.50813	D	0.999899	D	0.89917	1.0	D	0.75484	0.986	T	0.00520	-1.1692	10	0.87932	D	0	-23.7529	18.1981	0.89829	0.0:0.0:1.0:0.0	.	248	Q7Z570	Z804A_HUMAN	I	248	ENSP00000303252:R248I	ENSP00000303252:R248I	R	+	2	0	ZNF804A	185509111	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.986000	0.56937	2.532000	0.85374	0.591000	0.81541	AGA		ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
POMC	5443	hgsc.bcm.edu	37	2	25384061	25384061	+	Silent	SNP	C	C	T			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr2:25384061C>T	ENST00000405623.1	-	3	1148	c.693G>A	c.(691-693)ccG>ccA	p.P231P	POMC_ENST00000264708.3_Silent_p.P231P|RP11-509E16.1_ENST00000567599.1_lincRNA|POMC_ENST00000380794.1_Silent_p.P231P|POMC_ENST00000395826.2_Silent_p.P231P			P01189	COLI_HUMAN	proopiomelanocortin	231					cell-cell signaling (GO:0007267)|cellular pigmentation (GO:0033059)|cellular protein metabolic process (GO:0044267)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|negative regulation of tumor necrosis factor production (GO:0032720)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of appetite (GO:0032098)|regulation of blood pressure (GO:0008217)|regulation of corticosterone secretion (GO:2000852)|regulation of glycogen metabolic process (GO:0070873)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|peroxisomal matrix (GO:0005782)|secretory granule (GO:0030141)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|hormone activity (GO:0005179)|receptor binding (GO:0005102)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)	p.P231P(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Loperamide(DB00836)	TGTCCTTGGGCGGGCTGCCCC	0.642																																					p.P231P	Colon(110;1515 1566 8452 10082 43216)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G693A	2						.						35.0	37.0	36.0					2																	25384061		2203	4300	6503	25237565	SO:0001819	synonymous_variant	5443	exon4				CCDS1717.1	2p23	2013-02-25	2008-07-31		ENSG00000115138	ENSG00000115138		"""Endogenous ligands"""	9201	protein-coding gene	gene with protein product	"""adrenocorticotropin"", ""beta-lipotropin"", ""alpha-melanocyte stimulating hormone"", ""beta-melanocyte stimulating hormone"", ""beta-endorphin"", ""adrenocorticotropic hormone"", ""opiomelanocortin prepropeptide"""	176830				6254047, 9620771	Standard	NM_001035256		Approved	MSH, POC, CLIP, ACTH, NPP, LPH	uc002rfz.1	P01189	OTTHUMG00000094764	ENST00000405623.1:c.693G>A	2.37:g.25384061C>T		Somatic		Capture	SOLID	Phase_I	25237565	NM_001035256	P78442|Q53T23|Q9UD39|Q9UD40	Silent	SNP	ENST00000405623.1	37	CCDS1717.1																																																																																				POMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211573.3	NM_001035256	
GPR113	165082	hgsc.bcm.edu	37	2	26537402	26537402	+	Nonsense_Mutation	SNP	G	G	A	rs201621850	byFrequency	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr2:26537402G>A	ENST00000311519.1	-	7	1011	c.1012C>T	c.(1012-1014)Cga>Tga	p.R338*	GPR113_ENST00000333478.6_Nonsense_Mutation_p.R139*|GPR113_ENST00000459892.1_Intron|GPR113_ENST00000421160.2_Nonsense_Mutation_p.R269*|GPR113_ENST00000541401.1_Intron	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	338					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R139*(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TATGGAAGTCGAGCCACATCT	0.602													G|||	3	0.000599042	0.0	0.0	5008	,	,		18568	0.002		0.001	False		,,,				2504	0.0				p.R269X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C805T	2						.						129.0	102.0	111.0					2																	26537402		2203	4300	6503	26390906	SO:0001587	stop_gained	165082	exon6			AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.1012C>T	2.37:g.26537402G>A	ENSP00000307831:p.Arg338*	Somatic		Capture	SOLID	Phase_I	26390906	NM_001145169	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Nonsense_Mutation	SNP	ENST00000311519.1	37	CCDS46239.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	38	7.260560	0.98171	.	.	ENSG00000173567	ENST00000333478;ENST00000421160;ENST00000311519	.	.	.	5.3	3.44	0.39384	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.4148	8.8523	0.35208	0.0:0.3263:0.5184:0.1552	.	.	.	.	X	139;269;338	.	.	R	-	1	2	GPR113	26390906	0.001000	0.12720	0.001000	0.08648	0.477000	0.33069	0.753000	0.26376	0.590000	0.29694	0.462000	0.41574	CGA		GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	NM_153835	
GNLY	10578	hgsc.bcm.edu	37	2	85921570	85921570	+	Missense_Mutation	SNP	C	C	A	rs200705717		TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr2:85921570C>A	ENST00000263863.4	+	1	157	c.29C>A	c.(28-30)gCa>gAa	p.A10E	GNLY_ENST00000533041.1_3'UTR|GNLY_ENST00000524600.1_Missense_Mutation_p.A10E|GNLY_ENST00000409696.3_5'UTR	NM_006433.3	NP_006424.2	P22749	GNLY_HUMAN	granulysin	10					cellular defense response (GO:0006968)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|killing of cells of other organism (GO:0031640)	extracellular space (GO:0005615)		p.A10E(1)		endometrium(4)|kidney(10)|large_intestine(1)|lung(1)|skin(2)|upper_aerodigestive_tract(1)	19						CTGCTCCTTGCAGCCATGCTC	0.612																																					p.A10E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C29A	2						.						84.0	72.0	76.0					2																	85921570		2203	4300	6503	85775081	SO:0001583	missense	10578	exon1			X54101	CCDS1984.1, CCDS46354.1	2p12-q11	2008-02-05			ENSG00000115523	ENSG00000115523			4414	protein-coding gene	gene with protein product	"""T-lymphocyte activation gene 519"""	188855		LAG2		2212946, 2434598	Standard	NM_012483		Approved	NKG5, LAG-2, D2S69E, TLA519	uc002sql.4	P22749	OTTHUMG00000130179	ENST00000263863.4:c.29C>A	2.37:g.85921570C>A	ENSP00000263863:p.Ala10Glu	Somatic		Capture	SOLID	Phase_I	85775081	NM_006433	P09325|Q6GU08	Missense_Mutation	SNP	ENST00000263863.4	37	CCDS1984.1	.	.	.	.	.	.	.	.	.	.	C	12.45	1.941390	0.34283	.	.	ENSG00000115523	ENST00000263863;ENST00000524600	T;T	0.60299	0.72;0.2	1.96	1.06	0.20224	.	.	.	.	.	T	0.58963	0.2159	L	0.29908	0.895	0.19775	N	0.999959	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	T	0.44892	-0.9298	9	0.72032	D	0.01	.	4.5744	0.12226	0.0:0.8035:0.0:0.1965	.	10;10	B4E3H9;P22749	.;GNLY_HUMAN	E	10	ENSP00000263863:A10E;ENSP00000436423:A10E	ENSP00000263863:A10E	A	+	2	0	GNLY	85775081	0.025000	0.19082	0.010000	0.14722	0.061000	0.15899	0.157000	0.16402	0.408000	0.25621	0.313000	0.20887	GCA		GNLY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252497.1	NM_006433	
COL6A3	1293	hgsc.bcm.edu	37	2	238259828	238259828	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr2:238259828C>A	ENST00000295550.4	-	27	7213	c.6761G>T	c.(6760-6762)gGa>gTa	p.G2254V	COL6A3_ENST00000346358.4_Missense_Mutation_p.G2054V|COL6A3_ENST00000347401.3_Missense_Mutation_p.G2053V|COL6A3_ENST00000353578.4_Missense_Mutation_p.G2048V|COL6A3_ENST00000409809.1_Missense_Mutation_p.G2048V|COL6A3_ENST00000472056.1_Missense_Mutation_p.G1647V	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2254	Collagen-like 4.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G2254V(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AGCGGCACCTCCGCTTCCCTG	0.567																																					p.G1647V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4940T	2						.						88.0	75.0	79.0					2																	238259828		2203	4300	6503	237924567	SO:0001583	missense	1293	exon24			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6761G>T	2.37:g.238259828C>A	ENSP00000295550:p.Gly2254Val	Somatic		Capture	SOLID	Phase_I	237924567	NM_057166	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	5.142	0.211840	0.09757	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.93604	-3.2;-3.2;-3.25;-3.2;-3.25;-3.2	5.42	3.5	0.40072	.	0.246772	0.28322	N	0.015762	D	0.88153	0.6360	L	0.39085	1.19	0.80722	D	1	B;B;B;B	0.26258	0.09;0.015;0.145;0.09	B;B;B;B	0.25614	0.046;0.011;0.062;0.028	D	0.83905	0.0292	10	0.31617	T	0.26	.	10.565	0.45167	0.1495:0.7067:0.1438:0.0	.	1647;1647;2048;2254	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	V	2254;2053;2048;1647;2048;2054	ENSP00000295550:G2254V;ENSP00000315609:G2053V;ENSP00000315873:G2048V;ENSP00000418285:G1647V;ENSP00000386844:G2048V;ENSP00000295546:G2054V	ENSP00000295550:G2254V	G	-	2	0	COL6A3	237924567	0.975000	0.34042	0.554000	0.28268	0.034000	0.12701	3.315000	0.51951	1.277000	0.44412	-0.175000	0.13238	GGA		COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
RORB	6096	hgsc.bcm.edu	37	9	77257574	77257574	+	Silent	SNP	C	C	T	rs189210068		TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr9:77257574C>T	ENST00000396204.2	+	4	513	c.513C>T	c.(511-513)tcC>tcT	p.S171S	RORB_ENST00000376896.3_Silent_p.S160S			Q92753	RORB_HUMAN	RAR-related orphan receptor B	171	Hinge. {ECO:0000255}.				amacrine cell differentiation (GO:0035881)|cellular response to retinoic acid (GO:0071300)|eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.S160S(1)		breast(2)|large_intestine(4)|lung(1)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	12					Melatonin(DB01065)	ACGTCGATTCCGGTCAGCCGT	0.507																																					p.S160S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C480T	9						.						97.0	82.0	87.0					9																	77257574		2203	4300	6503	76447394	SO:0001819	synonymous_variant	6096	exon4			Y08639	CCDS6646.1	9q22	2013-01-16			ENSG00000198963	ENSG00000198963		"""Nuclear hormone receptors"""	10259	protein-coding gene	gene with protein product		601972				7926749	Standard	NM_006914		Approved	RZRB, NR1F2, ROR-BETA	uc004ajh.3	Q92753	OTTHUMG00000020026	ENST00000396204.2:c.513C>T	9.37:g.77257574C>T		Somatic		Capture	SOLID	Phase_I	76447394	NM_006914	Q8WX73	Silent	SNP	ENST00000396204.2	37																																																																																					RORB-201	KNOWN	basic	protein_coding	protein_coding			
CNTRL	11064	hgsc.bcm.edu	37	9	123920299	123920299	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr9:123920299G>A	ENST00000373855.1	+	30	4936	c.4676G>A	c.(4675-4677)cGc>cAc	p.R1559H	CNTRL_ENST00000373847.1_3'UTR|CNTRL_ENST00000373844.1_Missense_Mutation_p.R4H|CNTRL_ENST00000238341.5_Missense_Mutation_p.R1559H|CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000373850.1_Missense_Mutation_p.R1007H			Q7Z7A1	CNTRL_HUMAN	centriolin	1559					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)		p.R1559H(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						ATGGCAGAACGCAATGAGGAT	0.493																																					p.R1559H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4676A	9						.						122.0	122.0	122.0					9																	123920299		2203	4300	6503	122960120	SO:0001583	missense	11064	exon28			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.4676G>A	9.37:g.123920299G>A	ENSP00000362962:p.Arg1559His	Somatic		Capture	SOLID	Phase_I	122960120	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	G	7.869	0.727663	0.15439	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000373850;ENST00000431571;ENST00000373845;ENST00000373844	T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78	5.71	-7.73	0.01245	.	.	.	.	.	T	0.22513	0.0543	N	0.16478	0.41	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.14144	-1.0483	9	0.37606	T	0.19	.	3.5204	0.07740	0.5273:0.0936:0.1888:0.1903	.	1559	Q7Z7A1	CNTRL_HUMAN	H	1559;1559;1559;315;1007;228;241;4	ENSP00000362962:R1559H;ENSP00000238341:R1559H;ENSP00000362956:R1007H;ENSP00000413014:R228H;ENSP00000362950:R4H	ENSP00000238341:R1559H	R	+	2	0	CNTRL	122960120	0.009000	0.17119	0.000000	0.03702	0.089000	0.18198	-0.062000	0.11674	-1.781000	0.01277	-0.345000	0.07892	CGC		CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
SLITRK5	26050	hgsc.bcm.edu	37	13	88330282	88330282	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr13:88330282T>G	ENST00000325089.6	+	2	2858	c.2639T>G	c.(2638-2640)tTc>tGc	p.F880C	SLITRK5_ENST00000400028.3_Missense_Mutation_p.F639C	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	880					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.F880C(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TATCCCAAATTCCCGTGCAGC	0.602																																					p.F880C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2639G	13						.						47.0	50.0	49.0					13																	88330282		2203	4300	6503	87128283	SO:0001583	missense	26050	exon2			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.2639T>G	13.37:g.88330282T>G	ENSP00000366283:p.Phe880Cys	Somatic		Capture	SOLID	Phase_I	87128283	NM_015567	B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	T	14.56	2.573063	0.45902	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.60920	0.15;0.49	5.57	5.57	0.84162	.	0.281510	0.29737	N	0.011331	T	0.61677	0.2366	L	0.50333	1.59	0.36358	D	0.860523	D;D	0.61080	0.988;0.989	P;P	0.53313	0.723;0.608	T	0.68458	-0.5403	9	.	.	.	-19.8739	12.1328	0.53952	0.0:0.0:0.0:1.0	.	639;880	B4DSH5;O94991	.;SLIK5_HUMAN	C	880;639	ENSP00000366283:F880C;ENSP00000442244:F639C	.	F	+	2	0	SLITRK5	87128283	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.096000	0.50243	2.117000	0.64856	0.459000	0.35465	TTC		SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
EPC1	80314	hgsc.bcm.edu	37	10	32562139	32562139	+	Silent	SNP	T	T	C	rs141719918		TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr10:32562139T>C	ENST00000263062.8	-	11	2084	c.1815A>G	c.(1813-1815)caA>caG	p.Q605Q	EPC1_ENST00000375110.2_Silent_p.Q555Q|EPC1_ENST00000319778.6_Silent_p.Q605Q	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	605					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)		p.Q605Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				GTTGCTGAATTTGTGCAAGCT	0.403																																					p.Q605Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1815G	10						.	T		0,4406		0,0,2203	262.0	228.0	239.0		1815	0.9	1.0	10	dbSNP_134	239	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	EPC1	NM_025209.2		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		605/837	32562139	1,13005	2203	4300	6503	32602145	SO:0001819	synonymous_variant	80314	exon11			AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.1815A>G	10.37:g.32562139T>C		Somatic		Capture	SOLID	Phase_I	32602145	NM_025209	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Silent	SNP	ENST00000263062.8	37	CCDS7172.1																																																																																				EPC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047484.1		
RHOBTB1	9886	hgsc.bcm.edu	37	10	62648035	62648035	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr10:62648035G>A	ENST00000337910.5	-	6	1728	c.1391C>T	c.(1390-1392)aCg>aTg	p.T464M	RHOBTB1_ENST00000357917.4_Missense_Mutation_p.T464M	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	464					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.T464M(2)		endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					AAAGGCTTTCGTAATCTCCTG	0.507																																					p.T464M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1391T	10						.						111.0	102.0	105.0					10																	62648035		2203	4300	6503	62318041	SO:0001583	missense	9886	exon6			AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.1391C>T	10.37:g.62648035G>A	ENSP00000338671:p.Thr464Met	Somatic		Capture	SOLID	Phase_I	62318041	NM_014836		Missense_Mutation	SNP	ENST00000337910.5	37	CCDS7261.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.322517	0.81580	.	.	ENSG00000072422	ENST00000357917;ENST00000337910	T;T	0.16743	2.32;2.32	5.71	5.71	0.89125	BTB/POZ fold (1);	0.000000	0.85682	D	0.000000	T	0.46619	0.1402	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.32771	-0.9894	10	0.49607	T	0.09	.	19.8677	0.96824	0.0:0.0:1.0:0.0	.	464	O94844	RHBT1_HUMAN	M	464	ENSP00000350595:T464M;ENSP00000338671:T464M	ENSP00000338671:T464M	T	-	2	0	RHOBTB1	62318041	1.000000	0.71417	0.943000	0.38184	0.970000	0.65996	9.803000	0.99136	2.709000	0.92574	0.655000	0.94253	ACG		RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048220.1		
SORCS3	22986	hgsc.bcm.edu	37	10	106916999	106916999	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr10:106916999C>A	ENST00000369701.3	+	10	1813	c.1586C>A	c.(1585-1587)gCt>gAt	p.A529D		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	529					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.A529D(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CTGCTGCAAGCTCCGGATGTG	0.552																																					p.A529D	NSCLC(116;1497 1690 7108 13108 14106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1586A	10						.						100.0	89.0	92.0					10																	106916999		2203	4300	6503	106906989	SO:0001583	missense	22986	exon10			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.1586C>A	10.37:g.106916999C>A	ENSP00000358715:p.Ala529Asp	Somatic		Capture	SOLID	Phase_I	106906989	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	C	34	5.311618	0.95655	.	.	ENSG00000156395	ENST00000369701	T	0.23950	1.88	6.04	6.04	0.98038	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.62998	0.2474	M	0.91818	3.245	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.68288	-0.5448	9	.	.	.	.	20.5948	0.99439	0.0:1.0:0.0:0.0	.	529	Q9UPU3	SORC3_HUMAN	D	529	ENSP00000358715:A529D	.	A	+	2	0	SORCS3	106906989	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.873000	0.98535	0.563000	0.77884	GCT		SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
APC	324	hgsc.bcm.edu	37	5	112128143	112128143	+	Splice_Site	SNP	C	C	T	rs62619935		TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr5:112128143C>T	ENST00000457016.1	+	7	1026	c.646C>T	c.(646-648)Cga>Tga	p.R216*	APC_ENST00000508376.2_Splice_Site_p.R216*|APC_ENST00000257430.4_Splice_Site_p.R216*			P25054	APC_HUMAN	adenomatous polyposis coli	216	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R216*(12)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTTATTTTAGCGAAGAATAGC	0.323		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R216X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	12	Substitution - Nonsense(12)	large_intestine(12)	c.C646T	5	GRCh37	CM992133	APC	M	rs62619935	.						52.0	51.0	51.0					5																	112128143		2202	4300	6502	112156042	SO:0001630	splice_region_variant	324	exon8	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.646-1C>T	5.37:g.112128143C>T		Somatic		Capture	SOLID	Phase_I	112156042	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	39	7.466758	0.98302	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.19	2.99	0.34606	.	0.630262	0.16042	N	0.232387	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.2274	1.7088	0.02888	0.2899:0.3634:0.2259:0.1208	rs62619935	.	.	.	X	216	.	.	R	+	1	2	APC	112156042	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	0.662000	0.25038	1.304000	0.44892	-0.158000	0.13435	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	Nonsense_Mutation
APC	324	hgsc.bcm.edu	37	5	112175207	112175207	+	Nonsense_Mutation	SNP	G	G	T	rs121913462		TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr5:112175207G>T	ENST00000457016.1	+	16	4296	c.3916G>T	c.(3916-3918)Gaa>Taa	p.E1306*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.E1306*|APC_ENST00000257430.4_Nonsense_Mutation_p.E1306*			P25054	APC_HUMAN	adenomatous polyposis coli	1306	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E1306*(25)|p.E1306K(2)|p.K1192fs*3(1)|p.?(1)|p.E1306fs*8(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GCAAATAGCAGAAATAAAAGA	0.428		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1288X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,pancreas,NS,Substitution - Missense,0	.	30	Substitution - Nonsense(25)|Substitution - Missense(2)|Deletion - Frameshift(2)|Unknown(1)	large_intestine(26)|pancreas(1)|soft_tissue(1)|liver(1)|skin(1)	c.G3862T	5	GRCh37	CM077502	APC	M	rs121913462	.						53.0	55.0	54.0					5																	112175207		2202	4300	6502	112203106	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3916G>T	5.37:g.112175207G>T	ENSP00000413133:p.Glu1306*	Somatic		Capture	SOLID	Phase_I	112203106	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	37	6.245438	0.97408	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	5.73	5.73	0.89815	.	0.179091	0.53938	D	0.000048	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-23.6779	14.1203	0.65182	0.0727:0.0:0.9273:0.0	.	.	.	.	X	1306	.	.	E	+	1	0	APC	112203106	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	4.734000	0.62043	2.861000	0.98227	0.655000	0.94253	GAA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHB2	56133	hgsc.bcm.edu	37	5	140475429	140475429	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr5:140475429C>T	ENST00000194155.4	+	1	1203	c.1055C>T	c.(1054-1056)tCg>tTg	p.S352L		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	352					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S352L(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTAACTATGTCGACACTTATC	0.468																																					p.S352L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1055T	5						.						69.0	68.0	68.0					5																	140475429		2203	4300	6503	140455613	SO:0001583	missense	56133	exon1			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1055C>T	5.37:g.140475429C>T	ENSP00000194155:p.Ser352Leu	Somatic		Capture	SOLID	Phase_I	140455613	NM_018936	Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	C	11.14	1.549891	0.27652	.	.	ENSG00000112852	ENST00000194155	T	0.61392	0.11	4.99	4.99	0.66335	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.61590	0.2359	L	0.59912	1.85	0.09310	N	1	D	0.69078	0.997	P	0.53035	0.716	T	0.58544	-0.7618	9	0.87932	D	0	.	6.2764	0.20983	0.0:0.6941:0.1796:0.1263	.	352	Q9Y5E7	PCDB2_HUMAN	L	352	ENSP00000194155:S352L	ENSP00000194155:S352L	S	+	2	0	PCDHB2	140455613	0.000000	0.05858	0.972000	0.41901	0.835000	0.47333	-0.321000	0.08018	2.480000	0.83734	0.650000	0.86243	TCG		PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
PCDHB7	56129	hgsc.bcm.edu	37	5	140552929	140552929	+	Silent	SNP	C	C	A			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr5:140552929C>A	ENST00000231137.3	+	1	687	c.513C>A	c.(511-513)acC>acA	p.T171T		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	171	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T171T(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTAACTACACCATCAGCCCCA	0.463																																					p.T171T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C513A	5						.						59.0	58.0	58.0					5																	140552929		2203	4300	6503	140533113	SO:0001819	synonymous_variant	56129	exon1			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.513C>A	5.37:g.140552929C>A		Somatic		Capture	SOLID	Phase_I	140533113	NM_018940	A1L3Y8	Silent	SNP	ENST00000231137.3	37	CCDS4249.1																																																																																				PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
VCAN	1462	hgsc.bcm.edu	37	5	82835287	82835287	+	Nonsense_Mutation	SNP	T	T	G			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr5:82835287T>G	ENST00000265077.3	+	8	7030	c.6465T>G	c.(6463-6465)taT>taG	p.Y2155*	VCAN_ENST00000343200.5_Nonsense_Mutation_p.Y1168*|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000513016.1_3'UTR	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2155	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.Y2155*(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CCACAGATTATTCTGTACTAA	0.348																																					p.Y1168X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T3504G	5						.						43.0	43.0	43.0					5																	82835287		2203	4300	6503	82871043	SO:0001587	stop_gained	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.6465T>G	5.37:g.82835287T>G	ENSP00000265077:p.Tyr2155*	Somatic		Capture	SOLID	Phase_I	82871043	NM_001164097	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Nonsense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	T	47	13.144151	0.99723	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	.	.	.	5.61	0.557	0.17260	.	0.492239	0.19093	N	0.122918	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.2376	0.37475	0.0:0.3588:0.0:0.6412	.	.	.	.	X	2155;1168;1168	.	ENSP00000265077:Y2155X	Y	+	3	2	VCAN	82871043	0.668000	0.27493	0.000000	0.03702	0.004000	0.04260	0.672000	0.25187	-0.053000	0.13289	0.533000	0.62120	TAT		VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
PCDHB7	56129	hgsc.bcm.edu	37	5	140553788	140553788	+	Silent	SNP	C	C	T			TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3519-01A-02W-0831-10	TCGA-AA-3519-10A-01W-0831-10	g.chr5:140553788C>T	ENST00000231137.3	+	1	1546	c.1372C>T	c.(1372-1374)Ctg>Ttg	p.L458L		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	458	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L458L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCCTACACCCTGTTTGTCCG	0.602																																					p.L458L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1372T	5						.						141.0	136.0	137.0					5																	140553788		2203	4300	6503	140533972	SO:0001819	synonymous_variant	56129	exon1			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1372C>T	5.37:g.140553788C>T		Somatic		Capture	SOLID	Phase_I	140533972	NM_018940	A1L3Y8	Silent	SNP	ENST00000231137.3	37	CCDS4249.1																																																																																				PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
