#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FAM179B	23116	hgsc.bcm.edu	37	14	45475443	45475443	+	Silent	SNP	C	C	T			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr14:45475443C>T	ENST00000361577.3	+	5	3091	c.2877C>T	c.(2875-2877)ttC>ttT	p.F959F	KLHL28_ENST00000553817.1_Intron|FAM179B_ENST00000361462.2_Silent_p.F959F|FAM179B_ENST00000382233.2_Silent_p.F959F	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	959								p.F959F(1)		endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						AATTAAATTTCAAGGATAAAG	0.284																																					p.F959F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2877T	14						.						41.0	45.0	43.0					14																	45475443		2203	4300	6503	44545193	SO:0001819	synonymous_variant	23116	exon5			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.2877C>T	14.37:g.45475443C>T		Somatic		Capture	SOLID	Phase_I	44545193	NM_015091	Q68D66|Q6PG27	Silent	SNP	ENST00000361577.3	37	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	C	7.939	0.742380	0.15642	.	.	ENSG00000198718	ENST00000557250	.	.	.	5.24	3.4	0.38934	.	.	.	.	.	T	0.46560	0.1399	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33954	-0.9848	4	.	.	.	-0.5627	3.2629	0.06855	0.143:0.5652:0.1385:0.1534	.	.	.	.	L	151	.	.	S	+	2	0	FAM179B	44545193	0.974000	0.33945	0.934000	0.37439	0.984000	0.73092	0.388000	0.20735	0.583000	0.29574	0.563000	0.77884	TCA		FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
CRYBA4	1413	hgsc.bcm.edu	37	22	27019247	27019247	+	Missense_Mutation	SNP	C	C	T	rs147222776	byFrequency	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr22:27019247C>T	ENST00000354760.3	+	3	124	c.89C>T	c.(88-90)aCg>aTg	p.T30M	CRYBA4_ENST00000466315.1_Intron	NM_001886.2	NP_001877.1	P53673	CRBA4_HUMAN	crystallin, beta A4	30	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)	p.T30M(1)		large_intestine(6)|liver(1)|lung(6)|skin(3)|urinary_tract(2)	18						CACGAGTTCACGGCCGAGTGC	0.592																																					p.T30M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C89T	22						.	C	MET/THR	2,4404	4.2+/-10.8	0,2,2201	85.0	90.0	88.0		89	4.4	0.9	22	dbSNP_134	88	0,8600		0,0,4300	no	missense	CRYBA4	NM_001886.2	81	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	possibly-damaging	30/197	27019247	2,13004	2203	4300	6503	25349247	SO:0001583	missense	1413	exon3				CCDS13841.1	22q12.1	2008-06-10			ENSG00000196431	ENSG00000196431			2396	protein-coding gene	gene with protein product		123631				8999933, 960806	Standard	NM_001886		Approved		uc003acz.4	P53673	OTTHUMG00000150983	ENST00000354760.3:c.89C>T	22.37:g.27019247C>T	ENSP00000346805:p.Thr30Met	Somatic		Capture	SOLID	Phase_I	25349247	NM_001886	Q4VB22|Q6ICE4	Missense_Mutation	SNP	ENST00000354760.3	37	CCDS13841.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.248718	0.59103	4.54E-4	0.0	ENSG00000196431	ENST00000354760	T	0.77620	-1.11	4.44	4.44	0.53790	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.058054	0.64402	D	0.000002	T	0.71256	0.3318	L	0.48986	1.54	0.80722	D	1	P	0.45715	0.865	B	0.37692	0.256	T	0.76793	-0.2828	10	0.59425	D	0.04	.	14.6154	0.68544	0.0:1.0:0.0:0.0	.	30	P53673	CRBA4_HUMAN	M	30	ENSP00000346805:T30M	ENSP00000346805:T30M	T	+	2	0	CRYBA4	25349247	1.000000	0.71417	0.879000	0.34478	0.772000	0.43724	6.585000	0.74062	2.309000	0.77851	0.650000	0.86243	ACG		CRYBA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320793.1	NM_001886	
SAMM50	25813	hgsc.bcm.edu	37	22	44372006	44372006	+	Silent	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr22:44372006G>A	ENST00000350028.4	+	8	877	c.720G>A	c.(718-720)agG>agA	p.R240R	SAMM50_ENST00000396202.3_Silent_p.R30R	NM_015380.4	NP_056195.3	Q9Y512	SAM50_HUMAN	SAMM50 sorting and assembly machinery component	240					cellular protein metabolic process (GO:0044267)|protein import into mitochondrial outer membrane (GO:0045040)|protein targeting to mitochondrion (GO:0006626)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrial sorting and assembly machinery complex (GO:0001401)|mitochondrion (GO:0005739)		p.R240R(1)		endometrium(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				GCCTCTCAAGGACGGCGTCAT	0.463																																					p.R240R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G720A	22						.						110.0	100.0	104.0					22																	44372006		2203	4300	6503	42703339	SO:0001819	synonymous_variant	25813	exon8			AK001087	CCDS14055.1	22q13.31	2013-08-21	2013-08-21	2005-11-20	ENSG00000100347	ENSG00000100347			24276	protein-coding gene	gene with protein product		612058	"""sorting and assembly machinery component 50 homolog (S. cerevisiae)"""			15644312	Standard	NM_015380		Approved	CGI-51, TRG-3, YNL026W, OMP85, TOB55	uc003bej.3	Q9Y512	OTTHUMG00000150557	ENST00000350028.4:c.720G>A	22.37:g.44372006G>A		Somatic		Capture	SOLID	Phase_I	42703339	NM_015380	Q53HC4|Q56VW7|Q969Y9|Q96I46|Q9NW85|Q9UQM9	Silent	SNP	ENST00000350028.4	37	CCDS14055.1																																																																																				SAMM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318898.2	NM_015380	
GNA11	2767	hgsc.bcm.edu	37	19	3110206	3110206	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr19:3110206G>A	ENST00000078429.4	+	2	438	c.196G>A	c.(196-198)Ggc>Agc	p.G66S		NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)	66					action potential (GO:0001508)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cellular response to pH (GO:0071467)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|regulation of melanocyte differentiation (GO:0045634)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.G66S(1)		endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)		CCACGGCGCCGGCTACTCGGA	0.662			Mis		uveal melanoma																																p.G66S			Dom	yes		19	19p13.3	2767	"""guanine nucleotide binding protein (G protein), alpha 11 (Gq class)"""		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G196A	19						.						71.0	49.0	56.0					19																	3110206		2203	4300	6503	3061206	SO:0001583	missense	2767	exon2			AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256			4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2		1302014, 23802516	Standard	NM_002067		Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.196G>A	19.37:g.3110206G>A	ENSP00000078429:p.Gly66Ser	Somatic		Capture	SOLID	Phase_I	3061206	NM_002067	O15109|Q14350|Q6IB00	Missense_Mutation	SNP	ENST00000078429.4	37	CCDS12103.1	.	.	.	.	.	.	.	.	.	.	.	19.06	3.753853	0.69648	.	.	ENSG00000088256	ENST00000078429	D	0.89123	-2.47	3.39	2.33	0.28932	G protein alpha subunit, helical insertion (1);	0.078190	0.48767	D	0.000174	D	0.94735	0.8301	M	0.90977	3.165	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94367	0.7592	10	0.72032	D	0.01	.	11.1989	0.48730	0.0:0.1883:0.8117:0.0	.	66	P29992	GNA11_HUMAN	S	66	ENSP00000078429:G66S	ENSP00000078429:G66S	G	+	1	0	GNA11	3061206	1.000000	0.71417	0.957000	0.39632	0.480000	0.33159	9.412000	0.97347	0.610000	0.30035	-0.519000	0.04390	GGC		GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452261.2	NM_002067	
MAN2B1	4125	hgsc.bcm.edu	37	19	12760989	12760989	+	Silent	SNP	G	G	T			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr19:12760989G>T	ENST00000456935.2	-	17	2134	c.2094C>A	c.(2092-2094)tcC>tcA	p.S698S	CTD-2192J16.22_ENST00000597692.1_5'Flank|MAN2B1_ENST00000221363.4_Silent_p.S697S	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	698					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)	p.S698S(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GAACCACCTGGGAACACCAAG	0.622																																					p.S698S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2094A	19						.						130.0	110.0	117.0					19																	12760989		2203	4300	6503	12621989	SO:0001819	synonymous_variant	4125	exon17				CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.2094C>A	19.37:g.12760989G>T		Somatic		Capture	SOLID	Phase_I	12621989	NM_000528	G5E928|O15330|Q16680|Q93094|Q9BW13	Silent	SNP	ENST00000456935.2	37	CCDS32919.1																																																																																				MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344062.1		
BLVRB	645	hgsc.bcm.edu	37	19	40964360	40964360	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr19:40964360C>T	ENST00000263368.4	-	2	323	c.172G>A	c.(172-174)Gca>Aca	p.A58T	BLVRB_ENST00000595483.1_Missense_Mutation_p.A58T	NM_000713.2	NP_000704.1	P30043	BLVRB_HUMAN	biliverdin reductase B (flavin reductase (NADPH))	58					heme catabolic process (GO:0042167)|porphyrin-containing compound metabolic process (GO:0006778)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	biliverdin reductase activity (GO:0004074)|riboflavin reductase (NADPH) activity (GO:0042602)	p.A58T(1)		large_intestine(3)|lung(3)	6			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		Riboflavin(DB00140)	ACATCGGCTGCCTGCAGAACA	0.667																																					p.A58T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G172A	19						.						35.0	28.0	30.0					19																	40964360		2201	4298	6499	45656200	SO:0001583	missense	645	exon2			D26308	CCDS33029.1	19q13.1-q13.2	2011-09-14				ENSG00000090013	1.3.1.24, 1.5.1.30	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	1063	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 43U, member 1"""	600941	"""Flavin reductase"""	FLR		7656592, 19027726	Standard	NM_000713		Approved	SDR43U1	uc002onw.2	P30043		ENST00000263368.4:c.172G>A	19.37:g.40964360C>T	ENSP00000263368:p.Ala58Thr	Somatic		Capture	SOLID	Phase_I	45656200	NM_000713	A6NKD8|B2R5C6|P32078|P53005|Q32LZ2	Missense_Mutation	SNP	ENST00000263368.4	37	CCDS33029.1	.	.	.	.	.	.	.	.	.	.	C	4.995	0.184757	0.09495	.	.	ENSG00000090013	ENST00000263368	T	0.29917	1.55	5.08	2.77	0.32553	NAD(P)-binding domain (1);NmrA-like (1);	0.298852	0.35615	N	0.003092	T	0.25269	0.0614	M	0.66506	2.035	0.09310	N	1	B	0.30914	0.3	B	0.26517	0.07	T	0.13150	-1.0520	10	0.14656	T	0.56	-20.4212	8.1362	0.31056	0.0:0.4847:0.4282:0.0871	.	58	P30043	BLVRB_HUMAN	T	58	ENSP00000263368:A58T	ENSP00000263368:A58T	A	-	1	0	BLVRB	45656200	0.612000	0.27000	0.294000	0.24946	0.214000	0.24535	0.203000	0.17315	1.273000	0.44346	0.557000	0.71058	GCA		BLVRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462563.1		
NOVA2	4858	hgsc.bcm.edu	37	19	46457063	46457063	+	Missense_Mutation	SNP	G	G	A	rs547813363		TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr19:46457063G>A	ENST00000263257.5	-	3	565	c.371C>T	c.(370-372)aCg>aTg	p.T124M		NM_002516.2	NP_002507.1	Q9UNW9	NOVA2_HUMAN	neuro-oncological ventral antigen 2	124					regulation of RNA metabolic process (GO:0051252)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.T124M(1)		endometrium(3)|large_intestine(5)|lung(13)	21		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)		GGGGTTCATCGTGGTTTGGGG	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		21815	0.0		0.0	False		,,,				2504	0.001				p.T124M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C371T	19						.						304.0	258.0	274.0					19																	46457063		2203	4300	6503	51148903	SO:0001583	missense	4858	exon3			U70477	CCDS12679.1	19q13.3	2008-07-17				ENSG00000104967			7887	protein-coding gene	gene with protein product	"""neuro-oncological ventral antigen 3"""	601991		NOVA3		9344654, 10368286	Standard	NM_002516		Approved	ANOVA	uc002pdv.2	Q9UNW9		ENST00000263257.5:c.371C>T	19.37:g.46457063G>A	ENSP00000263257:p.Thr124Met	Somatic		Capture	SOLID	Phase_I	51148903	NM_002516	O43267|Q9UEA1	Missense_Mutation	SNP	ENST00000263257.5	37	CCDS12679.1	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466261	0.63625	.	.	ENSG00000104967	ENST00000263257	T	0.63255	-0.03	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.66665	0.2812	N	0.24115	0.695	0.58432	D	0.999997	D	0.89917	1.0	D	0.80764	0.994	T	0.65274	-0.6208	10	0.33940	T	0.23	-5.6018	15.5491	0.76133	0.0:0.0:1.0:0.0	.	124	Q9UNW9	NOVA2_HUMAN	M	124	ENSP00000263257:T124M	ENSP00000263257:T124M	T	-	2	0	NOVA2	51148903	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.192000	0.94947	2.528000	0.85240	0.563000	0.77884	ACG		NOVA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437210.2	NM_002516	
ADAMTS10	81794	hgsc.bcm.edu	37	19	8661081	8661081	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr19:8661081C>A	ENST00000597188.1	-	11	1483	c.1213G>T	c.(1213-1215)Gtg>Ttg	p.V405L	ADAMTS10_ENST00000270328.4_Missense_Mutation_p.V405L|ADAMTS10_ENST00000596709.1_5'Flank	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	405	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V405L(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						CTGTTTCCCACGCCGTCATGG	0.647																																					p.V405L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1213T	19						.						93.0	89.0	90.0					19																	8661081		2203	4300	6503	8567081	SO:0001583	missense	81794	exon11			AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.1213G>T	19.37:g.8661081C>A	ENSP00000471851:p.Val405Leu	Somatic		Capture	SOLID	Phase_I	8567081	NM_030957	M0QZE4	Missense_Mutation	SNP	ENST00000597188.1	37	CCDS12206.1	.	.	.	.	.	.	.	.	.	.	C	9.588	1.125502	0.20959	.	.	ENSG00000142303	ENST00000270328;ENST00000393912	T	0.06687	3.27	4.42	3.37	0.38596	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.208574	0.41097	N	0.000944	T	0.03959	0.0111	N	0.05050	-0.12	0.44660	D	0.997642	B;B	0.14012	0.007;0.009	B;B	0.18871	0.023;0.016	T	0.41197	-0.9522	10	0.40728	T	0.16	.	6.7668	0.23571	0.1779:0.7324:0.0:0.0897	.	159;405	Q59FE5;Q9H324	.;ATS10_HUMAN	L	405;159	ENSP00000270328:V405L	ENSP00000270328:V405L	V	-	1	0	ADAMTS10	8567081	0.922000	0.31269	0.987000	0.45799	0.664000	0.39144	1.764000	0.38471	1.068000	0.40764	0.313000	0.20887	GTG		ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460085.3	NM_030957	
FPR3	2359	hgsc.bcm.edu	37	19	52327944	52327944	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr19:52327944C>T	ENST00000339223.4	+	2	1122	c.943C>T	c.(943-945)Cgc>Tgc	p.R315C	FPR3_ENST00000595991.1_Missense_Mutation_p.R315C	NM_002030.3	NP_002021.3	P25089	FPR3_HUMAN	formyl peptide receptor 3	315					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)	p.R315C(1)		NS(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)	35						AAGACTGATTCGCTCTTTGCC	0.507																																					p.R315C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C943T	19						.						108.0	102.0	104.0					19																	52327944		2203	4300	6503	57019756	SO:0001583	missense	2359	exon2				CCDS12841.1	19q13.3-q13.4	2012-08-08	2008-04-17	2008-04-17		ENSG00000187474		"""GPCR / Class A : Formyl peptide receptors"""	3828	protein-coding gene	gene with protein product		136539	"""formyl peptide receptor-like 2"""	FPRL2		1612600, 8198572	Standard	NM_002030		Approved	FPRH1, FMLPY, RMLP-R-I	uc002pxt.1	P25089		ENST00000339223.4:c.943C>T	19.37:g.52327944C>T	ENSP00000341821:p.Arg315Cys	Somatic		Capture	SOLID	Phase_I	57019756	NM_002030		Missense_Mutation	SNP	ENST00000339223.4	37	CCDS12841.1	.	.	.	.	.	.	.	.	.	.	.	12.14	1.848546	0.32699	.	.	ENSG00000187474	ENST00000339223	T	0.41758	0.99	2.34	-0.267	0.12938	.	0.422186	0.21077	N	0.080555	T	0.41119	0.1145	L	0.49778	1.585	0.30061	N	0.810948	D	0.69078	0.997	P	0.55455	0.776	T	0.36480	-0.9746	10	0.46703	T	0.11	.	2.8854	0.05660	0.4068:0.4264:0.0:0.1667	.	315	P25089	FPR3_HUMAN	C	315	ENSP00000341821:R315C	ENSP00000341821:R315C	R	+	1	0	FPR3	57019756	0.000000	0.05858	0.135000	0.22099	0.304000	0.27724	0.024000	0.13555	0.322000	0.23283	0.305000	0.20034	CGC		FPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466914.1	NM_002030	
CA8	767	hgsc.bcm.edu	37	8	61178562	61178562	+	Silent	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr8:61178562G>A	ENST00000317995.4	-	3	603	c.339C>T	c.(337-339)taC>taT	p.Y113Y		NM_004056.4	NP_004047.3	P35219	CAH8_HUMAN	carbonic anhydrase VIII	113					one-carbon metabolic process (GO:0006730)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasm (GO:0005737)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.Y113Y(1)		endometrium(2)|large_intestine(5)|lung(6)|prostate(2)|skin(1)	16		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)			Zonisamide(DB00909)	ATCTCACTTCGTACAGTTCAA	0.403																																					p.Y113Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C339T	8						.						76.0	72.0	73.0					8																	61178562		2203	4300	6503	61341116	SO:0001819	synonymous_variant	767	exon3			L04656	CCDS6174.1	8q12.1	2012-08-21			ENSG00000178538	ENSG00000178538		"""Carbonic anhydrases"""	1382	protein-coding gene	gene with protein product		114815		CALS		17219437	Standard	NM_004056		Approved	CARP	uc003xtz.1	P35219	OTTHUMG00000165325	ENST00000317995.4:c.339C>T	8.37:g.61178562G>A		Somatic		Capture	SOLID	Phase_I	61341116	NM_004056	A8K0A5|B3KQZ7|Q32MY2	Silent	SNP	ENST00000317995.4	37	CCDS6174.1																																																																																				CA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383445.1		
ARFGEF1	10565	hgsc.bcm.edu	37	8	68204139	68204139	+	Missense_Mutation	SNP	C	C	T	rs368008426		TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr8:68204139C>T	ENST00000262215.3	-	6	1248	c.859G>A	c.(859-861)Gat>Aat	p.D287N		NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	287					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)	p.D287N(1)		breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CTGGAAATATCAGATCCATTT	0.423																																					p.D287N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G859A	8						.						161.0	149.0	153.0					8																	68204139		2203	4300	6503	68366693	SO:0001583	missense	10565	exon6			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.859G>A	8.37:g.68204139C>T	ENSP00000262215:p.Asp287Asn	Somatic		Capture	SOLID	Phase_I	68366693	NM_006421	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	37	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724723	0.48833	.	.	ENSG00000066777	ENST00000262215	T	0.19394	2.15	5.22	5.22	0.72569	Armadillo-type fold (1);	0.345822	0.29799	N	0.011169	T	0.23054	0.0557	L	0.50333	1.59	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.04400	-1.0954	10	0.21540	T	0.41	.	18.8032	0.92027	0.0:1.0:0.0:0.0	.	287	Q9Y6D6	BIG1_HUMAN	N	287	ENSP00000262215:D287N	ENSP00000262215:D287N	D	-	1	0	ARFGEF1	68366693	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.295000	0.65692	2.434000	0.82447	0.460000	0.39030	GAT		ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
FER1L6	654463	hgsc.bcm.edu	37	8	125072891	125072891	+	Missense_Mutation	SNP	G	G	A	rs138376786	byFrequency	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr8:125072891G>A	ENST00000522917.1	+	24	3294	c.3088G>A	c.(3088-3090)Gtg>Atg	p.V1030M	FER1L6-AS2_ENST00000520031.1_RNA|FER1L6-AS2_ENST00000601180.1_RNA|FER1L6_ENST00000399018.1_Missense_Mutation_p.V1030M	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1030						integral component of membrane (GO:0016021)		p.V1030M(2)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GAAGTCCTGCGTGATCCAGAG	0.547													G|||	4	0.000798722	0.0	0.0014	5008	,	,		17487	0.0		0.001	False		,,,				2504	0.002				p.V1030M												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G3088A	8						.	G	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	145.0	131.0	136.0		3088	5.9	1.0	8	dbSNP_134	136	16,8584	10.5+/-38.8	0,16,4284	yes	missense	FER1L6	NM_001039112.2	21	0,17,6486	AA,AG,GG		0.186,0.0227,0.1307	probably-damaging	1030/1858	125072891	17,12989	2203	4300	6503	125142072	SO:0001583	missense	654463	exon24			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.3088G>A	8.37:g.125072891G>A	ENSP00000428280:p.Val1030Met	Somatic		Capture	SOLID	Phase_I	125142072	NM_001039112		Missense_Mutation	SNP	ENST00000522917.1	37	CCDS43767.1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	G	26.3	4.719859	0.89205	2.27E-4	0.00186	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.81579	-1.51;-1.51	5.95	5.95	0.96441	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	U	0.000001	D	0.90724	0.7089	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90657	0.4587	10	0.66056	D	0.02	-16.6725	19.9804	0.97323	0.0:0.0:1.0:0.0	.	1030	Q2WGJ9	FR1L6_HUMAN	M	1030	ENSP00000428280:V1030M;ENSP00000381982:V1030M	ENSP00000381982:V1030M	V	+	1	0	FER1L6	125142072	0.999000	0.42202	0.993000	0.49108	0.964000	0.63967	2.637000	0.46553	2.825000	0.97269	0.655000	0.94253	GTG		FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
PTK2	5747	hgsc.bcm.edu	37	8	141856761	141856762	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	AT	AT	AT	-	AT	AT	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr8:141856761_141856762delAT	ENST00000522684.1	-	6	695_696	c.466_467delAT	c.(466-468)atgfs	p.M156fs	PTK2_ENST00000519419.1_Frame_Shift_Del_p.M200fs|PTK2_ENST00000535192.1_Frame_Shift_Del_p.M156fs|PTK2_ENST00000521059.1_Frame_Shift_Del_p.M156fs|PTK2_ENST00000340930.3_Frame_Shift_Del_p.M156fs|PTK2_ENST00000395218.2_Frame_Shift_Del_p.M156fs|PTK2_ENST00000517887.1_Frame_Shift_Del_p.M200fs	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	156	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)	p.M66fs*5(1)|p.M156fs*5(1)|p.M178fs*5(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			TATCTCTAACATATAATCGCTC	0.337																																					p.156_156del												.	.	3	Deletion - Frameshift(3)	large_intestine(3)	c.466_467del	8						.																																			141925944	SO:0001589	frameshift_variant	5747	exon6			L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.466_467delAT	8.37:g.141856763_141856764delAT	ENSP00000429911:p.Met156fs	Somatic		Capture	SOLID	Phase_I	141925943	NM_001199649	B4E2N6|F5H4S4|Q14291|Q9UD85	Frame_Shift_Del	DEL	ENST00000522684.1	37	CCDS6381.1																																																																																				PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	
GSTM4	2948	hgsc.bcm.edu	37	1	110201509	110201509	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr1:110201509G>A	ENST00000369836.4	+	6	743	c.434G>A	c.(433-435)aGg>aAg	p.R145K	GSTM4_ENST00000326729.5_Missense_Mutation_p.R145K|GSTM4_ENST00000495742.1_3'UTR|GSTM4_ENST00000336075.5_Missense_Mutation_p.R84K|GSTM4_ENST00000369833.1_Missense_Mutation_p.R104K	NM_000850.4	NP_000841.1	Q03013	GSTM4_HUMAN	glutathione S-transferase mu 4	145	GST C-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	enzyme binding (GO:0019899)|glutathione binding (GO:0043295)|glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)	p.R104K(1)|p.R145K(1)		endometrium(3)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0123)|Colorectal(144;0.0129)|Epithelial(280;0.0147)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.0471)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	CTGGGGAAGAGGCCATGGTTT	0.483																																					p.R145K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G434A	1						.						211.0	203.0	206.0					1																	110201509		2203	4300	6503	110003032	SO:0001583	missense	2948	exon6			M96234	CCDS806.1, CCDS807.1	1p13.3	2012-06-22	2008-11-26		ENSG00000168765	ENSG00000168765	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4636	protein-coding gene	gene with protein product		138333	"""glutathione S-transferase M4"""			8276420	Standard	NM_000850		Approved		uc001dyf.3	Q03013	OTTHUMG00000011642	ENST00000369836.4:c.434G>A	1.37:g.110201509G>A	ENSP00000358851:p.Arg145Lys	Somatic		Capture	SOLID	Phase_I	110003032	NM_147148	A8K765|Q05465|Q32NC1|Q4JNT8|Q6FH87	Missense_Mutation	SNP	ENST00000369836.4	37	CCDS807.1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.897446	0.33535	.	.	ENSG00000168765	ENST00000369836;ENST00000336075;ENST00000326729;ENST00000369833	T;T;T;T	0.03330	4.44;3.97;4.44;4.44	4.0	-1.4	0.08968	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.301495	0.27792	U	0.017838	T	0.01061	0.0035	L	0.49778	1.585	0.27421	N	0.954299	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.10450	0.005;0.004;0.001	T	0.48352	-0.9043	10	0.16896	T	0.51	-16.1208	8.7361	0.34530	0.4521:0.0:0.5479:0.0	.	84;145;145	Q4JNT8;Q03013-2;Q03013	.;.;GSTM4_HUMAN	K	145;84;145;104	ENSP00000358851:R145K;ENSP00000336744:R84K;ENSP00000316471:R145K;ENSP00000358848:R104K	ENSP00000316471:R145K	R	+	2	0	GSTM4	110003032	0.004000	0.15560	0.653000	0.29593	0.849000	0.48306	0.966000	0.29331	-0.112000	0.11979	0.298000	0.19748	AGG		GSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032187.1	NM_000850	
MAGI3	260425	hgsc.bcm.edu	37	1	114189216	114189216	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr1:114189216G>A	ENST00000307546.9	+	12	2182	c.2107G>A	c.(2107-2109)Gat>Aat	p.D703N	MAGI3_ENST00000369611.4_Missense_Mutation_p.D703N|MAGI3_ENST00000369617.4_Missense_Mutation_p.D728N|MAGI3_ENST00000369615.1_Missense_Mutation_p.D703N	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	728					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)	p.D703N(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCCAAAATTGGATCCTTCTGA	0.383																																					p.D703N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2107A	1						.						102.0	101.0	102.0					1																	114189216		2203	4300	6503	113990739	SO:0001583	missense	260425	exon12			AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.2107G>A	1.37:g.114189216G>A	ENSP00000304604:p.Asp703Asn	Somatic		Capture	SOLID	Phase_I	113990739	NM_152900	Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Missense_Mutation	SNP	ENST00000307546.9	37	CCDS44196.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.864946	0.91511	.	.	ENSG00000081026	ENST00000369617;ENST00000307546;ENST00000369615;ENST00000369611	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.39	5.39	0.77823	.	0.050986	0.85682	D	0.000000	T	0.56093	0.1962	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.97	D;D;P	0.74348	0.983;0.936;0.779	T	0.58978	-0.7540	10	0.72032	D	0.01	-9.0804	19.1481	0.93476	0.0:0.0:1.0:0.0	.	703;703;728	Q5TCQ9-4;Q5TCQ9-3;Q5TCQ9-2	.;.;.	N	728;703;703;703	ENSP00000358630:D728N;ENSP00000304604:D703N;ENSP00000358628:D703N;ENSP00000358624:D703N	ENSP00000304604:D703N	D	+	1	0	MAGI3	113990739	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.979000	0.93455	2.521000	0.84997	0.563000	0.77884	GAT		MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000032429.1	NM_152900	
USH2A	7399	hgsc.bcm.edu	37	1	215990449	215990449	+	Missense_Mutation	SNP	C	C	T	rs150266899		TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr1:215990449C>T	ENST00000307340.3	-	48	9846	c.9460G>A	c.(9460-9462)Gct>Act	p.A3154T	USH2A_ENST00000366943.2_Missense_Mutation_p.A3154T	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3154	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.A3154T(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGAGTTTTAGCGCATGGATAC	0.428										HNSCC(13;0.011)																											p.A3154T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G9460A	1						.	T	THR/ALA	2,4404	825.9+/-416.6	0,2,2201	143.0	133.0	136.0		9460	-2.6	0.1	1	dbSNP_134	136	0,8598		0,0,4299	no	missense	USH2A	NM_206933.2	58	0,2,6500	TT,TC,CC		0.0,0.0454,0.0154	benign	3154/5203	215990449	2,13002	2203	4299	6502	214057072	SO:0001583	missense	7399	exon48			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9460G>A	1.37:g.215990449C>T	ENSP00000305941:p.Ala3154Thr	Somatic		Capture	SOLID	Phase_I	214057072	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	0.902	-0.721807	0.03182	4.54E-4	0.0	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.13089	2.63;2.62	5.29	-2.64	0.06114	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.745426	0.11330	N	0.575111	T	0.03434	0.0099	N	0.03324	-0.35	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41998	-0.9477	10	0.10636	T	0.68	.	0.2253	0.00173	0.3635:0.1808:0.1715:0.2843	.	3154	O75445	USH2A_HUMAN	T	3154	ENSP00000305941:A3154T;ENSP00000355910:A3154T	ENSP00000305941:A3154T	A	-	1	0	USH2A	214057072	0.007000	0.16637	0.081000	0.20488	0.502000	0.33828	-0.479000	0.06567	-0.344000	0.08338	-0.955000	0.02649	GCT		USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
SLC35F3	148641	hgsc.bcm.edu	37	1	234452432	234452432	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr1:234452432G>A	ENST00000366617.3	+	4	934	c.706G>A	c.(706-708)Gca>Aca	p.A236T	SLC35F3_ENST00000366618.3_Missense_Mutation_p.A305T			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	236					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)		p.A305T(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			CATCGGCATCGCACTGGTGGT	0.607																																					p.A305T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G913A	1						.						166.0	147.0	153.0					1																	234452432		2203	4300	6503	232519055	SO:0001583	missense	148641	exon5				CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.706G>A	1.37:g.234452432G>A	ENSP00000355576:p.Ala236Thr	Somatic		Capture	SOLID	Phase_I	232519055	NM_173508	Q5TDD6|Q8N9C9	Missense_Mutation	SNP	ENST00000366617.3	37		.	.	.	.	.	.	.	.	.	.	G	18.99	3.739530	0.69304	.	.	ENSG00000183780	ENST00000366618;ENST00000366617	T;T	0.66638	-0.22;-0.22	5.79	5.79	0.91817	.	0.045544	0.85682	D	0.000000	T	0.52468	0.1736	N	0.20685	0.6	0.50632	D	0.999885	B;B	0.30455	0.184;0.28	B;B	0.23018	0.019;0.043	T	0.47736	-0.9094	10	0.21014	T	0.42	-17.0614	20.0276	0.97527	0.0:0.0:1.0:0.0	.	236;305	Q8IY50;Q8IY50-2	S35F3_HUMAN;.	T	305;236	ENSP00000355577:A305T;ENSP00000355576:A236T	ENSP00000355576:A236T	A	+	1	0	SLC35F3	232519055	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	5.361000	0.66092	2.731000	0.93534	0.655000	0.94253	GCA		SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000128322.1	NM_173508	
LYST	1130	hgsc.bcm.edu	37	1	235884128	235884128	+	Silent	SNP	C	C	G			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr1:235884128C>G	ENST00000389794.3	-	40	9567	c.9393G>C	c.(9391-9393)ctG>ctC	p.L3131L	LYST_ENST00000473037.1_5'UTR|LYST_ENST00000389793.2_Silent_p.L3131L			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3131	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.L3131L(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			ATAAATTTGTCAGAGCGGTGA	0.368																																					p.L3131L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G9393C	1						.						135.0	134.0	134.0					1																	235884128		2203	4300	6503	233950751	SO:0001819	synonymous_variant	1130	exon40			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.9393G>C	1.37:g.235884128C>G		Somatic		Capture	SOLID	Phase_I	233950751	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	ENST00000389794.3	37	CCDS31062.1																																																																																				LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
DSCAML1	57453	hgsc.bcm.edu	37	11	117375696	117375696	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr11:117375696G>A	ENST00000321322.6	-	10	2306	c.2305C>T	c.(2305-2307)Ctc>Ttc	p.L769F	DSCAML1_ENST00000527706.1_Missense_Mutation_p.L499F	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	709	Ig-like C2-type 8.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.L769F(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GAGCAGTTGAGCACACCAGCT	0.572																																					p.L769F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2305T	11						.						99.0	85.0	90.0					11																	117375696		2201	4296	6497	116880906	SO:0001583	missense	57453	exon10				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2305C>T	11.37:g.117375696G>A	ENSP00000315465:p.Leu769Phe	Somatic		Capture	SOLID	Phase_I	116880906	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377624	0.82682	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	D;D	0.89415	-2.51;-2.51	4.41	4.41	0.53225	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.92195	0.7525	L	0.48986	1.54	0.80722	D	1	D	0.63046	0.992	D	0.65773	0.938	D	0.93169	0.6564	9	0.72032	D	0.01	.	16.8091	0.85713	0.0:0.0:1.0:0.0	.	709	Q8TD84	DSCL1_HUMAN	F	499;769;476	ENSP00000434335:L499F;ENSP00000315465:L769F	ENSP00000315465:L769F	L	-	1	0	DSCAML1	116880906	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.684000	0.61686	2.270000	0.75569	0.313000	0.20887	CTC		DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
KCNE3	10008	hgsc.bcm.edu	37	11	74168468	74168468	+	Silent	SNP	C	C	T			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr11:74168468C>T	ENST00000310128.4	-	3	560	c.141G>A	c.(139-141)cgG>cgA	p.R47R	KCNE3_ENST00000525550.1_Silent_p.R47R|RP11-702H23.6_ENST00000530510.1_RNA|RP11-702H23.4_ENST00000533008.1_RNA	NM_005472.4	NP_005463.1	Q9Y6H6	KCNE3_HUMAN	potassium voltage-gated channel, Isk-related family, member 3	47					regulation of potassium ion transport (GO:0043266)	integral component of membrane (GO:0016021)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)	p.R47R(1)		cervix(1)|large_intestine(1)|lung(1)|ovary(1)	4	Breast(11;2.86e-06)					GTAGGCTGGCCCGCCTCTCTT	0.552																																					p.R47R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G141A	11						.						71.0	63.0	66.0					11																	74168468		2200	4293	6493	73846116	SO:0001819	synonymous_variant	10008	exon3			AF076531	CCDS8232.1	11q13.4	2014-09-17				ENSG00000175538		"""Potassium channels"""	6243	protein-coding gene	gene with protein product		604433				10219239	Standard	NM_005472		Approved	MiRP2, HOKPP	uc001ovc.3	Q9Y6H6		ENST00000310128.4:c.141G>A	11.37:g.74168468C>T		Somatic		Capture	SOLID	Phase_I	73846116	NM_005472		Silent	SNP	ENST00000310128.4	37	CCDS8232.1																																																																																				KCNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385531.1	NM_005472	
OR10G7	390265	hgsc.bcm.edu	37	11	123909297	123909297	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr11:123909297G>A	ENST00000330487.5	-	1	420	c.412C>T	c.(412-414)Cgc>Tgc	p.R138C		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R138C(2)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GCACACGAGCGCCCAGTCATC	0.562																																					p.R138C												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.C412T	11						.						184.0	175.0	178.0					11																	123909297		2200	4299	6499	123414507	SO:0001583	missense	390265	exon1			AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.412C>T	11.37:g.123909297G>A	ENSP00000329689:p.Arg138Cys	Somatic		Capture	SOLID	Phase_I	123414507	NM_001004463	Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	37	CCDS31705.1	.	.	.	.	.	.	.	.	.	.	g	0.070	-1.203919	0.01581	.	.	ENSG00000182634	ENST00000330487	T	0.81415	-1.49	3.24	0.798	0.18660	GPCR, rhodopsin-like superfamily (1);	0.802830	0.10590	N	0.656905	T	0.79828	0.4513	M	0.82193	2.58	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.68934	-0.5278	10	0.66056	D	0.02	.	7.9432	0.29971	0.1319:0.0:0.1429:0.7251	.	138	Q8NGN6	O10G7_HUMAN	C	138	ENSP00000329689:R138C	ENSP00000329689:R138C	R	-	1	0	OR10G7	123414507	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.980000	0.03770	-0.251000	0.09542	-4.047000	0.00012	CGC		OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463	
ZNF451	26036	hgsc.bcm.edu	37	6	56993537	56993537	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr6:56993537A>T	ENST00000370706.4	+	5	567	c.323A>T	c.(322-324)gAt>gTt	p.D108V	ZNF451_ENST00000357489.3_Missense_Mutation_p.D108V|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.D108V|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	108					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D108V(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GAAAAAATTGATTTTCAGCAT	0.358																																					p.D108V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A323T	6						.						90.0	85.0	87.0					6																	56993537		2203	4300	6503	57101496	SO:0001583	missense	26036	exon5			AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.323A>T	6.37:g.56993537A>T	ENSP00000359740:p.Asp108Val	Somatic		Capture	SOLID	Phase_I	57101496	NM_015555	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	ENST00000370706.4	37	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.029216	0.75504	.	.	ENSG00000112200	ENST00000510483;ENST00000370706;ENST00000357489;ENST00000491832	T;T;T;T	0.07444	3.19;3.19;3.19;3.19	4.94	4.94	0.65067	.	0.060830	0.64402	D	0.000004	T	0.16385	0.0394	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.97;1.0	D;D;P;D	0.78314	0.991;0.98;0.654;0.98	T	0.00686	-1.1610	10	0.72032	D	0.01	-18.1217	14.2642	0.66104	1.0:0.0:0.0:0.0	.	108;108;108;108	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	V	80;108;108;108	ENSP00000427558:D80V;ENSP00000359740:D108V;ENSP00000350083:D108V;ENSP00000421645:D108V	ENSP00000350083:D108V	D	+	2	0	ZNF451	57101496	1.000000	0.71417	0.992000	0.48379	0.920000	0.55202	6.444000	0.73452	1.850000	0.53721	0.533000	0.62120	GAT		ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555	
BAI3	577	hgsc.bcm.edu	37	6	69349279	69349279	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr6:69349279C>G	ENST00000370598.1	+	3	1533	c.712C>G	c.(712-714)Caa>Gaa	p.Q238E		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	238					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.Q238E(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GCAAACCACCCAAGTCTGCAA	0.557																																					p.Q238E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C712G	6						.						24.0	24.0	24.0					6																	69349279		2201	4299	6500	69406000	SO:0001583	missense	577	exon3			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.712C>G	6.37:g.69349279C>G	ENSP00000359630:p.Gln238Glu	Somatic		Capture	SOLID	Phase_I	69406000	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.247473	0.39697	.	.	ENSG00000135298	ENST00000370598	T	0.19394	2.15	5.23	5.23	0.72850	.	0.162448	0.41097	D	0.000941	T	0.14527	0.0351	L	0.36672	1.1	0.80722	D	1	P	0.40332	0.713	P	0.48654	0.585	T	0.02269	-1.1185	10	0.08179	T	0.78	.	19.1668	0.93561	0.0:1.0:0.0:0.0	.	238	O60242	BAI3_HUMAN	E	238	ENSP00000359630:Q238E	ENSP00000359630:Q238E	Q	+	1	0	BAI3	69406000	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.605000	0.67634	2.599000	0.87857	0.563000	0.77884	CAA		BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
LCA5	167691	hgsc.bcm.edu	37	6	80198892	80198892	+	Silent	SNP	C	C	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr6:80198892C>A	ENST00000392959.1	-	8	1751	c.1140G>T	c.(1138-1140)ggG>ggT	p.G380G	LCA5_ENST00000467898.3_Silent_p.G380G|LCA5_ENST00000369846.4_Silent_p.G380G	NM_181714.3	NP_859065.2	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5	380					intraciliary transport (GO:0042073)|photoreceptor cell maintenance (GO:0045494)|protein transport (GO:0015031)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein complex binding (GO:0032403)	p.G380G(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	32		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		GGTTTAGAATCCCTGCTTCTC	0.373																																					p.G380G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1140T	6						.						148.0	137.0	141.0					6																	80198892		2202	4299	6501	80255611	SO:0001819	synonymous_variant	167691	exon8				CCDS4990.1	6q14	2014-01-28			ENSG00000135338	ENSG00000135338			31923	protein-coding gene	gene with protein product	"""lebercilin"""	611408	"""chromosome 6 open reading frame 152"""	C6orf152		10631161, 17546029	Standard	NM_181714		Approved		uc003pix.3	Q86VQ0	OTTHUMG00000015080	ENST00000392959.1:c.1140G>T	6.37:g.80198892C>A		Somatic		Capture	SOLID	Phase_I	80255611	NM_181714	E1P542|Q9BWX7	Silent	SNP	ENST00000392959.1	37	CCDS4990.1																																																																																				LCA5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259269.1	NM_181714	
TP53	7157	hgsc.bcm.edu	37	17	7579313	7579313	+	Splice_Site	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr17:7579313G>A	ENST00000269305.4	-	4	563	c.374C>T	c.(373-375)aCg>aTg	p.T125M	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Splice_Site_p.T125M|TP53_ENST00000413465.2_Splice_Site_p.T125M|TP53_ENST00000455263.2_Splice_Site_p.T125M|TP53_ENST00000420246.2_Splice_Site_p.T125M|TP53_ENST00000445888.2_Splice_Site_p.T125M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	125	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in a sporadic cancer; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> M (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.T125M(16)|p.0?(8)|p.T125K(6)|p.T125R(3)|p.G59fs*23(3)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y126fs*11(1)|p.Y107fs*44(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAACTGACCGTGCAAGTCAC	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.T125M	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	42	Substitution - Missense(25)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(1)	large_intestine(8)|upper_aerodigestive_tract(7)|lung(6)|haematopoietic_and_lymphoid_tissue(5)|bone(4)|central_nervous_system(3)|urinary_tract(3)|breast(2)|stomach(1)|liver(1)|pancreas(1)|prostate(1)	c.C374T	17						.						66.0	62.0	63.0					17																	7579313		2203	4300	6503	7520038	SO:0001630	splice_region_variant	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1C>T	17.37:g.7579313G>A		Somatic		Capture	SOLID	Phase_I	7520038	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.430623	0.83776	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99850	-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16	4.75	4.75	0.60458	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99743	0.9898	M	0.70787	2.145	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.994;1.0;0.997;1.0	D;D;D;P;D;D;D	0.97110	1.0;0.956;0.986;0.868;0.985;0.981;1.0	D	0.96893	0.9654	10	0.87932	D	0	-16.188	15.6419	0.77012	0.0:0.0:1.0:0.0	.	86;125;125;125;125;125;125	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	M	125;125;125;125;125;125;114;125;125	ENSP00000410739:T125M;ENSP00000352610:T125M;ENSP00000269305:T125M;ENSP00000398846:T125M;ENSP00000391127:T125M;ENSP00000391478:T125M;ENSP00000424104:T125M;ENSP00000426252:T125M	ENSP00000269305:T125M	T	-	2	0	TP53	7520038	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.798000	0.85924	2.630000	0.89119	0.655000	0.94253	ACG		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Missense_Mutation
CNTROB	116840	hgsc.bcm.edu	37	17	7847801	7847801	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr17:7847801C>T	ENST00000563694.1	+	12	2504	c.1579C>T	c.(1579-1581)Cgg>Tgg	p.R527W	CNTROB_ENST00000380255.3_Intron|CNTROB_ENST00000565740.1_Missense_Mutation_p.R527W|CNTROB_ENST00000380262.3_Missense_Mutation_p.R527W	NM_053051.3	NP_444279.2	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	527	Required for centrosome localization.				centriole replication (GO:0007099)|centrosome separation (GO:0051299)|cytokinesis (GO:0000910)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)	p.R527W(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)				CAGACTGGCCCGGGAGCAAGC	0.562																																					p.R527W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1579T	17						.						31.0	34.0	33.0					17																	7847801		2203	4300	6503	7788526	SO:0001583	missense	116840	exon12			AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037			29616	protein-coding gene	gene with protein product	"""centrobin"""	611425				11984006, 16275750	Standard	NM_001037144		Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.1579C>T	17.37:g.7847801C>T	ENSP00000456335:p.Arg527Trp	Somatic		Capture	SOLID	Phase_I	7788526	NM_053051	A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	Missense_Mutation	SNP	ENST00000563694.1	37	CCDS11126.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.525928	0.64860	.	.	ENSG00000170037	ENST00000380262	T	0.67345	-0.26	4.56	3.56	0.40772	.	0.000000	0.49305	D	0.000151	T	0.68118	0.2966	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76071	0.987;0.987;0.987	T	0.71692	-0.4516	10	0.87932	D	0	-25.4769	11.4153	0.49949	0.3366:0.6634:0.0:0.0	.	527;527;527	Q8N137-3;Q8N137;Q8N137-2	.;CNTRB_HUMAN;.	W	527	ENSP00000369614:R527W	ENSP00000369614:R527W	R	+	1	2	CNTROB	7788526	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	1.436000	0.34980	1.214000	0.43395	0.561000	0.74099	CGG		CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421372.1	NM_053051	
GUCY2D	3000	hgsc.bcm.edu	37	17	7909696	7909696	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr17:7909696G>A	ENST00000254854.4	+	4	1192	c.1042G>A	c.(1042-1044)Ggc>Agc	p.G348S		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	348					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)	p.G348S(1)		skin(1)	1		Prostate(122;0.157)				CCCACTCTTTGGCACCATCTA	0.632																																					p.G348S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1042A	17						.						59.0	51.0	54.0					17																	7909696		2203	4300	6503	7850421	SO:0001583	missense	3000	exon4			L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.1042G>A	17.37:g.7909696G>A	ENSP00000254854:p.Gly348Ser	Somatic		Capture	SOLID	Phase_I	7850421	NM_000180	Q6LEA7	Missense_Mutation	SNP	ENST00000254854.4	37	CCDS11127.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.934264	0.92458	.	.	ENSG00000132518	ENST00000254854	D	0.83591	-1.74	5.33	5.33	0.75918	Extracellular ligand-binding receptor (1);	0.144353	0.32120	N	0.006548	D	0.91469	0.7307	M	0.81341	2.54	0.47153	D	0.99933	D	0.76494	0.999	D	0.83275	0.996	D	0.91954	0.5573	10	0.56958	D	0.05	.	17.7929	0.88561	0.0:0.0:1.0:0.0	.	348	Q02846	GUC2D_HUMAN	S	348	ENSP00000254854:G348S	ENSP00000254854:G348S	G	+	1	0	GUCY2D	7850421	1.000000	0.71417	0.997000	0.53966	0.544000	0.35116	7.328000	0.79160	2.503000	0.84419	0.561000	0.74099	GGC		GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
GUCY2D	3000	hgsc.bcm.edu	37	17	7910805	7910805	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr17:7910805G>A	ENST00000254854.4	+	6	1675	c.1525G>A	c.(1525-1527)Gac>Aac	p.D509N		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	509					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)	p.D509N(1)		skin(1)	1		Prostate(122;0.157)				GACCGTGGACGACATCACCTT	0.567																																					p.D509N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1525A	17						.						113.0	107.0	109.0					17																	7910805		2203	4300	6503	7851530	SO:0001583	missense	3000	exon6			L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.1525G>A	17.37:g.7910805G>A	ENSP00000254854:p.Asp509Asn	Somatic		Capture	SOLID	Phase_I	7851530	NM_000180	Q6LEA7	Missense_Mutation	SNP	ENST00000254854.4	37	CCDS11127.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.994258	0.93167	.	.	ENSG00000132518	ENST00000254854	D	0.84516	-1.86	5.52	5.52	0.82312	.	0.000000	0.53938	D	0.000051	D	0.90024	0.6885	M	0.76574	2.34	0.49483	D	0.999794	D	0.69078	0.997	P	0.54026	0.74	D	0.90941	0.4797	10	0.66056	D	0.02	.	18.2096	0.89866	0.0:0.0:1.0:0.0	.	509	Q02846	GUC2D_HUMAN	N	509	ENSP00000254854:D509N	ENSP00000254854:D509N	D	+	1	0	GUCY2D	7851530	1.000000	0.71417	0.730000	0.30809	0.625000	0.37756	8.971000	0.93419	2.606000	0.88127	0.561000	0.74099	GAC		GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
PRKCA	5578	hgsc.bcm.edu	37	17	64492367	64492367	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr17:64492367C>A	ENST00000413366.3	+	3	280	c.254C>A	c.(253-255)tCt>tAt	p.S85Y		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	85					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)	p.S85Y(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	GTTACTTTTTCTTGTCCGGGT	0.378																																					p.S85Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C254A	17						.						130.0	116.0	120.0					17																	64492367		2203	4300	6503	61922829	SO:0001583	missense	5578	exon3				CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.254C>A	17.37:g.64492367C>A	ENSP00000408695:p.Ser85Tyr	Somatic		Capture	SOLID	Phase_I	61922829	NM_002737	B5BU22|Q15137|Q32M72|Q96RE4	Missense_Mutation	SNP	ENST00000413366.3	37	CCDS11664.1	.	.	.	.	.	.	.	.	.	.	C	19.96	3.924291	0.73213	.	.	ENSG00000154229	ENST00000413366	D	0.93019	-3.15	5.68	5.68	0.88126	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.64402	U	0.000018	D	0.91129	0.7207	L	0.33245	0.995	0.54753	D	0.99998	P	0.42941	0.794	B	0.42495	0.389	D	0.91909	0.5538	10	0.72032	D	0.01	.	18.9319	0.92570	0.0:1.0:0.0:0.0	.	85	P17252	KPCA_HUMAN	Y	85	ENSP00000408695:S85Y	ENSP00000408695:S85Y	S	+	2	0	PRKCA	61922829	1.000000	0.71417	0.989000	0.46669	0.927000	0.56198	4.214000	0.58527	2.835000	0.97688	0.650000	0.86243	TCT		PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1		
KIAA0556	23247	hgsc.bcm.edu	37	16	27782957	27782957	+	Silent	SNP	G	G	A	rs202124589		TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr16:27782957G>A	ENST00000261588.4	+	22	4201	c.4182G>A	c.(4180-4182)ccG>ccA	p.P1394P		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1394						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.P1394P(4)		breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						ACGAGGCACCGCTGATGCCCT	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		18869	0.001		0.0	False		,,,				2504	0.0				p.P1394P												.	.	4	Substitution - coding silent(4)	large_intestine(2)|prostate(2)	c.G4182A	16						.						161.0	126.0	138.0					16																	27782957		2197	4300	6497	27690458	SO:0001819	synonymous_variant	23247	exon22			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.4182G>A	16.37:g.27782957G>A		Somatic		Capture	SOLID	Phase_I	27690458	NM_015202	A7E2C2	Silent	SNP	ENST00000261588.4	37	CCDS32415.1																																																																																				KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
CCBE1	147372	hgsc.bcm.edu	37	18	57122149	57122149	+	Silent	SNP	T	T	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr18:57122149T>A	ENST00000439986.4	-	6	625	c.588A>T	c.(586-588)ggA>ggT	p.G196G	CCBE1_ENST00000398179.2_5'UTR	NM_133459.3	NP_597716.1	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	196					lymphangiogenesis (GO:0001946)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of protein processing (GO:0010954)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|positive regulation vascular endothelial growth factor production (GO:0010575)|sprouting angiogenesis (GO:0002040)|venous blood vessel morphogenesis (GO:0048845)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|protease binding (GO:0002020)	p.G196G(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(3)	24		Colorectal(73;0.175)				CACAGCAAGTTCCGGCTTTCA	0.557																																					p.G196G	NSCLC(137;1340 1860 15773 39604 51087)|Esophageal Squamous(139;339 1777 2926 19691 38524)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A588T	18						.						154.0	110.0	125.0					18																	57122149		2203	4300	6503	55273129	SO:0001819	synonymous_variant	147372	exon6			AB075863	CCDS32838.1	18q21.32	2005-01-18				ENSG00000183287			29426	protein-coding gene	gene with protein product		612753				11853319, 12975309	Standard	NM_133459		Approved	FLJ30681, KIAA1983	uc002lib.3	Q6UXH8		ENST00000439986.4:c.588A>T	18.37:g.57122149T>A		Somatic		Capture	SOLID	Phase_I	55273129	NM_133459	Q6MZX5|Q86SS2|Q8TF19	Silent	SNP	ENST00000439986.4	37	CCDS32838.1																																																																																				CCBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449685.2	NM_133459	
C3orf30	152405	hgsc.bcm.edu	37	3	118865747	118865747	+	Missense_Mutation	SNP	T	T	A	rs200739931		TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr3:118865747T>A	ENST00000295622.1	+	1	751	c.711T>A	c.(709-711)agT>agA	p.S237R	IGSF11_ENST00000354673.2_5'Flank|IGSF11_ENST00000425327.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000441144.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	237								p.S237R(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		CTGACCAAAGTCCTTCTGTAC	0.458																																					p.S237R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T711A	3						.						94.0	96.0	95.0					3																	118865747		2203	4300	6503	120348437	SO:0001583	missense	152405	exon1			AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.711T>A	3.37:g.118865747T>A	ENSP00000295622:p.Ser237Arg	Somatic		Capture	SOLID	Phase_I	120348437	NM_152539	A1L4B7	Missense_Mutation	SNP	ENST00000295622.1	37	CCDS2984.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.143|7.143	0.582174|0.582174	0.13749|0.13749	.|.	.|.	ENSG00000163424|ENSG00000163424	ENST00000295622;ENST00000470341|ENST00000460150;ENST00000473121	T|T;T	0.36699|0.32988	1.24|1.43;1.43	2.88|2.88	-4.97|-4.97	0.03029|0.03029	.|.	0.847693|0.847693	0.10287|0.10287	N|N	0.692832|0.692832	T|T	0.06962|0.06962	0.0177|0.0177	N|N	0.01576|0.01576	-0.805|-0.805	0.09310|0.09310	N|N	1|1	B;B|.	0.12630|.	0.006;0.006|.	B;B|.	0.06405|.	0.002;0.002|.	T|T	0.28933|0.28933	-1.0028|-1.0028	10|8	0.13470|0.14656	T|T	0.59|0.56	.|.	0.8514|0.8514	0.01173|0.01173	0.3472:0.296:0.2061:0.1506|0.3472:0.296:0.2061:0.1506	.|.	237;237|.	E9PFE5;Q96M34|.	.;CC030_HUMAN|.	R|T	237|201;30	ENSP00000295622:S237R|ENSP00000418207:S201T;ENSP00000419675:S30T	ENSP00000295622:S237R|ENSP00000418207:S201T	S|S	+|+	3|1	2|0	C3orf30|C3orf30	120348437|120348437	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.052000|0.052000	0.14988|0.14988	-0.232000|-0.232000	0.09055|0.09055	-1.094000|-1.094000	0.03054|0.03054	0.172000|0.172000	0.16884|0.16884	AGT|TCC		C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539	
KALRN	8997	hgsc.bcm.edu	37	3	124415080	124415080	+	Silent	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr3:124415080G>A	ENST00000291478.5	+	21	2749	c.2586G>A	c.(2584-2586)acG>acA	p.T862T	AC080008.1_ENST00000584173.1_RNA|KALRN_ENST00000428018.2_Silent_p.T830T|KALRN_ENST00000360013.3_Silent_p.T2559T	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2558					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T2559T(1)|p.T862T(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CCACATCAACGTCTGCAACAG	0.428																																					p.T2559T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G7677A	3						.						115.0	111.0	112.0					3																	124415080		2203	4300	6503	125897770	SO:0001819	synonymous_variant	8997	exon54			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.2586G>A	3.37:g.124415080G>A		Somatic		Capture	SOLID	Phase_I	125897770	NM_001024660	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Silent	SNP	ENST00000291478.5	37	CCDS3028.1	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.575063	0.00887	.	.	ENSG00000160145	ENST00000354186	.	.	.	5.71	-11.4	0.00090	.	.	.	.	.	T	0.55242	0.1908	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72921	-0.4145	4	.	.	.	.	12.526	0.56087	0.7036:0.1504:0.0828:0.0632	.	.	.	.	H	2528	.	.	R	+	2	0	KALRN	125897770	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-3.196000	0.00562	-4.058000	0.00077	-2.865000	0.00100	CGT		KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5	NM_003947	
LRRN1	57633	hgsc.bcm.edu	37	3	3886686	3886686	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr3:3886686C>T	ENST00000319331.3	+	2	1122	c.361C>T	c.(361-363)Ctc>Ttc	p.L121F	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	121						integral component of membrane (GO:0016021)		p.L121F(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		CCTAACCCAGCTCACAACGCT	0.443																																					p.L121F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C361T	3						.						64.0	66.0	65.0					3																	3886686		2203	4300	6503	3861686	SO:0001583	missense	57633	exon2			AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.361C>T	3.37:g.3886686C>T	ENSP00000314901:p.Leu121Phe	Somatic		Capture	SOLID	Phase_I	3861686	NM_020873	Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	ENST00000319331.3	37	CCDS33685.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.798396	0.90538	.	.	ENSG00000175928	ENST00000319331	T	0.70399	-0.48	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.90614	0.7057	H	0.97214	3.96	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93324	0.6695	10	0.87932	D	0	.	19.976	0.97309	0.0:1.0:0.0:0.0	.	121	Q6UXK5	LRRN1_HUMAN	F	121	ENSP00000314901:L121F	ENSP00000314901:L121F	L	+	1	0	LRRN1	3861686	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.755000	0.85180	2.713000	0.92767	0.655000	0.94253	CTC		LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337704.2	NM_020873	
MLF1	4291	hgsc.bcm.edu	37	3	158320712	158320712	+	Nonsense_Mutation	SNP	C	C	T	rs200248107	byFrequency	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr3:158320712C>T	ENST00000355893.5	+	6	823	c.685C>T	c.(685-687)Cga>Tga	p.R229*	MLF1_ENST00000471745.1_Nonsense_Mutation_p.R219*|MLF1_ENST00000482628.1_Nonsense_Mutation_p.R204*|MLF1_ENST00000478894.2_Nonsense_Mutation_p.R219*|MLF1_ENST00000469452.1_Nonsense_Mutation_p.R161*|MLF1_ENST00000392822.3_Nonsense_Mutation_p.R260*|MLF1_ENST00000484955.1_Nonsense_Mutation_p.R204*|MLF1_ENST00000359117.5_Nonsense_Mutation_p.R204*|MLF1_ENST00000497004.1_3'UTR	NM_022443.4	NP_071888.1	P58340	MLF1_HUMAN	myeloid leukemia factor 1	229					cell cycle arrest (GO:0007050)|myeloid progenitor cell differentiation (GO:0002318)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)	p.R229*(2)|p.R260*(2)		large_intestine(3)	3		Melanoma(1037;0.000458)|Prostate(884;0.0235)|all_neural(597;0.0299)	Lung(72;0.00199)|LUSC - Lung squamous cell carcinoma(72;0.00256)			TCCTGGCTCCCGAGAACTTAA	0.353			T	NPM1	AML								C|||	7	0.00139776	0.0	0.0	5008	,	,		18250	0.006		0.0	False		,,,				2504	0.001				p.R219X			Dom	yes		3	3q25.1	4291	myeloid leukemia factor 1		L	.	.	4	Substitution - Nonsense(4)	large_intestine(4)	c.C655T	3						.						90.0	86.0	88.0					3																	158320712		2203	4300	6503	159803406	SO:0001587	stop_gained	4291	exon8			L49054	CCDS3182.1, CCDS46945.1, CCDS56286.1, CCDS56287.1, CCDS56288.1	3q25	2008-07-18			ENSG00000178053	ENSG00000178053			7125	protein-coding gene	gene with protein product	"""myeloid leukemia factor 1 variant 1"", ""myeloid leukemia factor 1 variant 2"", ""myeloid leukemia factor 1 variant 3"""	601402				8570204	Standard	NM_022443		Approved		uc003fcb.3	P58340	OTTHUMG00000158775	ENST00000355893.5:c.685C>T	3.37:g.158320712C>T	ENSP00000348157:p.Arg229*	Somatic		Capture	SOLID	Phase_I	159803406	NM_001195434	E9PEU9|Q2TLE3|Q2TLE5|Q8N8F8|Q96MH1	Nonsense_Mutation	SNP	ENST00000355893.5	37	CCDS3182.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	14.87	2.664495	0.47572	.	.	ENSG00000178053	ENST00000491767;ENST00000355893;ENST00000484955;ENST00000359117;ENST00000498592;ENST00000471745;ENST00000469452;ENST00000482628;ENST00000478894;ENST00000392822	.	.	.	5.86	2.72	0.32119	.	1.003150	0.08032	N	0.993686	.	.	.	.	.	.	0.53005	D	0.999966	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.7234	12.102	0.53790	0.3222:0.5825:0.0953:0.0	.	.	.	.	X	155;229;204;204;184;219;161;204;219;260	.	ENSP00000348157:R229X	R	+	1	2	MLF1	159803406	0.000000	0.05858	0.199000	0.23439	0.102000	0.19082	0.293000	0.19029	1.445000	0.47624	0.585000	0.79938	CGA		MLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352164.3	NM_022443	
KRT78	196374	hgsc.bcm.edu	37	12	53233617	53233617	+	Missense_Mutation	SNP	G	G	A	rs140660736	byFrequency	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr12:53233617G>A	ENST00000304620.4	-	7	1262	c.1199C>T	c.(1198-1200)aCg>aTg	p.T400M	KRT78_ENST00000359499.4_Missense_Mutation_p.T290M	NM_173352.2	NP_775487.2	Q8N1N4	K2C78_HUMAN	keratin 78	400	Coil 2.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.T400M(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18						CTTCGTGCTCGTCAGCTCCTG	0.627																																					p.T400M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1199T	12						.	A	MET/THR	3,4403	825.9+/-416.6	0,3,2200	77.0	65.0	69.0		1199	2.7	0.6	12	dbSNP_134	69	0,8600		0,0,4300	no	missense	KRT78	NM_173352.2	81	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign	400/521	53233617	3,13003	2203	4300	6503	51519884	SO:0001583	missense	196374	exon7			AK096419	CCDS8840.1, CCDS73473.1	12q13.13	2013-06-25			ENSG00000170423	ENSG00000170423		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28926	protein-coding gene	gene with protein product		611159				16831889	Standard	XM_005268695		Approved	K5B	uc001sbc.1	Q8N1N4	OTTHUMG00000169880	ENST00000304620.4:c.1199C>T	12.37:g.53233617G>A	ENSP00000306261:p.Thr400Met	Somatic		Capture	SOLID	Phase_I	51519884	NM_173352	A8K4D6|Q5HYM7|Q7RTT2	Missense_Mutation	SNP	ENST00000304620.4	37	CCDS8840.1	.	.	.	.	.	.	.	.	.	.	A	0.739	-0.776921	0.02929	6.81E-4	0.0	ENSG00000170423	ENST00000359499;ENST00000304620;ENST00000539860	D;D	0.88046	-2.33;-2.33	3.89	2.74	0.32292	Filament (1);	.	.	.	.	T	0.38825	0.1055	N	0.00002	-3.605	0.18873	N	0.999984	B	0.11235	0.004	B	0.09377	0.004	T	0.56159	-0.8025	9	0.02654	T	1	.	7.4427	0.27192	0.8123:0.0:0.1877:0.0	.	400	Q8N1N4	K2C78_HUMAN	M	290;400;171	ENSP00000352479:T290M;ENSP00000306261:T400M	ENSP00000306261:T400M	T	-	2	0	KRT78	51519884	1.000000	0.71417	0.584000	0.28653	0.837000	0.47467	5.114000	0.64648	0.201000	0.20466	-0.521000	0.04368	ACG		KRT78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406380.1	NM_173352	
NCKAP1L	3071	hgsc.bcm.edu	37	12	54925591	54925591	+	Silent	SNP	C	C	T			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr12:54925591C>T	ENST00000293373.6	+	25	2842	c.2763C>T	c.(2761-2763)gcC>gcT	p.A921A	NCKAP1L_ENST00000545638.2_Silent_p.A871A	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	921					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)	p.A921A(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						GGGCCATGGCCCAAGAGGGAC	0.478																																					p.A871A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2613T	12						.						76.0	66.0	69.0					12																	54925591		2203	4300	6503	53211858	SO:0001819	synonymous_variant	3071	exon25			AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.2763C>T	12.37:g.54925591C>T		Somatic		Capture	SOLID	Phase_I	53211858	NM_001184976	B4DUT5|Q52LW0	Silent	SNP	ENST00000293373.6	37	CCDS31813.1																																																																																				NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337	
DNAJC14	85406	hgsc.bcm.edu	37	12	56221835	56221835	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr12:56221835G>A	ENST00000357606.3	-	3	897	c.608C>T	c.(607-609)aCg>aTg	p.T203M	DNAJC14_ENST00000317287.5_Missense_Mutation_p.T203M|RP11-762I7.5_ENST00000546837.1_5'Flank|TMEM198B_ENST00000478241.1_RNA|DNAJC14_ENST00000317269.3_Missense_Mutation_p.T203M			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	203					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.T203M(1)		breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						ATCCTCCTTCGTTGGAAAGCG	0.557																																					p.T203M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C608T	12						.						55.0	53.0	54.0					12																	56221835		2203	4300	6503	54508102	SO:0001583	missense	85406	exon2			AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.608C>T	12.37:g.56221835G>A	ENSP00000350223:p.Thr203Met	Somatic		Capture	SOLID	Phase_I	54508102	NM_032364	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Missense_Mutation	SNP	ENST00000357606.3	37	CCDS8894.1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.443198	0.25987	.	.	ENSG00000135392	ENST00000357606;ENST00000317269;ENST00000317287	T;T;T	0.34667	1.35;1.35;1.35	5.2	4.29	0.51040	.	0.644557	0.15699	N	0.249020	T	0.16685	0.0401	N	0.08118	0	0.22226	N	0.999275	P;B	0.38420	0.63;0.32	B;B	0.29077	0.098;0.073	T	0.06180	-1.0841	9	.	.	.	0.0012	12.304	0.54891	0.0846:0.0:0.9154:0.0	.	203;203	Q6Y2X3;A8K5A7	DJC14_HUMAN;.	M	203	ENSP00000350223:T203M;ENSP00000316240:T203M;ENSP00000317500:T203M	.	T	-	2	0	DNAJC14	54508102	0.989000	0.36119	0.808000	0.32385	0.338000	0.28826	3.835000	0.55805	1.301000	0.44836	0.650000	0.86243	ACG		DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409095.1	NM_032364	
ANAPC5	51433	hgsc.bcm.edu	37	12	121773428	121773428	+	Silent	SNP	G	G	C	rs541537445		TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr12:121773428G>C	ENST00000261819.3	-	7	979	c.858C>G	c.(856-858)gcC>gcG	p.A286A	ANAPC5_ENST00000541887.1_Silent_p.A286A|ANAPC5_ENST00000536366.1_Silent_p.A165A|ANAPC5_ENST00000544314.1_5'UTR|ANAPC5_ENST00000344395.4_Silent_p.A187A|ANAPC5_ENST00000441917.2_Silent_p.A187A	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	286					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)	p.A286A(1)		breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TTTTGCTTTCGGCTCCGGTAA	0.483																																					p.A187A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C561G	12						.						122.0	119.0	120.0					12																	121773428		2203	4300	6503	120257811	SO:0001819	synonymous_variant	51433	exon7			AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.858C>G	12.37:g.121773428G>C		Somatic		Capture	SOLID	Phase_I	120257811	NM_001137559	E9PFB2|Q8N4H7|Q9BQD4	Silent	SNP	ENST00000261819.3	37	CCDS9220.1																																																																																				ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402582.1		
HERC2	8924	hgsc.bcm.edu	37	15	28377369	28377369	+	Silent	SNP	G	G	T			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr15:28377369G>T	ENST00000261609.7	-	81	12555	c.12447C>A	c.(12445-12447)gcC>gcA	p.A4149A		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.A4149A(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CACTGCCACAGGCGATGTCAA	0.632																																					p.A4149A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C12447A	15						.						64.0	52.0	56.0					15																	28377369		2203	4300	6503	26050964	SO:0001819	synonymous_variant	8924	exon81			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.12447C>A	15.37:g.28377369G>T		Somatic		Capture	SOLID	Phase_I	26050964	NM_004667		Silent	SNP	ENST00000261609.7	37	CCDS10021.1																																																																																				HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
ALPK1	80216	hgsc.bcm.edu	37	4	113333155	113333155	+	Missense_Mutation	SNP	G	G	A	rs374550552		TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr4:113333155G>A	ENST00000458497.1	+	5	728	c.449G>A	c.(448-450)cGc>cAc	p.R150H	ALPK1_ENST00000177648.9_Missense_Mutation_p.R150H|ALPK1_ENST00000504176.2_Missense_Mutation_p.R72H|ALPK1_ENST00000505912.1_3'UTR	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	150							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R150H(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		GTGGTTATTCGCCAAGCCCGA	0.602																																					p.R150H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G449A	4						.						78.0	65.0	69.0					4																	113333155		2203	4300	6503	113552604	SO:0001583	missense	80216	exon5			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.449G>A	4.37:g.113333155G>A	ENSP00000398048:p.Arg150His	Somatic		Capture	SOLID	Phase_I	113552604	NM_025144	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	ENST00000458497.1	37	CCDS3697.1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874812	0.72180	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000309610;ENST00000504176	T;T;T	0.34275	1.37;1.37;1.37	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.64886	0.2639	M	0.79805	2.47	0.58432	D	0.999994	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.69599	-0.5102	10	0.87932	D	0	-17.1925	19.0546	0.93058	0.0:0.0:1.0:0.0	.	72;125;125;150	F5H138;Q9H623;E7EX13;Q96QP1	.;.;.;ALPK1_HUMAN	H	150;150;125;72	ENSP00000398048:R150H;ENSP00000177648:R150H;ENSP00000426044:R72H	ENSP00000177648:R150H	R	+	2	0	ALPK1	113552604	1.000000	0.71417	0.352000	0.25734	0.099000	0.18886	8.489000	0.90461	2.499000	0.84300	0.462000	0.41574	CGC		ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144	
GPR125	166647	hgsc.bcm.edu	37	4	22446696	22446696	+	Silent	SNP	T	T	C			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr4:22446696T>C	ENST00000334304.5	-	6	875	c.606A>G	c.(604-606)gtA>gtG	p.V202V	GPR125_ENST00000502482.1_Silent_p.V202V|GPR125_ENST00000508133.1_5'Flank|GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	202	LRRCT.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)	p.V202V(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				TCTTCTCCTTTACCCAGCGAT	0.453																																					p.V202V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A606G	4						.						144.0	120.0	128.0					4																	22446696		2203	4300	6503	22055794	SO:0001819	synonymous_variant	166647	exon6			AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.606A>G	4.37:g.22446696T>C		Somatic		Capture	SOLID	Phase_I	22055794	NM_145290	Q6UXK9|Q86SQ5|Q8TC55	Silent	SNP	ENST00000334304.5	37	CCDS33964.1																																																																																				GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3		
TMPRSS11A	339967	hgsc.bcm.edu	37	4	68780427	68780427	+	Missense_Mutation	SNP	C	C	T	rs150048717		TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr4:68780427C>T	ENST00000334830.7	-	9	1729	c.983G>A	c.(982-984)cGa>cAa	p.R328Q	UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11A_ENST00000396188.2_Missense_Mutation_p.R325Q|TMPRSS11A_ENST00000508048.1_Missense_Mutation_p.R324Q			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	328	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.R328Q(1)		breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						TCTGGCTTCTCGGAGATCATT	0.388																																					p.R328Q	NSCLC(26;2 894 10941 14480 22546)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G983A	4						.	C	GLN/ARG,GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	138.0	130.0	132.0		974,983	3.2	0.6	4	dbSNP_134	132	25,8575	17.9+/-57.8	0,25,4275	yes	missense,missense	TMPRSS11A	NM_001114387.1,NM_182606.3	43,43	0,27,6476	TT,TC,CC		0.2907,0.0454,0.2076	possibly-damaging,possibly-damaging	325/419,328/422	68780427	27,12979	2203	4300	6503	68463022	SO:0001583	missense	339967	exon9			AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.983G>A	4.37:g.68780427C>T	ENSP00000334611:p.Arg328Gln	Somatic		Capture	SOLID	Phase_I	68463022	NM_182606	J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Missense_Mutation	SNP	ENST00000334830.7	37	CCDS3519.1	.	.	.	.	.	.	.	.	.	.	C	7.647	0.682081	0.14907	4.54E-4	0.002907	ENSG00000187054	ENST00000508048;ENST00000334830;ENST00000396188;ENST00000513536	D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01	5.78	3.15	0.36227	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.299635	0.24065	N	0.041869	T	0.67636	0.2914	N	0.01152	-0.98	0.31986	N	0.605203	P;P	0.51351	0.944;0.944	B;B	0.29077	0.098;0.098	T	0.73316	-0.4021	10	0.11794	T	0.64	.	7.8773	0.29601	0.0:0.6795:0.0:0.3205	.	325;328	B5MDI9;Q6ZMR5	.;TM11A_HUMAN	Q	324;328;325;292	ENSP00000426911:R324Q;ENSP00000334611:R328Q;ENSP00000379491:R325Q;ENSP00000427621:R292Q	ENSP00000334611:R328Q	R	-	2	0	TMPRSS11A	68463022	0.174000	0.23070	0.641000	0.29422	0.109000	0.19521	-0.117000	0.10708	0.380000	0.24823	0.591000	0.81541	CGA		TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251433.3	NM_182606	
CAMK2D	817	hgsc.bcm.edu	37	4	114458578	114458578	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr4:114458578T>C	ENST00000342666.5	-	7	435	c.436A>G	c.(436-438)Agc>Ggc	p.S146G	CAMK2D_ENST00000454265.2_Missense_Mutation_p.S146G|CAMK2D_ENST00000508738.1_Missense_Mutation_p.S146G|CAMK2D_ENST00000515496.1_Missense_Mutation_p.S146G|CAMK2D_ENST00000394522.3_Missense_Mutation_p.S146G|CAMK2D_ENST00000429180.1_Missense_Mutation_p.S146G|CAMK2D_ENST00000379773.2_Missense_Mutation_p.S146G|CAMK2D_ENST00000418639.2_Missense_Mutation_p.S146G|CAMK2D_ENST00000514328.1_Missense_Mutation_p.S146G|CAMK2D_ENST00000394524.3_Missense_Mutation_p.S146G|CAMK2D_ENST00000505990.1_Missense_Mutation_p.S146G|CAMK2D_ENST00000511664.1_Missense_Mutation_p.S146G|CAMK2D_ENST00000296402.5_Missense_Mutation_p.S146G|CAMK2D_ENST00000394526.2_Missense_Mutation_p.S146G			Q13557	KCC2D_HUMAN	calcium/calmodulin-dependent protein kinase II delta	146	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cardiac muscle cell contraction (GO:0086003)|cellular response to calcium ion (GO:0071277)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle cell action potential (GO:0098901)|regulation of cardiac muscle cell action potential involved in regulation of contraction (GO:0098909)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cell growth (GO:0001558)|regulation of cellular localization (GO:0060341)|regulation of generation of L-type calcium current (GO:1902514)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of histone deacetylase activity (GO:1901725)|regulation of membrane depolarization (GO:0003254)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of the force of heart contraction (GO:0002026)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|relaxation of cardiac muscle (GO:0055119)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|calcium channel complex (GO:0034704)|calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intercalated disc (GO:0014704)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|ion channel binding (GO:0044325)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|sodium channel inhibitor activity (GO:0019871)|titin binding (GO:0031432)	p.S146G(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	13		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)		TTGGATTTGCTAGCTAAAAGC	0.418																																					p.S146G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A436G	4						.						70.0	70.0	70.0					4																	114458578		2203	4300	6503	114678027	SO:0001583	missense	817	exon7			U50361	CCDS3703.1, CCDS3704.1, CCDS43263.1, CCDS47127.1, CCDS54797.1	4q26	2008-10-30	2008-10-30		ENSG00000145349	ENSG00000145349			1462	protein-coding gene	gene with protein product		607708	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II delta"""	CAMKD			Standard	NM_001221		Approved		uc003ibi.3	Q13557	OTTHUMG00000132910	ENST00000342666.5:c.436A>G	4.37:g.114458578T>C	ENSP00000339740:p.Ser146Gly	Somatic		Capture	SOLID	Phase_I	114678027	NM_172115	A8MVS8|Q52PK4|Q59G21|Q8N553|Q9UGH6|Q9UQE9	Missense_Mutation	SNP	ENST00000342666.5	37	CCDS3703.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.744419	0.89663	.	.	ENSG00000145349	ENST00000394524;ENST00000454265;ENST00000429180;ENST00000418639;ENST00000394526;ENST00000296402;ENST00000511664;ENST00000342666;ENST00000515496;ENST00000514328;ENST00000394522;ENST00000505990;ENST00000379773;ENST00000508738	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	5.9	5.9	0.94986	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79167	0.4400	L	0.52823	1.66	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.998	D;D;D;D;D	0.87578	0.998;0.992;0.992;0.992;0.992	T	0.80901	-0.1175	10	0.87932	D	0	.	16.3156	0.82923	0.0:0.0:0.0:1.0	.	146;146;146;146;146	E9PF82;Q13557-3;Q13557-6;Q13557-12;Q13557	.;.;.;.;KCC2D_HUMAN	G	146	ENSP00000378032:S146G;ENSP00000415248:S146G;ENSP00000415707:S146G;ENSP00000406131:S146G;ENSP00000378034:S146G;ENSP00000296402:S146G;ENSP00000425824:S146G;ENSP00000339740:S146G;ENSP00000423482:S146G;ENSP00000423677:S146G;ENSP00000378030:S146G;ENSP00000424245:S146G;ENSP00000369098:S146G;ENSP00000422566:S146G	ENSP00000296402:S146G	S	-	1	0	CAMK2D	114678027	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.039000	0.64185	2.260000	0.74910	0.528000	0.53228	AGC		CAMK2D-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256420.2		
ZMAT1	84460	hgsc.bcm.edu	37	X	101138825	101138825	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chrX:101138825T>C	ENST00000372782.3	-	7	1621	c.1574A>G	c.(1573-1575)aAc>aGc	p.N525S	ZMAT1_ENST00000540921.1_Missense_Mutation_p.N525S|ZMAT1_ENST00000494068.1_5'UTR|ZMAT1_ENST00000458570.1_Missense_Mutation_p.N354S	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	525						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.N354S(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						AGCAGTATTGTTTTCTGAAGA	0.418																																					p.N525S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1574G	X						.						154.0	127.0	136.0					X																	101138825		2202	4300	6502	101025481	SO:0001583	missense	84460	exon7			Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.1574A>G	X.37:g.101138825T>C	ENSP00000361868:p.Asn525Ser	Somatic		Capture	SOLID	Phase_I	101025481	NM_001011657	Q8NDS3|Q96JN6	Missense_Mutation	SNP	ENST00000372782.3	37	CCDS35348.1	.	.	.	.	.	.	.	.	.	.	T	3.020	-0.201968	0.06219	.	.	ENSG00000166432	ENST00000372782;ENST00000540921;ENST00000458570	T;T;T	0.23950	2.4;2.4;1.88	4.37	1.89	0.25635	.	0.555420	0.18533	N	0.138437	T	0.18341	0.0440	L	0.59436	1.845	0.09310	N	1	P	0.46395	0.877	B	0.35182	0.197	T	0.21314	-1.0249	10	0.59425	D	0.04	-0.6409	4.0911	0.09970	0.184:0.1058:0.0:0.7102	.	525	Q5H9K5	ZMAT1_HUMAN	S	525;525;354	ENSP00000361868:N525S;ENSP00000437529:N525S;ENSP00000413044:N354S	ENSP00000361868:N525S	N	-	2	0	ZMAT1	101025481	0.740000	0.28207	0.001000	0.08648	0.145000	0.21501	0.806000	0.27126	0.252000	0.21531	0.486000	0.48141	AAC		ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057598.1		
FRMPD4	9758	hgsc.bcm.edu	37	X	12736335	12736335	+	Silent	SNP	A	A	G			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chrX:12736335A>G	ENST00000380682.1	+	16	3896	c.3390A>G	c.(3388-3390)gaA>gaG	p.E1130E		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1130					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.E1120E(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						AAGGGAAGGAAGAAGGAGCTC	0.517																																					p.E1130E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3390G	X						.						172.0	169.0	170.0					X																	12736335		2203	4300	6503	12646256	SO:0001819	synonymous_variant	9758	exon16			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.3390A>G	X.37:g.12736335A>G		Somatic		Capture	SOLID	Phase_I	12646256	NM_014728	A8K0X9|O15032	Silent	SNP	ENST00000380682.1	37	CCDS35201.1																																																																																				FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
DOCK11	139818	hgsc.bcm.edu	37	X	117758569	117758569	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chrX:117758569G>A	ENST00000276202.7	+	32	3602	c.3539G>A	c.(3538-3540)cGa>cAa	p.R1180Q	DOCK11_ENST00000276204.6_Missense_Mutation_p.R1180Q	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1180					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R1180Q(1)		breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						AATATACAGCGATTAGCAGGT	0.348																																					p.R1180Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3539A	X						.						179.0	166.0	170.0					X																	117758569		2203	4300	6503	117642597	SO:0001583	missense	139818	exon32			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.3539G>A	X.37:g.117758569G>A	ENSP00000276202:p.Arg1180Gln	Somatic		Capture	SOLID	Phase_I	117642597	NM_144658	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.244541	0.79912	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.64438	-0.1;-0.1	5.53	5.53	0.82687	.	0.064020	0.64402	D	0.000004	T	0.56232	0.1971	L	0.48218	1.51	0.58432	D	0.99999	B;B	0.27656	0.184;0.184	B;B	0.17098	0.017;0.017	T	0.51949	-0.8640	10	0.26408	T	0.33	-3.5287	18.6852	0.91560	0.0:0.0:1.0:0.0	.	1180;1180	A6NIW2;Q5JSL3	.;DOC11_HUMAN	Q	1180	ENSP00000276204:R1180Q;ENSP00000276202:R1180Q	ENSP00000276202:R1180Q	R	+	2	0	DOCK11	117642597	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.784000	0.62411	2.443000	0.82685	0.594000	0.82650	CGA		DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658	
AFF2	2334	hgsc.bcm.edu	37	X	148037780	148037780	+	Silent	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chrX:148037780G>A	ENST00000370460.2	+	11	2684	c.2205G>A	c.(2203-2205)ccG>ccA	p.P735P	AFF2_ENST00000286437.5_Silent_p.P376P|AFF2_ENST00000370457.5_Silent_p.P702P|AFF2_ENST00000342251.3_Silent_p.P702P	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	735					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.P735P(1)|p.P376P(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TCCTGCCTCCGTGCATTATTT	0.463																																					p.P735P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2205A	X						.						91.0	89.0	89.0					X																	148037780		2203	4300	6503	147845480	SO:0001819	synonymous_variant	2334	exon11			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2205G>A	X.37:g.148037780G>A		Somatic		Capture	SOLID	Phase_I	147845480	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	ENST00000370460.2	37	CCDS14684.1																																																																																				AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
SULT1C4	27233	hgsc.bcm.edu	37	2	108998302	108998302	+	Missense_Mutation	SNP	G	G	T	rs137946991		TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr2:108998302G>T	ENST00000272452.2	+	2	580	c.254G>T	c.(253-255)cGa>cTa	p.R85L	SULT1C4_ENST00000409309.3_Missense_Mutation_p.R85L	NM_006588.2	NP_006579.2	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 4	85					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)	p.R85Q(2)|p.R85L(1)		endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						ACTCATCAACGATTTCCTTTC	0.398																																					p.R85L												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G254T	2						.						135.0	116.0	123.0					2																	108998302		2203	4300	6503	108364734	SO:0001583	missense	27233	exon2			AF055584	CCDS2077.1	2q12.3	2008-09-04	2007-03-16	2007-03-16	ENSG00000198075	ENSG00000198075		"""Sulfotransferases, cytosolic"""	11457	protein-coding gene	gene with protein product		608357	"""sulfotransferase family, cytosolic, 1C, member 2"""	SULT1C2		10783263, 9852044	Standard	NM_006588		Approved	SULT1C	uc002tea.1	O75897	OTTHUMG00000130958	ENST00000272452.2:c.254G>T	2.37:g.108998302G>T	ENSP00000272452:p.Arg85Leu	Somatic		Capture	SOLID	Phase_I	108364734	NM_006588	Q069I8|Q08AS5|Q53S63	Missense_Mutation	SNP	ENST00000272452.2	37	CCDS2077.1	.	.	.	.	.	.	.	.	.	.	G	14.27	2.486144	0.44147	.	.	ENSG00000198075	ENST00000272452;ENST00000409309	D;D	0.82711	-1.64;-1.64	4.33	3.41	0.39046	Sulfotransferase domain (1);	0.335160	0.21862	N	0.068002	D	0.86928	0.6051	L	0.58302	1.8	0.09310	N	1	P;D;D	0.89917	0.884;1.0;0.999	P;D;D	0.91635	0.598;0.999;0.982	T	0.76523	-0.2928	10	0.66056	D	0.02	.	6.6557	0.22986	0.0909:0.0:0.7295:0.1796	.	85;85;85	Q08AS5;O75897;Q6PD90	.;ST1C4_HUMAN;.	L	85	ENSP00000272452:R85L;ENSP00000387225:R85L	ENSP00000272452:R85L	R	+	2	0	SULT1C4	108364734	0.954000	0.32549	0.012000	0.15200	0.203000	0.24098	4.499000	0.60380	1.110000	0.41699	0.609000	0.83330	CGA		SULT1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253561.1	NM_006588	
RANBP2	5903	hgsc.bcm.edu	37	2	109379847	109379847	+	Missense_Mutation	SNP	C	C	T	rs549497956		TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr2:109379847C>T	ENST00000283195.6	+	20	2978	c.2852C>T	c.(2851-2853)aCg>aTg	p.T951M		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	951					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.T951M(2)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						TCTCCTGCAACGGGAATTCTA	0.463													C|||	1	0.000199681	0.0	0.0	5008	,	,		19187	0.0		0.001	False		,,,				2504	0.0				p.T951M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2852T	2						.						118.0	112.0	114.0					2																	109379847		2203	4300	6503	108746279	SO:0001583	missense	5903	exon20			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.2852C>T	2.37:g.109379847C>T	ENSP00000283195:p.Thr951Met	Somatic		Capture	SOLID	Phase_I	108746279	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095894	0.76870	.	.	ENSG00000153201	ENST00000283195	T	0.28895	1.59	5.19	5.19	0.71726	.	.	.	.	.	T	0.45256	0.1333	L	0.32530	0.975	0.41106	D	0.985708	D	0.89917	1.0	D	0.63957	0.92	T	0.44360	-0.9333	9	0.72032	D	0.01	-21.1681	19.0873	0.93209	0.0:1.0:0.0:0.0	.	951	P49792	RBP2_HUMAN	M	951	ENSP00000283195:T951M	ENSP00000283195:T951M	T	+	2	0	RANBP2	108746279	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.734000	0.84928	2.570000	0.86706	0.563000	0.77884	ACG		RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
SAP130	79595	hgsc.bcm.edu	37	2	128699655	128699655	+	Silent	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr2:128699655G>A	ENST00000259235.3	-	20	3201	c.3072C>T	c.(3070-3072)gaC>gaT	p.D1024D	SAP130_ENST00000357702.5_Silent_p.D1059D|SAP130_ENST00000259234.6_Silent_p.D1032D	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	1024	Interactions with SIN3A and HDAC1.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)	p.D1024D(1)		NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		TCAGGACACGGTCTTTATGAT	0.408																																					p.D1059D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3177T	2						.						175.0	154.0	161.0					2																	128699655		2203	4300	6503	128416125	SO:0001819	synonymous_variant	79595	exon21			BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.3072C>T	2.37:g.128699655G>A		Somatic		Capture	SOLID	Phase_I	128416125	NM_001145928	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Silent	SNP	ENST00000259235.3	37	CCDS2153.1																																																																																				SAP130-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254436.3	NM_024545	
NRXN1	9378	hgsc.bcm.edu	37	2	50318621	50318621	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr2:50318621T>A	ENST00000406316.2	-	19	5034	c.3558A>T	c.(3556-3558)aaA>aaT	p.K1186N	NRXN1_ENST00000342183.5_Missense_Mutation_p.K151N|NRXN1_ENST00000401669.2_Missense_Mutation_p.K1186N|NRXN1_ENST00000405472.3_Missense_Mutation_p.K1178N|NRXN1_ENST00000401710.1_Missense_Mutation_p.K204N|NRXN1_ENST00000404971.1_Missense_Mutation_p.K1226N|NRXN1_ENST00000402717.3_Missense_Mutation_p.K1178N|NRXN1_ENST00000406859.3_Missense_Mutation_p.K1186N	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1186	Laminin G-like 6. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.K151N(1)|p.K1227N(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TAACTCCAATTTTTCCCTGGT	0.353																																					p.K151N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A453T	2						.						112.0	104.0	107.0					2																	50318621		2203	4300	6503	50172125	SO:0001583	missense	9378	exon3			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3558A>T	2.37:g.50318621T>A	ENSP00000384311:p.Lys1186Asn	Somatic		Capture	SOLID	Phase_I	50172125	NM_138735	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	T	5.624	0.299911	0.10622	.	.	ENSG00000179915	ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23	5.74	1.7	0.24286	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.094685	0.40144	U	0.001167	T	0.53094	0.1775	N	0.05078	-0.115	0.23572	N	0.99738	B;B;B;B	0.17465	0.003;0.022;0.0;0.0	B;B;B;B	0.21917	0.015;0.037;0.002;0.005	T	0.36040	-0.9764	10	0.12103	T	0.63	.	10.2355	0.43280	0.0:0.2217:0.0:0.7783	.	1226;151;1186;1178	Q9ULB1-3;P58400;F8WB18;A7E294	.;NRX1B_HUMAN;.;.	N	151;105;204;1226;1186;1178;1186;1227;1178;1186	ENSP00000341184:K151N;ENSP00000385580:K204N;ENSP00000385142:K1226N;ENSP00000384311:K1186N;ENSP00000434015:K1178N;ENSP00000385017:K1186N;ENSP00000385434:K1178N;ENSP00000385681:K1186N	ENSP00000341184:K151N	K	-	3	2	NRXN1	50172125	0.998000	0.40836	1.000000	0.80357	0.679000	0.39708	0.359000	0.20233	0.459000	0.27016	0.460000	0.39030	AAA		NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
IFIH1	64135	hgsc.bcm.edu	37	2	163124065	163124065	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr2:163124065A>G	ENST00000263642.2	-	15	3217	c.2822T>C	c.(2821-2823)gTa>gCa	p.V941A		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	941					cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)	p.V941A(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						GTTTTCTCTTACAATGTAAAG	0.403																																					p.V941A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2822C	2						.						158.0	133.0	141.0					2																	163124065		2203	4300	6503	162832311	SO:0001583	missense	64135	exon15			AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.2822T>C	2.37:g.163124065A>G	ENSP00000263642:p.Val941Ala	Somatic		Capture	SOLID	Phase_I	162832311	NM_022168	Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	ENST00000263642.2	37	CCDS2217.1	.	.	.	.	.	.	.	.	.	.	A	5.157	0.214600	0.09810	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.45668	0.89	4.98	3.84	0.44239	C-terminal domain of RIG-I (1);	0.780544	0.11397	N	0.568242	T	0.38639	0.1048	M	0.67397	2.05	0.29225	N	0.873702	B	0.18310	0.027	B	0.20184	0.028	T	0.35847	-0.9772	10	0.29301	T	0.29	-3.3882	5.3054	0.15801	0.6623:0.0:0.0759:0.2618	.	941	Q9BYX4	IFIH1_HUMAN	A	941	ENSP00000263642:V941A	ENSP00000263642:V941A	V	-	2	0	IFIH1	162832311	0.665000	0.27466	0.987000	0.45799	0.374000	0.29953	0.518000	0.22847	0.940000	0.37473	0.477000	0.44152	GTA		IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255078.2	NM_022168	
INVS	27130	hgsc.bcm.edu	37	9	103054846	103054846	+	Silent	SNP	G	G	A	rs140706545	byFrequency	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr9:103054846G>A	ENST00000262457.2	+	14	2492	c.2307G>A	c.(2305-2307)ccG>ccA	p.P769P	INVS_ENST00000541287.1_Silent_p.P673P|INVS_ENST00000262456.2_Intron	NM_014425.3	NP_055240.2	Q9Y283	INVS_HUMAN	inversin	769					embryonic heart tube left/right pattern formation (GO:0060971)|kidney development (GO:0001822)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|pancreas development (GO:0031016)|post-embryonic development (GO:0009791)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.P769P(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Acute lymphoblastic leukemia(62;0.056)				GCCTTCCACCGCACGATAGCC	0.602																																					p.P769P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|breast(1)	c.G2307A	9						.	G	,	2,4404	4.2+/-10.8	0,2,2201	46.0	45.0	45.0		2307,	1.0	0.0	9	dbSNP_134	45	0,8600		0,0,4300	no	coding-synonymous,intron	INVS	NM_014425.2,NM_183245.1	,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,	769/1066,	103054846	2,13004	2203	4300	6503	102094667	SO:0001819	synonymous_variant	27130	exon14			AF039217	CCDS6746.1, CCDS6747.1	9q31	2013-01-10	2003-08-11		ENSG00000119509	ENSG00000119509		"""Ankyrin repeat domain containing"""	17870	protein-coding gene	gene with protein product	"""nephrocystin 2"""	243305	"""nephronophthisis 2 (infantile)"""	NPHP2		12872123	Standard	NM_014425		Approved		uc004bap.2	Q9Y283	OTTHUMG00000020364	ENST00000262457.2:c.2307G>A	9.37:g.103054846G>A		Somatic		Capture	SOLID	Phase_I	102094667	NM_014425	A2A2Y2|Q2NKL0|Q5W0T6|Q8IVX8|Q9BRB9|Q9Y488|Q9Y498	Silent	SNP	ENST00000262457.2	37	CCDS6746.1																																																																																				INVS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053407.1	NM_014425	
DENND1A	57706	hgsc.bcm.edu	37	9	126319858	126319858	+	Silent	SNP	T	T	C			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr9:126319858T>C	ENST00000373624.2	-	13	1185	c.984A>G	c.(982-984)aaA>aaG	p.K328K	DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000394215.2_Silent_p.K298K|DENND1A_ENST00000394219.3_Silent_p.K296K|DENND1A_ENST00000373620.3_Silent_p.K328K|DENND1A_ENST00000542603.1_Intron|DENND1A_ENST00000373618.1_Silent_p.K296K	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	328	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.K328K(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						CCGGCTCGATTTTCAGAGCGT	0.547																																					p.K328K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A984G	9						.						71.0	64.0	66.0					9																	126319858		2203	4300	6503	125359679	SO:0001819	synonymous_variant	57706	exon13			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.984A>G	9.37:g.126319858T>C		Somatic		Capture	SOLID	Phase_I	125359679	NM_024820	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Silent	SNP	ENST00000373624.2	37	CCDS35133.1																																																																																				DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820	
PHYHD1	254295	hgsc.bcm.edu	37	9	131702682	131702682	+	Silent	SNP	G	G	A	rs201233901		TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr9:131702682G>A	ENST00000372592.3	+	10	1425	c.492G>A	c.(490-492)acG>acA	p.T164T	PHYHD1_ENST00000421063.2_Silent_p.T143T|PHYHD1_ENST00000487504.1_3'UTR|PHYHD1_ENST00000353176.5_Silent_p.T143T|PHYHD1_ENST00000308941.5_Missense_Mutation_p.R157Q|RP11-101E3.5_ENST00000482796.1_5'Flank	NM_001100876.1	NP_001094346.1	Q5SRE7	PHYD1_HUMAN	phytanoyl-CoA dioxygenase domain containing 1	164							dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.R157Q(1)		central_nervous_system(1)|endometrium(2)|large_intestine(3)|skin(1)|stomach(3)	10						TCCTGTACACGGAGCCCCTGG	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		17829	0.001		0.0	False		,,,				2504	0.0				p.R157Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G470A	9						.						73.0	77.0	76.0					9																	131702682		2203	4300	6503	130742503	SO:0001819	synonymous_variant	254295	exon9			BC051300	CCDS6914.1, CCDS43885.1, CCDS43886.1	9q34.13	2010-08-13			ENSG00000175287	ENSG00000175287			23396	protein-coding gene	gene with protein product						12477932	Standard	NM_174933		Approved	MGC16638	uc004bwp.2	Q5SRE7	OTTHUMG00000020764	ENST00000372592.3:c.492G>A	9.37:g.131702682G>A		Somatic		Capture	SOLID	Phase_I	130742503	NM_174933	A6PWN9|A6PWP0|B3KT57|B4E3X8|Q5SRE9|Q5SRF0|Q7Z623|Q7Z7P9|Q96GM4	Missense_Mutation	SNP	ENST00000372592.3	37	CCDS43885.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	18.05	3.538039	0.65085	.	.	ENSG00000175287	ENST00000308941;ENST00000419872	.	.	.	5.25	4.26	0.50523	.	0.579443	0.18068	N	0.152718	T	0.38321	0.1036	.	.	.	0.80722	D	1	D	0.56521	0.976	P	0.46110	0.504	T	0.25813	-1.0121	8	0.02654	T	1	-9.5979	15.6699	0.77264	0.0:0.0:0.8537:0.1463	.	157	Q5SRE7-3	.	Q	157;22	.	ENSP00000309515:R157Q	R	+	2	0	PHYHD1	130742503	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	0.704000	0.25661	2.470000	0.83445	0.555000	0.69702	CGG		PHYHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054506.2	NM_174933	
CCL27	10850	hgsc.bcm.edu	37	9	34662282	34662282	+	Splice_Site	SNP	C	C	T	rs372580675		TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr9:34662282C>T	ENST00000259631.4	-	2	260	c.202G>A	c.(202-204)Gtg>Atg	p.V68M	CCL27_ENST00000557161.1_5'UTR|RP11-195F19.30_ENST00000564224.1_RNA	NM_006664.2	NP_006655.1	Q9Y4X3	CCL27_HUMAN	chemokine (C-C motif) ligand 27	68					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)	p.V68M(1)		kidney(1)|large_intestine(3)|ovary(1)	5	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		GGAGCTCACACGAAAGCCTGG	0.557																																					p.V68M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G202A	9						.	C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	54.0	48.0	50.0		202	4.4	0.9	9		50	0,8600		0,0,4300	no	missense-near-splice	CCL27	NM_006664.2	21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	68/113	34662282	1,13005	2203	4300	6503	34652282	SO:0001630	splice_region_variant	10850	exon2			AJ243542	CCDS6569.1	9p13	2014-05-16	2002-08-22	2002-08-23	ENSG00000213927	ENSG00000213927		"""Chemokine ligands"", ""Endogenous ligands"""	10626	protein-coding gene	gene with protein product	"""CC chemokine ILC"", ""IL-11 Ralpha-locus chemokine"", ""cutaneous T-cell attracting chemokine"""	604833	"""small inducible cytokine subfamily A (Cys-Cys), member 27"""	SCYA27		10556532, 10588729	Standard	NM_006664		Approved	ALP, ILC, CTACK, skinkine, ESkine, PESKY, CTAK	uc003zvm.1	Q9Y4X3	OTTHUMG00000019834	ENST00000259631.4:c.203+1G>A	9.37:g.34662282C>T		Somatic		Capture	SOLID	Phase_I	34652282	NM_006664		Missense_Mutation	SNP	ENST00000259631.4	37	CCDS6569.1	.	.	.	.	.	.	.	.	.	.	C	18.98	3.737441	0.69304	2.27E-4	0.0	ENSG00000213927	ENST00000259631	T	0.37411	1.2	5.29	4.39	0.52855	Chemokine interleukin-8-like domain (2);	0.144615	0.32190	N	0.006457	T	0.53674	0.1811	M	0.64997	1.995	0.34971	D	0.753151	D	0.89917	1.0	D	0.77004	0.989	T	0.66512	-0.5905	10	0.66056	D	0.02	-10.2017	9.8747	0.41195	0.0:0.9058:0.0:0.0942	.	68	Q9Y4X3	CCL27_HUMAN	M	68	ENSP00000259631:V68M	ENSP00000259631:V68M	V	-	1	0	CCL27	34652282	0.864000	0.29904	0.882000	0.34594	0.886000	0.51366	1.370000	0.34238	1.365000	0.46057	0.650000	0.86243	GTG		CCL27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052228.1	NM_006664	Missense_Mutation
DBH	1621	hgsc.bcm.edu	37	9	136507370	136507370	+	Silent	SNP	G	G	A	rs551376703		TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr9:136507370G>A	ENST00000393056.2	+	3	540	c.528G>A	c.(526-528)ccG>ccA	p.P176P		NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	176					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)	p.P176P(1)		central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	TGGAGGAGCCGTTCCGGTCAC	0.647													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17086	0.0		0.0	False		,,,				2504	0.0				p.P176P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G528A	9						.						38.0	41.0	40.0					9																	136507370		2203	4300	6503	135497191	SO:0001819	synonymous_variant	1621	exon3			X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.528G>A	9.37:g.136507370G>A		Somatic		Capture	SOLID	Phase_I	135497191	NM_000787	Q5T381|Q96AG2	Silent	SNP	ENST00000393056.2	37	CCDS6977.2																																																																																				DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054929.2	NM_000787	
LHX3	8022	hgsc.bcm.edu	37	9	139092533	139092533	+	Missense_Mutation	SNP	C	C	T	rs143900430		TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr9:139092533C>T	ENST00000371748.5	-	2	242	c.146G>A	c.(145-147)cGc>cAc	p.R49H	LHX3_ENST00000371746.3_Missense_Mutation_p.R54H	NM_178138.4	NP_835258.1	Q9UBR4	LHX3_HUMAN	LIM homeobox 3	49	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				inner ear development (GO:0048839)|lung development (GO:0030324)|medial motor column neuron differentiation (GO:0021526)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|placenta development (GO:0001890)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron cell fate specification (GO:0021520)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.R54H(1)		large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		GTGCCAGTGGCGGTCCAGAGC	0.612																																					p.R49H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G146A	9						.						72.0	67.0	69.0					9																	139092533		2203	4300	6503	138232354	SO:0001583	missense	8022	exon2			AF096169	CCDS6994.1, CCDS6995.1	9q34.3	2011-06-20			ENSG00000107187	ENSG00000107187		"""Homeoboxes / LIM class"""	6595	protein-coding gene	gene with protein product		600577				10598593, 10717474	Standard	NM_178138		Approved		uc004cgz.3	Q9UBR4	OTTHUMG00000020924	ENST00000371748.5:c.146G>A	9.37:g.139092533C>T	ENSP00000360813:p.Arg49His	Somatic		Capture	SOLID	Phase_I	138232354	NM_178138	Q5TB39|Q5TB40|Q9NZB5|Q9P0I8|Q9P0I9	Missense_Mutation	SNP	ENST00000371748.5	37	CCDS6994.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.29|17.29	3.351279|3.351279	0.61183|0.61183	.|.	.|.	ENSG00000107187|ENSG00000107187	ENST00000325195|ENST00000371748;ENST00000371746	.|D;D	.|0.87491	.|-2.26;-2.26	4.65|4.65	4.65|4.65	0.58169|0.58169	.|Zinc finger, LIM-type (5);	.|0.068831	.|0.64402	.|D	.|0.000012	D|D	0.93190|0.93190	0.7831|0.7831	M|M	0.80616|0.80616	2.505|2.505	0.80722|0.80722	D|D	1|1	.|D;P	.|0.76494	.|0.999;0.597	.|D;B	.|0.68353	.|0.957;0.28	D|D	0.94089|0.94089	0.7351|0.7351	6|10	0.87932|0.72032	D|D	0|0.01	.|.	16.6714|16.6714	0.85268|0.85268	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|49;54	.|Q9UBR4;F1T0D9	.|LHX3_HUMAN;.	T|H	53|49;54	.|ENSP00000360813:R49H;ENSP00000360811:R54H	ENSP00000319224:A53T|ENSP00000360811:R54H	A|R	-|-	1|2	0|0	LHX3|LHX3	138232354|138232354	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.014000|0.014000	0.08584|0.08584	7.405000|7.405000	0.80007|0.80007	2.424000|2.424000	0.82194|0.82194	0.591000|0.591000	0.81541|0.81541	GCC|CGC		LHX3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055048.3		
CUBN	8029	hgsc.bcm.edu	37	10	17151716	17151716	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr10:17151716C>G	ENST00000377833.4	-	10	1099	c.1034G>C	c.(1033-1035)aGa>aCa	p.R345T		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	345	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGTGCACACTCTTCCGTCACC	0.478																																					p.R345T												.	.	0			c.G1034C	10						.						168.0	118.0	135.0					10																	17151716		2203	4300	6503	17191722	SO:0001583	missense	8029	exon10			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1034G>C	10.37:g.17151716C>G	ENSP00000367064:p.Arg345Thr	None		Capture	SOLID	Phase_I	17191722	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.184655	0.38609	.	.	ENSG00000107611	ENST00000377833	D	0.91237	-2.81	5.64	1.18	0.20946	Growth factor, receptor (1);Epidermal growth factor-like (1);EGF-like calcium-binding (1);	0.134082	0.34386	N	0.004008	D	0.83496	0.5267	L	0.27053	0.805	0.80722	D	1	P	0.38677	0.642	B	0.43225	0.412	T	0.76772	-0.2836	10	0.41790	T	0.15	.	6.1452	0.20280	0.0:0.4406:0.0:0.5594	.	345	O60494	CUBN_HUMAN	T	345	ENSP00000367064:R345T	ENSP00000367064:R345T	R	-	2	0	CUBN	17191722	0.882000	0.30256	0.777000	0.31699	0.488000	0.33401	0.150000	0.16263	0.428000	0.26173	0.557000	0.71058	AGA		CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
SGMS1	259230	hgsc.bcm.edu	37	10	52103560	52103560	+	Silent	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr10:52103560G>A	ENST00000361781.2	-	7	1274	c.315C>T	c.(313-315)aaC>aaT	p.N105N	SGMS1_ENST00000492601.2_5'Flank|SGMS1_ENST00000429490.1_Intron|SGMS1_ENST00000361543.2_Silent_p.N105N	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	111					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)	p.N105N(1)		endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						TTGGCATCCCGTTGGGTTTAA	0.527																																					p.N105N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C315T	10						.						103.0	102.0	102.0					10																	52103560		2203	4300	6503	51773566	SO:0001819	synonymous_variant	259230	exon7			AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.315C>T	10.37:g.52103560G>A		Somatic		Capture	SOLID	Phase_I	51773566	NM_147156	Q68U43|Q6EKK0|Q75SP1	Silent	SNP	ENST00000361781.2	37	CCDS7240.1																																																																																				SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048074.2	NM_147156	
HOGA1	112817	hgsc.bcm.edu	37	10	99359497	99359497	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr10:99359497G>T	ENST00000370646.4	+	4	890	c.529G>T	c.(529-531)Gac>Tac	p.D177Y	HOGA1_ENST00000370647.4_Intron|PI4K2A_ENST00000370649.3_Intron|PI4K2A_ENST00000555577.1_Intron	NM_138413.3	NP_612422.2	Q86XE5	HOGA1_HUMAN	4-hydroxy-2-oxoglutarate aldolase 1	177					4-hydroxyproline catabolic process (GO:0019470)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|oxalate metabolic process (GO:0033609)|pyruvate biosynthetic process (GO:0042866)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	4-hydroxy-2-oxoglutarate aldolase activity (GO:0008700)|protein homodimerization activity (GO:0042803)	p.D177Y(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|stomach(1)	14						CACAGGGCTGGACCTGCCTGT	0.617																																					p.D177Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G529T	10						.						75.0	74.0	74.0					10																	99359497		2203	4300	6503	99349487	SO:0001583	missense	112817	exon4			BC011916	CCDS7467.1, CCDS44469.1	10q24.1	2010-12-19	2010-12-19	2010-12-19	ENSG00000241935	ENSG00000241935			25155	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 2 (E. coli)"", ""N-acetylneuraminate pyruvate lyase 2 (putative)"""	613597	"""chromosome 10 open reading frame 65"", ""dihydrodipicolinate synthase-like, mitochondrial"""	C10orf65, DHDPSL		20797690	Standard	NM_001134670		Approved	FLJ37472, DHDPS2, NPL2		Q86XE5	OTTHUMG00000018859	ENST00000370646.4:c.529G>T	10.37:g.99359497G>T	ENSP00000359680:p.Asp177Tyr	Somatic		Capture	SOLID	Phase_I	99349487	NM_138413	A8K075|Q5T680|Q5T684|Q711P0|Q8N9F2|Q96EV5	Missense_Mutation	SNP	ENST00000370646.4	37	CCDS7467.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.004703	0.93287	.	.	ENSG00000241935	ENST00000370646	D	0.95724	-3.79	5.09	5.09	0.68999	Aldolase-type TIM barrel (1);	0.147165	0.64402	D	0.000017	D	0.97682	0.9240	M	0.92784	3.345	0.58432	D	0.999999	P	0.44195	0.828	P	0.51701	0.677	D	0.98936	1.0789	10	0.87932	D	0	-21.3089	18.4909	0.90846	0.0:0.0:1.0:0.0	.	177	Q86XE5	HOGA1_HUMAN	Y	177	ENSP00000359680:D177Y	ENSP00000359680:D177Y	D	+	1	0	HOGA1	99349487	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.459000	0.97638	2.360000	0.80028	0.650000	0.86243	GAC		HOGA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049726.1	NM_138413	
DPYSL4	10570	hgsc.bcm.edu	37	10	134015484	134015484	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr10:134015484C>T	ENST00000338492.4	+	11	1309	c.1145C>T	c.(1144-1146)gCg>gTg	p.A382V	DPYSL4_ENST00000368627.1_Missense_Mutation_p.A282V|DPYSL4_ENST00000368629.1_Missense_Mutation_p.A282V	NM_006426.2	NP_006417.2	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	382					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)	cytosol (GO:0005829)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.A382V(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		GAGTTCGTCGCGGTGACCAGT	0.577																																					p.A382V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1145T	10						.						99.0	97.0	98.0					10																	134015484		2203	4300	6503	133865474	SO:0001583	missense	10570	exon11			AB006713	CCDS7665.1	10q25.2-q26	2008-05-14			ENSG00000151640	ENSG00000151640			3016	protein-coding gene	gene with protein product		608407				8973361, 9652388	Standard	NM_006426		Approved	ULIP4, DRP-4	uc009ybb.3	O14531	OTTHUMG00000019283	ENST00000338492.4:c.1145C>T	10.37:g.134015484C>T	ENSP00000339850:p.Ala382Val	Somatic		Capture	SOLID	Phase_I	133865474	NM_006426	B2RMQ1|D3DRG5|O00240|Q5T0Q7	Missense_Mutation	SNP	ENST00000338492.4	37	CCDS7665.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.006325	0.74932	.	.	ENSG00000151640	ENST00000338492;ENST00000368629;ENST00000368627	D;D;D	0.90732	-2.72;-2.72;-2.72	4.48	3.52	0.40303	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.057818	0.64402	D	0.000002	D	0.95614	0.8574	H	0.94222	3.51	0.53688	D	0.999974	D	0.89917	1.0	P	0.58721	0.844	D	0.96554	0.9410	10	0.66056	D	0.02	-24.4111	14.6074	0.68489	0.0:0.8541:0.1459:0.0	.	382	O14531	DPYL4_HUMAN	V	382;282;282	ENSP00000339850:A382V;ENSP00000357618:A282V;ENSP00000357616:A282V	ENSP00000339850:A382V	A	+	2	0	DPYSL4	133865474	0.997000	0.39634	0.409000	0.26459	0.346000	0.29079	3.600000	0.54052	2.317000	0.78254	0.650000	0.86243	GCG		DPYSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051050.2		
CTNND2	1501	hgsc.bcm.edu	37	5	11117585	11117585	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr5:11117585C>G	ENST00000304623.8	-	13	2443	c.2254G>C	c.(2254-2256)Ggg>Cgg	p.G752R	CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000458100.2_Missense_Mutation_p.G319R|CTNND2_ENST00000359640.2_Missense_Mutation_p.G752R|CTNND2_ENST00000503622.1_Missense_Mutation_p.G415R|CTNND2_ENST00000511377.1_Missense_Mutation_p.G661R	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	752					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.G752R(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TCACTGCTCCCCAGCGCAGAC	0.512																																					p.G752R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2254C	5						.						198.0	172.0	181.0					5																	11117585		2203	4300	6503	11170585	SO:0001583	missense	1501	exon13			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2254G>C	5.37:g.11117585C>G	ENSP00000307134:p.Gly752Arg	Somatic		Capture	SOLID	Phase_I	11170585	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	C	32	5.114629	0.94339	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622	T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02	5.6	5.6	0.85130	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.87815	0.6272	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.996	D	0.88351	0.2981	10	0.87932	D	0	-21.0958	19.6126	0.95616	0.0:1.0:0.0:0.0	.	415;319;752	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	R	752;752;661;319;415	ENSP00000307134:G752R;ENSP00000352661:G752R;ENSP00000426510:G661R;ENSP00000391155:G319R;ENSP00000426887:G415R	ENSP00000307134:G752R	G	-	1	0	CTNND2	11170585	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.407000	0.80029	2.647000	0.89833	0.650000	0.86243	GGG		CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
PCDHAC1	56135	hgsc.bcm.edu	37	5	140308620	140308620	+	Missense_Mutation	SNP	G	G	A	rs6877058	byFrequency	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr5:140308620G>A	ENST00000253807.2	+	1	2143	c.2143G>A	c.(2143-2145)Gct>Act	p.A715T	PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHAC1_ENST00000409700.3_Missense_Mutation_p.A715T|PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	715					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A715T(1)		NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGCTGTTGCGCTCAGAGCTG	0.448																																					p.A715T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2143A	5						.						102.0	101.0	101.0					5																	140308620		2203	4300	6503	140288804	SO:0001583	missense	56135	exon1			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.2143G>A	5.37:g.140308620G>A	ENSP00000253807:p.Ala715Thr	Somatic		Capture	SOLID	Phase_I	140288804	NM_031882	Q9Y5F5|Q9Y5I5	Missense_Mutation	SNP	ENST00000253807.2	37	CCDS4241.1	.	.	.	.	.	.	.	.	.	.	G	0.464	-0.887518	0.02511	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	T;T	0.15139	2.45;2.45	5.95	-6.4	0.01944	.	.	.	.	.	T	0.05318	0.0141	N	0.08118	0	0.09310	N	1	B;B	0.13145	0.007;0.0	B;B	0.04013	0.001;0.0	T	0.36335	-0.9752	9	0.22706	T	0.39	.	1.1049	0.01692	0.256:0.2517:0.0951:0.3972	.	715;715	Q9H158;Q9H158-2	PCDC1_HUMAN;.	T	715	ENSP00000386356:A715T;ENSP00000253807:A715T	ENSP00000253807:A715T	A	+	1	0	PCDHAC1	140288804	0.061000	0.20836	0.017000	0.16124	0.012000	0.07955	-0.188000	0.09642	-1.153000	0.02829	-2.473000	0.00201	GCT		PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898	
MIER3	166968	hgsc.bcm.edu	37	5	56233408	56233408	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr5:56233408G>A	ENST00000381199.3	-	5	443	c.433C>T	c.(433-435)Cga>Tga	p.R145*	MIER3_ENST00000409421.1_Nonsense_Mutation_p.R82*|MIER3_ENST00000381226.3_Nonsense_Mutation_p.R150*|MIER3_ENST00000381213.3_Nonsense_Mutation_p.R145*			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3	145					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R145*(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		TTCTTACATCGTAAAGGCCTA	0.388																																					p.R145X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C433T	5						.						97.0	91.0	93.0					5																	56233408		2203	4300	6503	56269165	SO:0001587	stop_gained	166968	exon5			BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.433C>T	5.37:g.56233408G>A	ENSP00000370596:p.Arg145*	Somatic		Capture	SOLID	Phase_I	56269165	NM_152622	B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	Nonsense_Mutation	SNP	ENST00000381199.3	37		.	.	.	.	.	.	.	.	.	.	G	34	5.351400	0.95830	.	.	ENSG00000155545	ENST00000381226;ENST00000381213;ENST00000381199;ENST00000409421;ENST00000336942	.	.	.	6.07	4.12	0.48240	.	0.054332	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	14.3063	0.66386	0.0:0.0:0.567:0.433	.	.	.	.	X	150;145;145;82;118	.	ENSP00000337027:R118X	R	-	1	2	MIER3	56269165	0.997000	0.39634	1.000000	0.80357	0.986000	0.74619	1.436000	0.34980	1.553000	0.49476	0.655000	0.94253	CGA		MIER3-004	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000132523.2	NM_152622	
CHD1	1105	hgsc.bcm.edu	37	5	98212228	98212228	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr5:98212228C>T	ENST00000284049.3	-	23	3421	c.3272G>A	c.(3271-3273)aGa>aAa	p.R1091K		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	1091					chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)	p.R1091K(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	TCTCCTACTTCTACTGCGCCT	0.403																																					p.R1091K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3272A	5						.						119.0	116.0	117.0					5																	98212228		2203	4300	6503	98240128	SO:0001583	missense	1105	exon23			AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.3272G>A	5.37:g.98212228C>T	ENSP00000284049:p.Arg1091Lys	Somatic		Capture	SOLID	Phase_I	98240128	NM_001270	Q17RZ3	Missense_Mutation	SNP	ENST00000284049.3	37	CCDS34204.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.999141	0.35226	.	.	ENSG00000153922	ENST00000284049	D	0.89552	-2.53	5.14	5.14	0.70334	.	0.000000	0.36444	U	0.002592	T	0.79118	0.4392	N	0.14661	0.345	0.80722	D	1	B	0.17852	0.024	B	0.15870	0.014	T	0.73949	-0.3821	10	0.02654	T	1	.	18.981	0.92755	0.0:1.0:0.0:0.0	.	1091	O14646	CHD1_HUMAN	K	1091	ENSP00000284049:R1091K	ENSP00000284049:R1091K	R	-	2	0	CHD1	98240128	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.427000	0.80284	2.546000	0.85860	0.650000	0.86243	AGA		CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370295.1	NM_001270	
ABLIM3	22885	hgsc.bcm.edu	37	5	148630052	148630052	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-3526-01A-02W-0831-10	TCGA-AA-3526-10A-01W-0831-10	g.chr5:148630052G>T	ENST00000506113.1	+	19	2254	c.1772G>T	c.(1771-1773)aGa>aTa	p.R591I	ABLIM3_ENST00000504238.1_Missense_Mutation_p.R480I|ABLIM3_ENST00000326685.7_Missense_Mutation_p.R496I|ABLIM3_ENST00000309868.7_Missense_Mutation_p.R591I|RP11-331K21.1_ENST00000522685.1_RNA|ABLIM3_ENST00000356541.3_Missense_Mutation_p.R480I|ABLIM3_ENST00000517451.1_Missense_Mutation_p.R77I|RP11-331K21.1_ENST00000512647.2_RNA|ABLIM3_ENST00000508983.1_Missense_Mutation_p.R558I|AC012613.2_ENST00000523176.1_RNA			O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	591					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|cilium assembly (GO:0042384)|lamellipodium assembly (GO:0030032)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)	p.R591I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTACCGAAGAAATGGGCTG	0.493																																					p.R591I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1772T	5						.						99.0	88.0	92.0					5																	148630052		2203	4300	6503	148610245	SO:0001583	missense	22885	exon20			AB020650	CCDS4294.1	5q33.1	2008-02-05			ENSG00000173210	ENSG00000173210			29132	protein-coding gene	gene with protein product		611305					Standard	XM_005268392		Approved	KIAA0843	uc003lpy.2	O94929	OTTHUMG00000129932	ENST00000506113.1:c.1772G>T	5.37:g.148630052G>T	ENSP00000425394:p.Arg591Ile	Somatic		Capture	SOLID	Phase_I	148610245	NM_014945	A8K121|Q19VH3|Q658S1|Q68CI5|Q9BV32	Missense_Mutation	SNP	ENST00000506113.1	37	CCDS4294.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.893041	0.91889	.	.	ENSG00000173210	ENST00000326685;ENST00000356541;ENST00000309868;ENST00000506113;ENST00000504238;ENST00000508983;ENST00000517451;ENST00000536903	T;T;T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12;1.12;1.12	5.0	5.0	0.66597	.	0.053489	0.64402	D	0.000001	T	0.64494	0.2603	M	0.66439	2.03	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.998;0.999	D;D;D;D	0.91635	0.999;0.992;0.992;0.962	T	0.68606	-0.5364	10	0.87932	D	0	.	17.9083	0.88926	0.0:0.0:1.0:0.0	.	77;496;480;591	O94929-4;O94929-3;O94929-2;O94929	.;.;.;ABLM3_HUMAN	I	496;480;591;591;480;558;77;76	ENSP00000315841:R496I;ENSP00000348938:R480I;ENSP00000310309:R591I;ENSP00000425394:R591I;ENSP00000421183:R480I;ENSP00000420855:R558I;ENSP00000430150:R77I	ENSP00000310309:R591I	R	+	2	0	ABLIM3	148610245	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.935000	0.75886	2.309000	0.77851	0.655000	0.94253	AGA		ABLIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373435.1	NM_014945	
