#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
JPH1	56704	hgsc.bcm.edu	37	8	75157280	75157281	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr8:75157280_75157281insG	ENST00000342232.4	-	4	1428_1429	c.1388_1389insC	c.(1387-1389)ccafs	p.P463fs	JPH1_ENST00000518195.1_5'Flank	NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	463					calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.R464fs*4(1)		endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			CAGGAGATCTTGGGGGTGTCGT	0.510																																					p.P463fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1389_1390insC	8						.																																			75319835	SO:0001589	frameshift_variant	56704	exon4			AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.1389dupC	8.37:g.75157285_75157285dupG	ENSP00000344488:p.Pro463fs	Somatic		Capture	SOLID	Phase_I	75319834	NM_020647	B2RTZ0	Frame_Shift_Ins	INS	ENST00000342232.4	37	CCDS6217.1																																																																																				JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379102.1		
PGLYRP1	8993	hgsc.bcm.edu	37	19	46522617	46522618	+	In_Frame_Ins	INS	-	-	AGT	rs201694975		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:46522617_46522618insAGT	ENST00000008938.4	-	3	512_513	c.469_470insACT	c.(469-471)gct>gACTct	p.157_157A>DS	MIR769_ENST00000390225.1_RNA|CCDC61_ENST00000601763.1_Intron	NM_005091.2	NP_005082.1	O75594	PGRP1_HUMAN	peptidoglycan recognition protein 1	157					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.A157>DS(1)		endometrium(2)|large_intestine(3)|lung(3)|ovary(2)	10		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.0036)|GBM - Glioblastoma multiforme(486;0.022)|Epithelial(262;0.208)		GGCTCCCTGAGCCACACCGCAG	0.634																																					p.A157delinsDS												.	.	1	Complex - insertion inframe(1)	large_intestine(1)	c.470_471insACT	19						.																																			51214458	SO:0001652	inframe_insertion	8993	exon3			AF076483	CCDS12680.1	19q13.2-q13.3	2008-02-05	2004-03-17	2004-03-19		ENSG00000008438			8904	protein-coding gene	gene with protein product		604963	"""peptidoglycan recognition protein"""	TNFSF3L, PGLYRP		9707603, 12669421	Standard	NM_005091		Approved	TAG7, PGRP, PGRP-S, PGRPS	uc002pdx.2	O75594		ENST00000008938.4:c.469_470insACT	19.37:g.46522617_46522618insAGT	ENSP00000008938:p.Ala157delinsAspSer	Somatic		Capture	SOLID	Phase_I	51214457	NM_005091	Q4VB36	In_Frame_Ins	INS	ENST00000008938.4	37	CCDS12680.1																																																																																				PGLYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461695.1	NM_005091	
PTPN3	5774	hgsc.bcm.edu	37	9	112153824	112153825	+	Frame_Shift_Ins	INS	-	-	T	rs573531360		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:112153824_112153825insT	ENST00000374541.2	-	20	2074_2075	c.1970_1971insA	c.(1969-1971)aagfs	p.K657fs	PTPN3_ENST00000446349.1_Frame_Shift_Ins_p.K481fs|PTPN3_ENST00000412145.1_Frame_Shift_Ins_p.K526fs|PTPN3_ENST00000497739.1_5'UTR|PTPN3_ENST00000262539.3_Frame_Shift_Ins_p.K503fs|PTPN3_ENST00000394827.3_Frame_Shift_Ins_p.K125fs	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	657	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)	p.P658fs*20(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						CCAAACCTGGCTTTTTTCTGTA	0.391																																					p.K657fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1971_1972insA	9						.																																			111193646	SO:0001589	frameshift_variant	5774	exon20				CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.1971dupA	9.37:g.112153830_112153830dupT	ENSP00000363667:p.Lys657fs	Somatic		Capture	SOLID	Phase_I	111193645	NM_002829	A0AUW9|E7EN99|E9PGU7	Frame_Shift_Ins	INS	ENST00000374541.2	37	CCDS6776.1																																																																																				PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4		
RANBP6	26953	hgsc.bcm.edu	37	9	6014442	6014443	+	Frame_Shift_Ins	INS	-	-	CAGTT			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:6014442_6014443insCAGTT	ENST00000259569.5	-	1	1175_1176	c.1165_1166insAACTG	c.(1165-1167)gccfs	p.A389fs	RANBP6_ENST00000485372.1_Intron	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	389					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A389fs*19(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		GGCAGATAAGGCCATTAATCCA	0.431																																					p.A389fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1166_1167insAACTG	9						.																																			6004443	SO:0001589	frameshift_variant	26953	exon1			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.1165_1166insAACTG	9.37:g.6014442_6014443insCAGTT	ENSP00000259569:p.Ala389fs	Somatic		Capture	SOLID	Phase_I	6004442	NM_012416	Q5T7X4|Q7Z3V2|Q96E78	Frame_Shift_Ins	INS	ENST00000259569.5	37	CCDS6467.1																																																																																				RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416	
RELN	5649	hgsc.bcm.edu	37	7	103155744	103155744	+	Silent	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:103155744A>G	ENST00000428762.1	-	50	8166	c.8007T>C	c.(8005-8007)gtT>gtC	p.V2669V	CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Silent_p.V2669V|RELN_ENST00000343529.5_Silent_p.V2669V	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2669					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TGTCCAGCATAACGGTCCTTT	0.592																																					p.V2669V	NSCLC(146;835 1944 15585 22231 52158)											.	.	0			c.T8007C	7						.						56.0	48.0	51.0					7																	103155744		2203	4300	6503	102942980	SO:0001819	synonymous_variant	5649	exon50				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.8007T>C	7.37:g.103155744A>G		Somatic		Capture	SOLID	Phase_I	102942980	NM_005045	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																				RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
PUS7	54517	hgsc.bcm.edu	37	7	105135688	105135688	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:105135688T>A	ENST00000356362.2	-	6	957	c.743A>T	c.(742-744)cAt>cTt	p.H248L	PUS7_ENST00000469408.1_Missense_Mutation_p.H248L	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	248					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						TGGCCAAGAATGTTTTCTTGG	0.333																																					p.H248L	Colon(138;2387 3051 17860)											.	.	0			c.A743T	7						.						174.0	175.0	175.0					7																	105135688		2203	4300	6503	104922924	SO:0001583	missense	54517	exon6			AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.743A>T	7.37:g.105135688T>A	ENSP00000348722:p.His248Leu	Somatic		Capture	SOLID	Phase_I	104922924	NM_019042	Q75MG4|Q9NX19	Missense_Mutation	SNP	ENST00000356362.2	37	CCDS34725.1	.	.	.	.	.	.	.	.	.	.	T	14.53	2.561730	0.45590	.	.	ENSG00000091127	ENST00000356362;ENST00000544995;ENST00000469408	T;T	0.19806	2.12;2.12	5.35	5.35	0.76521	Pseudouridine synthase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.31231	0.0790	L	0.57536	1.79	0.80722	D	1	P;P	0.45348	0.856;0.856	B;P	0.49887	0.406;0.625	T	0.02313	-1.1178	10	0.26408	T	0.33	-7.605	14.5167	0.67824	0.0:0.0:0.0:1.0	.	248;248	B3KY42;Q96PZ0	.;PUS7_HUMAN	L	248	ENSP00000348722:H248L;ENSP00000417402:H248L	ENSP00000348722:H248L	H	-	2	0	PUS7	104922924	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.484000	0.81180	2.026000	0.59711	0.528000	0.53228	CAT		PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348681.1	NM_019042	
ING3	54556	hgsc.bcm.edu	37	7	120591261	120591261	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:120591261A>T	ENST00000315870.5	+	2	220	c.72A>T	c.(70-72)gaA>gaT	p.E24D	ING3_ENST00000431467.1_Missense_Mutation_p.E9D|ING3_ENST00000339121.5_Missense_Mutation_p.E24D|ING3_ENST00000445699.1_Missense_Mutation_p.E24D	NM_019071.2	NP_061944.2	Q9NXR8	ING3_HUMAN	inhibitor of growth family, member 3	24					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|positive regulation of apoptotic process (GO:0043065)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.E24D(1)		NS(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	12	all_neural(327;0.117)					GCTTCACGGAAATGCGCGAGA	0.587																																					p.E24D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A72T	7						.						108.0	98.0	102.0					7																	120591261		2203	4300	6503	120378497	SO:0001583	missense	54556	exon2			AF074968	CCDS5778.1, CCDS35497.1	7q31	2013-01-28			ENSG00000071243	ENSG00000071243		"""Zinc fingers, PHD-type"""	14587	protein-coding gene	gene with protein product		607493				12080476	Standard	NM_019071		Approved	p47ING3, FLJ20089, Eaf4, MEAF4	uc003vjn.3	Q9NXR8	OTTHUMG00000141270	ENST00000315870.5:c.72A>T	7.37:g.120591261A>T	ENSP00000320566:p.Glu24Asp	Somatic		Capture	SOLID	Phase_I	120378497	NM_019071	A8K790|O60394|Q567P3|Q6GMT3|Q7Z762|Q969G0|Q96DT4|Q9HC99|Q9P081	Missense_Mutation	SNP	ENST00000315870.5	37	CCDS5778.1	.	.	.	.	.	.	.	.	.	.	A	15.40	2.823476	0.50739	.	.	ENSG00000071243	ENST00000315870;ENST00000339121;ENST00000445699;ENST00000431467	D;D	0.95980	-3.87;-3.81	5.21	4.29	0.51040	Inhibitor of growth protein, N-terminal (1);	0.051772	0.85682	D	0.000000	D	0.95379	0.8500	L	0.46885	1.475	0.54753	D	0.999987	B;D;D;B;B	0.57257	0.089;0.979;0.979;0.073;0.012	B;D;D;B;B	0.71414	0.052;0.973;0.973;0.031;0.032	D	0.92685	0.6161	10	0.16896	T	0.51	-18.6203	9.1042	0.36687	0.1695:0.0:0.8305:0.0	.	24;24;24;24;24	B7ZKQ7;Q5GRH6;Q9NXR8;Q9NXR8-2;C9JUT0	.;.;ING3_HUMAN;.;.	D	24;24;24;9	ENSP00000320566:E24D;ENSP00000388506:E9D	ENSP00000320566:E24D	E	+	3	2	ING3	120378497	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.921000	0.56454	1.425000	0.47237	-0.177000	0.13119	GAA		ING3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280453.2	NM_019071	
CPED1	79974	hgsc.bcm.edu	37	7	120906334	120906334	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:120906334A>T	ENST00000310396.5	+	19	2831	c.2364A>T	c.(2362-2364)gaA>gaT	p.E788D		NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	788						endoplasmic reticulum (GO:0005783)											ATCTTATTGAAAGGCTGAATG	0.358																																					p.E788D												.	.	0			c.A2364T	7						.						186.0	170.0	175.0					7																	120906334		2203	4300	6503	120693570	SO:0001583	missense	79974	exon19				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2364A>T	7.37:g.120906334A>T	ENSP00000309772:p.Glu788Asp	Somatic		Capture	SOLID	Phase_I	120693570	NM_024913	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	ENST00000310396.5	37	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.074795	0.76415	.	.	ENSG00000106034	ENST00000310396	T	0.18502	2.21	5.94	3.54	0.40534	.	0.000000	0.85682	D	0.000000	T	0.36690	0.0976	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.06391	-1.0829	10	0.40728	T	0.16	.	8.1385	0.31069	0.7242:0.0:0.2758:0.0	.	788	A4D0V7	CG058_HUMAN	D	788	ENSP00000309772:E788D	ENSP00000309772:E788D	E	+	3	2	C7orf58	120693570	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	1.338000	0.33873	1.025000	0.39708	0.459000	0.35465	GAA		CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913	
WNT16	51384	hgsc.bcm.edu	37	7	120979255	120979255	+	Silent	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:120979255T>C	ENST00000222462.2	+	4	1244	c.954T>C	c.(952-954)gaT>gaC	p.D318D	WNT16_ENST00000361301.2_Silent_p.D308D	NM_057168.1	NP_476509.1	Q9UBV4	WNT16_HUMAN	wingless-type MMTV integration site family, member 16	318					bone remodeling (GO:0046849)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|optic cup formation involved in camera-type eye development (GO:0003408)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|replicative senescence (GO:0090399)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.D318D(1)		breast(1)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)	18	all_neural(327;0.117)					AGGGTGCAGATGGCTGCAACC	0.502																																					p.D308D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T924C	7						.						146.0	113.0	124.0					7																	120979255		2203	4300	6503	120766491	SO:0001819	synonymous_variant	51384	exon4			AF152584	CCDS5780.1, CCDS5781.1	7q31	2008-07-18			ENSG00000002745	ENSG00000002745		"""Wingless-type MMTV integration sites"""	16267	protein-coding gene	gene with protein product		606267				10500199	Standard	NM_016087		Approved		uc003vjw.3	Q9UBV4	OTTHUMG00000156963	ENST00000222462.2:c.954T>C	7.37:g.120979255T>C		Somatic		Capture	SOLID	Phase_I	120766491	NM_016087	Q2M3G1|Q9Y5C0	Silent	SNP	ENST00000222462.2	37	CCDS5781.1																																																																																				WNT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346843.1	NM_057168	
SLC13A1	6561	hgsc.bcm.edu	37	7	122787312	122787312	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:122787312T>G	ENST00000194130.2	-	7	752	c.713A>C	c.(712-714)aAa>aCa	p.K238T	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	238					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	ACACGTAAGTTTACGTGTCAC	0.413																																					p.K238T												.	.	0			c.A713C	7						.						237.0	181.0	200.0					7																	122787312		2203	4300	6503	122574548	SO:0001583	missense	6561	exon7				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.713A>C	7.37:g.122787312T>G	ENSP00000194130:p.Lys238Thr	Somatic		Capture	SOLID	Phase_I	122574548	NM_022444	Q9H5Z0	Missense_Mutation	SNP	ENST00000194130.2	37	CCDS5786.1	.	.	.	.	.	.	.	.	.	.	T	19.10	3.761435	0.69763	.	.	ENSG00000081800	ENST00000194130	T	0.02682	4.2	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.11410	0.0278	L	0.60957	1.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.02220	-1.1193	10	0.42905	T	0.14	-11.5659	12.6815	0.56924	0.0:0.0:0.0:1.0	.	238;238	A4D0X1;Q9BZW2	.;S13A1_HUMAN	T	238	ENSP00000194130:K238T	ENSP00000194130:K238T	K	-	2	0	SLC13A1	122574548	1.000000	0.71417	0.997000	0.53966	0.675000	0.39556	6.811000	0.75221	1.895000	0.54865	0.460000	0.39030	AAA		SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1	NM_022444	
CPA5	93979	hgsc.bcm.edu	37	7	129999478	129999478	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:129999478G>C	ENST00000485477.1	+	5	1511	c.382G>C	c.(382-384)Gag>Cag	p.E128Q	CPA5_ENST00000461828.1_Missense_Mutation_p.E128Q|CPA5_ENST00000431780.2_Missense_Mutation_p.E128Q|CPA5_ENST00000466363.2_Missense_Mutation_p.E128Q|CPA5_ENST00000393213.3_Missense_Mutation_p.E128Q|CPA5_ENST00000474905.1_Missense_Mutation_p.E128Q|CPA5_ENST00000355388.3_Missense_Mutation_p.E128Q			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	128						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.E128Q(1)		NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					CCGCCGGCTGGAGCGCAGCAC	0.587																																					p.E128Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G382C	7						.						66.0	57.0	60.0					7																	129999478		2202	4300	6502	129786714	SO:0001583	missense	93979	exon7			AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.382G>C	7.37:g.129999478G>C	ENSP00000420237:p.Glu128Gln	Somatic		Capture	SOLID	Phase_I	129786714	NM_001127441	G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Missense_Mutation	SNP	ENST00000485477.1	37	CCDS5819.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.438671	0.62955	.	.	ENSG00000158525	ENST00000355388;ENST00000461828;ENST00000466363;ENST00000485477;ENST00000431780;ENST00000474905;ENST00000393213	T;T;T;T;T;T;T	0.13538	2.74;2.74;2.74;2.74;2.58;2.74;2.74	6.03	6.03	0.97812	Proteinase inhibitor, carboxypeptidase propeptide (1);	0.365563	0.26646	N	0.023225	T	0.20414	0.0491	L	0.37697	1.125	0.29397	N	0.862212	D;D	0.64830	0.994;0.962	P;B	0.54924	0.764;0.431	T	0.02950	-1.1090	9	.	.	.	.	12.9491	0.58389	0.076:0.0:0.924:0.0	.	128;128	G3V0G8;Q8WXQ8	.;CBPA5_HUMAN	Q	128	ENSP00000347549:E128Q;ENSP00000418183:E128Q;ENSP00000419025:E128Q;ENSP00000420237:E128Q;ENSP00000393045:E128Q;ENSP00000417314:E128Q;ENSP00000376907:E128Q	.	E	+	1	0	CPA5	129786714	0.997000	0.39634	1.000000	0.80357	0.980000	0.70556	2.078000	0.41567	2.861000	0.98227	0.655000	0.94253	GAG		CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349712.1	NM_001127441	
EXOC4	60412	hgsc.bcm.edu	37	7	132973850	132973850	+	Missense_Mutation	SNP	C	C	G	rs200463309		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:132973850C>G	ENST00000253861.4	+	3	480	c.451C>G	c.(451-453)Ctc>Gtc	p.L151V	EXOC4_ENST00000393161.2_Missense_Mutation_p.L151V|EXOC4_ENST00000539845.1_Missense_Mutation_p.L50V	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	151					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				CAAGCACTATCTCAGTGCCAC	0.413																																					p.L151V												.	.	0			c.C451G	7						.						79.0	58.0	65.0					7																	132973850		2203	4300	6503	132624390	SO:0001583	missense	60412	exon3			AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.451C>G	7.37:g.132973850C>G	ENSP00000253861:p.Leu151Val	Somatic		Capture	SOLID	Phase_I	132624390	NM_001037126	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	37	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.038404	0.93630	.	.	ENSG00000131558	ENST00000253861;ENST00000393161;ENST00000539845	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.83184	0.5199	M	0.81802	2.56	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.80764	0.978;0.994	T	0.81046	-0.1110	9	0.36615	T	0.2	.	20.1162	0.97934	0.0:1.0:0.0:0.0	.	151;151	Q96A65;Q8TAR2	EXOC4_HUMAN;.	V	151;151;50	.	ENSP00000253861:L151V	L	+	1	0	EXOC4	132624390	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	7.590000	0.82653	2.756000	0.94617	0.655000	0.94253	CTC		EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	
BRAF	673	hgsc.bcm.edu	37	7	140507788	140507788	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:140507788T>A	ENST00000288602.6	-	5	743	c.683A>T	c.(682-684)gAg>gTg	p.E228V		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	228					activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TGGAACATTCTCCAACACTTC	0.328		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.E228V	Colon(40;35 892 2973 5743 27438)		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	.	.	0			c.A683T	7						.						153.0	131.0	138.0					7																	140507788		2203	4300	6503	140154257	SO:0001583	missense	673	exon5	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.683A>T	7.37:g.140507788T>A	ENSP00000288602:p.Glu228Val	Somatic		Capture	SOLID	Phase_I	140154257	NM_004333	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.727323	0.89390	.	.	ENSG00000157764	ENST00000288602	D	0.84660	-1.88	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.84266	0.5434	L	0.50333	1.59	0.80722	D	1	P	0.52842	0.956	P	0.45071	0.468	D	0.86507	0.1807	10	0.87932	D	0	.	15.9818	0.80116	0.0:0.0:0.0:1.0	.	228	P15056	BRAF_HUMAN	V	228	ENSP00000288602:E228V	ENSP00000288602:E228V	E	-	2	0	BRAF	140154257	1.000000	0.71417	0.982000	0.44146	0.987000	0.75469	8.040000	0.89188	2.180000	0.69256	0.377000	0.23210	GAG		BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	
TRPV6	55503	hgsc.bcm.edu	37	7	142583152	142583152	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:142583152T>C	ENST00000359396.3	-	1	355	c.110A>G	c.(109-111)aAc>aGc	p.N37S	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	37				N -> D (in Ref. 1; AAG41951). {ECO:0000305}.	calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					CTGCAGCAGGTTCTGCTCATC	0.607																																					p.N37S												.	.	0			c.A110G	7						.						110.0	111.0	111.0					7																	142583152		2203	4300	6503	142293274	SO:0001583	missense	55503	exon1			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.110A>G	7.37:g.142583152T>C	ENSP00000352358:p.Asn37Ser	Somatic		Capture	SOLID	Phase_I	142293274	NM_018646	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	37	CCDS5874.1	.	.	.	.	.	.	.	.	.	.	T	1.828	-0.470636	0.04445	.	.	ENSG00000165125	ENST00000359396	T	0.51817	0.69	3.82	3.82	0.43975	.	0.538685	0.19780	N	0.106246	T	0.37265	0.0997	L	0.43152	1.355	0.22866	N	0.998639	B	0.13594	0.008	B	0.12837	0.008	T	0.17806	-1.0357	10	0.33141	T	0.24	-12.5826	9.1984	0.37242	0.0:0.0:0.0:1.0	.	37	Q9H1D0	TRPV6_HUMAN	S	37	ENSP00000352358:N37S	ENSP00000352358:N37S	N	-	2	0	TRPV6	142293274	1.000000	0.71417	0.810000	0.32431	0.061000	0.15899	2.218000	0.42889	1.753000	0.51906	0.403000	0.27427	AAC		TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	NM_014274	
ZNF212	7988	hgsc.bcm.edu	37	7	148951342	148951342	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:148951342T>A	ENST00000335870.2	+	5	1452	c.1324T>A	c.(1324-1326)Ttg>Atg	p.L442M		NM_012256.3	NP_036388.2	Q9UDV6	ZN212_HUMAN	zinc finger protein 212	442					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|ovary(1)|prostate(1)	9	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			CCCATCTGACTTGGTGCGGCA	0.587																																					p.L442M												.	.	0			c.T1324A	7						.						136.0	101.0	113.0					7																	148951342		2203	4300	6503	148582275	SO:0001583	missense	7988	exon5			U38864	CCDS5896.1	7q36.1	2013-01-08			ENSG00000170260	ENSG00000170260		"""Zinc fingers, C2H2-type"", ""-"""	13004	protein-coding gene	gene with protein product		602386				9169157	Standard	NM_012256		Approved	C2H2-150	uc003wfp.3	Q9UDV6	OTTHUMG00000158968	ENST00000335870.2:c.1324T>A	7.37:g.148951342T>A	ENSP00000338572:p.Leu442Met	Somatic		Capture	SOLID	Phase_I	148582275	NM_012256	B2RCF4|Q13396|Q8N664	Missense_Mutation	SNP	ENST00000335870.2	37	CCDS5896.1	.	.	.	.	.	.	.	.	.	.	T	17.52	3.410833	0.62399	.	.	ENSG00000170260	ENST00000335870	T	0.53640	0.61	4.97	1.99	0.26369	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40385	N	0.001109	T	0.65186	0.2667	M	0.81802	2.56	0.35266	D	0.780029	D	0.89917	1.0	D	0.97110	1.0	T	0.71272	-0.4642	10	0.87932	D	0	-14.5414	8.0374	0.30502	0.0:0.7176:0.0:0.2824	.	442	Q9UDV6	ZN212_HUMAN	M	442	ENSP00000338572:L442M	ENSP00000338572:L442M	L	+	1	2	ZNF212	148582275	0.000000	0.05858	0.774000	0.31636	0.826000	0.46750	0.009000	0.13219	0.211000	0.20683	-0.624000	0.04008	TTG		ZNF212-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352710.1	NM_012256	
PKD1L1	168507	hgsc.bcm.edu	37	7	47944892	47944892	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:47944892A>C	ENST00000289672.2	-	11	1603	c.1553T>G	c.(1552-1554)tTt>tGt	p.F518C		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	518	PKD 1. {ECO:0000255|PROSITE- ProRule:PRU00151}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GTCTGTGGCAAACACAGTTCC	0.443																																					p.F518C												.	.	0			c.T1553G	7						.						145.0	132.0	137.0					7																	47944892		2203	4300	6503	47911417	SO:0001583	missense	168507	exon11			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.1553T>G	7.37:g.47944892A>C	ENSP00000289672:p.Phe518Cys	Somatic		Capture	SOLID	Phase_I	47911417	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	A	17.67	3.446586	0.63178	.	.	ENSG00000158683	ENST00000289672	T	0.67523	-0.27	5.38	5.38	0.77491	PKD/Chitinase domain (1);	0.424109	0.21392	N	0.075298	T	0.72630	0.3484	L	0.29908	0.895	0.31914	N	0.614261	D	0.89917	1.0	D	0.78314	0.991	T	0.77335	-0.2626	10	0.72032	D	0.01	-19.2137	13.6779	0.62465	1.0:0.0:0.0:0.0	.	518	Q8TDX9	PK1L1_HUMAN	C	518	ENSP00000289672:F518C	ENSP00000289672:F518C	F	-	2	0	PKD1L1	47911417	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.055000	0.41345	2.185000	0.69588	0.529000	0.55759	TTT		PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
EGFR	1956	hgsc.bcm.edu	37	7	55249005	55249005	+	Missense_Mutation	SNP	G	G	C	rs146024686|rs121913465|rs397517108		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:55249005G>C	ENST00000275493.2	+	20	2480	c.2303G>C	c.(2302-2304)aGc>aCc	p.S768T	EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000455089.1_Missense_Mutation_p.S723T|EGFR_ENST00000454757.2_Missense_Mutation_p.S715T	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	768	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		S -> I (found in a lung cancer sample; constitutively activated kinase with higher levels of basal autophosphorylation; more sensitive to gefitinib than wild-type; dbSNP:rs121913465). {ECO:0000269|PubMed:15623594}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.S768I(24)|p.S768N(1)|p.S768_V769insVAS(1)|p.S768_V769>IL(1)|p.S768T(1)|p.A767_S768insTLA(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GTGATGGCCAGCGTGGACAAC	0.637		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.S768T		yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	EGFR,oesophagus,middle_third,Substitution - Missense,0	.	29	Substitution - Missense(26)|Insertion - In frame(2)|Complex - compound substitution(1)	lung(25)|oesophagus(2)|large_intestine(1)|central_nervous_system(1)	c.G2303C	7						.						102.0	94.0	97.0					7																	55249005		2203	4300	6503	55216499	SO:0001583	missense	1956	exon20	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2303G>C	7.37:g.55249005G>C	ENSP00000275493:p.Ser768Thr	Somatic		Capture	SOLID	Phase_I	55216499	NM_005228	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148532	0.78001	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	D;D;D	0.82619	-1.63;-1.63;-1.63	5.85	5.85	0.93711	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85788	0.5778	N	0.25957	0.775	0.80722	D	1	P;D	0.63880	0.92;0.993	B;D	0.63877	0.108;0.919	D	0.86907	0.2058	10	0.66056	D	0.02	.	18.7267	0.91716	0.0:0.0:1.0:0.0	.	723;768	Q504U8;P00533	.;EGFR_HUMAN	T	723;638;768;715	ENSP00000415559:S723T;ENSP00000275493:S768T;ENSP00000395243:S715T	ENSP00000275493:S768T	S	+	2	0	EGFR	55216499	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	9.830000	0.99415	2.760000	0.94817	0.655000	0.94253	AGC		EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
ZNF107	51427	hgsc.bcm.edu	37	7	64168270	64168270	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:64168270G>A	ENST00000395391.1	+	4	2963	c.1588G>A	c.(1588-1590)Ggc>Agc	p.G530S	ZNF107_ENST00000344930.3_Missense_Mutation_p.G530S|ZNF107_ENST00000423627.1_Missense_Mutation_p.G530S			Q9UII5	ZN107_HUMAN	zinc finger protein 107	530					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G530S(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				TGAAGAATTTGGCAAGGCCTT	0.333																																					p.G530S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1588A	7						.						40.0	41.0	41.0					7																	64168270		2201	4296	6497	63805705	SO:0001583	missense	51427	exon5			AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.1588G>A	7.37:g.64168270G>A	ENSP00000378789:p.Gly530Ser	Somatic		Capture	SOLID	Phase_I	63805705	NM_001013746		Missense_Mutation	SNP	ENST00000395391.1	37	CCDS5527.1	.	.	.	.	.	.	.	.	.	.	.	17.82	3.483599	0.63962	.	.	ENSG00000196247	ENST00000344930;ENST00000423627;ENST00000395391	T;T;T	0.01455	4.87;4.87;4.87	1.27	1.27	0.21489	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06735	0.0172	M	0.62209	1.925	0.28289	N	0.923656	D	0.71674	0.998	D	0.78314	0.991	T	0.15780	-1.0425	8	.	.	.	.	7.9559	0.30042	0.0:0.0:1.0:0.0	.	530	Q9UII5	ZN107_HUMAN	S	530	ENSP00000343443:G530S;ENSP00000400037:G530S;ENSP00000378789:G530S	.	G	+	1	0	ZNF107	63805705	1.000000	0.71417	0.066000	0.19879	0.437000	0.31866	2.439000	0.44846	0.635000	0.30488	0.313000	0.20887	GGC		ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251593.1	NM_016220	
WBSCR17	64409	hgsc.bcm.edu	37	7	71130461	71130461	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:71130461G>T	ENST00000333538.5	+	7	1780	c.1146G>T	c.(1144-1146)aaG>aaT	p.K382N	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	382					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				TTGAGCGGAAGAAGAAGCCAT	0.493																																					p.K382N												.	.	0			c.G1146T	7						.						112.0	103.0	106.0					7																	71130461		2203	4300	6503	70768397	SO:0001583	missense	64409	exon7			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1146G>T	7.37:g.71130461G>T	ENSP00000329654:p.Lys382Asn	Somatic		Capture	SOLID	Phase_I	70768397	NM_022479	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	G	11.73	1.726543	0.30593	.	.	ENSG00000185274	ENST00000333538	T	0.59502	0.26	5.85	5.85	0.93711	.	0.162322	0.53938	D	0.000053	T	0.47710	0.1460	N	0.21508	0.67	0.41370	D	0.987481	B	0.25609	0.13	B	0.30716	0.119	T	0.46400	-0.9194	10	0.54805	T	0.06	.	14.7207	0.69302	0.0:0.1444:0.8556:0.0	.	382	Q6IS24	GLTL3_HUMAN	N	382	ENSP00000329654:K382N	ENSP00000329654:K382N	K	+	3	2	WBSCR17	70768397	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.582000	0.46085	2.770000	0.95276	0.563000	0.77884	AAG		WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
HIP1	3092	hgsc.bcm.edu	37	7	75172216	75172216	+	Silent	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:75172216G>A	ENST00000336926.6	-	28	2870	c.2844C>T	c.(2842-2844)ggC>ggT	p.G948G	HIP1_ENST00000434438.2_Silent_p.G897G	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	948	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)	p.G950G(1)		breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						AGGCCACAACGCCGGCAGTGG	0.552			T	PDGFRB	CMML																																p.G948G			Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2844T	7						.						89.0	84.0	86.0					7																	75172216		2203	4300	6503	75010152	SO:0001819	synonymous_variant	3092	exon28			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2844C>T	7.37:g.75172216G>A		Somatic		Capture	SOLID	Phase_I	75010152	NM_005338	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Silent	SNP	ENST00000336926.6	37	CCDS34669.1																																																																																				HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338	
GSAP	54103	hgsc.bcm.edu	37	7	76984664	76984664	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:76984664T>C	ENST00000257626.7	-	16	1282	c.1204A>G	c.(1204-1206)Aag>Gag	p.K402E		NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	402					positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)										CTATAGAGCTTTCCAGAACAA	0.433																																					p.K402E												.	.	0			c.A1204G	7						.						103.0	111.0	108.0					7																	76984664		2203	4300	6503	76822600	SO:0001583	missense	54103	exon16				CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.1204A>G	7.37:g.76984664T>C	ENSP00000257626:p.Lys402Glu	Somatic		Capture	SOLID	Phase_I	76822600	NM_017439	A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Missense_Mutation	SNP	ENST00000257626.7	37	CCDS34672.2	.	.	.	.	.	.	.	.	.	.	T	10.39	1.335898	0.24253	.	.	ENSG00000186088	ENST00000257626	T	0.18502	2.21	5.76	5.76	0.90799	.	0.146937	0.45126	U	0.000381	T	0.17492	0.0420	L	0.54323	1.7	0.80722	D	1	B;B	0.27351	0.176;0.023	B;B	0.26094	0.066;0.013	T	0.03695	-1.1012	10	0.62326	D	0.03	.	8.6134	0.33817	0.0:0.0849:0.0:0.9151	.	402;402	A4D1B5-3;A4D1B5	.;GSAP_HUMAN	E	402	ENSP00000257626:K402E	ENSP00000257626:K402E	K	-	1	0	PION	76822600	1.000000	0.71417	0.991000	0.47740	0.401000	0.30781	3.371000	0.52379	2.202000	0.70862	0.533000	0.62120	AAG		GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318672.2	NM_017439	
ABCB4	5244	hgsc.bcm.edu	37	7	87079353	87079353	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:87079353A>G	ENST00000265723.4	-	8	875	c.764T>C	c.(763-765)gTg>gCg	p.V255A	ABCB4_ENST00000359206.3_Missense_Mutation_p.V255A|ABCB4_ENST00000545634.1_Missense_Mutation_p.V255A|ABCB4_ENST00000453593.1_Missense_Mutation_p.V255A|ABCB4_ENST00000358400.3_Missense_Mutation_p.V255A	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	255	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	CTCTTCTGCCACGGCGCCTGC	0.483																																					p.V255A												.	.	0			c.T764C	7						.						96.0	90.0	92.0					7																	87079353		2203	4300	6503	86917289	SO:0001583	missense	5244	exon8			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.764T>C	7.37:g.87079353A>G	ENSP00000265723:p.Val255Ala	Somatic		Capture	SOLID	Phase_I	86917289	NM_018849	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	37	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	a	29.6	5.020143	0.93462	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.91521	-2.86;-2.86;-2.86;-2.86;-2.86	5.75	5.75	0.90469	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.95796	0.8632	M	0.89414	3.03	0.80722	D	1	D;D;D	0.71674	0.998;0.982;0.985	D;P;P	0.67103	0.949;0.839;0.9	D	0.96497	0.9368	10	0.87932	D	0	-13.8936	16.051	0.80763	1.0:0.0:0.0:0.0	.	255;255;255	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	A	255	ENSP00000352135:V255A;ENSP00000351172:V255A;ENSP00000265723:V255A;ENSP00000392983:V255A;ENSP00000437465:V255A	ENSP00000265723:V255A	V	-	2	0	ABCB4	86917289	1.000000	0.71417	0.997000	0.53966	0.969000	0.65631	6.259000	0.72494	2.189000	0.69895	0.482000	0.46254	GTG		ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
DYNC1I1	1780	hgsc.bcm.edu	37	7	95439779	95439779	+	Silent	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:95439779T>C	ENST00000324972.6	+	3	377	c.184T>C	c.(184-186)Ttg>Ctg	p.L62L	DYNC1I1_ENST00000537881.1_Silent_p.L62L|DYNC1I1_ENST00000457059.1_Silent_p.L62L|DYNC1I1_ENST00000413338.1_Silent_p.L62L|DYNC1I1_ENST00000437599.1_Silent_p.L62L|DYNC1I1_ENST00000447467.2_Silent_p.L62L|DYNC1I1_ENST00000359388.4_Silent_p.L62L	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	62	Interaction with DCTN1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			GACAGAGGCTTTGCTGCAAAG	0.463																																					p.L62L												.	.	0			c.T184C	7						.						77.0	77.0	77.0					7																	95439779		2202	4300	6502	95277715	SO:0001819	synonymous_variant	1780	exon3			AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.184T>C	7.37:g.95439779T>C		Somatic		Capture	SOLID	Phase_I	95277715	NM_004411	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Silent	SNP	ENST00000324972.6	37	CCDS5644.1																																																																																				DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411	
BAIAP2L1	55971	hgsc.bcm.edu	37	7	97939847	97939847	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:97939847A>T	ENST00000005260.8	-	9	1080	c.865T>A	c.(865-867)Tca>Aca	p.S289T	RP4-607J23.2_ENST00000608882.1_RNA|RP4-607J23.2_ENST00000609873.1_RNA|BAIAP2L1_ENST00000462558.1_5'UTR	NM_018842.4	NP_061330.2	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	289					filopodium assembly (GO:0046847)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|response to bacterium (GO:0009617)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)	23	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			GCTCTGCCTGAAGGAGCGGGG	0.418																																					p.S289T												.	.	0			c.T865A	7						.						97.0	102.0	100.0					7																	97939847		2203	4300	6503	97777783	SO:0001583	missense	55971	exon9			AF119666	CCDS34687.1	7q22.1	2012-10-04			ENSG00000006453	ENSG00000006453			21649	protein-coding gene	gene with protein product		611877					Standard	NM_018842		Approved	IRTKS	uc003upj.3	Q9UHR4	OTTHUMG00000165117	ENST00000005260.8:c.865T>A	7.37:g.97939847A>T	ENSP00000005260:p.Ser289Thr	Somatic		Capture	SOLID	Phase_I	97777783	NM_018842	A4D268|Q75L21|Q75L22|Q96CV4|Q9H5F5|Q9Y2M8	Missense_Mutation	SNP	ENST00000005260.8	37	CCDS34687.1	.	.	.	.	.	.	.	.	.	.	A	13.77	2.335888	0.41398	.	.	ENSG00000006453	ENST00000005260	T	0.24723	1.84	5.5	5.5	0.81552	.	0.606006	0.18053	N	0.153218	T	0.23289	0.0563	M	0.62723	1.935	0.26158	N	0.98005	B	0.15719	0.014	B	0.11329	0.006	T	0.21042	-1.0257	10	0.19147	T	0.46	-18.711	6.1098	0.20094	0.5982:0.1423:0.0:0.2595	.	289	Q9UHR4	BI2L1_HUMAN	T	289	ENSP00000005260:S289T	ENSP00000005260:S289T	S	-	1	0	AC093799.1	97777783	0.999000	0.42202	1.000000	0.80357	0.906000	0.53458	1.501000	0.35693	2.092000	0.63282	0.533000	0.62120	TCA		BAIAP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334681.1	NM_018842	
KCNH2	3757	hgsc.bcm.edu	37	7	150648770	150648770	+	Missense_Mutation	SNP	T	T	C	rs199472928		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr7:150648770T>C	ENST00000262186.5	-	7	2112	c.1711A>G	c.(1711-1713)Atc>Gtc	p.I571V	KCNH2_ENST00000330883.4_Missense_Mutation_p.I231V|KCNH2_ENST00000430723.3_Missense_Mutation_p.I571V|KCNH2_ENST00000392968.2_Missense_Mutation_p.I475V	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	571			I -> L (in LQT2). {ECO:0000269|PubMed:15840476}.		cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	ATGTTGCCGATGGCGTACCAG	0.617																																					p.I231V	GBM(137;110 1844 13671 20123 45161)											.	.	0			c.A691G	7	GRCh37	CM055296|CM057117	KCNH2	M		.						77.0	62.0	67.0					7																	150648770		2203	4300	6503	150279703	SO:0001583	missense	3757	exon3			U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.1711A>G	7.37:g.150648770T>C	ENSP00000262186:p.Ile571Val	Somatic		Capture	SOLID	Phase_I	150279703	NM_172057	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	37	CCDS5910.1	.	.	.	.	.	.	.	.	.	.	T	19.28	3.797157	0.70567	.	.	ENSG00000055118	ENST00000330883;ENST00000392968;ENST00000262186;ENST00000350328;ENST00000430723	D;D;D;D	0.98684	-5.07;-5.07;-5.07;-5.07	4.44	3.3	0.37823	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98381	0.9462	L	0.60067	1.865	0.37453	D	0.914907	D;D;D;D;P	0.76494	0.958;0.996;0.97;0.999;0.828	D;D;D;D;P	0.76071	0.97;0.956;0.927;0.987;0.526	D	0.99316	1.0905	10	0.87932	D	0	.	7.4093	0.27009	0.0:0.1051:0.0:0.8949	.	475;571;231;571;231	C4PFH9;G5E9I0;Q708S9;Q12809;Q12809-2	.;.;.;KCNH2_HUMAN;.	V	231;475;571;231;571	ENSP00000328531:I231V;ENSP00000376695:I475V;ENSP00000262186:I571V;ENSP00000387657:I571V	ENSP00000262186:I571V	I	-	1	0	KCNH2	150279703	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	6.107000	0.71517	1.659000	0.50751	0.260000	0.18958	ATC		KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238	
PYGB	5834	hgsc.bcm.edu	37	20	25261008	25261008	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:25261008A>G	ENST00000216962.4	+	10	1309	c.1199A>G	c.(1198-1200)cAc>cGc	p.H400R		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	400					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						CTGCCGCGGCACCTGGAGATA	0.617																																					p.H400R												.	.	0			c.A1199G	20						.						95.0	84.0	88.0					20																	25261008		2203	4300	6503	25209008	SO:0001583	missense	5834	exon10				CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.1199A>G	20.37:g.25261008A>G	ENSP00000216962:p.His400Arg	Somatic		Capture	SOLID	Phase_I	25209008	NM_002862	Q96AK1|Q9NPX8	Missense_Mutation	SNP	ENST00000216962.4	37	CCDS13171.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.482039	0.84747	.	.	ENSG00000100994	ENST00000216962	D	0.93811	-3.29	4.17	4.17	0.49024	.	0.000000	0.85682	D	0.000000	D	0.97867	0.9299	H	0.97940	4.11	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98802	1.0740	10	0.87932	D	0	-43.6559	13.323	0.60444	1.0:0.0:0.0:0.0	.	400	P11216	PYGB_HUMAN	R	400	ENSP00000216962:H400R	ENSP00000216962:H400R	H	+	2	0	PYGB	25209008	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.932000	0.92897	1.874000	0.54306	0.379000	0.24179	CAC		PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078415.2	NM_002862	
ASXL1	171023	hgsc.bcm.edu	37	20	31021493	31021493	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:31021493G>T	ENST00000375687.4	+	12	1916	c.1492G>T	c.(1492-1494)Gca>Tca	p.A498S	ASXL1_ENST00000306058.5_Missense_Mutation_p.A493S	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	498	Interaction with NCOA1. {ECO:0000250}.				bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.A498S(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						AGACAACTTGGCACGTGCCTC	0.572			"""F, N, Mis"""		"""MDS, CMML"""																																p.A498S			Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1492T	20						.						114.0	119.0	117.0					20																	31021493		2203	4300	6503	30485154	SO:0001583	missense	171023	exon11			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.1492G>T	20.37:g.31021493G>T	ENSP00000364839:p.Ala498Ser	Somatic		Capture	SOLID	Phase_I	30485154	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	ENST00000375687.4	37	CCDS13201.1	.	.	.	.	.	.	.	.	.	.	G	4.723	0.134448	0.09032	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	T;T	0.15139	2.45;2.45	4.38	2.35	0.29111	.	0.862596	0.10621	N	0.653282	T	0.14098	0.0341	M	0.63428	1.95	0.09310	N	1	B;B	0.19935	0.017;0.04	B;B	0.17979	0.006;0.02	T	0.39820	-0.9595	10	0.15499	T	0.54	0.176	1.3277	0.02128	0.1974:0.258:0.3841:0.1605	.	493;498	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	S	498;498;498;437;493	ENSP00000364839:A498S;ENSP00000305119:A493S	ENSP00000305119:A493S	A	+	1	0	ASXL1	30485154	0.001000	0.12720	0.005000	0.12908	0.536000	0.34869	0.974000	0.29436	0.722000	0.32252	-0.150000	0.13652	GCA		ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
ERGIC3	51614	hgsc.bcm.edu	37	20	34130328	34130328	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:34130328T>A	ENST00000348547.2	+	3	303	c.226T>A	c.(226-228)Ttt>Att	p.F76I	ERGIC3_ENST00000357394.4_Missense_Mutation_p.F76I|ERGIC3_ENST00000279052.6_Missense_Mutation_p.F76I|ERGIC3_ENST00000447986.1_Missense_Mutation_p.F76I	NM_015966.2	NP_057050.1	Q9Y282	ERGI3_HUMAN	ERGIC and golgi 3	76					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.F76I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)	16	Lung NSC(9;0.00489)|all_lung(11;0.00729)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			CGATGTACTTTTTCCGCACAT	0.552																																					p.F76I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T226A	20						.						223.0	182.0	196.0					20																	34130328		2203	4300	6503	33593742	SO:0001583	missense	51614	exon3			AF077030	CCDS13257.1, CCDS13258.1	20q11.22	2013-09-19	2006-01-19	2006-01-19	ENSG00000125991	ENSG00000125991			15927	protein-coding gene	gene with protein product			"""serologically defined breast cancer antigen 84"", ""chromosome 20 open reading frame 47"""	SDBCAG84, C20orf47		10810093	Standard	NM_015966		Approved	CGI-54, PRO0989, NY-BR-84, Erv46	uc002xcs.3	Q9Y282	OTTHUMG00000032346	ENST00000348547.2:c.226T>A	20.37:g.34130328T>A	ENSP00000341358:p.Phe76Ile	Somatic		Capture	SOLID	Phase_I	33593742	NM_198398	Q5JWS3|Q6ZWP7|Q9H276|Q9P1L3	Missense_Mutation	SNP	ENST00000348547.2	37	CCDS13257.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	36|36|36	5.646377|5.646377|5.646377	0.96704|0.96704|0.96704	.|.|.	.|.|.	ENSG00000125991|ENSG00000125991|ENSG00000125991	ENST00000348547;ENST00000357394;ENST00000447986;ENST00000279052;ENST00000411577|ENST00000416206|ENST00000413587	T;T;T;T;T|.|.	0.59083|.|.	0.31;0.31;0.29;0.3;0.37|.|.	5.91|5.91|5.91	5.91|5.91|5.91	0.95273|0.95273|0.95273	.|.|.	0.000000|0.000000|0.000000	0.85682|0.85682|0.85682	D|D|D	0.000000|0.000000|0.000000	T|T|T	0.77671|0.77671|0.77671	0.4165|0.4165|0.4165	M|M|M	0.81497|0.81497|0.81497	2.545|2.545|2.545	0.80722|0.80722|0.80722	D|D|D	1|1|1	P;D;D;D;D;D|.|.	0.89917|.|.	0.87;1.0;1.0;0.966;1.0;1.0|.|.	D;D;D;P;D;D|.|.	0.97110|.|.	0.919;1.0;1.0;0.646;0.981;1.0|.|.	T|T|T	0.78942|0.78942|0.78942	-0.2005|-0.2005|-0.2005	10|6|6	0.49607|.|.	T|.|.	0.09|.|.	-34.2155|-34.2155|-34.2155	16.3432|16.3432|16.3432	0.83101|0.83101|0.83101	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	76;76;76;76;76;76|.|.	B4DV36;E9PFA8;Q9Y282;Q9Y282-3;Q9Y282-2;A2TJK5|.|.	.;.;ERGI3_HUMAN;.;.;.|.|.	I|L|Y	76;76;76;76;70|74|65	ENSP00000341358:F76I;ENSP00000349970:F76I;ENSP00000392341:F76I;ENSP00000279052:F76I;ENSP00000414490:F70I|.|.	ENSP00000279052:F76I|.|.	F|F|F	+|+|+	1|3|2	0|2|0	ERGIC3|ERGIC3|ERGIC3	33593742|33593742|33593742	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.924000|0.924000|0.924000	0.36721|0.36721|0.36721	0.958000|0.958000|0.958000	0.62258|0.62258|0.62258	8.007000|8.007000|8.007000	0.88571|0.88571|0.88571	2.263000|2.263000|2.263000	0.75096|0.75096|0.75096	0.377000|0.377000|0.377000	0.23210|0.23210|0.23210	TTT|TTT|TTT		ERGIC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078880.2	NM_015966	
SRC	6714	hgsc.bcm.edu	37	20	36030940	36030940	+	Missense_Mutation	SNP	G	G	C	rs186207963		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:36030940G>C	ENST00000373578.2	+	12	1568	c.1219G>C	c.(1219-1221)Gac>Cac	p.D407H	SRC_ENST00000360723.4_Missense_Mutation_p.D413H|SRC_ENST00000373558.2_Missense_Mutation_p.D413H|SRC_ENST00000445403.1_Missense_Mutation_p.D407H|SRC_ENST00000358208.4_Missense_Mutation_p.D407H|SRC_ENST00000373567.2_Missense_Mutation_p.D407H|SRC_ENST00000477066.1_3'UTR	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	407	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)	p.D407H(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	CAAAGTGGCGGACTTTGGGCT	0.622																																					p.D407H												.	.	1	Substitution - Missense(1)	ovary(1)	c.G1219C	20						.						64.0	57.0	59.0					20																	36030940		2203	4300	6503	35464354	SO:0001583	missense	6714	exon12			AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.1219G>C	20.37:g.36030940G>C	ENSP00000362680:p.Asp407His	Somatic		Capture	SOLID	Phase_I	35464354	NM_005417	E1P5V4|Q76P87|Q86VB9|Q9H5A8	Missense_Mutation	SNP	ENST00000373578.2	37	CCDS13294.1	263	0.12042124542124542	85	0.17276422764227642	28	0.07734806629834254	48	0.08391608391608392	102	0.1345646437994723	G	24.8	4.567860	0.86439	.	.	ENSG00000197122	ENST00000445403;ENST00000373578;ENST00000360723;ENST00000358208;ENST00000373567;ENST00000373558	T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87	4.99	4.99	0.66335	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.00695	0.0023	H	0.99238	4.48	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.56080	-0.8038	10	0.87932	D	0	.	15.8235	0.78678	0.0:0.0:1.0:0.0	.	407	P12931	SRC_HUMAN	H	407;407;413;407;407;413	ENSP00000408503:D407H;ENSP00000362680:D407H;ENSP00000353950:D413H;ENSP00000350941:D407H;ENSP00000362668:D407H;ENSP00000362659:D413H	ENSP00000350941:D407H	D	+	1	0	SRC	35464354	1.000000	0.71417	0.984000	0.44739	0.788000	0.44548	9.657000	0.98554	2.586000	0.87340	0.561000	0.74099	GAC		SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268142.1	NM_005417	
CHD6	84181	hgsc.bcm.edu	37	20	40143489	40143489	+	Silent	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:40143489T>A	ENST00000373233.3	-	4	834	c.657A>T	c.(655-657)ccA>ccT	p.P219P	CHD6_ENST00000309279.7_Silent_p.P219P|CHD6_ENST00000373222.3_Silent_p.P254P	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	219	Required for DNA-dependent ATPase activity.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TCCGCAGAGATGGGTTCGTCA	0.537																																					p.P219P												.	.	0			c.A657T	20						.						128.0	119.0	122.0					20																	40143489		2203	4300	6503	39576903	SO:0001819	synonymous_variant	84181	exon4			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.657A>T	20.37:g.40143489T>A		Somatic		Capture	SOLID	Phase_I	39576903	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	ENST00000373233.3	37	CCDS13317.1																																																																																				CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
PIGT	51604	hgsc.bcm.edu	37	20	44054403	44054403	+	Silent	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:44054403A>C	ENST00000279036.6	+	12	1754	c.1674A>C	c.(1672-1674)acA>acC	p.T558T	PIGT_ENST00000543458.2_Silent_p.T502T|PIGT_ENST00000279035.9_Silent_p.T456T|PIGT_ENST00000341555.5_Silent_p.T364T|PIGT_ENST00000545755.1_Silent_p.T296T|PIGT_ENST00000535404.1_Silent_p.T403T|PIGT_ENST00000372689.5_Silent_p.T491T	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	558					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)	p.T558T(1)		breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				AGCCCCGCACAGGTGGCCTGG	0.622																																					p.T456T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1368C	20						.						38.0	33.0	34.0					20																	44054403		2203	4300	6503	43487817	SO:0001819	synonymous_variant	51604	exon10				CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.1674A>C	20.37:g.44054403A>C		Somatic		Capture	SOLID	Phase_I	43487817	NM_001184730	B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Silent	SNP	ENST00000279036.6	37	CCDS13353.1																																																																																				PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079434.2	NM_015937	
ZSWIM3	140831	hgsc.bcm.edu	37	20	44506739	44506739	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:44506739G>T	ENST00000255152.2	+	2	1751	c.1542G>T	c.(1540-1542)tgG>tgT	p.W514C	ZSWIM3_ENST00000454862.2_Missense_Mutation_p.W508C	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	514							zinc ion binding (GO:0008270)	p.W514C(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				ACAATGAGTGGGAGGTGGTAC	0.562																																					p.W514C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1542T	20						.						86.0	71.0	76.0					20																	44506739		2203	4300	6503	43940146	SO:0001583	missense	140831	exon2			AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.1542G>T	20.37:g.44506739G>T	ENSP00000255152:p.Trp514Cys	Somatic		Capture	SOLID	Phase_I	43940146	NM_080752	Q9BR13	Missense_Mutation	SNP	ENST00000255152.2	37	CCDS13381.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.338784	0.60963	.	.	ENSG00000132801	ENST00000255152;ENST00000454862	T;T	0.31247	1.57;1.5	5.51	5.51	0.81932	.	0.084638	0.52532	D	0.000075	T	0.46908	0.1417	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.19549	-1.0302	10	0.39692	T	0.17	-14.0461	19.2067	0.93734	0.0:0.0:1.0:0.0	.	508;514	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	C	514;508	ENSP00000255152:W514C;ENSP00000406313:W508C	ENSP00000255152:W514C	W	+	3	0	ZSWIM3	43940146	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.055000	0.71103	2.873000	0.98535	0.561000	0.74099	TGG		ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	NM_080752	
SLC12A5	57468	hgsc.bcm.edu	37	20	44673620	44673620	+	Silent	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:44673620G>T	ENST00000454036.2	+	12	1528	c.1479G>T	c.(1477-1479)gtG>gtT	p.V493V	SLC12A5_ENST00000243964.3_Silent_p.V470V	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	493					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.V470V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	GCGAAGCTGTGAATGGCAACC	0.567																																					p.V470V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1410T	20						.						173.0	158.0	163.0					20																	44673620		2203	4300	6503	44107027	SO:0001819	synonymous_variant	57468	exon12			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.1479G>T	20.37:g.44673620G>T		Somatic		Capture	SOLID	Phase_I	44107027	NM_020708	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	ENST00000454036.2	37	CCDS46610.1																																																																																				SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1		
ZMYND8	23613	hgsc.bcm.edu	37	20	45905151	45905151	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:45905151C>A	ENST00000311275.7	-	11	1580	c.1327G>T	c.(1327-1329)Ggc>Tgc	p.G443C	ZMYND8_ENST00000372023.3_Missense_Mutation_p.G438C|ZMYND8_ENST00000458360.2_Missense_Mutation_p.G438C|ZMYND8_ENST00000468376.2_5'UTR|ZMYND8_ENST00000461685.1_Missense_Mutation_p.G463C|ZMYND8_ENST00000471951.2_Missense_Mutation_p.G463C|ZMYND8_ENST00000536340.1_Missense_Mutation_p.G470C|ZMYND8_ENST00000396281.4_Missense_Mutation_p.G443C|ZMYND8_ENST00000540497.1_Missense_Mutation_p.G438C|ZMYND8_ENST00000352431.2_Missense_Mutation_p.G463C|ZMYND8_ENST00000360911.3_Missense_Mutation_p.G438C|ZMYND8_ENST00000262975.4_Missense_Mutation_p.G443C|ZMYND8_ENST00000355972.4_Missense_Mutation_p.G443C|ZMYND8_ENST00000446994.2_Missense_Mutation_p.G380C	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	443					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)	p.G463C(1)		NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			ACGTCGGAGCCCGTGTGCACA	0.602																																					p.G463C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1387T	20						.						52.0	45.0	48.0					20																	45905151		2203	4300	6503	45338558	SO:0001583	missense	23613	exon11			U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.1327G>T	20.37:g.45905151C>A	ENSP00000312237:p.Gly443Cys	Somatic		Capture	SOLID	Phase_I	45338558	NM_012408	B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Missense_Mutation	SNP	ENST00000311275.7	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.6|25.6	4.651597|4.651597	0.88056|0.88056	.|.	.|.	ENSG00000101040|ENSG00000101040	ENST00000360911;ENST00000311275;ENST00000458360;ENST00000262975;ENST00000471951;ENST00000352431;ENST00000396281;ENST00000536340;ENST00000355972;ENST00000446994;ENST00000461685;ENST00000372023;ENST00000540497|ENST00000467200	D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.94650|.	-2.57;-2.4;-2.5;-2.47;-2.43;-2.45;-2.55;-2.44;-2.42;-3.48;-2.49;-2.57;-1.9|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.73094|0.73094	0.3543|0.3543	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.97110|.	0.997;0.997;1.0;1.0;1.0;0.999;0.997;1.0;0.995;0.994;1.0;1.0;1.0;1.0;1.0;1.0;0.995;0.998|.	T|T	0.70019|0.70019	-0.4987|-0.4987	10|6	0.87932|.	D|.	0|.	-12.8343|-12.8343	19.451|19.451	0.94867|0.94867	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	438;470;438;438;418;437;463;443;438;463;463;443;380;438;438;463;438;443|.	B7ZM62;F5H0X3;Q2HXV7;Q2HXV3;Q5TH11;Q5JV90;Q9ULU4-7;Q9ULU4-9;Q9ULU4-14;Q9ULU4-12;Q9ULU4-13;Q9ULU4;B3KVL2;Q2HXV9;Q2HXV1;Q9ULU4-8;Q2HXV4;B7Z2A8|.	.;.;.;.;.;.;.;.;.;.;.;PKCB1_HUMAN;.;.;.;.;.;.|.	C|V	438;443;438;443;463;463;443;470;443;380;463;438;438|369	ENSP00000354166:G438C;ENSP00000312237:G443C;ENSP00000392964:G438C;ENSP00000262975:G443C;ENSP00000420095:G463C;ENSP00000335537:G463C;ENSP00000379577:G443C;ENSP00000439800:G470C;ENSP00000348246:G443C;ENSP00000396725:G380C;ENSP00000418210:G463C;ENSP00000361093:G438C;ENSP00000443086:G438C|.	ENSP00000262975:G443C|.	G|G	-|-	1|2	0|0	ZMYND8|ZMYND8	45338558|45338558	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.786000|0.786000	0.44442|0.44442	7.711000|7.711000	0.84669|0.84669	2.593000|2.593000	0.87608|0.87608	0.655000|0.655000	0.94253|0.94253	GGC|GGG		ZMYND8-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000079596.2	NM_183047	
KCNB1	3745	hgsc.bcm.edu	37	20	48098693	48098693	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:48098693C>G	ENST00000371741.4	-	1	491	c.325G>C	c.(325-327)Gag>Cag	p.E109Q		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	109					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	GCGCACATCTCCTCCATCATG	0.592																																					p.E109Q												.	.	0			c.G325C	20						.						72.0	57.0	62.0					20																	48098693		2203	4300	6503	47532100	SO:0001583	missense	3745	exon1			AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.325G>C	20.37:g.48098693C>G	ENSP00000360806:p.Glu109Gln	Somatic		Capture	SOLID	Phase_I	47532100	NM_004975	Q14193	Missense_Mutation	SNP	ENST00000371741.4	37	CCDS13418.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515707	0.85389	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	T	0.77620	-1.11	5.37	5.37	0.77165	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.84325	0.5447	L	0.41356	1.27	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84266	0.0486	10	0.52906	T	0.07	.	18.9149	0.92501	0.0:1.0:0.0:0.0	.	109	Q14721	KCNB1_HUMAN	Q	109;64	ENSP00000360806:E109Q	ENSP00000360806:E109Q	E	-	1	0	KCNB1	47532100	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.793000	0.96121	0.563000	0.77884	GAG		KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975	
CTCFL	140690	hgsc.bcm.edu	37	20	56087791	56087791	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:56087791A>C	ENST00000608263.1	-	7	2009	c.1348T>G	c.(1348-1350)Ttg>Gtg	p.L450V	CTCFL_ENST00000423479.3_Missense_Mutation_p.L450V|CTCFL_ENST00000539382.1_Missense_Mutation_p.L245V|CTCFL_ENST00000422869.2_Missense_Mutation_p.L450V|CTCFL_ENST00000608903.1_Missense_Mutation_p.L188V|CTCFL_ENST00000608858.1_5'Flank|CTCFL_ENST00000432255.2_Intron|CTCFL_ENST00000609232.1_Missense_Mutation_p.L450V|CTCFL_ENST00000608425.1_Missense_Mutation_p.L450V|CTCFL_ENST00000502686.2_Missense_Mutation_p.L188V|CTCFL_ENST00000608440.1_Missense_Mutation_p.L450V|CTCFL_ENST00000429804.3_Missense_Mutation_p.L400V|CTCFL_ENST00000371196.2_Missense_Mutation_p.L450V|CTCFL_ENST00000243914.3_Missense_Mutation_p.L450V|CTCFL_ENST00000433949.3_Missense_Mutation_p.L245V	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	450					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			TAAGCATGCAAGTTGCGCATA	0.458																																					p.L450V												.	.	0			c.T1348G	20						.						81.0	70.0	73.0					20																	56087791		2203	4300	6503	55521197	SO:0001583	missense	140690	exon8				CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.1348T>G	20.37:g.56087791A>C	ENSP00000476783:p.Leu450Val	Somatic		Capture	SOLID	Phase_I	55521197	NM_080618	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Missense_Mutation	SNP	ENST00000608263.1	37	CCDS13459.1	.	.	.	.	.	.	.	.	.	.	A	14.18	2.459845	0.43736	.	.	ENSG00000124092	ENST00000423479;ENST00000243914;ENST00000371196;ENST00000429804;ENST00000433949;ENST00000502686;ENST00000539382;ENST00000422869	T;T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;3.02;0.89;0.89;0.89;0.89	5.35	-1.56	0.08532	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.231211	0.22027	N	0.065648	T	0.34164	0.0888	N	0.03209	-0.39	0.80722	D	1	P;D;P;D;D;D	0.71674	0.927;0.998;0.952;0.988;0.998;0.998	P;D;P;D;D;D	0.75020	0.842;0.975;0.78;0.934;0.975;0.985	T	0.26155	-1.0111	10	0.51188	T	0.08	-23.6208	10.6592	0.45692	0.4169:0.0:0.5831:0.0	.	450;450;400;450;450;450	A6XGM9;A6XGM2;E7EUE3;A1L4C6;A6XGL8;Q8NI51	.;.;.;.;.;CTCFL_HUMAN	V	450;450;450;400;450;188;245;450	ENSP00000415579:L450V;ENSP00000243914:L450V;ENSP00000360239:L450V;ENSP00000415329:L400V;ENSP00000392034:L450V;ENSP00000437999:L188V;ENSP00000439998:L245V;ENSP00000399061:L450V	ENSP00000243914:L450V	L	-	1	2	CTCFL	55521197	1.000000	0.71417	0.942000	0.38095	0.065000	0.16274	1.965000	0.40471	-0.241000	0.09681	-0.912000	0.02778	TTG		CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618	
PHACTR3	116154	hgsc.bcm.edu	37	20	58348363	58348363	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:58348363A>T	ENST00000371015.1	+	6	1248	c.781A>T	c.(781-783)Atg>Ttg	p.M261L	PHACTR3_ENST00000541461.1_Missense_Mutation_p.M220L|PHACTR3_ENST00000359926.3_Missense_Mutation_p.M258L|PHACTR3_ENST00000355648.4_Missense_Mutation_p.M220L|PHACTR3_ENST00000395639.4_Missense_Mutation_p.M150L|PHACTR3_ENST00000361300.4_Missense_Mutation_p.M150L|PHACTR3_ENST00000395636.2_Missense_Mutation_p.M220L	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	261						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			AGCCTCCAGCATGAAGAGTGC	0.627																																					p.M261L												.	.	0			c.A781T	20						.						85.0	87.0	87.0					20																	58348363		2203	4300	6503	57781758	SO:0001583	missense	116154	exon6			AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.781A>T	20.37:g.58348363A>T	ENSP00000360054:p.Met261Leu	Somatic		Capture	SOLID	Phase_I	57781758	NM_080672	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	37	CCDS13480.1	.	.	.	.	.	.	.	.	.	.	A	0.521	-0.862219	0.02610	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.27256	2.1;2.11;1.68;2.11;2.11;2.11;1.68	5.13	-6.35	0.01975	.	1.966960	0.02082	N	0.052453	T	0.10508	0.0257	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.14643	-1.0465	10	0.25106	T	0.35	-0.3349	3.3818	0.07257	0.539:0.185:0.1888:0.0872	.	150;261;258	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	L	258;261;150;220;220;220;150	ENSP00000353002:M258L;ENSP00000360054:M261L;ENSP00000379001:M150L;ENSP00000442483:M220L;ENSP00000347866:M220L;ENSP00000378998:M220L;ENSP00000354555:M150L	ENSP00000347866:M220L	M	+	1	0	PHACTR3	57781758	0.008000	0.16893	0.000000	0.03702	0.001000	0.01503	0.697000	0.25556	-1.040000	0.03271	-1.151000	0.01829	ATG		PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672	
SLC52A3	113278	hgsc.bcm.edu	37	20	744512	744512	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:744512G>T	ENST00000217254.7	-	3	944	c.703C>A	c.(703-705)Ctc>Atc	p.L235I	SLC52A3_ENST00000381944.3_Missense_Mutation_p.L235I|SLC52A3_ENST00000473664.1_Intron	NM_033409.3	NP_212134.3	Q9NQ40	S52A3_HUMAN	solute carrier family 52 (riboflavin transporter), member 3	235					cellular response to heat (GO:0034605)|riboflavin metabolic process (GO:0006771)|riboflavin transport (GO:0032218)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	riboflavin transporter activity (GO:0032217)	p.L235I(1)									AACGCCACGAGGCAGCAGGCC	0.612																																					p.L235I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C703A	20						.						80.0	71.0	74.0					20																	744512		2203	4300	6503	692512	SO:0001583	missense	113278	exon3			AL118502	CCDS13007.1	20p13	2013-07-17	2013-07-17	2012-02-29	ENSG00000101276	ENSG00000101276		"""Solute carriers"""	16187	protein-coding gene	gene with protein product	"""hypothetical protein LOC113278"""	613350	"""chromosome 20 open reading frame 54"""	C20orf54		11780052, 19122205	Standard	NM_033409		Approved	bA371L19.1, hRFT2, RFVT3	uc002wed.4	Q9NQ40	OTTHUMG00000031647	ENST00000217254.7:c.703C>A	20.37:g.744512G>T	ENSP00000217254:p.Leu235Ile	Somatic		Capture	SOLID	Phase_I	692512	NM_033409	A8K6P1|Q5W1A0|Q5W1A1|Q8NCL7|Q96GD5	Missense_Mutation	SNP	ENST00000217254.7	37	CCDS13007.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.208385	0.39003	.	.	ENSG00000101276	ENST00000217254;ENST00000381944	D;D	0.83250	-1.7;-1.7	4.95	1.95	0.26073	.	0.214008	0.40908	D	0.000990	D	0.86644	0.5982	L	0.61218	1.895	0.54753	D	0.999983	D;D	0.76494	0.999;0.998	D;P	0.65874	0.939;0.821	D	0.84052	0.0370	10	0.56958	D	0.05	-14.1714	8.6237	0.33877	0.3257:0.0:0.6743:0.0	.	235;235	Q9NQ40-2;Q9NQ40	.;RFT2_HUMAN	I	235	ENSP00000217254:L235I;ENSP00000371370:L235I	ENSP00000217254:L235I	L	-	1	0	C20orf54	692512	1.000000	0.71417	0.642000	0.29436	0.250000	0.25880	1.212000	0.32394	0.161000	0.19458	-0.291000	0.09656	CTC		SLC52A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077482.2	NM_033409	
PAK7	57144	hgsc.bcm.edu	37	20	9520136	9520136	+	Silent	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:9520136G>T	ENST00000378429.3	-	11	2679	c.2133C>A	c.(2131-2133)ccC>ccA	p.P711P	PAK7_ENST00000378423.1_Silent_p.P711P|PAK7_ENST00000353224.5_Silent_p.P711P	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	711					apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			GTCTCATGAGGGGGACGATGC	0.493																																					p.P711P												.	.	0			c.C2133A	20						.						237.0	219.0	225.0					20																	9520136		2203	4300	6503	9468136	SO:0001819	synonymous_variant	57144	exon10			AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.2133C>A	20.37:g.9520136G>T		Somatic		Capture	SOLID	Phase_I	9468136	NM_177990	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Silent	SNP	ENST00000378429.3	37	CCDS13107.1																																																																																				PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1		
CDH4	1002	hgsc.bcm.edu	37	20	60419831	60419831	+	Silent	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr20:60419831G>C	ENST00000360469.5	+	5	772	c.684G>C	c.(682-684)cgG>cgC	p.R228R	CDH4_ENST00000543233.1_Silent_p.R154R	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	228	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R228R(1)		NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TGTCCGGCCGGATGTACGTCA	0.637																																					p.R228R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G684C	20						.						72.0	61.0	65.0					20																	60419831		2203	4300	6503	59853226	SO:0001819	synonymous_variant	1002	exon5			L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.684G>C	20.37:g.60419831G>C		Somatic		Capture	SOLID	Phase_I	59853226	NM_001794	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Silent	SNP	ENST00000360469.5	37	CCDS13488.1																																																																																				CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794	
DYNC1H1	1778	hgsc.bcm.edu	37	14	102510338	102510338	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:102510338T>A	ENST00000360184.4	+	70	12804	c.12640T>A	c.(12640-12642)Tca>Aca	p.S4214T	RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA|RP11-1017G21.4_ENST00000553701.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	4214	AAA 6. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.S4214T(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TGACCTGCGGTCAGCTTGCGA	0.557																																					p.S4214T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T12640A	14						.						81.0	69.0	73.0					14																	102510338		2203	4300	6503	101580091	SO:0001583	missense	1778	exon70			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.12640T>A	14.37:g.102510338T>A	ENSP00000348965:p.Ser4214Thr	Somatic		Capture	SOLID	Phase_I	101580091	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	T	12.74	2.029158	0.35797	.	.	ENSG00000197102	ENST00000360184	T	0.08458	3.09	5.83	5.83	0.93111	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.08223	0.0205	N	0.25890	0.77	0.58432	D	0.999997	B	0.14012	0.009	B	0.15484	0.013	T	0.23726	-1.0180	10	0.36615	T	0.2	.	16.2009	0.82078	0.0:0.0:0.0:1.0	.	4214	Q14204	DYHC1_HUMAN	T	4214	ENSP00000348965:S4214T	ENSP00000348965:S4214T	S	+	1	0	DYNC1H1	101580091	1.000000	0.71417	0.995000	0.50966	0.576000	0.36127	6.290000	0.72712	2.235000	0.73313	0.533000	0.62120	TCA		DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
TTC5	91875	hgsc.bcm.edu	37	14	20757805	20757805	+	Missense_Mutation	SNP	G	G	C	rs201731132		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:20757805G>C	ENST00000258821.3	-	10	1360	c.1304C>G	c.(1303-1305)tCg>tGg	p.S435W	TTC5_ENST00000556592.1_5'Flank	NM_138376.2	NP_612385.2	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5	435					DNA repair (GO:0006281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.S435*(1)|p.S435W(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)		CTGTGGTCGCGATGCCACTGT	0.567																																					p.S435W												.	.	2	Substitution - Nonsense(1)|Substitution - Missense(1)	large_intestine(1)|lung(1)	c.C1304G	14						.						90.0	67.0	75.0					14																	20757805		2203	4300	6503	19827645	SO:0001583	missense	91875	exon10			BC008647	CCDS9546.1	14q11.2	2013-01-11			ENSG00000136319	ENSG00000136319		"""Tetratricopeptide (TTC) repeat domain containing"""	19274	protein-coding gene	gene with protein product						11511361	Standard	NM_138376		Approved	Strap	uc001vwt.3	Q8N0Z6	OTTHUMG00000029506	ENST00000258821.3:c.1304C>G	14.37:g.20757805G>C	ENSP00000258821:p.Ser435Trp	Somatic		Capture	SOLID	Phase_I	19827645	NM_138376	A8MQ18|Q96HF9	Missense_Mutation	SNP	ENST00000258821.3	37	CCDS9546.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.83|13.83	2.354830|2.354830	0.41700|0.41700	.|.	.|.	ENSG00000136319|ENSG00000136319	ENST00000423949|ENST00000258821	.|T	.|0.32272	.|1.46	5.48|5.48	4.53|4.53	0.55603|0.55603	.|.	.|0.127565	.|0.53938	.|D	.|0.000056	T|T	0.21801|0.21801	0.0525|0.0525	N|N	0.14661|0.14661	0.345|0.345	0.50467|0.50467	D|D	0.99987|0.99987	.|P	.|0.48503	.|0.911	.|P	.|0.46253	.|0.509	T|T	0.00673|0.00673	-1.1616|-1.1616	5|10	.|0.38643	.|T	.|0.18	.|.	10.7886|10.7886	0.46419|0.46419	0.0:0.0:0.7543:0.2457|0.0:0.0:0.7543:0.2457	.|.	.|435	.|Q8N0Z6	.|TTC5_HUMAN	M|W	379|435	.|ENSP00000258821:S435W	.|ENSP00000258821:S435W	I|S	-|-	3|2	3|0	TTC5|TTC5	19827645|19827645	0.999000|0.999000	0.42202|0.42202	0.337000|0.337000	0.25536|0.25536	0.157000|0.157000	0.22087|0.22087	4.295000|4.295000	0.59049|0.59049	2.861000|2.861000	0.98227|0.98227	0.650000|0.650000	0.86243|0.86243	ATC|TCG		TTC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073529.4	NM_138376	
ACIN1	22985	hgsc.bcm.edu	37	14	23548177	23548177	+	Missense_Mutation	SNP	T	T	A	rs113611108		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:23548177T>A	ENST00000262710.1	-	7	2360	c.2033A>T	c.(2032-2034)cAg>cTg	p.Q678L	ACIN1_ENST00000605057.1_Missense_Mutation_p.Q620L|ACIN1_ENST00000457657.1_Missense_Mutation_p.Q638L|ACIN1_ENST00000555053.1_Missense_Mutation_p.Q678L|ACIN1_ENST00000555352.1_5'Flank	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	678					apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		TGCAACCTCCTGACCAGAAGA	0.512																																					p.Q678L												.	.	0			c.A2033T	14						.						117.0	103.0	108.0					14																	23548177		2203	4300	6503	22618017	SO:0001583	missense	22985	exon7			AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.2033A>T	14.37:g.23548177T>A	ENSP00000262710:p.Gln678Leu	Somatic		Capture	SOLID	Phase_I	22618017	NM_001164814	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.696022	0.88830	.	.	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.15718	3.43;3.43;2.4	6.07	4.94	0.65067	.	0.000000	0.38897	N	0.001539	T	0.24236	0.0587	L	0.27053	0.805	0.38881	D	0.956911	D;P;P	0.53745	0.962;0.936;0.936	D;P;P	0.66716	0.946;0.885;0.885	T	0.02893	-1.1097	10	0.49607	T	0.09	-15.4778	8.167	0.31233	0.0:0.0867:0.0:0.9133	.	678;678;638	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	L	678;638;678	ENSP00000262710:Q678L;ENSP00000405677:Q638L;ENSP00000451328:Q678L	ENSP00000262710:Q678L	Q	-	2	0	ACIN1	22618017	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.200000	0.42724	2.326000	0.78906	0.533000	0.62120	CAG		ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
LRRC16B	90668	hgsc.bcm.edu	37	14	24530227	24530227	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:24530227A>C	ENST00000342740.5	+	26	2436	c.2282A>C	c.(2281-2283)aAa>aCa	p.K761T	LRRC16B_ENST00000334420.7_5'UTR	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	761						cytoplasm (GO:0005737)		p.K761T(1)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		GAGGTGTCCAAAGCTGTGGAC	0.572																																					p.K761T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2282C	14						.						49.0	35.0	39.0					14																	24530227		1917	3565	5482	23600067	SO:0001583	missense	90668	exon26			AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.2282A>C	14.37:g.24530227A>C	ENSP00000340467:p.Lys761Thr	Somatic		Capture	SOLID	Phase_I	23600067	NM_138360	Q8TEF7|Q96HS9	Missense_Mutation	SNP	ENST00000342740.5	37	CCDS32054.1	.	.	.	.	.	.	.	.	.	.	A	14.47	2.545096	0.45280	.	.	ENSG00000186648	ENST00000342740	T	0.15487	2.42	5.54	5.54	0.83059	.	0.228621	0.34603	N	0.003832	T	0.21718	0.0523	L	0.29908	0.895	0.80722	D	1	D	0.69078	0.997	P	0.57204	0.815	T	0.01245	-1.1407	10	0.62326	D	0.03	-8.9426	8.107	0.30892	0.9131:0.0:0.0869:0.0	.	761	Q8ND23	LR16B_HUMAN	T	761	ENSP00000340467:K761T	ENSP00000340467:K761T	K	+	2	0	LRRC16B	23600067	1.000000	0.71417	1.000000	0.80357	0.623000	0.37688	4.140000	0.58031	2.326000	0.78906	0.533000	0.62120	AAA		LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416527.1	NM_138360	
RIPK3	11035	hgsc.bcm.edu	37	14	24808477	24808477	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:24808477A>G	ENST00000216274.5	-	3	433	c.215T>C	c.(214-216)gTg>gCg	p.V72A	RIPK3_ENST00000554338.1_5'UTR|RP11-934B9.3_ENST00000555591.1_5'Flank	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	72	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)	p.V72A(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		TAGGCGCAGCACGAATTCGTT	0.562																																					p.V72A	Pancreas(58;918 1191 4668 13304 15331)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T215C	14						.						100.0	84.0	89.0					14																	24808477		2203	4300	6503	23878317	SO:0001583	missense	11035	exon3			AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.215T>C	14.37:g.24808477A>G	ENSP00000216274:p.Val72Ala	Somatic		Capture	SOLID	Phase_I	23878317	NM_006871	B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Missense_Mutation	SNP	ENST00000216274.5	37	CCDS9628.1	.	.	.	.	.	.	.	.	.	.	A	18.77	3.694714	0.68386	.	.	ENSG00000129465	ENST00000216274	T	0.67523	-0.27	4.69	4.69	0.59074	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.373259	0.20044	N	0.100452	T	0.77665	0.4164	M	0.74258	2.255	0.09310	N	1	D;D	0.63046	0.992;0.978	P;P	0.61328	0.887;0.829	T	0.70040	-0.4981	10	0.87932	D	0	-12.1379	10.7182	0.46026	1.0:0.0:0.0:0.0	.	72;72	B4DJZ5;Q9Y572	.;RIPK3_HUMAN	A	72	ENSP00000216274:V72A	ENSP00000216274:V72A	V	-	2	0	RIPK3	23878317	0.791000	0.28800	0.085000	0.20634	0.046000	0.14306	3.367000	0.52350	2.106000	0.64143	0.459000	0.35465	GTG		RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073203.4	NM_006871	
SEC23A	10484	hgsc.bcm.edu	37	14	39524437	39524437	+	Silent	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:39524437G>A	ENST00000307712.6	-	14	2086	c.1569C>T	c.(1567-1569)gcC>gcT	p.A523A	SEC23A_ENST00000537403.1_Silent_p.A321A|SEC23A_ENST00000536508.1_Silent_p.A397A|SEC23A_ENST00000545328.2_Silent_p.A494A	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	523					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		CCATAAGAATGGCAGCTGCCT	0.443																																					p.A523A												.	.	0			c.C1569T	14						.						103.0	101.0	102.0					14																	39524437		2203	4300	6503	38594188	SO:0001819	synonymous_variant	10484	exon14			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1569C>T	14.37:g.39524437G>A		Somatic		Capture	SOLID	Phase_I	38594188	NM_006364	B2R5P4|B3KXI2|Q8NE16	Silent	SNP	ENST00000307712.6	37	CCDS9668.1	.	.	.	.	.	.	.	.	.	.	G	15.80	2.940062	0.52972	.	.	ENSG00000100934	ENST00000554645	.	.	.	5.67	-2.7	0.06004	.	.	.	.	.	T	0.29355	0.0731	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.07927	-1.0747	6	.	.	.	-11.5476	3.6582	0.08229	0.4925:0.0993:0.2971:0.1112	.	394	G3V531	.	L	394	.	.	P	-	2	0	SEC23A	38594188	0.655000	0.27376	0.916000	0.36221	0.992000	0.81027	-0.143000	0.10296	-0.962000	0.03604	-0.499000	0.04595	CCA		SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2		
LRFN5	145581	hgsc.bcm.edu	37	14	42360515	42360515	+	Missense_Mutation	SNP	A	A	G	rs142301191		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:42360515A>G	ENST00000298119.4	+	4	2637	c.1448A>G	c.(1447-1449)gAc>gGc	p.D483G	LRFN5_ENST00000554171.1_Intron|LRFN5_ENST00000554120.1_Intron	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	483	Fibronectin type-III.					integral component of membrane (GO:0016021)		p.D483G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		ACTATGTATGACTTGTGTGTC	0.418										HNSCC(30;0.082)			A|||	1	0.000199681	0.0	0.0	5008	,	,		19524	0.001		0.0	False		,,,				2504	0.0				p.D483G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1448G	14						.						185.0	150.0	162.0					14																	42360515		2203	4300	6503	41430265	SO:0001583	missense	145581	exon4			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1448A>G	14.37:g.42360515A>G	ENSP00000298119:p.Asp483Gly	Somatic		Capture	SOLID	Phase_I	41430265	NM_152447	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	A	20.6	4.019954	0.75275	.	.	ENSG00000165379	ENST00000298119	T	0.68479	-0.33	5.88	5.88	0.94601	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000019	T	0.80433	0.4622	M	0.76727	2.345	0.80722	D	1	D	0.69078	0.997	D	0.66716	0.946	T	0.82655	-0.0350	10	0.72032	D	0.01	.	14.2486	0.66004	1.0:0.0:0.0:0.0	.	483	Q96NI6	LRFN5_HUMAN	G	483	ENSP00000298119:D483G	ENSP00000298119:D483G	D	+	2	0	LRFN5	41430265	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	2.243000	0.73865	0.528000	0.53228	GAC		LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
LRFN5	145581	hgsc.bcm.edu	37	14	42360839	42360839	+	Missense_Mutation	SNP	A	A	C	rs572170604		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:42360839A>C	ENST00000298119.4	+	4	2961	c.1772A>C	c.(1771-1773)aAa>aCa	p.K591T	LRFN5_ENST00000554171.1_Intron|LRFN5_ENST00000554120.1_Intron	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	591						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TCCGTGTCCAAACAAGCTGTG	0.473										HNSCC(30;0.082)																											p.K591T												.	.	0			c.A1772C	14						.						122.0	101.0	108.0					14																	42360839		2203	4300	6503	41430589	SO:0001583	missense	145581	exon4			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1772A>C	14.37:g.42360839A>C	ENSP00000298119:p.Lys591Thr	Somatic		Capture	SOLID	Phase_I	41430589	NM_152447	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	A	15.46	2.839966	0.51057	.	.	ENSG00000165379	ENST00000298119	T	0.50813	0.73	5.95	5.95	0.96441	.	0.000000	0.64402	D	0.000012	T	0.29882	0.0747	N	0.08118	0	0.80722	D	1	B	0.26672	0.156	B	0.21917	0.037	T	0.14144	-1.0483	10	0.51188	T	0.08	.	14.3636	0.66789	1.0:0.0:0.0:0.0	.	591	Q96NI6	LRFN5_HUMAN	T	591	ENSP00000298119:K591T	ENSP00000298119:K591T	K	+	2	0	LRFN5	41430589	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	5.674000	0.68117	2.276000	0.75962	0.528000	0.53228	AAA		LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
MIS18BP1	55320	hgsc.bcm.edu	37	14	45693248	45693248	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:45693248C>G	ENST00000310806.4	-	11	3000	c.2542G>C	c.(2542-2544)Gtt>Ctt	p.V848L		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	848					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						TCTTTCCTAACACCAGACTTC	0.363																																					p.V848L												.	.	0			c.G2542C	14						.						115.0	107.0	110.0					14																	45693248		2203	4300	6503	44762998	SO:0001583	missense	55320	exon11			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.2542G>C	14.37:g.45693248C>G	ENSP00000309790:p.Val848Leu	Somatic		Capture	SOLID	Phase_I	44762998	NM_018353	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Missense_Mutation	SNP	ENST00000310806.4	37	CCDS9684.1	.	.	.	.	.	.	.	.	.	.	C	0.799	-0.756253	0.03019	.	.	ENSG00000129534	ENST00000310806	T	0.18657	2.2	5.72	-4.37	0.03633	.	1.372320	0.04370	N	0.359004	T	0.15046	0.0363	L	0.40543	1.245	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.30416	-0.9979	10	0.19147	T	0.46	2.0E-4	6.8497	0.24008	0.0:0.4666:0.2452:0.2882	.	848	Q6P0N0	M18BP_HUMAN	L	848	ENSP00000309790:V848L	ENSP00000309790:V848L	V	-	1	0	MIS18BP1	44762998	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.130000	0.10498	-0.533000	0.06323	0.655000	0.94253	GTT		MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276795.2		
SPTB	6710	hgsc.bcm.edu	37	14	65253656	65253656	+	Silent	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:65253656G>T	ENST00000389721.5	-	15	3059	c.3027C>A	c.(3025-3027)gcC>gcA	p.A1009A	SPTB_ENST00000556626.1_Silent_p.A1009A|SPTB_ENST00000542895.1_Silent_p.A1009A|SPTB_ENST00000389720.3_Silent_p.A1009A|SPTB_ENST00000389722.3_Silent_p.A1009A	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1009					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.A1009A(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CATCCACACGGGCCTGGATGG	0.602																																					p.A1009A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3027A	14						.						88.0	82.0	84.0					14																	65253656		2203	4300	6503	64323409	SO:0001819	synonymous_variant	6710	exon15				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.3027C>A	14.37:g.65253656G>T		Somatic		Capture	SOLID	Phase_I	64323409	NM_001024858	Q15510|Q15519	Silent	SNP	ENST00000389721.5	37	CCDS32100.1																																																																																				SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
ALDH6A1	4329	hgsc.bcm.edu	37	14	74534193	74534193	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:74534193C>A	ENST00000553458.1	-	8	1030	c.932G>T	c.(931-933)gGa>gTa	p.G311V	CCDC176_ENST00000553773.1_Intron|ALDH6A1_ENST00000555126.1_Missense_Mutation_p.G28V|ALDH6A1_ENST00000350259.4_Missense_Mutation_p.G298V|AC005484.5_ENST00000492026.1_RNA	NM_001278593.1|NM_005589.2	NP_001265522.1|NP_005580.1	Q02252	MMSA_HUMAN	aldehyde dehydrogenase 6 family, member A1	311					branched-chain amino acid catabolic process (GO:0009083)|brown fat cell differentiation (GO:0050873)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|thymine metabolic process (GO:0019859)|valine catabolic process (GO:0006574)|valine metabolic process (GO:0006573)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	fatty-acyl-CoA binding (GO:0000062)|malonate-semialdehyde dehydrogenase (acetylating) activity (GO:0018478)|methylmalonate-semialdehyde dehydrogenase (acylating) activity (GO:0004491)|poly(A) RNA binding (GO:0044822)	p.G311V(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(3)|skin(3)	21				BRCA - Breast invasive adenocarcinoma(234;0.00354)		ACCAGCAGCTCCAAATGCTGC	0.517																																					p.G311V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G932T	14						.						74.0	72.0	73.0					14																	74534193		2203	4300	6503	73603946	SO:0001583	missense	4329	exon8			M93405	CCDS9826.1, CCDS61501.1	14q24.3	2014-02-03			ENSG00000119711	ENSG00000119711	1.2.1.27	"""Aldehyde dehydrogenases"""	7179	protein-coding gene	gene with protein product		603178		MMSDH		1527093	Standard	NM_005589		Approved		uc001xpo.3	Q02252	OTTHUMG00000171203	ENST00000553458.1:c.932G>T	14.37:g.74534193C>A	ENSP00000450436:p.Gly311Val	Somatic		Capture	SOLID	Phase_I	73603946	NM_005589	B2R609|B4DFS8|J3KNU8|Q9UKM8	Missense_Mutation	SNP	ENST00000553458.1	37	CCDS9826.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.986941	0.93106	.	.	ENSG00000119711	ENST00000553458;ENST00000350259;ENST00000555126	D;D;D	0.90732	-2.72;-2.72;-2.72	5.41	5.41	0.78517	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);Aldehyde dehydrogenase, conserved site (1);	0.097620	0.64402	D	0.000001	D	0.97126	0.9061	H	0.95884	3.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97882	1.0292	10	0.87932	D	0	.	19.3843	0.94550	0.0:1.0:0.0:0.0	.	298;311	B4DFS8;Q02252	.;MMSA_HUMAN	V	311;298;28	ENSP00000450436:G311V;ENSP00000342564:G298V;ENSP00000452081:G28V	ENSP00000342564:G311V	G	-	2	0	ALDH6A1	73603946	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.632000	0.83247	2.814000	0.96858	0.591000	0.81541	GGA		ALDH6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412309.1		
FLRT2	23768	hgsc.bcm.edu	37	14	86087902	86087902	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:86087902T>C	ENST00000330753.4	+	2	811	c.44T>C	c.(43-45)tTc>tCc	p.F15S	FLRT2_ENST00000554746.1_Missense_Mutation_p.F15S	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	15					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		GGGGCTTTTTTCCTGAAGTCT	0.468																																					p.F15S												.	.	0			c.T44C	14						.						65.0	68.0	67.0					14																	86087902		2203	4300	6503	85157655	SO:0001583	missense	23768	exon2			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.44T>C	14.37:g.86087902T>C	ENSP00000332879:p.Phe15Ser	Somatic		Capture	SOLID	Phase_I	85157655	NM_013231	A0AV84|B7ZLP3	Missense_Mutation	SNP	ENST00000330753.4	37	CCDS9877.1	.	.	.	.	.	.	.	.	.	.	T	16.77	3.213713	0.58452	.	.	ENSG00000185070	ENST00000330753;ENST00000554746	T;T	0.56103	0.48;0.48	5.73	4.59	0.56863	.	0.409080	0.27486	N	0.019149	T	0.32436	0.0829	N	0.14661	0.345	0.30639	N	0.756695	P	0.36733	0.567	B	0.30495	0.116	T	0.30736	-0.9968	10	0.46703	T	0.11	-3.3377	11.5093	0.50484	0.0:0.0699:0.0:0.9301	.	15	O43155	FLRT2_HUMAN	S	15	ENSP00000332879:F15S;ENSP00000451050:F15S	ENSP00000332879:F15S	F	+	2	0	FLRT2	85157655	0.998000	0.40836	0.988000	0.46212	0.998000	0.95712	5.906000	0.69900	1.007000	0.39238	0.533000	0.62120	TTC		FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
CATSPERB	79820	hgsc.bcm.edu	37	14	92055953	92055953	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:92055953C>T	ENST00000256343.3	-	24	3037	c.2881G>A	c.(2881-2883)Gat>Aat	p.D961N		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	961					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)		p.D961N(1)		NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				ACACGTCCATCCTCGTTGATA	0.378																																					p.D961N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2881A	14						.						95.0	87.0	90.0					14																	92055953		2203	4300	6503	91125706	SO:0001583	missense	79820	exon24			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.2881G>A	14.37:g.92055953C>T	ENSP00000256343:p.Asp961Asn	Somatic		Capture	SOLID	Phase_I	91125706	NM_024764	A0AV51	Missense_Mutation	SNP	ENST00000256343.3	37	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	C	8.259	0.810733	0.16537	.	.	ENSG00000133962	ENST00000256343	T	0.44482	0.92	5.1	-0.793	0.10922	.	1.391740	0.04554	N	0.390427	T	0.28599	0.0708	L	0.39020	1.185	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.12167	-1.0558	10	0.10902	T	0.67	-1.4512	4.275	0.10804	0.1667:0.4613:0.0:0.372	.	961	Q9H7T0	CTSRB_HUMAN	N	961	ENSP00000256343:D961N	ENSP00000256343:D961N	D	-	1	0	CATSPERB	91125706	0.000000	0.05858	0.000000	0.03702	0.166000	0.22503	-0.790000	0.04604	-0.520000	0.06435	-0.291000	0.09656	GAT		CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764	
SERPINA5	5104	hgsc.bcm.edu	37	14	95057087	95057087	+	Splice_Site	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:95057087C>A	ENST00000554866.1	+	4	1006	c.892C>A	c.(892-894)Cag>Aag	p.Q298K	SERPINA5_ENST00000329597.7_Splice_Site_p.Q298K|SERPINA5_ENST00000553780.1_Splice_Site_p.Q298K|SERPINA5_ENST00000554276.1_Splice_Site_p.Q298K|RP11-986E7.7_ENST00000553947.1_5'Flank			P05154	IPSP_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5	298					fusion of sperm to egg plasma membrane (GO:0007342)|lipid transport (GO:0006869)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|spermatogenesis (GO:0007283)	acrosomal membrane (GO:0002080)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|platelet alpha granule (GO:0031091)|platelet dense tubular network (GO:0031094)|protein C inhibitor-coagulation factor V complex (GO:0097181)|protein C inhibitor-coagulation factor Xa complex (GO:0097182)|protein C inhibitor-coagulation factor XI complex (GO:0097183)|protein C inhibitor-KLK3 complex (GO:0036029)|protein C inhibitor-plasma kallikrein complex (GO:0036030)|protein C inhibitor-PLAT complex (GO:0036026)|protein C inhibitor-PLAU complex (GO:0036027)|protein C inhibitor-thrombin complex (GO:0036028)|protein C inhibitor-TMPRSS11E complex (GO:0036025)|protein C inhibitor-TMPRSS7 complex (GO:0036024)|protein complex (GO:0043234)	acrosin binding (GO:0032190)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|phosphatidylcholine binding (GO:0031210)|protease binding (GO:0002020)|retinoic acid binding (GO:0001972)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q298K(1)		endometrium(3)|large_intestine(5)|lung(18)|ovary(2)|skin(5)|upper_aerodigestive_tract(3)	36				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	CCTTTCCAGGCAGCTCGAGCT	0.502																																					p.Q298K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C892A	14						.						80.0	66.0	71.0					14																	95057087		2203	4300	6503	94126840	SO:0001630	splice_region_variant	5104	exon5			M68516	CCDS9928.1	14q32.1	2014-02-18	2005-08-18		ENSG00000188488	ENSG00000188488		"""Serine (or cysteine) peptidase inhibitors"""	8723	protein-coding gene	gene with protein product		601841	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5"""	PLANH3, PCI		1714450, 8381582, 24172014	Standard	NM_000624		Approved	PAI3, PROCI	uc001ydm.3	P05154	OTTHUMG00000170860	ENST00000554866.1:c.891-1C>A	14.37:g.95057087C>A		Somatic		Capture	SOLID	Phase_I	94126840	NM_000624	Q07616|Q9UG30	Missense_Mutation	SNP	ENST00000554866.1	37	CCDS9928.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.511433	0.00984	.	.	ENSG00000188488	ENST00000553780;ENST00000554866;ENST00000329597;ENST00000554506;ENST00000537685;ENST00000438291;ENST00000554276	D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69	4.17	-0.411	0.12370	Serpin domain (3);	1.451290	0.04400	N	0.364013	T	0.68586	0.3017	N	0.25060	0.705	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.54669	-0.8259	10	0.02654	T	1	.	8.2719	0.31849	0.4027:0.3365:0.2608:0.0	.	298	P05154	IPSP_HUMAN	K	298;298;298;74;150;222;298	ENSP00000450837:Q298K;ENSP00000451126:Q298K;ENSP00000333203:Q298K;ENSP00000451610:Q298K	ENSP00000333203:Q298K	Q	+	1	0	SERPINA5	94126840	0.000000	0.05858	0.008000	0.14137	0.025000	0.11179	-0.483000	0.06536	-0.207000	0.10187	-0.311000	0.09066	CAG		SERPINA5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410726.1	NM_000624	Missense_Mutation
SERPINA3	12	hgsc.bcm.edu	37	14	95085773	95085773	+	Silent	SNP	C	C	T	rs368183583		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:95085773C>T	ENST00000467132.1	+	3	2033	c.885C>T	c.(883-885)acC>acT	p.T295T	SERPINA3_ENST00000393078.3_Silent_p.T295T|SERPINA3_ENST00000393080.4_Silent_p.T295T|SERPINA3_ENST00000482740.1_Silent_p.T77T|RP11-986E7.7_ENST00000553947.1_3'UTR			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	295					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of endopeptidase activity (GO:0010951)|regulation of lipid metabolic process (GO:0019216)|regulation of proteolysis (GO:0030162)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	DNA binding (GO:0003677)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.T295T(1)		NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		TCCCAGAGACCCTGAAGCGGT	0.562																																					p.T295T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C885T	14						.	C		0,4406		0,0,2203	66.0	59.0	61.0		885	-9.6	0.0	14		61	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SERPINA3	NM_001085.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		295/424	95085773	1,13005	2203	4300	6503	94155526	SO:0001819	synonymous_variant	12	exon3			K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136		"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT		3260956, 24172014	Standard	NM_001085		Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.885C>T	14.37:g.95085773C>T		Somatic		Capture	SOLID	Phase_I	94155526	NM_001085	B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	Silent	SNP	ENST00000467132.1	37	CCDS32150.1																																																																																				SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268080.3	NM_001085	
VRK1	7443	hgsc.bcm.edu	37	14	97299854	97299854	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:97299854A>G	ENST00000216639.3	+	2	195	c.46A>G	c.(46-48)Aag>Gag	p.K16E		NM_003384.2	NP_003375.1	Q99986	VRK1_HUMAN	vaccinia related kinase 1	16					Golgi disassembly (GO:0090166)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-T3 phosphorylation (GO:0072355)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi stack (GO:0005795)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H3-S10 specific) (GO:0035175)|histone kinase activity (H3-T3 specific) (GO:0072354)|nucleosomal histone binding (GO:0031493)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|large_intestine(5)|lung(3)|skin(1)|stomach(1)	12		Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.234)		GAGCTCTGCAAAGAGACATCT	0.393																																					p.K16E												.	.	0			c.A46G	14						.						107.0	103.0	104.0					14																	97299854		2203	4300	6503	96369607	SO:0001583	missense	7443	exon2			AB000449	CCDS9947.1	14q32.2	2012-07-05			ENSG00000100749	ENSG00000100749			12718	protein-coding gene	gene with protein product		602168				9344656	Standard	XM_006720247		Approved		uc001yft.3	Q99986	OTTHUMG00000171459	ENST00000216639.3:c.46A>G	14.37:g.97299854A>G	ENSP00000216639:p.Lys16Glu	Somatic		Capture	SOLID	Phase_I	96369607	NM_003384	Q3SYL2	Missense_Mutation	SNP	ENST00000216639.3	37	CCDS9947.1	.	.	.	.	.	.	.	.	.	.	A	14.78	2.637207	0.47049	.	.	ENSG00000100749	ENST00000216639	T	0.21543	2.0	5.95	3.48	0.39840	.	0.090431	0.85682	D	0.000000	T	0.20170	0.0485	M	0.65498	2.005	0.45607	D	0.998544	P	0.46064	0.872	B	0.36534	0.227	T	0.04481	-1.0948	10	0.72032	D	0.01	-14.8312	9.2558	0.37581	0.7933:0.133:0.0737:0.0	.	16	Q99986	VRK1_HUMAN	E	16	ENSP00000216639:K16E	ENSP00000216639:K16E	K	+	1	0	VRK1	96369607	0.996000	0.38824	0.856000	0.33681	0.642000	0.38348	3.595000	0.54016	1.083000	0.41159	0.533000	0.62120	AAG		VRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413520.1	NM_003384	
SIVA1	10572	hgsc.bcm.edu	37	14	105225784	105225784	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr14:105225784A>T	ENST00000329967.6	+	4	592	c.490A>T	c.(490-492)Aaa>Taa	p.K164*	SIVA1_ENST00000347067.5_Nonsense_Mutation_p.K99*	NM_006427.3	NP_006418.2	O15304	SIVA_HUMAN	SIVA1, apoptosis-inducing factor	164					activation-induced cell death of T cells (GO:0006924)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	CD27 receptor binding (GO:0005175)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)	p.K164*(1)		large_intestine(1)|lung(1)|prostate(1)	3		all_cancers(154;0.14)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.173)		CATGTACGAGAAAGTGCTGTG	0.612																																					p.K164X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A490T	14						.						70.0	51.0	57.0					14																	105225784		2203	4300	6503	104296829	SO:0001587	stop_gained	10572	exon4			U82938	CCDS9992.1, CCDS9993.1	14q32.33	2007-03-19							17712	protein-coding gene	gene with protein product		605567				9177220	Standard	NM_006427		Approved	SIVA, Siva-1, Siva-2, CD27BP	uc001yph.3	O15304		ENST00000329967.6:c.490A>T	14.37:g.105225784A>T	ENSP00000329213:p.Lys164*	Somatic		Capture	SOLID	Phase_I	104296829	NM_006427	Q96P98|Q9UPD6	Nonsense_Mutation	SNP	ENST00000329967.6	37	CCDS9992.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.44|15.44	2.834414|2.834414	0.50951|0.50951	.|.	.|.	ENSG00000184990|ENSG00000184990	ENST00000329967;ENST00000347067|ENST00000556195	.|.	.|.	.|.	4.68|4.68	-0.415|-0.415	0.12355|0.12355	.|.	0.670897|.	0.14464|.	N|.	0.317980|.	.|T	.|0.43188	.|0.1236	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999991|0.999991	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.22138	.|-1.0225	.|4	0.02654|.	T|.	1|.	-6.7255|-6.7255	3.215|3.215	0.06696|0.06696	0.5319:0.0:0.294:0.1741|0.5319:0.0:0.294:0.1741	.|.	.|.	.|.	.|.	X|S	164;99|181	.|.	ENSP00000329213:K164X|.	K|R	+|+	1|3	0|2	SIVA1|SIVA1	104296829|104296829	0.528000|0.528000	0.26314|0.26314	0.020000|0.020000	0.16555|0.16555	0.201000|0.201000	0.24016|0.24016	0.594000|0.594000	0.24014|0.24014	-0.229000|-0.229000	0.09854|0.09854	0.482000|0.482000	0.46254|0.46254	AAA|AGA		SIVA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410541.1	NM_006427	
SMARCB1	6598	hgsc.bcm.edu	37	22	24167452	24167452	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr22:24167452T>G	ENST00000263121.7	+	7	1032	c.836T>G	c.(835-837)tTt>tGt	p.F279C	SMARCB1_ENST00000477836.1_3'UTR|SMARCB1_ENST00000344921.6_Missense_Mutation_p.F288C|SMARCB1_ENST00000407082.3_Missense_Mutation_p.F233C|SMARCB1_ENST00000407422.3_Missense_Mutation_p.F270C	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	279	2 X approximate tandem repeats.				ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(6)|p.D277fs*79(1)|p.L266_*386del(1)|p.F279C(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				GTGGACCAGTTTGAGTGGGAC	0.552			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																															p.F279C		yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	.	.	9	Unknown(6)|Substitution - Missense(1)|Deletion - In frame(1)|Deletion - Frameshift(1)	central_nervous_system(7)|large_intestine(1)|soft_tissue(1)	c.T836G	22						.						121.0	99.0	106.0					22																	24167452		2203	4300	6503	22497452	SO:0001583	missense	6598	exon7			U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.836T>G	22.37:g.24167452T>G	ENSP00000263121:p.Phe279Cys	Somatic		Capture	SOLID	Phase_I	22497452	NM_003073	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Missense_Mutation	SNP	ENST00000263121.7	37	CCDS13817.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.439785	0.83885	.	.	ENSG00000099956	ENST00000344921;ENST00000263121;ENST00000407422;ENST00000407082	D;D;D;D	0.83335	-1.71;-1.71;-1.71;-1.71	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.93086	0.7799	M	0.93197	3.39	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.71656	0.959;0.968;0.974	D	0.94677	0.7862	10	0.87932	D	0	-15.6677	15.5176	0.75837	0.0:0.0:0.0:1.0	.	288;270;279	G5E975;Q17S11;Q12824	.;.;SNF5_HUMAN	C	288;279;270;233	ENSP00000340883:F288C;ENSP00000263121:F279C;ENSP00000383984:F270C;ENSP00000385226:F233C	ENSP00000263121:F279C	F	+	2	0	SMARCB1	22497452	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.990000	0.88215	2.327000	0.79052	0.524000	0.50904	TTT		SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1	NM_003073	
AP1B1	162	hgsc.bcm.edu	37	22	29754824	29754824	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr22:29754824T>G	ENST00000405198.1	-	4	447	c.416A>C	c.(415-417)aAg>aCg	p.K139T	AP1B1_ENST00000402502.1_Missense_Mutation_p.K139T|AP1B1_ENST00000356015.2_Missense_Mutation_p.K139T|AP1B1_ENST00000317368.7_Missense_Mutation_p.K139T|AP1B1_ENST00000432560.2_Missense_Mutation_p.K139T|AP1B1_ENST00000357586.2_Missense_Mutation_p.K139T|AP1B1_ENST00000415447.1_Missense_Mutation_p.K139T			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	139					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						AGCTGCTGTCTTGCGCACATA	0.592																																					p.K139T												.	.	0			c.A416C	22						.						138.0	100.0	113.0					22																	29754824		2203	4300	6503	28084824	SO:0001583	missense	162	exon5			L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.416A>C	22.37:g.29754824T>G	ENSP00000384194:p.Lys139Thr	Somatic		Capture	SOLID	Phase_I	28084824	NM_001166019	C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Missense_Mutation	SNP	ENST00000405198.1	37	CCDS13855.1	.	.	.	.	.	.	.	.	.	.	T	29.4	5.004591	0.93287	.	.	ENSG00000100280	ENST00000357586;ENST00000356015;ENST00000432560;ENST00000405198;ENST00000317368;ENST00000402502;ENST00000415447;ENST00000421126	T;T;T;T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25	5.62	5.62	0.85841	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69922	0.3165	M	0.94101	3.495	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.997	D;D;D;D	0.87578	0.998;0.998;0.998;0.99	T	0.78848	-0.2042	10	0.72032	D	0.01	-24.811	15.4796	0.75514	0.0:0.0:0.0:1.0	.	139;139;139;139	F8WDL0;Q10567-2;Q10567;Q10567-3	.;.;AP1B1_HUMAN;.	T	139	ENSP00000350199:K139T;ENSP00000348297:K139T;ENSP00000400065:K139T;ENSP00000384194:K139T;ENSP00000319361:K139T;ENSP00000386071:K139T;ENSP00000387612:K139T;ENSP00000400022:K139T	ENSP00000319361:K139T	K	-	2	0	AP1B1	28084824	1.000000	0.71417	0.999000	0.59377	0.915000	0.54546	7.958000	0.87877	2.142000	0.66516	0.460000	0.39030	AAG		AP1B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321374.1	NM_001127	
MORC2	22880	hgsc.bcm.edu	37	22	31328993	31328993	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr22:31328993C>T	ENST00000397641.3	-	22	2813	c.2405G>A	c.(2404-2406)cGt>cAt	p.R802H	MORC2_ENST00000215862.4_Missense_Mutation_p.R740H|MORC2-AS1_ENST00000441558.1_RNA			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	802						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.R740H(2)		breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						CCTGTTCACACGCACCTCCAC	0.572																																					p.R740H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2219A	22						.						248.0	222.0	231.0					22																	31328993		2203	4300	6503	29658993	SO:0001583	missense	22880	exon23			AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.2405G>A	22.37:g.31328993C>T	ENSP00000380763:p.Arg802His	Somatic		Capture	SOLID	Phase_I	29658993	NM_014941	B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	ENST00000397641.3	37		.	.	.	.	.	.	.	.	.	.	C	21.0	4.079949	0.76528	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	T;T	0.14516	2.51;2.5	5.94	5.94	0.96194	.	0.050797	0.85682	D	0.000000	T	0.37598	0.1009	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	T	0.01363	-1.1374	10	0.62326	D	0.03	.	20.3658	0.98878	0.0:1.0:0.0:0.0	.	802	Q9Y6X9	MORC2_HUMAN	H	802;740	ENSP00000380763:R802H;ENSP00000215862:R740H	ENSP00000215862:R740H	R	-	2	0	MORC2	29658993	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.988000	0.56951	2.820000	0.97059	0.650000	0.86243	CGT		MORC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321710.2	NM_014941	
BPIFC	254240	hgsc.bcm.edu	37	22	32833789	32833789	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr22:32833789A>C	ENST00000397452.1	-	8	815	c.705T>G	c.(703-705)agT>agG	p.S235R	BPIFC_ENST00000300399.3_Missense_Mutation_p.S235R|BPIFC_ENST00000534972.1_5'UTR|BPIFC_ENST00000432451.2_Missense_Mutation_p.S49R			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	235						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)	p.S235R(1)									TTTCTGGAGAACTGATTAGGG	0.353																																					p.S235R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T705G	22						.						103.0	95.0	97.0					22																	32833789		2203	4300	6503	31163789	SO:0001583	missense	254240	exon7			AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.705T>G	22.37:g.32833789A>C	ENSP00000380594:p.Ser235Arg	Somatic		Capture	SOLID	Phase_I	31163789	NM_174932	A2RRF1	Missense_Mutation	SNP	ENST00000397452.1	37	CCDS13906.1	.	.	.	.	.	.	.	.	.	.	A	14.88	2.667600	0.47677	.	.	ENSG00000184459	ENST00000397452;ENST00000300399;ENST00000432451	T;T;T	0.05786	3.39;3.39;3.39	5.68	3.47	0.39725	.	0.987485	0.08313	N	0.965061	T	0.10078	0.0247	M	0.77616	2.38	0.20926	N	0.999825	P;B	0.39576	0.679;0.048	B;B	0.38106	0.265;0.01	T	0.27536	-1.0071	10	0.36615	T	0.2	-0.5005	4.9865	0.14192	0.72:0.1871:0.0929:0.0	.	49;235	A2RRF1;Q8NFQ6	.;BPIFC_HUMAN	R	235;235;49	ENSP00000380594:S235R;ENSP00000300399:S235R;ENSP00000408920:S49R	ENSP00000300399:S235R	S	-	3	2	BPIFC	31163789	0.029000	0.19370	0.625000	0.29200	0.988000	0.76386	0.337000	0.19841	2.289000	0.77006	0.533000	0.62120	AGT		BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129029.2	NM_174932	
PI4KA	5297	hgsc.bcm.edu	37	22	21101936	21101937	+	Frame_Shift_Del	DEL	GC	GC	-	rs200036043		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	GC	GC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr22:21101936_21101937delGC	ENST00000572273.1	-	29	3353_3354	c.3123_3124delGC	c.(3121-3126)gggctgfs	p.L1042fs	PI4KA_ENST00000255882.6_Frame_Shift_Del_p.L1100fs			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1042					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.L1042fs*5(2)		breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GCCATGGCCAGCCCCGTGTGCT	0.475																																					p.1041_1042del	GBM(136;1332 1831 3115 23601 50806)											.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.3123_3124del	22						.																																			19431937	SO:0001589	frameshift_variant	5297	exon29			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.3123_3124delGC	22.37:g.21101936_21101937delGC	ENSP00000458238:p.Leu1042fs	Somatic		Capture	SOLID	Phase_I	19431936	NM_058004	Q7Z625|Q9UPG2	Frame_Shift_Del	DEL	ENST00000572273.1	37																																																																																					PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
POLDIP3	84271	hgsc.bcm.edu	37	22	42981841	42981841	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr22:42981841C>T	ENST00000252115.5	-	9	1326	c.1222G>A	c.(1222-1224)Gcc>Acc	p.A408T	POLDIP3_ENST00000339677.6_Intron|POLDIP3_ENST00000451060.2_3'UTR|POLDIP3_ENST00000348657.2_Missense_Mutation_p.A379T|POLDIP3_ENST00000491021.1_5'Flank	NM_032311.3	NP_115687.2	Q9BY77	PDIP3_HUMAN	polymerase (DNA-directed), delta interacting protein 3	408					poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	16						GTCACAGAGGCCCCTGAGGAC	0.607																																					p.A379T	Ovarian(52;967 1128 5875 19997 42537)											.	.	0			c.G1135A	22						.						112.0	110.0	111.0					22																	42981841		2203	4300	6503	41311785	SO:0001583	missense	84271	exon8				CCDS14038.1, CCDS14039.1, CCDS74873.1	22q13.31	2013-02-12			ENSG00000100227	ENSG00000100227		"""RNA binding motif (RRM) containing"""	23782	protein-coding gene	gene with protein product		611520				12522211	Standard	NM_032311		Approved	PDIP46, KIAA1649	uc003bcu.3	Q9BY77	OTTHUMG00000150887	ENST00000252115.5:c.1222G>A	22.37:g.42981841C>T	ENSP00000252115:p.Ala408Thr	Somatic		Capture	SOLID	Phase_I	41311785	NM_178136	A8K6F8|A8K6V9|Q009A7|Q5H972|Q6PGN6|Q7Z6Z0|Q9NSP5|Q9NSP6	Missense_Mutation	SNP	ENST00000252115.5	37	CCDS14038.1	.	.	.	.	.	.	.	.	.	.	C	15.36	2.809053	0.50421	.	.	ENSG00000100227	ENST00000348657;ENST00000252115	.	.	.	5.66	4.65	0.58169	.	0.379291	0.30840	N	0.008765	T	0.29945	0.0749	N	0.24115	0.695	0.80722	D	1	B;B;B	0.18863	0.031;0.012;0.017	B;B;B	0.14578	0.011;0.005;0.007	T	0.14090	-1.0485	9	0.02654	T	1	-21.0968	6.6356	0.22881	0.1454:0.7082:0.0:0.1464	.	425;379;408	B4E0L0;Q9BY77-2;Q9BY77	.;.;PDIP3_HUMAN	T	379;408	.	ENSP00000252115:A408T	A	-	1	0	POLDIP3	41311785	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.067000	0.41461	1.402000	0.46780	0.555000	0.69702	GCC		POLDIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320433.1	NM_032311	
RTBDN	83546	hgsc.bcm.edu	37	19	12940629	12940629	+	Silent	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:12940629C>A	ENST00000458671.2	-	2	317	c.165G>T	c.(163-165)ctG>ctT	p.L55L	RTBDN_ENST00000393233.2_Missense_Mutation_p.W14L|RTBDN_ENST00000592204.1_Silent_p.L65L|CTD-2265O21.3_ENST00000588469.1_RNA|RTBDN_ENST00000589272.1_Silent_p.L87L|RTBDN_ENST00000322912.5_Silent_p.L87L	NM_001080997.2	NP_001074466.1	Q9BSG5	RTBDN_HUMAN	retbindin	55						extracellular region (GO:0005576)		p.L87L(1)		kidney(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12						GCTCACCTGCCAGGTGCAGCT	0.597																																					p.L87L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G261T	19						.						56.0	41.0	46.0					19																	12940629		2203	4300	6503	12801629	SO:0001819	synonymous_variant	83546	exon3			AY028917	CCDS12283.1, CCDS45994.1, CCDS59355.1, CCDS59356.1	19p13	2006-03-22				ENSG00000132026			30310	protein-coding gene	gene with protein product		609553				12107411	Standard	NM_001080997		Approved	FLJ36353	uc002mvj.4	Q9BSG5		ENST00000458671.2:c.165G>T	19.37:g.12940629C>A		Somatic		Capture	SOLID	Phase_I	12801629	NM_031429	F1T0I8|Q9BWT5	Silent	SNP	ENST00000458671.2	37	CCDS45994.1	.	.	.	.	.	.	.	.	.	.	C	1.210	-0.629932	0.03610	.	.	ENSG00000132026	ENST00000393233	T	0.39997	1.05	3.74	0.239	0.15484	.	.	.	.	.	T	0.27313	0.0670	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23691	-1.0181	5	.	.	.	-37.5302	3.4597	0.07528	0.2125:0.5635:0.0:0.224	.	.	.	.	L	14	ENSP00000376925:W14L	.	W	-	2	0	RTBDN	12801629	0.022000	0.18835	0.005000	0.12908	0.017000	0.09413	-0.027000	0.12371	0.148000	0.19059	0.561000	0.74099	TGG		RTBDN-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000451513.1	NM_031429	
MAST1	22983	hgsc.bcm.edu	37	19	12979885	12979885	+	Missense_Mutation	SNP	C	C	A	rs200101413	byFrequency	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:12979885C>A	ENST00000251472.4	+	22	2818	c.2779C>A	c.(2779-2781)Cca>Aca	p.P927T		NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						TGTAGTGGACCCACATGGAAG	0.557																																					p.P927T												.	.	0			c.C2779A	19						.						125.0	83.0	97.0					19																	12979885		2203	4300	6503	12840885	SO:0001583	missense	22983	exon22			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.2779C>A	19.37:g.12979885C>A	ENSP00000251472:p.Pro927Thr	Somatic		Capture	SOLID	Phase_I	12840885	NM_014975		Missense_Mutation	SNP	ENST00000251472.4	37	CCDS32921.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.813605	0.32053	.	.	ENSG00000105613	ENST00000251472	T	0.63913	-0.07	5.01	5.01	0.66863	.	0.137478	0.49305	D	0.000152	T	0.44350	0.1289	N	0.08118	0	0.43047	D	0.994646	B	0.23185	0.081	B	0.29077	0.098	T	0.37619	-0.9698	10	0.22109	T	0.4	-12.5391	15.805	0.78491	0.0:1.0:0.0:0.0	.	927	Q9Y2H9	MAST1_HUMAN	T	927	ENSP00000251472:P927T	ENSP00000251472:P927T	P	+	1	0	MAST1	12840885	0.905000	0.30787	0.999000	0.59377	0.950000	0.60333	2.060000	0.41394	2.327000	0.79052	0.462000	0.41574	CCA		MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451733.2	NM_014975	
LPHN1	22859	hgsc.bcm.edu	37	19	14273615	14273615	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:14273615T>A	ENST00000340736.6	-	6	1310	c.1013A>T	c.(1012-1014)gAg>gTg	p.E338V	CTB-55O6.12_ENST00000592086.1_RNA|LPHN1_ENST00000591528.1_5'Flank|CTB-55O6.12_ENST00000588387.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.E333V	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	338	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GCCAGCCGCCTCGCTGTCATC	0.607																																					p.E333V												.	.	0			c.A998T	19						.						149.0	100.0	116.0					19																	14273615		2203	4300	6503	14134615	SO:0001583	missense	22859	exon5			AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.1013A>T	19.37:g.14273615T>A	ENSP00000340688:p.Glu338Val	Somatic		Capture	SOLID	Phase_I	14134615	NM_014921	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	37	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	T	16.26	3.074128	0.55646	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	D;D	0.90385	-2.66;-2.66	4.96	4.96	0.65561	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.94650	0.8275	M	0.78916	2.43	0.58432	D	0.999993	D;D	0.89917	0.999;1.0	D;D	0.87578	0.994;0.998	D	0.94692	0.7875	10	0.54805	T	0.06	.	12.5632	0.56295	0.0:0.0:0.0:1.0	.	333;338	O94910-2;O94910	.;LPHN1_HUMAN	V	338;333	ENSP00000340688:E338V;ENSP00000355328:E333V	ENSP00000340688:E338V	E	-	2	0	LPHN1	14134615	1.000000	0.71417	1.000000	0.80357	0.380000	0.30137	7.969000	0.87988	1.846000	0.53633	0.459000	0.35465	GAG		LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
OR10H1	26539	hgsc.bcm.edu	37	19	15918655	15918655	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:15918655C>T	ENST00000334920.2	-	1	281	c.193G>A	c.(193-195)Gcc>Acc	p.A65T		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	65			A -> V (in dbSNP:rs4808382).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A65T(1)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						ACGGAGAGGGCGCACAGGAAG	0.647																																					p.A65T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G193A	19						.						114.0	99.0	104.0					19																	15918655		2203	4297	6500	15779655	SO:0001583	missense	26539	exon1			AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.193G>A	19.37:g.15918655C>T	ENSP00000335596:p.Ala65Thr	Somatic		Capture	SOLID	Phase_I	15779655	NM_013940	Q6IFQ2|Q96R59	Missense_Mutation	SNP	ENST00000334920.2	37	CCDS12335.1	.	.	.	.	.	.	.	.	.	.	c	11.33	1.606025	0.28623	.	.	ENSG00000186723	ENST00000334920	T	0.03035	4.07	4.71	-0.5	0.12012	GPCR, rhodopsin-like superfamily (1);	0.271882	0.26200	N	0.025747	T	0.02267	0.0070	N	0.20610	0.595	0.25799	N	0.984534	B	0.17667	0.023	B	0.15484	0.013	T	0.44862	-0.9300	10	0.26408	T	0.33	.	7.5766	0.27939	0.0:0.4455:0.0:0.5545	.	65	Q9Y4A9	O10H1_HUMAN	T	65	ENSP00000335596:A65T	ENSP00000335596:A65T	A	-	1	0	OR10H1	15779655	0.186000	0.23225	0.946000	0.38457	0.504000	0.33889	0.241000	0.18065	-0.029000	0.13827	0.643000	0.83706	GCC		OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1		
TSHZ3	57616	hgsc.bcm.edu	37	19	31769490	31769490	+	Silent	SNP	G	G	T	rs375375661		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:31769490G>T	ENST00000240587.4	-	2	1536	c.1209C>A	c.(1207-1209)gcC>gcA	p.A403A		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	403					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CCATCATGTGGGCAGTGAGCT	0.562																																					p.A403A												.	.	0			c.C1209A	19						.						155.0	143.0	147.0					19																	31769490		2203	4300	6503	36461330	SO:0001819	synonymous_variant	57616	exon2			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1209C>A	19.37:g.31769490G>T		Somatic		Capture	SOLID	Phase_I	36461330	NM_020856	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	CCDS12421.2																																																																																				TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
KIAA0355	9710	hgsc.bcm.edu	37	19	34830830	34830830	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:34830830A>G	ENST00000299505.6	+	9	2293	c.1420A>G	c.(1420-1422)Aag>Gag	p.K474E		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	474										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					TGATCCTGAGAAGACCCTGGG	0.527																																					p.K474E												.	.	0			c.A1420G	19						.						307.0	268.0	281.0					19																	34830830		2203	4300	6503	39522670	SO:0001583	missense	9710	exon9				CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.1420A>G	19.37:g.34830830A>G	ENSP00000299505:p.Lys474Glu	Somatic		Capture	SOLID	Phase_I	39522670	NM_014686	Q2M3W4	Missense_Mutation	SNP	ENST00000299505.6	37	CCDS12436.1	.	.	.	.	.	.	.	.	.	.	A	29.6	5.021577	0.93462	.	.	ENSG00000166398	ENST00000299505;ENST00000543188	T	0.52983	0.64	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.55289	0.1911	N	0.24115	0.695	0.80722	D	1	D	0.67145	0.996	D	0.76071	0.987	T	0.61446	-0.7061	10	0.87932	D	0	-19.5774	15.0848	0.72142	1.0:0.0:0.0:0.0	.	474	O15063	K0355_HUMAN	E	474;177	ENSP00000299505:K474E	ENSP00000299505:K474E	K	+	1	0	KIAA0355	39522670	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.684000	0.91242	2.038000	0.60285	0.533000	0.62120	AAG		KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686	
DMKN	93099	hgsc.bcm.edu	37	19	35991457	35991457	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:35991457T>A	ENST00000339686.3	-	12	1441	c.1265A>T	c.(1264-1266)aAa>aTa	p.K422I	DMKN_ENST00000436012.1_Missense_Mutation_p.K118I|DMKN_ENST00000402589.2_Missense_Mutation_p.K135I|DMKN_ENST00000480502.1_Missense_Mutation_p.K116I|DMKN_ENST00000408915.2_Missense_Mutation_p.K36I|DMKN_ENST00000492341.2_Missense_Mutation_p.K69I|DMKN_ENST00000467637.1_Missense_Mutation_p.K147I|DMKN_ENST00000429837.1_Missense_Mutation_p.K381I|DMKN_ENST00000419602.1_Missense_Mutation_p.K411I|DMKN_ENST00000602781.1_Missense_Mutation_p.K135I|DMKN_ENST00000472252.2_Missense_Mutation_p.K69I|DMKN_ENST00000414866.2_Missense_Mutation_p.K135I|DMKN_ENST00000462126.1_5'UTR|DMKN_ENST00000443640.1_Missense_Mutation_p.K185I	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	422						extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.K422I(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GCCTGCACGTTTCTGCAGTGA	0.607																																					p.K422I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1265T	19						.						80.0	52.0	62.0					19																	35991457		2203	4300	6503	40683297	SO:0001583	missense	93099	exon12			BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.1265A>T	19.37:g.35991457T>A	ENSP00000342012:p.Lys422Ile	Somatic		Capture	SOLID	Phase_I	40683297	NM_033317	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	37	CCDS12463.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	17.67|17.67|17.67	3.445991|3.445991|3.445991	0.63178|0.63178|0.63178	.|.|.	.|.|.	ENSG00000161249|ENSG00000161249|ENSG00000161249	ENST00000434389|ENST00000408915;ENST00000402589;ENST00000339686;ENST00000436012;ENST00000414866;ENST00000429837;ENST00000419602;ENST00000443640|ENST00000443857	.|T;T;T;T;T;T;T;T|.	.|0.60920|.	.|0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15|.	4.11|4.11|4.11	1.93|1.93|1.93	0.25924|0.25924|0.25924	.|.|.	.|0.000000|.	.|0.44285|.	.|D|.	.|0.000478|.	T|T|T	0.53786|0.53786|0.53786	0.1818|0.1818|0.1818	L|L|L	0.54323|0.54323|0.54323	1.7|1.7|1.7	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D;D;P;P;D;D;D;D;P;P;D|.	.|0.71674|.	.|0.99;0.99;0.96;0.944;0.944;0.98;0.998;0.998;0.995;0.944;0.944;0.995|.	.|P;P;P;P;P;P;P;P;P;P;P;P|.	.|0.62491|.	.|0.814;0.814;0.748;0.714;0.714;0.814;0.903;0.903;0.891;0.714;0.714;0.891|.	T|T|T	0.43376|0.43376|0.43376	-0.9395|-0.9395|-0.9395	5|10|5	.|0.87932|.	.|D|.	.|0|.	-7.7226|-7.7226|-7.7226	4.539|4.539|4.539	0.12047|0.12047|0.12047	0.0:0.1056:0.1952:0.6992|0.0:0.1056:0.1952:0.6992|0.0:0.1056:0.1952:0.6992	.|.|.	.|118;69;78;78;98;116;411;381;422;135;185;36|.	.|B4E3D1;B7ZB10;Q6E0U4-12;Q6E0U4-11;Q6E0U4-10;Q6E0U4-9;C9J4P6;Q6E0U4-4;Q6E0U4;Q6E0U4-8;C9IYI1;Q6E0U4-15|.	.|.;.;.;.;.;.;.;.;DMKN_HUMAN;.;.;.|.	D|I|Y	132|36;135;422;118;135;381;411;185|126	.|ENSP00000386225:K36I;ENSP00000384509:K135I;ENSP00000342012:K422I;ENSP00000412075:K118I;ENSP00000392222:K135I;ENSP00000405503:K381I;ENSP00000391036:K411I;ENSP00000406864:K185I|.	.|ENSP00000342012:K422I|.	E|K|N	-|-|-	3|2|1	2|0|0	DMKN|DMKN|DMKN	40683297|40683297|40683297	0.998000|0.998000|0.998000	0.40836|0.40836|0.40836	0.944000|0.944000|0.944000	0.38274|0.38274|0.38274	0.052000|0.052000|0.052000	0.14988|0.14988|0.14988	1.145000|1.145000|1.145000	0.31577|0.31577|0.31577	0.214000|0.214000|0.214000	0.20742|0.20742|0.20742	0.358000|0.358000|0.358000	0.22013|0.22013|0.22013	GAA|AAA|AAC		DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
DMKN	93099	hgsc.bcm.edu	37	19	36004170	36004170	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:36004170C>T	ENST00000339686.3	-	1	384	c.208G>A	c.(208-210)Gcc>Acc	p.A70T	DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000451297.2_Missense_Mutation_p.A70T|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000424570.2_Missense_Mutation_p.A70T|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000429837.1_Missense_Mutation_p.A70T|DMKN_ENST00000447113.2_Missense_Mutation_p.A70T|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000440396.1_Missense_Mutation_p.A70T|DMKN_ENST00000419602.1_Missense_Mutation_p.A70T|DMKN_ENST00000418261.1_Missense_Mutation_p.A70T|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000488892.1_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	70	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.A70T(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TGGCCAAGGGCCTCACTGACT	0.627																																					p.A70T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G208A	19						.						132.0	110.0	117.0					19																	36004170		2203	4300	6503	40696010	SO:0001583	missense	93099	exon1			BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.208G>A	19.37:g.36004170C>T	ENSP00000342012:p.Ala70Thr	Somatic		Capture	SOLID	Phase_I	40696010	NM_033317	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	37	CCDS12463.1	.	.	.	.	.	.	.	.	.	.	C	7.686	0.690050	0.15039	.	.	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000429837;ENST00000419602;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T;T;T	0.37584	1.82;1.65;1.58;1.19;1.19;1.26;1.28;1.32	2.87	0.578	0.17391	.	0.000000	0.36555	N	0.002537	T	0.17831	0.0428	N	0.12961	0.28	0.09310	N	1	B;B;B;B;B;B;B	0.24576	0.004;0.106;0.106;0.004;0.002;0.004;0.004	B;B;B;B;B;B;B	0.20384	0.002;0.029;0.029;0.002;0.002;0.002;0.002	T	0.14227	-1.0480	10	0.51188	T	0.08	-1.0189	6.5597	0.22479	0.0:0.7309:0.0:0.2691	.	70;70;70;70;70;70;70	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;C9J4P6;Q6E0U4-4;Q6E0U4	.;.;.;.;.;.;DMKN_HUMAN	T	70	ENSP00000342012:A70T;ENSP00000405503:A70T;ENSP00000391036:A70T;ENSP00000394908:A70T;ENSP00000415277:A70T;ENSP00000414743:A70T;ENSP00000388404:A70T;ENSP00000409513:A70T	ENSP00000342012:A70T	A	-	1	0	DMKN	40696010	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	0.236000	0.17967	0.350000	0.24002	-0.556000	0.04195	GCC		DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
ATP4A	495	hgsc.bcm.edu	37	19	36042389	36042389	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:36042389T>C	ENST00000262623.3	-	19	2873	c.2845A>G	c.(2845-2847)Aag>Gag	p.K949E		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	949					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)	p.K949E(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	CGGCGCGTCTTGCGGATGAGG	0.602																																					p.K949E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2845G	19						.						113.0	83.0	93.0					19																	36042389		2203	4300	6503	40734229	SO:0001583	missense	495	exon19				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.2845A>G	19.37:g.36042389T>C	ENSP00000262623:p.Lys949Glu	Somatic		Capture	SOLID	Phase_I	40734229	NM_000704	O00738	Missense_Mutation	SNP	ENST00000262623.3	37	CCDS12467.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.066776	0.76301	.	.	ENSG00000105675	ENST00000262623	D	0.96011	-3.88	5.03	5.03	0.67393	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.64402	D	0.000002	D	0.98201	0.9405	H	0.94462	3.54	0.58432	D	0.999999	D	0.76494	0.999	D	0.91635	0.999	D	0.99133	1.0853	10	0.87932	D	0	.	12.7579	0.57345	0.0:0.0:0.0:1.0	.	949	P20648	ATP4A_HUMAN	E	949	ENSP00000262623:K949E	ENSP00000262623:K949E	K	-	1	0	ATP4A	40734229	1.000000	0.71417	1.000000	0.80357	0.475000	0.33008	7.868000	0.87116	2.120000	0.65058	0.260000	0.18958	AAG		ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
APLP1	333	hgsc.bcm.edu	37	19	36362176	36362176	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:36362176A>C	ENST00000221891.4	+	4	654	c.462A>C	c.(460-462)gaA>gaC	p.E154D	APLP1_ENST00000537454.2_Missense_Mutation_p.E115D|NPHS1_ENST00000591817.1_5'Flank|APLP1_ENST00000586861.1_Missense_Mutation_p.E148D	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	154					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)	p.E154D(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGGTGCCTGAAGGCTGCCGGT	0.617																																					p.E154D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A462C	19						.						84.0	67.0	73.0					19																	36362176		2203	4299	6502	41054016	SO:0001583	missense	333	exon4			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.462A>C	19.37:g.36362176A>C	ENSP00000221891:p.Glu154Asp	Somatic		Capture	SOLID	Phase_I	41054016	NM_001024807	O00113|Q96A92	Missense_Mutation	SNP	ENST00000221891.4	37	CCDS32997.1	.	.	.	.	.	.	.	.	.	.	a	12.52	1.961648	0.34659	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	D;D	0.94417	-3.3;-3.42	4.76	1.51	0.23008	Amyloidogenic glycoprotein, extracellular (1);Amyloidogenic glycoprotein, heparin-binding (1);Amyloidogenic glycoprotein, copper-binding (2);	0.000000	0.45361	D	0.000377	D	0.91965	0.7455	N	0.25647	0.755	0.33411	D	0.578674	D;P;B;B	0.76494	0.999;0.597;0.337;0.389	D;B;B;B	0.80764	0.994;0.166;0.079;0.129	D	0.88276	0.2933	10	0.13470	T	0.59	-12.6516	3.9896	0.09532	0.5462:0.1825:0.2713:0.0	.	148;115;154;154	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	D	115;154	ENSP00000441501:E115D;ENSP00000221891:E154D	ENSP00000221891:E154D	E	+	3	2	APLP1	41054016	0.790000	0.28787	0.997000	0.53966	0.983000	0.72400	0.333000	0.19768	0.684000	0.31448	0.392000	0.25879	GAA		APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1	NM_001024807	
CLIP3	25999	hgsc.bcm.edu	37	19	36517553	36517553	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:36517553T>C	ENST00000360535.4	-	5	724	c.497A>G	c.(496-498)cAc>cGc	p.H166R	CLIP3_ENST00000593074.1_Missense_Mutation_p.H166R|AC002116.7_ENST00000586962.1_RNA	NM_015526.2	NP_056341.1	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	166					chaperone-mediated protein transport (GO:0072321)|fat cell differentiation (GO:0045444)|membrane biogenesis (GO:0044091)|negative regulation of microtubule polymerization (GO:0031115)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein phosphorylation (GO:0001934)	early endosome membrane (GO:0031901)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)|trans-Golgi network membrane (GO:0032588)	ganglioside binding (GO:0035594)|microtubule binding (GO:0008017)	p.H166R(1)		cervix(1)|endometrium(6)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	23	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GGCCGCGTAGTGAAGCGCGTT	0.692																																					p.H166R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A497G	19						.						59.0	47.0	51.0					19																	36517553		2203	4300	6503	41209393	SO:0001583	missense	25999	exon4			AJ427922	CCDS12486.1	19q13.12	2014-08-12			ENSG00000105270	ENSG00000105270		"""Ankyrin repeat domain containing"""	24314	protein-coding gene	gene with protein product	"""CLIP-170-related"", ""restin-like 1"""	607382				11854307	Standard	NM_015526		Approved	CLIPR-59, RSNL1	uc002ocz.2	Q96DZ5	OTTHUMG00000181747	ENST00000360535.4:c.497A>G	19.37:g.36517553T>C	ENSP00000353732:p.His166Arg	Somatic		Capture	SOLID	Phase_I	41209393	NM_001199570	A8K0E4|Q8WWL1|Q96C99|Q9UFT7	Missense_Mutation	SNP	ENST00000360535.4	37	CCDS12486.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.651308	0.88056	.	.	ENSG00000105270	ENST00000360535;ENST00000544037;ENST00000534959	T	0.71341	-0.56	4.76	4.76	0.60689	Ankyrin repeat-containing domain (4);	0.054441	0.64402	D	0.000001	T	0.74854	0.3771	M	0.88105	2.93	0.58432	D	0.999996	B	0.34181	0.44	B	0.34722	0.188	T	0.78738	-0.2087	10	0.59425	D	0.04	-27.881	12.2682	0.54691	0.0:0.0:0.0:1.0	.	166	Q96DZ5	CLIP3_HUMAN	R	166;48;142	ENSP00000353732:H166R	ENSP00000353732:H166R	H	-	2	0	CLIP3	41209393	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.609000	0.82925	1.995000	0.58328	0.374000	0.22700	CAC		CLIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457426.1	NM_015526	
ZNF540	163255	hgsc.bcm.edu	37	19	38103591	38103591	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:38103591G>T	ENST00000592533.1	+	5	1742	c.1410G>T	c.(1408-1410)aaG>aaT	p.K470N	ZNF540_ENST00000589117.1_Missense_Mutation_p.K438N|ZNF540_ENST00000316433.4_Missense_Mutation_p.K470N|ZNF540_ENST00000343599.5_Missense_Mutation_p.K470N	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	470					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ACGAATGTAAGGAATGTGGGA	0.413																																					p.K470N												.	.	0			c.G1410T	19						.						94.0	89.0	91.0					19																	38103591		2203	4300	6503	42795431	SO:0001583	missense	163255	exon5			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.1410G>T	19.37:g.38103591G>T	ENSP00000466274:p.Lys470Asn	Somatic		Capture	SOLID	Phase_I	42795431	NM_152606	A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Missense_Mutation	SNP	ENST00000592533.1	37	CCDS12506.1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.504995	0.26949	.	.	ENSG00000171817	ENST00000316433;ENST00000343599	T	0.08546	3.08	2.32	-0.541	0.11858	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02929	0.0087	N	0.03324	-0.35	0.22880	N	0.998612	B;B	0.19935	0.032;0.04	B;B	0.23716	0.028;0.048	T	0.48896	-0.8994	9	0.11485	T	0.65	.	4.9575	0.14050	0.0:0.1799:0.2901:0.5301	.	438;470	Q8NDQ6-2;Q8NDQ6	.;ZN540_HUMAN	N	470;438	ENSP00000324598:K470N	ENSP00000324598:K470N	K	+	3	2	ZNF540	42795431	0.000000	0.05858	0.991000	0.47740	0.489000	0.33432	-2.901000	0.00704	0.253000	0.21552	0.305000	0.20034	AAG		ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459481.1	NM_152606	
DYRK1B	9149	hgsc.bcm.edu	37	19	40318995	40318995	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:40318995G>C	ENST00000593685.1	-	6	1217	c.749C>G	c.(748-750)cCc>cGc	p.P250R	DYRK1B_ENST00000323039.5_Missense_Mutation_p.P250R|DYRK1B_ENST00000430012.2_Missense_Mutation_p.P250R|DYRK1B_ENST00000597639.1_Missense_Mutation_p.P250R|DYRK1B_ENST00000348817.3_Missense_Mutation_p.P250R			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	250	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)	p.P250R(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			GCTGCGCTTGGGGTTGCACAG	0.622																																					p.P250R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C749G	19						.						65.0	54.0	58.0					19																	40318995		2203	4300	6503	45010835	SO:0001583	missense	9149	exon6			Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.749C>G	19.37:g.40318995G>C	ENSP00000469863:p.Pro250Arg	Somatic		Capture	SOLID	Phase_I	45010835	NM_006483	O75258|O75788|O75789	Missense_Mutation	SNP	ENST00000593685.1	37	CCDS12543.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.448100	0.84101	.	.	ENSG00000105204	ENST00000323039;ENST00000348817;ENST00000430012	T;T;T	0.20069	2.1;2.1;2.1	5.95	5.95	0.96441	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.43344	0.1243	M	0.62209	1.925	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.999	D;D;D	0.85130	0.986;0.997;0.991	T	0.05084	-1.0907	10	0.15952	T	0.53	.	17.8657	0.88794	0.0:0.0:1.0:0.0	.	250;250;250	Q9Y463-2;Q9Y463;Q9Y463-3	.;DYR1B_HUMAN;.	R	250	ENSP00000312789:P250R;ENSP00000221803:P250R;ENSP00000403182:P250R	ENSP00000312789:P250R	P	-	2	0	DYRK1B	45010835	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.841000	0.99482	2.826000	0.97356	0.491000	0.48974	CCC		DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462874.2	NM_004714	
FCGBP	8857	hgsc.bcm.edu	37	19	40433972	40433972	+	Silent	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:40433972T>G	ENST00000221347.6	-	2	304	c.297A>C	c.(295-297)atA>atC	p.I99I		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	99	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TCTTGCTGCCTATCATCTCAG	0.552																																					p.I99I												.	.	0			c.A297C	19						.						149.0	117.0	128.0					19																	40433972		2203	4300	6503	45125812	SO:0001819	synonymous_variant	8857	exon2			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.297A>C	19.37:g.40433972T>G		Somatic		Capture	SOLID	Phase_I	45125812	NM_003890	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																				FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
AKT2	208	hgsc.bcm.edu	37	19	40739823	40739823	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:40739823T>A	ENST00000392038.2	-	14	1700	c.1402A>T	c.(1402-1404)Acc>Tcc	p.T468S	AKT2_ENST00000311278.6_Missense_Mutation_p.T425S|AKT2_ENST00000424901.1_Missense_Mutation_p.T468S	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	468	AGC-kinase C-terminal.				activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)	p.T468S(1)		breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			GGGAAGTGGGTCCGCTGGTCC	0.647			A		"""ovarian, pancreatic """																																p.T468S			Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1402T	19						.						108.0	75.0	86.0					19																	40739823		2203	4300	6503	45431663	SO:0001583	missense	208	exon14			M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.1402A>T	19.37:g.40739823T>A	ENSP00000375892:p.Thr468Ser	Somatic		Capture	SOLID	Phase_I	45431663	NM_001626	B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Missense_Mutation	SNP	ENST00000392038.2	37	CCDS12552.1	.	.	.	.	.	.	.	.	.	.	T	14.93	2.681316	0.47991	.	.	ENSG00000105221	ENST00000392038;ENST00000391844;ENST00000424901;ENST00000311278	T;T;T	0.56444	0.46;0.46;0.46	5.38	3.24	0.37175	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.173564	0.49305	D	0.000148	T	0.34716	0.0907	L	0.35487	1.065	0.35006	D	0.756403	B;B	0.13145	0.007;0.0	B;B	0.16722	0.016;0.0	T	0.30534	-0.9975	10	0.37606	T	0.19	.	2.5416	0.04727	0.1516:0.0826:0.1578:0.6081	.	425;468	Q0VAN0;P31751	.;AKT2_HUMAN	S	468;369;468;425	ENSP00000375892:T468S;ENSP00000399532:T468S;ENSP00000309428:T425S	ENSP00000309428:T425S	T	-	1	0	AKT2	45431663	0.881000	0.30235	0.977000	0.42913	0.946000	0.59487	0.582000	0.23834	0.828000	0.34709	0.254000	0.18369	ACC		AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268029.1	NM_001626	
ARHGEF1	9138	hgsc.bcm.edu	37	19	42398368	42398368	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:42398368T>C	ENST00000354532.3	+	9	881	c.733T>C	c.(733-735)Ttc>Ctc	p.F245L	ARHGEF1_ENST00000378152.4_Missense_Mutation_p.F227L|ARHGEF1_ENST00000337665.4_Missense_Mutation_p.F260L|ARHGEF1_ENST00000347545.4_Missense_Mutation_p.F212L|ARHGEF1_ENST00000599846.1_Missense_Mutation_p.F245L	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	245					cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		GAGGAACTTCTTCCGGAAAAA	0.582																																					p.F212L												.	.	0			c.T634C	19						.						100.0	67.0	78.0					19																	42398368		2203	4299	6502	47090208	SO:0001583	missense	9138	exon8			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.733T>C	19.37:g.42398368T>C	ENSP00000346532:p.Phe245Leu	Somatic		Capture	SOLID	Phase_I	47090208	NM_198977	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Missense_Mutation	SNP	ENST00000354532.3	37	CCDS12591.1	.	.	.	.	.	.	.	.	.	.	T	15.94	2.979796	0.53827	.	.	ENSG00000076928	ENST00000354532;ENST00000347545;ENST00000316079;ENST00000337665;ENST00000378152	T;T;T;T	0.73469	-0.08;-0.5;-0.09;-0.75	3.95	3.95	0.45737	.	0.161101	0.41001	D	0.000967	T	0.62122	0.2402	L	0.29908	0.895	0.40756	D	0.982965	B;B;B;B;B	0.18610	0.0;0.001;0.001;0.002;0.029	B;B;B;B;B	0.17433	0.002;0.004;0.002;0.004;0.018	T	0.62709	-0.6797	10	0.52906	T	0.07	-18.2093	11.1231	0.48302	0.0:0.0:0.0:1.0	.	227;260;212;245;305	Q6NX52;Q92888-3;Q92888-2;Q92888;Q8NF33	.;.;.;ARHG1_HUMAN;.	L	245;212;281;260;227	ENSP00000346532:F245L;ENSP00000344429:F212L;ENSP00000337261:F260L;ENSP00000367394:F227L	ENSP00000323044:F281L	F	+	1	0	ARHGEF1	47090208	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.275000	0.65575	1.789000	0.52484	0.403000	0.27427	TTC		ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000463360.1	NM_199002	
KCNN4	3783	hgsc.bcm.edu	37	19	44276191	44276191	+	Silent	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:44276191G>T	ENST00000262888.3	-	4	1175	c.780C>A	c.(778-780)acC>acA	p.T260T		NM_002250.2	NP_002241.1	O15554	KCNN4_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4	260					calcium ion transport (GO:0006816)|cell volume homeostasis (GO:0006884)|defense response (GO:0006952)|immune system process (GO:0002376)|phospholipid translocation (GO:0045332)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell receptor signaling pathway (GO:0050862)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|saliva secretion (GO:0046541)|stabilization of membrane potential (GO:0030322)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|Intermediate conductance calcium-activated potassium channel activity (GO:0022894)|protein phosphatase binding (GO:0019903)	p.T260T(1)		biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0352)			Clotrimazole(DB00257)|Enflurane(DB00228)|Halothane(DB01159)|Miconazole(DB01110)|Procaine(DB00721)|Quinine(DB00468)	TGCCCCACATGGTGCCCGGCA	0.567																																					p.T260T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C780A	19						.						152.0	115.0	127.0					19																	44276191		2203	4300	6503	48968031	SO:0001819	synonymous_variant	3783	exon4			AF022797	CCDS12630.1	19q13.2	2012-07-05				ENSG00000104783		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6293	protein-coding gene	gene with protein product		602754				9380751, 9407042, 16382103	Standard	NM_002250		Approved	KCa3.1, hSK4, hKCa4, hIKCa1	uc002oxl.3	O15554		ENST00000262888.3:c.780C>A	19.37:g.44276191G>T		Somatic		Capture	SOLID	Phase_I	48968031	NM_002250	Q53XR4	Silent	SNP	ENST00000262888.3	37	CCDS12630.1																																																																																				KCNN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463598.1	NM_002250	
ERCC2	2068	hgsc.bcm.edu	37	19	45855838	45855838	+	Missense_Mutation	SNP	G	G	A	rs121913021		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:45855838G>A	ENST00000391945.4	-	21	2049	c.1972C>T	c.(1972-1974)Cgc>Tgc	p.R658C	ERCC2_ENST00000391944.3_Missense_Mutation_p.R580C	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	658			R -> C (in TTDP). {ECO:0000269|PubMed:11242112, ECO:0000269|PubMed:8571952}.|R -> G (in TTDP).|R -> H (in TTDP).		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.R658C(1)		large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GCCGCGTGGCGCATGGCATCG	0.612			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.R658C		yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1972T	19	GRCh37	CM013903|CM960514	ERCC2	M	rs121913021	.						63.0	55.0	57.0					19																	45855838		2203	4300	6503	50547678	SO:0001583	missense	2068	exon21	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.1972C>T	19.37:g.45855838G>A	ENSP00000375809:p.Arg658Cys	Somatic		Capture	SOLID	Phase_I	50547678	NM_000400	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.906529	0.72868	.	.	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944	D;D	0.93659	-3.26;-3.26	5.63	5.63	0.86233	Helicase, ATP-dependent, c2 type (1);	0.056254	0.64402	D	0.000001	D	0.98197	0.9404	H	0.99454	4.575	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98583	1.0651	10	0.87932	D	0	-29.3517	12.1615	0.54107	0.0:0.0:0.8291:0.1708	.	580;658;351	E7EVE9;P18074;Q6ZNQ5	.;ERCC2_HUMAN;.	C	608;634;658;580	ENSP00000375809:R658C;ENSP00000375808:R580C	ENSP00000375805:R608C	R	-	1	0	ERCC2	50547678	1.000000	0.71417	1.000000	0.80357	0.384000	0.30261	5.532000	0.67154	2.655000	0.90218	0.462000	0.41574	CGC		ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
RSPH6A	81492	hgsc.bcm.edu	37	19	46318216	46318216	+	Silent	SNP	C	C	T	rs61730712	byFrequency	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:46318216C>T	ENST00000221538.3	-	1	361	c.219G>A	c.(217-219)caG>caA	p.Q73Q	RSPH6A_ENST00000597055.1_Silent_p.Q73Q|SYMPK_ENST00000598155.1_5'Flank	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	73						intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						CCTGGAAGACCTGGGGCATCA	0.602													C|||	19	0.00379393	0.0008	0.0029	5008	,	,		16738	0.0		0.0119	False		,,,				2504	0.0041				p.Q73Q												.	.	0			c.G219A	19						.	C		9,4397	14.3+/-33.2	0,9,2194	52.0	47.0	49.0		219	0.4	0.0	19	dbSNP_129	49	138,8462	67.0+/-129.4	3,132,4165	no	coding-synonymous	RSPH6A	NM_030785.3		3,141,6359	TT,TC,CC		1.6047,0.2043,1.1302		73/718	46318216	147,12859	2203	4300	6503	51010056	SO:0001819	synonymous_variant	81492	exon1			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.219G>A	19.37:g.46318216C>T		Somatic		Capture	SOLID	Phase_I	51010056	NM_030785	Q53FE2|Q6PEZ9	Silent	SNP	ENST00000221538.3	37	CCDS12675.1																																																																																				RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1		
FKRP	79147	hgsc.bcm.edu	37	19	47259912	47259912	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:47259912T>A	ENST00000318584.5	+	4	1502	c.1205T>A	c.(1204-1206)tTt>tAt	p.F402Y	FKRP_ENST00000600646.1_Intron|FKRP_ENST00000391909.3_Missense_Mutation_p.F402Y	NM_001039885.2|NM_024301.4	NP_001034974.1|NP_077277.1	Q9H9S5	FKRP_HUMAN	fukutin related protein	402					glycoprotein biosynthetic process (GO:0009101)|protein processing (GO:0016485)	dystrophin-associated glycoprotein complex (GO:0016010)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)	transferase activity (GO:0016740)	p.F402Y(1)		NS(1)|large_intestine(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7		all_epithelial(76;5.08e-05)|Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000541)|all cancers(93;0.00128)|Epithelial(262;0.0207)|GBM - Glioblastoma multiforme(486;0.0336)		GAGGGCGACTTTTTCCGCGTG	0.642																																					p.F402Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1205A	19						.						103.0	59.0	74.0					19																	47259912		2203	4299	6502	51951752	SO:0001583	missense	79147	exon4			AJ314847	CCDS12691.1	19q13.32	2014-09-17			ENSG00000181027	ENSG00000181027			17997	protein-coding gene	gene with protein product		606596				11592034, 11741828	Standard	NM_024301		Approved	LGMD2I, MDC1C	uc002pfp.2	Q9H9S5		ENST00000318584.5:c.1205T>A	19.37:g.47259912T>A	ENSP00000326570:p.Phe402Tyr	Somatic		Capture	SOLID	Phase_I	51951752	NM_024301	A8K5G7	Missense_Mutation	SNP	ENST00000318584.5	37	CCDS12691.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.088937	0.76756	.	.	ENSG00000181027	ENST00000391909;ENST00000318584	D;D	0.99586	-6.23;-6.23	5.15	5.15	0.70609	.	0.053759	0.85682	D	0.000000	D	0.99133	0.9701	L	0.31664	0.95	0.58432	D	0.999993	D	0.63880	0.993	D	0.74674	0.984	D	0.99368	1.0919	10	0.49607	T	0.09	-13.0675	13.9511	0.64118	0.0:0.0:0.0:1.0	.	402	Q9H9S5	FKRP_HUMAN	Y	402	ENSP00000375776:F402Y;ENSP00000326570:F402Y	ENSP00000326570:F402Y	F	+	2	0	FKRP	51951752	1.000000	0.71417	1.000000	0.80357	0.454000	0.32378	7.771000	0.85420	1.954000	0.56735	0.254000	0.18369	TTT		FKRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465473.1	NM_024301	
TULP2	7288	hgsc.bcm.edu	37	19	49384359	49384359	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:49384359C>T	ENST00000221399.3	-	13	1616	c.1472G>A	c.(1471-1473)gGc>gAc	p.G491D		NM_003323.2	NP_003314.2	O00295	TULP2_HUMAN	tubby like protein 2	491					visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	protein complex binding (GO:0032403)	p.G491D(1)		NS(1)|breast(2)|central_nervous_system(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	22		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		GCCCACTCGGCCGAACTGGAG	0.493																																					p.G491D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1472A	19						.						86.0	84.0	84.0					19																	49384359		2203	4300	6503	54076171	SO:0001583	missense	7288	exon13			U82469	CCDS12739.1	19q13.1	2009-08-06			ENSG00000104804	ENSG00000104804			12424	protein-coding gene	gene with protein product	"""cancer/testis antigen 65"""	602309				9096357	Standard	NM_003323		Approved	TUBL2, CT65	uc002pkz.2	O00295	OTTHUMG00000164406	ENST00000221399.3:c.1472G>A	19.37:g.49384359C>T	ENSP00000221399:p.Gly491Asp	Somatic		Capture	SOLID	Phase_I	54076171	NM_003323	Q8TC50	Missense_Mutation	SNP	ENST00000221399.3	37	CCDS12739.1	.	.	.	.	.	.	.	.	.	.	C	16.85	3.236560	0.58886	.	.	ENSG00000104804	ENST00000221399;ENST00000522341	D;D	0.96459	-4.02;-4.02	4.67	4.67	0.58626	Tubby, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.98588	0.9528	H	0.94734	3.575	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99640	1.0988	10	0.87932	D	0	-26.0646	15.4528	0.75285	0.0:1.0:0.0:0.0	.	491	O00295	TULP2_HUMAN	D	491;51	ENSP00000221399:G491D;ENSP00000429131:G51D	ENSP00000221399:G491D	G	-	2	0	TULP2	54076171	1.000000	0.71417	0.997000	0.53966	0.053000	0.15095	7.167000	0.77562	2.321000	0.78463	0.655000	0.94253	GGC		TULP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378633.1	NM_003323	
PPFIA3	8541	hgsc.bcm.edu	37	19	49637103	49637103	+	Silent	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:49637103C>T	ENST00000334186.4	+	10	1561	c.1212C>T	c.(1210-1212)gcC>gcT	p.A404A	PPFIA3_ENST00000602351.1_Silent_p.A404A	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	404					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		AGCTGGAGGCCCAGCTGGAAG	0.597																																					p.A404A												.	.	0			c.C1212T	19						.						31.0	33.0	32.0					19																	49637103		2203	4300	6503	54328915	SO:0001819	synonymous_variant	8541	exon10			AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.1212C>T	19.37:g.49637103C>T		Somatic		Capture	SOLID	Phase_I	54328915	NM_003660	A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Silent	SNP	ENST00000334186.4	37	CCDS12758.1																																																																																				PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1	NM_003660	
KLK2	3817	hgsc.bcm.edu	37	19	51378099	51378099	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:51378099C>A	ENST00000325321.3	+	2	394	c.169C>A	c.(169-171)Ccc>Acc	p.P57T	AC037199.1_ENST00000594218.1_5'Flank|KLK2_ENST00000391810.2_Intron|KLK2_ENST00000597509.1_3'UTR|KLK2_ENST00000358049.4_Missense_Mutation_p.P57T			P20151	KLK2_HUMAN	kallikrein-related peptidase 2	57	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)	p.P57T(2)|p.P57S(1)	KLK2/ETV1(3)|KLK2/ETV4(2)	large_intestine(3)|lung(6)|ovary(1)|skin(1)	11		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)		CCTGGTGCACCCCCAGTGGGT	0.587			T	ETV4	prostate																																p.P57T			Dom	yes		19	19q13.41	3817	kallikrein-related peptidase 2		E	KLK2,skin,NS,Substitution - Missense,0	.	3	Substitution - Missense(3)	large_intestine(2)|skin(1)	c.C169A	19						.						69.0	57.0	61.0					19																	51378099		2203	4300	6503	56069911	SO:0001583	missense	3817	exon2			M18157	CCDS12808.1, CCDS42597.1, CCDS58675.1	19q13.33	2008-02-05	2006-10-27				3.4.21.35	"""Kallikreins"""	6363	protein-coding gene	gene with protein product		147960	"""kallikrein 2, prostatic"""			2468530, 16800724, 16800723	Standard	NM_005551		Approved		uc002ptv.3	P20151		ENST00000325321.3:c.169C>A	19.37:g.51378099C>A	ENSP00000313581:p.Pro57Thr	Somatic		Capture	SOLID	Phase_I	56069911	NM_001002231	B4DU93|B4DUB0|F5H8L3|Q15946|Q9UJZ9	Missense_Mutation	SNP	ENST00000325321.3	37	CCDS12808.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.416849	0.42918	.	.	ENSG00000167751	ENST00000325321;ENST00000358049	T;T	0.07908	3.15;3.15	2.62	1.5	0.22942	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.20455	0.0492	L	0.58925	1.835	0.09310	N	0.999996	D;D	0.69078	0.997;0.995	D;P	0.66351	0.943;0.878	T	0.05419	-1.0886	9	0.62326	D	0.03	.	9.3247	0.37986	0.0:0.7756:0.2244:0.0	.	57;57	P20151-2;P20151	.;KLK2_HUMAN	T	57	ENSP00000313581:P57T;ENSP00000350748:P57T	ENSP00000313581:P57T	P	+	1	0	KLK2	56069911	0.043000	0.20138	0.006000	0.13384	0.957000	0.61999	2.250000	0.43178	0.352000	0.24053	0.442000	0.29010	CCC		KLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464438.3	NM_005551.3	
SIGLEC12	89858	hgsc.bcm.edu	37	19	52003376	52003376	+	Silent	SNP	T	T	C	rs369537239		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:52003376T>C	ENST00000291707.3	-	2	661	c.606A>G	c.(604-606)ccA>ccG	p.P202P	SIGLEC12_ENST00000598614.1_Silent_p.P84P	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	202	Ig-like V-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TTGTGGCCACTGGAATATCCC	0.537																																					p.P84P												.	.	0			c.A252G	19						.						147.0	132.0	137.0					19																	52003376		2203	4300	6503	56695188	SO:0001819	synonymous_variant	89858	exon1			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.606A>G	19.37:g.52003376T>C		Somatic		Capture	SOLID	Phase_I	56695188	NM_033329	Q8IYH7	Silent	SNP	ENST00000291707.3	37	CCDS12833.1																																																																																				SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003	
ZNF350	59348	hgsc.bcm.edu	37	19	52468900	52468900	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:52468900T>G	ENST00000243644.4	-	5	1033	c.806A>C	c.(805-807)aAa>aCa	p.K269T	ZNF350_ENST00000600703.1_5'Flank|HCCAT3_ENST00000595010.1_RNA|HCCAT3_ENST00000600253.1_RNA	NM_021632.3	NP_067645.3	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	269					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E266fs*20(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		GAGAAAGGCTTTGCCACATTC	0.413																																					p.K269T												.	.	1	Complex - frameshift(1)	breast(1)	c.A806C	19						.						123.0	115.0	117.0					19																	52468900		2203	4300	6503	57160712	SO:0001583	missense	59348	exon5			AF295096	CCDS12845.1	19q13.41	2013-05-23			ENSG00000256683	ENSG00000256683		"""Zinc fingers, C2H2-type"", ""-"""	16656	protein-coding gene	gene with protein product		605422				11090615, 11161714	Standard	NM_021632		Approved	ZBRK1, ZFQR	uc002pyd.3	Q9GZX5	OTTHUMG00000182538	ENST00000243644.4:c.806A>C	19.37:g.52468900T>G	ENSP00000243644:p.Lys269Thr	Somatic		Capture	SOLID	Phase_I	57160712	NM_021632	Q96G73|Q9HAQ4	Missense_Mutation	SNP	ENST00000243644.4	37	CCDS12845.1	.	.	.	.	.	.	.	.	.	.	T	17.22	3.335422	0.60853	.	.	ENSG00000256683	ENST00000243644	T	0.07908	3.15	3.41	3.41	0.39046	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.39210	N	0.001427	T	0.25382	0.0617	M	0.86178	2.8	0.26192	N	0.97957	P	0.46859	0.885	P	0.56278	0.795	T	0.03493	-1.1031	10	0.87932	D	0	.	10.9884	0.47534	0.0:0.0:0.0:1.0	.	269	Q9GZX5	ZN350_HUMAN	T	269	ENSP00000243644:K269T	ENSP00000243644:K269T	K	-	2	0	ZNF350	57160712	0.998000	0.40836	0.993000	0.49108	0.996000	0.88848	3.351000	0.52232	1.424000	0.47217	0.482000	0.46254	AAA		ZNF350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462278.1	NM_021632	
NLRP12	91662	hgsc.bcm.edu	37	19	54313099	54313099	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:54313099G>A	ENST00000324134.6	-	3	1982	c.1814C>T	c.(1813-1815)aCc>aTc	p.T605I	NLRP12_ENST00000354278.3_Missense_Mutation_p.T605I|NLRP12_ENST00000391772.1_Missense_Mutation_p.T605I|NLRP12_ENST00000391773.1_Missense_Mutation_p.T605I|NLRP12_ENST00000535162.1_Missense_Mutation_p.T605I|NLRP12_ENST00000345770.5_Missense_Mutation_p.T605I|NLRP12_ENST00000351894.4_Missense_Mutation_p.T605I|NLRP12_ENST00000391775.3_Missense_Mutation_p.T605I	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	605					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.T605I(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CTGCTGCAGGGTGGAGCCGTC	0.577																																					p.T605I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1814T	19						.						88.0	88.0	88.0					19																	54313099		2203	4300	6503	59004911	SO:0001583	missense	91662	exon3			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1814C>T	19.37:g.54313099G>A	ENSP00000319377:p.Thr605Ile	Somatic		Capture	SOLID	Phase_I	59004911	NM_144687	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.364718	0.24684	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.86164	-2.08;-2.08;-2.08;-2.08;-2.08;-2.08;-2.08	4.05	0.395	0.16304	.	0.233302	0.22510	N	0.059112	D	0.84515	0.5489	M	0.62723	1.935	0.30136	N	0.804345	D;P;D;P	0.55605	0.972;0.949;0.972;0.895	P;P;P;P	0.48304	0.573;0.476;0.573;0.462	T	0.79529	-0.1766	10	0.46703	T	0.11	.	6.2016	0.20579	0.1064:0.3631:0.5305:0.0	.	605;605;605;605	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	I	605	ENSP00000319377:T605I;ENSP00000438030:T605I;ENSP00000340473:T605I;ENSP00000346231:T605I;ENSP00000375655:T605I;ENSP00000375653:T605I;ENSP00000375652:T605I	ENSP00000319377:T605I	T	-	2	0	NLRP12	59004911	0.000000	0.05858	0.438000	0.26821	0.928000	0.56348	0.156000	0.16382	-0.023000	0.13963	0.485000	0.47835	ACC		NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
LILRB5	10990	hgsc.bcm.edu	37	19	54761030	54761030	+	Silent	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:54761030A>G	ENST00000316219.5	-	1	134	c.27T>C	c.(25-27)atT>atC	p.I9I	LILRB5_ENST00000450632.1_Silent_p.I9I|LILRB5_ENST00000345866.6_Silent_p.I9I|LILRB5_ENST00000449561.2_Silent_p.I9I	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	9					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.I9I(2)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CACCGAGGCAAATCAGGACTG	0.572																																					p.I9I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T27C	19						.						90.0	82.0	84.0					19																	54761030		2203	4300	6503	59452842	SO:0001819	synonymous_variant	10990	exon1			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.27T>C	19.37:g.54761030A>G		Somatic		Capture	SOLID	Phase_I	59452842	NM_001081442	Q8N760	Silent	SNP	ENST00000316219.5	37	CCDS12885.1																																																																																				LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
ZNF77	58492	hgsc.bcm.edu	37	19	2934739	2934740	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	AG	AG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:2934739_2934740delAG	ENST00000314531.4	-	4	477_478	c.385_386delCT	c.(385-387)cttfs	p.L130fs		NM_021217.2	NP_067040.1	Q15935	ZNF77_HUMAN	zinc finger protein 77	130					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L129V(1)|p.L129fs*11(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGCACAAGAAGGTTCGCAGTC	0.490																																					p.129_129del												.	.	2	Substitution - Missense(1)|Deletion - Frameshift(1)	large_intestine(1)|kidney(1)	c.385_386del	19						.																																			2885740	SO:0001589	frameshift_variant	58492	exon4			X65230	CCDS12099.1	19p13.3	2013-01-08	2006-05-12					"""Zinc fingers, C2H2-type"", ""-"""	13150	protein-coding gene	gene with protein product		194551	"""zinc finger protein 77 (pT1)"""			8478004	Standard	NM_021217		Approved	pT1	uc002lws.4	Q15935		ENST00000314531.4:c.385_386delCT	19.37:g.2934739_2934740delAG	ENSP00000319053:p.Leu130fs	Somatic		Capture	SOLID	Phase_I	2885739	NM_021217	Q86XJ3|Q9NPP0	Frame_Shift_Del	DEL	ENST00000314531.4	37	CCDS12099.1																																																																																				ZNF77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451924.1	NM_021217	
CD70	970	hgsc.bcm.edu	37	19	6586286	6586286	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:6586286C>G	ENST00000245903.3	-	3	476	c.327G>C	c.(325-327)caG>caC	p.Q109H	CD70_ENST00000423145.3_Missense_Mutation_p.Q109H	NM_001252.3	NP_001243.1	P32970	CD70_HUMAN	CD70 molecule	109					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protease binding (GO:0002020)|receptor binding (GO:0005102)	p.Q109H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|skin(1)	11						CCAGCGTCACCTGGATGTGTA	0.647																																					p.Q109H	Pancreas(183;2617 2876 10173 34193)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G327C	19						.						128.0	90.0	103.0					19																	6586286		2203	4300	6503	6537286	SO:0001583	missense	970	exon3			L08096	CCDS12170.1	19p13	2013-05-22	2006-10-27	2006-10-27		ENSG00000125726		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11937	protein-coding gene	gene with protein product		602840	"""tumor necrosis factor (ligand) superfamily, member 7"""	CD27LG, TNFSF7		8387892, 8120384	Standard	NM_001252		Approved	CD27L	uc002mfi.3	P32970		ENST00000245903.3:c.327G>C	19.37:g.6586286C>G	ENSP00000245903:p.Gln109His	Somatic		Capture	SOLID	Phase_I	6537286	NM_001252	B4DPR8|Q53XX4|Q96J57	Missense_Mutation	SNP	ENST00000245903.3	37	CCDS12170.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.048908	0.36181	.	.	ENSG00000125726	ENST00000423145;ENST00000245903	D;D	0.99014	-5.33;-4.03	4.32	0.884	0.19182	Tumour necrosis factor (3);Tumour necrosis factor-like (2);Tumour necrosis factor, conserved site (1);	0.000000	0.46442	D	0.000283	D	0.98096	0.9372	L	0.34521	1.04	0.28525	N	0.912893	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.94452	0.7668	10	0.87932	D	0	-34.8456	7.0991	0.25327	0.0:0.675:0.0:0.325	.	109;109	B4DPR8;P32970	.;CD70_HUMAN	H	109	ENSP00000395294:Q109H;ENSP00000245903:Q109H	ENSP00000245903:Q109H	Q	-	3	2	CD70	6537286	0.997000	0.39634	1.000000	0.80357	0.293000	0.27360	0.033000	0.13754	0.393000	0.25203	0.556000	0.70494	CAG		CD70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457860.1		
OLFM2	93145	hgsc.bcm.edu	37	19	9964943	9964943	+	Silent	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:9964943G>C	ENST00000264833.4	-	6	1469	c.1284C>G	c.(1282-1284)gcC>gcG	p.A428A	OLFM2_ENST00000590841.1_Silent_p.A350A|AC008752.3_ENST00000582439.1_RNA	NM_058164.2	NP_477512.1	O95897	NOE2_HUMAN	olfactomedin 2	428	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				protein secretion (GO:0009306)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular region (GO:0005576)|synapse (GO:0045202)				breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	31						AGGTATAGAGGGCGCGCTCCC	0.567																																					p.A428A												.	.	0			c.C1284G	19						.						97.0	87.0	90.0					19																	9964943		2203	4300	6503	9825943	SO:0001819	synonymous_variant	93145	exon6			AF131839	CCDS12221.1	19p13.2	2008-07-03				ENSG00000105088			17189	protein-coding gene	gene with protein product	"""noelin 2"""						Standard	NM_058164		Approved	OlfC, NOE2	uc002mmp.3	O95897		ENST00000264833.4:c.1284C>G	19.37:g.9964943G>C		Somatic		Capture	SOLID	Phase_I	9825943	NM_058164	Q6IMJ3|Q96FC2	Silent	SNP	ENST00000264833.4	37	CCDS12221.1																																																																																				OLFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451119.1		
LILRA2	11027	hgsc.bcm.edu	37	19	55086265	55086265	+	Silent	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr19:55086265C>A	ENST00000251377.3	+	5	553	c.420C>A	c.(418-420)acC>acA	p.T140T	LILRA2_ENST00000391738.3_Silent_p.T140T|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000495786.1_3'UTR|LILRB1_ENST00000448689.1_Intron|LILRA2_ENST00000251376.3_Silent_p.T140T|LILRA2_ENST00000391737.1_Silent_p.T128T			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	140	Ig-like C2-type 2.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		GGAACGTGACCCTCCAGTGTG	0.557																																					p.T140T												.	.	0			c.C420A	19						.						166.0	151.0	156.0					19																	55086265		2203	4300	6503	59778077	SO:0001819	synonymous_variant	11027	exon4			U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.420C>A	19.37:g.55086265C>A		Somatic		Capture	SOLID	Phase_I	59778077	NM_001130917	O75020	Silent	SNP	ENST00000251377.3	37	CCDS46179.1																																																																																				LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2		
UBR5	51366	hgsc.bcm.edu	37	8	103305912	103305912	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr8:103305912T>C	ENST00000520539.1	-	34	5116	c.4510A>G	c.(4510-4512)Ata>Gta	p.I1504V	UBR5_ENST00000220959.4_Missense_Mutation_p.I1504V|UBR5_ENST00000519528.1_5'UTR|UBR5_ENST00000521922.1_Missense_Mutation_p.I1498V	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	1504					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			ATGGCATCTATGCTAGTACTA	0.473																																					p.I1504V	Ovarian(131;96 1741 5634 7352 27489)											.	.	0			c.A4510G	8						.						134.0	108.0	117.0					8																	103305912		2203	4300	6503	103375088	SO:0001583	missense	51366	exon34			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.4510A>G	8.37:g.103305912T>C	ENSP00000429084:p.Ile1504Val	Somatic		Capture	SOLID	Phase_I	103375088	NM_015902	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	ENST00000520539.1	37	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	T	11.84	1.758712	0.31137	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.42513	0.97;0.97;0.97	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.30479	0.0766	N	0.20685	0.6	0.53005	D	0.999969	B;B	0.22800	0.075;0.075	B;B	0.23018	0.043;0.043	T	0.10064	-1.0646	10	0.18276	T	0.48	.	16.5932	0.84781	0.0:0.0:0.0:1.0	.	1498;1504	E7EMW7;O95071	.;UBR5_HUMAN	V	1504;1504;1498	ENSP00000429084:I1504V;ENSP00000220959:I1504V;ENSP00000427819:I1498V	ENSP00000220959:I1504V	I	-	1	0	UBR5	103375088	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.139000	0.71728	2.320000	0.78422	0.528000	0.53228	ATA		UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
CSMD3	114788	hgsc.bcm.edu	37	8	113966962	113966962	+	Silent	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr8:113966962T>C	ENST00000297405.5	-	8	1615	c.1371A>G	c.(1369-1371)agA>agG	p.R457R	CSMD3_ENST00000343508.3_Silent_p.R417R|CSMD3_ENST00000455883.2_Silent_p.R353R|CSMD3_ENST00000352409.3_Silent_p.R457R	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	457						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATTTAAATCCTCTAGATTTAA	0.289										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.R457R												.	.	0			c.A1371G	8						.						60.0	61.0	61.0					8																	113966962		2198	4296	6494	114036138	SO:0001819	synonymous_variant	114788	exon8			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.1371A>G	8.37:g.113966962T>C		Somatic		Capture	SOLID	Phase_I	114036138	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1																																																																																				CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
TAF2	6873	hgsc.bcm.edu	37	8	120744196	120744196	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr8:120744196T>A	ENST00000378164.2	-	26	3866	c.3568A>T	c.(3568-3570)Agg>Tgg	p.R1190W		NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	1190					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CGAATAGACCTGCCACTGGCA	0.423																																					p.R1190W												.	.	0			c.A3568T	8						.						223.0	190.0	201.0					8																	120744196		2203	4300	6503	120813377	SO:0001583	missense	6873	exon26			AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.3568A>T	8.37:g.120744196T>A	ENSP00000367406:p.Arg1190Trp	Somatic		Capture	SOLID	Phase_I	120813377	NM_003184	B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	ENST00000378164.2	37	CCDS34937.1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.075228	0.55646	.	.	ENSG00000064313	ENST00000378164;ENST00000529653	T;T	0.39592	2.04;1.07	5.92	3.6	0.41247	.	0.110634	0.64402	D	0.000011	T	0.30103	0.0754	L	0.29908	0.895	0.46981	D	0.999276	D	0.55172	0.97	B	0.40741	0.339	T	0.11470	-1.0586	10	0.72032	D	0.01	-12.4974	10.8915	0.46998	0.0:0.0:0.4707:0.5293	.	1190	Q6P1X5	TAF2_HUMAN	W	1190;366	ENSP00000367406:R1190W;ENSP00000436750:R366W	ENSP00000367406:R1190W	R	-	1	2	TAF2	120813377	1.000000	0.71417	0.999000	0.59377	0.508000	0.34012	2.002000	0.40835	1.036000	0.39998	-0.321000	0.08615	AGG		TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381436.1	NM_003184	
DEPTOR	64798	hgsc.bcm.edu	37	8	120940811	120940811	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr8:120940811T>G	ENST00000286234.5	+	2	424	c.294T>G	c.(292-294)atT>atG	p.I98M	DEPTOR_ENST00000523492.1_Intron	NM_022783.2	NP_073620.2	Q8TB45	DPTOR_HUMAN	DEP domain containing MTOR-interacting protein	98	DEP 1. {ECO:0000255|PROSITE- ProRule:PRU00066}.				intracellular signal transduction (GO:0035556)|negative regulation of cell size (GO:0045792)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of TOR signaling (GO:0032007)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)	intracellular (GO:0005622)		p.I98M(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	18						GGGGCATTATTCACCATGGTG	0.433																																					p.I98M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T294G	8						.						98.0	93.0	95.0					8																	120940811		2203	4300	6503	121009992	SO:0001583	missense	64798	exon2				CCDS6331.1, CCDS64960.1	8q24.12	2011-12-13	2010-12-08	2010-12-08	ENSG00000155792	ENSG00000155792			22953	protein-coding gene	gene with protein product		612974	"""DEP domain containing 6"""	DEPDC6		19446321	Standard	NM_022783		Approved	DEP.6, FLJ12428	uc003yow.4	Q8TB45	OTTHUMG00000165052	ENST00000286234.5:c.294T>G	8.37:g.120940811T>G	ENSP00000286234:p.Ile98Met	Somatic		Capture	SOLID	Phase_I	121009992	NM_022783	B2RCL9|B4DN97|E7EV87|Q96EQ1|Q9H0R7|Q9H894|Q9HA07	Missense_Mutation	SNP	ENST00000286234.5	37	CCDS6331.1	.	.	.	.	.	.	.	.	.	.	T	18.03	3.533562	0.64972	.	.	ENSG00000155792	ENST00000286234	T	0.20332	2.08	5.95	-0.82	0.10826	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.043429	0.85682	D	0.000000	T	0.39306	0.1073	M	0.72353	2.195	0.52099	D	0.999948	D	0.57257	0.979	D	0.63703	0.917	T	0.28332	-1.0047	10	0.87932	D	0	-27.3276	13.1704	0.59595	0.0:0.6227:0.0:0.3773	.	98	Q8TB45	DPTOR_HUMAN	M	98	ENSP00000286234:I98M	ENSP00000286234:I98M	I	+	3	3	DEPTOR	121009992	0.957000	0.32711	0.988000	0.46212	0.932000	0.56968	0.028000	0.13644	-0.361000	0.08125	0.459000	0.35465	ATT		DEPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381601.1	NM_022783	
COL14A1	7373	hgsc.bcm.edu	37	8	121381587	121381587	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr8:121381587G>A	ENST00000297848.3	+	47	5444	c.5174G>A	c.(5173-5175)cGg>cAg	p.R1725Q	COL14A1_ENST00000247781.3_Missense_Mutation_p.R1630Q|COL14A1_ENST00000309791.4_Missense_Mutation_p.R1725Q	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.R1725Q(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GGGGAGAGTCGGCCTGGCAGC	0.562																																					p.R1725Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5174A	8						.						49.0	53.0	52.0					8																	121381587		2203	4300	6503	121450768	SO:0001583	missense	7373	exon47				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.5174G>A	8.37:g.121381587G>A	ENSP00000297848:p.Arg1725Gln	Somatic		Capture	SOLID	Phase_I	121450768	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	G	32	5.115046	0.94339	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000440844	D;D;D;D	0.94184	-2.16;-2.2;-3.14;-3.37	4.84	4.84	0.62591	.	0.058095	0.64402	D	0.000003	D	0.89371	0.6696	L	0.28740	0.885	0.80722	D	1	D	0.59357	0.985	P	0.44447	0.45	D	0.87133	0.2198	10	0.13470	T	0.59	.	18.4389	0.90658	0.0:0.0:1.0:0.0	.	1725	Q05707	COEA1_HUMAN	Q	1725;1725;1630;72	ENSP00000311809:R1725Q;ENSP00000297848:R1725Q;ENSP00000247781:R1630Q;ENSP00000403640:R72Q	ENSP00000247781:R1630Q	R	+	2	0	COL14A1	121450768	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	7.673000	0.83973	2.618000	0.88619	0.561000	0.74099	CGG		COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
TG	7038	hgsc.bcm.edu	37	8	133895133	133895133	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr8:133895133A>T	ENST00000220616.4	+	8	1004	c.964A>T	c.(964-966)Aat>Tat	p.N322Y	TG_ENST00000377869.1_Missense_Mutation_p.N322Y	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	322	Thyroglobulin type-1 4. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CTGCCGCCGAAATGGCGACTA	0.577																																					p.N322Y												.	.	0			c.A964T	8						.						54.0	53.0	53.0					8																	133895133		2203	4300	6503	133964315	SO:0001583	missense	7038	exon8			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.964A>T	8.37:g.133895133A>T	ENSP00000220616:p.Asn322Tyr	Somatic		Capture	SOLID	Phase_I	133964315	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	A	11.96	1.795292	0.31777	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.66280	-0.2;-0.2	5.49	-0.838	0.10762	Thyroglobulin type-1 (6);	0.768688	0.12182	N	0.492044	T	0.70334	0.3212	L	0.58101	1.795	0.09310	N	1	D	0.65815	0.995	P	0.62649	0.905	T	0.62840	-0.6769	10	0.87932	D	0	.	10.6867	0.45848	0.4657:0.0:0.5343:0.0	.	322	P01266	THYG_HUMAN	Y	322	ENSP00000367100:N322Y;ENSP00000220616:N322Y	ENSP00000220616:N322Y	N	+	1	0	TG	133964315	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.168000	0.16622	-0.142000	0.11354	-0.376000	0.06991	AAT		TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
COL22A1	169044	hgsc.bcm.edu	37	8	139601645	139601645	+	Missense_Mutation	SNP	G	G	A	rs150372930		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr8:139601645G>A	ENST00000303045.6	-	65	5178	c.4732C>T	c.(4732-4734)Cct>Tct	p.P1578S	COL22A1_ENST00000341807.4_5'UTR|COL22A1_ENST00000435777.1_Missense_Mutation_p.P1558S	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1578	Collagen-like 16.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.P1578S(2)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GGGATCCCAGGAAGTCCATCT	0.612										HNSCC(7;0.00092)																											p.P1578S												.	.	2	Substitution - Missense(2)	large_intestine(1)|skin(1)	c.C4732T	8						.						51.0	44.0	46.0					8																	139601645		2202	4300	6502	139670827	SO:0001583	missense	169044	exon65			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4732C>T	8.37:g.139601645G>A	ENSP00000303153:p.Pro1578Ser	Somatic		Capture	SOLID	Phase_I	139670827	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743951	0.69418	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.93547	-3.24;-3.24	5.52	5.52	0.82312	.	0.000000	0.49916	D	0.000132	D	0.96892	0.8985	M	0.84082	2.675	0.80722	D	1	P;D	0.89917	0.876;1.0	P;D	0.91635	0.802;0.999	D	0.96291	0.9214	10	0.45353	T	0.12	.	18.7902	0.91971	0.0:0.0:1.0:0.0	.	1558;1578	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	S	1578;1558;1271	ENSP00000303153:P1578S;ENSP00000387655:P1558S	ENSP00000303153:P1578S	P	-	1	0	COL22A1	139670827	1.000000	0.71417	0.494000	0.27515	0.979000	0.70002	9.168000	0.94781	2.752000	0.94435	0.655000	0.94253	CCT		COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
ZNF623	9831	hgsc.bcm.edu	37	8	144732172	144732172	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr8:144732172C>T	ENST00000501748.2	+	1	219	c.130C>T	c.(130-132)Ccc>Tcc	p.P44S	ZNF623_ENST00000526926.1_Missense_Mutation_p.P4S|ZNF623_ENST00000458270.2_Missense_Mutation_p.P4S	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	44					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P44S(1)		endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GATGGAGCTCCCCTCTCCCGA	0.547																																					p.P44S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C130T	8						.						79.0	76.0	77.0					8																	144732172		2203	4300	6503	144803315	SO:0001583	missense	9831	exon1			AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.130C>T	8.37:g.144732172C>T	ENSP00000445979:p.Pro44Ser	Somatic		Capture	SOLID	Phase_I	144803315	NM_014789	A4FU80|B4DGP3|E7ENV5	Missense_Mutation	SNP	ENST00000501748.2	37	CCDS34957.1	.	.	.	.	.	.	.	.	.	.	C	1.029	-0.682321	0.03353	.	.	ENSG00000183309	ENST00000526926;ENST00000328466;ENST00000458270;ENST00000532796;ENST00000501748	T;T;T	0.05786	3.39;3.39;3.45	3.5	-2.0	0.07433	.	.	.	.	.	T	0.02193	0.0068	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47071	-0.9145	9	0.10902	T	0.67	-0.0202	0.827	0.01123	0.1567:0.2069:0.3099:0.3265	.	44	O75123	ZN623_HUMAN	S	4;4;4;44;44	ENSP00000435232:P4S;ENSP00000411139:P4S;ENSP00000445979:P44S	ENSP00000330358:P4S	P	+	1	0	ZNF623	144803315	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.031000	0.13710	-0.440000	0.07211	0.655000	0.94253	CCC		ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382522.3	NM_014789	
ATP6V1B2	526	hgsc.bcm.edu	37	8	20075770	20075770	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr8:20075770T>C	ENST00000276390.2	+	13	1413	c.1373T>C	c.(1372-1374)tTt>tCt	p.F458S		NM_001693.3	NP_001684.2	P21281	VATB2_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2	458					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|ruffle (GO:0001726)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			endometrium(1)|kidney(2)|lung(5)|prostate(1)	9				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)	Gallium nitrate(DB05260)	CTGCAGAAGTTTGAGAGGAAC	0.398																																					p.F458S	Pancreas(119;1230 1726 3901 4036 31644)											.	.	0			c.T1373C	8						.						122.0	110.0	114.0					8																	20075770		2203	4300	6503	20120050	SO:0001583	missense	526	exon13			L35249	CCDS6014.1	8p21.3	2010-04-21	2006-01-13	2002-05-10	ENSG00000147416	ENSG00000147416	3.6.3.14	"""ATPases / V-type"""	854	protein-coding gene	gene with protein product		606939	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta polypeptide, 56/58kD, isoform 2"", ""ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2"""	VPP3, ATP6B2		2145275, 14580332	Standard	NM_001693		Approved	VATB, Vma2, HO57	uc003wzp.3	P21281	OTTHUMG00000131073	ENST00000276390.2:c.1373T>C	8.37:g.20075770T>C	ENSP00000276390:p.Phe458Ser	Somatic		Capture	SOLID	Phase_I	20120050	NM_001693	B2R5Z3|D3DSQ5|Q14544|Q15859|Q96IR0	Missense_Mutation	SNP	ENST00000276390.2	37	CCDS6014.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.772189	0.90108	.	.	ENSG00000147416	ENST00000276390;ENST00000542368	T	0.77877	-1.13	5.56	5.56	0.83823	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91882	0.7430	H	0.96943	3.91	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.94356	0.7583	10	0.87932	D	0	-6.8924	14.8249	0.70104	0.0:0.0:0.0:1.0	.	458	P21281	VATB2_HUMAN	S	458;332	ENSP00000276390:F458S	ENSP00000276390:F458S	F	+	2	0	ATP6V1B2	20120050	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.241000	0.73720	0.533000	0.62120	TTT		ATP6V1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253732.1	NM_001693	
ADHFE1	137872	hgsc.bcm.edu	37	8	67372565	67372565	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr8:67372565G>T	ENST00000396623.3	+	13	1216	c.1185G>T	c.(1183-1185)agG>agT	p.R395S	ADHFE1_ENST00000415254.1_Missense_Mutation_p.R347S|ADHFE1_ENST00000496501.1_3'UTR|C8orf46_ENST00000482608.2_3'UTR	NM_144650.2	NP_653251.2	Q8IWW8	HOT_HUMAN	alcohol dehydrogenase, iron containing, 1	395					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|molecular hydrogen transport (GO:0015993)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacid-oxoacid transhydrogenase activity (GO:0047988)|metal ion binding (GO:0046872)	p.R347S(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	29		Lung NSC(129;0.197)	Epithelial(68;0.0321)|all cancers(69;0.0751)|BRCA - Breast invasive adenocarcinoma(89;0.0855)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			GCACTGCCAGGATCCAAGATG	0.522											OREG0018808	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R395S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1185T	8						.						106.0	107.0	107.0					8																	67372565		2203	4300	6503	67535119	SO:0001583	missense	137872	exon13			AK056992	CCDS6190.2	8q12.3	2013-05-21			ENSG00000147576	ENSG00000147576	1.1.99.24	"""Alcohol dehydrogenases"""	16354	protein-coding gene	gene with protein product	"""hydroxyacid-oxoacid transhydrogenase"""	611083				12592711	Standard	NM_144650		Approved	ADHFe1, FLJ32430	uc003xwb.4	Q8IWW8	OTTHUMG00000150215	ENST00000396623.3:c.1185G>T	8.37:g.67372565G>T	ENSP00000379865:p.Arg395Ser	Somatic	1099	Capture	SOLID	Phase_I	67535119	NM_144650	B4DTJ8|Q49A19|Q68CI7|Q6P2B6|Q96MF9	Missense_Mutation	SNP	ENST00000396623.3	37	CCDS6190.2	.	.	.	.	.	.	.	.	.	.	G	9.706	1.155849	0.21454	.	.	ENSG00000147576	ENST00000396623;ENST00000415254	T;T	0.39592	1.07;1.07	5.71	3.37	0.38596	Alcohol dehydrogenase, iron-type (1);	0.196790	0.53938	D	0.000044	T	0.12732	0.0309	N	0.01656	-0.775	0.80722	D	1	B	0.16603	0.018	B	0.23018	0.043	T	0.10132	-1.0643	10	0.07175	T	0.84	-11.6997	4.5564	0.12138	0.5621:0.0:0.4379:0.0	.	395	Q8IWW8	HOT_HUMAN	S	395;347	ENSP00000379865:R395S;ENSP00000407115:R347S	ENSP00000379865:R395S	R	+	3	2	ADHFE1	67535119	1.000000	0.71417	0.833000	0.33012	0.083000	0.17756	3.905000	0.56333	1.158000	0.42547	0.563000	0.77884	AGG		ADHFE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316867.3	NM_144650	
PRDM14	63978	hgsc.bcm.edu	37	8	70970960	70970960	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr8:70970960C>G	ENST00000276594.2	-	6	1502	c.1301G>C	c.(1300-1302)tGt>tCt	p.C434S		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	434					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			GCAGAGAGAACAGGGAAATTT	0.473																																					p.C434S	NSCLC(129;99 1813 5906 40656 46114)											.	.	0			c.G1301C	8						.						120.0	108.0	112.0					8																	70970960		2203	4300	6503	71133514	SO:0001583	missense	63978	exon6			AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.1301G>C	8.37:g.70970960C>G	ENSP00000276594:p.Cys434Ser	Somatic		Capture	SOLID	Phase_I	71133514	NM_024504	Q86UX9	Missense_Mutation	SNP	ENST00000276594.2	37	CCDS6206.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.023260	0.93462	.	.	ENSG00000147596	ENST00000276594	T	0.60040	0.22	5.73	5.73	0.89815	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.83857	0.5345	H	0.95004	3.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87739	0.2584	10	0.87932	D	0	-24.2859	19.9036	0.96999	0.0:1.0:0.0:0.0	.	434	Q9GZV8	PRD14_HUMAN	S	434	ENSP00000276594:C434S	ENSP00000276594:C434S	C	-	2	0	PRDM14	71133514	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	7.343000	0.79319	2.706000	0.92434	0.655000	0.94253	TGT		PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1		
LY96	23643	hgsc.bcm.edu	37	8	74922345	74922345	+	Silent	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr8:74922345T>C	ENST00000284818.2	+	3	403	c.312T>C	c.(310-312)ttT>ttC	p.F104F	LY96_ENST00000518893.1_Silent_p.F74F	NM_015364.4	NP_056179	Q9Y6Y9	LY96_HUMAN	lymphocyte antigen 96	104					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endosome membrane (GO:0010008)|extracellular region (GO:0005576)|lipopolysaccharide receptor complex (GO:0046696)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|lipopolysaccharide receptor activity (GO:0001875)			endometrium(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5	Breast(64;0.0311)		Epithelial(68;0.0208)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0619)			ATTACTCTTTTTGCAGAGCTC	0.299																																					p.F104F	GBM(131;1357 1748 34893 50149 52212)											.	.	0			c.T312C	8						.						98.0	94.0	95.0					8																	74922345		2203	4300	6503	75084899	SO:0001819	synonymous_variant	23643	exon3			AB018549	CCDS6216.1, CCDS56540.1	8q13.3	2004-01-22			ENSG00000154589	ENSG00000154589			17156	protein-coding gene	gene with protein product		605243				10359581, 11466383	Standard	NM_015364		Approved	MD-2	uc003yad.3	Q9Y6Y9	OTTHUMG00000164504	ENST00000284818.2:c.312T>C	8.37:g.74922345T>C		Somatic		Capture	SOLID	Phase_I	75084899	NM_015364	B3Y6A5|E5RJJ7	Silent	SNP	ENST00000284818.2	37	CCDS6216.1																																																																																				LY96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379032.2	NM_015364	
ZNF16	7564	hgsc.bcm.edu	37	8	146156357	146156357	+	Missense_Mutation	SNP	A	A	G	rs146707278		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr8:146156357A>G	ENST00000276816.4	-	4	2002	c.1816T>C	c.(1816-1818)Tgt>Cgt	p.C606R	ZNF16_ENST00000394909.2_Missense_Mutation_p.C606R	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	606					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C606R(1)		breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		CCCTTACCACATTCAACACAG	0.493																																					p.C606R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1816C	8						.	A	ARG/CYS,ARG/CYS	1,4405	2.1+/-5.4	0,1,2202	106.0	97.0	100.0		1816,1816	4.0	1.0	8	dbSNP_134	100	0,8600		0,0,4300	no	missense,missense	ZNF16	NM_001029976.2,NM_006958.2	180,180	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging,probably-damaging	606/683,606/683	146156357	1,13005	2203	4300	6503	146127161	SO:0001583	missense	7564	exon3			X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.1816T>C	8.37:g.146156357A>G	ENSP00000276816:p.Cys606Arg	Somatic		Capture	SOLID	Phase_I	146127161	NM_006958	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Missense_Mutation	SNP	ENST00000276816.4	37	CCDS6437.1	.	.	.	.	.	.	.	.	.	.	A	15.33	2.801731	0.50315	2.27E-4	0.0	ENSG00000170631	ENST00000276816;ENST00000394909	D;D	0.85955	-2.05;-2.05	4.0	4.0	0.46444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94019	0.8084	H	0.95187	3.635	0.53688	D	0.999973	D	0.89917	1.0	D	0.91635	0.999	D	0.95084	0.8216	9	0.87932	D	0	.	12.015	0.53309	1.0:0.0:0.0:0.0	.	606	P17020	ZNF16_HUMAN	R	606	ENSP00000276816:C606R;ENSP00000378369:C606R	ENSP00000276816:C606R	C	-	1	0	ZNF16	146127161	1.000000	0.71417	0.955000	0.39395	0.810000	0.45777	8.137000	0.89612	1.673000	0.50895	0.379000	0.24179	TGT		ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382978.1	NM_006958	
AGL	178	hgsc.bcm.edu	37	1	100349711	100349711	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:100349711A>C	ENST00000294724.4	+	18	2822	c.2344A>C	c.(2344-2346)Att>Ctt	p.I782L	AGL_ENST00000370165.3_Missense_Mutation_p.I782L|AGL_ENST00000361302.3_Missense_Mutation_p.I766L|AGL_ENST00000370161.2_Missense_Mutation_p.I766L|AGL_ENST00000361522.4_Missense_Mutation_p.I765L|AGL_ENST00000370163.3_Missense_Mutation_p.I782L|AGL_ENST00000361915.3_Missense_Mutation_p.I782L	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	782					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		AGCTAGAACTATTGAGAGAAA	0.323																																					p.I765L												.	.	0			c.A2293C	1						.						103.0	109.0	107.0					1																	100349711		2203	4298	6501	100122299	SO:0001583	missense	178	exon16			BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.2344A>C	1.37:g.100349711A>C	ENSP00000294724:p.Ile782Leu	Somatic		Capture	SOLID	Phase_I	100122299	NM_000645	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	37	CCDS759.1	.	.	.	.	.	.	.	.	.	.	A	9.546	1.114666	0.20795	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	T;T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59;1.59	5.8	-0.743	0.11105	.	0.302846	0.37577	N	0.002033	T	0.04724	0.0128	N	0.11927	0.2	0.37410	D	0.9132	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.09377	0.003;0.003;0.004	T	0.38090	-0.9677	10	0.07644	T	0.81	.	12.2626	0.54660	0.3578:0.0:0.6422:0.0	.	765;766;782	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	L	782;782;782;782;766;766;765	ENSP00000355106:I782L;ENSP00000359184:I782L;ENSP00000359182:I782L;ENSP00000294724:I782L;ENSP00000354971:I766L;ENSP00000359180:I766L;ENSP00000354635:I765L	ENSP00000294724:I782L	I	+	1	0	AGL	100122299	0.532000	0.26346	0.997000	0.53966	0.974000	0.67602	0.262000	0.18460	-0.078000	0.12730	0.528000	0.53228	ATT		AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
KIAA1324	57535	hgsc.bcm.edu	37	1	109743420	109743420	+	Silent	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:109743420A>T	ENST00000369939.3	+	21	3054	c.2871A>T	c.(2869-2871)gcA>gcT	p.A957A	KIAA1324_ENST00000369938.1_3'UTR|KIAA1324_ENST00000529753.1_Silent_p.A870A	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324	957					cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		ACCTGCCAGCAGCTGACAGCT	0.473											OREG0013630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A957A												.	.	0			c.A2871T	1						.						106.0	96.0	100.0					1																	109743420		2203	4300	6503	109544943	SO:0001819	synonymous_variant	57535	exon21			AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725	ENST00000369939.3:c.2871A>T	1.37:g.109743420A>T		Somatic	1422	Capture	SOLID	Phase_I	109544943	NM_020775	Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	Silent	SNP	ENST00000369939.3	37	CCDS794.1																																																																																				KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032389.2	NM_020775	
SORT1	6272	hgsc.bcm.edu	37	1	109870150	109870150	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:109870150G>T	ENST00000256637.6	-	12	1503	c.1445C>A	c.(1444-1446)cCg>cAg	p.P482Q	SORT1_ENST00000538502.1_Missense_Mutation_p.P345Q	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	482					endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)	p.P482Q(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		TACGGCATTCGGCTCTGAGAG	0.493																																					p.P482Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1445A	1						.						94.0	84.0	88.0					1																	109870150		2203	4300	6503	109671673	SO:0001583	missense	6272	exon12			BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.1445C>A	1.37:g.109870150G>T	ENSP00000256637:p.Pro482Gln	Somatic		Capture	SOLID	Phase_I	109671673	NM_002959	B4DWI3|C0JYZ0|Q8IZ49	Missense_Mutation	SNP	ENST00000256637.6	37	CCDS798.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.131861	0.77662	.	.	ENSG00000134243	ENST00000256637;ENST00000538502	T;T	0.26223	1.75;1.75	5.62	5.62	0.85841	VPS10 (1);	0.119463	0.56097	D	0.000024	T	0.37433	0.1003	M	0.61703	1.905	0.58432	D	0.999995	B;D	0.69078	0.22;0.997	B;D	0.66497	0.129;0.944	T	0.01945	-1.1242	10	0.24483	T	0.36	-4.8651	18.4615	0.90739	0.0:0.0:1.0:0.0	.	345;482	B4DWI3;Q99523	.;SORT_HUMAN	Q	482;345	ENSP00000256637:P482Q;ENSP00000438597:P345Q	ENSP00000256637:P482Q	P	-	2	0	SORT1	109671673	1.000000	0.71417	0.958000	0.39756	0.674000	0.39518	8.989000	0.93506	2.648000	0.89879	0.650000	0.86243	CCG		SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033179.1	NM_002959	
LAMTOR5	10542	hgsc.bcm.edu	37	1	110946616	110946616	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:110946616A>T	ENST00000602318.1	-	3	227	c.140T>A	c.(139-141)gTt>gAt	p.V47D	LAMTOR5-AS1_ENST00000590413.1_RNA|LAMTOR5_ENST00000483260.1_Missense_Mutation_p.V46D|LAMTOR5_ENST00000602858.1_Missense_Mutation_p.V35D|LAMTOR5_ENST00000256644.4_Missense_Mutation_p.V129D|LAMTOR5_ENST00000474861.2_Missense_Mutation_p.V46D			O43504	LTOR5_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 5	47					cellular response to amino acid stimulus (GO:0071230)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)|protein localization to lysosome (GO:0061462)|regulation of cell size (GO:0008361)|response to virus (GO:0009615)|viral genome replication (GO:0019079)	cytosol (GO:0005829)|lysosome (GO:0005764)|Ragulator complex (GO:0071986)		p.V129D(1)									CTGGGCTAGAACAGATATCAC	0.448																																					p.V129D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T386A	1						.						117.0	105.0	109.0					1																	110946616		2203	4300	6503	110748139	SO:0001583	missense	10542	exon3			AF029890	CCDS824.1	1p12	2012-09-24	2012-09-24	2012-09-24	ENSG00000134248	ENSG00000134248			17955	protein-coding gene	gene with protein product	"""HBx-interacting protein"", ""hepatitis B virus x-interacting protein (9.6kD)"""	608521	"""hepatitis B virus x interacting protein"""	HBXIP		9499022, 22980980	Standard	NM_006402		Approved	XIP, MGC71071	uc001dzr.3	O43504	OTTHUMG00000011568	ENST00000602318.1:c.140T>A	1.37:g.110946616A>T	ENSP00000473439:p.Val47Asp	Somatic		Capture	SOLID	Phase_I	110748139	NM_006402	Q6IBD8	Missense_Mutation	SNP	ENST00000602318.1	37		.	.	.	.	.	.	.	.	.	.	A	26.2	4.716828	0.89205	.	.	ENSG00000134248	ENST00000483260;ENST00000474861;ENST00000256644	.	.	.	5.87	5.87	0.94306	.	0.063428	0.64402	D	0.000008	T	0.39682	0.1087	.	.	.	0.80722	D	1	P	0.42203	0.773	B	0.37304	0.246	T	0.46162	-0.9211	8	0.49607	T	0.09	-20.5942	15.5573	0.76208	1.0:0.0:0.0:0.0	.	47	O43504	HBXIP_HUMAN	D	46;46;129	.	ENSP00000256644:V129D	V	-	2	0	HBXIP	110748139	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.857000	0.86963	2.371000	0.80710	0.533000	0.62120	GTT		LAMTOR5-007	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467909.1	NM_006402	
TRIM33	51592	hgsc.bcm.edu	37	1	114967331	114967331	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:114967331T>G	ENST00000358465.2	-	10	1825	c.1742A>C	c.(1741-1743)aAc>aCc	p.N581T	TRIM33_ENST00000450349.2_Missense_Mutation_p.N189T|TRIM33_ENST00000369543.2_Missense_Mutation_p.N581T	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	581					gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGCTCCACAGTTCATGTTGCC	0.413			T	RET	papillary thyroid																																p.N581T			Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	.	.	0			c.A1742C	1						.						125.0	107.0	113.0					1																	114967331		2203	4300	6503	114768854	SO:0001583	missense	51592	exon10			AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.1742A>C	1.37:g.114967331T>G	ENSP00000351250:p.Asn581Thr	Somatic		Capture	SOLID	Phase_I	114768854	NM_015906	O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Missense_Mutation	SNP	ENST00000358465.2	37	CCDS872.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.78|13.78	2.340195|2.340195	0.41398|0.41398	.|.	.|.	ENSG00000197323|ENSG00000197323	ENST00000358465;ENST00000369543;ENST00000450349|ENST00000448034	T;T;T|.	0.79845|.	-0.95;-0.87;-1.31|.	5.62|5.62	4.48|4.48	0.54585|0.54585	.|.	0.233337|.	0.51477|.	D|.	0.000090|.	T|T	0.39306|0.39306	0.1073|0.1073	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	P;P;P;B|.	0.43633|.	0.813;0.671;0.562;0.427|.	B;B;B;B|.	0.38500|.	0.202;0.154;0.275;0.142|.	T|T	0.27706|0.27706	-1.0066|-1.0066	10|5	0.18710|.	T|.	0.47|.	-9.5427|-9.5427	11.3475|11.3475	0.49569|0.49569	0.0:0.0709:0.0:0.9291|0.0:0.0709:0.0:0.9291	.|.	189;189;581;581|.	E7EN20;B3KN30;Q9UPN9-2;Q9UPN9|.	.;.;.;TRI33_HUMAN|.	T|P	581;581;189|318	ENSP00000351250:N581T;ENSP00000358556:N581T;ENSP00000412077:N189T|.	ENSP00000351250:N581T|.	N|T	-|-	2|1	0|0	TRIM33|TRIM33	114768854|114768854	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	5.299000|5.299000	0.65716|0.65716	0.964000|0.964000	0.38108|0.38108	0.528000|0.528000	0.53228|0.53228	AAC|ACT		TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	NM_015906	
MAN1A2	10905	hgsc.bcm.edu	37	1	118039587	118039587	+	Missense_Mutation	SNP	A	A	C	rs376973752		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:118039587A>C	ENST00000356554.3	+	10	2222	c.1487A>C	c.(1486-1488)gAg>gCg	p.E496A		NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	496					cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		ACTTGTCATGAGTCATATGAC	0.358																																					p.E496A	Ovarian(33;199 881 8228 13687 31538)											.	.	0			c.A1487C	1						.						86.0	84.0	85.0					1																	118039587		2203	4299	6502	117841110	SO:0001583	missense	10905	exon10			AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.1487A>C	1.37:g.118039587A>C	ENSP00000348959:p.Glu496Ala	Somatic		Capture	SOLID	Phase_I	117841110	NM_006699	Q9H510	Missense_Mutation	SNP	ENST00000356554.3	37	CCDS895.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	24.7|24.7|24.7	4.561145|4.561145|4.561145	0.86335|0.86335|0.86335	.|.|.	.|.|.	ENSG00000198162|ENSG00000198162|ENSG00000198162	ENST00000356554;ENST00000369450;ENST00000329466|ENST00000449370|ENST00000421535	T|.|.	0.71698|.|.	-0.59|.|.	5.6|5.6|5.6	5.6|5.6|5.6	0.85130|0.85130|0.85130	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|.	0.55784|0.55784|.	0.1942|0.1942|.	L|L|L	0.57130|0.57130|0.57130	1.785|1.785|1.785	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;P|.|.	0.89917|.|.	1.0;0.933|.|.	D;P|.|.	0.91635|.|.	0.999;0.85|.|.	T|T|.	0.56360|0.56360|.	-0.7992|-0.7992|.	10|5|.	0.45353|.|.	T|.|.	0.12|.|.	-22.7285|-22.7285|-22.7285	14.0249|14.0249|14.0249	0.64580|0.64580|0.64580	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	260;496|.|.	A6NLR2;O60476|.|.	.;MA1A2_HUMAN|.|.	A|R|C	496;260;30|229|62	ENSP00000348959:E496A|.|.	ENSP00000358462:E30A|.|.	E|S|X	+|+|+	2|1|3	0|0|0	MAN1A2|MAN1A2|MAN1A2	117841110|117841110|117841110	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.991000|0.991000|0.991000	0.79684|0.79684|0.79684	9.179000|9.179000|9.179000	0.94861|0.94861|0.94861	2.254000|2.254000|2.254000	0.74563|0.74563|0.74563	0.460000|0.460000|0.460000	0.39030|0.39030|0.39030	GAG|AGT|TGA		MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033593.1	NM_006699	
PBXIP1	57326	hgsc.bcm.edu	37	1	154918258	154918258	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:154918258T>A	ENST00000368463.3	-	10	1963	c.1892A>T	c.(1891-1893)cAg>cTg	p.Q631L	PBXIP1_ENST00000539880.1_Missense_Mutation_p.Q458L|PBXIP1_ENST00000368465.1_Missense_Mutation_p.Q602L|PBXIP1_ENST00000542459.1_Missense_Mutation_p.Q476L|PBXIP1_ENST00000498553.1_5'Flank	NM_020524.2	NP_065385.2	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein 1	631					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)	cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.Q631L(1)		breast(1)|kidney(2)|large_intestine(6)|lung(13)|prostate(1)|urinary_tract(1)	24	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CTTGGTCAGCTGCCCAGCCCA	0.597																																					p.Q631L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1892T	1						.						70.0	66.0	67.0					1																	154918258		2203	4300	6503	153184882	SO:0001583	missense	57326	exon10			AF221521	CCDS1074.1	1q22	2008-02-05	2007-01-30		ENSG00000163346	ENSG00000163346			21199	protein-coding gene	gene with protein product			"""pre-B-cell leukemia transcription factor interacting protein 1"""			7505766, 10825160	Standard	NM_020524		Approved	HPIP	uc001ffr.3	Q96AQ6	OTTHUMG00000037369	ENST00000368463.3:c.1892A>T	1.37:g.154918258T>A	ENSP00000357448:p.Gln631Leu	Somatic		Capture	SOLID	Phase_I	153184882	NM_020524	Q5T174|Q5T176|Q9H8X6|Q9HA02|Q9HD85	Missense_Mutation	SNP	ENST00000368463.3	37	CCDS1074.1	.	.	.	.	.	.	.	.	.	.	T	10.46	1.356881	0.24598	.	.	ENSG00000163346	ENST00000368465;ENST00000368463;ENST00000539880;ENST00000543593;ENST00000542459	T;T;T;T	0.12569	2.67;2.68;2.69;2.69	5.24	-4.17	0.03857	.	0.969977	0.08518	N	0.933952	T	0.03434	0.0099	L	0.60455	1.87	0.09310	N	0.999995	B	0.26258	0.145	B	0.27380	0.079	T	0.44128	-0.9348	10	0.10902	T	0.67	-7.556	7.2731	0.26268	0.0:0.3309:0.4776:0.1915	.	631	Q96AQ6	PBIP1_HUMAN	L	602;631;458;407;476	ENSP00000357450:Q602L;ENSP00000357448:Q631L;ENSP00000440142:Q458L;ENSP00000438584:Q476L	ENSP00000357448:Q631L	Q	-	2	0	PBXIP1	153184882	0.000000	0.05858	0.021000	0.16686	0.704000	0.40688	-0.685000	0.05167	-0.311000	0.08754	-0.624000	0.04008	CAG		PBXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090943.1	NM_020524	
ASH1L	55870	hgsc.bcm.edu	37	1	155408528	155408528	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:155408528T>A	ENST00000368346.3	-	5	6057	c.5418A>T	c.(5416-5418)caA>caT	p.Q1806H	ASH1L_ENST00000392403.3_Missense_Mutation_p.Q1806H			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1806					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.Q1806H(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TTTTCCGAGCTTGGCGTTGCA	0.408																																					p.Q1806H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5418T	1						.						148.0	147.0	147.0					1																	155408528		2203	4300	6503	153675152	SO:0001583	missense	55870	exon5			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.5418A>T	1.37:g.155408528T>A	ENSP00000357330:p.Gln1806His	Somatic		Capture	SOLID	Phase_I	153675152	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	T	18.78	3.696249	0.68386	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.89270	-2.49;-2.49	4.94	-1.5	0.08691	.	0.000000	0.64402	D	0.000016	T	0.79505	0.4457	N	0.14661	0.345	0.80722	D	1	D;D	0.64830	0.989;0.994	P;P	0.56865	0.648;0.808	T	0.79692	-0.1697	10	0.72032	D	0.01	.	12.067	0.53594	0.0:0.529:0.0:0.471	.	1806;1806	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	H	1806	ENSP00000357330:Q1806H;ENSP00000376204:Q1806H	ENSP00000357330:Q1806H	Q	-	3	2	ASH1L	153675152	0.999000	0.42202	0.991000	0.47740	0.997000	0.91878	0.381000	0.20619	-0.347000	0.08299	0.533000	0.62120	CAA		ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
ASH1L	55870	hgsc.bcm.edu	37	1	155491092	155491092	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:155491092A>C	ENST00000368346.3	-	2	858	c.219T>G	c.(217-219)ttT>ttG	p.F73L	ASH1L_ENST00000548830.1_Missense_Mutation_p.F73L|ASH1L_ENST00000392403.3_Missense_Mutation_p.F73L			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	73					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CTTTCACTGAAAACTGTTGCT	0.388																																					p.F73L												.	.	0			c.T219G	1						.						216.0	222.0	220.0					1																	155491092		2203	4300	6503	153757716	SO:0001583	missense	55870	exon2			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.219T>G	1.37:g.155491092A>C	ENSP00000357330:p.Phe73Leu	Somatic		Capture	SOLID	Phase_I	153757716	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	A	25.2	4.610928	0.87258	.	.	ENSG00000116539	ENST00000368346;ENST00000392403;ENST00000548830	D;D	0.91686	-2.89;-2.88	5.89	3.61	0.41365	.	0.194965	0.41001	D	0.000968	D	0.86531	0.5955	N	0.08118	0	0.38791	D	0.954974	D;D	0.67145	0.993;0.996	D;D	0.73380	0.956;0.98	D	0.89255	0.3593	10	0.87932	D	0	.	9.5909	0.39545	0.8581:0.0:0.1419:0.0	.	73;73	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	L	73	ENSP00000357330:F73L;ENSP00000376204:F73L	ENSP00000357330:F73L	F	-	3	2	ASH1L	153757716	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.647000	0.61418	1.062000	0.40625	-0.385000	0.06624	TTT		ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
KIAA0907	22889	hgsc.bcm.edu	37	1	155896536	155896536	+	Silent	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:155896536G>C	ENST00000368321.3	-	6	635	c.612C>G	c.(610-612)gtC>gtG	p.V204V	KIAA0907_ENST00000368319.3_Silent_p.V204V|SCARNA4_ENST00000516999.1_RNA|KIAA0907_ENST00000368320.3_Silent_p.V204V|KIAA0907_ENST00000482337.1_5'UTR	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	204							RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			GCTGGTGATAGACAGTTACTG	0.473																																					p.V204V												.	.	0			c.C612G	1						.						166.0	147.0	153.0					1																	155896536		2203	4300	6503	154163160	SO:0001819	synonymous_variant	22889	exon6			BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.612C>G	1.37:g.155896536G>C		Somatic		Capture	SOLID	Phase_I	154163160	NM_014949	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Silent	SNP	ENST00000368321.3	37	CCDS30885.1																																																																																				KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1	NM_014949	
BCAN	63827	hgsc.bcm.edu	37	1	156621342	156621342	+	Silent	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:156621342C>T	ENST00000329117.5	+	7	1494	c.1158C>T	c.(1156-1158)acC>acT	p.T386T	RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_Silent_p.T386T	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	386	Glu-rich.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.T386T(1)		cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGACAGAGACCCTGGAGGAAC	0.607																																					p.T386T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1158T	1						.						67.0	63.0	64.0					1																	156621342		2203	4300	6503	154887966	SO:0001819	synonymous_variant	63827	exon7			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.1158C>T	1.37:g.156621342C>T		Somatic		Capture	SOLID	Phase_I	154887966	NM_021948	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Silent	SNP	ENST00000329117.5	37	CCDS1149.1																																																																																				BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	
BCAN	63827	hgsc.bcm.edu	37	1	156621466	156621466	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:156621466C>T	ENST00000329117.5	+	7	1618	c.1282C>T	c.(1282-1284)Cct>Tct	p.P428S	RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_Missense_Mutation_p.P428S	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	428	Glu-rich.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.P428S(1)		cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGCAGAGGCCCCTAGGACGCT	0.562																																					p.P428S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1282T	1						.						72.0	74.0	74.0					1																	156621466		2203	4300	6503	154888090	SO:0001583	missense	63827	exon7			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.1282C>T	1.37:g.156621466C>T	ENSP00000331210:p.Pro428Ser	Somatic		Capture	SOLID	Phase_I	154888090	NM_021948	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	37	CCDS1149.1	.	.	.	.	.	.	.	.	.	.	C	14.59	2.580331	0.46006	.	.	ENSG00000132692	ENST00000255029;ENST00000329117;ENST00000361588	T;T	0.13778	2.56;3.25	5.02	5.02	0.67125	.	0.226724	0.29328	N	0.012463	T	0.14917	0.0360	L	0.32530	0.975	0.49483	D	0.999795	D;D	0.76494	0.999;0.974	P;P	0.61874	0.895;0.546	T	0.02202	-1.1196	10	0.34782	T	0.22	-10.554	15.196	0.73088	0.0:1.0:0.0:0.0	.	428;428	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	S	367;428;428	ENSP00000331210:P428S;ENSP00000354925:P428S	ENSP00000255029:P367S	P	+	1	0	BCAN	154888090	1.000000	0.71417	0.998000	0.56505	0.530000	0.34684	2.807000	0.47955	2.612000	0.88384	0.655000	0.94253	CCT		BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	
FCRL4	83417	hgsc.bcm.edu	37	1	157557188	157557188	+	Missense_Mutation	SNP	G	G	A	rs562374887		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:157557188G>A	ENST00000271532.1	-	5	860	c.725C>T	c.(724-726)aCg>aTg	p.T242M	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	242	Ig-like C2-type 3.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T242M(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				TTCCGGGTACGTGCTCCAGTC	0.537																																					p.T242M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C725T	1						.						280.0	280.0	280.0					1																	157557188		2203	4300	6503	155823812	SO:0001583	missense	83417	exon5			AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.725C>T	1.37:g.157557188G>A	ENSP00000271532:p.Thr242Met	Somatic		Capture	SOLID	Phase_I	155823812	NM_031282	Q96PJ3|Q96RE0	Missense_Mutation	SNP	ENST00000271532.1	37	CCDS1166.1	.	.	.	.	.	.	.	.	.	.	G	1.499	-0.552622	0.03996	.	.	ENSG00000163518	ENST00000271532	T	0.13420	2.59	4.34	-2.25	0.06888	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.950321	0.08687	N	0.908615	T	0.02848	0.0085	L	0.34521	1.04	0.09310	N	1	B	0.12630	0.006	B	0.22880	0.042	T	0.46911	-0.9157	10	0.42905	T	0.14	.	4.6882	0.12767	0.0:0.3707:0.2927:0.3366	.	242	Q96PJ5	FCRL4_HUMAN	M	242	ENSP00000271532:T242M	ENSP00000271532:T242M	T	-	2	0	FCRL4	155823812	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.399000	0.02506	-0.565000	0.06061	-1.407000	0.01130	ACG		FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086180.1	NM_031282	
FCRL1	115350	hgsc.bcm.edu	37	1	157771816	157771816	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:157771816C>T	ENST00000368176.3	-	5	842	c.775G>A	c.(775-777)Gga>Aga	p.G259R	FCRL1_ENST00000491942.1_Missense_Mutation_p.G259R|FCRL1_ENST00000489998.1_5'UTR|FCRL1_ENST00000358292.3_Missense_Mutation_p.G259R	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	259	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			AAGGAGGCTCCTCCTCCAGAG	0.587																																					p.G259R	GBM(54;482 1003 11223 30131 35730)											.	.	0			c.G775A	1						.						61.0	64.0	63.0					1																	157771816		2203	4300	6503	156038440	SO:0001583	missense	115350	exon5			BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.775G>A	1.37:g.157771816C>T	ENSP00000357158:p.Gly259Arg	Somatic		Capture	SOLID	Phase_I	156038440	NM_001159398	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	ENST00000368176.3	37	CCDS1170.1	.	.	.	.	.	.	.	.	.	.	C	18.04	3.534748	0.64972	.	.	ENSG00000163534	ENST00000358292;ENST00000368176;ENST00000491942	T;T;T	0.03330	3.97;3.97;3.97	5.1	3.18	0.36537	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.610213	0.16050	N	0.232009	T	0.06005	0.0156	L	0.61387	1.9	0.31912	N	0.614604	P;D;D	0.89917	0.778;0.983;1.0	B;P;D	0.97110	0.399;0.86;1.0	T	0.16041	-1.0416	9	.	.	.	.	6.9905	0.24753	0.0:0.7319:0.1751:0.0929	.	259;259;259	Q96LA6-3;Q96LA6-2;Q96LA6	.;.;FCRL1_HUMAN	R	259	ENSP00000351039:G259R;ENSP00000357158:G259R;ENSP00000418130:G259R	.	G	-	1	0	FCRL1	156038440	0.604000	0.26932	0.999000	0.59377	0.933000	0.57130	0.419000	0.21247	0.821000	0.34540	0.650000	0.86243	GGA		FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1	NM_052938	
CASP9	842	hgsc.bcm.edu	37	1	15820425	15820425	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:15820425A>T	ENST00000333868.5	-	8	1214	c.1120T>A	c.(1120-1122)Tgg>Agg	p.W374R	CASP9_ENST00000546424.1_Missense_Mutation_p.W374R|CASP9_ENST00000375890.4_Missense_Mutation_p.W291R|CASP9_ENST00000348549.5_Missense_Mutation_p.W224R	NM_001229.3	NP_001220.2	P55211	CASP9_HUMAN	caspase 9, apoptosis-related cysteine peptidase	374					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell apoptotic process (GO:0034349)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of apoptotic process (GO:0042981)|regulation of response to DNA damage stimulus (GO:2001020)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|signal transduction in response to DNA damage (GO:0042770)	apoptosome (GO:0043293)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|enzyme activator activity (GO:0008047)|peptidase activity (GO:0008233)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)	p.W374R(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|stomach(1)	18		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		GAGTGAGCCCACTGCTCAAAG	0.592																																					p.W291R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T871A	1						.						73.0	53.0	60.0					1																	15820425		2203	4300	6503	15693012	SO:0001583	missense	842	exon8			U60521	CCDS158.1, CCDS159.1, CCDS159.2, CCDS59995.1	1p36.21	2012-04-17	2005-08-17		ENSG00000132906	ENSG00000132906		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 56"""	602234	"""caspase 9, apoptosis-related cysteine protease"""			8663294, 9390557	Standard	NM_001229		Approved	MCH6, ICE-LAP6, APAF-3, PPP1R56	uc001awn.4	P55211	OTTHUMG00000002256	ENST00000333868.5:c.1120T>A	1.37:g.15820425A>T	ENSP00000330237:p.Trp374Arg	Somatic		Capture	SOLID	Phase_I	15693012	NM_032996	B4E1A3|O95348|Q53Y70|Q5JRU9|Q5UGI1|Q92852|Q9BQ62|Q9UEQ3|Q9UIJ8	Missense_Mutation	SNP	ENST00000333868.5	37	CCDS158.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.43|15.43	2.830004|2.830004	0.50845|0.50845	.|.	.|.	ENSG00000132906|ENSG00000132906	ENST00000424908|ENST00000546424;ENST00000333868;ENST00000348549;ENST00000375874;ENST00000375890	.|T;T;T;T	.|0.19250	.|2.16;2.16;2.16;2.16	5.7|5.7	5.7|5.7	0.88788|0.88788	.|Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	.|0.271805	.|0.42420	.|D	.|0.000719	T|T	0.29945|0.29945	0.0749|0.0749	L|L	0.31294|0.31294	0.92|0.92	0.30095|0.30095	N|N	0.807981|0.807981	.|D;B;D	.|0.67145	.|0.996;0.444;0.981	.|D;P;D	.|0.70487	.|0.969;0.574;0.923	T|T	0.16600|0.16600	-1.0397|-1.0397	5|10	.|0.45353	.|T	.|0.12	.|.	8.4632|8.4632	0.32940|0.32940	0.914:0.0:0.086:0.0|0.914:0.0:0.086:0.0	.|.	.|224;374;374	.|P55211-2;P55211;F8VVS7	.|.;CASP9_HUMAN;.	E|R	155|374;374;224;158;291	.|ENSP00000449584:W374R;ENSP00000330237:W374R;ENSP00000255256:W224R;ENSP00000365051:W291R	.|ENSP00000330237:W374R	V|W	-|-	2|1	0|0	CASP9|CASP9	15693012|15693012	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.745000|0.745000	0.42441|0.42441	2.984000|2.984000	0.49353|0.49353	2.183000|2.183000	0.69458|0.69458	0.533000|0.533000	0.62120|0.62120	GTG|TGG		CASP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006438.1	NM_032996	
OR10T2	128360	hgsc.bcm.edu	37	1	158368722	158368722	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:158368722A>C	ENST00000334438.1	-	1	534	c.535T>G	c.(535-537)Ttc>Gtc	p.F179V		NM_001004475.1	NP_001004475.1	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T, member 2	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F179V(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_hematologic(112;0.0378)					ATGTCACAGAAATAGTGGTTA	0.463																																					p.F179V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T535G	1						.						54.0	50.0	51.0					1																	158368722		2203	4300	6503	156635346	SO:0001583	missense	128360	exon1			AB065643	CCDS30895.1	1q23.1	2012-08-09			ENSG00000186306	ENSG00000186306		"""GPCR / Class A : Olfactory receptors"""	14816	protein-coding gene	gene with protein product							Standard	NM_001004475		Approved		uc010pih.2	Q8NGX3	OTTHUMG00000017521	ENST00000334438.1:c.535T>G	1.37:g.158368722A>C	ENSP00000334115:p.Phe179Val	Somatic		Capture	SOLID	Phase_I	156635346	NM_001004475	Q6IF98	Missense_Mutation	SNP	ENST00000334438.1	37	CCDS30895.1	.	.	.	.	.	.	.	.	.	.	A	17.38	3.373885	0.61624	.	.	ENSG00000186306	ENST00000334438	T	0.00220	8.52	4.51	4.51	0.55191	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44285	D	0.000477	T	0.00271	0.0008	M	0.87269	2.87	0.26514	N	0.974559	P	0.49447	0.924	P	0.58266	0.836	T	0.09143	-1.0688	10	0.87932	D	0	.	12.931	0.58286	1.0:0.0:0.0:0.0	.	179	Q8NGX3	O10T2_HUMAN	V	179	ENSP00000334115:F179V	ENSP00000334115:F179V	F	-	1	0	OR10T2	156635346	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	5.359000	0.66074	1.883000	0.54544	0.533000	0.62120	TTC		OR10T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046371.1	NM_001004475	
OR10J5	127385	hgsc.bcm.edu	37	1	159504870	159504870	+	Nonstop_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:159504870A>T	ENST00000334857.2	-	1	972	c.928T>A	c.(928-930)Taa>Aaa	p.*310K		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.*310K(1)		kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					CCAATCCATTAAGAAATATTT	0.383																																					p.X310K												.	.	1	Nonstop extension(1)	large_intestine(1)	c.T928A	1						.						52.0	48.0	50.0					1																	159504870		2203	4300	6503	157771494	SO:0001578	stop_lost	127385	exon1				CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.928T>A	1.37:g.159504870A>T		Somatic		Capture	SOLID	Phase_I	157771494	NM_001004469	B9EH35|Q6IFH2	Missense_Mutation	SNP	ENST00000334857.2	37	CCDS30910.1	.	.	.	.	.	.	.	.	.	.	A	0.617	-0.822814	0.02755	.	.	ENSG00000184155	ENST00000334857	.	.	.	3.82	-0.285	0.12866	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.9445	0.13982	0.5315:0.1589:0.0:0.3096	.	.	.	.	K	310	.	.	X	-	1	0	OR10J5	157771494	0.021000	0.18746	0.030000	0.17652	0.257000	0.26127	0.224000	0.17738	0.152000	0.19188	-0.339000	0.08088	TAA		OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059021.1	NM_001004469	
RCSD1	92241	hgsc.bcm.edu	37	1	167666567	167666567	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:167666567A>G	ENST00000367854.3	+	6	1037	c.706A>G	c.(706-708)Aag>Gag	p.K236E	RCSD1_ENST00000537350.1_Missense_Mutation_p.K206E	NM_052862.3	NP_443094.3	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1	236	RCSD.				cellular hyperosmotic response (GO:0071474)|skeletal muscle contraction (GO:0003009)	actin filament (GO:0005884)	actin filament binding (GO:0051015)	p.K236E(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	24	all_hematologic(923;0.215)					ACCTGCTGAAAAGCCTCCTCT	0.597																																					p.K236E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A706G	1						.						59.0	68.0	65.0					1																	167666567		2203	4300	6503	165933191	SO:0001583	missense	92241	exon6			BC072399	CCDS1263.1	1q24.2	2008-02-05			ENSG00000198771	ENSG00000198771			28310	protein-coding gene	gene with protein product		610579				12477932	Standard	NM_052862		Approved	MK2S4, MGC21854	uc001gem.3	Q6JBY9	OTTHUMG00000035318	ENST00000367854.3:c.706A>G	1.37:g.167666567A>G	ENSP00000356828:p.Lys236Glu	Somatic		Capture	SOLID	Phase_I	165933191	NM_052862	B1AK48|Q4G0E7|Q6IN93|Q8IZM2|Q96DX0|Q9NST4	Missense_Mutation	SNP	ENST00000367854.3	37	CCDS1263.1	.	.	.	.	.	.	.	.	.	.	A	15.73	2.920766	0.52653	.	.	ENSG00000198771	ENST00000367854;ENST00000537350	T;T	0.48201	0.83;0.82	5.09	2.79	0.32731	.	1.077850	0.07075	N	0.836117	T	0.16214	0.0390	L	0.27053	0.805	0.36621	D	0.875759	B;B	0.27791	0.156;0.189	B;B	0.31614	0.111;0.133	T	0.21586	-1.0241	9	0.21014	T	0.42	-24.9415	7.6678	0.28441	0.8326:0.0:0.1674:0.0	.	206;236	B7ZKW8;Q6JBY9	.;CPZIP_HUMAN	E	236;206	ENSP00000356828:K236E;ENSP00000439409:K206E	ENSP00000356828:K236E	K	+	1	0	RCSD1	165933191	0.987000	0.35691	0.014000	0.15608	0.462000	0.32619	1.898000	0.39809	0.781000	0.33589	0.477000	0.44152	AAG		RCSD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085451.1	NM_052862	
C1orf112	55732	hgsc.bcm.edu	37	1	169796873	169796873	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:169796873T>G	ENST00000286031.6	+	12	1719	c.1019T>G	c.(1018-1020)tTt>tGt	p.F340C	C1orf112_ENST00000359326.4_Missense_Mutation_p.F340C|C1orf112_ENST00000498289.1_3'UTR|C1orf112_ENST00000413811.2_Intron	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	340								p.F340C(1)		breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GAACTGCAGTTTCCACAATGT	0.398																																					p.F340C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1019G	1						.						374.0	370.0	371.0					1																	169796873		2203	4300	6503	168063497	SO:0001583	missense	55732	exon12			AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.1019T>G	1.37:g.169796873T>G	ENSP00000286031:p.Phe340Cys	Somatic		Capture	SOLID	Phase_I	168063497	NM_018186	A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Missense_Mutation	SNP	ENST00000286031.6	37	CCDS1285.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.021124	0.75275	.	.	ENSG00000000460	ENST00000359326;ENST00000286031	T;T	0.46819	0.86;0.86	5.53	5.53	0.82687	.	0.544205	0.22086	N	0.064826	T	0.49830	0.1580	L	0.50333	1.59	0.80722	D	1	D;D	0.61697	0.99;0.99	P;P	0.59546	0.8;0.859	T	0.55817	-0.8081	10	0.87932	D	0	-1.2347	13.6085	0.62061	0.0:0.0:0.0:1.0	.	282;340	B4DGF2;Q9NSG2	.;CA112_HUMAN	C	340	ENSP00000352276:F340C;ENSP00000286031:F340C	ENSP00000286031:F340C	F	+	2	0	C1orf112	168063497	0.994000	0.37717	0.967000	0.41034	0.819000	0.46315	6.705000	0.74644	2.103000	0.63969	0.402000	0.26972	TTT		C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087126.3	NM_018186	
PADI3	51702	hgsc.bcm.edu	37	1	17594444	17594444	+	Silent	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:17594444C>G	ENST00000375460.3	+	6	679	c.639C>G	c.(637-639)gtC>gtG	p.V213V		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	213					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)	p.V213V(1)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GGGCACAGGTCTTCCACATCT	0.587																																					p.V213V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C639G	1						.						175.0	121.0	140.0					1																	17594444		2203	4300	6503	17467031	SO:0001819	synonymous_variant	51702	exon6			AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.639C>G	1.37:g.17594444C>G		Somatic		Capture	SOLID	Phase_I	17467031	NM_016233	Q58EY7|Q70SX5	Silent	SNP	ENST00000375460.3	37	CCDS179.1																																																																																				PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006805.1		
METTL13	51603	hgsc.bcm.edu	37	1	171763536	171763536	+	Splice_Site	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:171763536C>A	ENST00000361735.3	+	7	1960	c.1694C>A	c.(1693-1695)gCa>gAa	p.A565E	METTL13_ENST00000458517.1_Splice_Site_p.A564E|METTL13_ENST00000362019.3_Splice_Site_p.A479E|METTL13_ENST00000466643.1_3'UTR|METTL13_ENST00000367737.5_Splice_Site_p.A409E	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	565							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						TTTTTCCCAGCACGGCCTTGC	0.443																																					p.A479E												.	.	0			c.C1436A	1						.						93.0	82.0	86.0					1																	171763536		2203	4300	6503	170030159	SO:0001630	splice_region_variant	51603	exon7			AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.1694-1C>A	1.37:g.171763536C>A		Somatic		Capture	SOLID	Phase_I	170030159	NM_014955	A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Missense_Mutation	SNP	ENST00000361735.3	37	CCDS1299.1	.	.	.	.	.	.	.	.	.	.	C	2.078	-0.411524	0.04799	.	.	ENSG00000010165	ENST00000458517;ENST00000362019;ENST00000367737;ENST00000361735;ENST00000367736;ENST00000341850	T;T;T;T;T	0.44083	2.25;1.52;1.93;2.25;0.93	5.01	-3.25	0.05079	.	0.519620	0.22386	N	0.060744	T	0.04861	0.0131	N	0.25426	0.745	0.26761	N	0.969994	B;B;B	0.21071	0.003;0.051;0.005	B;B;B	0.19666	0.015;0.023;0.026	T	0.33214	-0.9877	10	0.02654	T	1	.	0.7906	0.01057	0.1977:0.3381:0.2077:0.2565	.	564;409;565	B4E2X3;Q8N6R0-1;Q8N6R0	.;.;MTL13_HUMAN	E	564;479;409;565;265;262	ENSP00000401955:A564E;ENSP00000355393:A479E;ENSP00000356711:A409E;ENSP00000354920:A565E;ENSP00000356710:A265E	ENSP00000341732:A262E	A	+	2	0	METTL13	170030159	0.010000	0.17322	0.004000	0.12327	0.013000	0.08279	0.085000	0.14912	-0.355000	0.08199	-0.150000	0.13652	GCA		METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084528.5	NM_014955	Missense_Mutation
ASTN1	460	hgsc.bcm.edu	37	1	176998792	176998792	+	Silent	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:176998792T>A	ENST00000367654.3	-	5	1309	c.1098A>T	c.(1096-1098)tcA>tcT	p.S366S	MIR488_ENST00000365739.2_RNA|ASTN1_ENST00000367657.3_Silent_p.S366S|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000424564.2_Silent_p.S366S|ASTN1_ENST00000361833.2_Silent_p.S366S	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	366					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TCCTGCTCCTTGAAGGATCCG	0.552																																					p.S366S												.	.	0			c.A1098T	1						.						65.0	61.0	63.0					1																	176998792		2203	4300	6503	175265415	SO:0001819	synonymous_variant	460	exon5			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1098A>T	1.37:g.176998792T>A		Somatic		Capture	SOLID	Phase_I	175265415	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	ENST00000367654.3	37																																																																																					ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
TRMT1L	81627	hgsc.bcm.edu	37	1	185114622	185114622	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:185114622G>A	ENST00000367506.5	-	5	872	c.604C>T	c.(604-606)Cat>Tat	p.H202Y	TRMT1L_ENST00000367504.3_Missense_Mutation_p.H46Y	NM_001202423.1|NM_030934.4	NP_001189352.1|NP_112196.3	Q7Z2T5	TRM1L_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)-like	202					adult locomotory behavior (GO:0008344)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	21						CGCCTAACATGTCCTAGCATA	0.323																																					p.H202Y												.	.	0			c.C604T	1						.						193.0	180.0	184.0					1																	185114622		2203	4300	6503	183381245	SO:0001583	missense	81627	exon5			AF288399	CCDS1366.1	1q25.2	2012-06-29	2012-06-29	2011-01-24	ENSG00000121486	ENSG00000121486			16782	protein-coding gene	gene with protein product	"""TRM1-like"""	611673	"""chromosome 1 open reading frame 25"", ""TRM1 tRNA methyltransferase 1-like"""	C1orf25		11318611, 17198746	Standard	NM_030934		Approved		uc001grf.4	Q7Z2T5	OTTHUMG00000035389	ENST00000367506.5:c.604C>T	1.37:g.185114622G>A	ENSP00000356476:p.His202Tyr	Somatic		Capture	SOLID	Phase_I	183381245	NM_030934	Q5TEN0|Q6ZMX0|Q8IWH5|Q8NC68|Q9BZQ1	Missense_Mutation	SNP	ENST00000367506.5	37	CCDS1366.1	.	.	.	.	.	.	.	.	.	.	G	32	5.156686	0.94686	.	.	ENSG00000121486	ENST00000367504;ENST00000367506	.	.	.	5.66	5.66	0.87406	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.78610	0.4310	M	0.62723	1.935	0.58432	D	0.999997	D	0.69078	0.997	D	0.75484	0.986	T	0.78897	-0.2023	9	0.72032	D	0.01	-17.5815	20.1115	0.97913	0.0:0.0:1.0:0.0	.	202	Q7Z2T5	TRM1L_HUMAN	Y	46;202	.	ENSP00000356474:H46Y	H	-	1	0	TRMT1L	183381245	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.887000	0.92456	2.814000	0.96858	0.655000	0.94253	CAT		TRMT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085787.1	NM_030934	
HMCN1	83872	hgsc.bcm.edu	37	1	185972923	185972923	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:185972923A>C	ENST00000271588.4	+	29	4651	c.4422A>C	c.(4420-4422)gaA>gaC	p.E1474D	HMCN1_ENST00000367492.2_Missense_Mutation_p.E1474D	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1474	Ig-like C2-type 12.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TCGCCCTTGAATGCCAGGTCA	0.413																																					p.E1474D												.	.	0			c.A4422C	1						.						153.0	126.0	135.0					1																	185972923		2203	4300	6503	184239546	SO:0001583	missense	83872	exon29			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.4422A>C	1.37:g.185972923A>C	ENSP00000271588:p.Glu1474Asp	Somatic		Capture	SOLID	Phase_I	184239546	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	18.09	3.545126	0.65198	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68479	-0.33;-0.33	5.86	-3.76	0.04359	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.045602	0.85682	D	0.000000	T	0.51432	0.1674	L	0.39397	1.21	0.39759	D	0.972005	P	0.36990	0.577	B	0.36378	0.223	T	0.46373	-0.9196	10	0.36615	T	0.2	.	13.261	0.60104	0.5155:0.0:0.4845:0.0	.	1474	Q96RW7	HMCN1_HUMAN	D	1474	ENSP00000271588:E1474D;ENSP00000356462:E1474D	ENSP00000271588:E1474D	E	+	3	2	HMCN1	184239546	0.769000	0.28531	0.797000	0.32132	0.945000	0.59286	-0.028000	0.12350	-0.541000	0.06257	0.528000	0.53228	GAA		HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HMCN1	83872	hgsc.bcm.edu	37	1	186143663	186143663	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:186143663G>C	ENST00000271588.4	+	103	16061	c.15832G>C	c.(15832-15834)Gat>Cat	p.D5278H	HMCN1_ENST00000367492.2_Missense_Mutation_p.D5278H|GS1-174L6.4_ENST00000428391.1_RNA	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5278	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TGAATGTAAAGATGGGACCCA	0.398																																					p.D5278H												.	.	0			c.G15832C	1						.						135.0	118.0	124.0					1																	186143663		2203	4300	6503	184410286	SO:0001583	missense	83872	exon103			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.15832G>C	1.37:g.186143663G>C	ENSP00000271588:p.Asp5278His	Somatic		Capture	SOLID	Phase_I	184410286	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253801	0.80135	.	.	ENSG00000143341	ENST00000271588;ENST00000367492;ENST00000414277	D;D;D	0.95518	-3.04;-3.73;-3.04	5.6	5.6	0.85130	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.043354	0.85682	D	0.000000	D	0.95843	0.8647	L	0.33485	1.01	0.58432	D	0.999999	D	0.89917	1.0	D	0.72338	0.977	D	0.95182	0.8300	10	0.38643	T	0.18	.	15.917	0.79527	0.0:0.0:0.8644:0.1356	.	5278	Q96RW7	HMCN1_HUMAN	H	5278;5278;70	ENSP00000271588:D5278H;ENSP00000356462:D5278H;ENSP00000406205:D70H	ENSP00000271588:D5278H	D	+	1	0	HMCN1	184410286	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.901000	0.87382	2.640000	0.89533	0.655000	0.94253	GAT		HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
UBR4	23352	hgsc.bcm.edu	37	1	19419381	19419381	+	Missense_Mutation	SNP	A	A	G	rs550273146		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:19419381A>G	ENST00000375254.3	-	97	14170	c.14143T>C	c.(14143-14145)Tct>Cct	p.S4715P	UBR4_ENST00000543981.1_Missense_Mutation_p.S379P|UBR4_ENST00000429347.2_Missense_Mutation_p.S238P|UBR4_ENST00000375217.2_Missense_Mutation_p.S4708P|UBR4_ENST00000375224.1_Missense_Mutation_p.S422P|UBR4_ENST00000375226.2_Missense_Mutation_p.S4691P|UBR4_ENST00000375267.2_Missense_Mutation_p.S4715P|UBR4_ENST00000467272.2_5'Flank	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	4715					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S4715P(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GCTGGGCGAGACAAAAACTTT	0.537																																					p.S4715P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T14143C	1						.						38.0	36.0	37.0					1																	19419381		2203	4300	6503	19291968	SO:0001583	missense	23352	exon97			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.14143T>C	1.37:g.19419381A>G	ENSP00000364403:p.Ser4715Pro	Somatic		Capture	SOLID	Phase_I	19291968	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	A	19.35	3.810435	0.70797	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000375224;ENST00000429347;ENST00000543981	T;T;T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42;1.42;1.42	6.04	6.04	0.98038	.	0.112193	0.64402	D	0.000007	T	0.47581	0.1453	M	0.76328	2.33	0.58432	D	0.999999	B;B;P;B	0.35208	0.157;0.274;0.49;0.13	B;B;P;B	0.45577	0.276;0.276;0.486;0.116	T	0.49184	-0.8966	10	0.87932	D	0	.	15.4125	0.74937	1.0:0.0:0.0:0.0	.	379;238;4715;4691	B4DYV5;B4DPF6;Q5T4S7;Q5T4S7-3	.;.;UBR4_HUMAN;.	P	4715;4715;4708;4691;422;238;379	ENSP00000364403:S4715P;ENSP00000364416:S4715P;ENSP00000364365:S4708P;ENSP00000364374:S4691P;ENSP00000364372:S422P;ENSP00000394173:S238P;ENSP00000444070:S379P	ENSP00000364365:S4708P	S	-	1	0	UBR4	19291968	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.426000	0.66476	2.317000	0.78254	0.460000	0.39030	TCT		UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
HMCN1	83872	hgsc.bcm.edu	37	1	186147575	186147575	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:186147575A>C	ENST00000271588.4	+	104	16200	c.15971A>C	c.(15970-15972)aAa>aCa	p.K5324T	HMCN1_ENST00000367492.2_Intron|GS1-174L6.4_ENST00000428391.1_RNA	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5324	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAAGTGCCTAAACCTTGTGCA	0.418																																					p.K5324T												.	.	0			c.A15971C	1						.						81.0	82.0	82.0					1																	186147575		2203	4300	6503	184414198	SO:0001583	missense	83872	exon104			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.15971A>C	1.37:g.186147575A>C	ENSP00000271588:p.Lys5324Thr	Somatic		Capture	SOLID	Phase_I	184414198	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	14.87	2.664550	0.47572	.	.	ENSG00000143341	ENST00000271588	D	0.92348	-3.02	6.07	2.49	0.30216	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.194285	0.53938	D	0.000042	D	0.83087	0.5178	L	0.31420	0.93	0.80722	D	1	B	0.21071	0.051	B	0.18263	0.021	T	0.68973	-0.5268	10	0.11794	T	0.64	.	7.0432	0.25031	0.7448:0.1256:0.1296:0.0	.	5324	Q96RW7	HMCN1_HUMAN	T	5324	ENSP00000271588:K5324T	ENSP00000271588:K5324T	K	+	2	0	HMCN1	184414198	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	2.628000	0.46477	0.177000	0.19895	0.533000	0.62120	AAA		HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
KIF21B	23046	hgsc.bcm.edu	37	1	200974736	200974736	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:200974736C>A	ENST00000422435.2	-	4	850	c.534G>T	c.(532-534)gaG>gaT	p.E178D	KIF21B_ENST00000461742.2_Missense_Mutation_p.E178D|KIF21B_ENST00000360529.5_Missense_Mutation_p.E178D|KIF21B_ENST00000332129.2_Missense_Mutation_p.E178D	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	178	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						CGTTTGCGTCCTCGTGGATCT	0.602																																					p.E178D												.	.	0			c.G534T	1						.						219.0	177.0	192.0					1																	200974736		2203	4300	6503	199241359	SO:0001583	missense	23046	exon4			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.534G>T	1.37:g.200974736C>A	ENSP00000411831:p.Glu178Asp	Somatic		Capture	SOLID	Phase_I	199241359	NM_017596	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506905	0.44558	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13	5.27	2.35	0.29111	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.83801	0.5333	M	0.62723	1.935	0.58432	D	0.999994	D;D;D;D	0.69078	0.997;0.997;0.992;0.996	D;D;D;D	0.79108	0.992;0.992;0.989;0.987	T	0.83255	-0.0051	10	0.87932	D	0	.	9.743	0.40429	0.0:0.7159:0.0:0.2841	.	178;178;178;178	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	D	178	ENSP00000328494:E178D;ENSP00000353724:E178D;ENSP00000433808:E178D;ENSP00000411831:E178D	ENSP00000328494:E178D	E	-	3	2	KIF21B	199241359	0.997000	0.39634	0.990000	0.47175	0.123000	0.20343	0.536000	0.23129	0.604000	0.29930	-0.140000	0.14226	GAG		KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
CACNA1S	779	hgsc.bcm.edu	37	1	201054121	201054121	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:201054121T>A	ENST00000362061.3	-	9	1415	c.1189A>T	c.(1189-1191)Agc>Tgc	p.S397C	CACNA1S_ENST00000367338.3_Missense_Mutation_p.S397C	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	397					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.S397C(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TCATACAGGCTCTCTGTGTCA	0.552																																					p.S397C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1189T	1						.						71.0	80.0	77.0					1																	201054121		2203	4300	6503	199320744	SO:0001583	missense	779	exon9			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.1189A>T	1.37:g.201054121T>A	ENSP00000355192:p.Ser397Cys	Somatic		Capture	SOLID	Phase_I	199320744	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.391998	0.83011	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.96491	-4.03;-3.96	5.02	5.02	0.67125	.	0.731895	0.11244	U	0.584302	D	0.98201	0.9405	M	0.88775	2.98	0.45330	D	0.998325	D	0.76494	0.999	D	0.65010	0.931	D	0.97282	0.9918	10	0.87932	D	0	.	13.2965	0.60301	0.0:0.0:0.0:1.0	.	397	Q13698	CAC1S_HUMAN	C	397	ENSP00000355192:S397C;ENSP00000356307:S397C	ENSP00000355192:S397C	S	-	1	0	CACNA1S	199320744	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.273000	0.78527	1.877000	0.54381	0.467000	0.42956	AGC		CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
TNNT2	7139	hgsc.bcm.edu	37	1	201333493	201333493	+	Missense_Mutation	SNP	C	C	T	rs397516464		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:201333493C>T	ENST00000509001.1	-	10	678	c.392G>A	c.(391-393)cGg>cAg	p.R131Q	TNNT2_ENST00000367318.5_Missense_Mutation_p.R131Q|TNNT2_ENST00000367320.2_Missense_Mutation_p.R101Q|TNNT2_ENST00000236918.7_Missense_Mutation_p.R136Q|TNNT2_ENST00000367322.1_Missense_Mutation_p.R131Q|TNNT2_ENST00000367315.2_Missense_Mutation_p.R131Q|TNNT2_ENST00000458432.2_Missense_Mutation_p.R143Q|TNNT2_ENST00000421663.2_Missense_Mutation_p.R133Q|TNNT2_ENST00000460780.1_5'Flank|TNNT2_ENST00000367317.4_Missense_Mutation_p.R131Q|TNNT2_ENST00000360372.4_Missense_Mutation_p.R126Q	NM_001276347.1	NP_001263276.1	P45379	TNNT2_HUMAN	troponin T type 2 (cardiac)	141					ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|muscle filament sliding (GO:0030049)|negative regulation of ATPase activity (GO:0032780)|positive regulation of ATPase activity (GO:0032781)|regulation of heart contraction (GO:0008016)|regulation of muscle contraction (GO:0006937)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle thin filament (GO:0005865)|troponin complex (GO:0005861)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)	p.R131Q(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(9)	20						CCGCTCTGCCCGACGTCTCTC	0.627																																					p.R141Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G422A	1						.						40.0	35.0	37.0					1																	201333493		2203	4300	6503	199600116	SO:0001583	missense	7139	exon11			X74819	CCDS30968.1, CCDS30969.1, CCDS60390.1, CCDS73002.1, CCDS73003.1	1q32	2014-09-17	2005-09-12		ENSG00000118194	ENSG00000118194			11949	protein-coding gene	gene with protein product		191045	"""troponin T2, cardiac"", ""cardiomyopathy, hypertrophic 2"", ""cardiomyopathy, dilated 1D (autosomal dominant)"""	CMH2, CMD1D		8088824, 8205619, 9482583	Standard	NM_001001430		Approved	CMPD2	uc001gwf.4	P45379	OTTHUMG00000035733	ENST00000509001.1:c.392G>A	1.37:g.201333493C>T	ENSP00000422031:p.Arg131Gln	Somatic		Capture	SOLID	Phase_I	199600116	NM_000364	A2TDB9|A8K3K6|O60214|Q99596|Q99597|Q9BUF6|Q9UM96	Missense_Mutation	SNP	ENST00000509001.1	37	CCDS30969.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.980549	0.74474	.	.	ENSG00000118194	ENST00000367322;ENST00000367318;ENST00000458432;ENST00000421663;ENST00000236918;ENST00000367317;ENST00000367315;ENST00000360372;ENST00000357848;ENST00000367319;ENST00000367320;ENST00000509001;ENST00000438742;ENST00000455702	D;D;D;D;D;D;D;D;D;D;D;D	0.99113	-3.02;-3.02;-3.02;-3.02;-5.26;-3.02;-3.02;-5.26;-5.44;-3.02;-3.02;-3.02	4.28	4.28	0.50868	.	0.000000	0.85682	D	0.000000	D	0.99223	0.9730	M	0.82630	2.6	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.78314	0.973;0.985;0.985;0.991;0.987;0.985	D	0.99180	1.0867	10	0.87932	D	0	-17.6628	15.2601	0.73615	0.0:1.0:0.0:0.0	.	126;143;140;141;131;141	E7EPW4;F8WAF6;P45379-3;P45379;Q9BUF6;P45379-10	.;.;.;TNNT2_HUMAN;.;.	Q	131;131;143;133;136;131;131;126;127;72;101;131;126;141	ENSP00000356291:R131Q;ENSP00000356287:R131Q;ENSP00000387874:R143Q;ENSP00000404134:R133Q;ENSP00000236918:R136Q;ENSP00000356286:R131Q;ENSP00000356284:R131Q;ENSP00000353535:R126Q;ENSP00000356289:R101Q;ENSP00000422031:R131Q;ENSP00000414036:R126Q;ENSP00000402238:R141Q	ENSP00000236918:R136Q	R	-	2	0	TNNT2	199600116	0.974000	0.33945	0.960000	0.40013	0.203000	0.24098	7.426000	0.80270	1.926000	0.55796	0.491000	0.48974	CGG		TNNT2-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360358.1	NM_000364	
FAM71A	149647	hgsc.bcm.edu	37	1	212798547	212798547	+	Missense_Mutation	SNP	C	C	T	rs75853115		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:212798547C>T	ENST00000294829.3	+	1	759	c.328C>T	c.(328-330)Cgc>Tgc	p.R110C	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	110						nucleus (GO:0005634)		p.R110C(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		GAGAAAAAAACGCAAGGCAGC	0.552																																					p.R110C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C328T	1						.	C	CYS/ARG	0,4406		0,0,2203	67.0	71.0	70.0		328	4.5	0.0	1	dbSNP_131	70	1,8599	1.2+/-3.3	0,1,4299	no	missense	FAM71A	NM_153606.3	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	110/595	212798547	1,13005	2203	4300	6503	210865170	SO:0001583	missense	149647	exon1				CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.328C>T	1.37:g.212798547C>T	ENSP00000294829:p.Arg110Cys	Somatic		Capture	SOLID	Phase_I	210865170	NM_153606	Q5VTZ1	Missense_Mutation	SNP	ENST00000294829.3	37	CCDS1507.1	.	.	.	.	.	.	.	.	.	.	C	6.405	0.442817	0.12164	0.0	1.16E-4	ENSG00000162771	ENST00000294829	T	0.04015	3.73	4.53	4.53	0.55603	.	0.594469	0.14986	N	0.286943	T	0.09158	0.0226	L	0.33093	0.98	0.09310	N	0.999999	D	0.76494	0.999	P	0.54965	0.765	T	0.28870	-1.0030	10	0.33141	T	0.24	-8.0943	13.0067	0.58710	0.0:1.0:0.0:0.0	.	110	Q8IYT1	FA71A_HUMAN	C	110	ENSP00000294829:R110C	ENSP00000294829:R110C	R	+	1	0	FAM71A	210865170	0.002000	0.14202	0.008000	0.14137	0.009000	0.06853	0.827000	0.27421	2.521000	0.84997	0.557000	0.71058	CGC		FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098529.1	NM_153606	
USH2A	7399	hgsc.bcm.edu	37	1	216074120	216074120	+	Silent	SNP	G	G	A	rs150372183		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:216074120G>A	ENST00000307340.3	-	39	7814	c.7428C>T	c.(7426-7428)ggC>ggT	p.G2476G	RP5-1111A8.3_ENST00000414995.1_RNA|USH2A_ENST00000366943.2_Silent_p.G2476G	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2476	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.G2476G(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGGTGGAGTCGCCAGACCTCA	0.453										HNSCC(13;0.011)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		16809	0.0		0.0	False		,,,				2504	0.0				p.G2476G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C7428T	1						.	G		2,4404	4.2+/-10.8	0,2,2201	91.0	91.0	91.0		7428	0.6	0.0	1	dbSNP_134	91	0,8600		0,0,4300	no	coding-synonymous	USH2A	NM_206933.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		2476/5203	216074120	2,13004	2203	4300	6503	214140743	SO:0001819	synonymous_variant	7399	exon39			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7428C>T	1.37:g.216074120G>A		Somatic		Capture	SOLID	Phase_I	214140743	NM_206933	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																				USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
SLC2A7	155184	hgsc.bcm.edu	37	1	9083076	9083076	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:9083076T>G	ENST00000400906.1	-	3	211	c.212A>C	c.(211-213)aAg>aCg	p.K71T		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	71					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)	p.K71T(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		CAGCATGAGCTTCCCGTCCAT	0.522																																					p.K71T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A212C	1						.						179.0	162.0	167.0					1																	9083076		2203	4300	6503	9005663	SO:0001583	missense	155184	exon3			AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.212A>C	1.37:g.9083076T>G	ENSP00000383698:p.Lys71Thr	Somatic		Capture	SOLID	Phase_I	9005663	NM_207420	A2A333	Missense_Mutation	SNP	ENST00000400906.1	37	CCDS98.2	.	.	.	.	.	.	.	.	.	.	T	9.829	1.187983	0.21954	.	.	ENSG00000197241	ENST00000400906	T	0.80304	-1.36	4.68	-5.93	0.02254	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.722949	0.13021	U	0.420113	T	0.42337	0.1198	N	0.01134	-0.995	0.09310	N	1	B	0.10296	0.003	B	0.19666	0.026	T	0.50491	-0.8822	10	0.14656	T	0.56	.	4.0145	0.09637	0.1173:0.449:0.2337:0.2	.	71	Q6PXP3	GTR7_HUMAN	T	71	ENSP00000383698:K71T	ENSP00000383698:K71T	K	-	2	0	SLC2A7	9005663	0.000000	0.05858	0.000000	0.03702	0.371000	0.29859	-0.913000	0.04042	-0.632000	0.05553	0.454000	0.30748	AAG		SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127768.3	NM_207420	
PITHD1	57095	hgsc.bcm.edu	37	1	24112224	24112224	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:24112224T>C	ENST00000246151.4	+	4	491	c.380T>C	c.(379-381)tTt>tCt	p.F127S	PITHD1_ENST00000374524.1_Missense_Mutation_p.F14S	NM_020362.4	NP_065095.2	Q9GZP4	PITH1_HUMAN	PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1	127	PITH. {ECO:0000255|PROSITE- ProRule:PRU00864}.					nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	6						GATCAGACCTTTAGTCTGAAC	0.413																																					p.F127S												.	.	0			c.T380C	1						.						94.0	88.0	90.0					1																	24112224		2203	4300	6503	23984811	SO:0001583	missense	57095	exon4				CCDS240.1	1p36.11	2011-02-21	2011-02-21	2011-02-21	ENSG00000057757	ENSG00000057757			25022	protein-coding gene	gene with protein product	"""TXNL1 C-terminal like"""		"""chromosome 1 open reading frame 128"""	C1orf128		12477932	Standard	NM_020362		Approved	HT014, TXNL1CL	uc001bhq.3	Q9GZP4	OTTHUMG00000002960	ENST00000246151.4:c.380T>C	1.37:g.24112224T>C	ENSP00000246151:p.Phe127Ser	Somatic		Capture	SOLID	Phase_I	23984811	NM_020362	B2R7J4|Q5QPN6|Q5QPN7|Q9NRI8	Missense_Mutation	SNP	ENST00000246151.4	37	CCDS240.1	.	.	.	.	.	.	.	.	.	.	T	33	5.209834	0.95069	.	.	ENSG00000057757	ENST00000246151;ENST00000415372;ENST00000374524	.	.	.	5.98	5.98	0.97165	Proteasome-interacting thioredoxin-like domain, C-terminal (2);Galactose-binding domain-like (1);	0.043564	0.85682	D	0.000000	D	0.84566	0.5500	M	0.89414	3.03	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.86675	0.1913	9	0.54805	T	0.06	-0.003	16.4622	0.84064	0.0:0.0:0.0:1.0	.	127	Q9GZP4	PITH1_HUMAN	S	127;34;14	.	ENSP00000246151:F127S	F	+	2	0	PITHD1	23984811	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.920000	0.87521	2.289000	0.77006	0.533000	0.62120	TTT		PITHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008243.1	NM_020362	
NCMAP	400746	hgsc.bcm.edu	37	1	24927503	24927503	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:24927503A>C	ENST00000374392.2	+	3	221	c.155A>C	c.(154-156)aAg>aCg	p.K52T	NCMAP_ENST00000486262.1_3'UTR	NM_001010980.4	NP_001010980.1	Q5T1S8	NCMAP_HUMAN	noncompact myelin associated protein	52					peripheral nervous system myelin formation (GO:0032290)|positive regulation of myelination (GO:0031643)	integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|Schmidt-Lanterman incisure (GO:0043220)	structural constituent of myelin sheath (GO:0019911)										ATCCTGCTGAAGATGTACAAC	0.512																																					p.K52T												.	.	0			c.A155C	1						.						241.0	190.0	208.0					1																	24927503		2203	4300	6503	24800090	SO:0001583	missense	400746	exon3			AK124519	CCDS30632.1	1p36.11	2012-07-31	2012-07-31	2012-07-31	ENSG00000184454	ENSG00000184454			29332	protein-coding gene	gene with protein product	"""myelin protein of 11 kDa"""		"""chromosome 1 open reading frame 130"""	C1orf130		18650334	Standard	NM_001010980		Approved	FLJ42528, MP11	uc001bjk.2	Q5T1S8	OTTHUMG00000003317	ENST00000374392.2:c.155A>C	1.37:g.24927503A>C	ENSP00000363513:p.Lys52Thr	Somatic		Capture	SOLID	Phase_I	24800090	NM_001010980	A0PK04|B2RV34	Missense_Mutation	SNP	ENST00000374392.2	37	CCDS30632.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.656272	0.88056	.	.	ENSG00000184454	ENST00000374392	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.67287	0.2877	L	0.36672	1.1	0.41841	D	0.990122	D	0.76494	0.999	D	0.83275	0.996	T	0.70788	-0.4777	9	0.87932	D	0	-28.3981	13.6684	0.62409	1.0:0.0:0.0:0.0	.	52	Q5T1S8	CA130_HUMAN	T	52	.	ENSP00000363513:K52T	K	+	2	0	C1orf130	24800090	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.575000	0.67430	2.265000	0.75225	0.482000	0.46254	AAG		NCMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009288.2	NM_001010980	
GPATCH3	63906	hgsc.bcm.edu	37	1	27217658	27217658	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:27217658A>T	ENST00000361720.5	-	7	1444	c.1421T>A	c.(1420-1422)tTg>tAg	p.L474*	GPN2_ENST00000461282.1_5'Flank|GPN2_ENST00000374135.4_5'Flank	NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN	G patch domain containing 3	474							nucleic acid binding (GO:0003676)			endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		GATGAGCCCCAAGCCATTTCT	0.552																																					p.L474X												.	.	0			c.T1421A	1						.						43.0	41.0	42.0					1																	27217658		2203	4300	6503	27090245	SO:0001587	stop_gained	63906	exon7			BC007767	CCDS290.1	1p35.3-p35.1	2013-01-28		2006-12-13	ENSG00000198746	ENSG00000198746		"""G patch domain containing"""	25720	protein-coding gene	gene with protein product				GPATC3			Standard	NM_022078		Approved	FLJ12455	uc001bne.3	Q96I76	OTTHUMG00000004229	ENST00000361720.5:c.1421T>A	1.37:g.27217658A>T	ENSP00000354645:p.Leu474*	Somatic		Capture	SOLID	Phase_I	27090245	NM_022078	Q5JYH2|Q8NDJ2|Q9H9Z3	Nonsense_Mutation	SNP	ENST00000361720.5	37	CCDS290.1	.	.	.	.	.	.	.	.	.	.	A	15.57	2.873366	0.51695	.	.	ENSG00000198746	ENST00000361720;ENST00000536641;ENST00000450844	.	.	.	5.18	4.04	0.47022	.	0.659704	0.13067	N	0.416383	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-3.0956	1.8351	0.03138	0.5662:0.1755:0.0908:0.1676	.	.	.	.	X	474;456;92	.	ENSP00000354645:L474X	L	-	2	0	GPATCH3	27090245	0.006000	0.16342	0.944000	0.38274	0.225000	0.24961	2.172000	0.42463	0.970000	0.38263	-0.327000	0.08410	TTG		GPATCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012181.1	NM_022078	
TXLNA	200081	hgsc.bcm.edu	37	1	32657961	32657961	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:32657961A>T	ENST00000373609.1	+	6	1294	c.1013A>T	c.(1012-1014)gAt>gTt	p.D338V	TXLNA_ENST00000373610.3_Missense_Mutation_p.D338V			P40222	TXLNA_HUMAN	taxilin alpha	338					B cell activation (GO:0042113)|cell proliferation (GO:0008283)|exocytosis (GO:0006887)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	cytokine activity (GO:0005125)|high molecular weight B cell growth factor receptor binding (GO:0030372)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CAGCTGGTGGATGCCAAGCTC	0.572																																					p.D338V												.	.	0			c.A1013T	1						.						75.0	73.0	73.0					1																	32657961		2203	4300	6503	32430548	SO:0001583	missense	200081	exon7			AF516206	CCDS353.1	1p35	2012-02-21			ENSG00000084652	ENSG00000084652			30685	protein-coding gene	gene with protein product		608676				15184072, 14623251	Standard	NM_175852		Approved	DKFZp451J0118	uc001bui.3	P40222	OTTHUMG00000004423	ENST00000373609.1:c.1013A>T	1.37:g.32657961A>T	ENSP00000362711:p.Asp338Val	Somatic		Capture	SOLID	Phase_I	32430548	NM_175852	D3DPP6|Q5TFJ6|Q66K62|Q86T54|Q86T85|Q86T86|Q86Y86|Q86YW3|Q8N2Y3	Missense_Mutation	SNP	ENST00000373609.1	37	CCDS353.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.831490	0.91036	.	.	ENSG00000084652	ENST00000373610;ENST00000373609	T;T	0.78481	-1.18;-1.18	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.87916	0.6298	M	0.77486	2.375	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	D	0.89441	0.3723	10	0.87932	D	0	-26.4471	15.988	0.80176	1.0:0.0:0.0:0.0	.	338	P40222	TXLNA_HUMAN	V	338	ENSP00000362712:D338V;ENSP00000362711:D338V	ENSP00000362711:D338V	D	+	2	0	TXLNA	32430548	1.000000	0.71417	0.982000	0.44146	0.994000	0.84299	9.339000	0.96797	2.243000	0.73865	0.477000	0.44152	GAT		TXLNA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012844.1	NM_175852	
TMEM234	56063	hgsc.bcm.edu	37	1	32690044	32690044	+	5'Flank	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:32690044A>T	ENST00000344461.3	-	0	0				EIF3I_ENST00000373586.1_Missense_Mutation_p.D73V|TMEM234_ENST00000545122.1_5'Flank|TMEM234_ENST00000309777.6_5'Flank|EIF3I_ENST00000471486.1_3'UTR|TMEM234_ENST00000373593.1_5'Flank			Q8WY98	TM234_HUMAN	transmembrane protein 234							integral component of membrane (GO:0016021)		p.D73V(1)		kidney(2)|lung(3)	5						GGCTCAGCTGACAACAGCTGT	0.473																																					p.D73V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A218T	1						.						102.0	92.0	95.0					1																	32690044		2203	4300	6503	32462631	SO:0001631	upstream_gene_variant	8668	exon4			AY358586	CCDS356.2	1p36.11-p34.2	2011-02-14	2011-02-14	2011-02-14	ENSG00000160055	ENSG00000160055			28837	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 91"""	C1orf91		12477932	Standard	XM_005271045		Approved	RP4-622L5, dJ622L5.7, FLJ90779	uc001buq.4	Q8WY98	OTTHUMG00000005742		1.37:g.32690044A>T	Exception_encountered	Somatic		Capture	SOLID	Phase_I	32462631	NM_003757	B2R535|D3DPP7|Q6UWY9|Q8N2H6|Q9BSR2|Q9NU76	Missense_Mutation	SNP	ENST00000344461.3	37		.	.	.	.	.	.	.	.	.	.	A	25.3	4.620797	0.87460	.	.	ENSG00000084623	ENST00000355082;ENST00000373586	D;D	0.89415	-2.51;-2.51	4.48	4.48	0.54585	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.044148	0.85682	D	0.000000	D	0.96911	0.8991	H	0.99182	4.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98435	1.0584	10	0.87932	D	0	-16.7259	14.5241	0.67875	1.0:0.0:0.0:0.0	.	73	Q13347	EIF3I_HUMAN	V	73	ENSP00000347194:D73V;ENSP00000362688:D73V	ENSP00000347194:D73V	D	+	2	0	EIF3I	32462631	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.458000	0.90364	1.978000	0.57642	0.529000	0.55759	GAC		TMEM234-009	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000092260.2	NM_019118	
HDAC1	3065	hgsc.bcm.edu	37	1	32793175	32793175	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:32793175A>G	ENST00000373548.3	+	6	617	c.533A>G	c.(532-534)cAc>cGc	p.H178R	HDAC1_ENST00000490081.1_3'UTR|HDAC1_ENST00000373541.2_5'UTR	NM_004964.2	NP_004955.2	Q13547	HDAC1_HUMAN	histone deacetylase 1	178	Histone deacetylase.				ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|mitotic cell cycle (GO:0000278)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deacetylation (GO:0006476)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18		Breast(348;0.000523)|Lung NSC(340;0.000992)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Lung SC(1967;0.113)		KIRC - Kidney renal clear cell carcinoma(1967;0.138)	Vorinostat(DB02546)	ATTGATATTCACCATGGTGAC	0.557																																					p.H178R												.	.	0			c.A533G	1						.						128.0	112.0	118.0					1																	32793175		2203	4300	6503	32565762	SO:0001583	missense	3065	exon6			D50405	CCDS360.1	1p34	2008-02-05			ENSG00000116478	ENSG00000116478			4852	protein-coding gene	gene with protein product		601241		RPD3L1		8602529	Standard	NM_004964		Approved	HD1, GON-10	uc001bvb.1	Q13547	OTTHUMG00000007529	ENST00000373548.3:c.533A>G	1.37:g.32793175A>G	ENSP00000362649:p.His178Arg	Somatic		Capture	SOLID	Phase_I	32565762	NM_004964	Q92534	Missense_Mutation	SNP	ENST00000373548.3	37	CCDS360.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.998680	0.74818	.	.	ENSG00000116478	ENST00000373548;ENST00000428704	D;D	0.97430	-4.38;-1.88	4.83	4.83	0.62350	Histone deacetylase domain (2);	0.130282	0.64402	D	0.000001	D	0.99171	0.9713	H	0.99104	4.43	0.80722	D	1	D;D	0.89917	1.0;0.975	D;D	0.97110	1.0;0.918	D	0.98667	1.0686	10	0.87932	D	0	-21.1012	14.8815	0.70537	1.0:0.0:0.0:0.0	.	178;178	B4DSK9;Q13547	.;HDAC1_HUMAN	R	178;153	ENSP00000362649:H178R;ENSP00000407859:H153R	ENSP00000362649:H178R	H	+	2	0	HDAC1	32565762	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.139000	0.94554	2.168000	0.68352	0.533000	0.62120	CAC		HDAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019815.3	NM_004964	
SH3D21	79729	hgsc.bcm.edu	37	1	36785523	36785523	+	Missense_Mutation	SNP	T	T	A	rs199774281		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:36785523T>A	ENST00000426732.2	+	13	1196	c.911T>A	c.(910-912)gTg>gAg	p.V304E	SH3D21_ENST00000453908.2_Missense_Mutation_p.V420E|SH3D21_ENST00000505871.1_Missense_Mutation_p.V309E|EVA1B_ENST00000490466.1_5'Flank|SH3D21_ENST00000312808.4_Missense_Mutation_p.V66E			A4FU49	SH321_HUMAN	SH3 domain containing 21	304						extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(6)|lung(4)|pancreas(1)	12						GAGAAGATGGTGACTCCGGAG	0.567																																					p.V309E												.	.	0			c.T926A	1						.						58.0	64.0	62.0					1																	36785523		2203	4300	6503	36558110	SO:0001583	missense	79729	exon11			AK056459	CCDS30674.1, CCDS30674.2	1p34.3	2011-02-21	2011-02-21	2011-02-21	ENSG00000214193	ENSG00000214193			26236	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 113"""	C1orf113		12477932	Standard	NM_024676		Approved	FLJ22938	uc010oia.1	A4FU49	OTTHUMG00000007868	ENST00000426732.2:c.911T>A	1.37:g.36785523T>A	ENSP00000408613:p.Val304Glu	Somatic		Capture	SOLID	Phase_I	36558110	NM_024676	B4DLI6|D3DPS6|J3KQM5|Q5VTK7|Q86XZ6|Q8N445|Q96DN4|Q9H5W5	Missense_Mutation	SNP	ENST00000426732.2	37		.	.	.	.	.	.	.	.	.	.	T	9.125	1.009889	0.19277	.	.	ENSG00000214193	ENST00000453908;ENST00000426732;ENST00000312808;ENST00000505871	T;T;T;T	0.54479	1.15;1.6;0.57;1.62	2.63	-5.25	0.02781	.	50.916300	0.00166	N	0.000009	T	0.37461	0.1004	L	0.40543	1.245	0.09310	N	1	P;P	0.40834	0.73;0.652	B;B	0.33960	0.173;0.161	T	0.39143	-0.9628	9	.	.	.	.	6.3054	0.21135	0.1339:0.4748:0.0:0.3913	.	309;304	A4FU49-3;A4FU49	.;SH321_HUMAN	E	420;304;66;309	ENSP00000403476:V420E;ENSP00000408613:V304E;ENSP00000321936:V66E;ENSP00000421294:V309E	.	V	+	2	0	SH3D21	36558110	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.068000	0.01382	-1.964000	0.01012	-0.468000	0.05107	GTG		SH3D21-202	KNOWN	basic	protein_coding	protein_coding		NM_024676	
PTPRF	5792	hgsc.bcm.edu	37	1	44085361	44085361	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:44085361G>C	ENST00000359947.4	+	29	5283	c.4943G>C	c.(4942-4944)aGc>aCc	p.S1648T	PTPRF_ENST00000438120.1_Missense_Mutation_p.S1639T|PTPRF_ENST00000422171.2_Missense_Mutation_p.S1007T|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000372413.3_Missense_Mutation_p.S1639T|PTPRF_ENST00000372414.3_Missense_Mutation_p.S1648T	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1648	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.S1638T(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TTGCTGGCCAGCTCCAAGGCC	0.602																																					p.S1639T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4916C	1						.						92.0	79.0	83.0					1																	44085361		2203	4300	6503	43857948	SO:0001583	missense	5792	exon28			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.4943G>C	1.37:g.44085361G>C	ENSP00000353030:p.Ser1648Thr	Somatic		Capture	SOLID	Phase_I	43857948	NM_130440	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	37	CCDS489.2	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	6.787|6.787|6.787	0.514263|0.514263|0.514263	0.12944|0.12944|0.12944	.|.|.	.|.|.	ENSG00000142949|ENSG00000142949|ENSG00000142949	ENST00000429895|ENST00000412568;ENST00000414879|ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171;ENST00000372407	.|.|T;T;T;T;T;T	.|.|0.12255	.|.|2.7;2.7;2.7;2.7;2.7;2.7	5.01|5.01|5.01	2.09|2.09|2.09	0.27110|0.27110|0.27110	.|.|Protein-tyrosine phosphatase, receptor/non-receptor type (2);	.|.|0.380565	.|.|0.19343	.|.|N	.|.|0.116593	T|T|T	0.05318|0.05318|0.05318	0.0141|0.0141|0.0141	N|N|N	0.08118|0.08118|0.08118	0|0|0	0.28798|0.28798|0.28798	N|N|N	0.898927|0.898927|0.898927	.|.|B;B;B;B;B	.|.|0.18166	.|.|0.0;0.0;0.0;0.006;0.026	.|.|B;B;B;B;B	.|.|0.09377	.|.|0.0;0.0;0.0;0.003;0.004	T|T|T	0.35724|0.35724|0.35724	-0.9777|-0.9777|-0.9777	5|5|10	.|.|0.17832	.|.|T	.|.|0.49	.|.|.	5.4604|5.4604|5.4604	0.16614|0.16614|0.16614	0.5354:0.0:0.4646:0.0|0.5354:0.0:0.4646:0.0|0.5354:0.0:0.4646:0.0	.|.|.	.|.|1293;1007;1225;1639;1648	.|.|Q59FI2;F2Z3B8;Q5W9G3;P10586-2;P10586	.|.|.;.;.;.;PTPRF_HUMAN	P|H|T	1294|1031;1072|1648;1639;1648;1639;1007;720	.|.|ENSP00000353030:S1648T;ENSP00000398822:S1639T;ENSP00000361491:S1648T;ENSP00000361490:S1639T;ENSP00000387885:S1007T;ENSP00000361484:S720T	.|.|ENSP00000353030:S1648T	A|Q|S	+|+|+	1|3|2	0|2|0	PTPRF|PTPRF|PTPRF	43857948|43857948|43857948	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.796000|0.796000|0.796000	0.44982|0.44982|0.44982	1.685000|1.685000|1.685000	0.37659|0.37659|0.37659	0.759000|0.759000|0.759000	0.33084|0.33084|0.33084	0.555000|0.555000|0.555000	0.69702|0.69702|0.69702	GCT|CAG|AGC		PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
C8A	731	hgsc.bcm.edu	37	1	57351778	57351778	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:57351778G>T	ENST00000361249.3	+	7	1130	c.1034G>T	c.(1033-1035)gGa>gTa	p.G345V		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	345	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						ATCACATCTGGATCCATGGGT	0.408																																					p.G345V												.	.	0			c.G1034T	1						.						126.0	104.0	111.0					1																	57351778		2203	4300	6503	57124366	SO:0001583	missense	731	exon7			M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.1034G>T	1.37:g.57351778G>T	ENSP00000354458:p.Gly345Val	Somatic		Capture	SOLID	Phase_I	57124366	NM_000562	A2RUI4|A2RUI5|Q13668|Q9H130	Missense_Mutation	SNP	ENST00000361249.3	37	CCDS606.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.772772	0.90108	.	.	ENSG00000157131	ENST00000361249	D	0.83250	-1.7	6.04	6.04	0.98038	Membrane attack complex component/perforin (MACPF) domain (3);	0.045662	0.85682	D	0.000000	D	0.93575	0.7949	M	0.91300	3.195	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93882	0.7172	10	0.87932	D	0	-18.8449	20.5948	0.99439	0.0:0.0:1.0:0.0	.	345	P07357	CO8A_HUMAN	V	345	ENSP00000354458:G345V	ENSP00000354458:G345V	G	+	2	0	C8A	57124366	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.229000	0.95273	2.873000	0.98535	0.563000	0.77884	GGA		C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022890.1	NM_000562	
HHLA3	11147	hgsc.bcm.edu	37	1	70820763	70820763	+	Silent	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:70820763A>G	ENST00000359875.5	+	1	269	c.129A>G	c.(127-129)ccA>ccG	p.P43P	HHLA3_ENST00000432224.1_Silent_p.P43P|ANKRD13C_ENST00000370944.4_5'Flank|ANKRD13C_ENST00000262346.6_5'Flank|HHLA3_ENST00000361764.4_Silent_p.P43P|HHLA3_ENST00000531950.1_Silent_p.P43P|HHLA3_ENST00000486110.1_3'UTR|HHLA3_ENST00000370940.5_Silent_p.P43P	NM_001036645.1	NP_001031722.1	Q9XRX5	HHLA3_HUMAN	HERV-H LTR-associating 3	43										large_intestine(3)|lung(1)	4						tcagtcaaccaacatttactg	0.502																																					p.P43P												.	.	0			c.A129G	1						.						115.0	87.0	97.0					1																	70820763		2203	4300	6503	70593351	SO:0001819	synonymous_variant	11147	exon1			AF126164	CCDS649.1, CCDS30752.1, CCDS30753.1	1p31.1	2008-02-05			ENSG00000197568	ENSG00000197568			4906	protein-coding gene	gene with protein product		604372				10444326	Standard	NR_027404		Approved		uc001dfa.3	Q9XRX5	OTTHUMG00000009346	ENST00000359875.5:c.129A>G	1.37:g.70820763A>G		Somatic		Capture	SOLID	Phase_I	70593351	NM_001036645	D3DQ74|Q5VZP2|Q96FH5|Q9XRX4	Silent	SNP	ENST00000359875.5	37	CCDS30753.1																																																																																				HHLA3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025911.2	NM_007071	
FUBP1	8880	hgsc.bcm.edu	37	1	78428485	78428485	+	Silent	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:78428485A>G	ENST00000370768.2	-	14	1395	c.1314T>C	c.(1312-1314)taT>taC	p.Y438Y	FUBP1_ENST00000370767.1_Silent_p.Y438Y|FUBP1_ENST00000436586.2_Silent_p.Y459Y	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	438	KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.				positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)	p.Y438Y(1)		central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						GTTGCCGAGCATAGTCTATCT	0.353			"""F, N"""		oligodendroglioma																																p.Y438Y			Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1314C	1						.						112.0	107.0	108.0					1																	78428485		2202	4300	6502	78201073	SO:0001819	synonymous_variant	8880	exon14			U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.1314T>C	1.37:g.78428485A>G		Somatic		Capture	SOLID	Phase_I	78201073	NM_003902	Q12828	Silent	SNP	ENST00000370768.2	37	CCDS683.1																																																																																				FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902	
GIPC2	54810	hgsc.bcm.edu	37	1	78511999	78511999	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:78511999T>A	ENST00000370759.3	+	1	414	c.221T>A	c.(220-222)tTt>tAt	p.F74Y	GIPC2_ENST00000476882.1_Intron	NM_017655.4	NP_060125.4	Q8TF65	GIPC2_HUMAN	GIPC PDZ domain containing family, member 2	74						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.F74Y(1)		endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)	20						GCGGGCGCGTTTGAAATCTCG	0.701																																					p.F74Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T221A	1						.						14.0	14.0	14.0					1																	78511999		2171	4263	6434	78284587	SO:0001583	missense	54810	exon1			AB073737	CCDS685.1	1p31.1	2010-05-28			ENSG00000137960	ENSG00000137960			18177	protein-coding gene	gene with protein product	"""semaphorin cytoplasmic domain associated protein 2"""					11836570	Standard	NM_017655		Approved	FLJ20075, SEMCAP-2	uc001dik.3	Q8TF65	OTTHUMG00000041145	ENST00000370759.3:c.221T>A	1.37:g.78511999T>A	ENSP00000359795:p.Phe74Tyr	Somatic		Capture	SOLID	Phase_I	78284587	NM_017655	Q8IYD3|Q9NXS7	Missense_Mutation	SNP	ENST00000370759.3	37	CCDS685.1	.	.	.	.	.	.	.	.	.	.	T	12.28	1.890006	0.33348	.	.	ENSG00000137960	ENST00000370759	D	0.84589	-1.87	3.94	2.78	0.32641	.	0.171260	0.52532	N	0.000074	T	0.65080	0.2657	L	0.45051	1.395	0.49483	D	0.999795	B	0.06786	0.001	B	0.09377	0.004	T	0.59263	-0.7487	10	0.28530	T	0.3	-30.9852	9.6259	0.39750	0.1564:0.0:0.0:0.8436	.	74	Q8TF65	GIPC2_HUMAN	Y	74	ENSP00000359795:F74Y	ENSP00000359795:F74Y	F	+	2	0	GIPC2	78284587	1.000000	0.71417	0.004000	0.12327	0.025000	0.11179	5.338000	0.65947	0.557000	0.29117	-0.516000	0.04426	TTT		GIPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098629.1	NM_017655	
CLCA2	9635	hgsc.bcm.edu	37	1	86921139	86921139	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:86921139G>T	ENST00000370565.4	+	14	2923	c.2761G>T	c.(2761-2763)Gtt>Ttt	p.V921F		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	921					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		CCTTATTATAGTTGTGACACA	0.338																																					p.V921F	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)											.	.	0			c.G2761T	1						.						92.0	100.0	97.0					1																	86921139		2203	4300	6503	86693727	SO:0001583	missense	9635	exon14				CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.2761G>T	1.37:g.86921139G>T	ENSP00000359596:p.Val921Phe	Somatic		Capture	SOLID	Phase_I	86693727	NM_006536	A8K2T3|Q9Y6N2	Missense_Mutation	SNP	ENST00000370565.4	37	CCDS708.1	.	.	.	.	.	.	.	.	.	.	G	6.680	0.494054	0.12702	.	.	ENSG00000137975	ENST00000370565	T	0.03181	4.02	5.62	2.4	0.29515	.	0.569682	0.17321	N	0.178514	T	0.01092	0.0036	L	0.55481	1.735	0.09310	N	1	B	0.12630	0.006	B	0.12156	0.007	T	0.48139	-0.9061	10	0.11794	T	0.64	-7.9438	6.1942	0.20540	0.2937:0.0:0.5709:0.1354	.	921	Q9UQC9	CLCA2_HUMAN	F	921	ENSP00000359596:V921F	ENSP00000359596:V921F	V	+	1	0	CLCA2	86693727	0.089000	0.21612	0.357000	0.25798	0.851000	0.48451	0.369000	0.20416	0.739000	0.32628	0.591000	0.81541	GTT		CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536	
HIST3H3	8290	hgsc.bcm.edu	37	1	228612626	228612626	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr1:228612626T>G	ENST00000366696.1	-	1	400	c.401A>C	c.(400-402)gAg>gCg	p.E134A		NM_003493.2	NP_003484.1	Q16695	H31T_HUMAN	histone cluster 3, H3	134					telomere maintenance (GO:0000723)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(1)|lung(2)|prostate(2)|skin(1)	6		Prostate(94;0.0724)				CTAGGCCCGCTCCCCGCGGAT	0.592																																					p.E134A												.	.	0			c.A401C	1						.						63.0	57.0	59.0					1																	228612626		2203	4300	6503	226679249	SO:0001583	missense	8290	exon1			Z49861	CCDS1572.1	1q42.13	2012-09-19	2006-10-11	2003-02-21	ENSG00000168148	ENSG00000168148		"""Histones / Replication-dependent"""	4778	protein-coding gene	gene with protein product		602820	"""H3 histone family, member T"", ""histone 3, H3"""	H3FT		8834248, 12408966	Standard	NM_003493		Approved	H3t, H3/g, H3.4	uc001hsx.1	Q16695	OTTHUMG00000040044	ENST00000366696.1:c.401A>C	1.37:g.228612626T>G	ENSP00000355657:p.Glu134Ala	Somatic		Capture	SOLID	Phase_I	226679249	NM_003493	B2R5K3|Q6FGU4	Missense_Mutation	SNP	ENST00000366696.1	37	CCDS1572.1	.	.	.	.	.	.	.	.	.	.	t	10.74	1.436582	0.25813	.	.	ENSG00000168148	ENST00000366696	T	0.47177	0.85	3.89	3.89	0.44902	Histone-fold (2);	0.183733	0.26556	N	0.023708	T	0.67173	0.2865	M	0.82132	2.575	0.38462	D	0.947241	D	0.69078	0.997	D	0.74348	0.983	T	0.74284	-0.3715	10	0.87932	D	0	.	11.3598	0.49636	0.0:0.0:0.0:1.0	.	134	Q16695	H31T_HUMAN	A	134	ENSP00000355657:E134A	ENSP00000355657:E134A	E	-	2	0	HIST3H3	226679249	1.000000	0.71417	0.041000	0.18516	0.006000	0.05464	7.350000	0.79385	1.974000	0.57490	0.524000	0.50904	GAG		HIST3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096595.2	NM_003493	
KIAA1377	57562	hgsc.bcm.edu	37	11	101793435	101793435	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:101793435A>T	ENST00000263468.8	+	2	462	c.192A>T	c.(190-192)caA>caT	p.Q64H		NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	64										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		TGCAGCAACAAAAAATATGTC	0.318																																					p.Q64H												.	.	0			c.A192T	11						.						64.0	66.0	65.0					11																	101793435		2203	4299	6502	101298645	SO:0001583	missense	57562	exon2			AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.192A>T	11.37:g.101793435A>T	ENSP00000263468:p.Gln64His	Somatic		Capture	SOLID	Phase_I	101298645	NM_020802	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	37	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	A	20.0	3.930742	0.73327	.	.	ENSG00000110318	ENST00000263468	T	0.10860	2.83	5.93	3.64	0.41730	.	0.000000	0.64402	D	0.000008	T	0.27134	0.0665	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01007	-1.1483	10	0.87932	D	0	-6.3588	8.1683	0.31239	0.8377:0.0:0.1623:0.0	.	64	Q9P2H0	K1377_HUMAN	H	64	ENSP00000263468:Q64H	ENSP00000263468:Q64H	Q	+	3	2	KIAA1377	101298645	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	1.565000	0.36386	1.059000	0.40554	0.533000	0.62120	CAA		KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
NUP98	4928	hgsc.bcm.edu	37	11	3707400	3707400	+	Silent	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:3707400C>T	ENST00000324932.7	-	29	4899	c.4479G>A	c.(4477-4479)ctG>ctA	p.L1493L	NUP98_ENST00000355260.3_Intron|NUP98_ENST00000359171.4_Intron	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	1510					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)	p.L1493L(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		TTCGAGGCTCCAGCAGCTGGT	0.502			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																p.L1493L			Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4479A	11						.						97.0	84.0	89.0					11																	3707400		2201	4298	6499	3663976	SO:0001819	synonymous_variant	4928	exon29			AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.4479G>A	11.37:g.3707400C>T		Somatic		Capture	SOLID	Phase_I	3663976	NM_016320	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Silent	SNP	ENST00000324932.7	37	CCDS7746.1	.	.	.	.	.	.	.	.	.	.	C	9.266	1.044376	0.19748	.	.	ENSG00000110713	ENST00000429801	.	.	.	5.59	1.59	0.23543	.	.	.	.	.	T	0.57489	0.2057	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49224	-0.8962	4	.	.	.	-1.9979	8.9387	0.35715	0.0:0.6441:0.0:0.3559	.	.	.	.	R	446	.	.	G	-	1	0	NUP98	3663976	0.951000	0.32395	0.765000	0.31456	0.983000	0.72400	0.094000	0.15107	0.114000	0.18032	-0.145000	0.13849	GGA		NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320	
RRM1	6240	hgsc.bcm.edu	37	11	4154877	4154877	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:4154877G>C	ENST00000300738.5	+	17	2194	c.1990G>C	c.(1990-1992)Ggc>Cgc	p.G664R	RRM1_ENST00000534285.1_Missense_Mutation_p.G442R|RRM1_ENST00000537197.1_Missense_Mutation_p.G326R|RRM1_ENST00000423050.2_Missense_Mutation_p.G567R	NM_001033.3	NP_001024.1	P23921	RIR1_HUMAN	ribonucleotide reductase M1	664					cell proliferation in forebrain (GO:0021846)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|male gonad development (GO:0008584)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|pyrimidine nucleobase metabolic process (GO:0006206)|response to ionizing radiation (GO:0010212)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)	14		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	TGCATGCAATGGCTCTATTCA	0.433																																					p.G664R	NSCLC(45;1345 1376 6258 22925)|Ovarian(34;894 1053 6175 12768)											.	.	0			c.G1990C	11						.						100.0	93.0	95.0					11																	4154877		2201	4298	6499	4111453	SO:0001583	missense	6240	exon17			X59543	CCDS7750.1	11p15.5	2009-07-10	2008-03-11		ENSG00000167325	ENSG00000167325	1.17.14.1		10451	protein-coding gene	gene with protein product		180410	"""ribonucleotide reductase M1 polypeptide"""			7557993	Standard	NM_001033		Approved		uc001lyw.4	P23921	OTTHUMG00000133361	ENST00000300738.5:c.1990G>C	11.37:g.4154877G>C	ENSP00000300738:p.Gly664Arg	Somatic		Capture	SOLID	Phase_I	4111453	NM_001033	Q9UNN2	Missense_Mutation	SNP	ENST00000300738.5	37	CCDS7750.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.866776	0.91511	.	.	ENSG00000167325	ENST00000300738;ENST00000423050;ENST00000536894;ENST00000534285;ENST00000543838;ENST00000537197	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.52	5.52	0.82312	Ribonucleoside-diphosphate reductase, alpha subunit (1);Ribonucleotide reductase large subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.84352	0.5453	H	0.99838	4.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91817	0.5464	10	0.87932	D	0	-9.8668	18.4154	0.90568	0.0:0.0:1.0:0.0	.	664	P23921	RIR1_HUMAN	R	664;567;577;442;442;326	ENSP00000300738:G664R;ENSP00000390539:G567R;ENSP00000431464:G442R;ENSP00000442148:G326R	ENSP00000300738:G664R	G	+	1	0	RRM1	4111453	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.476000	0.97823	2.588000	0.87417	0.655000	0.94253	GGC		RRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257197.1	NM_001033	
PPFIBP2	8495	hgsc.bcm.edu	37	11	7631578	7631578	+	Silent	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:7631578G>C	ENST00000299492.4	+	6	931	c.543G>C	c.(541-543)gtG>gtC	p.V181V	PPFIBP2_ENST00000528883.1_Silent_p.V69V|PPFIBP2_ENST00000533792.1_Silent_p.V23V|PPFIBP2_ENST00000530181.1_Silent_p.V38V	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	181					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)	p.V181V(1)		breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		TGACTGAAGTGTCTGAGCTGA	0.498																																					p.V181V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G543C	11						.						214.0	209.0	210.0					11																	7631578		2201	4296	6497	7588154	SO:0001819	synonymous_variant	8495	exon6			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.543G>C	11.37:g.7631578G>C		Somatic		Capture	SOLID	Phase_I	7588154	NM_003621	B7Z433|E9PK77|O75337|Q8WW26	Silent	SNP	ENST00000299492.4	37	CCDS31419.1																																																																																				PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385345.2	NM_003621	
SCUBE2	57758	hgsc.bcm.edu	37	11	9051564	9051564	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:9051564G>T	ENST00000309263.3	-	18	2355	c.2283C>A	c.(2281-2283)aaC>aaA	p.N761K	SCUBE2_ENST00000520467.1_Missense_Mutation_p.N733K|SCUBE2_ENST00000450649.2_Missense_Mutation_p.N635K|SCUBE2_ENST00000457346.2_Missense_Mutation_p.N790K|RP11-467K18.2_ENST00000531592.1_RNA			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	761						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.N761K(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		GAGTGGTGGTGTTGTAGAAAT	0.393																																					p.N733K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2199A	11						.						133.0	125.0	128.0					11																	9051564		2201	4296	6497	9008140	SO:0001583	missense	57758	exon18			AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.2283C>A	11.37:g.9051564G>T	ENSP00000310658:p.Asn761Lys	Somatic		Capture	SOLID	Phase_I	9008140	NM_020974	Q2NKQ8|Q6ZWI1	Missense_Mutation	SNP	ENST00000309263.3	37		.	.	.	.	.	.	.	.	.	.	G	15.72	2.917747	0.52546	.	.	ENSG00000175356	ENST00000457346;ENST00000309263;ENST00000450649;ENST00000520467	T;T;T;T	0.14893	2.47;2.47;2.47;2.47	5.19	4.28	0.50868	Tyrosine-protein kinase ephrin type A/B receptor-like (1);Growth factor, receptor (1);	0.045724	0.85682	D	0.000000	T	0.44201	0.1282	M	0.85299	2.745	0.50813	D	0.999896	D;D;D	0.76494	0.971;0.999;0.996	P;D;D	0.72075	0.621;0.975;0.976	T	0.49835	-0.8897	10	0.87932	D	0	.	12.0625	0.53570	0.1446:0.0:0.8554:0.0	.	635;733;761	Q9NQ36-3;Q9NQ36-2;Q9NQ36	.;.;SCUB2_HUMAN	K	790;761;635;733	ENSP00000390481:N790K;ENSP00000310658:N761K;ENSP00000415187:N635K;ENSP00000429969:N733K	ENSP00000310658:N761K	N	-	3	2	SCUBE2	9008140	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.398000	0.44486	1.193000	0.43086	-0.333000	0.08304	AAC		SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000385812.2	NM_020974	
ZNF143	7702	hgsc.bcm.edu	37	11	9530235	9530235	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:9530235A>C	ENST00000396602.2	+	12	1336	c.1217A>C	c.(1216-1218)aAa>aCa	p.K406T	ZNF143_ENST00000396604.1_Missense_Mutation_p.K405T|ZNF143_ENST00000530463.1_Missense_Mutation_p.K405T|ZNF143_ENST00000396597.3_Missense_Mutation_p.K375T|ZNF143_ENST00000299606.2_Missense_Mutation_p.K378T	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143	406					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K406T(1)		endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		AGTTTGTACAAACATCATGTT	0.423																																					p.K406T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1217C	11						.						110.0	97.0	101.0					11																	9530235		2201	4294	6495	9486811	SO:0001583	missense	7702	exon12			U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.1217A>C	11.37:g.9530235A>C	ENSP00000379847:p.Lys406Thr	Somatic		Capture	SOLID	Phase_I	9486811	NM_003442	A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	Missense_Mutation	SNP	ENST00000396602.2	37	CCDS7799.2	.	.	.	.	.	.	.	.	.	.	A	23.7	4.449720	0.84101	.	.	ENSG00000166478	ENST00000396604;ENST00000396602;ENST00000530463;ENST00000396597;ENST00000299606	T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31	5.62	5.62	0.85841	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.41305	0.1153	N	0.11698	0.16	0.80722	D	1	D;D;D	0.61080	0.989;0.981;0.981	D;D;D	0.72982	0.979;0.954;0.954	T	0.37197	-0.9716	10	0.27785	T	0.31	.	15.8239	0.78683	1.0:0.0:0.0:0.0	.	375;405;406	P52747-2;E7ER34;P52747	.;.;ZN143_HUMAN	T	405;406;405;375;378	ENSP00000379849:K405T;ENSP00000379847:K406T;ENSP00000432154:K405T;ENSP00000379843:K375T;ENSP00000299606:K378T	ENSP00000299606:K378T	K	+	2	0	ZNF143	9486811	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.135000	0.66039	0.533000	0.62120	AAA		ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313921.2	NM_003442	
SBF2	81846	hgsc.bcm.edu	37	11	9834200	9834200	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:9834200T>C	ENST00000256190.8	-	30	4171	c.4034A>G	c.(4033-4035)gAa>gGa	p.E1345G	SBF2-AS1_ENST00000498905.2_RNA	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1345	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		TTGCCGGATTTCATGAAATTC	0.433																																					p.E1345G												.	.	0			c.A4034G	11						.						95.0	93.0	94.0					11																	9834200		2201	4294	6495	9790776	SO:0001583	missense	81846	exon30			AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.4034A>G	11.37:g.9834200T>C	ENSP00000256190:p.Glu1345Gly	Somatic		Capture	SOLID	Phase_I	9790776	NM_030962	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	37	CCDS31427.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.1|21.1	4.098915|4.098915	0.76870|0.76870	.|.	.|.	ENSG00000133812|ENSG00000133812	ENST00000256190|ENST00000530741	D|.	0.89415|.	-2.51|.	6.04|6.04	6.04|6.04	0.98038|0.98038	Myotubularin phosphatase domain (1);|.	0.169570|.	0.64402|.	D|.	0.000005|.	T|T	0.61223|0.61223	0.2330|0.2330	L|L	0.40543|0.40543	1.245|1.245	0.58432|0.58432	D|D	0.999991|0.999991	B|.	0.16603|.	0.018|.	B|.	0.22601|.	0.04|.	T|T	0.57051|0.57051	-0.7877|-0.7877	10|5	0.87932|.	D|.	0|.	.|.	16.5763|16.5763	0.84648|0.84648	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1345|.	Q86WG5|.	MTMRD_HUMAN|.	G|E	1345|261	ENSP00000256190:E1345G|.	ENSP00000256190:E1345G|.	E|K	-|-	2|1	0|0	SBF2|SBF2	9790776|9790776	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	8.040000|8.040000	0.89188|0.89188	2.317000|2.317000	0.78254|0.78254	0.459000|0.459000	0.35465|0.35465	GAA|AAA		SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962	
CALCA	796	hgsc.bcm.edu	37	11	14992656	14992656	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:14992656A>C	ENST00000486207.1	-	1	91	c.83T>G	c.(82-84)tTc>tGc	p.F28C	CALCA_ENST00000361010.3_Missense_Mutation_p.F28C|CALCA_ENST00000396372.2_Missense_Mutation_p.F28C|CALCB_ENST00000523376.1_Intron|CALCA_ENST00000331587.4_Missense_Mutation_p.F28C|CALCA_ENST00000359642.3_Missense_Mutation_p.F28C			P06881	CALCA_HUMAN	calcitonin-related polypeptide alpha	28					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|cytosolic calcium ion homeostasis (GO:0051480)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor internalization (GO:0002031)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of blood pressure (GO:0045776)|negative regulation of bone resorption (GO:0045779)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of osteoclast differentiation (GO:0045671)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of vasodilation (GO:0045909)|protein phosphorylation (GO:0006468)|receptor internalization (GO:0031623)|regulation of blood pressure (GO:0008217)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	protein complex binding (GO:0032403)|receptor binding (GO:0005102)	p.F28C(2)		central_nervous_system(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	8						GTCTTACCTGAATGGTGCTGC	0.542																																					p.F28C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T83G	11						.						99.0	89.0	92.0					11																	14992656		2200	4294	6494	14949232	SO:0001583	missense	796	exon2			X00356, M64486	CCDS7819.1, CCDS31432.1	11p15.2	2014-09-17	2008-02-20		ENSG00000110680	ENSG00000110680		"""Endogenous ligands"""	1437	protein-coding gene	gene with protein product	"""calcitonin"""	114130	"""calcitonin 1"""	CALC1		6546550	Standard	NM_001033953		Approved		uc001mlw.1	P01258	OTTHUMG00000159731	ENST00000486207.1:c.83T>G	11.37:g.14992656A>C	ENSP00000417833:p.Phe28Cys	Somatic		Capture	SOLID	Phase_I	14949232	NM_001741	Q93048|Q9UCP0	Missense_Mutation	SNP	ENST00000486207.1	37	CCDS31432.1	.	.	.	.	.	.	.	.	.	.	A	10.05	1.244269	0.22796	.	.	ENSG00000110680	ENST00000486207;ENST00000361010;ENST00000359642;ENST00000331587;ENST00000396372	T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91	4.69	0.942	0.19525	.	0.481200	0.25467	N	0.030462	T	0.40322	0.1112	M	0.77313	2.365	0.28493	N	0.914397	D;D	0.63046	0.978;0.992	P;P	0.59948	0.819;0.866	T	0.27502	-1.0072	10	0.66056	D	0.02	.	5.0486	0.14496	0.6453:0.0:0.0766:0.2781	.	28;28	P01258;P06881	CALC_HUMAN;CALCA_HUMAN	C	28	ENSP00000417833:F28C;ENSP00000354286:F28C;ENSP00000352663:F28C;ENSP00000331746:F28C;ENSP00000379657:F28C	ENSP00000331746:F28C	F	-	2	0	CALCA	14949232	0.996000	0.38824	0.211000	0.23655	0.007000	0.05969	3.073000	0.50057	0.051000	0.15978	-2.515000	0.00186	TTC		CALCA-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357068.1	NM_001741	
USH1C	10083	hgsc.bcm.edu	37	11	17523513	17523513	+	Nonsense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:17523513A>C	ENST00000318024.4	-	16	1407	c.1299T>G	c.(1297-1299)taT>taG	p.Y433*	USH1C_ENST00000005226.7_Nonsense_Mutation_p.Y733*|USH1C_ENST00000527020.1_Nonsense_Mutation_p.Y414*|USH1C_ENST00000529563.1_5'UTR|USH1C_ENST00000527720.1_Nonsense_Mutation_p.Y402*	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	433					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)	p.Y733*(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						AGCCTTCCTCATATTTCCGGA	0.527																																					p.Y733X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T2199G	11						.						101.0	93.0	96.0					11																	17523513		2200	4293	6493	17480089	SO:0001587	stop_gained	10083	exon21			AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1299T>G	11.37:g.17523513A>C	ENSP00000317018:p.Tyr433*	Somatic		Capture	SOLID	Phase_I	17480089	NM_153676	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Nonsense_Mutation	SNP	ENST00000318024.4	37	CCDS31438.1	.	.	.	.	.	.	.	.	.	.	A	39	7.480544	0.98309	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226	.	.	.	5.37	-1.29	0.09288	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	9.4852	0.38924	0.5993:0.0:0.4007:0.0	.	.	.	.	X	433;402;414;733	.	ENSP00000005226:Y733X	Y	-	3	2	USH1C	17480089	0.927000	0.31430	0.996000	0.52242	0.998000	0.95712	-0.016000	0.12613	-0.235000	0.09767	0.528000	0.53228	TAT		USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709	
USH1C	10083	hgsc.bcm.edu	37	11	17523523	17523523	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:17523523A>G	ENST00000318024.4	-	16	1397	c.1289T>C	c.(1288-1290)tTc>tCc	p.F430S	USH1C_ENST00000005226.7_Missense_Mutation_p.F730S|USH1C_ENST00000527020.1_Missense_Mutation_p.F411S|USH1C_ENST00000529563.1_5'UTR|USH1C_ENST00000527720.1_Missense_Mutation_p.F399S	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	430					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)	p.F730S(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						ATATTTCCGGAAATCCTGGAA	0.537																																					p.F730S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2189C	11						.						91.0	84.0	86.0					11																	17523523		2200	4293	6493	17480099	SO:0001583	missense	10083	exon21			AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1289T>C	11.37:g.17523523A>G	ENSP00000317018:p.Phe430Ser	Somatic		Capture	SOLID	Phase_I	17480099	NM_153676	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	ENST00000318024.4	37	CCDS31438.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.213540	0.79352	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226	T;T;T;T	0.36157	1.27;1.27;1.62;1.64	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.48150	0.1484	L	0.32530	0.975	0.39073	D	0.960753	P;P;D	0.71674	0.763;0.651;0.998	B;B;D	0.75484	0.229;0.115;0.986	T	0.52815	-0.8525	10	0.62326	D	0.03	.	12.9057	0.58152	1.0:0.0:0.0:0.0	.	411;430;730	Q9Y6N9-4;Q9Y6N9;Q7RTU8	.;USH1C_HUMAN;.	S	430;399;411;730	ENSP00000317018:F430S;ENSP00000432944:F399S;ENSP00000436934:F411S;ENSP00000005226:F730S	ENSP00000005226:F730S	F	-	2	0	USH1C	17480099	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.625000	0.74248	2.042000	0.60477	0.528000	0.53228	TTC		USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709	
NAV2	89797	hgsc.bcm.edu	37	11	20101636	20101636	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:20101636C>G	ENST00000396087.3	+	27	5473	c.5374C>G	c.(5374-5376)Ctc>Gtc	p.L1792V	NAV2_ENST00000533917.1_Missense_Mutation_p.L800V|NAV2_ENST00000311043.8_Missense_Mutation_p.L800V|NAV2_ENST00000540292.1_Missense_Mutation_p.L1723V|NAV2_ENST00000527559.2_Missense_Mutation_p.L1721V|NAV2_ENST00000396085.1_Missense_Mutation_p.L1736V|NAV2_ENST00000349880.4_Missense_Mutation_p.L1736V|NAV2_ENST00000360655.4_Missense_Mutation_p.L1672V	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	1792					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)	p.L1792V(1)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						GTCTGCAGACCTCCGCATCCG	0.557																																					p.L1672V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5014G	11						.						54.0	51.0	52.0					11																	20101636		2203	4300	6503	20058212	SO:0001583	missense	89797	exon25			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.5374C>G	11.37:g.20101636C>G	ENSP00000379396:p.Leu1792Val	Somatic		Capture	SOLID	Phase_I	20058212	NM_001111018	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	ENST00000396087.3	37	CCDS58126.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.393046	0.83011	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292;ENST00000533917;ENST00000525322;ENST00000311043;ENST00000536595	D;D;D;D;D;D;D;D;D	0.94650	-3.48;-3.48;-3.48;-3.48;-3.48;-3.48;-3.48;-3.48;-3.48	5.71	4.77	0.60923	.	0.000000	0.49916	D	0.000139	D	0.95909	0.8668	M	0.72894	2.215	0.58432	D	0.999994	D;P;P;D;D;D	0.64830	0.989;0.937;0.902;0.974;0.994;0.978	P;B;B;P;P;P	0.62382	0.799;0.256;0.269;0.778;0.901;0.669	D	0.95183	0.8301	9	.	.	.	.	10.8594	0.46819	0.1309:0.8003:0.0:0.0688	.	1736;1792;800;785;1736;1672	A7E2D6;Q8IVL1;Q8IVL1-5;E9PNV5;Q8IVL1-3;Q8IVL1-4	.;NAV2_HUMAN;.;.;.;.	V	1672;1736;1736;1792;1721;1723;800;785;800;785	ENSP00000353871:L1672V;ENSP00000379394:L1736V;ENSP00000309577:L1736V;ENSP00000379396:L1792V;ENSP00000435395:L1721V;ENSP00000443489:L1723V;ENSP00000437316:L800V;ENSP00000437136:L785V;ENSP00000312169:L800V	.	L	+	1	0	NAV2	20058212	1.000000	0.71417	0.996000	0.52242	0.865000	0.49528	4.909000	0.63314	1.342000	0.45619	0.557000	0.71058	CTC		NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
PEX16	9409	hgsc.bcm.edu	37	11	45936221	45936221	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:45936221G>T	ENST00000378750.5	-	6	718	c.475C>A	c.(475-477)Cct>Act	p.P159T	PEX16_ENST00000241041.3_Missense_Mutation_p.P159T|PEX16_ENST00000532554.1_5'UTR|PEX16_ENST00000532681.1_Missense_Mutation_p.P64T			Q9Y5Y5	PEX16_HUMAN	peroxisomal biogenesis factor 16	159					ER-dependent peroxisome organization (GO:0032581)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)|protein localization to endoplasmic reticulum (GO:0070972)|protein targeting to peroxisome (GO:0006625)|protein to membrane docking (GO:0022615)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)	p.P159T(1)		large_intestine(2)|lung(2)|ovary(2)|skin(1)	7				GBM - Glioblastoma multiforme(35;0.223)		TGGTTGCCAGGGCTGTGGTCA	0.582																																					p.P159T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C475A	11						.						154.0	129.0	137.0					11																	45936221		2203	4299	6502	45892797	SO:0001583	missense	9409	exon6			AF118240	CCDS7917.1, CCDS31472.1	11p	2007-12-14			ENSG00000121680	ENSG00000121680			8857	protein-coding gene	gene with protein product		603360				9922452	Standard	NM_057174		Approved		uc001nbt.3	Q9Y5Y5	OTTHUMG00000167005	ENST00000378750.5:c.475C>A	11.37:g.45936221G>T	ENSP00000368024:p.Pro159Thr	Somatic		Capture	SOLID	Phase_I	45892797	NM_057174	Q9BWB9	Missense_Mutation	SNP	ENST00000378750.5	37	CCDS31472.1	.	.	.	.	.	.	.	.	.	.	G	3.445	-0.113156	0.06881	.	.	ENSG00000121680	ENST00000241041;ENST00000378750;ENST00000532681;ENST00000533151;ENST00000525192	T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14	6.04	-5.2	0.02823	.	1.274680	0.04746	N	0.423709	T	0.09069	0.0224	N	0.17474	0.49	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.002;0.004	T	0.27571	-1.0070	10	0.15952	T	0.53	2.692	1.5964	0.02665	0.2746:0.3442:0.2067:0.1744	.	159;159	Q9Y5Y5;Q9Y5Y5-2	PEX16_HUMAN;.	T	159;159;64;55;64	ENSP00000241041:P159T;ENSP00000368024:P159T;ENSP00000434654:P64T;ENSP00000433045:P55T;ENSP00000431309:P64T	ENSP00000241041:P159T	P	-	1	0	PEX16	45892797	0.000000	0.05858	0.001000	0.08648	0.474000	0.32979	-1.251000	0.02882	-0.602000	0.05775	0.561000	0.74099	CCT		PEX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392398.1	NM_057174	
ATG13	9776	hgsc.bcm.edu	37	11	46667489	46667489	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:46667489C>T	ENST00000434074.1	+	4	909	c.220C>T	c.(220-222)Cct>Tct	p.P74S	ATG13_ENST00000359513.4_Missense_Mutation_p.P74S|ATG13_ENST00000528494.1_Missense_Mutation_p.P74S|ATG13_ENST00000524625.1_Missense_Mutation_p.P74S|ATG13_ENST00000526508.1_Missense_Mutation_p.P74S|ATG13_ENST00000451945.1_Missense_Mutation_p.P74S|ATG13_ENST00000530500.1_5'UTR|ATG13_ENST00000529655.1_Missense_Mutation_p.P74S|ATG13_ENST00000312040.4_Missense_Mutation_p.P74S	NM_001205120.1	NP_001192049.1	O75143	ATG13_HUMAN	autophagy related 13	74					autophagic vacuole assembly (GO:0000045)	ATG1/UKL1 signaling complex (GO:0034273)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)|ULK1-ATG13-FIP200 complex (GO:0070969)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	15						AGGACAGCTGCCTGCAGTCGG	0.473																																					p.P74S												.	.	0			c.C220T	11						.						105.0	100.0	102.0					11																	46667489		2201	4299	6500	46624065	SO:0001583	missense	9776	exon5			AB014552	CCDS7921.1, CCDS44582.1, CCDS55760.1, CCDS55761.1	11p11.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000175224	ENSG00000175224			29091	protein-coding gene	gene with protein product		615088	"""KIAA0652"", ""ATG13 autophagy related 13 homolog (S. cerevisiae)"""	KIAA0652		15169610, 18339812, 17204848	Standard	NM_001205120		Approved		uc001nda.3	O75143	OTTHUMG00000166538	ENST00000434074.1:c.220C>T	11.37:g.46667489C>T	ENSP00000400642:p.Pro74Ser	Somatic		Capture	SOLID	Phase_I	46624065	NM_001142673	B4DFI4|D3DQQ1|D3DQQ2|E9PQZ8|Q53EN6|Q9BRL3|Q9H8B0	Missense_Mutation	SNP	ENST00000434074.1	37	CCDS44582.1	.	.	.	.	.	.	.	.	.	.	C	34	5.323791	0.95708	.	.	ENSG00000175224	ENST00000395549;ENST00000434074;ENST00000312040;ENST00000451945;ENST00000529655;ENST00000533325;ENST00000526508;ENST00000524625;ENST00000359513;ENST00000528494;ENST00000526078	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.73148	0.3550	L	0.55990	1.75	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.79784	0.978;0.993;0.983	T	0.65780	-0.6085	9	0.06891	T	0.86	-13.4374	19.4113	0.94673	0.0:1.0:0.0:0.0	.	74;74;74	O75143;E9PQZ8;O75143-2	ATG13_HUMAN;.;.	S	74	.	ENSP00000310321:P74S	P	+	1	0	ATG13	46624065	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.745000	0.85046	2.579000	0.87056	0.563000	0.77884	CCT		ATG13-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390300.2	NM_014741	
LRP4	4038	hgsc.bcm.edu	37	11	46897185	46897185	+	Silent	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:46897185C>T	ENST00000378623.1	-	27	3989	c.3747G>A	c.(3745-3747)gtG>gtA	p.V1249V	LRP4-AS1_ENST00000531719.1_RNA|LRP4-AS1_ENST00000502049.2_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1249					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		GCACCGGTGACACCAATGTAT	0.572																																					p.V1249V												.	.	0			c.G3747A	11						.						76.0	57.0	63.0					11																	46897185		2201	4299	6500	46853761	SO:0001819	synonymous_variant	4038	exon27			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.3747G>A	11.37:g.46897185C>T		Somatic		Capture	SOLID	Phase_I	46853761	NM_002334	B2RN39|Q4AC85|Q5KTZ5	Silent	SNP	ENST00000378623.1	37	CCDS31478.1																																																																																				LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334	
LRP4	4038	hgsc.bcm.edu	37	11	46917508	46917508	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:46917508C>G	ENST00000378623.1	-	10	1352	c.1110G>C	c.(1108-1110)caG>caC	p.Q370H		NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	370	EGF-like 1; calcium-binding. {ECO:0000255}.				dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)	p.Q370H(1)		breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		CCCGCACCATCTGGCACTTCT	0.622																																					p.Q370H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1110C	11						.						89.0	70.0	77.0					11																	46917508		2201	4299	6500	46874084	SO:0001583	missense	4038	exon10			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.1110G>C	11.37:g.46917508C>G	ENSP00000367888:p.Gln370His	Somatic		Capture	SOLID	Phase_I	46874084	NM_002334	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.563455	0.86335	.	.	ENSG00000134569	ENST00000378623	D	0.87334	-2.24	5.8	5.8	0.92144	Growth factor, receptor (1);Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	T	0.79701	0.4491	N	0.04132	-0.27	0.80722	D	1	D	0.60160	0.987	P	0.49332	0.607	T	0.77900	-0.2415	10	0.12430	T	0.62	.	20.054	0.97641	0.0:1.0:0.0:0.0	.	370	O75096	LRP4_HUMAN	H	370	ENSP00000367888:Q370H	ENSP00000367888:Q370H	Q	-	3	2	LRP4	46874084	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.307000	0.59123	2.743000	0.94032	0.650000	0.86243	CAG		LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334	
OR10V1	390201	hgsc.bcm.edu	37	11	59480925	59480925	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:59480925G>A	ENST00000307552.2	-	1	412	c.394C>T	c.(394-396)Cga>Tga	p.R132*	STX3_ENST00000300150.7_5'Flank	NM_001005324.1	NP_001005324.1	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V, member 1	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R132*(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(10)|skin(1)	16						AGCCTGTATCGCAGAGGGTGA	0.507																																					p.R132X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C394T	11						.						67.0	56.0	59.0					11																	59480925		2201	4295	6496	59237501	SO:0001587	stop_gained	390201	exon1			AB065807	CCDS31565.1	11q12.1	2012-08-09			ENSG00000172289	ENSG00000172289		"""GPCR / Class A : Olfactory receptors"""	15136	protein-coding gene	gene with protein product							Standard	NM_001005324		Approved		uc001nof.1	Q8NGI7	OTTHUMG00000167406	ENST00000307552.2:c.394C>T	11.37:g.59480925G>A	ENSP00000302199:p.Arg132*	Somatic		Capture	SOLID	Phase_I	59237501	NM_001005324	Q6IFD9|Q96R50	Nonsense_Mutation	SNP	ENST00000307552.2	37	CCDS31565.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.166341	0.57476	.	.	ENSG00000172289	ENST00000307552	.	.	.	4.57	-0.833	0.10782	.	0.113194	0.36101	N	0.002794	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.8724	0.41182	0.0:0.0839:0.647:0.2692	.	.	.	.	X	132	.	ENSP00000302199:R132X	R	-	1	2	OR10V1	59237501	0.001000	0.12720	0.617000	0.29091	0.395000	0.30598	0.476000	0.22180	-0.208000	0.10171	0.543000	0.68304	CGA		OR10V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394517.1	NM_001005324	
SCGB2A1	4246	hgsc.bcm.edu	37	11	61976218	61976218	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:61976218G>A	ENST00000244930.4	+	1	79	c.15G>A	c.(13-15)atG>atA	p.M5I		NM_002407.2	NP_002398.1	O75556	SG2A1_HUMAN	secretoglobin, family 2A, member 1	5					androgen receptor signaling pathway (GO:0030521)	extracellular space (GO:0005615)	protein heterodimerization activity (GO:0046982)	p.M5I(1)		breast(1)|kidney(1)|large_intestine(2)|lung(2)	6						AGCTGCTGATGGTCCTCATGC	0.602																																					p.M5I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G15A	11						.						109.0	99.0	103.0					11																	61976218		2202	4299	6501	61732794	SO:0001583	missense	4246	exon1			AF071219	CCDS8016.1	11q13	2011-12-14	2002-03-22	2002-03-22	ENSG00000124939	ENSG00000124939		"""Secretoglobins"""	7051	protein-coding gene	gene with protein product	"""lipophilin C"", ""mammaglobin B"", ""lacryglobin"""	604398	"""mammaglobin 2"""	MGB2		9806831, 22155607	Standard	NM_002407		Approved	UGB3, LPHC, MGC71973	uc001nta.2	O75556	OTTHUMG00000167506	ENST00000244930.4:c.15G>A	11.37:g.61976218G>A	ENSP00000244930:p.Met5Ile	Somatic		Capture	SOLID	Phase_I	61732794	NM_002407		Missense_Mutation	SNP	ENST00000244930.4	37	CCDS8016.1	.	.	.	.	.	.	.	.	.	.	G	0.073	-1.198259	0.01594	.	.	ENSG00000124939	ENST00000244930	.	.	.	4.66	-6.73	0.01749	.	.	.	.	.	T	0.07324	0.0185	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31308	-0.9948	7	0.02654	T	1	.	1.1961	0.01875	0.4489:0.1214:0.1843:0.2455	.	5	O75556	SG2A1_HUMAN	I	5	.	ENSP00000244930:M5I	M	+	3	0	SCGB2A1	61732794	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.323000	0.02692	-1.091000	0.03065	-0.311000	0.09066	ATG		SCGB2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394857.1	NM_002407	
GNG3	2785	hgsc.bcm.edu	37	11	62476265	62476265	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:62476265G>C	ENST00000294117.5	+	3	474	c.215G>C	c.(214-216)tGt>tCt	p.C72S	BSCL2_ENST00000407022.3_5'Flank|BSCL2_ENST00000433053.1_Intron|BSCL2_ENST00000421906.1_5'Flank|BSCL2_ENST00000360796.5_5'Flank|BSCL2_ENST00000537604.1_5'Flank|BSCL2_ENST00000278893.7_5'Flank|HNRNPUL2-BSCL2_ENST00000403734.2_Intron|BSCL2_ENST00000405837.1_Intron|BSCL2_ENST00000403550.1_5'Flank	NM_012202.4	NP_036334.1	P63215	GBG3_HUMAN	guanine nucleotide binding protein (G protein), gamma 3	72					activation of MAPK activity (GO:0000187)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	5						AAGTTCTTCTGTGCTCTCCTC	0.567																																					p.C72S												.	.	0			c.G215C	11						.						102.0	102.0	102.0					11																	62476265		2202	4299	6501	62232841	SO:0001583	missense	2785	exon3			AF075042	CCDS8032.1	11p11	2008-07-18				ENSG00000162188			4405	protein-coding gene	gene with protein product	"""guanine nucleotide-binding protein gamma-3 subunit"", ""NBP gamma-3"""	608941				10644457	Standard	NM_012202		Approved		uc001nuv.4	P63215		ENST00000294117.5:c.215G>C	11.37:g.62476265G>C	ENSP00000294117:p.Cys72Ser	Somatic		Capture	SOLID	Phase_I	62232841	NM_012202	B2R4S7|P29798|Q61014	Missense_Mutation	SNP	ENST00000294117.5	37	CCDS8032.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724301	0.89298	.	.	ENSG00000162188	ENST00000294117	T	0.38887	1.11	5.5	5.5	0.81552	G-protein gamma domain (3);	0.000000	0.85682	D	0.000000	T	0.66713	0.2817	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.69760	-0.5058	9	0.66056	D	0.02	-11.624	16.9474	0.86233	0.0:0.0:1.0:0.0	.	72	P63215	GBG3_HUMAN	S	72	ENSP00000294117:C72S	ENSP00000294117:C72S	C	+	2	0	GNG3	62232841	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.366000	0.97143	2.584000	0.87258	0.558000	0.71614	TGT		GNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395020.1	NM_012202	
CHRM1	1128	hgsc.bcm.edu	37	11	62677985	62677985	+	Silent	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:62677985G>C	ENST00000306960.3	-	2	1129	c.588C>G	c.(586-588)gcC>gcG	p.A196A	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	196					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.A196A(1)		large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	GGAGGTAGAAGGCAGCCATGG	0.607																																					p.A196A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C588G	11						.						94.0	69.0	78.0					11																	62677985		2201	4298	6499	62434561	SO:0001819	synonymous_variant	1128	exon2			Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.588C>G	11.37:g.62677985G>C		Somatic		Capture	SOLID	Phase_I	62434561	NM_000738	Q96RH1	Silent	SNP	ENST00000306960.3	37	CCDS8040.1																																																																																				CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396178.1	NM_000738	
CATSPER1	117144	hgsc.bcm.edu	37	11	65793031	65793031	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:65793031G>T	ENST00000312106.5	-	1	957	c.820C>A	c.(820-822)Ccc>Acc	p.P274T		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	274	His-rich.				calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						tactcactggggtggtgatca	0.582																																					p.P274T												.	.	0			c.C820A	11						.						191.0	162.0	172.0					11																	65793031		2201	4295	6496	65549607	SO:0001583	missense	117144	exon1			AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.820C>A	11.37:g.65793031G>T	ENSP00000309052:p.Pro274Thr	Somatic		Capture	SOLID	Phase_I	65549607	NM_053054	Q96P76	Missense_Mutation	SNP	ENST00000312106.5	37	CCDS8127.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.230968	0.39399	.	.	ENSG00000175294	ENST00000312106	D	0.97066	-4.23	1.92	1.92	0.25849	.	.	.	.	.	D	0.89914	0.6853	N	0.14661	0.345	0.09310	N	1	P	0.41232	0.743	B	0.28991	0.097	D	0.83427	0.0036	9	0.29301	T	0.29	.	10.0402	0.42153	0.0:0.0:1.0:0.0	.	274	Q8NEC5	CTSR1_HUMAN	T	274	ENSP00000309052:P274T	ENSP00000309052:P274T	P	-	1	0	CATSPER1	65549607	0.001000	0.12720	0.060000	0.19600	0.123000	0.20343	0.088000	0.14979	1.409000	0.46915	0.289000	0.19496	CCC		CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054	
CCS	9973	hgsc.bcm.edu	37	11	66368002	66368002	+	Silent	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:66368002C>T	ENST00000533244.1	+	5	912	c.471C>T	c.(469-471)ggC>ggT	p.G157G	CCS_ENST00000310190.4_Silent_p.G138G	NM_005125.1	NP_005116.1	O14618	CCS_HUMAN	copper chaperone for superoxide dismutase	157	Superoxide dismutase-like.				copper ion transmembrane transport (GO:0035434)|intracellular copper ion transport (GO:0015680)|positive regulation of oxidoreductase activity (GO:0051353)|removal of superoxide radicals (GO:0019430)|superoxide metabolic process (GO:0006801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|protein disulfide oxidoreductase activity (GO:0015035)|superoxide dismutase activity (GO:0004784)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|large_intestine(2)|lung(3)|stomach(1)	9						CTCATGGGGGCCCCCAGGACT	0.562																																					p.G157G												.	.	0			c.C471T	11						.						112.0	112.0	112.0					11																	66368002		2200	4295	6495	66124578	SO:0001819	synonymous_variant	9973	exon5			AF002210	CCDS8146.1	11q13.2	2012-09-20			ENSG00000173992	ENSG00000173992			1613	protein-coding gene	gene with protein product		603864				9295278	Standard	NM_005125		Approved		uc001oir.3	O14618	OTTHUMG00000167238	ENST00000533244.1:c.471C>T	11.37:g.66368002C>T		Somatic		Capture	SOLID	Phase_I	66124578	NM_005125	Q2M366|Q8NEV0	Silent	SNP	ENST00000533244.1	37	CCDS8146.1																																																																																				CCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393826.1	NM_005125	
ME3	10873	hgsc.bcm.edu	37	11	86161019	86161019	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:86161019A>T	ENST00000393324.3	-	9	1296	c.1043T>A	c.(1042-1044)cTt>cAt	p.L348H	RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000359636.2_Missense_Mutation_p.L348H|ME3_ENST00000543262.1_Missense_Mutation_p.L348H	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	348					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)	p.L348H(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				GGCCATGACAAGGAGGTGGGC	0.498																																					p.L348H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1043A	11						.						131.0	119.0	123.0					11																	86161019		2202	4299	6501	85838667	SO:0001583	missense	10873	exon10			X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.1043T>A	11.37:g.86161019A>T	ENSP00000376998:p.Leu348His	Somatic		Capture	SOLID	Phase_I	85838667	NM_001161586	B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	A	29.0	4.970766	0.92919	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	5.82	5.82	0.92795	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.191295	0.44902	D	0.000409	T	0.72779	0.3503	H	0.97516	4.02	0.80722	D	1	D	0.60160	0.987	D	0.64687	0.928	D	0.83537	0.0094	9	.	.	.	.	16.1848	0.81942	1.0:0.0:0.0:0.0	.	348	Q16798	MAON_HUMAN	H	348	ENSP00000352657:L348H;ENSP00000440246:L348H;ENSP00000376998:L348H;ENSP00000431182:L348H	.	L	-	2	0	ME3	85838667	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.228000	0.95250	2.232000	0.73038	0.528000	0.53228	CTT		ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2		
RPUSD4	84881	hgsc.bcm.edu	37	11	126074167	126074167	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr11:126074167C>T	ENST00000298317.4	-	6	906	c.853G>A	c.(853-855)Ggt>Agt	p.G285S	RPUSD4_ENST00000533628.1_Missense_Mutation_p.G254S|RPUSD4_ENST00000534393.1_5'Flank	NM_032795.2	NP_116184.2	Q96CM3	RUSD4_HUMAN	RNA pseudouridylate synthase domain containing 4	285					pseudouridine synthesis (GO:0001522)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)	p.G285S(1)|p.G285R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(8)|skin(1)	17	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0761)		TTGTGATCACCAAGGATTGGA	0.438																																					p.G285S												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G853A	11						.						125.0	122.0	123.0					11																	126074167		2201	4299	6500	125579377	SO:0001583	missense	84881	exon6			BC014131	CCDS8469.1, CCDS53721.1	11q24.2	2013-02-11			ENSG00000165526	ENSG00000165526		"""RNA pseudouridylate synthase domain containing"""	25898	protein-coding gene	gene with protein product							Standard	NM_032795		Approved	FLJ14494	uc001qde.3	Q96CM3	OTTHUMG00000165815	ENST00000298317.4:c.853G>A	11.37:g.126074167C>T	ENSP00000298317:p.Gly285Ser	Somatic		Capture	SOLID	Phase_I	125579377	NM_032795	E9PML2|Q96K56	Missense_Mutation	SNP	ENST00000298317.4	37	CCDS8469.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.020000	0.93462	.	.	ENSG00000165526	ENST00000298317;ENST00000533628	T;T	0.34072	1.38;1.38	5.04	5.04	0.67666	Pseudouridine synthase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70448	0.3225	M	0.93720	3.45	0.58432	D	0.999997	D;D	0.89917	0.999;1.0	D;D	0.97110	0.991;1.0	T	0.79790	-0.1655	10	0.72032	D	0.01	-22.2312	17.3621	0.87354	0.0:1.0:0.0:0.0	.	254;285	E9PML2;Q96CM3	.;RUSD4_HUMAN	S	285;254	ENSP00000298317:G285S;ENSP00000433065:G254S	ENSP00000298317:G285S	G	-	1	0	RPUSD4	125579377	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	6.985000	0.76193	2.315000	0.78130	0.557000	0.71058	GGT		RPUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386336.1	NM_032795	
LAMA2	3908	hgsc.bcm.edu	37	6	129777512	129777512	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:129777512C>T	ENST00000421865.2	+	48	6789	c.6740C>T	c.(6739-6741)gCc>gTc	p.A2247V		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2247	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TCTGTGAGAGCCCTGGATGGA	0.468																																					p.A2247V												.	.	0			c.C6740T	6						.						169.0	150.0	157.0					6																	129777512		2203	4300	6503	129819205	SO:0001583	missense	3908	exon48			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.6740C>T	6.37:g.129777512C>T	ENSP00000400365:p.Ala2247Val	Somatic		Capture	SOLID	Phase_I	129819205	NM_001079823	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	C	34	5.320714	0.95682	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865;ENST00000443169	T	0.76316	-1.01	5.52	5.52	0.82312	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.053642	0.85682	D	0.000000	T	0.70491	0.3230	N	0.08118	0	0.58432	D	0.999997	D;D	0.71674	0.998;0.996	D;D	0.69479	0.964;0.935	T	0.72740	-0.4202	9	.	.	.	.	19.4354	0.94792	0.0:1.0:0.0:0.0	.	2248;2247	A6NF00;P24043	.;LAMA2_HUMAN	V	2247;2246;2247;265	ENSP00000400365:A2247V	.	A	+	2	0	LAMA2	129819205	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.408000	0.66368	2.596000	0.87737	0.557000	0.71058	GCC		LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
UTRN	7402	hgsc.bcm.edu	37	6	144814584	144814584	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:144814584G>T	ENST00000367545.3	+	32	4585	c.4585G>T	c.(4585-4587)Ggc>Tgc	p.G1529C		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1529	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CAATGACCTGGGCGCACAGGT	0.473																																					p.G1529C												.	.	0			c.G4585T	6						.						77.0	66.0	70.0					6																	144814584		2203	4300	6503	144856277	SO:0001583	missense	7402	exon32			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.4585G>T	6.37:g.144814584G>T	ENSP00000356515:p.Gly1529Cys	Somatic		Capture	SOLID	Phase_I	144856277	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.189291	0.78789	.	.	ENSG00000152818	ENST00000367545	T	0.33865	1.39	5.32	5.32	0.75619	.	0.000000	0.53938	D	0.000058	T	0.58694	0.2140	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64322	-0.6435	10	0.72032	D	0.01	.	19.0104	0.92871	0.0:0.0:1.0:0.0	.	1529	P46939	UTRO_HUMAN	C	1529	ENSP00000356515:G1529C	ENSP00000356515:G1529C	G	+	1	0	UTRN	144856277	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	6.608000	0.74168	2.487000	0.83934	0.655000	0.94253	GGC		UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
IYD	389434	hgsc.bcm.edu	37	6	150690204	150690204	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:150690204T>A	ENST00000344419.3	+	1	177	c.37T>A	c.(37-39)Tgc>Agc	p.C13S	IYD_ENST00000229447.5_Missense_Mutation_p.C13S|IYD_ENST00000425615.3_5'Flank|IYD_ENST00000392255.3_Missense_Mutation_p.C13S|IYD_ENST00000392256.2_Missense_Mutation_p.C13S|IYD_ENST00000500320.3_Missense_Mutation_p.C13S	NM_203395.2	NP_981932.1	Q6PHW0	IYD1_HUMAN	iodotyrosine deiodinase	13					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	iodide peroxidase activity (GO:0004447)|oxidoreductase activity (GO:0016491)	p.C13S(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	15		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		AGCCATTCTCTGCATTTTGGT	0.507																																					p.C13S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T37A	6						.						211.0	226.0	221.0					6																	150690204		2203	4300	6503	150731897	SO:0001583	missense	389434	exon1			AK129950	CCDS5227.1, CCDS55066.1, CCDS55067.1	6q25.1	2006-08-24	2006-08-24	2006-08-24	ENSG00000009765	ENSG00000009765			21071	protein-coding gene	gene with protein product		612025	"""chromosome 6 open reading frame 71"""	C6orf71		16316988, 15289438	Standard	NM_001164694		Approved	dJ422F24.1, DEHAL1	uc003qnx.2	Q6PHW0	OTTHUMG00000016347	ENST00000344419.3:c.37T>A	6.37:g.150690204T>A	ENSP00000343763:p.Cys13Ser	Somatic		Capture	SOLID	Phase_I	150731897	NM_001164695	C9JFW2|Q2VPW0|Q2VPW1|Q5F1L5|Q5F1L6|Q5THM4|Q6ZP69|Q7Z7D7|Q7Z7D8	Missense_Mutation	SNP	ENST00000344419.3	37	CCDS5227.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.957998	0.73902	.	.	ENSG00000009765	ENST00000229447;ENST00000344419;ENST00000392256;ENST00000392255;ENST00000500320	D;T;D;D;D	0.88586	-2.4;-0.65;-2.27;-2.33;-2.36	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	D	0.92143	0.7509	M	0.77103	2.36	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.981	D;D;P	0.66716	0.946;0.935;0.69	D	0.92880	0.6322	10	0.59425	D	0.04	-21.1738	12.4862	0.55874	0.0:0.0:0.0:1.0	.	13;13;13	C9JFW2;Q6PHW0-3;Q6PHW0	.;.;IYD1_HUMAN	S	13	ENSP00000229447:C13S;ENSP00000343763:C13S;ENSP00000376085:C13S;ENSP00000376084:C13S;ENSP00000441276:C13S	ENSP00000229447:C13S	C	+	1	0	IYD	150731897	1.000000	0.71417	0.988000	0.46212	0.932000	0.56968	4.699000	0.61796	2.003000	0.58678	0.460000	0.39030	TGC		IYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043754.3	NM_203395	
ESR1	2099	hgsc.bcm.edu	37	6	152332875	152332875	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:152332875G>T	ENST00000206249.3	+	5	1543	c.1181G>T	c.(1180-1182)cGc>cTc	p.R394L	ESR1_ENST00000456483.2_Missense_Mutation_p.R282L|ESR1_ENST00000427531.2_Missense_Mutation_p.R221L|ESR1_ENST00000338799.5_Missense_Mutation_p.R394L|ESR1_ENST00000406599.1_Intron|ESR1_ENST00000443427.1_Missense_Mutation_p.R394L|ESR1_ENST00000440973.1_Missense_Mutation_p.R394L	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	394	Interaction with AKAP13.|Self-association.|Steroid-binding.|Transactivation AF-2.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	CTCGTCTGGCGCTCCATGGAG	0.498																																					p.R394L												.	.	0			c.G1181T	6						.						143.0	128.0	133.0					6																	152332875		2203	4300	6503	152374568	SO:0001583	missense	2099	exon6			X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.1181G>T	6.37:g.152332875G>T	ENSP00000206249:p.Arg394Leu	Somatic		Capture	SOLID	Phase_I	152374568	NM_001122740	Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Missense_Mutation	SNP	ENST00000206249.3	37	CCDS5234.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.385998|5.385998	0.95967|0.95967	.|.	.|.	ENSG00000091831|ENSG00000091831	ENST00000427531|ENST00000440973;ENST00000338799;ENST00000456483;ENST00000431219;ENST00000443427;ENST00000206249;ENST00000431590;ENST00000544394;ENST00000415488	.|D;D;D;D;D;D;T	.|0.96992	.|-4.2;-4.2;-4.2;-4.2;-4.2;-4.2;0.42	5.42|5.42	5.42|5.42	0.78866|0.78866	.|Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.98692|0.98692	0.9561|0.9561	M|M	0.94101|0.94101	3.495|3.495	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;0.997;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.97110	.|0.999;0.998;0.994;1.0;0.978;0.987	D|D	0.99655|0.99655	1.0992|1.0992	5|10	.|0.87932	.|D	.|0	.|.	19.21|19.21	0.93749|0.93749	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|298;175;89;393;394;394	.|B0QYW6;E7EVR3;C8CJL6;A8KAF4;G4XH65;P03372	.|.;.;.;.;.;ESR1_HUMAN	S|L	299|394;394;282;175;394;394;322;221;67	.|ENSP00000405330:R394L;ENSP00000342630:R394L;ENSP00000415934:R282L;ENSP00000387500:R394L;ENSP00000206249:R394L;ENSP00000445454:R221L;ENSP00000401995:R67L	.|ENSP00000206249:R394L	A|R	+|+	1|2	0|0	ESR1|ESR1	152374568|152374568	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.476000|9.476000	0.97823|0.97823	2.541000|2.541000	0.85698|0.85698	0.591000|0.591000	0.81541|0.81541	GCT|CGC		ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043308.1		
MYCT1	80177	hgsc.bcm.edu	37	6	153043226	153043226	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:153043226T>A	ENST00000367245.5	+	2	554	c.546T>A	c.(544-546)agT>agA	p.S182R	MYCT1_ENST00000529453.1_Intron	NM_025107.2	NP_079383.2	Q8N699	MYCT1_HUMAN	myc target 1	182						nucleus (GO:0005634)		p.S182R(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	20		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		AAACTGAGAGTCAGCTGGTGA	0.488																																					p.S182R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T546A	6						.						95.0	91.0	92.0					6																	153043226		2203	4300	6503	153084919	SO:0001583	missense	80177	exon2			AF527367	CCDS5239.1	6q25.1	2008-02-05			ENSG00000120279	ENSG00000120279			23172	protein-coding gene	gene with protein product						12477932	Standard	NM_025107		Approved	MTLC, FLJ21269	uc003qpc.4	Q8N699	OTTHUMG00000015850	ENST00000367245.5:c.546T>A	6.37:g.153043226T>A	ENSP00000356214:p.Ser182Arg	Somatic		Capture	SOLID	Phase_I	153084919	NM_025107	Q8N396|Q8TBE8|Q9H763	Missense_Mutation	SNP	ENST00000367245.5	37	CCDS5239.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.94|18.94	3.730260|3.730260	0.69074|0.69074	.|.	.|.	ENSG00000120279|ENSG00000120279	ENST00000367245|ENST00000532295	T|.	0.33216|.	1.42|.	5.8|5.8	2.05|2.05	0.26809|0.26809	.|.	0.087462|.	0.85682|.	D|.	0.000000|.	T|T	0.41903|0.41903	0.1179|0.1179	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	T|T	0.26189|0.26189	-1.0110|-1.0110	10|5	0.66056|.	D|.	0.02|.	-19.1697|-19.1697	9.1437|9.1437	0.36919|0.36919	0.0:0.3538:0.0:0.6462|0.0:0.3538:0.0:0.6462	.|.	134;182|.	D6Q1S4;Q8N699|.	.;MYCT1_HUMAN|.	R|D	182|163	ENSP00000356214:S182R|.	ENSP00000356214:S182R|.	S|V	+|+	3|2	2|0	MYCT1|MYCT1	153084919|153084919	1.000000|1.000000	0.71417|0.71417	0.950000|0.950000	0.38849|0.38849	0.864000|0.864000	0.49448|0.49448	0.650000|0.650000	0.24858|0.24858	0.116000|0.116000	0.18110|0.18110	0.482000|0.482000	0.46254|0.46254	AGT|GTC		MYCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042750.2	NM_025107	
MYCT1	80177	hgsc.bcm.edu	37	6	153043303	153043303	+	Missense_Mutation	SNP	G	G	T	rs148259104	byFrequency	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:153043303G>T	ENST00000367245.5	+	2	631	c.623G>T	c.(622-624)tGg>tTg	p.W208L	MYCT1_ENST00000529453.1_Intron	NM_025107.2	NP_079383.2	Q8N699	MYCT1_HUMAN	myc target 1	208						nucleus (GO:0005634)		p.W208L(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	20		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		CCTGACTACTGGTCCAGTAAC	0.537																																					p.W208L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G623T	6						.						110.0	106.0	108.0					6																	153043303		2203	4300	6503	153084996	SO:0001583	missense	80177	exon2			AF527367	CCDS5239.1	6q25.1	2008-02-05			ENSG00000120279	ENSG00000120279			23172	protein-coding gene	gene with protein product						12477932	Standard	NM_025107		Approved	MTLC, FLJ21269	uc003qpc.4	Q8N699	OTTHUMG00000015850	ENST00000367245.5:c.623G>T	6.37:g.153043303G>T	ENSP00000356214:p.Trp208Leu	Somatic		Capture	SOLID	Phase_I	153084996	NM_025107	Q8N396|Q8TBE8|Q9H763	Missense_Mutation	SNP	ENST00000367245.5	37	CCDS5239.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.8|28.8	4.952399|4.952399	0.92660|0.92660	.|.	.|.	ENSG00000120279|ENSG00000120279	ENST00000532295|ENST00000367245	.|T	.|0.26067	.|1.76	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.48484|0.48484	0.1502|0.1502	M|M	0.74881|0.74881	2.28|2.28	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	T|T	0.49143|0.49143	-0.8970|-0.8970	5|10	.|0.87932	.|D	.|0	-12.6422|-12.6422	20.0503|20.0503	0.97624|0.97624	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|160;208	.|D6Q1S4;Q8N699	.|.;MYCT1_HUMAN	C|L	189|208	.|ENSP00000356214:W208L	.|ENSP00000356214:W208L	G|W	+|+	1|2	0|0	MYCT1|MYCT1	153084996|153084996	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	8.072000|8.072000	0.89496|0.89496	2.736000|2.736000	0.93811|0.93811	0.591000|0.591000	0.81541|0.81541	GGT|TGG		MYCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042750.2	NM_025107	
PLG	5340	hgsc.bcm.edu	37	6	161139447	161139447	+	Silent	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:161139447C>A	ENST00000308192.9	+	8	972	c.909C>A	c.(907-909)acC>acA	p.T303T		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	303	Kringle 3. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	GTGCACAGACCCCTCACACAC	0.532																																					p.T303T												.	.	0			c.C909A	6						.						148.0	150.0	149.0					6																	161139447		2203	4300	6503	161059437	SO:0001819	synonymous_variant	5340	exon8			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.909C>A	6.37:g.161139447C>A		Somatic		Capture	SOLID	Phase_I	161059437	NM_000301	Q15146|Q5TEH4|Q6PA00	Silent	SNP	ENST00000308192.9	37	CCDS5279.1																																																																																				PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301	
MAP3K4	4216	hgsc.bcm.edu	37	6	161533733	161533733	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:161533733A>C	ENST00000392142.4	+	25	4701	c.4553A>C	c.(4552-4554)aAa>aCa	p.K1518T	MAP3K4_ENST00000348824.7_Missense_Mutation_p.K1464T|MAP3K4_ENST00000366919.2_Missense_Mutation_p.K1468T|MAP3K4_ENST00000366920.2_Missense_Mutation_p.K1514T	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1518	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		ACTCGTGCCAAAGGAGAGGGC	0.502																																					p.K1468T												.	.	0			c.A4403C	6						.						131.0	128.0	129.0					6																	161533733		2203	4300	6503	161453723	SO:0001583	missense	4216	exon24			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.4553A>C	6.37:g.161533733A>C	ENSP00000375986:p.Lys1518Thr	Somatic		Capture	SOLID	Phase_I	161453723	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.493799	0.84962	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.56	5.56	0.83823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.56292	0.1975	N	0.12961	0.28	0.52099	D	0.999948	D;P;D;D	0.89917	0.988;0.888;0.999;1.0	P;P;D;D	0.83275	0.882;0.647;0.99;0.996	T	0.63655	-0.6588	10	0.40728	T	0.16	-31.3882	15.7219	0.77718	1.0:0.0:0.0:0.0	.	1514;454;1468;1518	F5H538;Q9P1M2;Q9Y6R4-2;Q9Y6R4	.;.;.;M3K4_HUMAN	T	1468;1518;1468;1514;1464	ENSP00000355886:K1468T;ENSP00000375986:K1518T;ENSP00000355887:K1514T;ENSP00000297332:K1464T	ENSP00000297332:K1464T	K	+	2	0	MAP3K4	161453723	1.000000	0.71417	0.985000	0.45067	0.994000	0.84299	7.404000	0.79996	2.112000	0.64535	0.533000	0.62120	AAA		MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
FARS2	10667	hgsc.bcm.edu	37	6	5545445	5545445	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:5545445G>A	ENST00000324331.6	+	5	1273	c.937G>A	c.(937-939)Ggc>Agc	p.G313S	FARS2_ENST00000274680.4_Missense_Mutation_p.G313S			O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2, mitochondrial	313					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)|stomach(2)	15	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	CTGGGCTTTTGGCCTAGGATT	0.463																																					p.G313S												.	.	0			c.G937A	6						.						167.0	170.0	169.0					6																	5545445		2203	4300	6503	5490444	SO:0001583	missense	10667	exon5			AF097441	CCDS4494.1	6p25.1	2011-07-01	2007-02-23	2004-12-03	ENSG00000145982	ENSG00000145982	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	21062	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 2, mitochondrial"""	611592	"""phenylalanine-tRNA synthetase 1 (mitochondrial)"""	FARS1		10329163	Standard	NM_006567		Approved	dJ236A3.1	uc003mwr.2	O95363	OTTHUMG00000014178	ENST00000324331.6:c.937G>A	6.37:g.5545445G>A	ENSP00000316335:p.Gly313Ser	Somatic		Capture	SOLID	Phase_I	5490444	NM_006567	B2R664|Q53F66|Q5TCS3|Q6FG29|Q9NPY7|Q9P062	Missense_Mutation	SNP	ENST00000324331.6	37	CCDS4494.1	.	.	.	.	.	.	.	.	.	.	G	34	5.291555	0.95546	.	.	ENSG00000145982	ENST00000274680;ENST00000324331	D;D	0.90261	-2.64;-2.64	5.27	5.27	0.74061	Aminoacyl-tRNA synthetase, class II (1);Phenylalanyl-tRNA synthetase (1);	0.000000	0.85682	D	0.000000	D	0.97489	0.9178	H	0.98818	4.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99320	1.0906	10	0.87932	D	0	-16.8444	17.8691	0.88806	0.0:0.0:1.0:0.0	.	313	O95363	SYFM_HUMAN	S	313	ENSP00000274680:G313S;ENSP00000316335:G313S	ENSP00000274680:G313S	G	+	1	0	FARS2	5490444	1.000000	0.71417	0.937000	0.37676	0.936000	0.57629	9.390000	0.97246	2.445000	0.82738	0.563000	0.77884	GGC		FARS2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467790.1	NM_006567	
FAM8A1	51439	hgsc.bcm.edu	37	6	17606120	17606120	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:17606120G>A	ENST00000259963.3	+	4	1028	c.973G>A	c.(973-975)Gga>Aga	p.G325R		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	325	RDD.					integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			TTGCATTTGGGGAGCAGGTGG	0.403																																					p.G325R												.	.	0			c.G973A	6						.						108.0	105.0	106.0					6																	17606120		2203	4300	6503	17714099	SO:0001583	missense	51439	exon4			AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.973G>A	6.37:g.17606120G>A	ENSP00000259963:p.Gly325Arg	Somatic		Capture	SOLID	Phase_I	17714099	NM_016255	B2R725	Missense_Mutation	SNP	ENST00000259963.3	37	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.003804	0.93287	.	.	ENSG00000137414	ENST00000542476;ENST00000259963	.	.	.	5.87	5.87	0.94306	RDD (1);	0.000000	0.85682	D	0.000000	T	0.70579	0.3240	M	0.62723	1.935	0.80722	D	1	D	0.52996	0.957	P	0.59424	0.857	T	0.67067	-0.5764	9	0.41790	T	0.15	-9.7736	20.1991	0.98252	0.0:0.0:1.0:0.0	.	325	Q9UBU6	FA8A1_HUMAN	R	75;325	.	ENSP00000259963:G325R	G	+	1	0	FAM8A1	17714099	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.411000	0.97342	2.775000	0.95449	0.650000	0.86243	GGA		FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1		
CDKAL1	54901	hgsc.bcm.edu	37	6	21231214	21231214	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:21231214G>A	ENST00000378610.1	+	14	1694	c.1684G>A	c.(1684-1686)Gtg>Atg	p.V562M	CDKAL1_ENST00000476517.1_3'UTR|CDKAL1_ENST00000378624.4_Missense_Mutation_p.V471M|CDKAL1_ENST00000274695.4_Missense_Mutation_p.V562M			Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein 1-like 1	562					maintenance of translational fidelity (GO:1990145)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|N6-threonylcarbomyladenosine methylthiotransferase activity (GO:0035598)	p.V562M(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|stomach(1)	29	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			GAGGATGTCCGTGGGCTTGGC	0.448																																					p.V562M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1684A	6						.						147.0	143.0	144.0					6																	21231214		2203	4300	6503	21339193	SO:0001583	missense	54901	exon16			AK000349	CCDS4546.1	6p22.2	2008-02-05			ENSG00000145996	ENSG00000145996			21050	protein-coding gene	gene with protein product		611259					Standard	NM_017774		Approved	FLJ20342	uc003ndd.2	Q5VV42	OTTHUMG00000014340	ENST00000378610.1:c.1684G>A	6.37:g.21231214G>A	ENSP00000367873:p.Val562Met	Somatic		Capture	SOLID	Phase_I	21339193	NM_017774	A8K6S0|Q6P385|Q6ZR27|Q9NXB3	Missense_Mutation	SNP	ENST00000378610.1	37	CCDS4546.1	.	.	.	.	.	.	.	.	.	.	G	7.355	0.623582	0.14193	.	.	ENSG00000145996	ENST00000274695;ENST00000378624;ENST00000378610	T;T;T	0.53857	0.64;0.6;0.64	5.0	4.12	0.48240	.	0.510111	0.18805	N	0.130664	T	0.14442	0.0349	N	0.08118	0	0.22096	N	0.999366	P;P	0.41345	0.746;0.63	B;B	0.37346	0.247;0.125	T	0.02484	-1.1152	10	0.62326	D	0.03	.	8.2459	0.31689	0.0799:0.0:0.7665:0.1536	.	471;562	Q5VV42-2;Q5VV42	.;CDKAL_HUMAN	M	562;471;562	ENSP00000274695:V562M;ENSP00000367889:V471M;ENSP00000367873:V562M	ENSP00000274695:V562M	V	+	1	0	CDKAL1	21339193	0.996000	0.38824	0.807000	0.32361	0.017000	0.09413	2.830000	0.48136	1.307000	0.44944	0.644000	0.83932	GTG		CDKAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039986.1	NM_017774	
KIAA0319	9856	hgsc.bcm.edu	37	6	24570231	24570231	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:24570231G>C	ENST00000378214.3	-	12	2415	c.1891C>G	c.(1891-1893)Cct>Gct	p.P631A	KIAA0319_ENST00000543707.1_Missense_Mutation_p.P631A|KIAA0319_ENST00000430948.2_Missense_Mutation_p.P586A|KIAA0319_ENST00000535378.1_Missense_Mutation_p.P622A|KIAA0319_ENST00000537886.1_Missense_Mutation_p.P631A	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	631	PKD 4. {ECO:0000255|PROSITE- ProRule:PRU00151}.				negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						TCTTTATCAGGGCCGGCCACA	0.483																																					p.P631A												.	.	0			c.C1891G	6						.						78.0	67.0	71.0					6																	24570231		2203	4300	6503	24678210	SO:0001583	missense	9856	exon12			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.1891C>G	6.37:g.24570231G>C	ENSP00000367459:p.Pro631Ala	Somatic		Capture	SOLID	Phase_I	24678210	NM_001168377	A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Missense_Mutation	SNP	ENST00000378214.3	37	CCDS34348.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.924211	0.52653	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	T;T;T;T;T	0.11169	2.8;2.8;2.8;2.8;2.8	3.97	3.97	0.46021	PKD/Chitinase domain (1);Fibronectin, type III (1);PKD/REJ-like protein (1);PKD domain (1);	0.000000	0.56097	D	0.000022	T	0.16041	0.0386	L	0.41573	1.285	0.53688	D	0.999979	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.998	T	0.02844	-1.1103	10	0.45353	T	0.12	-12.8662	16.2184	0.82243	0.0:0.0:1.0:0.0	.	631;622;631	F5H123;Q5VV43-2;Q5VV43	.;.;K0319_HUMAN	A	631;622;586;631;631	ENSP00000439700:P631A;ENSP00000442403:P622A;ENSP00000401086:P586A;ENSP00000367459:P631A;ENSP00000437656:P631A	ENSP00000367459:P631A	P	-	1	0	KIAA0319	24678210	1.000000	0.71417	0.905000	0.35620	0.114000	0.19823	6.860000	0.75473	2.019000	0.59389	0.563000	0.77884	CCT		KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040009.1	NM_014809	
SCGN	10590	hgsc.bcm.edu	37	6	25661801	25661801	+	Missense_Mutation	SNP	T	T	G	rs555716689		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:25661801T>G	ENST00000377961.2	+	3	343	c.175T>G	c.(175-177)Ttg>Gtg	p.L59V	SCGN_ENST00000334979.6_Missense_Mutation_p.F35C	NM_006998.3	NP_008929.2	O76038	SEGN_HUMAN	secretagogin, EF-hand calcium binding protein	59	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						GAAAGCAAATTTGCACAAGGT	0.393																																					p.L59V												.	.	0			c.T175G	6						.						151.0	135.0	140.0					6																	25661801		2203	4300	6503	25769780	SO:0001583	missense	10590	exon3			BC000336	CCDS4561.1	6p22.3-p22.1	2013-01-10			ENSG00000079689	ENSG00000079689		"""EF-hand domain containing"""	16941	protein-coding gene	gene with protein product	"""calbindin-like"""	609202				10811645	Standard	NM_006998		Approved	SECRET, DJ501N12.8, SEGN, CALBL	uc003nfb.3	O76038	OTTHUMG00000014409	ENST00000377961.2:c.175T>G	6.37:g.25661801T>G	ENSP00000367197:p.Leu59Val	Somatic		Capture	SOLID	Phase_I	25769780	NM_006998	A8K0B2|Q5VV44|Q96QV7|Q9UJF6	Missense_Mutation	SNP	ENST00000377961.2	37	CCDS4561.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.220|3.220	-0.159800|-0.159800	0.06502|0.06502	.|.	.|.	ENSG00000079689|ENSG00000079689	ENST00000334979|ENST00000377961	.|T	.|0.09723	.|2.95	3.48|3.48	-3.48|-3.48	0.04739|0.04739	.|EF-hand-like domain (1);	.|0.679982	.|0.14277	.|N	.|0.329800	T|T	0.00608|0.00608	0.0020|0.0020	N|N	0.01874|0.01874	-0.695|-0.695	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.40720|0.40720	-0.9548|-0.9548	6|10	0.87932|0.10636	D|T	0|0.68	.|.	1.1472|1.1472	0.01778|0.01778	0.2462:0.138:0.3938:0.222|0.2462:0.138:0.3938:0.222	.|.	.|59	.|O76038	.|SEGN_HUMAN	C|V	35|59	.|ENSP00000367197:L59V	ENSP00000333933:F35C|ENSP00000367197:L59V	F|L	+|+	2|1	0|2	SCGN|SCGN	25769780|25769780	0.141000|0.141000	0.22595|0.22595	0.000000|0.000000	0.03702|0.03702	0.064000|0.064000	0.16182|0.16182	0.403000|0.403000	0.20982|0.20982	-0.881000|-0.881000	0.03992|0.03992	-0.254000|-0.254000	0.11334|0.11334	TTT|TTG		SCGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040067.1		
BTN3A1	11119	hgsc.bcm.edu	37	6	26411361	26411361	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:26411361A>C	ENST00000289361.6	+	8	1357	c.989A>C	c.(988-990)aAt>aCt	p.N330T	BTN3A1_ENST00000414912.2_Missense_Mutation_p.N278T|BTN3A1_ENST00000425234.2_Missense_Mutation_p.N330T|BTN3A1_ENST00000476549.2_Missense_Mutation_p.N330T	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	330	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N330T(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						TCAGCCTATAATGGTGAGTGA	0.428																																					p.N330T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A989C	6						.						188.0	182.0	184.0					6																	26411361		2203	4300	6503	26519340	SO:0001583	missense	11119	exon8			U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.989A>C	6.37:g.26411361A>C	ENSP00000289361:p.Asn330Thr	Somatic		Capture	SOLID	Phase_I	26519340	NM_001145009	A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Missense_Mutation	SNP	ENST00000289361.6	37	CCDS4608.1	.	.	.	.	.	.	.	.	.	.	.	0.042	-1.278809	0.01410	.	.	ENSG00000026950	ENST00000476549;ENST00000289361;ENST00000425234;ENST00000414912	T;T;T;T	0.46063	4.0;1.22;3.96;0.88	1.01	-2.01	0.07410	B30.2/SPRY domain (1);	.	.	.	.	T	0.05364	0.0142	N	0.03608	-0.345	0.09310	N	1	B;B;B;B	0.19817	0.013;0.029;0.039;0.013	B;B;B;B	0.18871	0.007;0.023;0.023;0.007	T	0.37267	-0.9713	9	0.30854	T	0.27	.	5.5031	0.16838	0.3974:0.6026:0.0:0.0	.	278;330;330;330	E9PGB4;O00481-3;O00481-2;O00481	.;.;.;BT3A1_HUMAN	T	330;330;330;278	ENSP00000420010:N330T;ENSP00000289361:N330T;ENSP00000396684:N330T;ENSP00000406667:N278T	ENSP00000289361:N330T	N	+	2	0	BTN3A1	26519340	0.014000	0.17966	0.005000	0.12908	0.009000	0.06853	-0.407000	0.07178	-0.786000	0.04516	-0.387000	0.06579	AAT		BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040112.3		
GPX5	2880	hgsc.bcm.edu	37	6	28497334	28497334	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:28497334T>A	ENST00000412168.2	+	2	283	c.194T>A	c.(193-195)cTc>cAc	p.L65H	GPX6_ENST00000483058.1_5'Flank|GPX5_ENST00000442674.2_3'UTR|GPX5_ENST00000469384.1_Missense_Mutation_p.L65H	NM_001509.2	NP_001500.1	O75715	GPX5_HUMAN	glutathione peroxidase 5 (epididymal androgen-related protein)	65					lipid metabolic process (GO:0006629)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)	p.L65H(1)		endometrium(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16					Glutathione(DB00143)	AAGCACATCCTCTTCGTCAAC	0.438																																					p.L65H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T194A	6						.						162.0	128.0	139.0					6																	28497334		2203	4300	6503	28605313	SO:0001583	missense	2880	exon2			AJ005277	CCDS4652.1, CCDS4653.1	6p22.1	2008-02-05			ENSG00000224586	ENSG00000224586	1.11.1.9		4557	protein-coding gene	gene with protein product		603435				9639555	Standard	NM_001509		Approved		uc003nll.2	O75715	OTTHUMG00000016307	ENST00000412168.2:c.194T>A	6.37:g.28497334T>A	ENSP00000392398:p.Leu65His	Somatic		Capture	SOLID	Phase_I	28605313	NM_003996	A1A4Y0	Missense_Mutation	SNP	ENST00000412168.2	37	CCDS4652.1	.	.	.	.	.	.	.	.	.	.	T	17.76	3.468555	0.63625	.	.	ENSG00000224586	ENST00000412168;ENST00000469384	T;T	0.10288	2.89;2.89	3.72	3.72	0.42706	Thioredoxin-like fold (2);	0.000000	0.64402	D	0.000001	T	0.43100	0.1232	H	0.99425	4.56	0.54753	D	0.999984	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.64437	-0.6408	10	0.87932	D	0	-16.6134	11.0057	0.47633	0.0:0.0:0.0:1.0	.	65;65	A1A4Y0;O75715	.;GPX5_HUMAN	H	65	ENSP00000392398:L65H;ENSP00000419935:L65H	ENSP00000392398:L65H	L	+	2	0	GPX5	28605313	1.000000	0.71417	0.980000	0.43619	0.639000	0.38242	6.441000	0.73439	1.889000	0.54706	0.533000	0.62120	CTC		GPX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043672.2		
DHX16	8449	hgsc.bcm.edu	37	6	30632684	30632684	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:30632684A>G	ENST00000376442.3	-	7	1406	c.1211T>C	c.(1210-1212)tTt>tCt	p.F404S	DHX16_ENST00000376437.5_5'Flank	NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	404					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						CTCCTCTCGAAATGGGAACAC	0.567																																					p.F404S												.	.	0			c.T1211C	6						.						76.0	72.0	73.0					6																	30632684		1509	2709	4218	30740663	SO:0001583	missense	8449	exon7			AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.1211T>C	6.37:g.30632684A>G	ENSP00000365625:p.Phe404Ser	Somatic		Capture	SOLID	Phase_I	30740663	NM_003587	O60322|Q5JP45|Q969X7|Q96QC1	Missense_Mutation	SNP	ENST00000376442.3	37	CCDS4685.1	.	.	.	.	.	.	.	.	.	.	A	19.68	3.872037	0.72180	.	.	ENSG00000204560	ENST00000376442	T	0.02606	4.23	5.18	5.18	0.71444	DEAD-like helicase (1);	0.179933	0.51477	D	0.000098	T	0.04679	0.0127	L	0.52011	1.625	0.80722	D	1	D;P	0.61697	0.99;0.741	D;P	0.64595	0.927;0.568	T	0.20306	-1.0279	10	0.72032	D	0.01	.	8.5109	0.33217	0.8275:0.0:0.0:0.1725	.	344;404	B4DZ28;O60231	.;DHX16_HUMAN	S	404	ENSP00000365625:F404S	ENSP00000365625:F404S	F	-	2	0	DHX16	30740663	1.000000	0.71417	0.157000	0.22605	0.914000	0.54420	2.753000	0.47524	1.959000	0.56917	0.402000	0.26972	TTT		DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	
KIF6	221458	hgsc.bcm.edu	37	6	39328176	39328176	+	Silent	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:39328176G>A	ENST00000287152.7	-	18	2171	c.2077C>T	c.(2077-2079)Ctg>Ttg	p.L693L	KIF6_ENST00000541946.1_Silent_p.L144L|KIF6_ENST00000373215.3_Silent_p.L676L|KIF6_ENST00000373213.4_Silent_p.L532L|KIF6_ENST00000229913.5_Silent_p.L144L|KIF6_ENST00000394362.1_Silent_p.L144L|KIF6_ENST00000538893.1_Silent_p.L637L|KIF6_ENST00000373216.3_Silent_p.L693L	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	693					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L693L(2)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						CATACCTGCAGGTTGGTGGCC	0.587																																					p.L693L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2077T	6						.						97.0	89.0	92.0					6																	39328176		2203	4300	6503	39436154	SO:0001819	synonymous_variant	221458	exon18			AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.2077C>T	6.37:g.39328176G>A		Somatic		Capture	SOLID	Phase_I	39436154	NM_145027	Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Silent	SNP	ENST00000287152.7	37	CCDS4844.1																																																																																				KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	NM_145027	
TREM2	54209	hgsc.bcm.edu	37	6	41129106	41129106	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:41129106T>C	ENST00000373113.3	-	2	379	c.286A>G	c.(286-288)Acg>Gcg	p.T96A	TREM2_ENST00000373122.4_Missense_Mutation_p.T96A|TREM2_ENST00000338469.3_Missense_Mutation_p.T96A	NM_018965.2	NP_061838.1	Q9NZC2	TREM2_HUMAN	triggering receptor expressed on myeloid cells 2	96	Ig-like V-type.		T -> K (in dbSNP:rs2234253).|T -> R (in dbSNP:rs2234253).		axon guidance (GO:0007411)|dendritic cell differentiation (GO:0097028)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|positive regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002588)|positive regulation of C-C chemokine receptor CCR7 signaling pathway (GO:1903082)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of CD40 signaling pathway (GO:2000350)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein localization to plasma membrane (GO:1903078)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	11	Ovarian(28;0.0418)|Colorectal(47;0.196)					TTCCGCAGCGTAATGGTGAGA	0.587																																					p.T96A												.	.	0			c.A286G	6						.						134.0	120.0	125.0					6																	41129106		2203	4300	6503	41237084	SO:0001583	missense	54209	exon2			AF213457	CCDS4852.1, CCDS64422.1	6p21.1	2014-09-17	2002-08-15		ENSG00000095970	ENSG00000095970		"""Immunoglobulin superfamily / V-set domain containing"""	17761	protein-coding gene	gene with protein product		605086	"""triggering receptor expressed on myeloid cells 2a"""			10799849, 12080485	Standard	NM_001271821		Approved	TREM-2, Trem2a, Trem2b, Trem2c	uc003opy.3	Q9NZC2	OTTHUMG00000014671	ENST00000373113.3:c.286A>G	6.37:g.41129106T>C	ENSP00000362205:p.Thr96Ala	Somatic		Capture	SOLID	Phase_I	41237084	NM_018965	Q8N5H8|Q8WYN6	Missense_Mutation	SNP	ENST00000373113.3	37	CCDS4852.1	.	.	.	.	.	.	.	.	.	.	T	13.49	2.252219	0.39797	.	.	ENSG00000095970	ENST00000373113;ENST00000338469;ENST00000373122	T;T;T	0.69175	-0.38;-0.38;-0.38	5.51	5.51	0.81932	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	T	0.79551	0.4465	M	0.86178	2.8	0.40829	D	0.98357	D;D;D	0.89917	0.998;0.998;1.0	D;D;D	0.87578	0.994;0.994;0.998	D	0.83693	0.0178	10	0.72032	D	0.01	-13.5737	13.3665	0.60687	0.0:0.0:0.0:1.0	.	96;96;96	Q9NZC2-2;Q9NZC2-3;Q9NZC2	.;.;TREM2_HUMAN	A	96	ENSP00000362205:T96A;ENSP00000342651:T96A;ENSP00000362214:T96A	ENSP00000342651:T96A	T	-	1	0	TREM2	41237084	0.994000	0.37717	0.074000	0.20217	0.045000	0.14185	4.160000	0.58164	2.101000	0.63845	0.459000	0.35465	ACG		TREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040499.1	NM_018965	
CUL7	9820	hgsc.bcm.edu	37	6	43011213	43011213	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:43011213G>T	ENST00000265348.3	-	17	3413	c.3328C>A	c.(3328-3330)Cct>Act	p.P1110T	CUL7_ENST00000535468.1_Missense_Mutation_p.P1194T|CUL7_ENST00000478630.1_5'Flank			Q14999	CUL7_HUMAN	cullin 7	1110					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.P1110T(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			ACCACAGGAGGGGGTGCCTCA	0.637																																					p.P1110T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3328A	6						.						37.0	41.0	40.0					6																	43011213		2203	4300	6503	43119191	SO:0001583	missense	9820	exon17			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.3328C>A	6.37:g.43011213G>T	ENSP00000265348:p.Pro1110Thr	Somatic		Capture	SOLID	Phase_I	43119191	NM_014780	B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	ENST00000265348.3	37	CCDS4881.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.860553	0.51482	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.80033	-1.31;-1.33	5.52	2.58	0.30949	.	1.565640	0.03206	N	0.175421	T	0.71609	0.3360	L	0.59436	1.845	0.27455	N	0.95332	B;B;B;B	0.26602	0.013;0.016;0.039;0.154	B;B;B;B	0.36092	0.009;0.026;0.158;0.217	T	0.63834	-0.6547	10	0.87932	D	0	-21.6658	11.0883	0.48099	0.0:0.1248:0.6161:0.2591	.	1194;1110;1194;1110	F5H0L1;A8K9U1;B4DYZ0;Q14999	.;.;.;CUL7_HUMAN	T	1110;1194	ENSP00000265348:P1110T;ENSP00000438788:P1194T	ENSP00000265348:P1110T	P	-	1	0	CUL7	43119191	0.000000	0.05858	0.021000	0.16686	0.311000	0.27955	-0.110000	0.10824	0.644000	0.30656	0.655000	0.94253	CCT		CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780	
TNFRSF21	27242	hgsc.bcm.edu	37	6	47200529	47200529	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:47200529A>G	ENST00000296861.2	-	6	2333	c.1940T>C	c.(1939-1941)gTt>gCt	p.V647A		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	647					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)		p.V647A(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			ATGGCTATAAACAGAGTCCAG	0.448																																					p.V647A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1940C	6						.						102.0	114.0	110.0					6																	47200529		2203	4300	6503	47308488	SO:0001583	missense	27242	exon6			AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1940T>C	6.37:g.47200529A>G	ENSP00000296861:p.Val647Ala	Somatic		Capture	SOLID	Phase_I	47308488	NM_014452	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	ENST00000296861.2	37	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.433495	0.83776	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	T	0.74002	-0.8	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.75459	0.3852	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.80269	-0.1453	10	0.87932	D	0	.	16.4237	0.83790	1.0:0.0:0.0:0.0	.	647	O75509	TNR21_HUMAN	A	647;336	ENSP00000296861:V647A	ENSP00000296861:V647A	V	-	2	0	TNFRSF21	47308488	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.279000	0.76181	0.533000	0.62120	GTT		TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452	
PKHD1	5314	hgsc.bcm.edu	37	6	51720738	51720738	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:51720738T>A	ENST00000371117.3	-	49	8139	c.7864A>T	c.(7864-7866)Acc>Tcc	p.T2622S	PKHD1_ENST00000340994.4_Missense_Mutation_p.T2622S	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2622					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AATGAGTAGGTCTCTTGGTCC	0.428																																					p.T2622S												.	.	0			c.A7864T	6						.						178.0	180.0	180.0					6																	51720738		2203	4300	6503	51828697	SO:0001583	missense	5314	exon49			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.7864A>T	6.37:g.51720738T>A	ENSP00000360158:p.Thr2622Ser	Somatic		Capture	SOLID	Phase_I	51828697	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	19.58	3.853822	0.71719	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.88277	-2.17;-2.36	6.17	6.17	0.99709	.	0.136880	0.51477	N	0.000091	D	0.82710	0.5096	L	0.55481	1.735	0.32481	N	0.541439	P;P;P	0.48694	0.914;0.825;0.914	P;B;P	0.48901	0.594;0.446;0.516	T	0.80286	-0.1446	10	0.07030	T	0.85	.	16.0034	0.80327	0.0:0.0:0.0:1.0	.	2622;2622;2622	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	S	2622	ENSP00000360158:T2622S;ENSP00000341097:T2622S	ENSP00000341097:T2622S	T	-	1	0	PKHD1	51828697	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	3.744000	0.55112	2.371000	0.80710	0.533000	0.62120	ACC		PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
PKHD1	5314	hgsc.bcm.edu	37	6	51732676	51732676	+	Missense_Mutation	SNP	C	C	A	rs371730612		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:51732676C>A	ENST00000371117.3	-	48	7993	c.7718G>T	c.(7717-7719)cGt>cTt	p.R2573L	PKHD1_ENST00000340994.4_Missense_Mutation_p.R2573L	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2573			R -> C (in ARPKD). {ECO:0000269|PubMed:19914852}.		cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.R2573L(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AATAGACATACGATGAAAAAG	0.433																																					p.R2573L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7718T	6						.						73.0	70.0	71.0					6																	51732676		2203	4300	6503	51840635	SO:0001583	missense	5314	exon48			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.7718G>T	6.37:g.51732676C>A	ENSP00000360158:p.Arg2573Leu	Somatic		Capture	SOLID	Phase_I	51840635	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	16.20	3.057098	0.55325	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.95001	-3.39;-3.58	5.67	2.93	0.34026	.	0.145744	0.48767	D	0.000171	D	0.91489	0.7313	M	0.78637	2.42	0.35922	D	0.831881	P;B;P	0.51449	0.945;0.34;0.561	P;B;B	0.46320	0.512;0.194;0.149	D	0.89590	0.3827	10	0.87932	D	0	.	8.4995	0.33150	0.0:0.7342:0.1267:0.139	.	2573;2573;2573	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	L	2573	ENSP00000360158:R2573L;ENSP00000341097:R2573L	ENSP00000341097:R2573L	R	-	2	0	PKHD1	51840635	0.995000	0.38212	0.840000	0.33206	0.823000	0.46562	3.533000	0.53561	0.337000	0.23665	0.591000	0.81541	CGT		PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
EFHC1	114327	hgsc.bcm.edu	37	6	52288836	52288836	+	Silent	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:52288836C>T	ENST00000371068.5	+	2	259	c.156C>T	c.(154-156)ctC>ctT	p.L52L	EFHC1_ENST00000538167.1_Silent_p.L33L|EFHC1_ENST00000491749.1_3'UTR|EFHC1_ENST00000433625.2_5'UTR	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	52						axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)	p.L52L(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					GAGACCGGCTCCAGTTCAACC	0.522																																					p.L52L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C156T	6						.						93.0	87.0	89.0					6																	52288836		2203	4300	6503	52396795	SO:0001819	synonymous_variant	114327	exon2			AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.156C>T	6.37:g.52288836C>T		Somatic		Capture	SOLID	Phase_I	52396795	NM_018100	B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Silent	SNP	ENST00000371068.5	37	CCDS4942.1																																																																																				EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040905.2	NM_018100	
PGM3	5238	hgsc.bcm.edu	37	6	83888433	83888433	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:83888433C>T	ENST00000283977.4	-	7	871	c.745G>A	c.(745-747)Gca>Aca	p.A249T	PGM3_ENST00000506587.1_Missense_Mutation_p.A358T|PGM3_ENST00000512866.1_Missense_Mutation_p.A330T|PGM3_ENST00000513973.1_Missense_Mutation_p.A330T					phosphoglucomutase 3											NS(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	18		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)		CTTCCATTTGCATATGCAGTT	0.313																																					p.A330T												.	.	0			c.G988A	6						.						134.0	117.0	122.0					6																	83888433		2203	4299	6502	83945152	SO:0001583	missense	5238	exon8			BC001258	CCDS4997.1, CCDS56435.1, CCDS56436.1, CCDS75487.1	6q14.1-q15	2012-10-02			ENSG00000013375	ENSG00000013375	5.4.2.3		8907	protein-coding gene	gene with protein product	"""acetylglucosamine phosphomutase"""	172100				12174217, 10721701	Standard	NM_001199917		Approved	AGM1, DKFZP434B187, PAGM	uc011dyz.2	O95394	OTTHUMG00000015110	ENST00000283977.4:c.745G>A	6.37:g.83888433C>T	ENSP00000283977:p.Ala249Thr	Somatic		Capture	SOLID	Phase_I	83945152	NM_015599		Missense_Mutation	SNP	ENST00000283977.4	37		.	.	.	.	.	.	.	.	.	.	C	29.9	5.046913	0.93740	.	.	ENSG00000013375	ENST00000513973;ENST00000512866;ENST00000283977;ENST00000506587	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	6.06	5.18	0.71444	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);	0.044268	0.85682	D	0.000000	T	0.76990	0.4065	M	0.90922	3.16	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.997;0.966;0.999	T	0.82997	-0.0179	10	0.56958	D	0.05	-42.061	16.2772	0.82651	0.1338:0.8662:0.0:0.0	.	358;358;330	E9PF86;B4DX94;O95394	.;.;AGM1_HUMAN	T	330;330;249;358	ENSP00000424874:A330T;ENSP00000421565:A330T;ENSP00000283977:A249T;ENSP00000425809:A358T	ENSP00000283977:A249T	A	-	1	0	PGM3	83945152	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.089000	0.76909	1.537000	0.49254	0.650000	0.86243	GCA		PGM3-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000366385.2	NM_015599	
SLC35A1	10559	hgsc.bcm.edu	37	6	88218780	88218780	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:88218780T>A	ENST00000369552.4	+	7	800	c.773T>A	c.(772-774)cTc>cAc	p.L258H	SLC35A1_ENST00000544441.1_Missense_Mutation_p.L124H|SLC35A1_ENST00000464978.1_3'UTR|SLC35A1_ENST00000369557.5_Missense_Mutation_p.S177T|C6orf165_ENST00000506888.1_3'UTR|SLC35A1_ENST00000369556.3_Missense_Mutation_p.L199H	NM_006416.4	NP_006407.1	P78382	S35A1_HUMAN	solute carrier family 35 (CMP-sialic acid transporter), member A1	258					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|CMP-N-acetylneuraminate transport (GO:0015782)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	CMP-N-acetylneuraminate transmembrane transporter activity (GO:0005456)|sugar:proton symporter activity (GO:0005351)			breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		GTTGGTGGCCTCTACACTTCT	0.393																																					p.L258H	NSCLC(183;214 2117 17033 22638 44782)|Ovarian(87;1008 1343 9644 42916 50932)											.	.	0			c.T773A	6						.						156.0	141.0	146.0					6																	88218780		2203	4300	6503	88275499	SO:0001583	missense	10559	exon7			D87969	CCDS5010.1, CCDS55043.1	6q15	2013-05-22			ENSG00000164414	ENSG00000164414		"""Solute carriers"""	11021	protein-coding gene	gene with protein product		605634	"""solute carrier family 35 (UDP-galactose transporter), member 1"""			9010752, 9644260	Standard	NM_006416		Approved	CMPST, hCST	uc011dzj.2	P78382	OTTHUMG00000015177	ENST00000369552.4:c.773T>A	6.37:g.88218780T>A	ENSP00000358565:p.Leu258His	Somatic		Capture	SOLID	Phase_I	88275499	NM_006416	Q5W1L8	Missense_Mutation	SNP	ENST00000369552.4	37	CCDS5010.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.3|21.3	4.121358|4.121358	0.77436|0.77436	.|.	.|.	ENSG00000164414|ENSG00000164414	ENST00000369556;ENST00000544441;ENST00000369552|ENST00000369557	T;T;T|.	0.61040|.	0.14;0.14;0.14|.	5.7|5.7	4.52|4.52	0.55395|0.55395	.|.	0.077730|.	0.52532|.	U|.	0.000061|.	T|T	0.72550|0.72550	0.3474|0.3474	M|M	0.92833|0.92833	3.35|3.35	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.85130|.	0.989;0.995;0.997|.	T|T	0.76438|0.76438	-0.2959|-0.2959	10|6	0.87932|0.13853	D|T	0|0.58	-35.1144|-35.1144	13.0315|13.0315	0.58845|0.58845	0.0:0.0:0.1346:0.8654|0.0:0.0:0.1346:0.8654	.|.	258;199;124|.	P78382;Q5W1L8;B4DEM1|.	S35A1_HUMAN;.;.|.	H|T	199;124;258|177	ENSP00000358569:L199H;ENSP00000438603:L124H;ENSP00000358565:L258H|.	ENSP00000358565:L258H|ENSP00000358570:S177T	L|S	+|+	2|1	0|0	SLC35A1|SLC35A1	88275499|88275499	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	7.698000|7.698000	0.84413|0.84413	0.968000|0.968000	0.38212|0.38212	0.377000|0.377000	0.23210|0.23210	CTC|TCT		SLC35A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041446.1		
BACH2	60468	hgsc.bcm.edu	37	6	90647926	90647926	+	Silent	SNP	G	G	C	rs371695425		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:90647926G>C	ENST00000257749.4	-	8	2687	c.1980C>G	c.(1978-1980)gcC>gcG	p.A660A	BACH2_ENST00000343122.3_Silent_p.A660A|BACH2_ENST00000537989.1_Silent_p.A660A	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	660	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		GGCAGCGCTGGGCCGCGATGC	0.463																																					p.A660A												.	.	0			c.C1980G	6						.						94.0	96.0	95.0					6																	90647926		2203	4300	6503	90704647	SO:0001819	synonymous_variant	60468	exon8			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.1980C>G	6.37:g.90647926G>C		Somatic		Capture	SOLID	Phase_I	90704647	NM_021813	E1P518|Q59H70|Q5T793|Q9NTS5	Silent	SNP	ENST00000257749.4	37	CCDS5026.1																																																																																				BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813	
THBS2	7058	hgsc.bcm.edu	37	6	169650839	169650839	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr6:169650839G>T	ENST00000366787.3	-	3	290	c.41C>A	c.(40-42)cCc>cAc	p.P14H		NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	14					cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.P14H(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		TTGCGTGCTGGGCCACACCCA	0.552																																					p.P14H	Esophageal Squamous(91;219 1934 18562 44706)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C41A	6						.						58.0	48.0	52.0					6																	169650839		2203	4300	6503	169392764	SO:0001583	missense	7058	exon3				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.41C>A	6.37:g.169650839G>T	ENSP00000355751:p.Pro14His	Somatic		Capture	SOLID	Phase_I	169392764	NM_003247	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.126584	0.37533	.	.	ENSG00000186340	ENST00000366787;ENST00000435791	T	0.80480	-1.38	4.85	0.724	0.18236	.	0.665589	0.12281	U	0.482923	T	0.47746	0.1462	N	0.22421	0.69	0.09310	N	1	B	0.28512	0.214	B	0.25759	0.063	T	0.38585	-0.9654	10	0.54805	T	0.06	-1.8625	8.8318	0.35089	0.0:0.4839:0.3446:0.1714	.	14	P35442	TSP2_HUMAN	H	14	ENSP00000355751:P14H	ENSP00000355751:P14H	P	-	2	0	THBS2	169392764	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.285000	0.18883	-0.069000	0.12931	0.655000	0.94253	CCC		THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
SUPT6H	6830	hgsc.bcm.edu	37	17	27015172	27015172	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:27015172G>T	ENST00000314616.6	+	24	3353	c.3070G>T	c.(3070-3072)Ggt>Tgt	p.G1024C	SUPT6H_ENST00000347486.4_Missense_Mutation_p.G1024C	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1024	Interaction with KDM6A. {ECO:0000250}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G1024C(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GTGCCACATGGGTCCCAAAGT	0.602																																					p.G1024C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3070T	17						.						109.0	99.0	102.0					17																	27015172		2203	4300	6503	24039299	SO:0001583	missense	6830	exon24			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3070G>T	17.37:g.27015172G>T	ENSP00000319104:p.Gly1024Cys	Somatic		Capture	SOLID	Phase_I	24039299	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105043	0.77096	.	.	ENSG00000109111	ENST00000314616	.	.	.	4.95	4.95	0.65309	Tex RuvX-like domain (1);	0.000000	0.85682	D	0.000000	D	0.90789	0.7108	H	0.98333	4.205	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94469	0.7683	9	0.87932	D	0	-13.3635	18.5664	0.91118	0.0:0.0:1.0:0.0	.	1024	Q7KZ85	SPT6H_HUMAN	C	1024	.	ENSP00000319104:G1024C	G	+	1	0	SUPT6H	24039299	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.182000	0.94881	2.473000	0.83533	0.650000	0.86243	GGT		SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
MYO1D	4642	hgsc.bcm.edu	37	17	31065356	31065356	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:31065356A>G	ENST00000318217.5	-	14	1965	c.1661T>C	c.(1660-1662)aTt>aCt	p.I554T	MYO1D_ENST00000584232.1_5'UTR|MYO1D_ENST00000394649.4_Missense_Mutation_p.I466T|MYO1D_ENST00000579584.1_Missense_Mutation_p.I554T	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	554	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			CACCTCTGTAATGCTCAGTTT	0.383																																					p.I554T												.	.	0			c.T1661C	17						.						94.0	95.0	94.0					17																	31065356		2203	4300	6503	28089469	SO:0001583	missense	4642	exon14			AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.1661T>C	17.37:g.31065356A>G	ENSP00000324527:p.Ile554Thr	Somatic		Capture	SOLID	Phase_I	28089469	NM_015194	A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	37	CCDS32615.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.733209	0.89482	.	.	ENSG00000176658	ENST00000318217	D	0.86865	-2.18	5.55	5.55	0.83447	Myosin head, motor domain (2);	0.000000	0.39909	U	0.001236	D	0.90618	0.7058	L	0.46947	1.48	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.73708	0.981;0.981	D	0.91030	0.4863	10	0.56958	D	0.05	.	13.6602	0.62363	1.0:0.0:0.0:0.0	.	465;554	Q7Z3N6;O94832	.;MYO1D_HUMAN	T	554	ENSP00000324527:I554T	ENSP00000324527:I554T	I	-	2	0	MYO1D	28089469	1.000000	0.71417	0.990000	0.47175	0.997000	0.91878	9.133000	0.94460	2.105000	0.64084	0.528000	0.53228	ATT		MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1		
SYNRG	11276	hgsc.bcm.edu	37	17	35937541	35937541	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:35937541T>G	ENST00000339208.6	-	7	900	c.760A>C	c.(760-762)Agt>Cgt	p.S254R	SYNRG_ENST00000346661.4_Missense_Mutation_p.S254R|SYNRG_ENST00000394378.2_Intron|SYNRG_ENST00000345615.4_Intron|SYNRG_ENST00000591288.1_Intron|SYNRG_ENST00000585472.1_Intron|SYNRG_ENST00000588194.1_Intron|SYNRG_ENST00000502449.2_Intron	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	254					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						GTGGTACCACTTACACATCCA	0.443																																					p.S254R												.	.	0			c.A760C	17						.						265.0	260.0	262.0					17																	35937541		2203	4300	6503	33011654	SO:0001583	missense	11276	exon7			AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.760A>C	17.37:g.35937541T>G	ENSP00000343610:p.Ser254Arg	Somatic		Capture	SOLID	Phase_I	33011654	NM_007247	A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	ENST00000339208.6	37	CCDS11321.1	.	.	.	.	.	.	.	.	.	.	T	18.05	3.536623	0.65085	.	.	ENSG00000006114	ENST00000346661;ENST00000345615	T	0.35605	1.3	5.46	5.46	0.80206	.	0.312679	0.35970	N	0.002879	T	0.40886	0.1135	L	0.53249	1.67	0.39603	D	0.969764	P;P	0.49090	0.919;0.919	P;P	0.48795	0.59;0.59	T	0.33445	-0.9868	10	0.38643	T	0.18	-2.5447	10.8614	0.46829	0.0:0.0:0.1575:0.8425	.	254;254	Q9UMZ2-5;Q9UMZ2	.;SYNRG_HUMAN	R	254	ENSP00000005279:S254R	ENSP00000315722:S254R	S	-	1	0	SYNRG	33011654	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.889000	0.56212	2.056000	0.61249	0.482000	0.46254	AGT		SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256811.2	NM_007247	
FAM134C	162427	hgsc.bcm.edu	37	17	40733873	40733873	+	Silent	SNP	C	C	A	rs373567501		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:40733873C>A	ENST00000309428.5	-	9	1418	c.1359G>T	c.(1357-1359)tcG>tcT	p.S453S	FAM134C_ENST00000585894.1_Silent_p.S356S|FAM134C_ENST00000543197.1_Silent_p.S258S	NM_178126.3	NP_835227.1	Q86VR2	F134C_HUMAN	family with sequence similarity 134, member C	453						integral component of membrane (GO:0016021)		p.S453S(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	11		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.134)		GACTCAGCTCCGACTGGTCCA	0.562																																					p.S453S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1359T	17						.						37.0	36.0	36.0					17																	40733873		2203	4300	6503	37987399	SO:0001819	synonymous_variant	162427	exon9			BC049370	CCDS11432.1	17q21.2	2007-05-01							27258	protein-coding gene	gene with protein product						12477932	Standard	NM_178126		Approved	DKFZp686B1036, FLJ33806	uc002ial.2	Q86VR2		ENST00000309428.5:c.1359G>T	17.37:g.40733873C>A		Somatic		Capture	SOLID	Phase_I	37987399	NM_178126	B3KR75	Silent	SNP	ENST00000309428.5	37	CCDS11432.1																																																																																				FAM134C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450536.1	NM_178126	
PSME3	10197	hgsc.bcm.edu	37	17	40990154	40990154	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:40990154C>T	ENST00000590720.1	+	6	570	c.337C>T	c.(337-339)Cag>Tag	p.Q113*	PSME3_ENST00000545225.1_Nonsense_Mutation_p.Q52*|PSME3_ENST00000441946.2_Nonsense_Mutation_p.Q124*|PSME3_ENST00000592169.1_Nonsense_Mutation_p.Q57*|PSME3_ENST00000293362.3_Nonsense_Mutation_p.Q113*|PSME3_ENST00000541124.1_3'UTR			P61289	PSME3_HUMAN	proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)	113					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)	p.Q113*(1)		NS(1)|cervix(1)|large_intestine(3)|lung(1)	6		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		GAAAAGCAACCAGCAGCTGGT	0.517																																					p.Q113X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C337T	17						.						133.0	124.0	127.0					17																	40990154		2203	4300	6503	38243680	SO:0001587	stop_gained	10197	exon6			U11292	CCDS11442.1, CCDS45689.1, CCDS59290.1	17q12-q21	2004-02-17				ENSG00000131467		"""Proteasome (prosome, macropain) subunits"""	9570	protein-coding gene	gene with protein product		605129				7951316	Standard	NM_005789		Approved	Ki, PA28-gamma, REG-GAMMA, PA28G	uc002ibq.4	P61289		ENST00000590720.1:c.337C>T	17.37:g.40990154C>T	ENSP00000466794:p.Gln113*	Somatic		Capture	SOLID	Phase_I	38243680	NM_005789	A8K9A3|O35563|P97373|Q12920|Q13172|Q9BQD9	Nonsense_Mutation	SNP	ENST00000590720.1	37	CCDS45689.1	.	.	.	.	.	.	.	.	.	.	C	37	6.009447	0.97200	.	.	ENSG00000131467	ENST00000545225;ENST00000293362;ENST00000441946	.	.	.	5.64	4.67	0.58626	.	0.323946	0.31772	N	0.007094	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.5827	10.4445	0.44486	0.0:0.7971:0.1332:0.0697	.	.	.	.	X	52;113;113	.	ENSP00000293362:Q113X	Q	+	1	0	PSME3	38243680	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.368000	0.52357	1.623000	0.50342	0.650000	0.86243	CAG		PSME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452430.1	NM_176863	
CD300LG	146894	hgsc.bcm.edu	37	17	41939235	41939235	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:41939235A>T	ENST00000317310.4	+	7	996	c.955A>T	c.(955-957)Aca>Tca	p.T319S		NM_145273.3	NP_660316.2	Q6UXG3	CLM9_HUMAN	CD300 molecule-like family member g	319					immune system process (GO:0002376)|immunoglobulin transcytosis in epithelial cells (GO:0002414)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.T319S(1)		central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|skin(4)	19		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)		TCCCCTCCACACATCTGAGGA	0.602																																					p.T319S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A955T	17						.						48.0	43.0	45.0					17																	41939235		2203	4300	6503	39294761	SO:0001583	missense	146894	exon7			BC025395	CCDS11470.1, CCDS54131.1, CCDS54132.1, CCDS54133.1	17q21.31	2013-01-11	2006-03-29					"""Immunoglobulin superfamily / V-set domain containing"""	30455	protein-coding gene	gene with protein product	"""nepmucin"""	610520	"""CD300 antigen like family member G"""			16876123, 16754720	Standard	NM_001168322		Approved	Trem4, CLM9	uc002iem.3	Q6UXG3		ENST00000317310.4:c.955A>T	17.37:g.41939235A>T	ENSP00000321005:p.Thr319Ser	Somatic		Capture	SOLID	Phase_I	39294761	NM_145273	B4DNY5|F5H7P9|F8W9M3|Q8IX38|Q8IX39|Q8TA95	Missense_Mutation	SNP	ENST00000317310.4	37	CCDS11470.1	.	.	.	.	.	.	.	.	.	.	A	10.87	1.473915	0.26423	.	.	ENSG00000161649	ENST00000317310	T	0.05513	3.43	3.96	-3.95	0.04118	.	0.801696	0.10930	N	0.618448	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.14023	0.01	T	0.40421	-0.9564	10	0.72032	D	0.01	.	4.0235	0.09677	0.3018:0.0:0.3806:0.3176	.	319	Q6UXG3	CLM9_HUMAN	S	319	ENSP00000321005:T319S	ENSP00000321005:T319S	T	+	1	0	CD300LG	39294761	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.827000	0.01704	-0.918000	0.03808	-0.250000	0.11733	ACA		CD300LG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457646.1	NM_145273	
TBX21	30009	hgsc.bcm.edu	37	17	45820054	45820054	+	Silent	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:45820054C>G	ENST00000177694.1	+	2	781	c.570C>G	c.(568-570)gtC>gtG	p.V190V		NM_013351.1	NP_037483.1	Q9UL17	TBX21_HUMAN	T-box 21	190					cellular response to organic substance (GO:0071310)|lymphocyte migration (GO:0072676)|multicellular organismal development (GO:0007275)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(1)|large_intestine(3)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	22						TGGACGTGGTCTTGGTGGACC	0.632																																					p.V190V												.	.	0			c.C570G	17						.						47.0	39.0	42.0					17																	45820054		2203	4300	6503	43175053	SO:0001819	synonymous_variant	30009	exon2			AF093098	CCDS11514.1	17q21.2	2008-06-23				ENSG00000073861		"""T-boxes"""	11599	protein-coding gene	gene with protein product		604895					Standard	NM_013351		Approved	TBLYM, T-bet	uc002ilv.1	Q9UL17		ENST00000177694.1:c.570C>G	17.37:g.45820054C>G		Somatic		Capture	SOLID	Phase_I	43175053	NM_013351		Silent	SNP	ENST00000177694.1	37	CCDS11514.1																																																																																				TBX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441365.1	NM_013351	
ITGA3	3675	hgsc.bcm.edu	37	17	48158703	48158703	+	Silent	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:48158703A>T	ENST00000320031.8	+	23	3180	c.2850A>T	c.(2848-2850)gtA>gtT	p.V950V	ITGA3_ENST00000007722.7_Silent_p.V950V	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	950					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)	p.V950V(1)		endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						GAGTCCGGGTAAATGGCTGGG	0.547																																					p.V950V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2850T	17						.						88.0	64.0	72.0					17																	48158703		2203	4299	6502	45513702	SO:0001819	synonymous_variant	3675	exon23			M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.2850A>T	17.37:g.48158703A>T		Somatic		Capture	SOLID	Phase_I	45513702	NM_002204	A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Silent	SNP	ENST00000320031.8	37	CCDS11558.1																																																																																				ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000366298.1	NM_005501	
SGCA	6442	hgsc.bcm.edu	37	17	48247614	48247614	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:48247614C>G	ENST00000262018.3	+	7	894	c.858C>G	c.(856-858)ttC>ttG	p.F286L	HILS1_ENST00000504307.1_RNA|SGCA_ENST00000513942.1_Intron|SGCA_ENST00000543315.1_Intron|SGCA_ENST00000344627.6_Intron	NM_000023.2	NP_000014.1	Q16586	SGCA_HUMAN	sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)	286					muscle contraction (GO:0006936)|muscle organ development (GO:0007517)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(2)|skin(1)	14						ACCGTGACTTCTTGGTGGATG	0.642																																					p.F286L												.	.	0			c.C858G	17						.						125.0	107.0	113.0					17																	48247614		2203	4300	6503	45602613	SO:0001583	missense	6442	exon7			L34355	CCDS32679.1, CCDS45729.1	17q21	2014-09-17	2002-08-29		ENSG00000108823	ENSG00000108823			10805	protein-coding gene	gene with protein product	"""50kD DAG"", ""Sarcoglycan, alpha (50kD dystrophin-associated glycoprotein; adhalin)"", ""adhalin (limb girdle muscular dystrophy 2D)"""	600119	"""sarcoglycan, alpha (50kD dystrophin-associated glycoprotein)"""	ADL		7937874	Standard	NM_000023		Approved	SCARMD1, LGMD2D, adhalin, DMDA2, A2	uc002iqi.3	Q16586	OTTHUMG00000162024	ENST00000262018.3:c.858C>G	17.37:g.48247614C>G	ENSP00000262018:p.Phe286Leu	Somatic		Capture	SOLID	Phase_I	45602613	NM_000023	A6NEB8|A8K3K7|Q13710|Q13712	Missense_Mutation	SNP	ENST00000262018.3	37	CCDS32679.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.07|19.07	3.756529|3.756529	0.69648|0.69648	.|.	.|.	ENSG00000108823|ENSG00000108823	ENST00000262018|ENST00000504073	D|.	0.98234|.	-4.81|.	5.8|5.8	3.82|3.82	0.43975|0.43975	.|.	0.122077|.	0.56097|.	D|.	0.000035|.	T|T	0.69753|0.69753	0.3146|0.3146	M|M	0.70275|0.70275	2.135|2.135	0.80722|0.80722	D|D	1|1	D|.	0.61080|.	0.989|.	P|.	0.57101|.	0.813|.	T|T	0.69610|0.69610	-0.5099|-0.5099	10|5	0.45353|.	T|.	0.12|.	-27.5925|-27.5925	10.9379|10.9379	0.47255|0.47255	0.0:0.8466:0.0:0.1534|0.0:0.8466:0.0:0.1534	.|.	286|.	Q16586|.	SGCA_HUMAN|.	L|V	286|59	ENSP00000262018:F286L|.	ENSP00000262018:F286L|.	F|L	+|+	3|1	2|0	SGCA|SGCA	45602613|45602613	0.983000|0.983000	0.35010|0.35010	0.999000|0.999000	0.59377|0.59377	0.864000|0.864000	0.49448|0.49448	0.407000|0.407000	0.21049|0.21049	1.467000|1.467000	0.48044|0.48044	0.655000|0.655000	0.94253|0.94253	TTC|CTT		SGCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366841.1	NM_000023	
ABCC3	8714	hgsc.bcm.edu	37	17	48745263	48745263	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:48745263C>A	ENST00000285238.8	+	13	1755	c.1675C>A	c.(1675-1677)Cca>Aca	p.P559T	ABCC3_ENST00000427699.1_3'UTR	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	559	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	GTACGTGGACCCAAACAATGT	0.547																																					p.P559T												.	.	0			c.C1675A	17						.						178.0	143.0	154.0					17																	48745263		2203	4300	6503	46100262	SO:0001583	missense	8714	exon13			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.1675C>A	17.37:g.48745263C>A	ENSP00000285238:p.Pro559Thr	Somatic		Capture	SOLID	Phase_I	46100262	NM_003786	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	37	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	C	12.75	2.032883	0.35893	.	.	ENSG00000108846	ENST00000285238	D	0.88664	-2.41	4.32	-8.41	0.00961	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	1.478760	0.04542	N	0.388412	D	0.82426	0.5034	L	0.42686	1.345	0.09310	N	0.999998	B	0.26602	0.154	B	0.31101	0.124	T	0.71632	-0.4534	10	0.62326	D	0.03	0.9688	6.6481	0.22947	0.2515:0.1249:0.5479:0.0757	.	559	O15438	MRP3_HUMAN	T	559	ENSP00000285238:P559T	ENSP00000285238:P559T	P	+	1	0	ABCC3	46100262	0.000000	0.05858	0.001000	0.08648	0.575000	0.36095	-0.473000	0.06615	-1.187000	0.02709	0.591000	0.81541	CCA		ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
MRC2	9902	hgsc.bcm.edu	37	17	60753169	60753169	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:60753169C>A	ENST00000303375.5	+	10	1990	c.1588C>A	c.(1588-1590)Cca>Aca	p.P530T		NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	530	C-type lectin 3. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)	p.P530T(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						GTGGCACAGCCCATCCTGCTA	0.577																																					p.P530T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1588A	17						.						128.0	115.0	120.0					17																	60753169		2203	4300	6503	58106901	SO:0001583	missense	9902	exon10			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.1588C>A	17.37:g.60753169C>A	ENSP00000307513:p.Pro530Thr	Somatic		Capture	SOLID	Phase_I	58106901	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	37	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	C	16.69	3.194473	0.58017	.	.	ENSG00000011028	ENST00000303375	T	0.53423	0.62	4.26	3.29	0.37713	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.000000	0.85682	D	0.000000	T	0.52208	0.1720	L	0.35414	1.06	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.40496	-0.9560	10	0.15499	T	0.54	-8.1644	11.6528	0.51299	0.0:0.9124:0.0:0.0876	.	530	Q9UBG0	MRC2_HUMAN	T	530	ENSP00000307513:P530T	ENSP00000307513:P530T	P	+	1	0	MRC2	58106901	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.599000	0.67592	1.008000	0.39264	0.555000	0.69702	CCA		MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
AXIN2	8313	hgsc.bcm.edu	37	17	63554409	63554409	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:63554409G>T	ENST00000375702.5	-	1	438	c.330C>A	c.(328-330)ttC>ttA	p.F110L	AXIN2_ENST00000307078.5_Missense_Mutation_p.F110L|CTD-2535L24.2_ENST00000577662.1_3'UTR			Q9Y2T1	AXIN2_HUMAN	axin 2	110	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)	p.F110L(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						AGGCAAACCAGAAGTCTAAGG	0.468									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																												p.F110L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C330A	17						.						214.0	195.0	201.0					17																	63554409		2203	4300	6503	60984871	SO:0001583	missense	8313	exon2	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.330C>A	17.37:g.63554409G>T	ENSP00000364854:p.Phe110Leu	Somatic		Capture	SOLID	Phase_I	60984871	NM_004655	Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	ENST00000375702.5	37		.	.	.	.	.	.	.	.	.	.	G	10.98	1.504424	0.26949	.	.	ENSG00000168646	ENST00000307078;ENST00000544103;ENST00000375702	T;T;T	0.58210	0.35;0.35;0.35	4.91	1.28	0.21552	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.051188	0.85682	N	0.000000	T	0.64886	0.2639	H	0.94542	3.55	0.58432	D	0.999998	B;P;B	0.40638	0.267;0.725;0.267	B;P;B	0.44394	0.097;0.448;0.097	T	0.69416	-0.5151	10	0.87932	D	0	-21.7696	8.4846	0.33063	0.1564:0.0:0.7161:0.1275	.	110;110;110	B7ZKL5;Q9Y2T1;E7ES00	.;AXIN2_HUMAN;.	L	110	ENSP00000302625:F110L;ENSP00000441151:F110L;ENSP00000364854:F110L	ENSP00000302625:F110L	F	-	3	2	AXIN2	60984871	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.436000	0.34980	0.474000	0.27392	0.555000	0.69702	TTC		AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000445901.1	NM_004655	
ABCA6	23460	hgsc.bcm.edu	37	17	67075355	67075355	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:67075355T>A	ENST00000284425.2	-	38	4922	c.4748A>T	c.(4747-4749)gAg>gTg	p.E1583V	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1583					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					ACTTACCTTCTCCAGTGTGCA	0.348																																					p.E1583V												.	.	0			c.A4748T	17						.						99.0	93.0	95.0					17																	67075355		2203	4300	6503	64586950	SO:0001583	missense	23460	exon38			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.4748A>T	17.37:g.67075355T>A	ENSP00000284425:p.Glu1583Val	Somatic		Capture	SOLID	Phase_I	64586950	NM_080284	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	ENST00000284425.2	37	CCDS11683.1	.	.	.	.	.	.	.	.	.	.	T	18.31	3.595187	0.66219	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	D	0.82984	-1.67	4.45	4.45	0.53987	.	0.325159	0.21392	N	0.075281	D	0.91606	0.7348	H	0.94542	3.55	0.80722	D	1	P	0.52061	0.95	P	0.60345	0.873	D	0.92654	0.6135	10	0.87932	D	0	.	9.3307	0.38021	0.0:0.0:0.1807:0.8193	.	1583	Q8N139	ABCA6_HUMAN	V	1583;443	ENSP00000284425:E1583V	ENSP00000284425:E1583V	E	-	2	0	ABCA6	64586950	1.000000	0.71417	0.941000	0.38009	0.733000	0.41908	4.828000	0.62730	2.007000	0.58848	0.482000	0.46254	GAG		ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284	
TTYH2	94015	hgsc.bcm.edu	37	17	72227055	72227055	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:72227055A>T	ENST00000269346.4	+	3	405	c.331A>T	c.(331-333)Aac>Tac	p.N111Y	TTYH2_ENST00000529107.1_Missense_Mutation_p.N90Y	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	111						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						TTTCTATGGAAACAGCGAGAC	0.493																																					p.N111Y												.	.	0			c.A331T	17						.						189.0	148.0	162.0					17																	72227055		2203	4300	6503	69738650	SO:0001583	missense	94015	exon3				CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.331A>T	17.37:g.72227055A>T	ENSP00000269346:p.Asn111Tyr	Somatic		Capture	SOLID	Phase_I	69738650	NM_032646	B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Missense_Mutation	SNP	ENST00000269346.4	37	CCDS32717.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.623621	0.87460	.	.	ENSG00000141540	ENST00000269346;ENST00000529107	T;T	0.26067	1.76;1.76	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.58538	0.2129	M	0.89601	3.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.989;0.996	T	0.68176	-0.5478	10	0.87932	D	0	-50.2284	14.32	0.66479	1.0:0.0:0.0:0.0	.	90;111	B4DKD1;Q9BSA4	.;TTYH2_HUMAN	Y	111;90	ENSP00000269346:N111Y;ENSP00000433089:N90Y	ENSP00000269346:N111Y	N	+	1	0	TTYH2	69738650	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.653000	0.91088	2.027000	0.59764	0.533000	0.62120	AAC		TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387459.1		
ATP1B2	482	hgsc.bcm.edu	37	17	7559066	7559066	+	Silent	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:7559066C>A	ENST00000250111.4	+	7	1133	c.726C>A	c.(724-726)ccC>ccA	p.P242P		NM_001678.3	NP_001669.3	P14415	AT1B2_HUMAN	ATPase, Na+/K+ transporting, beta 2 polypeptide	242	immunoglobulin-like.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein stabilization (GO:0050821)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.0?(2)|p.P242P(1)|p.?(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|pancreas(1)	10		all_cancers(10;0.000178)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;2.55e-06)|READ - Rectum adenocarcinoma(115;0.168)		ACACACAGCCCCTGGTGGCTG	0.617																																					p.P242P												.	.	4	Whole gene deletion(2)|Unknown(1)|Substitution - coding silent(1)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|bone(1)	c.C726A	17						.						52.0	47.0	49.0					17																	7559066		2203	4300	6503	7499791	SO:0001819	synonymous_variant	482	exon7			U45945	CCDS32550.1	17p13.1	2012-10-22			ENSG00000129244	ENSG00000129244	3.6.3.9	"""ATPases / P-type"""	805	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-2"", ""sodium pump subunit beta-2"", ""sodium-potassium ATPase subunit beta 2 (non-catalytic)"""	182331				1699290	Standard	NM_001678		Approved	AMOG	uc002gif.1	P14415		ENST00000250111.4:c.726C>A	17.37:g.7559066C>A		Somatic		Capture	SOLID	Phase_I	7499791	NM_001678	A0AV17|A8K278|D3DTQ2|O60444	Silent	SNP	ENST00000250111.4	37	CCDS32550.1																																																																																				ATP1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440234.1	NM_001678	
TP53	7157	hgsc.bcm.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	C	T	rs28934575|rs397516437		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:7577548C>T	ENST00000269305.4	-	7	922	c.733G>A	c.(733-735)Ggc>Agc	p.G245S	TP53_ENST00000359597.4_Missense_Mutation_p.G245S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.G245S|TP53_ENST00000455263.2_Missense_Mutation_p.G245S|TP53_ENST00000445888.2_Missense_Mutation_p.G245S|TP53_ENST00000420246.2_Missense_Mutation_p.G245S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGTTCATGCCGCCCATGCAG	0.577	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.G245S	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,0	.	420	Substitution - Missense(390)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)|Insertion - Frameshift(1)	large_intestine(119)|lung(51)|breast(38)|ovary(29)|central_nervous_system(27)|upper_aerodigestive_tract(25)|stomach(25)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(22)|urinary_tract(14)|skin(9)|liver(7)|prostate(7)|biliary_tract(5)|bone(5)|pancreas(4)|soft_tissue(3)|vulva(2)|endometrium(2)|kidney(1)|cervix(1)|salivary_gland(1)	c.G733A	17	GRCh37	CM010463|CM900210|CM920674	TP53	M	rs28934575	.	C	SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	149.0	112.0	125.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	733,733,733,733,337,337,337	4.6	1.0	17	dbSNP_125	125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	56,56,56,56,56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	245/394,245/394,245/347,245/342,113/262,113/210,113/215	7577548	1,13005	2203	4300	6503	7518273	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.733G>A	17.37:g.7577548C>T	ENSP00000269305:p.Gly245Ser	Somatic		Capture	SOLID	Phase_I	7518273	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	33	5.259904	0.95368	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99878	0.9942	M	0.84585	2.705	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.976;0.992;0.999;0.999;1.0	D	0.96039	0.9023	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	rs28934575	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245S;ENSP00000352610:G245S;ENSP00000269305:G245S;ENSP00000398846:G245S;ENSP00000391127:G245S;ENSP00000391478:G245S;ENSP00000425104:G113S;ENSP00000423862:G152S	ENSP00000269305:G245S	G	-	1	0	TP53	7518273	1.000000	0.71417	0.965000	0.40720	0.974000	0.67602	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH2	146754	hgsc.bcm.edu	37	17	7695603	7695603	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:7695603A>C	ENST00000572933.1	+	46	8547	c.7087A>C	c.(7087-7089)Ata>Cta	p.I2363L	DNAH2_ENST00000389173.2_Missense_Mutation_p.I2363L			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2363					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I2363L(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GGACCCCAAAATACGGAGTTG	0.547																																					p.I2363L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A7087C	17						.						98.0	92.0	94.0					17																	7695603		2203	4300	6503	7636328	SO:0001583	missense	146754	exon45			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.7087A>C	17.37:g.7695603A>C	ENSP00000458355:p.Ile2363Leu	Somatic		Capture	SOLID	Phase_I	7636328	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	A	10.24	1.295083	0.23564	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.21543	2.0	4.98	3.85	0.44370	.	0.489552	0.19025	N	0.124716	T	0.06645	0.0170	N	0.01168	-0.975	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22452	-1.0216	10	0.28530	T	0.3	.	7.1788	0.25760	0.7108:0.1471:0.0:0.1421	.	2363	Q9P225	DYH2_HUMAN	L	2363	ENSP00000373825:I2363L	ENSP00000353818:I2363L	I	+	1	0	DNAH2	7636328	1.000000	0.71417	0.910000	0.35882	0.366000	0.29705	2.863000	0.48396	2.088000	0.63022	0.523000	0.50628	ATA		DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
ALOX12B	242	hgsc.bcm.edu	37	17	7989422	7989422	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:7989422C>G	ENST00000319144.4	-	2	524	c.264G>C	c.(262-264)caG>caC	p.Q88H	MIR4314_ENST00000583321.1_RNA	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	88	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						GGGCACAGATCTGCACATAGT	0.597										Multiple Myeloma(8;0.094)																											p.Q88H												.	.	0			c.G264C	17						.						136.0	112.0	120.0					17																	7989422		2203	4300	6503	7930147	SO:0001583	missense	242	exon2			AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.264G>C	17.37:g.7989422C>G	ENSP00000315167:p.Gln88His	Somatic		Capture	SOLID	Phase_I	7930147	NM_001139		Missense_Mutation	SNP	ENST00000319144.4	37	CCDS11129.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.982838	0.34942	.	.	ENSG00000179477	ENST00000319144	T	0.64085	-0.08	4.44	3.46	0.39613	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.230113	0.45606	D	0.000345	T	0.55737	0.1939	L	0.61218	1.895	0.29520	N	0.853545	B	0.23249	0.082	B	0.21546	0.035	T	0.54616	-0.8267	10	0.40728	T	0.16	-28.4528	8.8754	0.35343	0.1683:0.6687:0.1629:0.0	.	88	O75342	LX12B_HUMAN	H	88	ENSP00000315167:Q88H	ENSP00000315167:Q88H	Q	-	3	2	ALOX12B	7930147	0.986000	0.35501	1.000000	0.80357	0.990000	0.78478	0.600000	0.24104	1.064000	0.40671	0.555000	0.69702	CAG		ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226984.3		
EVPL	2125	hgsc.bcm.edu	37	17	74004774	74004774	+	Silent	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr17:74004774G>T	ENST00000301607.3	-	22	4765	c.4512C>A	c.(4510-4512)gtC>gtA	p.V1504V	TEN1-CDK3_ENST00000567351.1_RNA|EVPL_ENST00000586740.1_Silent_p.V1526V	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1504	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.V1504V(1)		breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CGTCAATCTGGACCTGCAGGT	0.597																																					p.V1504V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4512A	17						.						188.0	154.0	166.0					17																	74004774		2203	4300	6503	71516369	SO:0001819	synonymous_variant	2125	exon22			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.4512C>A	17.37:g.74004774G>T		Somatic		Capture	SOLID	Phase_I	71516369	NM_001988	A0AUV5	Silent	SNP	ENST00000301607.3	37	CCDS11737.1																																																																																				EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
SON	6651	hgsc.bcm.edu	37	21	34924591	34924591	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr21:34924591G>A	ENST00000356577.4	+	3	3529	c.3054G>A	c.(3052-3054)atG>atA	p.M1018I	SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Missense_Mutation_p.M1018I|SON_ENST00000300278.4_Missense_Mutation_p.M1018I|SON_ENST00000290239.6_Missense_Mutation_p.M1018I	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1018	14 X 6 AA repeats of [ED]-R-S-M-M-S.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GCTCTATGATGTCTTATGAGC	0.488																																					p.M1018I												.	.	0			c.G3054A	21						.						136.0	118.0	124.0					21																	34924591		2203	4300	6503	33846461	SO:0001583	missense	6651	exon3			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.3054G>A	21.37:g.34924591G>A	ENSP00000348984:p.Met1018Ile	Somatic		Capture	SOLID	Phase_I	33846461	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	CCDS13629.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.47|15.47	2.843062|2.843062	0.51057|0.51057	.|.	.|.	ENSG00000159140|ENSG00000159140	ENST00000436227|ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	.|T;T;T;T	.|0.11169	.|3.08;3.07;3.06;2.8	6.05|6.05	6.05|6.05	0.98169|0.98169	.|.	.|0.000000	.|0.64402	.|D	.|0.000003	T|T	0.28665|0.28665	0.0710|0.0710	M|M	0.68593|0.68593	2.085|2.085	0.31966|0.31966	N|N	0.607743|0.607743	.|D;D;P;D;D	.|0.59767	.|0.986;0.976;0.94;0.986;0.969	.|D;D;P;D;D	.|0.71656	.|0.974;0.943;0.465;0.974;0.961	T|T	0.18935|0.18935	-1.0321|-1.0321	5|10	.|0.46703	.|T	.|0.11	.|.	11.369|11.369	0.49690|0.49690	0.0814:0.0:0.9186:0.0|0.0814:0.0:0.9186:0.0	.|.	.|1018;1018;699;1018;1018	.|P18583-10;P18583;P18583-2;P18583-3;P18583-6	.|.;SON_HUMAN;.;.;.	Y|I	13|1018	.|ENSP00000348984:M1018I;ENSP00000290239:M1018I;ENSP00000300278:M1018I;ENSP00000371095:M1018I	.|ENSP00000290239:M1018I	C|M	+|+	2|3	0|0	SON|SON	33846461|33846461	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.320000|5.320000	0.65841|0.65841	2.878000|2.878000	0.98634|0.98634	0.650000|0.650000	0.86243|0.86243	TGT|ATG		SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
IGSF5	150084	hgsc.bcm.edu	37	21	41137756	41137756	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr21:41137756G>T	ENST00000380588.4	+	3	498	c.395G>T	c.(394-396)gGa>gTa	p.G132V	IGSF5_ENST00000479378.1_3'UTR	NM_001080444.1	NP_001073913.1	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily, member 5	132	Ig-like V-type 1.				single organismal cell-cell adhesion (GO:0016337)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.G132V(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(7)|skin(2)|stomach(1)	23		Prostate(19;5.35e-06)				CGCCTGCATGGATCTGCTTAC	0.532																																					p.G132V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G395T	21						.						91.0	80.0	84.0					21																	41137756		2203	4300	6503	40059626	SO:0001583	missense	150084	exon3				CCDS33562.1	21q22.2	2013-01-29			ENSG00000183067	ENSG00000183067		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5952	protein-coding gene	gene with protein product	"""junctional adhesion molecule 4"""	610638					Standard	NM_001080444		Approved	JAM4	uc002yyo.3	Q9NSI5	OTTHUMG00000086724	ENST00000380588.4:c.395G>T	21.37:g.41137756G>T	ENSP00000369962:p.Gly132Val	Somatic		Capture	SOLID	Phase_I	40059626	NM_001080444		Missense_Mutation	SNP	ENST00000380588.4	37	CCDS33562.1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.106878	0.37145	.	.	ENSG00000183067	ENST00000380588	T	0.64085	-0.08	3.85	-1.78	0.07957	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.824868	0.11440	N	0.563856	T	0.63367	0.2505	L	0.40543	1.245	0.09310	N	0.999996	D	0.69078	0.997	D	0.65874	0.939	T	0.54807	-0.8238	10	0.36615	T	0.2	-0.4206	6.8497	0.24008	0.2605:0.4678:0.2717:0.0	.	132	Q9NSI5	IGSF5_HUMAN	V	132	ENSP00000369962:G132V	ENSP00000369962:G132V	G	+	2	0	IGSF5	40059626	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.029000	0.13666	-0.264000	0.09365	0.557000	0.71058	GGA		IGSF5-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195005.1		
ACSM1	116285	hgsc.bcm.edu	37	16	20681276	20681276	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:20681276A>T	ENST00000307493.4	-	5	852	c.785T>A	c.(784-786)gTc>gAc	p.V262D	ACSM1_ENST00000520010.1_Missense_Mutation_p.V262D|ACSM1_ENST00000219151.4_5'UTR	NM_052956.2	NP_443188.2	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member 1	262					benzoate metabolic process (GO:0018874)|butyrate metabolic process (GO:0019605)|cholesterol homeostasis (GO:0042632)|energy derivation by oxidation of organic compounds (GO:0015980)|fatty acid biosynthetic process (GO:0006633)|fatty acid oxidation (GO:0019395)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	acyl-CoA ligase activity (GO:0003996)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(23)|skin(3)|upper_aerodigestive_tract(2)	42						GCACCAGGAGACATCAGATGT	0.512																																					p.V262D												.	.	0			c.T785A	16						.						137.0	119.0	125.0					16																	20681276		2201	4300	6501	20588777	SO:0001583	missense	116285	exon5			AB059429	CCDS10587.1	16p12.3	2008-02-05	2005-09-08	2005-09-08	ENSG00000166743	ENSG00000166743	6.2.1.2	"""Acyl-CoA synthetase family"""	18049	protein-coding gene	gene with protein product		614357	"""butyryl Coenzyme A synthetase 1"""	BUCS1		11470804, 12654705	Standard	NM_052956		Approved	MACS1	uc002dhm.1	Q08AH1	OTTHUMG00000131550	ENST00000307493.4:c.785T>A	16.37:g.20681276A>T	ENSP00000301956:p.Val262Asp	Somatic		Capture	SOLID	Phase_I	20588777	NM_052956	Q08AH2|Q96A20	Missense_Mutation	SNP	ENST00000307493.4	37	CCDS10587.1	.	.	.	.	.	.	.	.	.	.	A	13.94	2.386532	0.42308	.	.	ENSG00000166743	ENST00000307493;ENST00000520010	T;T	0.55930	0.49;0.49	5.05	3.97	0.46021	AMP-dependent synthetase/ligase (1);	1.245610	0.05989	N	0.645704	T	0.68915	0.3053	M	0.67517	2.055	0.54753	D	0.999985	D	0.59767	0.986	P	0.62184	0.899	T	0.54846	-0.8232	10	0.87932	D	0	.	8.6956	0.34293	0.9093:0.0:0.0907:0.0	.	262	Q08AH1	ACSM1_HUMAN	D	262	ENSP00000301956:V262D;ENSP00000428047:V262D	ENSP00000301956:V262D	V	-	2	0	ACSM1	20588777	0.166000	0.22962	0.042000	0.18584	0.475000	0.33008	2.868000	0.48436	0.948000	0.37687	0.421000	0.28195	GTC		ACSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254412.1	NM_052956	
OTOA	146183	hgsc.bcm.edu	37	16	21739679	21739679	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:21739679G>A	ENST00000286149.4	+	19	2177	c.2176G>A	c.(2176-2178)Ggc>Agc	p.G726S	OTOA_ENST00000388958.3_Missense_Mutation_p.G712S|OTOA_ENST00000388957.3_Missense_Mutation_p.G388S|OTOA_ENST00000388956.4_Missense_Mutation_p.G633S			Q7RTW8	OTOAN_HUMAN	otoancorin	726					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)		p.G712S(1)|p.G712C(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		TGCTCTACACGGCCTCAGAGA	0.597																																					p.G712S												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G2134A	16						.						76.0	68.0	71.0					16																	21739679		2198	4300	6498	21647180	SO:0001583	missense	146183	exon19			AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.2176G>A	16.37:g.21739679G>A	ENSP00000286149:p.Gly726Ser	Somatic		Capture	SOLID	Phase_I	21647180	NM_144672	A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	ENST00000286149.4	37		.	.	.	.	.	.	.	.	.	.	G	0.373	-0.932907	0.02359	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956;ENST00000388957;ENST00000338456	T;T;T;T	0.62364	0.03;0.04;0.04;0.04	5.29	-6.43	0.01926	.	0.930648	0.09084	N	0.850899	T	0.36771	0.0979	L	0.38531	1.155	0.09310	N	1	B;P;B;B	0.34892	0.286;0.474;0.108;0.286	B;B;B;B	0.24155	0.021;0.051;0.008;0.021	T	0.27226	-1.0080	10	0.14656	T	0.56	-0.359	6.2874	0.21041	0.4369:0.3649:0.1981:0.0	.	726;633;388;712	Q7RTW8;B3KWU3;Q7RTW8-2;E9PF51	OTOAN_HUMAN;.;.;.	S	712;726;633;388;121	ENSP00000373610:G712S;ENSP00000286149:G726S;ENSP00000373608:G633S;ENSP00000373609:G388S	ENSP00000286149:G726S	G	+	1	0	OTOA	21647180	0.000000	0.05858	0.008000	0.14137	0.080000	0.17528	-0.195000	0.09546	-0.661000	0.05345	-0.150000	0.13652	GGC		OTOA-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000430021.1		
KDM8	79831	hgsc.bcm.edu	37	16	27221627	27221627	+	Silent	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:27221627G>A	ENST00000286096.4	+	2	356	c.183G>A	c.(181-183)agG>agA	p.R61R	KDM8_ENST00000441782.2_Silent_p.R99R|KDM8_ENST00000380948.2_Silent_p.R61R|KDM8_ENST00000568965.1_Silent_p.R61R	NM_024773.2	NP_079049.2	Q8N371	KDM8_HUMAN	lysine (K)-specific demethylase 8	61					G2/M transition of mitotic cell cycle (GO:0000086)|histone H3-K36 demethylation (GO:0070544)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (H3-K36 specific) (GO:0051864)|metal ion binding (GO:0046872)										AGGGCAGGAGGGACGAGTGTC	0.577																																					p.R99R												.	.	0			c.G297A	16						.						84.0	54.0	64.0					16																	27221627		2193	4292	6485	27129128	SO:0001819	synonymous_variant	79831	exon2			AK023860	CCDS10627.1, CCDS45448.1	16p12.1	2012-03-28	2012-03-28	2012-03-28	ENSG00000155666	ENSG00000155666		"""Chromatin-modifying enzymes / K-demethylases"""	25840	protein-coding gene	gene with protein product		611917	"""jumonji domain containing 5"""	JMJD5		20457893	Standard	NM_024773		Approved	FLJ13798	uc010vcn.1	Q8N371	OTTHUMG00000131677	ENST00000286096.4:c.183G>A	16.37:g.27221627G>A		Somatic		Capture	SOLID	Phase_I	27129128	NM_001145348	B4DLU9|Q6VAK5|Q9H8B1	Silent	SNP	ENST00000286096.4	37	CCDS10627.1																																																																																				KDM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254580.3	NM_024773	
MVP	9961	hgsc.bcm.edu	37	16	29856042	29856042	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:29856042G>C	ENST00000357402.5	+	11	2001	c.1863G>C	c.(1861-1863)agG>agC	p.R621S	MVP_ENST00000395353.1_Missense_Mutation_p.R621S	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	621					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)	p.R621S(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						CCCTGCCCAGGCCCCGGGACC	0.627																																					p.R621S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1863C	16						.						91.0	92.0	92.0					16																	29856042		2197	4300	6497	29763543	SO:0001583	missense	9961	exon11			X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.1863G>C	16.37:g.29856042G>C	ENSP00000349977:p.Arg621Ser	Somatic		Capture	SOLID	Phase_I	29763543	NM_017458	Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Missense_Mutation	SNP	ENST00000357402.5	37	CCDS10656.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904603	0.33628	.	.	ENSG00000013364	ENST00000357402;ENST00000395353	T;T	0.40756	1.02;1.02	5.91	3.95	0.45737	Shoulder domain (1);	0.927686	0.09206	N	0.833998	T	0.28234	0.0697	N	0.19112	0.55	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.09975	-1.0650	10	0.33141	T	0.24	-16.9271	8.7938	0.34868	0.147:0.0:0.853:0.0	.	621	Q14764	MVP_HUMAN	S	621	ENSP00000349977:R621S;ENSP00000378760:R621S	ENSP00000349977:R621S	R	+	3	2	MVP	29763543	0.025000	0.19082	0.514000	0.27761	0.354000	0.29330	0.756000	0.26419	2.808000	0.96608	0.655000	0.94253	AGG		MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109711.3	NM_005115	
DNAJA3	9093	hgsc.bcm.edu	37	16	4493082	4493082	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:4493082C>G	ENST00000262375.6	+	6	925	c.848C>G	c.(847-849)tCc>tGc	p.S283C	DNAJA3_ENST00000355296.4_Missense_Mutation_p.S283C|DNAJA3_ENST00000431375.2_Missense_Mutation_p.S130C	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	283					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						GGCCGCGGCTCCATCATCATA	0.537																																					p.S283C												.	.	0			c.C848G	16						.						103.0	84.0	90.0					16																	4493082		2197	4300	6497	4433083	SO:0001583	missense	9093	exon6			AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.848C>G	16.37:g.4493082C>G	ENSP00000262375:p.Ser283Cys	Somatic		Capture	SOLID	Phase_I	4433083	NM_001135110	B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Missense_Mutation	SNP	ENST00000262375.6	37	CCDS10515.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.912099	0.92178	.	.	ENSG00000103423	ENST00000262375;ENST00000355296;ENST00000431375	T;T;T	0.65364	-0.15;-0.15;0.86	5.92	5.92	0.95590	HSP40/DnaJ peptide-binding (1);Heat shock protein DnaJ, cysteine-rich domain (4);	0.226617	0.47852	D	0.000218	T	0.79930	0.4531	M	0.83384	2.64	0.58432	D	0.999997	D;P;P	0.64830	0.994;0.879;0.953	P;P;P	0.60068	0.868;0.669;0.8	T	0.81547	-0.0883	10	0.66056	D	0.02	-18.249	19.3095	0.94179	0.0:1.0:0.0:0.0	.	130;283;283	E7ES32;Q96EY1-2;Q96EY1	.;.;DNJA3_HUMAN	C	283;283;130	ENSP00000262375:S283C;ENSP00000347445:S283C;ENSP00000393970:S130C	ENSP00000262375:S283C	S	+	2	0	DNAJA3	4433083	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.768000	0.85345	2.804000	0.96469	0.655000	0.94253	TCC		DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251633.1		
ZNF267	10308	hgsc.bcm.edu	37	16	31926953	31926953	+	Silent	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:31926953A>G	ENST00000300870.10	+	4	1592	c.1383A>G	c.(1381-1383)gaA>gaG	p.E461E		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	461					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E461E(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						ATACAGGAGAAAAACTTTACA	0.333																																					p.E461E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1383G	16						.						74.0	83.0	80.0					16																	31926953		2197	4300	6497	31834454	SO:0001819	synonymous_variant	10308	exon4			X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.1383A>G	16.37:g.31926953A>G		Somatic		Capture	SOLID	Phase_I	31834454	NM_003414	A0JNZ9|Q8NE41|Q9NRJ0	Silent	SNP	ENST00000300870.10	37	CCDS32440.1																																																																																				ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432446.2	NM_003414	
ARL2BP	23568	hgsc.bcm.edu	37	16	57284355	57284355	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:57284355T>G	ENST00000219204.3	+	5	596	c.326T>G	c.(325-327)tTc>tGc	p.F109C	RP11-407G23.4_ENST00000562409.1_RNA|ARL2BP_ENST00000562023.1_Missense_Mutation_p.F69C|RP11-407G23.3_ENST00000564376.1_RNA	NM_012106.3	NP_036238.1	Q9Y2Y0	AR2BP_HUMAN	ADP-ribosylation factor-like 2 binding protein	109					maintenance of protein location in nucleus (GO:0051457)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of catalytic activity (GO:0050790)|regulation of RNA biosynthetic process (GO:2001141)|signal transduction (GO:0007165)	centrosome (GO:0005813)|cilium (GO:0005929)|midbody (GO:0030496)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	small GTPase regulator activity (GO:0005083)|transcription coactivator activity (GO:0003713)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|urinary_tract(1)	12						GGTGACATATTCGACATGCTG	0.408																																					p.F109C												.	.	0			c.T326G	16						.						134.0	109.0	118.0					16																	57284355		2198	4300	6498	55841856	SO:0001583	missense	23568	exon5			AF126062	CCDS10776.1	16q13	2014-01-30			ENSG00000102931	ENSG00000102931			17146	protein-coding gene	gene with protein product	"""binder of Arl2"""	615407	"""retinitis pigmentosa 66 (autosomal recessive)"""	RP66		10488091, 18981177, 23849777	Standard	NM_012106		Approved	BART1, BART	uc002elf.1	Q9Y2Y0	OTTHUMG00000133459	ENST00000219204.3:c.326T>G	16.37:g.57284355T>G	ENSP00000219204:p.Phe109Cys	Somatic		Capture	SOLID	Phase_I	55841856	NM_012106	B3KQJ5|Q504R0	Missense_Mutation	SNP	ENST00000219204.3	37	CCDS10776.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.557929	0.86231	.	.	ENSG00000102931	ENST00000219204	T	0.51325	0.71	5.55	5.55	0.83447	ADP-ribosylation factor-like 2-binding protein, domain (2);	0.067290	0.64402	U	0.000010	T	0.72740	0.3498	M	0.86953	2.85	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	T	0.78565	-0.2155	10	0.87932	D	0	-8.7704	15.3447	0.74327	0.0:0.0:0.0:1.0	.	77;109	B4DQD8;Q9Y2Y0	.;AR2BP_HUMAN	C	109	ENSP00000219204:F109C	ENSP00000219204:F109C	F	+	2	0	ARL2BP	55841856	1.000000	0.71417	0.986000	0.45419	0.974000	0.67602	7.107000	0.77047	2.114000	0.64651	0.455000	0.32223	TTC		ARL2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257334.2	NM_012106	
DRC7	84229	hgsc.bcm.edu	37	16	57734074	57734074	+	Silent	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:57734074C>A	ENST00000360716.3	+	5	617	c.396C>A	c.(394-396)acC>acA	p.T132T	RP11-405F3.4_ENST00000563062.1_RNA|CCDC135_ENST00000394337.4_Silent_p.T132T|CCDC135_ENST00000336825.8_Silent_p.T132T			Q8IY82	CC135_HUMAN		132					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						TGAGCACAACCCTCCGGCCCA	0.572																																					p.T132T												.	.	0			c.C396A	16						.						169.0	160.0	163.0					16																	57734074		2198	4300	6498	56291575	SO:0001819	synonymous_variant	84229	exon4																														ENST00000360716.3:c.396C>A	16.37:g.57734074C>A		Somatic		Capture	SOLID	Phase_I	56291575	NM_032269	A8K943|Q8NAA0|Q9H080	Silent	SNP	ENST00000360716.3	37	CCDS10787.1																																																																																				CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2		
CSNK2A2	1459	hgsc.bcm.edu	37	16	58202559	58202559	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:58202559C>A	ENST00000262506.3	-	6	651	c.468G>T	c.(466-468)agG>agT	p.R156S	CSNK2A2_ENST00000566813.1_5'UTR	NM_001896.2	NP_001887.1	P19784	CSK22_HUMAN	casein kinase 2, alpha prime polypeptide	156	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)	1						GTTTCACATCCCTGTGCATGA	0.453																																					p.R156S	Melanoma(54;119 1219 18349 35700 39738)											.	.	0			c.G468T	16						.						198.0	177.0	184.0					16																	58202559		2198	4300	6498	56760060	SO:0001583	missense	1459	exon6			M55268	CCDS10794.1	16q21	2013-01-17			ENSG00000070770	ENSG00000070770			2459	protein-coding gene	gene with protein product		115442				2174700, 1766873	Standard	NM_001896		Approved	CSNK2A1	uc002enc.3	P19784	OTTHUMG00000133488	ENST00000262506.3:c.468G>T	16.37:g.58202559C>A	ENSP00000262506:p.Arg156Ser	Somatic		Capture	SOLID	Phase_I	56760060	NM_001896		Missense_Mutation	SNP	ENST00000262506.3	37	CCDS10794.1	.	.	.	.	.	.	.	.	.	.	C	18.94	3.730421	0.69074	.	.	ENSG00000070770	ENST00000262506	T	0.15372	2.43	5.67	2.48	0.30137	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.51856	0.1699	H	0.97390	3.995	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.55761	-0.8090	10	0.87932	D	0	-5.5904	7.6614	0.28404	0.0:0.5107:0.0:0.4893	.	156	P19784	CSK22_HUMAN	S	156	ENSP00000262506:R156S	ENSP00000262506:R156S	R	-	3	2	CSNK2A2	56760060	0.979000	0.34478	1.000000	0.80357	0.998000	0.95712	0.126000	0.15769	0.261000	0.21753	0.555000	0.69702	AGG		CSNK2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257386.2	NM_001896	
CIRH1A	84916	hgsc.bcm.edu	37	16	69199407	69199407	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:69199407T>G	ENST00000314423.7	+	15	1988	c.1811T>G	c.(1810-1812)tTc>tGc	p.F604C	CIRH1A_ENST00000352319.4_Missense_Mutation_p.F489C|CIRH1A_ENST00000563094.1_Missense_Mutation_p.F604C			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	604					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		GCCTACATGTTCTGCATCATT	0.423																																					p.F604C	Melanoma(69;1156 1278 4951 8715 52012)											.	.	0			c.T1811G	16						.						175.0	133.0	147.0					16																	69199407		2198	4300	6498	67756908	SO:0001583	missense	84916	exon15			AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.1811T>G	16.37:g.69199407T>G	ENSP00000327179:p.Phe604Cys	Somatic		Capture	SOLID	Phase_I	67756908	NM_032830	Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Missense_Mutation	SNP	ENST00000314423.7	37	CCDS10872.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.441203	0.83993	.	.	ENSG00000141076	ENST00000314423;ENST00000352319	T;T	0.40476	1.57;1.03	6.17	6.17	0.99709	.	0.140435	0.64402	D	0.000003	T	0.62122	0.2402	M	0.65975	2.015	0.58432	D	0.999992	D;D	0.89917	0.999;1.0	P;D	0.68943	0.862;0.961	T	0.60742	-0.7203	10	0.41790	T	0.15	.	15.8048	0.78491	0.0:0.0:0.0:1.0	.	604;604	Q969X6;Q969X6-3	CIR1A_HUMAN;.	C	604;489	ENSP00000327179:F604C;ENSP00000339164:F489C	ENSP00000327179:F604C	F	+	2	0	CIRH1A	67756908	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.925000	0.75829	2.371000	0.80710	0.533000	0.62120	TTC		CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268950.2	NM_032830	
NFAT5	10725	hgsc.bcm.edu	37	16	69726308	69726308	+	Silent	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:69726308C>T	ENST00000354436.2	+	12	2844	c.2526C>T	c.(2524-2526)agC>agT	p.S842S	NFAT5_ENST00000566899.1_Silent_p.S766S|NFAT5_ENST00000349945.1_Silent_p.S766S|NFAT5_ENST00000567239.1_Silent_p.S859S|NFAT5_ENST00000432919.1_Silent_p.S860S|NFAT5_ENST00000393742.2_Silent_p.S766S	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	842					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S766S(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						GTGGTGTAAGCCCTGGAATGT	0.403																																					p.S766S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2298T	16						.						120.0	119.0	119.0					16																	69726308		2198	4300	6498	68283809	SO:0001819	synonymous_variant	10725	exon14			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2526C>T	16.37:g.69726308C>T		Somatic		Capture	SOLID	Phase_I	68283809	NM_138714	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Silent	SNP	ENST00000354436.2	37	CCDS10881.1																																																																																				NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714	
SF3B3	23450	hgsc.bcm.edu	37	16	70582282	70582282	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:70582282A>G	ENST00000302516.5	+	11	1550	c.1339A>G	c.(1339-1341)Atg>Gtg	p.M447V		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	447					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				GGTGTCAGAAATGGCTGTTTC	0.468																																					p.M447V												.	.	0			c.A1339G	16						.						161.0	132.0	142.0					16																	70582282		2198	4300	6498	69139783	SO:0001583	missense	23450	exon11			AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.1339A>G	16.37:g.70582282A>G	ENSP00000305790:p.Met447Val	Somatic		Capture	SOLID	Phase_I	69139783	NM_012426	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	37	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	A	15.13	2.741986	0.49151	.	.	ENSG00000189091	ENST00000302516	T	0.39787	1.06	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.44477	0.1295	M	0.62723	1.935	0.80722	D	1	B	0.17465	0.022	B	0.25140	0.058	T	0.29212	-1.0019	10	0.28530	T	0.3	.	16.1839	0.81934	1.0:0.0:0.0:0.0	.	447	Q15393	SF3B3_HUMAN	V	447	ENSP00000305790:M447V	ENSP00000305790:M447V	M	+	1	0	SF3B3	69139783	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.317000	0.96327	2.222000	0.72286	0.533000	0.62120	ATG		SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
ZFHX3	463	hgsc.bcm.edu	37	16	72991480	72991480	+	Silent	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:72991480T>C	ENST00000268489.5	-	2	3237	c.2565A>G	c.(2563-2565)tcA>tcG	p.S855S	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	855					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CCTCGGCGGGTGAGGGCAGGC	0.562																																					p.S855S												.	.	0			c.A2565G	16						.						104.0	98.0	100.0					16																	72991480		2198	4300	6498	71548981	SO:0001819	synonymous_variant	463	exon2			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2565A>G	16.37:g.72991480T>C		Somatic		Capture	SOLID	Phase_I	71548981	NM_006885	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1																																																																																				ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
CFDP1	10428	hgsc.bcm.edu	37	16	75327851	75327851	+	Nonstop_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:75327851C>A	ENST00000283882.3	-	7	1031	c.899G>T	c.(898-900)tGa>tTa	p.*300L		NM_006324.2	NP_006315.1	Q9UEE9	CFDP1_HUMAN	craniofacial development protein 1	0					cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|negative regulation of fibroblast apoptotic process (GO:2000270)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)					endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5						CCCGTAACATCAAGGTTTCAT	0.423																																					p.X300L												.	.	0			c.G899T	16						.						140.0	113.0	122.0					16																	75327851		2198	4300	6498	73885352	SO:0001578	stop_lost	10428	exon7			AB009285	CCDS10916.1	16q22.2-q22.3	2011-08-12			ENSG00000153774	ENSG00000153774			1873	protein-coding gene	gene with protein product	"""Bucentaur"", ""centromere protein 29"""	608108				9602175, 9006920, 11992732	Standard	NM_006324		Approved	BCNT, p97, CP27, SWC5, Yeti, CENP-29	uc002fdy.3	Q9UEE9	OTTHUMG00000137615	ENST00000283882.3:c.899G>T	16.37:g.75327851C>A		Somatic		Capture	SOLID	Phase_I	73885352	NM_006324	O00393|O00404|Q9UEF0|Q9UEF1|Q9UEF8	Missense_Mutation	SNP	ENST00000283882.3	37	CCDS10916.1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.844520	0.71488	.	.	ENSG00000153774	ENST00000283882	.	.	.	5.86	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0622	0.53568	0.0:0.9203:0.0:0.0797	.	.	.	.	L	300	.	.	X	-	2	2	CFDP1	73885352	1.000000	0.71417	0.993000	0.49108	0.927000	0.56198	3.264000	0.51553	1.492000	0.48499	0.563000	0.77884	TGA		CFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269031.2	NM_006324	
WFDC1	58189	hgsc.bcm.edu	37	16	84353114	84353114	+	Missense_Mutation	SNP	C	C	A	rs200449936		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr16:84353114C>A	ENST00000219454.5	+	4	825	c.499C>A	c.(499-501)Cca>Aca	p.P167T	WFDC1_ENST00000568638.1_Missense_Mutation_p.P167T	NM_001282466.1|NM_001282467.1	NP_001269395.1|NP_001269396.1	Q9HC57	WFDC1_HUMAN	WAP four-disulfide core domain 1	167					negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|response to drug (GO:0042493)|response to estradiol (GO:0032355)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P167T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)	9						CATCCTGAGCCCAGGTGACGT	0.672																																					p.P167T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C499A	16						.	C	THR/PRO	0,4400		0,0,2200	83.0	65.0	71.0		499	4.4	1.0	16		71	1,8599	1.2+/-3.3	0,1,4299	yes	missense	WFDC1	NM_021197.2	38	0,1,6499	AA,AC,CC		0.0116,0.0,0.0077	possibly-damaging	167/221	84353114	1,12999	2200	4300	6500	82910615	SO:0001583	missense	58189	exon4			AF302109	CCDS10946.1	16q24.1	2013-01-21			ENSG00000103175	ENSG00000103175		"""WAP four-disulfide core domain containing"""	15466	protein-coding gene	gene with protein product		605322				10967136	Standard	NM_021197		Approved	PS20	uc002fhw.3	Q9HC57	OTTHUMG00000137641	ENST00000219454.5:c.499C>A	16.37:g.84353114C>A	ENSP00000219454:p.Pro167Thr	Somatic		Capture	SOLID	Phase_I	82910615	NM_021197	D3DUL7|Q8NC27|Q9HAU1	Missense_Mutation	SNP	ENST00000219454.5	37	CCDS10946.1	.	.	.	.	.	.	.	.	.	.	C	19.54	3.846927	0.71603	0.0	1.16E-4	ENSG00000103175	ENST00000219454	T	0.34072	1.38	4.43	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.45915	0.1366	L	0.32530	0.975	0.80722	D	1	D	0.69078	0.997	P	0.61397	0.888	T	0.44267	-0.9339	10	0.52906	T	0.07	-9.0541	15.7941	0.78394	0.0:1.0:0.0:0.0	.	167	Q9HC57	WFDC1_HUMAN	T	167	ENSP00000219454:P167T	ENSP00000219454:P167T	P	+	1	0	WFDC1	82910615	1.000000	0.71417	0.964000	0.40570	0.767000	0.43475	4.010000	0.57117	2.295000	0.77249	0.555000	0.69702	CCA		WFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269083.2		
CABYR	26256	hgsc.bcm.edu	37	18	21735818	21735818	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr18:21735818A>C	ENST00000399496.3	+	4	518	c.353A>C	c.(352-354)aAa>aCa	p.K118T	CABYR_ENST00000327201.6_Missense_Mutation_p.K20T|CABYR_ENST00000415309.2_Missense_Mutation_p.K118T|CABYR_ENST00000399481.2_Missense_Mutation_p.K20T|CABYR_ENST00000399499.1_Missense_Mutation_p.K118T|CABYR_ENST00000581397.1_Missense_Mutation_p.K118T	NM_012189.2|NM_153769.1	NP_036321.2|NP_722453.1	O75952	CABYR_HUMAN	calcium binding tyrosine-(Y)-phosphorylation regulated	118					epithelial cilium movement (GO:0003351)|sperm capacitation (GO:0048240)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|protein heterodimerization activity (GO:0046982)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)	11	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)					TATAGTGACAAAACCACCCAG	0.448																																					p.K118T												.	.	0			c.A353C	18						.						135.0	111.0	119.0					18																	21735818		2203	4300	6503	19989816	SO:0001583	missense	26256	exon4			AF088868	CCDS11881.1, CCDS11882.1, CCDS11883.1, CCDS42420.1, CCDS45840.1	18q11.2	2009-08-06	2007-11-22		ENSG00000154040	ENSG00000154040			15569	protein-coding gene	gene with protein product	"""fibrousheathin 2"", ""cancer/testis antigen 88"""	612135				11820818, 17317841, 16139264	Standard	NM_012189		Approved	FSP-2, CBP86, CT88	uc002kux.3	O75952	OTTHUMG00000037365	ENST00000399496.3:c.353A>C	18.37:g.21735818A>C	ENSP00000382419:p.Lys118Thr	Somatic		Capture	SOLID	Phase_I	19989816	NM_138644	B2R857|Q8WXW5|Q9HAY3|Q9HAY4|Q9HAY5|Q9HCY9	Missense_Mutation	SNP	ENST00000399496.3	37	CCDS42420.1	.	.	.	.	.	.	.	.	.	.	A	14.96	2.690614	0.48097	.	.	ENSG00000154040	ENST00000399496;ENST00000415309;ENST00000399481;ENST00000327201;ENST00000399499	T;T;T;T	0.58060	0.36;0.93;1.16;0.36	5.95	5.95	0.96441	.	0.106560	0.40640	N	0.001051	T	0.68044	0.2958	L	0.54323	1.7	0.38474	D	0.947549	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.997;0.997	T	0.72988	-0.4124	10	0.87932	D	0	-21.3866	13.9324	0.64003	1.0:0.0:0.0:0.0	.	100;118;118;118	O75952-2;O75952-4;O75952-3;O75952	.;.;.;CABYR_HUMAN	T	118;118;20;20;118	ENSP00000382419:K118T;ENSP00000399973:K118T;ENSP00000382404:K20T;ENSP00000382421:K118T	ENSP00000317095:K20T	K	+	2	0	CABYR	19989816	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	5.335000	0.65929	2.276000	0.75962	0.460000	0.39030	AAA		CABYR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090926.2	NM_153770	
FHOD3	80206	hgsc.bcm.edu	37	18	34238107	34238107	+	Silent	SNP	C	C	A	rs146339788	byFrequency	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr18:34238107C>A	ENST00000359247.4	+	11	1266	c.1266C>A	c.(1264-1266)acC>acA	p.T422T	FHOD3_ENST00000257209.4_Silent_p.T422T|FHOD3_ENST00000445677.1_Intron|FHOD3_ENST00000590592.1_Silent_p.T597T|FHOD3_ENST00000591635.1_Intron	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	422					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				TGCCCACCACCCCCACATCAT	0.507																																					p.T422T												.	.	0			c.C1266A	18						.						131.0	112.0	118.0					18																	34238107		2203	4300	6503	32492105	SO:0001819	synonymous_variant	80206	exon11			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1266C>A	18.37:g.34238107C>A		Somatic		Capture	SOLID	Phase_I	32492105	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Silent	SNP	ENST00000359247.4	37																																																																																					FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
ME2	4200	hgsc.bcm.edu	37	18	48439180	48439180	+	Silent	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr18:48439180C>T	ENST00000321341.5	+	4	524	c.252C>T	c.(250-252)taC>taT	p.Y84Y	ME2_ENST00000382927.3_Silent_p.Y84Y	NM_002396.4	NP_002387.1	P23368	MAOM_HUMAN	malic enzyme 2, NAD(+)-dependent, mitochondrial	84					malate metabolic process (GO:0006108)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)	p.Y84Y(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(3)	23		Colorectal(6;0.0273)|all_epithelial(6;0.118)		Colorectal(21;0.0313)|READ - Rectum adenocarcinoma(32;0.105)|STAD - Stomach adenocarcinoma(97;0.184)		GATATATCTACATAATGGGAA	0.313																																					p.Y84Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C252T	18						.						85.0	90.0	88.0					18																	48439180		2203	4300	6503	46693178	SO:0001819	synonymous_variant	4200	exon4			M55905	CCDS11948.1, CCDS54187.1	18q21	2012-10-02			ENSG00000082212	ENSG00000082212	1.1.1.40		6984	protein-coding gene	gene with protein product		154270				1993674	Standard	NM_002396		Approved		uc002ley.3	P23368	OTTHUMG00000132694	ENST00000321341.5:c.252C>T	18.37:g.48439180C>T		Somatic		Capture	SOLID	Phase_I	46693178	NM_001168335	B2R8J2|Q9BWL6|Q9BYG1|Q9H4B2	Silent	SNP	ENST00000321341.5	37	CCDS11948.1																																																																																				ME2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255991.1	NM_002396	
LAMA1	284217	hgsc.bcm.edu	37	18	6980591	6980591	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr18:6980591A>C	ENST00000389658.3	-	42	6029	c.5936T>G	c.(5935-5937)tTt>tGt	p.F1979C		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1979	Domain II and I.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ATTCTCTTGAAATCTGTTTGT	0.348																																					p.F1979C												.	.	0			c.T5936G	18						.						187.0	166.0	173.0					18																	6980591		2202	4300	6502	6970591	SO:0001583	missense	284217	exon42			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.5936T>G	18.37:g.6980591A>C	ENSP00000374309:p.Phe1979Cys	Somatic		Capture	SOLID	Phase_I	6970591	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	A	16.95	3.263431	0.59431	.	.	ENSG00000101680	ENST00000389658	T	0.17528	2.27	5.15	5.15	0.70609	.	0.232865	0.34906	N	0.003598	T	0.24736	0.0600	L	0.50333	1.59	0.41115	D	0.985774	D	0.62365	0.991	P	0.50231	0.635	T	0.01309	-1.1389	10	0.38643	T	0.18	.	13.8667	0.63592	1.0:0.0:0.0:0.0	.	1979	P25391	LAMA1_HUMAN	C	1979	ENSP00000374309:F1979C	ENSP00000374309:F1979C	F	-	2	0	LAMA1	6970591	0.996000	0.38824	0.997000	0.53966	0.798000	0.45092	3.091000	0.50199	2.064000	0.61679	0.533000	0.62120	TTT		LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
DCC	1630	hgsc.bcm.edu	37	18	50731726	50731726	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr18:50731726A>C	ENST00000442544.2	+	10	2330	c.1714A>C	c.(1714-1716)Aaa>Caa	p.K572Q	DCC_ENST00000412726.1_Missense_Mutation_p.K420Q|DCC_ENST00000581580.1_Missense_Mutation_p.K227Q	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	572	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GTCCACAGGAAAAGAACAGGT	0.483																																					p.K572Q												.	.	0			c.A1714C	18						.						169.0	149.0	156.0					18																	50731726		2203	4300	6503	48985724	SO:0001583	missense	1630	exon10			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1714A>C	18.37:g.50731726A>C	ENSP00000389140:p.Lys572Gln	Somatic		Capture	SOLID	Phase_I	48985724	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	A	12.76	2.035598	0.35893	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.56941	0.43;0.43	5.88	5.88	0.94601	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.39118	0.1066	N	0.12502	0.225	0.40438	D	0.980015	B;B;B	0.22080	0.004;0.064;0.032	B;B;B	0.29942	0.014;0.109;0.052	T	0.28996	-1.0026	10	0.32370	T	0.25	.	15.2705	0.73696	1.0:0.0:0.0:0.0	.	420;420;572	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	Q	572;505;420	ENSP00000389140:K572Q;ENSP00000397322:K420Q	ENSP00000304146:K505Q	K	+	1	0	DCC	48985724	1.000000	0.71417	0.977000	0.42913	0.660000	0.38997	7.701000	0.84566	2.242000	0.73789	0.533000	0.62120	AAA		DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
FANCD2OS	115795	hgsc.bcm.edu	37	3	10146320	10146320	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:10146320C>G	ENST00000450660.2	-	2	355	c.139G>C	c.(139-141)Gaa>Caa	p.E47Q	FANCD2OS_ENST00000524279.1_Missense_Mutation_p.E47Q	NM_001164839.1	NP_001158311.1	Q96PS1	FACOS_HUMAN	FANCD2 opposite strand	47																	AGCTGCACTTCAAGGTCGGAC	0.557																																					p.E47Q												.	.	0			c.G139C	3						.						171.0	170.0	171.0					3																	10146320		2203	4300	6503	10121320	SO:0001583	missense	115795	exon2			AF230334	CCDS2596.1	3p25.3	2012-11-12	2012-11-12	2012-11-12	ENSG00000163705	ENSG00000163705			28623	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 24"""	C3orf24		12477932	Standard	NM_001164839		Approved	MGC40179	uc003buz.3	Q96PS1	OTTHUMG00000128669	ENST00000450660.2:c.139G>C	3.37:g.10146320C>G	ENSP00000429608:p.Glu47Gln	Somatic		Capture	SOLID	Phase_I	10121320	NM_001164839		Missense_Mutation	SNP	ENST00000450660.2	37	CCDS2596.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.345153	0.61073	.	.	ENSG00000163705	ENST00000524279;ENST00000453223;ENST00000450660	.	.	.	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000002	T	0.64757	0.2627	L	0.27053	0.805	0.40555	D	0.981157	D	0.60575	0.988	D	0.65140	0.932	T	0.68895	-0.5288	9	0.87932	D	0	.	17.2209	0.86957	0.0:1.0:0.0:0.0	.	47	Q96PS1	CC024_HUMAN	Q	47;45;47	.	ENSP00000429608:E47Q	E	-	1	0	C3orf24	10121320	1.000000	0.71417	1.000000	0.80357	0.443000	0.32047	4.534000	0.60622	2.673000	0.90976	0.558000	0.71614	GAA		FANCD2OS-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339891.2	NM_173472	
KALRN	8997	hgsc.bcm.edu	37	3	124413227	124413227	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:124413227G>T	ENST00000291478.5	+	20	2526	c.2363G>T	c.(2362-2364)gGg>gTg	p.G788V	KALRN_ENST00000360013.3_Missense_Mutation_p.G2485V|KALRN_ENST00000428018.2_Missense_Mutation_p.G756V|AC080008.1_ENST00000584173.1_RNA	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2484					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TGCTTGCTTGGGGACACAGTG	0.473																																					p.G2485V												.	.	0			c.G7454T	3						.						163.0	147.0	152.0					3																	124413227		2203	4300	6503	125895917	SO:0001583	missense	8997	exon53			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.2363G>T	3.37:g.124413227G>T	ENSP00000291478:p.Gly788Val	Somatic		Capture	SOLID	Phase_I	125895917	NM_001024660	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000291478.5	37	CCDS3028.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.3|23.3	4.404346|4.404346	0.83230|0.83230	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000360013;ENST00000291478;ENST00000428018|ENST00000354186	T;T;T|D	0.81415|0.81499	-1.49;-1.49;-1.49|-1.5	6.07|6.07	5.2|5.2	0.72013|0.72013	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.063413|0.063413	0.64402|0.64402	D|D	0.000006|0.000006	D|D	0.92417|0.92417	0.7593|0.7593	H|H	0.96208|0.96208	3.785|3.785	0.80722|0.80722	D|D	1|1	D;D|.	0.63046|.	0.992;0.984|.	D;P|.	0.67548|.	0.952;0.825|.	D|D	0.94367|0.94367	0.7592|0.7592	10|8	0.87932|0.87932	D|D	0|0	.|.	13.5808|13.5808	0.61901|0.61901	0.0715:0.0:0.9285:0.0|0.0715:0.0:0.9285:0.0	.|.	788;2484|.	C9JQ37;O60229|.	.;KALRN_HUMAN|.	V|W	2485;788;756|2454	ENSP00000353109:G2485V;ENSP00000291478:G788V;ENSP00000402419:G756V|ENSP00000346122:G2454W	ENSP00000291478:G788V|ENSP00000346122:G2454W	G|G	+|+	2|1	0|0	KALRN|KALRN	125895917|125895917	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	9.113000|9.113000	0.94321|0.94321	1.567000|1.567000	0.49668|0.49668	0.655000|0.655000	0.94253|0.94253	GGG|GGG		KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5	NM_003947	
ITGB5	3693	hgsc.bcm.edu	37	3	124487873	124487873	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:124487873C>A	ENST00000296181.4	-	12	2300	c.2004G>T	c.(2002-2004)tgG>tgT	p.W668C	ITGB5_ENST00000461306.1_5'UTR	NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	668					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)	p.W668C(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		TGGTGTCCACCCATGTGATCA	0.567																																					p.W668C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2004T	3						.						139.0	119.0	126.0					3																	124487873		2203	4300	6503	125970563	SO:0001583	missense	3693	exon12			J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.2004G>T	3.37:g.124487873C>A	ENSP00000296181:p.Trp668Cys	Somatic		Capture	SOLID	Phase_I	125970563	NM_002213	B0LPF8|B2RD70	Missense_Mutation	SNP	ENST00000296181.4	37	CCDS3030.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.52|13.52	2.262138|2.262138	0.39995|0.39995	.|.	.|.	ENSG00000082781|ENSG00000082781	ENST00000481591|ENST00000296181	.|D	.|0.92495	.|-3.05	5.29|5.29	4.41|4.41	0.53225|0.53225	.|Integrin beta subunit, tail (2);	.|1.088580	.|0.06808	.|N	.|0.789936	D|D	0.88104|0.88104	0.6347|0.6347	N|N	0.08118|0.08118	0|0	0.50313|0.50313	D|D	0.999861|0.999861	.|P	.|0.45240	.|0.854	.|P	.|0.53035	.|0.716	T|T	0.80747|0.80747	-0.1244|-0.1244	5|10	.|0.48119	.|T	.|0.1	.|.	4.5313|4.5313	0.12006|0.12006	0.1485:0.4863:0.2868:0.0784|0.1485:0.4863:0.2868:0.0784	.|.	.|668	.|P18084	.|ITB5_HUMAN	V|C	358|668	.|ENSP00000296181:W668C	.|ENSP00000296181:W668C	G|W	-|-	2|3	0|0	ITGB5|ITGB5	125970563|125970563	0.445000|0.445000	0.25657|0.25657	0.897000|0.897000	0.35233|0.35233	0.984000|0.984000	0.73092|0.73092	0.022000|0.022000	0.13511|0.13511	1.442000|1.442000	0.47568|0.47568	0.655000|0.655000	0.94253|0.94253	GGG|TGG		ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	
ITGB5	3693	hgsc.bcm.edu	37	3	124515349	124515349	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:124515349C>G	ENST00000296181.4	-	10	1875	c.1579G>C	c.(1579-1581)Gac>Cac	p.D527H		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	527	Cysteine-rich tandem repeats.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)	p.D527H(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		CAGCTGCAGTCCCCACGCCCG	0.617																																					p.D527H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1579C	3						.						84.0	75.0	78.0					3																	124515349		2203	4300	6503	125998039	SO:0001583	missense	3693	exon10			J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.1579G>C	3.37:g.124515349C>G	ENSP00000296181:p.Asp527His	Somatic		Capture	SOLID	Phase_I	125998039	NM_002213	B0LPF8|B2RD70	Missense_Mutation	SNP	ENST00000296181.4	37	CCDS3030.1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.678375	0.68042	.	.	ENSG00000082781	ENST00000296181	D	0.92911	-3.13	5.26	3.45	0.39498	.	0.351640	0.31897	N	0.006894	D	0.88596	0.6479	L	0.37697	1.125	0.27967	N	0.936568	B	0.29301	0.241	B	0.31390	0.129	T	0.82510	-0.0421	10	0.87932	D	0	.	15.626	0.76859	0.0:0.728:0.272:0.0	.	527	P18084	ITB5_HUMAN	H	527	ENSP00000296181:D527H	ENSP00000296181:D527H	D	-	1	0	ITGB5	125998039	0.994000	0.37717	0.821000	0.32701	0.851000	0.48451	3.190000	0.50973	0.765000	0.33221	0.563000	0.77884	GAC		ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	
XRN1	54464	hgsc.bcm.edu	37	3	142075777	142075777	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:142075777G>A	ENST00000264951.4	-	31	3766	c.3649C>T	c.(3649-3651)Caa>Taa	p.Q1217*	XRN1_ENST00000392981.2_Nonsense_Mutation_p.Q1217*	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1217					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.Q1217*(1)		NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						AAAAGTGATTGAGGGGAATGG	0.418																																					p.Q1217X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3649T	3						.						135.0	135.0	135.0					3																	142075777		2203	4300	6503	143558467	SO:0001587	stop_gained	54464	exon31			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.3649C>T	3.37:g.142075777G>A	ENSP00000264951:p.Gln1217*	Somatic		Capture	SOLID	Phase_I	143558467	NM_019001	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Nonsense_Mutation	SNP	ENST00000264951.4	37	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	G	37	6.053328	0.97241	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	.	.	.	5.32	5.32	0.75619	.	0.128960	0.52532	D	0.000063	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-10.6416	19.003	0.92841	0.0:0.0:1.0:0.0	.	.	.	.	X	1217	.	ENSP00000264951:Q1217X	Q	-	1	0	XRN1	143558467	1.000000	0.71417	0.992000	0.48379	0.830000	0.47004	6.319000	0.72871	2.494000	0.84150	0.462000	0.41574	CAA		XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
HLTF	6596	hgsc.bcm.edu	37	3	148759319	148759319	+	Silent	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:148759319T>C	ENST00000310053.5	-	20	2527	c.2334A>G	c.(2332-2334)gtA>gtG	p.V778V	HLTF_ENST00000392912.2_Silent_p.V778V|HLTF_ENST00000494055.1_Silent_p.V778V|HLTF_ENST00000465259.1_Silent_p.V777V	NM_003071.3|NM_139048.2	NP_003062.2|NP_620636.1	Q14527	HLTF_HUMAN	helicase-like transcription factor	778					chromatin modification (GO:0016568)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GTTTACAAAATACATGTGCAC	0.378																																					p.V778V												.	.	0			c.A2334G	3						.						127.0	122.0	124.0					3																	148759319		2203	4300	6503	150242009	SO:0001819	synonymous_variant	6596	exon20			L34673	CCDS33875.1	3q25.1-q26.1	2006-11-09	2006-11-09	2006-11-09	ENSG00000071794	ENSG00000071794		"""RING-type (C3HC4) zinc fingers"""	11099	protein-coding gene	gene with protein product		603257	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3"""	SNF2L3, SMARCA3		7558014	Standard	NM_139048		Approved	HIP116A, HLTF1, RNF80	uc003ewr.1	Q14527	OTTHUMG00000159534	ENST00000310053.5:c.2334A>G	3.37:g.148759319T>C		Somatic		Capture	SOLID	Phase_I	150242009	NM_139048	D3DNH3|Q14536|Q16051|Q7KYJ6|Q86YA5|Q92652|Q96KM9	Silent	SNP	ENST00000310053.5	37	CCDS33875.1																																																																																				HLTF-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356064.1		
P2RY12	64805	hgsc.bcm.edu	37	3	151055672	151055672	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:151055672G>A	ENST00000302632.3	-	3	1261	c.962C>T	c.(961-963)tCt>tTt	p.S321F	MED12L_ENST00000474524.1_Intron|MED12L_ENST00000491549.1_Intron|MED12L_ENST00000273432.4_Intron	NM_022788.4|NM_176876.2	NP_073625.1|NP_795345.1	Q9H244	P2Y12_HUMAN	purinergic receptor P2Y, G-protein coupled, 12	321					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell projection organization (GO:0030030)|G-protein coupled purinergic nucleotide receptor signaling pathway (GO:0035589)|G-protein coupled receptor signaling pathway (GO:0007186)|hemostasis (GO:0007599)|negative regulation of cell differentiation (GO:0045596)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of GTPase activity (GO:0043547)|positive regulation of ion transport (GO:0043270)|potassium ion transmembrane transport (GO:0071805)|protein kinase B signaling (GO:0043491)|regulation of calcium ion transport (GO:0051924)	basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	ADP receptor activity (GO:0001621)|G-protein coupled adenosine receptor activity (GO:0001609)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.S321F(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	17			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		Clopidogrel(DB00758)|Epoprostenol(DB01240)|Prasugrel(DB06209)|Ticagrelor(DB08816)|Ticlopidine(DB00208)|Treprostinil(DB00374)	CTGGGACAGAGATGTTGCAGA	0.383																																					p.S321F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C962T	3						.						128.0	128.0	128.0					3																	151055672		2203	4300	6503	152538362	SO:0001583	missense	64805	exon3			AJ320495	CCDS3159.1	3q24-q25	2014-09-17			ENSG00000169313	ENSG00000169313		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	18124	protein-coding gene	gene with protein product		600515				11502873, 11104774	Standard	NM_022788		Approved	P2Y12, SP1999, HORK3	uc003eyw.1	Q9H244	OTTHUMG00000159863	ENST00000302632.3:c.962C>T	3.37:g.151055672G>A	ENSP00000307259:p.Ser321Phe	Somatic		Capture	SOLID	Phase_I	152538362	NM_022788	D3DNJ5|Q546J7	Missense_Mutation	SNP	ENST00000302632.3	37	CCDS3159.1	.	.	.	.	.	.	.	.	.	.	G	9.621	1.133721	0.21123	.	.	ENSG00000169313	ENST00000302632;ENST00000455408	T	0.26223	1.75	5.32	2.52	0.30459	.	0.793235	0.12092	N	0.500324	T	0.13500	0.0327	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.22277	-1.0221	10	0.59425	D	0.04	-3.245	8.7853	0.34816	0.2531:0.0:0.7469:0.0	.	321	Q9H244	P2Y12_HUMAN	F	321;224	ENSP00000307259:S321F	ENSP00000307259:S321F	S	-	2	0	P2RY12	152538362	0.001000	0.12720	0.001000	0.08648	0.108000	0.19459	0.667000	0.25112	0.727000	0.32360	0.655000	0.94253	TCT		P2RY12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357796.1		
LEKR1	389170	hgsc.bcm.edu	37	3	156763210	156763210	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:156763210C>G	ENST00000470811.1	+	14	2173	c.838C>G	c.(838-840)Cag>Gag	p.Q280E	LEKR1_ENST00000356539.4_Missense_Mutation_p.Q584E			Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1	280								p.Q584E(1)|p.Q280E(1)		breast(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	11			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			AGCCAGAGAACAGCTCCTGGA	0.493																																					p.Q584E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1750G	3						.						91.0	93.0	92.0					3																	156763210		2203	4300	6503	158245904	SO:0001583	missense	389170	exon13			AK131473	CCDS54660.1	3q25.31	2014-02-12	2008-02-21		ENSG00000197980	ENSG00000197980			33765	protein-coding gene	gene with protein product		613536					Standard	NM_001004316		Approved	FLJ16641	uc021xgh.1	Q6ZMV7	OTTHUMG00000160130	ENST00000470811.1:c.838C>G	3.37:g.156763210C>G	ENSP00000418214:p.Gln280Glu	Somatic		Capture	SOLID	Phase_I	158245904	NM_001004316		Missense_Mutation	SNP	ENST00000470811.1	37		.	.	.	.	.	.	.	.	.	.	C	11.88	1.770238	0.31320	.	.	ENSG00000178110	ENST00000470811;ENST00000356539	T;T	0.57107	0.53;0.42	4.96	4.08	0.47627	.	0.000000	0.56097	D	0.000024	T	0.47002	0.1422	L	0.47016	1.485	0.35152	D	0.76986	B	0.12013	0.005	B	0.17433	0.018	T	0.53099	-0.8486	10	0.33141	T	0.24	-10.7397	15.061	0.71955	0.0:0.8571:0.1429:0.0	.	280	Q6ZMV7	LEKR1_HUMAN	E	280;584	ENSP00000418214:Q280E;ENSP00000348936:Q584E	ENSP00000348936:Q584E	Q	+	1	0	LEKR1	158245904	1.000000	0.71417	0.999000	0.59377	0.562000	0.35680	3.186000	0.50942	1.074000	0.40909	-0.150000	0.13652	CAG		LEKR1-010	KNOWN	upstream_ATG|basic	protein_coding	protein_coding	OTTHUMT00000351625.3	NM_001004316	
MECOM	2122	hgsc.bcm.edu	37	3	168807796	168807796	+	Silent	SNP	G	G	T	rs373451242		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:168807796G>T	ENST00000464456.1	-	13	4002	c.2802C>A	c.(2800-2802)tcC>tcA	p.S934S	MECOM_ENST00000433243.2_Silent_p.S944S|MECOM_ENST00000264674.3_Silent_p.S1008S|MECOM_ENST00000468789.1_Silent_p.S943S|MECOM_ENST00000392736.3_Silent_p.S943S|MECOM_ENST00000472280.1_Silent_p.S944S|MECOM_ENST00000460814.1_Silent_p.S934S|MECOM_ENST00000494292.1_Silent_p.S1122S	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						ACCTCACTGGGGATGTCTTGC	0.423																																					p.S1008S												.	.	0			c.C3024A	3						.						177.0	168.0	171.0					3																	168807796		2203	4300	6503	170290490	SO:0001819	synonymous_variant	2122	exon15			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.2802C>A	3.37:g.168807796G>T		Somatic		Capture	SOLID	Phase_I	170290490	NM_001105077	Q13466|Q6FH90	Silent	SNP	ENST00000464456.1	37	CCDS54669.1																																																																																				MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991	
PLD1	5337	hgsc.bcm.edu	37	3	171404483	171404483	+	Missense_Mutation	SNP	G	G	T	rs140003741		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:171404483G>T	ENST00000351298.4	-	16	1985	c.1859C>A	c.(1858-1860)cCt>cAt	p.P620H	PLD1_ENST00000340989.4_Missense_Mutation_p.P620H|PLD1_ENST00000356327.5_Intron|PLD1_ENST00000342215.6_Intron	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	620	Catalytic.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	ACCAGCATGAGGTCTAGTGAG	0.428																																					p.P620H	NSCLC(149;2174 3517 34058)											.	.	0			c.C1859A	3						.						135.0	139.0	138.0					3																	171404483		2203	4300	6503	172887177	SO:0001583	missense	5337	exon16			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.1859C>A	3.37:g.171404483G>T	ENSP00000342793:p.Pro620His	Somatic		Capture	SOLID	Phase_I	172887177	NM_002662		Missense_Mutation	SNP	ENST00000351298.4	37	CCDS3216.1	.	.	.	.	.	.	.	.	.	.	G	9.145	1.014726	0.19355	.	.	ENSG00000075651	ENST00000351298;ENST00000340989	T;T	0.06687	3.41;3.27	5.46	3.6	0.41247	.	0.741562	0.12831	N	0.435591	T	0.06600	0.0169	L	0.29908	0.895	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.31223	-0.9951	10	0.35671	T	0.21	-2.0139	7.0502	0.25069	0.089:0.0:0.7316:0.1795	.	620	Q13393	PLD1_HUMAN	H	620	ENSP00000342793:P620H;ENSP00000340326:P620H	ENSP00000340326:P620H	P	-	2	0	PLD1	172887177	0.294000	0.24380	0.004000	0.12327	0.210000	0.24377	0.925000	0.28791	1.239000	0.43787	0.557000	0.71058	CCT		PLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346730.2	NM_002662	
FNDC3B	64778	hgsc.bcm.edu	37	3	172025214	172025214	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:172025214C>G	ENST00000336824.4	+	10	1222	c.1123C>G	c.(1123-1125)Cac>Gac	p.H375D	FNDC3B_ENST00000416957.1_Missense_Mutation_p.H375D|FNDC3B_ENST00000415807.2_Missense_Mutation_p.H375D	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	375	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)	p.H375D(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		CTTCACCACCCACAGCTGTGC	0.512																																					p.H375D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1123G	3						.						146.0	122.0	130.0					3																	172025214		2203	4300	6503	173507908	SO:0001583	missense	64778	exon10			AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.1123C>G	3.37:g.172025214C>G	ENSP00000338523:p.His375Asp	Somatic		Capture	SOLID	Phase_I	173507908	NM_001135095	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Missense_Mutation	SNP	ENST00000336824.4	37	CCDS3217.1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.508451	0.44660	.	.	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957	T;T;T	0.38560	1.13;1.13;1.13	5.93	5.93	0.95920	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.085474	0.85682	D	0.000000	T	0.37210	0.0995	L	0.41236	1.265	0.80722	D	1	B;B	0.28291	0.206;0.093	B;B	0.28011	0.085;0.07	T	0.14090	-1.0485	10	0.12103	T	0.63	-19.5227	19.949	0.97192	0.0:1.0:0.0:0.0	.	375;375	Q53EP0-2;Q53EP0	.;FND3B_HUMAN	D	375	ENSP00000411242:H375D;ENSP00000338523:H375D;ENSP00000389094:H375D	ENSP00000338523:H375D	H	+	1	0	FNDC3B	173507908	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.206000	0.65192	2.826000	0.97356	0.655000	0.94253	CAC		FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
EIF2B5	8893	hgsc.bcm.edu	37	3	183862711	183862711	+	Missense_Mutation	SNP	G	G	A	rs146951976		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:183862711G>A	ENST00000273783.3	+	16	2268	c.2146G>A	c.(2146-2148)Gag>Aag	p.E716K	EIF2B5_ENST00000444495.1_Intron	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	716	W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)	p.E716K(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			GGCAGAAGAGGAGTCATCTGA	0.552																																					p.E716K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2146A	3						.	G	LYS/GLU	0,4406		0,0,2203	81.0	78.0	79.0		2146	5.9	1.0	3	dbSNP_134	79	1,8599	1.2+/-3.3	0,1,4299	no	missense	EIF2B5	NM_003907.2	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	716/722	183862711	1,13005	2203	4300	6503	185345405	SO:0001583	missense	8893	exon16			U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.2146G>A	3.37:g.183862711G>A	ENSP00000273783:p.Glu716Lys	Somatic		Capture	SOLID	Phase_I	185345405	NM_003907	Q541Z1|Q96D04	Missense_Mutation	SNP	ENST00000273783.3	37	CCDS3252.1	.	.	.	.	.	.	.	.	.	.	g	23.4	4.406927	0.83230	0.0	1.16E-4	ENSG00000145191	ENST00000273783	D	0.90900	-2.75	5.9	5.9	0.94986	eIF4-gamma/eIF5/eIF2-epsilon (3);MIF4-like, type 1/2/3 (1);	0.336404	0.32488	N	0.006025	D	0.96358	0.8812	M	0.91196	3.185	0.80722	D	1	D	0.71674	0.998	D	0.67103	0.949	D	0.95995	0.8989	10	0.52906	T	0.07	.	19.8772	0.96880	0.0:0.0:1.0:0.0	.	716	Q13144	EI2BE_HUMAN	K	716	ENSP00000273783:E716K	ENSP00000273783:E716K	E	+	1	0	EIF2B5	185345405	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.738000	0.91569	2.806000	0.96561	0.655000	0.94253	GAG		EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346168.1		
SENP2	59343	hgsc.bcm.edu	37	3	185347585	185347585	+	Missense_Mutation	SNP	T	T	C	rs200602306		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:185347585T>C	ENST00000296257.5	+	17	1963	c.1723T>C	c.(1723-1725)Ttc>Ctc	p.F575L	SENP2_ENST00000427465.2_Missense_Mutation_p.F399L|SENP2_ENST00000545472.1_Missense_Mutation_p.F565L	NM_021627.2	NP_067640.2	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 2	575					cellular protein metabolic process (GO:0044267)|dorsal/ventral axis specification (GO:0009950)|heart development (GO:0007507)|labyrinthine layer development (GO:0060711)|mRNA transport (GO:0051028)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein binding (GO:0032091)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|protein transport (GO:0015031)|regulation of DNA endoreduplication (GO:0032875)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of Wnt signaling pathway (GO:0030111)|spongiotrophoblast layer development (GO:0060712)|trophoblast giant cell differentiation (GO:0060707)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	SUMO-specific protease activity (GO:0016929)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(3)	12	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			GATGCCTCTCTTCCGGAAGAA	0.468																																					p.F575L												.	.	0			c.T1723C	3						.	T	LEU/PHE	1,4405	2.1+/-5.4	0,1,2202	190.0	169.0	176.0		1723	5.7	1.0	3		176	0,8600		0,0,4300	yes	missense	SENP2	NM_021627.2	22	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	probably-damaging	575/590	185347585	1,13005	2203	4300	6503	186830279	SO:0001583	missense	59343	exon17			AF151697	CCDS33902.1	3q28	2005-08-17	2005-08-17		ENSG00000163904	ENSG00000163904			23116	protein-coding gene	gene with protein product		608261	"""SUMO1/sentrin/SMT3 specific protease 2"""			11896061, 11489887	Standard	XM_005247690		Approved	SMT3IP2, KIAA1331, DKFZp762A2316, AXAM2	uc003fpn.3	Q9HC62	OTTHUMG00000156658	ENST00000296257.5:c.1723T>C	3.37:g.185347585T>C	ENSP00000296257:p.Phe575Leu	Somatic		Capture	SOLID	Phase_I	186830279	NM_021627	B4DQ42|Q8IW97|Q96SR2|Q9P2L5	Missense_Mutation	SNP	ENST00000296257.5	37	CCDS33902.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.390715	0.82902	2.27E-4	0.0	ENSG00000163904	ENST00000545472;ENST00000296257;ENST00000437107;ENST00000427465	T;T;T	0.30448	1.53;1.53;1.53	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.47563	0.1452	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.27872	-1.0061	10	0.25751	T	0.34	-9.5322	14.8806	0.70531	0.0:0.0:0.0:1.0	.	565;575	B4DQ42;Q9HC62	.;SENP2_HUMAN	L	565;575;446;399	ENSP00000439653:F565L;ENSP00000296257:F575L;ENSP00000394562:F399L	ENSP00000296257:F575L	F	+	1	0	SENP2	186830279	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.011000	0.76359	2.150000	0.67090	0.528000	0.53228	TTC		SENP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345159.1	NM_021627	
KCNH8	131096	hgsc.bcm.edu	37	3	19559523	19559523	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:19559523A>G	ENST00000328405.2	+	15	2842	c.2576A>G	c.(2575-2577)aAa>aGa	p.K859R		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	859					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CTCTTCATCAAAGCAGAGGAG	0.408																																					p.K859R	NSCLC(124;1625 1765 8018 24930 42026)											.	.	0			c.A2576G	3						.						114.0	114.0	114.0					3																	19559523		2203	4299	6502	19534527	SO:0001583	missense	131096	exon15			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2576A>G	3.37:g.19559523A>G	ENSP00000328813:p.Lys859Arg	Somatic		Capture	SOLID	Phase_I	19534527	NM_144633	B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	A	17.11	3.306291	0.60305	.	.	ENSG00000183960	ENST00000328405	D	0.98684	-5.07	5.66	5.66	0.87406	.	0.000000	0.33075	U	0.005307	D	0.96956	0.9006	L	0.48642	1.525	0.80722	D	1	B	0.33512	0.415	B	0.35114	0.196	D	0.96586	0.9434	9	.	.	.	.	14.7558	0.69564	1.0:0.0:0.0:0.0	.	859	Q96L42	KCNH8_HUMAN	R	859	ENSP00000328813:K859R	.	K	+	2	0	KCNH8	19534527	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.652000	0.67959	2.277000	0.76020	0.528000	0.53228	AAA		KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
BCL6	604	hgsc.bcm.edu	37	3	187443369	187443369	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:187443369G>T	ENST00000406870.2	-	8	2123	c.1757C>A	c.(1756-1758)cCa>cAa	p.P586Q	BCL6_ENST00000450123.2_Missense_Mutation_p.P530Q|RP11-211G3.3_ENST00000449623.1_Intron|BCL6_ENST00000232014.4_Missense_Mutation_p.P586Q|RP11-211G3.3_ENST00000437407.1_Intron	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	586					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P586Q(1)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		CAGGTTGGCTGGCCGGTTGAA	0.488			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																p.P586Q			Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1757A	3						.						126.0	134.0	132.0					3																	187443369		2203	4300	6503	188926063	SO:0001583	missense	604	exon8				CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.1757C>A	3.37:g.187443369G>T	ENSP00000384371:p.Pro586Gln	Somatic		Capture	SOLID	Phase_I	188926063	NM_001130845	A7E241|B8PSA7|D3DNV5	Missense_Mutation	SNP	ENST00000406870.2	37	CCDS3289.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743376	0.89663	.	.	ENSG00000113916	ENST00000406870;ENST00000232014;ENST00000450123	T;T;T	0.35421	1.31;1.31;2.46	5.7	5.7	0.88788	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.47303	0.1438	N	0.16478	0.41	0.80722	D	1	D;P	0.89917	1.0;0.454	D;B	0.85130	0.997;0.098	T	0.52434	-0.8576	10	0.72032	D	0.01	.	18.8311	0.92139	0.0:0.0:1.0:0.0	.	530;586	B8PSA7;P41182	.;BCL6_HUMAN	Q	586;586;530	ENSP00000384371:P586Q;ENSP00000232014:P586Q;ENSP00000413122:P530Q	ENSP00000232014:P586Q	P	-	2	0	BCL6	188926063	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.062000	0.89475	2.679000	0.91253	0.655000	0.94253	CCA		BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
PLCD1	5333	hgsc.bcm.edu	37	3	38051458	38051458	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:38051458G>C	ENST00000334661.4	-	8	1446	c.1224C>G	c.(1222-1224)atC>atG	p.I408M	PLCD1_ENST00000479619.1_5'Flank|PLCD1_ENST00000463876.1_Missense_Mutation_p.I429M	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	408	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		TGGGGCCCAGGATGGCATGCA	0.662																																					p.I408M												.	.	0			c.C1224G	3						.						46.0	47.0	47.0					3																	38051458		2203	4300	6503	38026462	SO:0001583	missense	5333	exon8				CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.1224C>G	3.37:g.38051458G>C	ENSP00000335600:p.Ile408Met	Somatic		Capture	SOLID	Phase_I	38026462	NM_006225	B3KR14|Q86VN8	Missense_Mutation	SNP	ENST00000334661.4	37	CCDS2671.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002637	0.35320	.	.	ENSG00000187091	ENST00000463876;ENST00000334661	T;T	0.67865	-0.29;-0.29	4.92	1.06	0.20224	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.239232	0.48286	D	0.000197	T	0.82157	0.4976	H	0.95679	3.705	0.48040	D	0.999579	P;P	0.46020	0.58;0.871	P;P	0.58210	0.779;0.835	T	0.81061	-0.1103	10	0.59425	D	0.04	.	8.7008	0.34325	0.3699:0.0:0.6301:0.0	.	408;429	P51178;B3KR14	PLCD1_HUMAN;.	M	429;408	ENSP00000430344:I429M;ENSP00000335600:I408M	ENSP00000335600:I408M	I	-	3	3	PLCD1	38026462	1.000000	0.71417	0.212000	0.23672	0.418000	0.31294	1.942000	0.40243	-0.015000	0.14150	0.505000	0.49811	ATC		PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253359.2		
CCR8	1237	hgsc.bcm.edu	37	3	39374509	39374509	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:39374509A>C	ENST00000326306.4	+	2	825	c.687A>C	c.(685-687)caA>caC	p.Q229H	CCR8_ENST00000545843.1_Missense_Mutation_p.Q146H|CCR8_ENST00000414803.1_3'UTR	NM_005201.3	NP_005192.1	P51685	CCR8_HUMAN	chemokine (C-C motif) receptor 8	229					cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|coreceptor activity (GO:0015026)			NS(3)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0504)|Kidney(284;0.0635)		AGAGGTGTCAAAACCACAACA	0.423																																					p.Q229H												.	.	0			c.A687C	3						.						116.0	101.0	106.0					3																	39374509		2203	4300	6503	39349513	SO:0001583	missense	1237	exon2			D49919	CCDS2684.1	3p22	2012-08-08			ENSG00000179934	ENSG00000179934		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1609	protein-coding gene	gene with protein product		601834		CMKBRL2, CMKBR8		8816377, 8886020	Standard	NM_005201		Approved	CY6, TER1, CKR-L1, GPR-CY6, CDw198	uc010hhr.2	P51685	OTTHUMG00000131290	ENST00000326306.4:c.687A>C	3.37:g.39374509A>C	ENSP00000326432:p.Gln229His	Somatic		Capture	SOLID	Phase_I	39349513	NM_005201	B2RC64|Q3KNQ8|Q3KNR3|Q9BYX5	Missense_Mutation	SNP	ENST00000326306.4	37	CCDS2684.1	.	.	.	.	.	.	.	.	.	.	A	10.65	1.410667	0.25465	.	.	ENSG00000179934	ENST00000326306;ENST00000545843	T;T	0.38240	1.15;1.15	4.76	-7.14	0.01527	GPCR, rhodopsin-like superfamily (1);	0.679688	0.14515	N	0.314816	T	0.18087	0.0434	N	0.17278	0.47	0.09310	N	0.999999	B;B	0.17038	0.02;0.02	B;B	0.24701	0.055;0.055	T	0.16837	-1.0389	10	0.52906	T	0.07	.	8.8314	0.35087	0.3173:0.2068:0.4759:0.0	.	229;146	P51685;Q3KNR3	CCR8_HUMAN;.	H	229;146	ENSP00000326432:Q229H;ENSP00000440474:Q146H	ENSP00000326432:Q229H	Q	+	3	2	CCR8	39349513	0.000000	0.05858	0.619000	0.29118	0.974000	0.67602	-1.414000	0.02471	-1.297000	0.02351	-0.290000	0.09829	CAA		CCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254058.2	NM_005201	
SETD2	29072	hgsc.bcm.edu	37	3	47162587	47162587	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:47162587G>A	ENST00000409792.3	-	3	3581	c.3539C>T	c.(3538-3540)cCt>cTt	p.P1180L		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1180					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GTGACCCAGAGGGTCAGATTT	0.428			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.P1180L			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	.	0			c.C3539T	3						.						116.0	120.0	119.0					3																	47162587		2203	4300	6503	47137591	SO:0001583	missense	29072	exon3			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.3539C>T	3.37:g.47162587G>A	ENSP00000386759:p.Pro1180Leu	Somatic		Capture	SOLID	Phase_I	47137591	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	3.160	-0.172231	0.06421	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	D;T	0.87412	-2.25;1.64	5.55	-6.4	0.01944	.	1.892250	0.02213	N	0.063368	T	0.69620	0.3131	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.57900	-0.7731	10	0.52906	T	0.07	.	1.1874	0.01858	0.3356:0.0896:0.2088:0.366	.	1180;1180	F2Z317;Q9BYW2	.;SETD2_HUMAN	L	1180;1180;1180;1136	ENSP00000386759:P1180L;ENSP00000416401:P1136L	ENSP00000386759:P1180L	P	-	2	0	SETD2	47137591	0.000000	0.05858	0.000000	0.03702	0.283000	0.27025	-0.582000	0.05814	-1.847000	0.01173	-0.825000	0.03093	CCT		SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
POC1A	25886	hgsc.bcm.edu	37	3	52183362	52183362	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:52183362T>A	ENST00000296484.2	-	4	358	c.319A>T	c.(319-321)Agg>Tgg	p.R107W	POC1A_ENST00000394970.2_Missense_Mutation_p.R107W|POC1A_ENST00000474012.1_Missense_Mutation_p.R69W	NM_015426.4	NP_056241.3	Q8NBT0	POC1A_HUMAN	POC1 centriolar protein A	107					cell projection organization (GO:0030030)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)		p.R107W(1)		endometrium(1)|large_intestine(4)|liver(1)|lung(4)|prostate(3)|skin(1)	14						TGGACACTCCTCACTGTGGCT	0.517																																					p.R69W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A205T	3						.						162.0	125.0	138.0					3																	52183362		2203	4300	6503	52158402	SO:0001583	missense	25886	exon4			AL117629	CCDS2846.1, CCDS54591.1, CCDS54592.1	3p21.2	2014-05-02	2013-08-21	2010-03-26	ENSG00000164087	ENSG00000164087		"""WD repeat domain containing"""	24488	protein-coding gene	gene with protein product		614783	"""WD repeat domain 51A"", ""POC1 centriolar protein homolog A (Chlamydomonas)"""	WDR51A		19109428, 22840364	Standard	NM_015426		Approved	DKFZP434C245	uc003dcu.3	Q8NBT0	OTTHUMG00000157817	ENST00000296484.2:c.319A>T	3.37:g.52183362T>A	ENSP00000296484:p.Arg107Trp	Somatic		Capture	SOLID	Phase_I	52158402	NM_001161581	A4FUW4|E9PFC6|Q0VDF8|Q2TAK6|Q96IK6|Q9UFJ8	Missense_Mutation	SNP	ENST00000296484.2	37	CCDS2846.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.851719	0.91355	.	.	ENSG00000164087	ENST00000296484;ENST00000394970;ENST00000474012	T;T;T	0.61859	0.07;0.07;0.07	5.68	5.68	0.88126	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.65709	0.2717	L	0.35854	1.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.66085	-0.6011	10	0.46703	T	0.11	.	11.593	0.50957	0.0:0.0:0.1488:0.8511	.	107;107	Q8NBT0-2;Q8NBT0	.;POC1A_HUMAN	W	107;107;69	ENSP00000296484:R107W;ENSP00000378421:R107W;ENSP00000418968:R69W	ENSP00000296484:R107W	R	-	1	2	POC1A	52158402	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.554000	0.53720	2.172000	0.68678	0.533000	0.62120	AGG		POC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349685.1	NM_015426	
GP5	2814	hgsc.bcm.edu	37	3	194117390	194117390	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr3:194117390A>T	ENST00000401815.1	-	1	1693	c.1622T>A	c.(1621-1623)tTt>tAt	p.F541Y	GP5_ENST00000323007.3_Missense_Mutation_p.F541Y			P40197	GPV_HUMAN	glycoprotein V (platelet)	541					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|negative regulation of platelet activation (GO:0010544)|platelet activation (GO:0030168)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(14)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	35	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		AATCATAGCAAACACGATGAT	0.433																																					p.F541Y												.	.	0			c.T1622A	3						.						120.0	137.0	131.0					3																	194117390		2203	4299	6502	195598679	SO:0001583	missense	2814	exon2			L11238	CCDS3307.1	3q29	2008-02-01			ENSG00000178732	ENSG00000178732		"""CD molecules"""	4443	protein-coding gene	gene with protein product		173511				7690959	Standard	NM_004488		Approved	CD42d	uc003ftv.1	P40197	OTTHUMG00000150345	ENST00000401815.1:c.1622T>A	3.37:g.194117390A>T	ENSP00000383931:p.Phe541Tyr	Somatic		Capture	SOLID	Phase_I	195598679	NM_004488	D1MER9	Missense_Mutation	SNP	ENST00000401815.1	37	CCDS3307.1	.	.	.	.	.	.	.	.	.	.	A	12.81	2.048692	0.36181	.	.	ENSG00000178732	ENST00000401815;ENST00000323007	T;T	0.46063	0.88;0.88	4.3	4.3	0.51218	.	0.347439	0.21151	N	0.079337	T	0.31765	0.0807	L	0.32530	0.975	0.23966	N	0.996328	B	0.09022	0.002	B	0.08055	0.003	T	0.23297	-1.0192	10	0.56958	D	0.05	.	10.3905	0.44166	1.0:0.0:0.0:0.0	.	541	P40197	GPV_HUMAN	Y	541	ENSP00000383931:F541Y;ENSP00000319286:F541Y	ENSP00000319286:F541Y	F	-	2	0	GP5	195598679	0.186000	0.23225	0.989000	0.46669	0.334000	0.28698	0.822000	0.27352	1.880000	0.54463	0.443000	0.29094	TTT		GP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317710.1	NM_004488	
CHPT1	56994	hgsc.bcm.edu	37	12	102091873	102091873	+	Silent	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:102091873G>A	ENST00000229266.3	+	1	469	c.234G>A	c.(232-234)acG>acA	p.T78T	CHPT1_ENST00000549872.1_Silent_p.T78T|CHPT1_ENST00000550385.1_Intron	NM_020244.2	NP_064629.2	Q8WUD6	CHPT1_HUMAN	choline phosphotransferase 1	78					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|regulation of cell growth (GO:0001558)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	diacylglycerol binding (GO:0019992)|diacylglycerol cholinephosphotransferase activity (GO:0004142)|metal ion binding (GO:0046872)	p.T78T(1)		kidney(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						TGGTCACCACGCTCGTGCTCA	0.692																																					p.T78T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G234A	12						.						35.0	20.0	25.0					12																	102091873		2200	4296	6496	100616004	SO:0001819	synonymous_variant	56994	exon1				CCDS9086.1	12q	2010-07-08				ENSG00000111666	2.7.8.2		17852	protein-coding gene	gene with protein product	"""phosphatidylcholine synthesizing enzyme"""					10893425	Standard	NM_020244		Approved	CPT1	uc001tin.3	Q8WUD6		ENST00000229266.3:c.234G>A	12.37:g.102091873G>A		Somatic		Capture	SOLID	Phase_I	100616004	NM_020244	B3KQM2|Q7Z7H0|Q7Z7H1|Q7Z7H2|Q8IWQ4|Q8IWQ5|Q8WYI4|Q9NRQ6|Q9NRQ7|Q9Y6M6	Silent	SNP	ENST00000229266.3	37	CCDS9086.1																																																																																				CHPT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409173.1	NM_020244	
PAH	5053	hgsc.bcm.edu	37	12	103237525	103237525	+	Silent	SNP	G	G	A	rs62516097		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:103237525G>A	ENST00000553106.1	-	11	1570	c.1098C>T	c.(1096-1098)ccC>ccT	p.P366P	PAH_ENST00000307000.2_Silent_p.P361P	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	366			Missing (in PKU). {ECO:0000269|PubMed:1363837}.|P -> H (in PKU).		catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)			endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	CCAGCTCCAGGGGGAGAAGCT	0.458																																					p.P366P												.	.	0			c.C1098T	12						.						95.0	92.0	93.0					12																	103237525		2203	4300	6503	101761655	SO:0001819	synonymous_variant	5053	exon11			U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.1098C>T	12.37:g.103237525G>A		Somatic		Capture	SOLID	Phase_I	101761655	NM_000277	Q16717|Q8TC14	Silent	SNP	ENST00000553106.1	37	CCDS9092.1																																																																																				PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406692.1		
STAB2	55576	hgsc.bcm.edu	37	12	104084236	104084236	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:104084236G>C	ENST00000388887.2	+	30	3421	c.3217G>C	c.(3217-3219)Gat>Cat	p.D1073H		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CAGAGTGGCAGATCTGCAGAC	0.428																																					p.D1073H												.	.	0			c.G3217C	12						.						141.0	129.0	133.0					12																	104084236		2203	4300	6503	102608366	SO:0001583	missense	55576	exon30			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.3217G>C	12.37:g.104084236G>C	ENSP00000373539:p.Asp1073His	Somatic		Capture	SOLID	Phase_I	102608366	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	G	19.79	3.893455	0.72639	.	.	ENSG00000136011	ENST00000388887	D	0.93189	-3.18	5.91	5.91	0.95273	FAS1 domain (5);Growth factor, receptor (1);	0.192286	0.48286	D	0.000195	D	0.96990	0.9017	M	0.89534	3.04	0.43494	D	0.995737	D	0.89917	1.0	D	0.77557	0.99	D	0.96690	0.9510	10	0.49607	T	0.09	.	13.4885	0.61379	0.0711:0.0:0.9289:0.0	.	1073	Q8WWQ8	STAB2_HUMAN	H	1073	ENSP00000373539:D1073H	ENSP00000373539:D1073H	D	+	1	0	STAB2	102608366	0.999000	0.42202	0.610000	0.28997	0.941000	0.58515	4.081000	0.57627	2.813000	0.96785	0.655000	0.94253	GAT		STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
STAB2	55576	hgsc.bcm.edu	37	12	104106180	104106180	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:104106180A>C	ENST00000388887.2	+	41	4574	c.4370A>C	c.(4369-4371)aAg>aCg	p.K1457T		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GCTTCATGCAAGTGTGCAGCA	0.522																																					p.K1457T												.	.	0			c.A4370C	12						.						158.0	144.0	149.0					12																	104106180		2203	4300	6503	102630310	SO:0001583	missense	55576	exon41			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.4370A>C	12.37:g.104106180A>C	ENSP00000373539:p.Lys1457Thr	Somatic		Capture	SOLID	Phase_I	102630310	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	A	7.820	0.717528	0.15372	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	T	0.02890	4.12	6.07	-0.299	0.12808	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	1.082480	0.07118	N	0.843493	T	0.03520	0.0101	L	0.42245	1.32	0.27455	N	0.953317	B	0.29085	0.232	B	0.31614	0.133	T	0.49523	-0.8931	10	0.14656	T	0.56	.	10.1592	0.42842	0.6672:0.0:0.3328:0.0	.	1457	Q8WWQ8	STAB2_HUMAN	T	1457;144	ENSP00000373539:K1457T	ENSP00000258495:K144T	K	+	2	0	STAB2	102630310	0.998000	0.40836	0.647000	0.29507	0.512000	0.34134	0.738000	0.26158	-0.273000	0.09246	-0.274000	0.10170	AAG		STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
ACACB	32	hgsc.bcm.edu	37	12	109660389	109660389	+	Silent	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:109660389A>G	ENST00000338432.7	+	25	3761	c.3642A>G	c.(3640-3642)aaA>aaG	p.K1214K	ACACB_ENST00000377854.5_Silent_p.K1144K|ACACB_ENST00000377848.3_Silent_p.K1214K			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1214					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.K1214K(1)		NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	AGCTGAGCAAAAGCGAGCACT	0.602																																					p.K1214K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3642G	12						.						92.0	83.0	86.0					12																	109660389		2203	4300	6503	108144772	SO:0001819	synonymous_variant	32	exon24			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.3642A>G	12.37:g.109660389A>G		Somatic		Capture	SOLID	Phase_I	108144772	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Silent	SNP	ENST00000338432.7	37	CCDS31898.1																																																																																				ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
ANAPC7	51434	hgsc.bcm.edu	37	12	110824170	110824170	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:110824170A>C	ENST00000455511.3	-	6	881	c.881T>G	c.(880-882)tTt>tGt	p.F294C	RP11-478C19.2_ENST00000550231.1_RNA|ANAPC7_ENST00000450008.2_Missense_Mutation_p.F294C	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	294					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						TGCCTGTTCAAACTTGAGGAC	0.438																																					p.F294C												.	.	0			c.T881G	12						.						239.0	236.0	237.0					12																	110824170		2203	4300	6503	109308553	SO:0001583	missense	51434	exon6			AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.881T>G	12.37:g.110824170A>C	ENSP00000394394:p.Phe294Cys	Somatic		Capture	SOLID	Phase_I	109308553	NM_001137664	Q96AC4|Q96GF4|Q9BU24|Q9NT16	Missense_Mutation	SNP	ENST00000455511.3	37	CCDS9145.2	.	.	.	.	.	.	.	.	.	.	A	25.1	4.605514	0.87157	.	.	ENSG00000196510	ENST00000455511;ENST00000450008	T;T	0.59083	0.97;0.29	5.37	5.37	0.77165	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.69949	0.3168	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.76071	0.987;0.948	T	0.71659	-0.4526	10	0.54805	T	0.06	-6.238	15.3593	0.74457	1.0:0.0:0.0:0.0	.	294;294	Q9UJX3-2;Q9UJX3	.;APC7_HUMAN	C	294	ENSP00000394394:F294C;ENSP00000402314:F294C	ENSP00000402314:F294C	F	-	2	0	ANAPC7	109308553	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.930000	0.92872	2.024000	0.59613	0.533000	0.62120	TTT		ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347075.3	NM_016238	
DTX1	1840	hgsc.bcm.edu	37	12	113532889	113532889	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:113532889G>C	ENST00000257600.3	+	7	1932	c.1429G>C	c.(1429-1431)Gag>Cag	p.E477Q	DTX1_ENST00000547974.1_3'UTR	NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	477					cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E477Q(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						CATCTACGGGGAGAAGACGGG	0.647																																					p.E477Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1429C	12						.						61.0	59.0	59.0					12																	113532889		2203	4300	6503	112017272	SO:0001583	missense	1840	exon7			AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.1429G>C	12.37:g.113532889G>C	ENSP00000257600:p.Glu477Gln	Somatic		Capture	SOLID	Phase_I	112017272	NM_004416	O60630|Q9BS04	Missense_Mutation	SNP	ENST00000257600.3	37	CCDS9164.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.438485	0.62955	.	.	ENSG00000135144	ENST00000257600	T	0.21932	1.98	4.54	4.54	0.55810	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.33876	0.0878	L	0.57536	1.79	0.80722	D	1	D	0.53151	0.958	P	0.51945	0.685	T	0.10064	-1.0646	10	0.49607	T	0.09	-2.3546	16.0386	0.80648	0.0:0.0:1.0:0.0	.	477	Q86Y01	DTX1_HUMAN	Q	477	ENSP00000257600:E477Q	ENSP00000257600:E477Q	E	+	1	0	DTX1	112017272	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.750000	0.85110	2.047000	0.60756	0.561000	0.74099	GAG		DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2		
CIT	11113	hgsc.bcm.edu	37	12	120173033	120173033	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:120173033G>A	ENST00000261833.7	-	24	3014	c.2962C>T	c.(2962-2964)Cga>Tga	p.R988*	CIT_ENST00000392521.2_Nonsense_Mutation_p.R1030*|CIT_ENST00000537607.1_5'UTR	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	988					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		ACTTCACTTCGCAGTTGTACA	0.522																																					p.R988X												.	.	0			c.C2962T	12						.						219.0	188.0	199.0					12																	120173033		2203	4300	6503	118657416	SO:0001587	stop_gained	11113	exon24			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.2962C>T	12.37:g.120173033G>A	ENSP00000261833:p.Arg988*	Somatic		Capture	SOLID	Phase_I	118657416	NM_007174	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Nonsense_Mutation	SNP	ENST00000261833.7	37	CCDS9192.1	.	.	.	.	.	.	.	.	.	.	G	36	5.786489	0.96937	.	.	ENSG00000122966	ENST00000392521;ENST00000261833	.	.	.	5.23	5.23	0.72850	.	0.132700	0.51477	D	0.000095	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.1641	0.93546	0.0:0.0:1.0:0.0	.	.	.	.	X	1030;988	.	ENSP00000261833:R988X	R	-	1	2	CIT	118657416	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.300000	0.51834	2.587000	0.87381	0.655000	0.94253	CGA		CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
PITPNM2	57605	hgsc.bcm.edu	37	12	123498432	123498432	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:123498432T>G	ENST00000542749.1	-	2	299	c.236A>C	c.(235-237)aAg>aCg	p.K79T	PITPNM2_ENST00000546049.1_Missense_Mutation_p.K79T|PITPNM2_ENST00000392428.1_Intron|PITPNM2_ENST00000320201.4_Missense_Mutation_p.K79T|RN7SL133P_ENST00000585256.1_RNA|PITPNM2_ENST00000280562.5_Missense_Mutation_p.K79T|PITPNM2_ENST00000451868.2_5'UTR			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	79					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)	p.K79T(1)		NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CAGGGCTGCCTTGGGCAGGAT	0.627																																					p.K79T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A236C	12						.						116.0	96.0	103.0					12																	123498432		2203	4300	6503	122064385	SO:0001583	missense	57605	exon3			AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.236A>C	12.37:g.123498432T>G	ENSP00000437611:p.Lys79Thr	Somatic		Capture	SOLID	Phase_I	122064385	NM_020845	Q9P271	Missense_Mutation	SNP	ENST00000542749.1	37	CCDS9242.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.772844	0.90108	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000542749	T;T;T	0.49720	0.77;0.77;0.77	4.42	4.42	0.53409	START-like domain (1);	0.058851	0.64402	D	0.000002	T	0.66703	0.2816	M	0.80422	2.495	0.80722	D	1	P;D;D	0.55800	0.78;0.973;0.96	P;D;P	0.63283	0.506;0.913;0.893	T	0.69595	-0.5103	10	0.42905	T	0.14	-35.6316	13.974	0.64259	0.0:0.0:0.0:1.0	.	79;79;79	A5D8U3;Q9BZ72-2;Q9BZ72	.;.;PITM2_HUMAN	T	79	ENSP00000280562:K79T;ENSP00000322218:K79T;ENSP00000437611:K79T	ENSP00000280562:K79T	K	-	2	0	PITPNM2	122064385	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.800000	0.85949	1.761000	0.52028	0.533000	0.62120	AAG		PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
CCDC92	80212	hgsc.bcm.edu	37	12	124428826	124428826	+	Silent	SNP	G	G	A	rs565466744		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:124428826G>A	ENST00000238156.3	-	2	381	c.27C>T	c.(25-27)taC>taT	p.Y9Y	CCDC92_ENST00000545891.1_Intron|CCDC92_ENST00000544798.1_5'UTR|CCDC92_ENST00000545135.1_De_novo_Start_InFrame	NM_025140.1	NP_079416.1	Q53HC0	CCD92_HUMAN	coiled-coil domain containing 92	9						centriole (GO:0005814)		p.Y9Y(1)		large_intestine(5)|lung(2)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.0002)|OV - Ovarian serous cystadenocarcinoma(86;0.000222)|all cancers(50;0.00129)|BRCA - Breast invasive adenocarcinoma(302;0.242)		TACCTTCATCGTAACTCGAGA	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		17601	0.0		0.0	False		,,,				2504	0.001				p.Y9Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C27T	12						.						87.0	84.0	85.0					12																	124428826		2203	4300	6503	122994779	SO:0001819	synonymous_variant	80212	exon2			AK026124	CCDS9256.1	12q24.31	2011-09-02			ENSG00000119242	ENSG00000119242			29563	protein-coding gene	gene with protein product	"""limkain beta 2"""					12477932	Standard	NM_025140		Approved	FLJ22471	uc001ufw.1	Q53HC0	OTTHUMG00000168725	ENST00000238156.3:c.27C>T	12.37:g.124428826G>A		Somatic		Capture	SOLID	Phase_I	122994779	NM_025140	B3KNQ0|Q9H697	Silent	SNP	ENST00000238156.3	37	CCDS9256.1																																																																																				CCDC92-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400780.2	NM_025140	
WNK1	65125	hgsc.bcm.edu	37	12	1005450	1005450	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:1005450G>A	ENST00000315939.6	+	24	6440	c.5797G>A	c.(5797-5799)Gca>Aca	p.A1933T	WNK1_ENST00000340908.4_Missense_Mutation_p.A1526T|WNK1_ENST00000537687.1_Missense_Mutation_p.A2193T|WNK1_ENST00000530271.2_Missense_Mutation_p.A2431T|WNK1_ENST00000535572.1_Missense_Mutation_p.A1685T	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1933					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TGCCTCAGAGGCAAAGTCAGA	0.488																																					p.A2193T	Colon(19;451 567 6672 12618 28860)											.	.	0			c.G6577A	12						.						95.0	91.0	92.0					12																	1005450		2203	4300	6503	875711	SO:0001583	missense	65125	exon24			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.5797G>A	12.37:g.1005450G>A	ENSP00000313059:p.Ala1933Thr	Somatic		Capture	SOLID	Phase_I	875711	NM_001184985	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	37	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	G	9.810	1.182953	0.21870	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000252477;ENST00000530271;ENST00000340908	T;T;T;T;T	0.70631	-0.5;-0.47;-0.47;-0.5;0.7	5.48	-6.84	0.01687	.	1.054000	0.07394	N	0.889534	T	0.45115	0.1326	N	0.22421	0.69	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.25047	-1.0143	10	0.16896	T	0.51	1.8422	3.3751	0.07234	0.5188:0.2299:0.1156:0.1357	.	1686;1685;1933	Q9H4A3-2;F5GWT4;Q9H4A3	.;.;WNK1_HUMAN	T	1685;1933;2193;1106;2431;1526	ENSP00000441972:A1685T;ENSP00000313059:A1933T;ENSP00000444465:A2193T;ENSP00000433548:A2431T;ENSP00000341292:A1526T	ENSP00000252477:A1106T	A	+	1	0	WNK1	875711	0.971000	0.33674	0.007000	0.13788	0.691000	0.40173	0.344000	0.19962	-0.998000	0.03446	-0.806000	0.03193	GCA		WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
ENO2	2026	hgsc.bcm.edu	37	12	7031310	7031310	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:7031310G>T	ENST00000535366.1	+	9	1785	c.1159G>T	c.(1159-1161)Ggg>Tgg	p.G387W	ENO2_ENST00000229277.1_Missense_Mutation_p.G387W|ENO2_ENST00000544774.1_Missense_Mutation_p.G344W|ENO2_ENST00000534977.1_Intron|ENO2_ENST00000538763.1_Missense_Mutation_p.G344W|ENO2_ENST00000541477.1_Missense_Mutation_p.G387W|ATN1_ENST00000356654.4_5'Flank|ENO2_ENST00000545045.2_Missense_Mutation_p.G268W			P09104	ENOG_HUMAN	enolase 2 (gamma, neuronal)	387					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|perikaryon (GO:0043204)|phosphopyruvate hydratase complex (GO:0000015)|photoreceptor inner segment (GO:0001917)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						CCTGGTGGTGGGGCTGTGCAC	0.572																																					p.G387W												.	.	0			c.G1159T	12						.						85.0	81.0	83.0					12																	7031310		2203	4300	6503	6901571	SO:0001583	missense	2026	exon10			M22349	CCDS8570.1	12p13	2012-10-02				ENSG00000111674	4.2.1.11		3353	protein-coding gene	gene with protein product		131360					Standard	NM_001975		Approved		uc001qru.1	P09104		ENST00000535366.1:c.1159G>T	12.37:g.7031310G>T	ENSP00000437402:p.Gly387Trp	Somatic		Capture	SOLID	Phase_I	6901571	NM_001975	B7Z2X9|Q96J33	Missense_Mutation	SNP	ENST00000535366.1	37	CCDS8570.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.634797	0.87760	.	.	ENSG00000111674	ENST00000541477;ENST00000229277;ENST00000538763;ENST00000544774;ENST00000535366;ENST00000545045	T;T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78;1.78	5.16	5.16	0.70880	Enolase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.72938	0.3523	H	0.99642	4.675	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.994;0.998	D	0.86438	0.1765	10	0.87932	D	0	-22.8059	19.0295	0.92950	0.0:0.0:1.0:0.0	.	344;387	B7Z2X9;P09104	.;ENOG_HUMAN	W	387;387;344;344;387;268	ENSP00000438873:G387W;ENSP00000229277:G387W;ENSP00000441490:G344W;ENSP00000446195:G344W;ENSP00000437402:G387W;ENSP00000438062:G268W	ENSP00000229277:G387W	G	+	1	0	ENO2	6901571	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.859000	0.99545	2.585000	0.87301	0.448000	0.29417	GGG		ENO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401786.1		
C12orf57	113246	hgsc.bcm.edu	37	12	7053753	7053753	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:7053753C>G	ENST00000229281.5	+	2	266	c.167C>G	c.(166-168)cCc>cGc	p.P56R	C12orf57_ENST00000544681.1_Missense_Mutation_p.P56R|C12orf57_ENST00000542222.1_3'UTR|C12orf57_ENST00000540506.2_Missense_Mutation_p.P21R|U47924.31_ENST00000607421.1_RNA|PTPN6_ENST00000447931.2_5'Flank|RNU7-1_ENST00000458811.1_RNA|PTPN6_ENST00000399448.1_5'Flank|C12orf57_ENST00000537087.1_Intron	NM_138425.2	NP_612434.1	Q99622	C10_HUMAN	chromosome 12 open reading frame 57	56						cytoplasm (GO:0005737)		p.P56R(1)		kidney(1)|large_intestine(1)	2						TTCGTGCTGCCCGTGGCCACG	0.622											OREG0021642	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P56R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C167G	12						.						89.0	68.0	75.0					12																	7053753		2203	4300	6503	6924014	SO:0001583	missense	113246	exon2			U47924	CCDS8571.1	12p13.31	2012-05-30			ENSG00000111678	ENSG00000111678			29521	protein-coding gene	gene with protein product		615140				9445485	Standard	NM_138425		Approved	GRCC10, C10	uc009zfj.2	Q99622	OTTHUMG00000169017	ENST00000229281.5:c.167C>G	12.37:g.7053753C>G	ENSP00000229281:p.Pro56Arg	Somatic	638	Capture	SOLID	Phase_I	6924014	NM_138425	B2R4Q6	Missense_Mutation	SNP	ENST00000229281.5	37	CCDS8571.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.852837	0.91355	.	.	ENSG00000111678	ENST00000545581;ENST00000229281	D;D	0.87809	-2.3;-2.3	3.74	3.74	0.42951	.	0.000000	0.85682	D	0.000000	D	0.92283	0.7552	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93107	0.6513	10	0.87932	D	0	-15.1577	14.5671	0.68185	0.0:1.0:0.0:0.0	.	56	Q99622	C10_HUMAN	R	56	ENSP00000440602:P56R;ENSP00000229281:P56R	ENSP00000229281:P56R	P	+	2	0	C12orf57	6924014	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.154000	0.77437	2.373000	0.80994	0.561000	0.74099	CCC		C12orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401959.1	NM_138425	
LPCAT3	10162	hgsc.bcm.edu	37	12	7125611	7125611	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:7125611G>A	ENST00000261407.4	-	1	203	c.118C>T	c.(118-120)Cag>Tag	p.Q40*	C1S_ENST00000406697.1_Intron	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	40					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)	p.Q40*(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						CGCAGCGCCTGTTCTGACGCG	0.667																																					p.Q40X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C118T	12						.						43.0	43.0	43.0					12																	7125611		2199	4300	6499	6995872	SO:0001587	stop_gained	10162	exon1			U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970	ENST00000261407.4:c.118C>T	12.37:g.7125611G>A	ENSP00000261407:p.Gln40*	Somatic		Capture	SOLID	Phase_I	6995872	NM_005768	B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	Nonsense_Mutation	SNP	ENST00000261407.4	37	CCDS8572.1	.	.	.	.	.	.	.	.	.	.	G	37	6.327972	0.97476	.	.	ENSG00000111684	ENST00000261407	.	.	.	5.01	5.01	0.66863	.	0.197758	0.44688	D	0.000431	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-13.6697	15.359	0.74453	0.0:0.0:1.0:0.0	.	.	.	.	X	40	.	ENSP00000261407:Q40X	Q	-	1	0	LPCAT3	6995872	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.943000	0.63554	2.586000	0.87340	0.655000	0.94253	CAG		LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401812.1	NM_005768	
CLSTN3	9746	hgsc.bcm.edu	37	12	7287941	7287941	+	Silent	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:7287941G>T	ENST00000266546.6	+	4	852	c.402G>T	c.(400-402)cgG>cgT	p.R134R	CLSTN3_ENST00000537408.1_Silent_p.R146R	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	134	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						TGCATGTGCGGGTCAACGATG	0.547																																					p.R134R												.	.	0			c.G402T	12						.						195.0	114.0	142.0					12																	7287941		2203	4300	6503	7179208	SO:0001819	synonymous_variant	9746	exon4			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.402G>T	12.37:g.7287941G>T		Somatic		Capture	SOLID	Phase_I	7179208	NM_014718	D3DUT6|O94831|Q2T9J5|Q5UE57	Silent	SNP	ENST00000266546.6	37	CCDS8575.1																																																																																				CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
CD163L1	283316	hgsc.bcm.edu	37	12	7531888	7531888	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:7531888G>A	ENST00000313599.3	-	9	2114	c.2057C>T	c.(2056-2058)tCg>tTg	p.S686L	CD163L1_ENST00000544331.1_5'Flank|CD163L1_ENST00000396630.1_Missense_Mutation_p.S686L|CD163L1_ENST00000416109.2_Missense_Mutation_p.S696L			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	686						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.S686L(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CTCCATATCCGATGCATCTGA	0.463																																					p.S686L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2057T	12						.						69.0	58.0	62.0					12																	7531888		2203	4300	6503	7423155	SO:0001583	missense	283316	exon9			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.2057C>T	12.37:g.7531888G>A	ENSP00000315945:p.Ser686Leu	Somatic		Capture	SOLID	Phase_I	7423155	NM_174941	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.024649	0.54683	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.01505	4.87;4.87;4.82	2.79	2.79	0.32731	Speract/scavenger receptor-related (1);	.	.	.	.	T	0.03783	0.0107	L	0.45470	1.425	0.09310	N	1	P;D	0.65815	0.952;0.995	B;P	0.50659	0.406;0.647	T	0.45948	-0.9226	9	0.44086	T	0.13	.	11.7492	0.51839	0.0:0.0:1.0:0.0	.	696;686	E7EVK4;Q9NR16	.;C163B_HUMAN	L	686;696;686	ENSP00000315945:S686L;ENSP00000393474:S696L;ENSP00000379871:S686L	ENSP00000315945:S686L	S	-	2	0	CD163L1	7423155	0.056000	0.20664	0.002000	0.10522	0.075000	0.17131	0.927000	0.28818	1.492000	0.48499	0.455000	0.32223	TCG		CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
PZP	5858	hgsc.bcm.edu	37	12	9309933	9309933	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:9309933C>T	ENST00000261336.2	-	28	3416	c.3388G>A	c.(3388-3390)Gcc>Acc	p.A1130T	PZP_ENST00000381997.2_Missense_Mutation_p.A916T	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	1130					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.A916T(1)|p.A1130T(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						CAGAACAGGGCATTGCGAACA	0.498																																					p.A1130T	Melanoma(125;1402 1695 4685 34487 38571)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3388A	12						.						88.0	86.0	87.0					12																	9309933		2203	4300	6503	9201200	SO:0001583	missense	5858	exon28			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.3388G>A	12.37:g.9309933C>T	ENSP00000261336:p.Ala1130Thr	Somatic		Capture	SOLID	Phase_I	9201200	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	C	15.10	2.732857	0.48939	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.63096	-0.02;-0.02	3.99	3.99	0.46301	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.181563	0.36268	U	0.002681	D	0.82641	0.5081	M	0.90870	3.155	0.25150	N	0.990431	D;D	0.89917	0.994;1.0	D;D	0.87578	0.943;0.998	T	0.77056	-0.2729	10	0.87932	D	0	.	15.4763	0.75481	0.0:1.0:0.0:0.0	.	916;1130	P20742-2;P20742	.;PZP_HUMAN	T	1130;916	ENSP00000261336:A1130T;ENSP00000371427:A916T	ENSP00000261336:A1130T	A	-	1	0	PZP	9201200	0.970000	0.33590	0.412000	0.26496	0.075000	0.17131	2.100000	0.41777	2.143000	0.66587	0.557000	0.71058	GCC		PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
STRAP	11171	hgsc.bcm.edu	37	12	16036586	16036586	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:16036586C>A	ENST00000419869.2	+	2	537	c.224C>A	c.(223-225)gCt>gAt	p.A75D	STRAP_ENST00000538352.1_Intron|STRAP_ENST00000025399.6_Missense_Mutation_p.A88D	NM_007178.3	NP_009109.3	Q9Y3F4	STRAP_HUMAN	serine/threonine kinase receptor associated protein	75					maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|spliceosomal snRNP assembly (GO:0000387)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)	p.A75D(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	15		Hepatocellular(102;0.121)				ACCAAAGCAGCTACAGCAGCT	0.453																																					p.A75D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C224A	12						.						72.0	63.0	66.0					12																	16036586		2203	4300	6503	15927853	SO:0001583	missense	11171	exon2			AB024327	CCDS8676.1	12p13.1	2013-01-10			ENSG00000023734	ENSG00000023734		"""WD repeat domain containing"""	30796	protein-coding gene	gene with protein product	"""Unr-interacting protein"""	605986					Standard	NM_007178		Approved	UNRIP, pt-wd, MAWD	uc001rdc.4	Q9Y3F4	OTTHUMG00000168791	ENST00000419869.2:c.224C>A	12.37:g.16036586C>A	ENSP00000392270:p.Ala75Asp	Somatic		Capture	SOLID	Phase_I	15927853	NM_007178	B2R5S5|B4DNJ6|Q5TZT4|Q9NTK0|Q9UQC8	Missense_Mutation	SNP	ENST00000419869.2	37	CCDS8676.1	.	.	.	.	.	.	.	.	.	.	C	32	5.107548	0.94292	.	.	ENSG00000023734	ENST00000025399;ENST00000419869	T;T	0.70399	-0.48;-0.48	4.59	4.59	0.56863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.050841	0.85682	D	0.000000	D	0.86736	0.6004	M	0.88310	2.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89501	0.3764	10	0.87932	D	0	-15.9471	17.9869	0.89158	0.0:1.0:0.0:0.0	.	88;75	B4DNJ6;Q9Y3F4	.;STRAP_HUMAN	D	88;75	ENSP00000025399:A88D;ENSP00000392270:A75D	ENSP00000025399:A88D	A	+	2	0	STRAP	15927853	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	7.604000	0.82830	2.542000	0.85734	0.655000	0.94253	GCT		STRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401114.1	NM_007178	
TSPAN11	441631	hgsc.bcm.edu	37	12	31132559	31132559	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:31132559C>G	ENST00000261177.9	+	5	469	c.410C>G	c.(409-411)cCc>cGc	p.P137R	TSPAN11_ENST00000546076.1_Missense_Mutation_p.P137R|TSPAN11_ENST00000544427.1_Missense_Mutation_p.P127R|TSPAN11_ENST00000535215.1_Missense_Mutation_p.P66R	NM_001080509.2	NP_001073978.1	A1L157	TSN11_HUMAN	tetraspanin 11	137						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)	11	all_lung(12;3.11e-10)|Lung NSC(12;5.24e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					TACGGGCAGCCCGGAGCCACG	0.597																																					p.P137R												.	.	0			c.C410G	12						.						99.0	89.0	92.0					12																	31132559		2203	4300	6503	31023826	SO:0001583	missense	441631	exon5				CCDS31765.1	12p11.21	2013-02-14				ENSG00000110900		"""Tetraspanins"""	30795	protein-coding gene	gene with protein product							Standard	NM_001080509		Approved		uc001rjp.3	A1L157		ENST00000261177.9:c.410C>G	12.37:g.31132559C>G	ENSP00000261177:p.Pro137Arg	Somatic		Capture	SOLID	Phase_I	31023826	NM_001080509	A1L158|B2RUX6	Missense_Mutation	SNP	ENST00000261177.9	37	CCDS31765.1	.	.	.	.	.	.	.	.	.	.	C	7.205	0.594312	0.13875	.	.	ENSG00000110900	ENST00000546076;ENST00000535215;ENST00000544427;ENST00000261177	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	3.44	2.54	0.30619	Tetraspanin, EC2 domain (1);	.	.	.	.	D	0.82678	0.5089	L	0.56280	1.765	0.44946	D	0.997961	B;B	0.17852	0.024;0.019	B;B	0.24848	0.023;0.056	T	0.74275	-0.3718	9	0.35671	T	0.21	.	8.629	0.33908	0.0:0.8785:0.0:0.1215	.	127;137	F5H0F0;A1L157	.;TSN11_HUMAN	R	137;66;127;137	ENSP00000437403:P137R;ENSP00000445503:P66R;ENSP00000439895:P127R;ENSP00000261177:P137R	ENSP00000261177:P137R	P	+	2	0	TSPAN11	31023826	0.934000	0.31675	0.491000	0.27477	0.211000	0.24417	1.966000	0.40481	0.414000	0.25790	-0.657000	0.03884	CCC		TSPAN11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399888.1	XM_497334	
BICD1	636	hgsc.bcm.edu	37	12	32480897	32480897	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:32480897C>T	ENST00000281474.5	+	5	1611	c.1508C>T	c.(1507-1509)aCg>aTg	p.T503M	BICD1_ENST00000548411.1_Missense_Mutation_p.T503M	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	503					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)	p.T503M(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			ACCCTTAATACGGCCCAGGAT	0.468																																					p.T503M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1508T	12						.						134.0	114.0	121.0					12																	32480897		2203	4300	6503	32372164	SO:0001583	missense	636	exon5			U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.1508C>T	12.37:g.32480897C>T	ENSP00000281474:p.Thr503Met	Somatic		Capture	SOLID	Phase_I	32372164	NM_001003398	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	37	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	C	14.69	2.609562	0.46527	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.46451	0.87;0.87	5.57	5.57	0.84162	.	0.076546	0.64402	D	0.000012	T	0.58892	0.2154	L	0.45581	1.43	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.67231	0.862;0.95	T	0.55444	-0.8140	10	0.45353	T	0.12	.	19.543	0.95281	0.0:1.0:0.0:0.0	.	503;503	F8W113;Q96G01	.;BICD1_HUMAN	M	503	ENSP00000446793:T503M;ENSP00000281474:T503M	ENSP00000281474:T503M	T	+	2	0	BICD1	32372164	1.000000	0.71417	0.219000	0.23793	0.591000	0.36615	4.783000	0.62403	2.617000	0.88574	0.655000	0.94253	ACG		BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
ZNF641	121274	hgsc.bcm.edu	37	12	48736965	48736965	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:48736965T>G	ENST00000544117.2	-	6	1816	c.1108A>C	c.(1108-1110)Aag>Cag	p.K370Q	ZNF641_ENST00000547026.1_Missense_Mutation_p.K356Q|ZNF641_ENST00000448928.3_Missense_Mutation_p.K347Q|ZNF641_ENST00000301042.3_Missense_Mutation_p.K370Q			Q96N77	ZN641_HUMAN	zinc finger protein 641	370					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(2)|kidney(3)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	12						ACGTGACACTTTGGCACTGGT	0.592																																					p.K356Q												.	.	0			c.A1066C	12						.						98.0	85.0	89.0					12																	48736965		2203	4300	6503	47023232	SO:0001583	missense	121274	exon6			BC018090	CCDS8763.1, CCDS53787.1, CCDS53788.1	12q13.11	2013-01-08				ENSG00000167528		"""Zinc fingers, C2H2-type"", ""-"""	31834	protein-coding gene	gene with protein product		613906					Standard	NM_152320		Approved	FLJ31295	uc001rro.2	Q96N77		ENST00000544117.2:c.1108A>C	12.37:g.48736965T>G	ENSP00000437832:p.Lys370Gln	Somatic		Capture	SOLID	Phase_I	47023232	NM_001172681	B3KS43|B4DNU5|Q8TCQ7|Q8WVE1	Missense_Mutation	SNP	ENST00000544117.2	37	CCDS8763.1	.	.	.	.	.	.	.	.	.	.	T	18.96	3.732934	0.69189	.	.	ENSG00000167528	ENST00000301042;ENST00000544117;ENST00000448928;ENST00000547026	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.56	4.34	0.51931	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.084046	0.47455	D	0.000221	T	0.61652	0.2364	M	0.83223	2.63	0.32805	D	0.500616	D;D	0.69078	0.997;0.965	P;P	0.61874	0.895;0.656	T	0.74402	-0.3677	10	0.87932	D	0	.	10.715	0.46006	0.0:0.0:0.1596:0.8404	.	347;370	B4DNU5;Q96N77	.;ZN641_HUMAN	Q	370;370;347;356	ENSP00000301042:K370Q;ENSP00000437832:K370Q;ENSP00000394627:K347Q;ENSP00000449974:K356Q	ENSP00000301042:K370Q	K	-	1	0	ZNF641	47023232	0.000000	0.05858	1.000000	0.80357	0.967000	0.64934	0.914000	0.28624	2.232000	0.73038	0.533000	0.62120	AAG		ZNF641-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000406518.1	NM_152320	
ANKRD33	341405	hgsc.bcm.edu	37	12	52285011	52285011	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:52285011C>T	ENST00000340970.4	+	6	1077	c.706C>T	c.(706-708)Cct>Tct	p.P236S	ANKRD33_ENST00000538991.1_Missense_Mutation_p.P167S|ANKRD33_ENST00000301190.6_Silent_p.A427A|ANKRD33_ENST00000547119.1_3'UTR			Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33	236					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.A427A(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.0969)		AAAGTCTGGCCCTTCCTCTCT	0.592																																					p.P236S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C706T	12						.						53.0	49.0	50.0					12																	52285011		2203	4300	6503	50571278	SO:0001583	missense	341405	exon6				CCDS8815.1, CCDS44892.1	12q13.13	2013-01-10	2005-01-07	2005-01-07		ENSG00000167612		"""Ankyrin repeat domain containing"""	13788	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 7"""	C12orf7		20026326	Standard	NM_182608		Approved	DKFZp686O1689, PANKY	uc001rzd.3	Q7Z3H0	OTTHUMG00000169506	ENST00000340970.4:c.706C>T	12.37:g.52285011C>T	ENSP00000344690:p.Pro236Ser	Somatic		Capture	SOLID	Phase_I	50571278	NM_001130015	Q0VAA7|Q5K619|Q5K621|Q5K622|Q5K623|Q5K624|Q6ZUN0	Silent	SNP	ENST00000340970.4	37	CCDS44892.1	.	.	.	.	.	.	.	.	.	.	C	13.66	2.304485	0.40795	.	.	ENSG00000167612	ENST00000538991;ENST00000340970	T;T	0.21734	1.99;2.3	4.58	-2.47	0.06442	.	.	.	.	.	T	0.05547	0.0146	.	.	.	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.37150	-0.9718	8	0.05959	T	0.93	-9.8677	0.556	0.00671	0.3864:0.2318:0.1267:0.2551	.	236	Q7Z3H0	ANR33_HUMAN	S	167;236	ENSP00000443722:P167S;ENSP00000344690:P236S	ENSP00000344690:P236S	P	+	1	0	ANKRD33	50571278	0.973000	0.33851	0.476000	0.27291	0.886000	0.51366	1.410000	0.34691	-0.251000	0.09542	0.561000	0.74099	CCT		ANKRD33-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404515.1	NM_182608	
KRT84	3890	hgsc.bcm.edu	37	12	52778871	52778871	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:52778871C>T	ENST00000257951.3	-	1	565	c.499G>A	c.(499-501)Gag>Aag	p.E167K	RP3-416H24.4_ENST00000547174.1_RNA	NM_033045.3	NP_149034.2	Q9NSB2	KRT84_HUMAN	keratin 84	167	Coil 1A.|Rod.				hair follicle development (GO:0001942)|nail development (GO:0035878)|regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of epidermis (GO:0030280)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(10)|skin(3)	27	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TTGATTTGCTCCTTCTCATCC	0.488																																					p.E167K												.	.	0			c.G499A	12						.						213.0	212.0	212.0					12																	52778871		2203	4300	6503	51065138	SO:0001583	missense	3890	exon1			Y19209	CCDS8825.1	12q13	2013-06-25	2006-07-17	2006-07-17	ENSG00000161849	ENSG00000161849		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6461	protein-coding gene	gene with protein product	"""hard keratin type II 4"""	602766	"""keratin, hair, basic, 4"""	KRTHB4		2431943, 16831889	Standard	NM_033045		Approved	Hb-4	uc001sah.1	Q9NSB2	OTTHUMG00000169634	ENST00000257951.3:c.499G>A	12.37:g.52778871C>T	ENSP00000257951:p.Glu167Lys	Somatic		Capture	SOLID	Phase_I	51065138	NM_033045	B2RA43|Q6ISB0|Q701L6	Missense_Mutation	SNP	ENST00000257951.3	37	CCDS8825.1	.	.	.	.	.	.	.	.	.	.	C	32	5.186755	0.94923	.	.	ENSG00000161849	ENST00000257951	D	0.91631	-2.88	5.03	5.03	0.67393	Filament (1);	0.000000	0.50627	D	0.000119	D	0.96765	0.8944	M	0.88640	2.97	0.54753	D	0.999984	D	0.76494	0.999	D	0.87578	0.998	D	0.97154	0.9833	10	0.87932	D	0	.	18.9362	0.92586	0.0:1.0:0.0:0.0	.	167	Q9NSB2	KRT84_HUMAN	K	167	ENSP00000257951:E167K	ENSP00000257951:E167K	E	-	1	0	KRT84	51065138	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.612000	0.82975	2.790000	0.95986	0.609000	0.83330	GAG		KRT84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405187.1	NM_033045	
KRT72	140807	hgsc.bcm.edu	37	12	52979874	52979874	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:52979874T>A	ENST00000537672.2	-	9	1438	c.1428A>T	c.(1426-1428)aaA>aaT	p.K476N	KRT72_ENST00000398066.3_Missense_Mutation_p.K288N|KRT72_ENST00000354310.4_Missense_Mutation_p.K434N|KRT72_ENST00000293745.2_Missense_Mutation_p.K476N	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	476	Tail.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.K476N(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		CAGCTGCAGTTTTGTAGCTAT	0.567																																					p.K434N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1302T	12						.						91.0	83.0	85.0					12																	52979874		2203	4300	6503	51266141	SO:0001583	missense	140807	exon8			AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.1428A>T	12.37:g.52979874T>A	ENSP00000441160:p.Lys476Asn	Somatic		Capture	SOLID	Phase_I	51266141	NM_001146226	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Missense_Mutation	SNP	ENST00000537672.2	37	CCDS8833.1	.	.	.	.	.	.	.	.	.	.	T	5.226	0.227213	0.09916	.	.	ENSG00000170486	ENST00000537672;ENST00000293745;ENST00000354310;ENST00000398066	D;D;D;T	0.81996	-1.5;-1.5;-1.56;-1.22	4.18	-0.968	0.10313	.	0.382752	0.18944	N	0.126842	T	0.69405	0.3107	L	0.36672	1.1	0.09310	N	1	P;B	0.34522	0.455;0.281	B;B	0.30105	0.111;0.081	T	0.60016	-0.7345	10	0.59425	D	0.04	.	7.4482	0.27223	0.0:0.4874:0.0:0.5126	.	434;476	B4DEI8;Q14CN4	.;K2C72_HUMAN	N	476;476;434;288	ENSP00000441160:K476N;ENSP00000293745:K476N;ENSP00000346269:K434N;ENSP00000446151:K288N	ENSP00000293745:K476N	K	-	3	2	KRT72	51266141	0.064000	0.20934	0.008000	0.14137	0.309000	0.27889	-0.935000	0.03950	-0.249000	0.09569	0.445000	0.29226	AAA		KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	NM_080747	
ITGB7	3695	hgsc.bcm.edu	37	12	53591327	53591327	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:53591327C>G	ENST00000267082.5	-	5	755	c.524G>C	c.(523-525)gGg>gCg	p.G175A	ITGB7_ENST00000422257.3_Missense_Mutation_p.G175A|ITGB7_ENST00000338737.4_Missense_Mutation_p.G175A|ITGB7_ENST00000550743.2_Missense_Mutation_p.G175A	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	175	VWFA.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)	p.G175A(1)		NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CAGAGCGTGCCCGAGCTGGCG	0.617																																					p.G175A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G524C	12						.						79.0	70.0	73.0					12																	53591327		2203	4300	6503	51877594	SO:0001583	missense	3695	exon5				CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.524G>C	12.37:g.53591327C>G	ENSP00000267082:p.Gly175Ala	Somatic		Capture	SOLID	Phase_I	51877594	NM_000889	Q9UCP7|Q9UCS7	Missense_Mutation	SNP	ENST00000267082.5	37	CCDS8849.1	.	.	.	.	.	.	.	.	.	.	C	34	5.310534	0.95629	.	.	ENSG00000139626	ENST00000422257;ENST00000267082;ENST00000338737;ENST00000542497	D;D;D;D	0.95724	-3.79;-3.79;-3.79;-3.79	4.91	4.91	0.64330	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.000000	0.35436	N	0.003220	D	0.97256	0.9103	M	0.67517	2.055	0.80722	D	1	D;D	0.89917	0.995;1.0	D;D	0.91635	0.967;0.999	D	0.97787	1.0236	10	0.66056	D	0.02	.	17.3056	0.87194	0.0:1.0:0.0:0.0	.	175;175	B7Z769;P26010	.;ITB7_HUMAN	A	175	ENSP00000408741:G175A;ENSP00000267082:G175A;ENSP00000345501:G175A;ENSP00000437375:G175A	ENSP00000267082:G175A	G	-	2	0	ITGB7	51877594	1.000000	0.71417	0.816000	0.32577	0.995000	0.86356	7.598000	0.82745	2.459000	0.83118	0.555000	0.69702	GGG		ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405821.2		
MFSD5	84975	hgsc.bcm.edu	37	12	53647045	53647045	+	Silent	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:53647045C>T	ENST00000329548.4	+	2	617	c.426C>T	c.(424-426)gcC>gcT	p.A142A	MFSD5_ENST00000534842.1_Silent_p.A249A	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	142					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.A142A(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						TGTCCACAGCCCTGCTCTTCT	0.547																																					p.A142A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C426T	12						.						226.0	217.0	220.0					12																	53647045		2203	4300	6503	51933312	SO:0001819	synonymous_variant	84975	exon2			AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.426C>T	12.37:g.53647045C>T		Somatic		Capture	SOLID	Phase_I	51933312	NM_032889	G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Silent	SNP	ENST00000329548.4	37	CCDS8851.1																																																																																				MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406896.1	NM_032889	
HOXC4	3221	hgsc.bcm.edu	37	12	54448773	54448773	+	Silent	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:54448773G>C	ENST00000430889.2	+	2	625	c.579G>C	c.(577-579)ctG>ctC	p.L193L	HOXC4_ENST00000303406.4_Silent_p.L193L|HOXC4_ENST00000609810.1_Silent_p.L193L	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	193					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						CCCACTCGCTGTGCCTCTCTG	0.532																																					p.L193L												.	.	0			c.G579C	12						.						47.0	43.0	44.0					12																	54448773		2203	4300	6503	52735040	SO:0001819	synonymous_variant	3221	exon4				CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.579G>C	12.37:g.54448773G>C		Somatic		Capture	SOLID	Phase_I	52735040	NM_014620		Silent	SNP	ENST00000430889.2	37	CCDS8873.1																																																																																				HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358963.1		
ESYT1	23344	hgsc.bcm.edu	37	12	56526318	56526318	+	Silent	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:56526318C>A	ENST00000394048.5	+	9	1362	c.1098C>A	c.(1096-1098)acC>acA	p.T366T	RP11-603J24.5_ENST00000550947.1_RNA|ESYT1_ENST00000267113.4_Silent_p.T366T|ESYT1_ENST00000541590.1_Silent_p.T366T	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	366	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						GTTTGGGTACCCAGACATTCT	0.522																																					p.T366T												.	.	0			c.C1098A	12						.						100.0	95.0	97.0					12																	56526318		2203	4300	6503	54812585	SO:0001819	synonymous_variant	23344	exon9			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.1098C>A	12.37:g.56526318C>A		Somatic		Capture	SOLID	Phase_I	54812585	NM_015292	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Silent	SNP	ENST00000394048.5	37	CCDS8904.1																																																																																				ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292	
SMARCC2	6601	hgsc.bcm.edu	37	12	56578696	56578696	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:56578696T>G	ENST00000267064.4	-	5	510	c.424A>C	c.(424-426)Att>Ctt	p.I142L	SMARCC2_ENST00000550164.1_Missense_Mutation_p.I142L|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000347471.4_Missense_Mutation_p.I142L|SMARCC2_ENST00000550859.1_5'UTR|SMARCC2_ENST00000394023.3_Missense_Mutation_p.I142L	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	142					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CACAGAAAAATGTTAGGTCGA	0.398																																					p.I142L												.	.	0			c.A424C	12						.						146.0	134.0	138.0					12																	56578696		2203	4300	6503	54864963	SO:0001583	missense	6601	exon5			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.424A>C	12.37:g.56578696T>G	ENSP00000267064:p.Ile142Leu	Somatic		Capture	SOLID	Phase_I	54864963	NM_139067	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	ENST00000267064.4	37	CCDS8907.1	.	.	.	.	.	.	.	.	.	.	T	19.76	3.887473	0.72410	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T;T	0.60171	0.21;0.21;0.21;0.21	5.85	5.85	0.93711	BRCT (1);	0.000000	0.85682	D	0.000000	T	0.60090	0.2242	M	0.66939	2.045	0.45777	D	0.998663	B;B;B;B;B	0.33318	0.286;0.408;0.286;0.286;0.408	B;B;B;B;B	0.35727	0.103;0.209;0.103;0.103;0.209	T	0.63773	-0.6561	10	0.72032	D	0.01	-11.0441	15.5289	0.75936	0.0:0.0:0.0:1.0	.	31;142;147;142;142	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	L	142	ENSP00000377591:I142L;ENSP00000449396:I142L;ENSP00000302919:I142L;ENSP00000267064:I142L	ENSP00000267064:I142L	I	-	1	0	SMARCC2	54864963	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.553000	0.45837	2.371000	0.80710	0.533000	0.62120	ATT		SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1		
ATP5B	506	hgsc.bcm.edu	37	12	57033004	57033004	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:57033004T>G	ENST00000262030.3	-	9	1425	c.1375A>C	c.(1375-1377)Aaa>Caa	p.K459Q	BAZ2A_ENST00000551812.1_5'Flank|BAZ2A_ENST00000379441.3_5'Flank|BAZ2A_ENST00000179765.5_5'Flank|ATP5B_ENST00000550162.1_5'Flank|ATP5B_ENST00000552919.1_Missense_Mutation_p.K448Q	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	459					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CGCTGTATTTTCCGTGCACGG	0.478																																					p.K459Q												.	.	0			c.A1375C	12						.						144.0	132.0	136.0					12																	57033004		2203	4300	6503	55319271	SO:0001583	missense	506	exon9			M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.1375A>C	12.37:g.57033004T>G	ENSP00000262030:p.Lys459Gln	Somatic		Capture	SOLID	Phase_I	55319271	NM_001686	A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	37	CCDS8924.1	.	.	.	.	.	.	.	.	.	.	T	29.9	5.043560	0.93685	.	.	ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000552104;ENST00000551020	T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13	5.92	5.92	0.95590	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (2);ATPase, F1 complex beta subunit/V1 complex, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90021	0.6884	M	0.90198	3.095	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.91921	0.5547	10	0.87932	D	0	-19.0085	15.3986	0.74818	0.0:0.0:0.0:1.0	.	459	P06576	ATPB_HUMAN	Q	459;448;162;274	ENSP00000262030:K459Q;ENSP00000450297:K448Q;ENSP00000450233:K162Q;ENSP00000446677:K274Q	ENSP00000262030:K459Q	K	-	1	0	ATP5B	55319271	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.872000	0.87187	2.278000	0.76064	0.524000	0.50904	AAA		ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686	
LRP1	4035	hgsc.bcm.edu	37	12	57550011	57550011	+	Silent	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:57550011C>A	ENST00000243077.3	+	9	1828	c.1362C>A	c.(1360-1362)acC>acA	p.T454T		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	454					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AGGTTGTCACCCGGGTGGACA	0.582																																					p.T454T												.	.	0			c.C1362A	12						.						133.0	104.0	114.0					12																	57550011		2203	4300	6503	55836278	SO:0001819	synonymous_variant	4035	exon9			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.1362C>A	12.37:g.57550011C>A		Somatic		Capture	SOLID	Phase_I	55836278	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	ENST00000243077.3	37	CCDS8932.1																																																																																				LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
LRP1	4035	hgsc.bcm.edu	37	12	57574547	57574547	+	Silent	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:57574547C>A	ENST00000243077.3	+	33	5950	c.5484C>A	c.(5482-5484)acC>acA	p.T1828T		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1828					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	ACAGCACCACCCTGGTGATGC	0.647																																					p.T1828T												.	.	0			c.C5484A	12						.						93.0	87.0	89.0					12																	57574547		2203	4300	6503	55860814	SO:0001819	synonymous_variant	4035	exon33			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.5484C>A	12.37:g.57574547C>A		Somatic		Capture	SOLID	Phase_I	55860814	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	ENST00000243077.3	37	CCDS8932.1																																																																																				LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
TSFM	10102	hgsc.bcm.edu	37	12	58180851	58180851	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:58180851G>A	ENST00000550559.1	+	4	404	c.389G>A	c.(388-390)aGa>aAa	p.R130K	TSFM_ENST00000454289.3_Missense_Mutation_p.R130K|TSFM_ENST00000323833.8_Missense_Mutation_p.R130K|TSFM_ENST00000350762.5_Missense_Mutation_p.R90K|TSFM_ENST00000548851.1_Missense_Mutation_p.R130K|TSFM_ENST00000543727.1_Missense_Mutation_p.R130K|TSFM_ENST00000497617.1_3'UTR|TSFM_ENST00000540550.1_Missense_Mutation_p.R130K					Ts translation elongation factor, mitochondrial									p.R130K(1)		endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)	8	all_cancers(7;6.31e-80)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					TTTGTTTCTAGAAATTTAAAA	0.378																																					p.R130K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G389A	12						.						50.0	49.0	50.0					12																	58180851		2201	4299	6500	56467118	SO:0001583	missense	10102	exon4			L37936	CCDS8958.2, CCDS53809.1, CCDS53810.1, CCDS53811.1	12q14.1	2006-06-10			ENSG00000123297	ENSG00000123297			12367	protein-coding gene	gene with protein product		604723				7615523	Standard	NM_005726		Approved	EF-Tsmt, EF-TS	uc001sqh.3	P43897	OTTHUMG00000153042	ENST00000550559.1:c.389G>A	12.37:g.58180851G>A	ENSP00000448575:p.Arg130Lys	Somatic		Capture	SOLID	Phase_I	56467118	NM_001172695		Missense_Mutation	SNP	ENST00000550559.1	37		.	.	.	.	.	.	.	.	.	.	G	24.5	4.542402	0.85917	.	.	ENSG00000123297	ENST00000454289;ENST00000543727;ENST00000540550;ENST00000323833;ENST00000350762;ENST00000550559;ENST00000548851;ENST00000434359;ENST00000457189	T;T;T;T;T;T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83;-0.83;-0.83;-0.83;-0.83;-0.83	5.2	4.3	0.51218	Translation elongation factor Ts, conserved site (1);Translation elongation factor EFTs/EF1B, dimerisation (3);	0.049932	0.64402	N	0.000001	T	0.73992	0.3658	L	0.56199	1.76	0.44843	D	0.997854	P;P;P;P	0.47841	0.901;0.864;0.791;0.854	P;P;P;P	0.48840	0.567;0.457;0.592;0.54	T	0.72947	-0.4137	9	.	.	.	.	11.4549	0.50176	0.0865:0.0:0.9135:0.0	.	130;90;130;130	B4E391;F8W6R3;P43897;P43897-2	.;.;EFTS_HUMAN;.	K	130;130;130;130;90;130;130;80;80	ENSP00000388330:R130K;ENSP00000439342:R130K;ENSP00000440987:R130K;ENSP00000313877:R130K;ENSP00000242983:R90K;ENSP00000448575:R130K;ENSP00000450041:R130K;ENSP00000390679:R80K;ENSP00000389162:R80K	.	R	+	2	0	TSFM	56467118	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	4.047000	0.57383	1.309000	0.44985	-0.150000	0.13652	AGA		TSFM-008	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000409343.1	NM_005726	
SLC16A7	9194	hgsc.bcm.edu	37	12	60165120	60165121	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	AC	AC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:60165120_60165121delAC	ENST00000261187.4	+	3	502_503	c.338_339delAC	c.(337-339)tacfs	p.Y113fs	SLC16A7_ENST00000547379.1_Frame_Shift_Del_p.Y113fs|SLC16A7_ENST00000552432.1_Frame_Shift_Del_p.Y113fs|SLC16A7_ENST00000543448.1_Frame_Shift_Del_p.Y14fs|SLC16A7_ENST00000552024.1_Frame_Shift_Del_p.Y113fs	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	113					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)	p.Y113fs*28(1)		endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	GTACAGCTGTACCTCACTATGG	0.431																																					p.113_113del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.338_339del	12						.																																			58451388	SO:0001589	frameshift_variant	9194	exon3			AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.338_339delAC	12.37:g.60165120_60165121delAC	ENSP00000261187:p.Tyr113fs	Somatic		Capture	SOLID	Phase_I	58451387	NM_004731	Q8NEM3|Q9UPB3	Frame_Shift_Del	DEL	ENST00000261187.4	37	CCDS8961.1																																																																																				SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406587.1	NM_004731	
ACSS3	79611	hgsc.bcm.edu	37	12	81613796	81613796	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:81613796G>T	ENST00000548058.1	+	11	2365	c.1455G>T	c.(1453-1455)atG>atT	p.M485I	ACSS3_ENST00000261206.3_Missense_Mutation_p.M484I|ACSS3_ENST00000548324.1_Missense_Mutation_p.M167I			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	485						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						TTGTAGTTATGATTTTGGATG	0.254																																					p.M485I												ACSS3,lung,NS,Substitution - Missense,+2	.	0			c.G1455T	12						.						39.0	43.0	42.0					12																	81613796		2200	4298	6498	80137927	SO:0001583	missense	79611	exon11				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1455G>T	12.37:g.81613796G>T	ENSP00000449535:p.Met485Ile	Somatic		Capture	SOLID	Phase_I	80137927	NM_024560	Q8NC66	Missense_Mutation	SNP	ENST00000548058.1	37	CCDS9022.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.742326	0.49151	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	T;T;T	0.39997	1.05;1.05;1.05	5.49	5.49	0.81192	AMP-dependent synthetase/ligase (1);	0.362513	0.35378	N	0.003252	T	0.28599	0.0708	N	0.17723	0.515	0.37388	D	0.912327	B;B	0.27416	0.052;0.178	B;B	0.24541	0.042;0.054	T	0.21655	-1.0239	10	0.52906	T	0.07	-17.4924	11.9384	0.52886	0.0812:0.0:0.9188:0.0	.	167;485	Q9H6R3-2;Q9H6R3	.;ACSS3_HUMAN	I	485;484;167	ENSP00000449535:M485I;ENSP00000261206:M484I;ENSP00000448965:M167I	ENSP00000261206:M484I	M	+	3	0	ACSS3	80137927	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.508000	0.53378	2.727000	0.93392	0.655000	0.94253	ATG		ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	NM_024560	
LRRIQ1	84125	hgsc.bcm.edu	37	12	85459091	85459091	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:85459091G>A	ENST00000393217.2	+	9	2504	c.2443G>A	c.(2443-2445)Gca>Aca	p.A815T		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	815								p.A815T(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		CTCCACACTGGCAGAGTGTAC	0.388																																					p.A815T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2443A	12						.						144.0	136.0	138.0					12																	85459091		2203	4300	6503	83983222	SO:0001583	missense	84125	exon9			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.2443G>A	12.37:g.85459091G>A	ENSP00000376910:p.Ala815Thr	Somatic		Capture	SOLID	Phase_I	83983222	NM_032165	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	G	13.51	2.257866	0.39896	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.25250	1.81	5.6	1.26	0.21427	.	0.265498	0.30547	N	0.009400	T	0.16257	0.0391	L	0.45137	1.4	0.29337	N	0.866287	B;B	0.21071	0.051;0.051	B;B	0.14023	0.01;0.01	T	0.14364	-1.0475	10	0.62326	D	0.03	.	1.346	0.02163	0.1871:0.1169:0.4176:0.2784	.	815;790	Q96JM4;C9JI57	LRIQ1_HUMAN;.	T	815;790;815	ENSP00000376910:A815T	ENSP00000256007:A815T	A	+	1	0	LRRIQ1	83983222	1.000000	0.71417	0.224000	0.23877	0.619000	0.37552	0.917000	0.28665	0.311000	0.23014	0.585000	0.79938	GCA		LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
USP44	84101	hgsc.bcm.edu	37	12	95926710	95926710	+	Silent	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:95926710T>A	ENST00000258499.3	-	2	1611	c.1323A>T	c.(1321-1323)acA>acT	p.T441T	USP44_ENST00000393091.2_Silent_p.T441T|USP44_ENST00000552440.1_Silent_p.T441T|USP44_ENST00000537435.2_Silent_p.T441T	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44	441	USP.				mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						TGGTACCAGTTGTCTCTAATT	0.388																																					p.T441T												.	.	0			c.A1323T	12						.						107.0	109.0	108.0					12																	95926710		2203	4300	6503	94450841	SO:0001819	synonymous_variant	84101	exon2			AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7		ENST00000258499.3:c.1323A>T	12.37:g.95926710T>A		Somatic		Capture	SOLID	Phase_I	94450841	NM_001042403	B2RDW3	Silent	SNP	ENST00000258499.3	37	CCDS9053.1																																																																																				USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408312.1	NM_032147	
TMEM132D	121256	hgsc.bcm.edu	37	12	129563189	129563189	+	Missense_Mutation	SNP	C	C	A	rs143218514		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr12:129563189C>A	ENST00000422113.2	-	8	2331	c.2005G>T	c.(2005-2007)Ggg>Tgg	p.G669W	TMEM132D_ENST00000389441.4_Missense_Mutation_p.G207W	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	669					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.G669W(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AGCTGCACCCCGAGGTCTGTG	0.577																																					p.G669W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2005T	12						.						154.0	129.0	137.0					12																	129563189		2203	4300	6503	128129142	SO:0001583	missense	121256	exon8			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2005G>T	12.37:g.129563189C>A	ENSP00000408581:p.Gly669Trp	Somatic		Capture	SOLID	Phase_I	128129142	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188190	0.78789	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.60920	0.15;0.15	5.06	5.06	0.68205	.	0.065787	0.56097	D	0.000024	T	0.78666	0.4319	M	0.83118	2.625	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80924	-0.1165	9	.	.	.	-44.6538	18.4197	0.90586	0.0:1.0:0.0:0.0	.	669;207	Q14C87;Q14C87-2	T132D_HUMAN;.	W	207;669	ENSP00000374092:G207W;ENSP00000408581:G669W	.	G	-	1	0	TMEM132D	128129142	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	5.772000	0.68889	2.337000	0.79520	0.563000	0.77884	GGG		TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
LRRC57	255252	hgsc.bcm.edu	37	15	42837372	42837372	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr15:42837372G>A	ENST00000323443.2	-	4	948	c.581C>T	c.(580-582)cCc>cTc	p.P194L	LRRC57_ENST00000397130.3_Missense_Mutation_p.P194L|LRRC57_ENST00000563454.1_Missense_Mutation_p.P194L			Q8N9N7	LRC57_HUMAN	leucine rich repeat containing 57	194						extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|lung(5)|prostate(1)	8		all_cancers(109;1.99e-12)|all_epithelial(112;5.11e-11)|Lung NSC(122;4.53e-07)|all_lung(180;1.64e-06)|Melanoma(134;0.0262)		GBM - Glioblastoma multiforme(94;6.87e-07)		GATGCTCTGGGGAAGCATGCT	0.423																																					p.P194L												.	.	0			c.C581T	15						.						102.0	97.0	99.0					15																	42837372		2203	4299	6502	40624664	SO:0001583	missense	255252	exon5			AK094891	CCDS10089.1	15q15.1	2006-02-13			ENSG00000180979	ENSG00000180979			26719	protein-coding gene	gene with protein product							Standard	NM_153260		Approved	FLJ36812	uc001zqc.3	Q8N9N7	OTTHUMG00000130679	ENST00000323443.2:c.581C>T	15.37:g.42837372G>A	ENSP00000326817:p.Pro194Leu	Somatic		Capture	SOLID	Phase_I	40624664	NM_153260	Q7Z2Z6|Q8N1T6	Missense_Mutation	SNP	ENST00000323443.2	37	CCDS10089.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.090326	0.76756	.	.	ENSG00000180979	ENST00000323443;ENST00000397130	T;T	0.60672	0.17;0.17	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.76478	0.3993	M	0.83012	2.62	0.80722	D	1	D	0.71674	0.998	P	0.60345	0.873	T	0.79482	-0.1785	10	0.56958	D	0.05	.	19.0849	0.93200	0.0:0.0:1.0:0.0	.	194	Q8N9N7	LRC57_HUMAN	L	194	ENSP00000326817:P194L;ENSP00000380319:P194L	ENSP00000326817:P194L	P	-	2	0	LRRC57	40624664	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.184000	0.94893	2.520000	0.84964	0.557000	0.71058	CCC		LRRC57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253174.1	NM_153260	
ALDH1A2	8854	hgsc.bcm.edu	37	15	58302913	58302913	+	Missense_Mutation	SNP	C	C	T	rs572439325		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr15:58302913C>T	ENST00000249750.4	-	4	1194	c.427G>A	c.(427-429)Gtc>Atc	p.V143I	ALDH1A2_ENST00000558231.1_Missense_Mutation_p.V114I|ALDH1A2_ENST00000347587.3_Missense_Mutation_p.V143I|ALDH1A2_ENST00000559517.1_Missense_Mutation_p.V47I|ALDH1A2_ENST00000537372.1_Missense_Mutation_p.V122I	NM_003888.3	NP_003879.2	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1 family, member A2	143					9-cis-retinoic acid biosynthetic process (GO:0042904)|anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|cardiac muscle tissue development (GO:0048738)|cellular response to retinoic acid (GO:0071300)|determination of bilateral symmetry (GO:0009855)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract development (GO:0048566)|embryonic forelimb morphogenesis (GO:0035115)|face development (GO:0060324)|heart morphogenesis (GO:0003007)|hindbrain development (GO:0030902)|kidney development (GO:0001822)|liver development (GO:0001889)|lung development (GO:0030324)|midgut development (GO:0007494)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|neural crest cell development (GO:0014032)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|proximal/distal pattern formation (GO:0009954)|regulation of endothelial cell proliferation (GO:0001936)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to vitamin A (GO:0033189)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)|retinoic acid receptor signaling pathway (GO:0048384)|retinol metabolic process (GO:0042572)|ureter maturation (GO:0035799)|vitamin A metabolic process (GO:0006776)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|retinal binding (GO:0016918)|retinal dehydrogenase activity (GO:0001758)	p.V143I(2)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	Tretinoin(DB00755)|Vitamin A(DB00162)	GTTTTGATGACGCCCTGCAAA	0.433													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18764	0.0		0.0	False		,,,				2504	0.0				p.V47I												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G139A	15						.						105.0	96.0	99.0					15																	58302913		2192	4292	6484	56090205	SO:0001583	missense	8854	exon2			AB015228	CCDS10163.1, CCDS10164.1, CCDS45266.1, CCDS55968.1	15q21.2	2011-02-18			ENSG00000128918	ENSG00000128918		"""Aldehyde dehydrogenases"""	15472	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 2"""	603687				9819382	Standard	NM_003888		Approved	RALDH2	uc002aex.3	O94788	OTTHUMG00000132624	ENST00000249750.4:c.427G>A	15.37:g.58302913C>T	ENSP00000249750:p.Val143Ile	Somatic		Capture	SOLID	Phase_I	56090205	NM_170697	B3KY52|B4DZR2|F5H2Y9|H0YM00|Q2PJS6|Q8NHQ4|Q9UBR8|Q9UFY0	Missense_Mutation	SNP	ENST00000249750.4	37	CCDS10163.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.882508	0.51908	.	.	ENSG00000128918	ENST00000249750;ENST00000430119;ENST00000543386;ENST00000347587;ENST00000537372	T;T;T	0.76709	-1.04;2.36;-1.04	5.0	5.0	0.66597	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.173986	0.51477	D	0.000089	T	0.71937	0.3399	L	0.37697	1.125	0.39933	D	0.974315	B;B;B;B	0.12630	0.006;0.005;0.0;0.001	B;B;B;B	0.10450	0.005;0.003;0.001;0.002	T	0.68618	-0.5361	10	0.51188	T	0.08	.	18.851	0.92230	0.0:1.0:0.0:0.0	.	114;122;143;143	B4DH89;F5H2Y9;O94788-2;O94788	.;.;.;AL1A2_HUMAN	I	143;47;114;143;122	ENSP00000249750:V143I;ENSP00000309623:V143I;ENSP00000438296:V122I	ENSP00000249750:V143I	V	-	1	0	ALDH1A2	56090205	1.000000	0.71417	0.982000	0.44146	0.991000	0.79684	4.362000	0.59467	2.756000	0.94617	0.655000	0.94253	GTC		ALDH1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255869.1		
USP3	9960	hgsc.bcm.edu	37	15	63881207	63881207	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr15:63881207C>A	ENST00000380324.3	+	14	1523	c.1394C>A	c.(1393-1395)tCc>tAc	p.S465Y	USP3-AS1_ENST00000560622.1_RNA|USP3-AS1_ENST00000561256.1_RNA|USP3-AS1_ENST00000559357.1_RNA|USP3_ENST00000558285.1_Missense_Mutation_p.S448Y|USP3-AS1_ENST00000558831.1_RNA|USP3-AS1_ENST00000559737.1_RNA|USP3_ENST00000558218.1_3'UTR|USP3-AS1_ENST00000559861.1_RNA|USP3_ENST00000540797.1_Missense_Mutation_p.S421Y|USP3-AS1_ENST00000560962.1_RNA|USP3-AS1_ENST00000561191.1_RNA|USP3_ENST00000268049.7_Missense_Mutation_p.S443Y|USP3_ENST00000539772.1_Missense_Mutation_p.S216Y|USP3_ENST00000559711.1_Missense_Mutation_p.S376Y|USP3-AS1_ENST00000560350.1_RNA	NM_006537.3	NP_006528.2	Q9Y6I4	UBP3_HUMAN	ubiquitin specific peptidase 3	465	USP.				DNA repair (GO:0006281)|histone deubiquitination (GO:0016578)|mitotic cell cycle (GO:0000278)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear chromatin (GO:0000790)	histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.S465Y(1)		endometrium(3)|large_intestine(7)|lung(4)	14				GBM - Glioblastoma multiforme(80;0.0187)		CACCATGGTTCCGGGTGAGTA	0.542																																					p.S465Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1394A	15						.						158.0	152.0	154.0					15																	63881207		2203	4300	6503	61668260	SO:0001583	missense	9960	exon14			AF073344	CCDS32265.1, CCDS58370.1	15q22.3	2008-04-11	2005-08-08			ENSG00000140455		"""Ubiquitin-specific peptidases"""	12626	protein-coding gene	gene with protein product		604728	"""ubiquitin specific protease 3"""			12838346	Standard	NM_006537		Approved		uc002amf.4	Q9Y6I4		ENST00000380324.3:c.1394C>A	15.37:g.63881207C>A	ENSP00000369681:p.Ser465Tyr	Somatic		Capture	SOLID	Phase_I	61668260	NM_006537	B4DVU5|F5H1A6|Q8WVD0	Missense_Mutation	SNP	ENST00000380324.3	37	CCDS32265.1	.	.	.	.	.	.	.	.	.	.	C	34	5.330517	0.95733	.	.	ENSG00000140455	ENST00000540797;ENST00000380324;ENST00000268049;ENST00000539772;ENST00000538686	T;T;T;T	0.33865	1.88;1.99;2.09;1.39	5.28	5.28	0.74379	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.51381	0.1671	L	0.55017	1.72	0.80722	D	1	P;P;P;D	0.52996	0.89;0.851;0.926;0.957	P;P;P;P	0.56612	0.624;0.657;0.73;0.802	T	0.39800	-0.9596	10	0.36615	T	0.2	.	19.2602	0.93964	0.0:1.0:0.0:0.0	.	421;421;443;465	F5H1A6;B4DVU5;Q6JHV3;Q9Y6I4	.;.;.;UBP3_HUMAN	Y	421;465;443;216;296	ENSP00000445828:S421Y;ENSP00000369681:S465Y;ENSP00000268049:S443Y;ENSP00000445642:S216Y	ENSP00000268049:S443Y	S	+	2	0	USP3	61668260	1.000000	0.71417	0.794000	0.32065	0.981000	0.71138	7.776000	0.85560	2.635000	0.89317	0.655000	0.94253	TCC		USP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417773.1		
MYO9A	4649	hgsc.bcm.edu	37	15	72120290	72120290	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr15:72120290A>C	ENST00000356056.5	-	41	7590	c.7118T>G	c.(7117-7119)aTt>aGt	p.I2373S	MYO9A_ENST00000424560.1_Missense_Mutation_p.I2444S|MYO9A_ENST00000564571.1_Missense_Mutation_p.I2373S|MYO9A_ENST00000444904.1_Missense_Mutation_p.I2354S	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	2373	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AGCAGTCCCAATGGAGGCCTC	0.443																																					p.I2373S												.	.	0			c.T7118G	15						.						104.0	102.0	103.0					15																	72120290		2199	4297	6496	69907344	SO:0001583	missense	4649	exon41			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.7118T>G	15.37:g.72120290A>C	ENSP00000348349:p.Ile2373Ser	Somatic		Capture	SOLID	Phase_I	69907344	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	A	32	5.182894	0.94885	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.85702	-2.0;-2.02;-1.99	5.84	5.84	0.93424	.	.	.	.	.	D	0.82843	0.5125	M	0.63428	1.95	0.48696	D	0.999692	P;P	0.48764	0.915;0.879	B;P	0.44394	0.374;0.448	T	0.81571	-0.0872	9	0.02654	T	1	.	16.215	0.82206	1.0:0.0:0.0:0.0	.	2373;2137	B2RTY4;B2RTY4-5	MYO9A_HUMAN;.	S	2373;2444;2354	ENSP00000348349:I2373S;ENSP00000399162:I2444S;ENSP00000398250:I2354S	ENSP00000348349:I2373S	I	-	2	0	MYO9A	69907344	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	8.887000	0.92456	2.239000	0.73571	0.533000	0.62120	ATT		MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
BOD1L1	259282	hgsc.bcm.edu	37	4	13571652	13571652	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr4:13571652T>C	ENST00000040738.5	-	26	9274	c.9139A>G	c.(9139-9141)Aaa>Gaa	p.K3047E		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	3047						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K3047E(1)									TTCGCTTTTTTCACAGGGGCT	0.542																																					p.K3047E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A9139G	4						.						149.0	126.0	134.0					4																	13571652		2203	4300	6503	13180750	SO:0001583	missense	259282	exon26			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.9139A>G	4.37:g.13571652T>C	ENSP00000040738:p.Lys3047Glu	Somatic		Capture	SOLID	Phase_I	13180750	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.28|19.28	3.797535|3.797535	0.70567|0.70567	.|.	.|.	ENSG00000038219|ENSG00000038219	ENST00000040738|ENST00000507943	T|.	0.15952|.	2.38|.	4.85|4.85	4.85|4.85	0.62838|0.62838	.|.	0.000000|.	0.56097|.	D|.	0.000024|.	T|.	0.55909|.	0.1950|.	L|L	0.36672|0.36672	1.1|1.1	0.38515|0.38515	D|D	0.948587|0.948587	D|.	0.76494|.	0.999|.	D|.	0.80764|.	0.994|.	T|.	0.57081|.	-0.7872|.	10|.	0.48119|.	T|.	0.1|.	-10.7681|-10.7681	13.2871|13.2871	0.60249|0.60249	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	3047|.	Q8NFC6|.	BOD1L_HUMAN|.	E|W	3047|202	ENSP00000040738:K3047E|.	ENSP00000040738:K3047E|.	K|X	-|-	1|3	0|0	BOD1L|BOD1L	13180750|13180750	1.000000|1.000000	0.71417|0.71417	0.925000|0.925000	0.36789|0.36789	0.923000|0.923000	0.55619|0.55619	4.849000|4.849000	0.62882|0.62882	1.930000|1.930000	0.55929|0.55929	0.533000|0.533000	0.62120|0.62120	AAA|TGA		BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
SMARCA5	8467	hgsc.bcm.edu	37	4	144464729	144464729	+	Silent	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr4:144464729A>T	ENST00000283131.3	+	15	2433	c.1971A>T	c.(1969-1971)ggA>ggT	p.G657G		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	657					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					TTAGACATGGAGCAACACATG	0.358																																					p.G657G												.	.	0			c.A1971T	4						.						94.0	92.0	92.0					4																	144464729		2203	4300	6503	144684179	SO:0001819	synonymous_variant	8467	exon15			AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.1971A>T	4.37:g.144464729A>T		Somatic		Capture	SOLID	Phase_I	144684179	NM_003601		Silent	SNP	ENST00000283131.3	37	CCDS3761.1																																																																																				SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365077.3		
DCHS2	54798	hgsc.bcm.edu	37	4	155241787	155241787	+	Silent	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr4:155241787T>A	ENST00000357232.4	-	14	3398	c.3399A>T	c.(3397-3399)acA>acT	p.T1133T		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1133	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GATCAGATGCTGTTACTGTCA	0.463																																					p.T1133T												.	.	0			c.A3399T	4						.						239.0	241.0	240.0					4																	155241787		2203	4300	6503	155461237	SO:0001819	synonymous_variant	54798	exon14			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.3399A>T	4.37:g.155241787T>A		Somatic		Capture	SOLID	Phase_I	155461237	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	37	CCDS3785.1																																																																																				DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
TRAPPC11	60684	hgsc.bcm.edu	37	4	184589190	184589190	+	Silent	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr4:184589190T>A	ENST00000334690.6	+	5	682	c.480T>A	c.(478-480)gcT>gcA	p.A160A	TRAPPC11_ENST00000357207.4_Silent_p.A160A|TRAPPC11_ENST00000511409.1_3'UTR	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	160					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)											GGGCTGCAGCTTTATGCAATG	0.373																																					p.A160A												.	.	0			c.T480A	4						.						145.0	145.0	145.0					4																	184589190		2203	4300	6503	184826184	SO:0001819	synonymous_variant	60684	exon5				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.480T>A	4.37:g.184589190T>A		Somatic		Capture	SOLID	Phase_I	184826184	NM_199053	A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Silent	SNP	ENST00000334690.6	37	CCDS34112.1																																																																																				TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361654.2	NM_021942	
STK32B	55351	hgsc.bcm.edu	37	4	5461853	5461853	+	Silent	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr4:5461853C>T	ENST00000282908.5	+	9	1229	c.807C>T	c.(805-807)agC>agT	p.S269S	STK32B_ENST00000510398.1_Silent_p.S222S|STK32B_ENST00000512636.1_Silent_p.S192S|RN7SKP275_ENST00000364626.1_RNA|STK32B_ENST00000508728.1_3'UTR	NM_018401.1	NP_060871.1			serine/threonine kinase 32B									p.S269S(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						ATCCTGAGAGCCGCGTGTCCA	0.567											OREG0016061	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S269S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C807T	4						.						104.0	89.0	94.0					4																	5461853		2203	4300	6503	5512754	SO:0001819	synonymous_variant	55351	exon9			AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.807C>T	4.37:g.5461853C>T		Somatic	626	Capture	SOLID	Phase_I	5512754	NM_018401		Silent	SNP	ENST00000282908.5	37	CCDS3380.1																																																																																				STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206854.4	NM_018401	
GABRA4	2557	hgsc.bcm.edu	37	4	46995406	46995406	+	Silent	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr4:46995406C>T	ENST00000264318.3	-	1	1018	c.36G>A	c.(34-36)ctG>ctA	p.L12L	GABRA4_ENST00000509316.1_5'UTR	NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	12					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	CCCCGGCGGACAGAGCGATCG	0.582																																					p.L12L	Ovarian(6;283 369 8234 12290 33402)											.	.	0			c.G36A	4						.						112.0	105.0	108.0					4																	46995406		2203	4300	6503	46690163	SO:0001819	synonymous_variant	2557	exon1				CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.36G>A	4.37:g.46995406C>T		Somatic		Capture	SOLID	Phase_I	46690163	NM_000809	Q8IYR7	Silent	SNP	ENST00000264318.3	37	CCDS3473.1																																																																																				GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1		
GABRB1	2560	hgsc.bcm.edu	37	4	47427754	47427754	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr4:47427754G>T	ENST00000295454.3	+	9	1436	c.1144G>T	c.(1144-1146)Gaa>Taa	p.E382*	GABRB1_ENST00000538619.1_Nonsense_Mutation_p.E312*	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	382					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)	p.E382*(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GAGTGGCTCGGAAGTGCTCAC	0.597																																					p.E382X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1144T	4						.						60.0	63.0	62.0					4																	47427754		2203	4300	6503	47122511	SO:0001587	stop_gained	2560	exon9				CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.1144G>T	4.37:g.47427754G>T	ENSP00000295454:p.Glu382*	Somatic		Capture	SOLID	Phase_I	47122511	NM_000812	B2R6U7|D6REL3|Q16166|Q8TBK3	Nonsense_Mutation	SNP	ENST00000295454.3	37	CCDS3474.1	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079144	0.55753	.	.	ENSG00000163288	ENST00000295454;ENST00000538619	.	.	.	5.48	5.48	0.80851	.	0.620399	0.12536	U	0.460375	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-16.9454	13.7801	0.63077	0.0727:0.0:0.9273:0.0	.	.	.	.	X	382;312	.	ENSP00000295454:E382X	E	+	1	0	GABRB1	47122511	1.000000	0.71417	0.812000	0.32479	0.019000	0.09904	4.421000	0.59848	2.861000	0.98227	0.650000	0.86243	GAA		GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216896.1		
ATP10D	57205	hgsc.bcm.edu	37	4	47565714	47565714	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr4:47565714A>G	ENST00000273859.3	+	15	3054	c.2785A>G	c.(2785-2787)Aac>Gac	p.N929D		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	929					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						GACAGCTGTCAACATAGCTTA	0.453																																					p.N929D												.	.	0			c.A2785G	4						.						107.0	93.0	98.0					4																	47565714		2203	4300	6503	47260471	SO:0001583	missense	57205	exon15			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.2785A>G	4.37:g.47565714A>G	ENSP00000273859:p.Asn929Asp	Somatic		Capture	SOLID	Phase_I	47260471	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.798724	0.90538	.	.	ENSG00000145246	ENST00000273859	D	0.93247	-3.19	5.21	5.21	0.72293	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.97813	0.9282	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.99053	1.0828	10	0.87932	D	0	-24.6322	14.4173	0.67158	1.0:0.0:0.0:0.0	.	929	Q9P241	AT10D_HUMAN	D	929	ENSP00000273859:N929D	ENSP00000273859:N929D	N	+	1	0	ATP10D	47260471	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.139000	0.94554	2.190000	0.69967	0.477000	0.44152	AAC		ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
WDFY3	23001	hgsc.bcm.edu	37	4	85694062	85694062	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr4:85694062G>A	ENST00000295888.4	-	30	5182	c.4775C>T	c.(4774-4776)tCt>tTt	p.S1592F	WDFY3_ENST00000322366.6_Missense_Mutation_p.S1592F	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1592					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TGGCAAAGTAGAAGAAATAAA	0.328																																					p.S1592F												.	.	0			c.C4775T	4						.						57.0	56.0	56.0					4																	85694062		2202	4300	6502	85913086	SO:0001583	missense	23001	exon30			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.4775C>T	4.37:g.85694062G>A	ENSP00000295888:p.Ser1592Phe	Somatic		Capture	SOLID	Phase_I	85913086	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	G	19.65	3.867174	0.72065	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.65549	-0.16;-0.16	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.52661	0.1748	L	0.43152	1.355	0.80722	D	1	B	0.30889	0.299	B	0.22152	0.038	T	0.51236	-0.8731	10	0.11485	T	0.65	.	19.2304	0.93836	0.0:0.0:1.0:0.0	.	1592	Q8IZQ1	WDFY3_HUMAN	F	1592	ENSP00000318466:S1592F;ENSP00000295888:S1592F	ENSP00000295888:S1592F	S	-	2	0	WDFY3	85913086	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.611000	0.98342	2.540000	0.85666	0.655000	0.94253	TCT		WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
PPM1K	152926	hgsc.bcm.edu	37	4	89183858	89183858	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr4:89183858C>A	ENST00000608933.1	-	7	1397	c.1008G>T	c.(1006-1008)gaG>gaT	p.E336D	PPM1K_ENST00000295908.7_Missense_Mutation_p.E291D|PPM1K_ENST00000508256.1_Missense_Mutation_p.E117D	NM_152542.4	NP_689755.3	Q8N3J5	PPM1K_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1K	336	PP2C-like.				protein dephosphorylation (GO:0006470)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	13		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000192)		TACTGTTATCCTCAGTACCGT	0.428																																					p.E336D												.	.	0			c.G1008T	4						.						94.0	87.0	89.0					4																	89183858		2203	4300	6503	89402882	SO:0001583	missense	152926	exon7			BC037552	CCDS3629.1	4q22.1	2012-04-17	2010-03-05		ENSG00000163644	ENSG00000163644	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	25415	protein-coding gene	gene with protein product	"""PP2C-type mitochondrial phosphoprotein phosphatase"", ""protein phosphatase 2C kappa"", ""branched-chain &#945;-ketoacid dehydrogenase phosphatase"""	611065	"""protein phosphatase 1K (PP2C domain containing)"""			22291014	Standard	NM_152542		Approved	DKFZp761G058, PP2Ckappa, hPTMP, PP2Cm, BDP	uc003hrm.5	Q8N3J5	OTTHUMG00000130952	ENST00000608933.1:c.1008G>T	4.37:g.89183858C>A	ENSP00000477341:p.Glu336Asp	Somatic		Capture	SOLID	Phase_I	89402882	NM_152542	B2RAZ1|Q05CT5|Q49AB5|Q4W5E6|Q56AN8|Q8IUZ7|Q8IXG7|Q8ND70|Q96NT4	Missense_Mutation	SNP	ENST00000608933.1	37	CCDS3629.1	.	.	.	.	.	.	.	.	.	.	C	6.051	0.377822	0.11466	.	.	ENSG00000163644	ENST00000295908	T	0.19105	2.17	4.09	-3.25	0.05079	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.09642	0.0237	N	0.16201	0.385	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.16837	-1.0389	10	0.27785	T	0.31	-25.1534	10.006	0.41957	0.0:0.4485:0.0:0.5515	.	336	Q8N3J5	PPM1K_HUMAN	D	336	ENSP00000295908:E336D	ENSP00000295908:E336D	E	-	3	2	PPM1K	89402882	1.000000	0.71417	0.811000	0.32455	0.049000	0.14656	1.292000	0.33342	-0.475000	0.06852	-1.223000	0.01593	GAG		PPM1K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253553.4	NM_152542	
HERC3	8916	hgsc.bcm.edu	37	4	89599143	89599143	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr4:89599143A>T	ENST00000402738.1	+	19	2293	c.2054A>T	c.(2053-2055)aAt>aTt	p.N685I	HERC3_ENST00000264345.3_Missense_Mutation_p.N685I|HERC3_ENST00000543130.1_Missense_Mutation_p.N129I	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	685					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.N685I(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		AACCTGCAGAATGTCTTCATG	0.537																																					p.N685I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2054T	4						.						105.0	99.0	101.0					4																	89599143		2203	4300	6503	89818166	SO:0001583	missense	8916	exon19			D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.2054A>T	4.37:g.89599143A>T	ENSP00000385684:p.Asn685Ile	Somatic		Capture	SOLID	Phase_I	89818166	NM_014606	A8K1S5|Q8IXX3	Missense_Mutation	SNP	ENST00000402738.1	37	CCDS34028.1	.	.	.	.	.	.	.	.	.	.	A	18.65	3.668983	0.67814	.	.	ENSG00000138641	ENST00000402738;ENST00000264345;ENST00000543130;ENST00000512194	T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02	5.35	5.35	0.76521	HECT (1);	0.000000	0.85682	D	0.000000	D	0.85779	0.5776	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.84597	0.0670	10	0.34782	T	0.22	.	15.5138	0.75806	1.0:0.0:0.0:0.0	.	685	Q15034	HERC3_HUMAN	I	685;685;129;78	ENSP00000385684:N685I;ENSP00000264345:N685I;ENSP00000441703:N129I;ENSP00000421021:N78I	ENSP00000264345:N685I	N	+	2	0	HERC3	89818166	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.709000	0.91379	2.250000	0.74265	0.454000	0.30748	AAT		HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318081.2	NM_014606	
SNX25	83891	hgsc.bcm.edu	37	4	186253782	186253782	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr4:186253782G>C	ENST00000504273.1	+	10	1585	c.1291G>C	c.(1291-1293)Gat>Cat	p.D431H	SNX25_ENST00000512853.1_3'UTR|SNX25_ENST00000264694.8_Missense_Mutation_p.D431H			Q9H3E2	SNX25_HUMAN	sorting nexin 25	431					negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		GGAAGCCGTGGATGATGGTAC	0.403																																					p.D431H												.	.	0			c.G1291C	4						.						71.0	67.0	68.0					4																	186253782		2203	4300	6503	186490776	SO:0001583	missense	83891	exon10			AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.1291G>C	4.37:g.186253782G>C	ENSP00000426255:p.Asp431His	Somatic		Capture	SOLID	Phase_I	186490776	NM_031953	Q3ZT30|Q8N6K3	Missense_Mutation	SNP	ENST00000504273.1	37	CCDS34116.1	.	.	.	.	.	.	.	.	.	.	.	20.7	4.037713	0.75617	.	.	ENSG00000109762	ENST00000504273;ENST00000264694	T;T	0.11604	2.76;2.76	5.71	4.86	0.63082	.	1.434260	0.03575	N	0.229245	T	0.27241	0.0668	L	0.59436	1.845	0.47862	D	0.999532	B;D	0.53151	0.303;0.958	B;P	0.50791	0.137;0.65	T	0.00742	-1.1585	10	0.54805	T	0.06	-12.0959	16.0523	0.80772	0.0:0.0:0.8648:0.1352	.	202;431	Q8N6K3;Q9H3E2	.;SNX25_HUMAN	H	431	ENSP00000426255:D431H;ENSP00000264694:D431H	ENSP00000264694:D431H	D	+	1	0	SNX25	186490776	1.000000	0.71417	0.037000	0.18230	0.003000	0.03518	6.970000	0.76099	1.406000	0.46857	0.579000	0.79373	GAT		SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1	NM_031953	
MID1	4281	hgsc.bcm.edu	37	X	10535192	10535192	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chrX:10535192C>G	ENST00000317552.4	-	2	796	c.396G>C	c.(394-396)aaG>aaC	p.K132N	MID1_ENST00000380779.1_Missense_Mutation_p.K132N|MID1_ENST00000380780.1_Missense_Mutation_p.K132N|MID1_ENST00000453318.2_Missense_Mutation_p.K132N|MID1_ENST00000380785.1_Missense_Mutation_p.K132N|MID1_ENST00000380787.1_Missense_Mutation_p.K132N|MID1_ENST00000380782.2_Missense_Mutation_p.K132N	NM_000381.3|NM_033289.1	NP_000372.1|NP_150631.1	O15344	TRI18_HUMAN	midline 1	132					microtubule cytoskeleton organization (GO:0000226)|negative regulation of microtubule depolymerization (GO:0007026)|pattern specification process (GO:0007389)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein localization to microtubule (GO:0035372)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K132N(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	26						TGACACAGGTCTTCACAGCGT	0.557																																					p.K132N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G396C	X						.						83.0	64.0	70.0					X																	10535192		2203	4300	6503	10495192	SO:0001583	missense	4281	exon2			Y13667	CCDS14138.1, CCDS75952.1, CCDS75953.1	Xp22	2014-06-18	2014-06-18		ENSG00000101871	ENSG00000101871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7095	protein-coding gene	gene with protein product	"""Opitz/BBB syndrome"""	300552				9354791, 9425238	Standard	NM_001098624		Approved	OS, FXY, TRIM18, RNF59	uc004cti.4	O15344	OTTHUMG00000021127	ENST00000317552.4:c.396G>C	X.37:g.10535192C>G	ENSP00000312678:p.Lys132Asn	Somatic		Capture	SOLID	Phase_I	10495192	NM_001193277	B2RCG2|O75361|Q9BZX5	Missense_Mutation	SNP	ENST00000317552.4	37	CCDS14138.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.027254	0.54683	.	.	ENSG00000101871	ENST00000453318;ENST00000317552;ENST00000380785;ENST00000380779;ENST00000380787;ENST00000380780;ENST00000380782;ENST00000454373;ENST00000413894;ENST00000423614	D;D;D;D;D;D;D;D;D	0.89939	-2.59;-2.59;-2.59;-2.59;-2.59;-2.59;-2.59;-2.59;-2.59	5.64	-0.946	0.10385	Zinc finger, B-box (1);	0.000000	0.85682	D	0.000000	D	0.95274	0.8467	H	0.95539	3.685	0.54753	D	0.999985	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.992;0.993;1.0;0.999;0.998;0.997	D	0.94608	0.7802	10	0.66056	D	0.02	.	13.0882	0.59153	0.0:0.4511:0.0:0.5489	.	132;132;132;132;132;132	C9JZJ7;B7Z5K6;C9J453;O15344-2;A8K5A0;O15344	.;.;.;.;.;TRI18_HUMAN	N	132;132;132;132;132;132;132;120;132;132	ENSP00000414521:K132N;ENSP00000312678:K132N;ENSP00000370162:K132N;ENSP00000370156:K132N;ENSP00000370164:K132N;ENSP00000370157:K132N;ENSP00000370159:K132N;ENSP00000391154:K132N;ENSP00000387771:K132N	ENSP00000312678:K132N	K	-	3	2	MID1	10495192	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	1.290000	0.33319	-0.255000	0.09486	-0.192000	0.12808	AAG		MID1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055738.1		
COL4A6	1288	hgsc.bcm.edu	37	X	107408627	107408627	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chrX:107408627C>A	ENST00000372216.4	-	38	3884	c.3784G>T	c.(3784-3786)Ggg>Tgg	p.G1262W	COL4A6_ENST00000545689.1_Missense_Mutation_p.G1237W|COL4A6_ENST00000334504.7_Missense_Mutation_p.G1261W|COL4A6_ENST00000538570.1_Missense_Mutation_p.G1237W|COL4A6_ENST00000394872.2_Missense_Mutation_p.G1262W	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1262	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.G1261W(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CCTGGTCGCCCGGGGTCACCA	0.572									Alport syndrome with Diffuse Leiomyomatosis																												p.G1261W	Melanoma(87;1895 1945 2589 7165)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3781T	X						.						106.0	97.0	100.0					X																	107408627		2203	4300	6503	107295283	SO:0001583	missense	1288	exon38	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.3784G>T	X.37:g.107408627C>A	ENSP00000361290:p.Gly1262Trp	Somatic		Capture	SOLID	Phase_I	107295283	NM_033641	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	C	15.75	2.924453	0.52653	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.99369	-5.78;-5.78;-5.78;-5.78;-5.78	4.32	4.32	0.51571	.	0.000000	0.39909	N	0.001222	D	0.99701	0.9886	H	0.98918	4.37	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96961	0.9701	10	0.87932	D	0	.	16.8852	0.86074	0.0:1.0:0.0:0.0	.	1237;1237;1262;1261	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	W	1262;1261;1262;1261;1237;1237	ENSP00000361290:G1262W;ENSP00000334733:G1261W;ENSP00000378340:G1262W;ENSP00000443707:G1237W;ENSP00000445236:G1237W	ENSP00000334733:G1261W	G	-	1	0	COL4A6	107295283	1.000000	0.71417	0.834000	0.33040	0.919000	0.55068	6.539000	0.73856	2.100000	0.63781	0.529000	0.55759	GGG		COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
RGAG1	57529	hgsc.bcm.edu	37	X	109695869	109695869	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chrX:109695869C>T	ENST00000465301.2	+	3	2270	c.2024C>T	c.(2023-2025)gCt>gTt	p.A675V	RGAG1_ENST00000540313.1_Missense_Mutation_p.A675V	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	675								p.A675V(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						AGAGACACAGCTTCTGGAGCA	0.512																																					p.A675V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2024T	X						.						110.0	92.0	98.0					X																	109695869		2203	4300	6503	109582525	SO:0001583	missense	57529	exon3			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.2024C>T	X.37:g.109695869C>T	ENSP00000419786:p.Ala675Val	Somatic		Capture	SOLID	Phase_I	109582525	NM_020769	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	C	4.010	-0.000869	0.07819	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.51325	0.71;0.71	4.35	0.143	0.14820	.	0.487741	0.15384	N	0.265145	T	0.41119	0.1145	L	0.46157	1.445	0.28167	N	0.928727	P	0.40731	0.728	P	0.44359	0.447	T	0.29488	-1.0010	9	.	.	.	-0.334	7.3824	0.26864	0.425:0.3863:0.1887:0.0	.	675	Q8NET4	RGAG1_HUMAN	V	675	ENSP00000419786:A675V;ENSP00000441452:A675V	.	A	+	2	0	RGAG1	109582525	0.010000	0.17322	0.188000	0.23233	0.025000	0.11179	-0.725000	0.04942	-0.119000	0.11830	-1.117000	0.02048	GCT		RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
CHRDL1	91851	hgsc.bcm.edu	37	X	109922610	109922610	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chrX:109922610C>G	ENST00000372045.1	-	11	1307	c.1176G>C	c.(1174-1176)atG>atC	p.M392I	CHRDL1_ENST00000444321.2_Missense_Mutation_p.M399I|CHRDL1_ENST00000372042.1_Missense_Mutation_p.M400I|CHRDL1_ENST00000218054.4_Missense_Mutation_p.M398I|CHRDL1_ENST00000394797.4_Missense_Mutation_p.M398I|CHRDL1_ENST00000482160.1_Missense_Mutation_p.M320I|CHRDL1_ENST00000434224.1_Missense_Mutation_p.M319I			Q9BU40	CRDL1_HUMAN	chordin-like 1	392					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|compound eye development (GO:0048749)|eye development (GO:0001654)|negative regulation of BMP signaling pathway (GO:0030514)|nervous system development (GO:0007399)|ossification (GO:0001503)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(12)|liver(1)|lung(15)|prostate(1)|skin(1)	31						GCTCCTCAAACATCCTCTTGG	0.448																																					p.M400I												.	.	0			c.G1200C	X						.						167.0	131.0	143.0					X																	109922610		2203	4300	6503	109809266	SO:0001583	missense	91851	exon11			AL049176	CCDS14553.1, CCDS48148.1, CCDS48149.1, CCDS48150.1, CCDS48148.2	Xq23	2014-01-31			ENSG00000101938	ENSG00000101938			29861	protein-coding gene	gene with protein product		300350	"""megalocornea 1 (X-linked)"""	MGC1		11441185, 11118896, 22284829	Standard	NM_001143981		Approved	NRLN1, CHL	uc004eow.3	Q9BU40	OTTHUMG00000022199	ENST00000372045.1:c.1176G>C	X.37:g.109922610C>G	ENSP00000361115:p.Met392Ile	Somatic		Capture	SOLID	Phase_I	109809266	NM_001143981	B1AKD0|B4DMP3|D3DUY6|E9PGS5|Q539E4|Q9Y3H7	Missense_Mutation	SNP	ENST00000372045.1	37		.	.	.	.	.	.	.	.	.	.	C	14.27	2.485865	0.44147	.	.	ENSG00000101938	ENST00000372045;ENST00000434224;ENST00000218054;ENST00000394797;ENST00000372042;ENST00000482160;ENST00000444321	T;T;T;T;T;T;T	0.29397	2.32;1.57;2.32;2.32;2.58;1.58;2.32	4.89	4.02	0.46733	.	0.240041	0.47852	D	0.000204	T	0.13114	0.0318	N	0.14661	0.345	0.32096	N	0.591222	B;B;B;B;B;B	0.31026	0.304;0.039;0.039;0.039;0.039;0.009	B;B;B;B;B;B	0.25614	0.062;0.016;0.016;0.016;0.016;0.003	T	0.07751	-1.0756	9	.	.	.	-11.1554	3.7707	0.08640	0.0:0.6279:0.0:0.3721	.	320;399;379;392;400;319	B4DMP3;E9PGS5;Q59FB2;Q9BU40;D3DUY6;D3YTA8	.;.;.;CRDL1_HUMAN;.;.	I	392;319;398;398;400;320;399	ENSP00000361115:M392I;ENSP00000389627:M319I;ENSP00000218054:M398I;ENSP00000378276:M398I;ENSP00000361112:M400I;ENSP00000418443:M320I;ENSP00000399739:M399I	.	M	-	3	0	CHRDL1	109809266	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.599000	0.46231	2.366000	0.80165	0.523000	0.50628	ATG		CHRDL1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057912.1	NM_145234	
PHKA2	5256	hgsc.bcm.edu	37	X	18926933	18926933	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chrX:18926933A>C	ENST00000379942.4	-	21	3011	c.2346T>G	c.(2344-2346)atT>atG	p.I782M		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	782					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.I782M(1)		NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TGACATAAAGAATGTACAGAA	0.423																																					p.I782M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2346G	X						.						212.0	180.0	191.0					X																	18926933		2203	4300	6503	18836854	SO:0001583	missense	5256	exon21				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.2346T>G	X.37:g.18926933A>C	ENSP00000369274:p.Ile782Met	Somatic		Capture	SOLID	Phase_I	18836854	NM_000292	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	ENST00000379942.4	37	CCDS14190.1	.	.	.	.	.	.	.	.	.	.	A	10.03	1.237606	0.22711	.	.	ENSG00000044446	ENST00000379942	D	0.91237	-2.81	5.55	1.84	0.25277	Glycoside hydrolase 15-related (1);	0.093807	0.64402	D	0.000001	T	0.82199	0.4985	L	0.41824	1.3	0.44908	D	0.99792	B	0.24721	0.11	B	0.25759	0.063	T	0.68477	-0.5398	10	0.24483	T	0.36	-11.0237	3.7445	0.08542	0.4119:0.0:0.4055:0.1826	.	782	P46019	KPB2_HUMAN	M	782	ENSP00000369274:I782M	ENSP00000369274:I782M	I	-	3	3	PHKA2	18836854	0.998000	0.40836	0.999000	0.59377	0.965000	0.64279	0.487000	0.22356	0.235000	0.21160	0.430000	0.28490	ATT		PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292	
DMD	1756	hgsc.bcm.edu	37	X	32361382	32361382	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chrX:32361382T>C	ENST00000357033.4	-	40	5814	c.5608A>G	c.(5608-5610)Aaa>Gaa	p.K1870E	DMD_ENST00000378677.2_Missense_Mutation_p.K1866E	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1870	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AGAGCCTTTTTTCTTCTTTGA	0.353																																					p.K529E												.	.	0			c.A1585G	X						.						103.0	92.0	96.0					X																	32361382		2202	4300	6502	32271303	SO:0001583	missense	1756	exon12			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5608A>G	X.37:g.32361382T>C	ENSP00000354923:p.Lys1870Glu	Somatic		Capture	SOLID	Phase_I	32271303	NM_004011	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	T	16.02	3.004467	0.54254	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000493412	T;T;T	0.55413	0.52;0.52;0.52	5.62	5.62	0.85841	.	0.000000	0.39407	U	0.001368	T	0.44912	0.1316	L	0.29908	0.895	0.80722	D	1	P;P;P;P;P	0.52316	0.952;0.919;0.919;0.948;0.948	P;B;B;B;B	0.45881	0.496;0.3;0.3;0.351;0.351	T	0.29243	-1.0018	10	0.16420	T	0.52	.	14.9893	0.71374	0.0:0.0:0.0:1.0	.	1862;1870;1866;529;526	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	E	1862;529;526;1866;1870;1870;1747;89	ENSP00000367948:K1866E;ENSP00000354923:K1870E;ENSP00000417725:K89E	ENSP00000354923:K1870E	K	-	1	0	DMD	32271303	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.896000	0.75665	1.990000	0.58119	0.481000	0.45027	AAA		DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
LAS1L	81887	hgsc.bcm.edu	37	X	64734797	64734797	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chrX:64734797G>A	ENST00000374811.3	-	13	2024	c.1984C>T	c.(1984-1986)Cca>Tca	p.P662S	LAS1L_ENST00000374807.5_Missense_Mutation_p.P645S|LAS1L_ENST00000374804.5_Missense_Mutation_p.P603S|LAS1L_ENST00000312391.8_3'UTR	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)	662					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						AGCTCTGCTGGGTCCTCGGTC	0.547																																					p.P662S												.	.	0			c.C1984T	X						.						121.0	81.0	94.0					X																	64734797		2203	4300	6503	64651522	SO:0001583	missense	81887	exon13			BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.1984C>T	X.37:g.64734797G>A	ENSP00000363944:p.Pro662Ser	Somatic		Capture	SOLID	Phase_I	64651522	NM_031206	A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	Missense_Mutation	SNP	ENST00000374811.3	37	CCDS14381.1	.	.	.	.	.	.	.	.	.	.	g	20.3	3.972290	0.74246	.	.	ENSG00000001497	ENST00000374807;ENST00000374811;ENST00000374804	.	.	.	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.77226	0.4099	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;0.994;0.996	T	0.80331	-0.1427	9	0.87932	D	0	.	13.6179	0.62120	0.0:0.0:1.0:0.0	.	603;645;662;175	Q9Y4W2-3;Q9Y4W2-2;Q9Y4W2;B3KNR6	.;.;LAS1L_HUMAN;.	S	645;662;603	.	ENSP00000363937:P603S	P	-	1	0	LAS1L	64651522	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.136000	0.71703	1.950000	0.56595	0.425000	0.28330	CCA		LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056974.1	NM_031206	
ZMYM3	9203	hgsc.bcm.edu	37	X	70469001	70469001	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chrX:70469001G>T	ENST00000353904.2	-	8	1676	c.1489C>A	c.(1489-1491)Cca>Aca	p.P497T	ZMYM3_ENST00000373998.1_Missense_Mutation_p.P497T|ZMYM3_ENST00000373984.3_Missense_Mutation_p.P499T|ZMYM3_ENST00000373988.1_Missense_Mutation_p.P499T|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000314425.5_Missense_Mutation_p.P497T	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	497					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.P497T(1)		breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					CAGACACATGGGTACACACGT	0.428																																					p.P497T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1489A	X						.						209.0	169.0	183.0					X																	70469001		2203	4300	6503	70385726	SO:0001583	missense	9203	exon8			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.1489C>A	X.37:g.70469001G>T	ENSP00000343909:p.Pro497Thr	Somatic		Capture	SOLID	Phase_I	70385726	NM_001171162	D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	ENST00000353904.2	37	CCDS14409.1	.	.	.	.	.	.	.	.	.	.	g	5.964	0.361868	0.11296	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988	T;T;T;T;T	0.45276	1.49;0.9;1.49;1.49;1.49	4.89	4.89	0.63831	Zinc finger, MYM-type (1);	0.000000	0.64402	D	0.000004	T	0.29321	0.0730	N	0.19112	0.55	0.37158	D	0.902485	B;B	0.15930	0.012;0.015	B;B	0.18561	0.013;0.022	T	0.17018	-1.0383	10	0.17369	T	0.5	-6.472	16.0962	0.81127	0.0:0.0:1.0:0.0	.	497;497	Q14202-2;Q14202	.;ZMYM3_HUMAN	T	497;497;497;499;499	ENSP00000322845:P497T;ENSP00000363110:P497T;ENSP00000343909:P497T;ENSP00000363096:P499T;ENSP00000363100:P499T	ENSP00000322845:P497T	P	-	1	0	ZMYM3	70385726	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.592000	0.74095	2.257000	0.74773	0.417000	0.27973	CCA		ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057154.1	NM_201599	
FAM46D	169966	hgsc.bcm.edu	37	X	79698083	79698083	+	Silent	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chrX:79698083A>C	ENST00000308293.5	+	3	284	c.45A>C	c.(43-45)atA>atC	p.I15I	FAM46D_ENST00000538312.1_Silent_p.I15I	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	15										kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						ATCAAGTTATAACACTGGATC	0.363																																					p.I15I												.	.	0			c.A45C	X						.						64.0	51.0	55.0					X																	79698083		2203	4299	6502	79584739	SO:0001819	synonymous_variant	169966	exon5			BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.45A>C	X.37:g.79698083A>C		Somatic		Capture	SOLID	Phase_I	79584739	NM_001170574	B2R9Q6|Q7Z3F6|Q8NHU1	Silent	SNP	ENST00000308293.5	37	CCDS14446.1																																																																																				FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057338.1	NM_152630	
TNMD	64102	hgsc.bcm.edu	37	X	99840038	99840038	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chrX:99840038A>C	ENST00000373031.4	+	1	240	c.23A>C	c.(22-24)aAt>aCt	p.N8T		NM_022144.2	NP_071427.2	Q9H2S6	TNMD_HUMAN	tenomodulin	8					cellular response to BMP stimulus (GO:0071773)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|tendon cell differentiation (GO:0035990)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.N8T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(7)|skin(1)	16						CCTCCAGAGAATTGTGAAGAC	0.408																																					p.N8T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A23C	X						.						113.0	96.0	102.0					X																	99840038		2203	4300	6503	99726694	SO:0001583	missense	64102	exon1			AF191770	CCDS14469.1	Xq21.33-q23	2012-10-10			ENSG00000000005	ENSG00000000005		"""BRICHOS domain containing"""	17757	protein-coding gene	gene with protein product	"""BRICHOS domain containing 4"""	300459					Standard	NM_022144		Approved	myodulin, ChM1L, tendin, TEM, BRICD4	uc004efy.4	Q9H2S6	OTTHUMG00000022001	ENST00000373031.4:c.23A>C	X.37:g.99840038A>C	ENSP00000362122:p.Asn8Thr	Somatic		Capture	SOLID	Phase_I	99726694	NM_022144	Q9HBX0|Q9UJG0	Missense_Mutation	SNP	ENST00000373031.4	37	CCDS14469.1	.	.	.	.	.	.	.	.	.	.	A	11.90	1.777950	0.31502	.	.	ENSG00000000005	ENST00000373031	T	0.31247	1.5	4.82	4.82	0.62117	.	0.139789	0.46758	D	0.000275	T	0.28366	0.0701	N	0.19112	0.55	0.31800	N	0.628524	P	0.51653	0.947	P	0.53490	0.727	T	0.17107	-1.0380	10	0.24483	T	0.36	-4.6386	10.0481	0.42199	1.0:0.0:0.0:0.0	.	8	Q9H2S6	TNMD_HUMAN	T	8	ENSP00000362122:N8T	ENSP00000362122:N8T	N	+	2	0	TNMD	99726694	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.720000	0.38022	1.709000	0.51313	0.430000	0.28490	AAT		TNMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057481.1	NM_022144	
AFF2	2334	hgsc.bcm.edu	37	X	147743667	147743667	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chrX:147743667C>G	ENST00000370460.2	+	3	898	c.419C>G	c.(418-420)tCt>tGt	p.S140C	AFF2_ENST00000370458.1_Missense_Mutation_p.S136C|AFF2_ENST00000370457.5_Missense_Mutation_p.S136C|AFF2_ENST00000342251.3_Missense_Mutation_p.S136C	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	140					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CCTCCACCTTCTGTTGTGATA	0.413																																					p.S140C												.	.	0			c.C419G	X						.						223.0	218.0	220.0					X																	147743667		2203	4300	6503	147551359	SO:0001583	missense	2334	exon3			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.419C>G	X.37:g.147743667C>G	ENSP00000359489:p.Ser140Cys	Somatic		Capture	SOLID	Phase_I	147551359	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.417435	0.62622	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.63	5.63	0.86233	.	0.116813	0.64402	D	0.000015	T	0.75133	0.3808	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0;0.999	D;D;D;D;D;D	0.85130	0.935;0.935;0.935;0.994;0.997;0.935	T	0.77983	-0.2382	10	0.72032	D	0.01	.	18.7174	0.91680	0.0:1.0:0.0:0.0	.	140;136;136;136;140;136	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	C	140;136;136;136	ENSP00000359489:S140C;ENSP00000359486:S136C;ENSP00000345459:S136C;ENSP00000359487:S136C	ENSP00000345459:S136C	S	+	2	0	AFF2	147551359	1.000000	0.71417	0.935000	0.37517	0.993000	0.82548	6.223000	0.72257	2.365000	0.80145	0.600000	0.82982	TCT		AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
GREB1	9687	hgsc.bcm.edu	37	2	11696755	11696755	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:11696755C>A	ENST00000381486.2	+	2	315	c.15C>A	c.(13-15)taC>taA	p.Y5*	GREB1_ENST00000234142.5_Nonsense_Mutation_p.Y5*|GREB1_ENST00000263834.5_Nonsense_Mutation_p.Y5*|GREB1_ENST00000381483.2_Nonsense_Mutation_p.Y5*|GREB1_ENST00000389825.3_Intron	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	5						integral component of membrane (GO:0016021)		p.Y5*(3)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GAAATTCTTACGCTGGACAGC	0.507																																					p.Y5X	Ovarian(39;850 945 2785 23371 33093)											.	.	3	Substitution - Nonsense(3)	large_intestine(3)	c.C15A	2						.						93.0	90.0	91.0					2																	11696755		2203	4300	6503	11614206	SO:0001587	stop_gained	9687	exon2				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.15C>A	2.37:g.11696755C>A	ENSP00000370896:p.Tyr5*	Somatic		Capture	SOLID	Phase_I	11614206	NM_148903	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Nonsense_Mutation	SNP	ENST00000381486.2	37	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	C	39	7.748944	0.98468	.	.	ENSG00000196208	ENST00000381486;ENST00000263834;ENST00000381483;ENST00000234142	.	.	.	4.71	2.85	0.33270	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.4314	8.347	0.32279	0.0:0.6312:0.0:0.3688	.	.	.	.	X	5	.	ENSP00000234142:Y5X	Y	+	3	2	GREB1	11614206	0.982000	0.34865	1.000000	0.80357	0.998000	0.95712	0.108000	0.15396	1.107000	0.41642	0.655000	0.94253	TAC		GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
C2orf40	84417	hgsc.bcm.edu	37	2	106690432	106690432	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:106690432G>C	ENST00000238044.3	+	3	327	c.218G>C	c.(217-219)tGg>tCg	p.W73S	C2orf40_ENST00000409944.1_Missense_Mutation_p.W37S|C2orf40_ENST00000489174.1_3'UTR	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	73					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				lung(7)|urinary_tract(1)	8						CGGCAGCTGTGGGACCGGACT	0.557																																					p.W73S												.	.	0			c.G218C	2						.						80.0	91.0	87.0					2																	106690432		2203	4300	6503	106056864	SO:0001583	missense	84417	exon3			BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.218G>C	2.37:g.106690432G>C	ENSP00000238044:p.Trp73Ser	Somatic		Capture	SOLID	Phase_I	106056864	NM_032411	D3DVK2	Missense_Mutation	SNP	ENST00000238044.3	37	CCDS2072.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.528395	0.85706	.	.	ENSG00000119147	ENST00000409944;ENST00000238044;ENST00000437659	T;T;T	0.61158	0.13;0.13;0.13	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.77718	0.4172	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79475	-0.1788	10	0.87932	D	0	-19.662	19.6614	0.95875	0.0:0.0:1.0:0.0	.	73	Q9H1Z8	AUGN_HUMAN	S	37;73;75	ENSP00000386421:W37S;ENSP00000238044:W73S;ENSP00000388664:W75S	ENSP00000238044:W73S	W	+	2	0	C2orf40	106056864	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.019000	0.88732	2.633000	0.89246	0.655000	0.94253	TGG		C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253515.2	NM_032411	
ERCC3	2071	hgsc.bcm.edu	37	2	128015201	128015201	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:128015201G>A	ENST00000285398.2	-	15	2414	c.2320C>T	c.(2320-2322)Cac>Tac	p.H774Y	ERCC3_ENST00000493187.2_Missense_Mutation_p.H710Y	NM_000122.1	NP_000113.1	P19447	ERCC3_HUMAN	excision repair cross-complementation group 3	774					7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|DNA topological change (GO:0006265)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA duplex unwinding (GO:0000717)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein localization (GO:0008104)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' DNA helicase activity (GO:0043138)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|damaged DNA binding (GO:0003684)|dATP binding (GO:0032564)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|peptide binding (GO:0042277)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	31	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		AAGAGCGGGTGTACATGTTTG	0.532			"""Mis, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.H774Y		yes	Rec		Xeroderma pigmentosum (B)	2	2q21	2071	"""excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)"""		E	.	.	0			c.C2320T	2						.						121.0	111.0	114.0					2																	128015201		2203	4300	6503	127731671	SO:0001583	missense	2071	exon15	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	M31899	CCDS2144.1	2q21	2014-09-17	2014-03-07		ENSG00000163161	ENSG00000163161		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	3435	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group B complementing"""	133510	"""excision repair cross-complementing rodent repair deficiency, complementation group 3"""			8202161	Standard	NM_000122		Approved	XPB, BTF2, RAD25, TFIIH, GTF2H	uc002toh.1	P19447	OTTHUMG00000131530	ENST00000285398.2:c.2320C>T	2.37:g.128015201G>A	ENSP00000285398:p.His774Tyr	Somatic		Capture	SOLID	Phase_I	127731671	NM_000122	Q53QM0	Missense_Mutation	SNP	ENST00000285398.2	37	CCDS2144.1	.	.	.	.	.	.	.	.	.	.	G	19.15	3.771179	0.69992	.	.	ENSG00000163161	ENST00000285398;ENST00000493187	T;T	0.68331	-0.32;-0.28	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.84808	0.5554	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.87128	0.2195	10	0.87932	D	0	-26.2009	19.0691	0.93125	0.0:0.0:1.0:0.0	.	774	P19447	ERCC3_HUMAN	Y	774;710	ENSP00000285398:H774Y;ENSP00000444796:H710Y	ENSP00000285398:H774Y	H	-	1	0	ERCC3	127731671	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	9.258000	0.95555	2.593000	0.87608	0.455000	0.32223	CAC		ERCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331028.1	NM_000122	
TPO	7173	hgsc.bcm.edu	37	2	1507737	1507737	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:1507737G>C	ENST00000345913.4	+	14	2495	c.2404G>C	c.(2404-2406)Gac>Cac	p.D802H	TPO_ENST00000349624.3_Missense_Mutation_p.D629H|TPO_ENST00000346956.3_Intron|TPO_ENST00000329066.4_Missense_Mutation_p.D802H|TPO_ENST00000497517.2_3'UTR|TPO_ENST00000382201.3_Missense_Mutation_p.D745H|TPO_ENST00000337415.3_Missense_Mutation_p.D802H|TPO_ENST00000382198.1_Missense_Mutation_p.D629H	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	802	EGF-like; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.D802H(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CGAGTGTGCAGACGGTGCCCA	0.647																																					p.D745H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2233C	2						.						65.0	62.0	63.0					2																	1507737		2203	4300	6503	1486744	SO:0001583	missense	7173	exon13				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2404G>C	2.37:g.1507737G>C	ENSP00000318820:p.Asp802His	Somatic		Capture	SOLID	Phase_I	1486744	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.54|10.54	1.378381|1.378381	0.24944|0.24944	.|.	.|.	ENSG00000115705|ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000425083|ENST00000446278	D;D;D;D;D;D;D|.	0.92446|.	-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04|.	4.53|4.53	3.62|3.62	0.41486|0.41486	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);|.	2.229260|.	0.02206|.	N|.	0.062686|.	T|T	0.55210|0.55210	0.1906|0.1906	L|L	0.49350|0.49350	1.555|1.555	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.999;0.995;0.996|.	D;D;D|.	0.72075|.	0.976;0.938;0.963|.	T|T	0.49698|0.49698	-0.8912|-0.8912	10|5	0.59425|.	D|.	0.04|.	-30.1672|-30.1672	6.6289|6.6289	0.22845|0.22845	0.1345:0.1736:0.692:0.0|0.1345:0.1736:0.692:0.0	.|.	629;745;802|.	P07202-5;P07202-2;P07202|.	.;.;PERT_HUMAN|.	H|H	802;802;629;802;745;629;23|276	ENSP00000337263:D802H;ENSP00000318820:D802H;ENSP00000332044:D629H;ENSP00000329869:D802H;ENSP00000371636:D745H;ENSP00000371633:D629H;ENSP00000389659:D23H|.	ENSP00000329869:D802H|.	D|Q	+|+	1|3	0|2	TPO|TPO	1486744|1486744	0.998000|0.998000	0.40836|0.40836	0.010000|0.010000	0.14722|0.14722	0.018000|0.018000	0.09664|0.09664	1.963000|1.963000	0.40452|0.40452	0.847000|0.847000	0.35167|0.35167	0.453000|0.453000	0.30009|0.30009	GAC|CAG		TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
MAP3K19	80122	hgsc.bcm.edu	37	2	135738955	135738955	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:135738955T>G	ENST00000375845.3	-	9	3386	c.3356A>C	c.(3355-3357)aAa>aCa	p.K1119T	MAP3K19_ENST00000375844.3_Missense_Mutation_p.K301T|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000392918.3_Missense_Mutation_p.K253T|MAP3K19_ENST00000392915.1_3'UTR|MAP3K19_ENST00000392917.3_Missense_Mutation_p.K251T|MAP3K19_ENST00000358371.4_Missense_Mutation_p.K1006T	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	1119	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										GTTGACATGTTTCAGTGCTTT	0.403																																					p.K1119T												.	.	0			c.A3356C	2						.						157.0	140.0	146.0					2																	135738955		2203	4300	6503	135455425	SO:0001583	missense	80122	exon9			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.3356A>C	2.37:g.135738955T>G	ENSP00000365005:p.Lys1119Thr	Somatic		Capture	SOLID	Phase_I	135455425	NM_025052	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	ENST00000375845.3	37	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	T	13.11	2.139825	0.37728	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000437365	T;T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77;1.77	5.88	5.88	0.94601	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.49916	D	0.000135	T	0.46308	0.1386	L	0.51422	1.61	0.80722	D	1	D;D;D;D;D	0.89917	0.993;1.0;0.999;0.999;1.0	P;D;D;D;D	0.81914	0.877;0.987;0.945;0.945;0.995	T	0.40384	-0.9566	10	0.72032	D	0.01	.	15.482	0.75534	0.0:0.0:0.0:1.0	.	251;1006;253;301;1119	B7ZMH9;Q56UN5-3;Q56UN5-4;Q56UN5-5;Q56UN5	.;.;.;.;YSK4_HUMAN	T	1119;1006;301;253;251;509	ENSP00000365005:K1119T;ENSP00000351140:K1006T;ENSP00000365004:K301T;ENSP00000376650:K253T;ENSP00000376649:K251T;ENSP00000392827:K509T	ENSP00000351140:K1006T	K	-	2	0	YSK4	135455425	1.000000	0.71417	1.000000	0.80357	0.023000	0.10783	3.969000	0.56816	2.246000	0.74042	0.533000	0.62120	AAA		MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	
NR4A2	4929	hgsc.bcm.edu	37	2	157184454	157184454	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:157184454G>T	ENST00000339562.4	-	5	1429	c.1067C>A	c.(1066-1068)tCt>tAt	p.S356Y	NR4A2_ENST00000409572.1_Missense_Mutation_p.S356Y|NR4A2_ENST00000429376.1_Missense_Mutation_p.S293Y|NR4A2_ENST00000539077.1_Missense_Mutation_p.S367Y|NR4A2_ENST00000409108.2_Missense_Mutation_p.S356Y|NR4A2_ENST00000426264.1_Missense_Mutation_p.S293Y	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	356	Pro-rich.				adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						CGAAGGGGGAGAGGGCTCCTG	0.602																																					p.S356Y												.	.	0			c.C1067A	2						.						27.0	28.0	28.0					2																	157184454		2203	4298	6501	156892700	SO:0001583	missense	4929	exon5			X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.1067C>A	2.37:g.157184454G>T	ENSP00000344479:p.Ser356Tyr	Somatic		Capture	SOLID	Phase_I	156892700	NM_006186	Q16311|Q53RZ2|Q6NXU0	Missense_Mutation	SNP	ENST00000339562.4	37	CCDS2201.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.919645	0.92249	.	.	ENSG00000153234	ENST00000339562;ENST00000426264;ENST00000409572;ENST00000539077;ENST00000409108;ENST00000429376	T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56	6.17	6.17	0.99709	Nuclear hormone receptor, ligand-binding (2);	0.225086	0.49305	D	0.000158	T	0.62208	0.2409	M	0.62723	1.935	0.80722	D	1	P	0.44659	0.84	P	0.48454	0.578	T	0.54098	-0.8344	10	0.29301	T	0.29	.	20.4745	0.99168	0.0:0.0:1.0:0.0	.	356	P43354	NR4A2_HUMAN	Y	356;293;356;367;356;293	ENSP00000344479:S356Y;ENSP00000389986:S293Y;ENSP00000386747:S356Y;ENSP00000444925:S367Y;ENSP00000386993:S356Y;ENSP00000410952:S293Y	ENSP00000344479:S356Y	S	-	2	0	NR4A2	156892700	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	TCT		NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254909.2		
LRP2	4036	hgsc.bcm.edu	37	2	170044590	170044590	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:170044590G>T	ENST00000263816.3	-	49	9503	c.9218C>A	c.(9217-9219)cCc>cAc	p.P3073H		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3073	LDL-receptor class A 25. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TGGACACGTGGGTTCTGGGGT	0.517																																					p.P3073H												.	.	0			c.C9218A	2						.						162.0	135.0	144.0					2																	170044590		2203	4300	6503	169752836	SO:0001583	missense	4036	exon49				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.9218C>A	2.37:g.170044590G>T	ENSP00000263816:p.Pro3073His	Somatic		Capture	SOLID	Phase_I	169752836	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594767	0.28445	.	.	ENSG00000081479	ENST00000263816	D	0.95853	-3.83	5.68	4.8	0.61643	.	0.576149	0.19559	N	0.111364	D	0.95379	0.8500	L	0.48642	1.525	0.80722	D	1	D	0.71674	0.998	P	0.62813	0.907	D	0.92659	0.6140	10	0.14252	T	0.57	.	11.5734	0.50848	0.1431:0.0:0.8569:0.0	.	3073	P98164	LRP2_HUMAN	H	3073	ENSP00000263816:P3073H	ENSP00000263816:P3073H	P	-	2	0	LRP2	169752836	1.000000	0.71417	0.528000	0.27938	0.006000	0.05464	4.766000	0.62279	1.391000	0.46566	0.650000	0.86243	CCC		LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
LRP2	4036	hgsc.bcm.edu	37	2	170062047	170062047	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:170062047G>A	ENST00000263816.3	-	41	7942	c.7657C>T	c.(7657-7659)Ccc>Tcc	p.P2553S		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2553					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AGCCCACTGGGCATGACCAGA	0.512																																					p.P2553S												.	.	0			c.C7657T	2						.						120.0	111.0	114.0					2																	170062047		2203	4300	6503	169770293	SO:0001583	missense	4036	exon41				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.7657C>T	2.37:g.170062047G>A	ENSP00000263816:p.Pro2553Ser	Somatic		Capture	SOLID	Phase_I	169770293	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978734	0.74360	.	.	ENSG00000081479	ENST00000263816	D	0.99563	-6.17	5.9	5.9	0.94986	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.99832	0.9924	H	0.98178	4.165	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96978	0.9713	10	0.72032	D	0.01	.	20.2664	0.98460	0.0:0.0:1.0:0.0	.	2553	P98164	LRP2_HUMAN	S	2553	ENSP00000263816:P2553S	ENSP00000263816:P2553S	P	-	1	0	LRP2	169770293	1.000000	0.71417	1.000000	0.80357	0.113000	0.19764	9.869000	0.99810	2.786000	0.95864	0.561000	0.74099	CCC		LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
CALCRL	10203	hgsc.bcm.edu	37	2	188210997	188210997	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:188210997G>C	ENST00000409998.1	-	16	2081	c.1300C>G	c.(1300-1302)Cat>Gat	p.H434D	AC007319.1_ENST00000453517.1_RNA|AC007319.1_ENST00000412276.1_RNA|CALCRL_ENST00000410068.1_Missense_Mutation_p.H434D|CALCRL_ENST00000392370.3_Missense_Mutation_p.H434D			Q16602	CALRL_HUMAN	calcitonin receptor-like	434					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)			endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			GGACAGTCATGACTATAACCT	0.348																																					p.H434D												.	.	0			c.C1300G	2						.						132.0	122.0	125.0					2																	188210997		2203	4299	6502	187919242	SO:0001583	missense	10203	exon15			U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.1300C>G	2.37:g.188210997G>C	ENSP00000386972:p.His434Asp	Somatic		Capture	SOLID	Phase_I	187919242	NM_005795	A8K6G5|A8KAD3|Q53S02|Q53TS5	Missense_Mutation	SNP	ENST00000409998.1	37	CCDS2293.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.348257	0.24426	.	.	ENSG00000064989	ENST00000392370;ENST00000409998;ENST00000410068	T;T;T	0.71103	-0.54;-0.54;-0.54	5.7	3.71	0.42584	.	0.190507	0.35067	N	0.003468	T	0.66096	0.2755	L	0.59436	1.845	0.31190	N	0.701046	B	0.24092	0.097	B	0.29598	0.104	T	0.67015	-0.5777	10	0.36615	T	0.2	.	11.294	0.49267	0.0736:0.0:0.7908:0.1356	.	434	Q16602	CALRL_HUMAN	D	434	ENSP00000376177:H434D;ENSP00000386972:H434D;ENSP00000387190:H434D	ENSP00000376177:H434D	H	-	1	0	CALCRL	187919242	1.000000	0.71417	0.973000	0.42090	0.949000	0.60115	4.014000	0.57145	1.390000	0.46547	0.655000	0.94253	CAT		CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334648.1	NM_005795	
STAT1	6772	hgsc.bcm.edu	37	2	191872347	191872347	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:191872347A>G	ENST00000361099.3	-	5	701	c.314T>C	c.(313-315)aTt>aCt	p.I105T	STAT1_ENST00000392323.2_Missense_Mutation_p.I107T|STAT1_ENST00000392322.3_Missense_Mutation_p.I105T|STAT1_ENST00000540176.1_Missense_Mutation_p.I105T|STAT1_ENST00000409465.1_Missense_Mutation_p.I105T	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	105					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			ACAGCTGTAAATGATCATAGA	0.308																																					p.I105T												.	.	0			c.T314C	2						.						89.0	96.0	93.0					2																	191872347		2203	4299	6502	191580592	SO:0001583	missense	6772	exon5				CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.314T>C	2.37:g.191872347A>G	ENSP00000354394:p.Ile105Thr	Somatic		Capture	SOLID	Phase_I	191580592	NM_007315	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	ENST00000361099.3	37	CCDS2309.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.395028	0.83011	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000540176;ENST00000392322;ENST00000392323;ENST00000544783;ENST00000424722;ENST00000454414	T;T;T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3;0.3;0.3	5.73	5.73	0.89815	STAT transcription factor, protein interaction (4);	0.000000	0.85682	D	0.000000	T	0.79028	0.4377	M	0.85630	2.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.993	T	0.82748	-0.0304	10	0.87932	D	0	-29.4607	16.0092	0.80385	1.0:0.0:0.0:0.0	.	105;105	P42224-2;P42224	.;STAT1_HUMAN	T	105;105;105;105;107;13;105;105	ENSP00000354394:I105T;ENSP00000386244:I105T;ENSP00000438703:I105T;ENSP00000376136:I105T;ENSP00000376137:I107T;ENSP00000402548:I105T;ENSP00000411398:I105T	ENSP00000354394:I105T	I	-	2	0	STAT1	191580592	1.000000	0.71417	0.992000	0.48379	0.870000	0.49936	8.925000	0.92832	2.184000	0.69523	0.460000	0.39030	ATT		STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3	NM_007315	
ANKRD44	91526	hgsc.bcm.edu	37	2	197889949	197889949	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:197889949C>G	ENST00000328737.2	-	17	1694	c.1618G>C	c.(1618-1620)Ggt>Cgt	p.G540R	ANKRD44_ENST00000450567.1_Missense_Mutation_p.G540R|ANKRD44_ENST00000282272.8_Missense_Mutation_p.G557R|ANKRD44_ENST00000337207.5_Missense_Mutation_p.G540R			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	565										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TTAGTAGCACCAGAATCTGAT	0.398																																					p.G565R												.	.	0			c.G1693C	2						.						142.0	125.0	131.0					2																	197889949		2203	4300	6503	197598194	SO:0001583	missense	91526	exon17			AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1618G>C	2.37:g.197889949C>G	ENSP00000331516:p.Gly540Arg	Somatic		Capture	SOLID	Phase_I	197598194	NM_001195144	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	ENST00000328737.2	37		.	.	.	.	.	.	.	.	.	.	C	7.021	0.558681	0.13436	.	.	ENSG00000065413	ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207;ENST00000422886	T;T;T;T;T;T	0.70869	1.78;-0.52;-0.23;-0.23;-0.26;0.86	4.63	3.75	0.43078	.	0.550760	0.19991	N	0.101568	T	0.57946	0.2088	N	0.05592	-0.015	0.58432	D	0.999997	P	0.43909	0.821	P	0.54815	0.761	T	0.53606	-0.8415	10	0.27785	T	0.31	.	5.2835	0.15688	0.204:0.6947:0.0:0.1013	.	583	Q8N8A2-2	.	R	380;557;540;540;540;240	ENSP00000403415:G380R;ENSP00000282272:G557R;ENSP00000331516:G540R;ENSP00000402420:G540R;ENSP00000338794:G540R;ENSP00000416319:G240R	ENSP00000282272:G557R	G	-	1	0	ANKRD44	197598194	0.525000	0.26290	0.954000	0.39281	0.897000	0.52465	1.541000	0.36126	2.567000	0.86603	0.655000	0.94253	GGT		ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697	
CTLA4	1493	hgsc.bcm.edu	37	2	204732707	204732707	+	Silent	SNP	C	C	T	rs376591332		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:204732707C>T	ENST00000302823.3	+	1	199	c.42C>T	c.(40-42)aaC>aaT	p.N14N	CTLA4_ENST00000487393.1_3'UTR|CTLA4_ENST00000427473.2_5'Flank|CTLA4_ENST00000295854.6_Silent_p.N14N|CTLA4_ENST00000472206.1_Silent_p.N14N	NM_005214.4	NP_005205.2	P16410	CTLA4_HUMAN	cytotoxic T-lymphocyte-associated protein 4	14					B cell receptor signaling pathway (GO:0050853)|cellular response to DNA damage stimulus (GO:0006974)|immune response (GO:0006955)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of immune response (GO:0050777)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of apoptotic process (GO:0043065)|T cell costimulation (GO:0031295)	clathrin-coated endocytic vesicle (GO:0045334)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				large_intestine(4)|lung(4)|skin(1)	9					Ipilimumab(DB06186)	CTCAGCTGAACCTGGCTACCA	0.512																																					p.N14N												.	.	0			c.C42T	2						.	C	,	1,4405	2.1+/-5.4	0,1,2202	148.0	128.0	135.0		42,42	-0.4	0.0	2		135	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CTLA4	NM_001037631.2,NM_005214.4	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	14/175,14/224	204732707	1,13005	2203	4300	6503	204440952	SO:0001819	synonymous_variant	1493	exon1				CCDS2362.1, CCDS42803.1	2q33	2014-02-03			ENSG00000163599	ENSG00000163599		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	2505	protein-coding gene	gene with protein product		123890	"""celiac disease 3"", ""insulin-dependent diabetes mellitus 12"""	CELIAC3, IDDM12		3220103, 8817351	Standard	NM_005214		Approved	CD152, CD, GSE, CD28, ICOS	uc002vak.2	P16410	OTTHUMG00000132877	ENST00000302823.3:c.42C>T	2.37:g.204732707C>T		Somatic		Capture	SOLID	Phase_I	204440952	NM_005214	A0N1S0|E9PDH0|O95653|Q0PP65|Q52MC1|Q53TD5|Q5S005|Q8WXJ1|Q96P43|Q9UKN9	Silent	SNP	ENST00000302823.3	37	CCDS2362.1																																																																																				CTLA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256365.1	NM_005214	
TNS1	7145	hgsc.bcm.edu	37	2	218758212	218758212	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:218758212C>A	ENST00000171887.4	-	8	744	c.292G>T	c.(292-294)Gac>Tac	p.D98Y	TNS1_ENST00000430930.1_Missense_Mutation_p.D98Y|TNS1_ENST00000419504.1_Missense_Mutation_p.D98Y|TNS1_ENST00000310858.6_Missense_Mutation_p.D129Y	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	98	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)	p.D98Y(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		AGCCATGTGTCCATGGCCTTA	0.557																																					p.D98Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G292T	2						.						147.0	120.0	129.0					2																	218758212		2203	4300	6503	218466457	SO:0001583	missense	7145	exon8			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.292G>T	2.37:g.218758212C>A	ENSP00000171887:p.Asp98Tyr	Somatic		Capture	SOLID	Phase_I	218466457	NM_022648	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	37	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	C	18.98	3.737146	0.69304	.	.	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903;ENST00000413554;ENST00000310858;ENST00000413280	D;D;D;D;D;D;D	0.98717	-5.09;-5.09;-5.09;-5.09;-5.09;-5.09;-5.09	5.32	5.32	0.75619	Phosphatase tensin type (1);	.	.	.	.	D	0.98770	0.9586	L	0.49455	1.56	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.994;0.995;1.0;0.999;0.999	D;D;D;D;D;D	0.91635	0.945;0.945;0.947;0.999;0.945;0.945	D	0.99903	1.1168	9	0.87932	D	0	.	18.7709	0.91892	0.0:1.0:0.0:0.0	.	98;152;129;98;98;98	B2RU35;A1L0S7;Q6IPI5;Q9HBL0;E9PGF5;E9PF55	.;.;.;TENS1_HUMAN;.;.	Y	98;98;98;223;166;129;98	ENSP00000171887:D98Y;ENSP00000408724:D98Y;ENSP00000406016:D98Y;ENSP00000405460:D223Y;ENSP00000400383:D166Y;ENSP00000308321:D129Y;ENSP00000395615:D98Y	ENSP00000171887:D98Y	D	-	1	0	TNS1	218466457	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.609000	0.82925	2.769000	0.95229	0.563000	0.77884	GAC		TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
SLC11A1	6556	hgsc.bcm.edu	37	2	219254617	219254617	+	Missense_Mutation	SNP	C	C	G	rs572756670		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:219254617C>G	ENST00000233202.6	+	9	1160	c.820C>G	c.(820-822)Cga>Gga	p.R274G	SLC11A1_ENST00000539932.1_Missense_Mutation_p.R156G	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	274					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCGGGCCCGCCGAGCAGACAT	0.542																																					p.R274G												.	.	0			c.C820G	2						.						126.0	98.0	108.0					2																	219254617		2203	4300	6503	218962861	SO:0001583	missense	6556	exon9			D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.820C>G	2.37:g.219254617C>G	ENSP00000233202:p.Arg274Gly	Somatic		Capture	SOLID	Phase_I	218962861	NM_000578	C0H5Y3	Missense_Mutation	SNP	ENST00000233202.6	37	CCDS2415.1	.	.	.	.	.	.	.	.	.	.	C	13.48	2.248685	0.39797	.	.	ENSG00000018280	ENST00000233202;ENST00000539932	T;T	0.69926	-0.44;-0.44	4.95	1.82	0.25136	.	0.544224	0.17561	N	0.169814	T	0.55878	0.1948	L	0.37800	1.135	0.09310	N	1	B;B;B	0.13145	0.007;0.006;0.003	B;B;B	0.18871	0.01;0.023;0.023	T	0.53180	-0.8475	10	0.52906	T	0.07	-6.207	12.7767	0.57453	0.679:0.321:0.0:0.0	.	274;156;274	B4DQ73;C0H5Y3;P49279	.;.;NRAM1_HUMAN	G	274;156	ENSP00000233202:R274G;ENSP00000443435:R156G	ENSP00000233202:R274G	R	+	1	2	SLC11A1	218962861	0.025000	0.19082	0.006000	0.13384	0.355000	0.29361	1.282000	0.33226	0.652000	0.30806	0.561000	0.74099	CGA		SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	NM_000578	
RNF25	64320	hgsc.bcm.edu	37	2	219530664	219530664	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:219530664T>G	ENST00000295704.2	-	7	988	c.548A>C	c.(547-549)gAa>gCa	p.E183A		NM_022453.2	NP_071898.2	Q96BH1	RNF25_HUMAN	ring finger protein 25	183					positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|NF-kappaB binding (GO:0051059)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ATGCTGCCGTTCCTGTTCCTG	0.522																																					p.E183A												.	.	0			c.A548C	2						.						416.0	303.0	341.0					2																	219530664		2203	4300	6503	219238908	SO:0001583	missense	64320	exon7				CCDS2420.1	2q35	2008-02-05			ENSG00000163481	ENSG00000163481		"""RING-type (C3HC4) zinc fingers"""	14662	protein-coding gene	gene with protein product						12748188	Standard	NM_022453		Approved	AO7, FLJ13906	uc002vit.3	Q96BH1	OTTHUMG00000133077	ENST00000295704.2:c.548A>C	2.37:g.219530664T>G	ENSP00000295704:p.Glu183Ala	Somatic		Capture	SOLID	Phase_I	219238908	NM_022453	A8K0D6|Q53HQ5|Q9H874	Missense_Mutation	SNP	ENST00000295704.2	37	CCDS2420.1	.	.	.	.	.	.	.	.	.	.	T	9.799	1.180062	0.21787	.	.	ENSG00000163481	ENST00000295704	T	0.44881	0.91	4.44	4.44	0.53790	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.076106	0.50627	D	0.000115	T	0.23451	0.0567	N	0.14661	0.345	0.34573	D	0.71364	B	0.19445	0.036	B	0.19391	0.025	T	0.26849	-1.0091	10	0.17369	T	0.5	-19.0228	9.4454	0.38695	0.0:0.0:0.1784:0.8216	.	183	Q96BH1	RNF25_HUMAN	A	183	ENSP00000295704:E183A	ENSP00000295704:E183A	E	-	2	0	RNF25	219238908	1.000000	0.71417	0.999000	0.59377	0.929000	0.56500	4.442000	0.59988	1.878000	0.54408	0.329000	0.21502	GAA		RNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256721.1	NM_022453	
PSMD1	5707	hgsc.bcm.edu	37	2	231949777	231949777	+	Silent	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:231949777T>A	ENST00000308696.6	+	15	1929	c.1767T>A	c.(1765-1767)gcT>gcA	p.A589A	PSMD1_ENST00000373635.4_Silent_p.A589A|PSMD1_ENST00000409643.1_Silent_p.A589A	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	589					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	TAGCCATGGCTTATTGTGGCT	0.398																																					p.A589A												.	.	0			c.T1767A	2						.						196.0	179.0	185.0					2																	231949777		2203	4300	6503	231658021	SO:0001819	synonymous_variant	5707	exon15			D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.1767T>A	2.37:g.231949777T>A		Somatic		Capture	SOLID	Phase_I	231658021	NM_002807	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Silent	SNP	ENST00000308696.6	37	CCDS2482.1	.	.	.	.	.	.	.	.	.	.	T	11.17	1.559553	0.27827	.	.	ENSG00000173692	ENST00000447633	.	.	.	6.06	3.57	0.40892	.	.	.	.	.	T	0.45975	0.1369	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34576	-0.9823	4	.	.	.	-17.6698	2.443	0.04499	0.3418:0.0717:0.1191:0.4673	.	.	.	.	H	82	.	.	L	+	2	0	PSMD1	231658021	0.931000	0.31567	1.000000	0.80357	0.991000	0.79684	-0.100000	0.10990	0.460000	0.27045	-0.417000	0.06048	CTT		PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2		
DGKD	8527	hgsc.bcm.edu	37	2	234346078	234346078	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:234346078A>C	ENST00000264057.2	+	8	887	c.875A>C	c.(874-876)aAa>aCa	p.K292T	DGKD_ENST00000409813.3_Missense_Mutation_p.K248T	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	292					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.K292T(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GGCCTGTGCAAAGTGTCAGTC	0.547																																					p.K292T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A875C	2						.						175.0	144.0	155.0					2																	234346078		2203	4300	6503	234010817	SO:0001583	missense	8527	exon8			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.875A>C	2.37:g.234346078A>C	ENSP00000264057:p.Lys292Thr	Somatic		Capture	SOLID	Phase_I	234010817	NM_152879	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	37	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.368061	0.82463	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	T;D	0.81821	-1.38;-1.54	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.81795	0.4898	L	0.60455	1.87	0.47778	D	0.999518	P;P;P	0.51791	0.948;0.873;0.651	P;P;B	0.48304	0.573;0.544;0.174	D	0.84219	0.0460	10	0.62326	D	0.03	.	15.1094	0.72343	1.0:0.0:0.0:0.0	.	176;248;292	Q53SE4;Q16760-2;Q16760	.;.;DGKD_HUMAN	T	292;248	ENSP00000264057:K292T;ENSP00000386455:K248T	ENSP00000264057:K292T	K	+	2	0	DGKD	234010817	1.000000	0.71417	0.963000	0.40424	0.995000	0.86356	7.249000	0.78278	2.217000	0.71921	0.533000	0.62120	AAA		DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	
TRPM8	79054	hgsc.bcm.edu	37	2	234835263	234835263	+	Missense_Mutation	SNP	C	C	A	rs201380061		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:234835263C>A	ENST00000324695.4	+	2	121	c.81C>A	c.(79-81)agC>agA	p.S27R	TRPM8_ENST00000433712.2_5'UTR	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	27					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.S27R(1)		breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	TGTACTCCAGCGCGTCTCGGA	0.507																																					p.S27R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C81A	2						.						118.0	104.0	109.0					2																	234835263		2203	4300	6503	234500002	SO:0001583	missense	79054	exon2			AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.81C>A	2.37:g.234835263C>A	ENSP00000323926:p.Ser27Arg	Somatic		Capture	SOLID	Phase_I	234500002	NM_024080	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	ENST00000324695.4	37	CCDS33407.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.178395	0.57692	.	.	ENSG00000144481	ENST00000324695	T	0.60548	0.18	5.01	-1.43	0.08884	.	0.000000	0.64402	D	0.000001	T	0.56529	0.1991	L	0.36672	1.1	0.37860	D	0.929671	D	0.71674	0.998	D	0.77004	0.989	T	0.56300	-0.8002	10	0.40728	T	0.16	-25.6113	4.5511	0.12112	0.1476:0.4264:0.0:0.426	.	27	Q7Z2W7	TRPM8_HUMAN	R	27	ENSP00000323926:S27R	ENSP00000323926:S27R	S	+	3	2	TRPM8	234500002	0.000000	0.05858	0.088000	0.20740	0.963000	0.63663	-1.048000	0.03517	-0.090000	0.12462	0.561000	0.74099	AGC		TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080	
GALNT14	79623	hgsc.bcm.edu	37	2	31168725	31168725	+	Silent	SNP	C	C	A	rs148021854	byFrequency	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:31168725C>A	ENST00000349752.5	-	7	1305	c.666G>T	c.(664-666)cgG>cgT	p.R222R	GALNT14_ENST00000324589.5_Silent_p.R227R|GALNT14_ENST00000420311.2_Silent_p.R187R|GALNT14_ENST00000486564.1_5'UTR|GALNT14_ENST00000406653.1_Silent_p.R202R|GALNT14_ENST00000356174.3_Silent_p.R189R	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	222					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.R222R(1)		cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					GGCACACCACCCGCGTGTAGT	0.582																																					p.R222R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G666T	2						.						87.0	70.0	76.0					2																	31168725		2203	4300	6503	31022229	SO:0001819	synonymous_variant	79623	exon7			AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.666G>T	2.37:g.31168725C>A		Somatic		Capture	SOLID	Phase_I	31022229	NM_024572	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Silent	SNP	ENST00000349752.5	37	CCDS1773.2																																																																																				GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572	
EHD3	30845	hgsc.bcm.edu	37	2	31489218	31489218	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:31489218A>C	ENST00000322054.5	+	6	1541	c.1256A>C	c.(1255-1257)cAc>cCc	p.H419P	EHD3_ENST00000541626.1_3'UTR	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	419					blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					GGCACCCTGCACGGCCCCTTT	0.627																																					p.H419P												.	.	0			c.A1256C	2						.						67.0	64.0	65.0					2																	31489218		2203	4300	6503	31342722	SO:0001583	missense	30845	exon6			AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3		10673336	Standard	NM_014600		Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.1256A>C	2.37:g.31489218A>C	ENSP00000327116:p.His419Pro	Somatic		Capture	SOLID	Phase_I	31342722	NM_014600	B4DFR5|D6W574|Q8N514|Q9NZB3	Missense_Mutation	SNP	ENST00000322054.5	37	CCDS1774.1	.	.	.	.	.	.	.	.	.	.	A	14.78	2.638934	0.47153	.	.	ENSG00000013016	ENST00000322054	T	0.16897	2.31	5.84	5.84	0.93424	.	0.354205	0.36409	N	0.002618	T	0.13798	0.0334	N	0.22421	0.69	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.06607	-1.0817	10	0.31617	T	0.26	-8.5544	16.2163	0.82224	1.0:0.0:0.0:0.0	.	419	Q9NZN3	EHD3_HUMAN	P	419	ENSP00000327116:H419P	ENSP00000327116:H419P	H	+	2	0	EHD3	31342722	1.000000	0.71417	0.867000	0.34043	0.808000	0.45660	9.339000	0.96797	2.235000	0.73313	0.459000	0.35465	CAC		EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216810.1	NM_014600	
MXD1	4084	hgsc.bcm.edu	37	2	70143260	70143260	+	Silent	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:70143260A>G	ENST00000264444.2	+	2	341	c.81A>G	c.(79-81)gaA>gaG	p.E27E	MXD1_ENST00000540449.1_Silent_p.E27E	NM_001202513.1|NM_001202514.1|NM_002357.3	NP_001189442.1|NP_001189443.1|NP_002348.1	Q05195	MAD1_HUMAN	MAX dimerization protein 1	27					cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						TAGAAGCTGAACATGGTTATG	0.373																																					p.E27E												.	.	0			c.A81G	2						.						102.0	93.0	96.0					2																	70143260		2203	4300	6503	69996764	SO:0001819	synonymous_variant	4084	exon2				CCDS1896.1, CCDS56123.1	2p13-p12	2010-07-07		2005-02-11	ENSG00000059728	ENSG00000059728		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	6761	protein-coding gene	gene with protein product		600021		MAD		7829091	Standard	NM_002357		Approved	MAD1, bHLHc58	uc002sfy.3	Q05195	OTTHUMG00000129646	ENST00000264444.2:c.81A>G	2.37:g.70143260A>G		Somatic		Capture	SOLID	Phase_I	69996764	NM_002357	B2R6V8|B7ZLI6|D6W5G2|Q6FI41	Silent	SNP	ENST00000264444.2	37	CCDS1896.1																																																																																				MXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251845.3	NM_002357	
C2orf42	54980	hgsc.bcm.edu	37	2	70408475	70408475	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:70408475T>C	ENST00000264434.2	-	3	1022	c.643A>G	c.(643-645)Aaa>Gaa	p.K215E	C2orf42_ENST00000420306.1_Missense_Mutation_p.K215E|C2orf42_ENST00000470096.1_5'Flank	NM_017880.1	NP_060350.1	Q9NWW7	CB042_HUMAN	chromosome 2 open reading frame 42	215								p.K215E(1)		endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	12						GGCAAGCTTTTGCCACTGACT	0.463																																					p.K215E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A643G	2						.						120.0	119.0	119.0					2																	70408475		2203	4300	6503	70261979	SO:0001583	missense	54980	exon3			AK000565	CCDS1899.1	2p14	2011-03-08			ENSG00000115998	ENSG00000115998			26056	protein-coding gene	gene with protein product						12477932	Standard	XM_005264389		Approved	FLJ20558	uc002sgh.3	Q9NWW7	OTTHUMG00000129642	ENST00000264434.2:c.643A>G	2.37:g.70408475T>C	ENSP00000264434:p.Lys215Glu	Somatic		Capture	SOLID	Phase_I	70261979	NM_017880	D6W5G3|Q9H629	Missense_Mutation	SNP	ENST00000264434.2	37	CCDS1899.1	.	.	.	.	.	.	.	.	.	.	T	10.48	1.362308	0.24684	.	.	ENSG00000115998	ENST00000264434;ENST00000420306	T;T	0.35421	1.31;1.31	4.93	4.93	0.64822	.	0.503987	0.23801	N	0.044436	T	0.29652	0.0740	L	0.39898	1.24	0.26700	N	0.971179	B	0.11235	0.004	B	0.11329	0.006	T	0.19160	-1.0314	10	0.56958	D	0.05	-7.9497	9.8577	0.41094	0.0:0.0:0.172:0.828	.	215	Q9NWW7	CB042_HUMAN	E	215	ENSP00000264434:K215E;ENSP00000404515:K215E	ENSP00000264434:K215E	K	-	1	0	C2orf42	70261979	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	3.217000	0.51184	2.069000	0.61940	0.378000	0.23410	AAA		C2orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251840.1	NM_017880	
DCTN1	1639	hgsc.bcm.edu	37	2	74594925	74594925	+	Silent	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:74594925G>A	ENST00000361874.3	-	18	2399	c.2082C>T	c.(2080-2082)gcC>gcT	p.A694A	DCTN1_ENST00000495643.1_5'UTR|DCTN1_ENST00000407639.2_Silent_p.A560A|DCTN1_ENST00000409567.3_Silent_p.A674A|DCTN1_ENST00000394003.3_Silent_p.A687A|DCTN1_ENST00000409438.1_Silent_p.A560A|DCTN1_ENST00000409240.1_Silent_p.A657A|DCTN1_ENST00000409868.1_Silent_p.A677A	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	694					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)	p.A694A(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						AGCGCTCATGGGCACTCATCT	0.522																																					p.A560A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1680T	2						.						96.0	90.0	92.0					2																	74594925		2203	4300	6503	74448433	SO:0001819	synonymous_variant	1639	exon13				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.2082C>T	2.37:g.74594925G>A		Somatic		Capture	SOLID	Phase_I	74448433	NM_023019	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Silent	SNP	ENST00000361874.3	37	CCDS1939.1																																																																																				DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082	
RTKN	6242	hgsc.bcm.edu	37	2	74657771	74657771	+	Silent	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:74657771G>C	ENST00000233330.6	-	3	512	c.195C>G	c.(193-195)tcC>tcG	p.S65S	RTKN_ENST00000305557.5_Silent_p.S102S|RTKN_ENST00000272430.5_Silent_p.S115S|RTKN_ENST00000484453.1_5'Flank	NM_001015056.1	NP_001015056.1			rhotekin									p.S102S(1)|p.S115S(1)		endometrium(3)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	16						CGCGGCAGGGGGAGCGCTCAG	0.627																																					p.S65S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C195G	2						.						39.0	44.0	43.0					2																	74657771		2203	4300	6503	74511279	SO:0001819	synonymous_variant	6242	exon3			AF049227	CCDS1941.1, CCDS33226.1, CCDS42699.1	2p13.1	2013-01-10			ENSG00000114993	ENSG00000114993		"""Pleckstrin homology (PH) domain containing"""	10466	protein-coding gene	gene with protein product		602288				9073523, 10940294	Standard	XM_005264478		Approved	B5	uc002sle.3	Q9BST9	OTTHUMG00000129955	ENST00000233330.6:c.195C>G	2.37:g.74657771G>C		Somatic		Capture	SOLID	Phase_I	74511279	NM_001015056		Silent	SNP	ENST00000233330.6	37	CCDS42699.1																																																																																				RTKN-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328236.3	NM_001015055	
FARP2	9855	hgsc.bcm.edu	37	2	242429383	242429383	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr2:242429383G>C	ENST00000264042.3	+	22	2598	c.2428G>C	c.(2428-2430)Gaa>Caa	p.E810Q		NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	810	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E810Q(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		ACAGGTGGAAGAAAGTGATAA	0.527																																					p.E810Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2428C	2						.						98.0	86.0	90.0					2																	242429383		2203	4300	6503	242078056	SO:0001583	missense	9855	exon22			AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.2428G>C	2.37:g.242429383G>C	ENSP00000264042:p.Glu810Gln	Somatic		Capture	SOLID	Phase_I	242078056	NM_014808	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	ENST00000264042.3	37	CCDS33424.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.4|25.4	4.629374|4.629374	0.87660|0.87660	.|.	.|.	ENSG00000006607|ENSG00000006607	ENST00000264042|ENST00000444371	T|.	0.76186|.	-1.0|.	5.51|5.51	5.51|5.51	0.81932|0.81932	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.110586|.	0.64402|.	D|.	0.000012|.	T|T	0.77405|0.77405	0.4125|0.4125	M|M	0.75085|0.75085	2.285|2.285	0.80722|0.80722	D|D	1|1	D|.	0.58620|.	0.983|.	P|.	0.57057|.	0.812|.	T|T	0.76661|0.76661	-0.2877|-0.2877	10|5	0.54805|.	T|.	0.06|.	.|.	19.4258|19.4258	0.94741|0.94741	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	810|.	O94887|.	FARP2_HUMAN|.	Q|T	810|3	ENSP00000264042:E810Q|.	ENSP00000264042:E810Q|.	E|R	+|+	1|2	0|0	FARP2|FARP2	242078056|242078056	1.000000|1.000000	0.71417|0.71417	0.021000|0.021000	0.16686|0.16686	0.021000|0.021000	0.10359|0.10359	9.666000|9.666000	0.98612|0.98612	2.582000|2.582000	0.87167|0.87167	0.650000|0.650000	0.86243|0.86243	GAA|AGA		FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
DMRT2	10655	hgsc.bcm.edu	37	9	1056729	1056729	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:1056729C>A	ENST00000358146.2	+	3	1142	c.1142C>A	c.(1141-1143)gCa>gAa	p.A381E	DMRT2_ENST00000382251.3_Missense_Mutation_p.A381E|DMRT2_ENST00000259622.6_3'UTR|DMRT2_ENST00000302441.6_Missense_Mutation_p.A381E|DMRT2_ENST00000382255.3_3'UTR			Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor 2	381			A -> P (in dbSNP:rs3824419). {ECO:0000269|PubMed:15489334}.		embryonic skeletal system development (GO:0048706)|positive regulation of myotome development (GO:2000287)|regulation of somitogenesis (GO:0014807)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A381E(1)		large_intestine(1)|lung(1)|prostate(2)	4		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		TTGAAGGGAGCACGAGTCCAG	0.577																																					p.A381E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1142A	9						.						90.0	86.0	88.0					9																	1056729		2203	4300	6503	1046729	SO:0001583	missense	10655	exon4			AF130729	CCDS6444.1, CCDS6445.1	9p24.3	2008-07-21			ENSG00000173253	ENSG00000173253			2935	protein-coding gene	gene with protein product	"""terra-like protein"""	604935				10332030	Standard	NM_181872		Approved		uc003zha.3	Q9Y5R5	OTTHUMG00000019437	ENST00000358146.2:c.1142C>A	9.37:g.1056729C>A	ENSP00000350865:p.Ala381Glu	Somatic		Capture	SOLID	Phase_I	1046729	NM_181872	B1ANC0|B9EGJ1|Q9NPG6|Q9NQR6	Missense_Mutation	SNP	ENST00000358146.2	37	CCDS6444.1	.	.	.	.	.	.	.	.	.	.	C	7.607	0.673975	0.14841	.	.	ENSG00000173253	ENST00000382251;ENST00000302441;ENST00000358146	T;T;T	0.22743	1.94;1.94;1.94	5.78	3.82	0.43975	.	0.746171	0.13395	N	0.391098	T	0.11239	0.0274	N	0.19112	0.55	0.09310	N	1	B	0.28128	0.201	B	0.16722	0.016	T	0.25433	-1.0132	10	0.48119	T	0.1	0.1605	3.2994	0.06978	0.2046:0.5539:0.0:0.2415	.	381	Q9Y5R5	DMRT2_HUMAN	E	381	ENSP00000371686:A381E;ENSP00000305785:A381E;ENSP00000350865:A381E	ENSP00000305785:A381E	A	+	2	0	DMRT2	1046729	0.039000	0.19947	0.002000	0.10522	0.479000	0.33129	2.742000	0.47434	0.661000	0.30985	0.650000	0.86243	GCA		DMRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051492.1	NM_006557	
ABCA1	19	hgsc.bcm.edu	37	9	107558349	107558349	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:107558349C>A	ENST00000374736.3	-	39	5761	c.5367G>T	c.(5365-5367)gaG>gaT	p.E1789D		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1789					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.E1789D(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CGGTGAACAGCTCCAGCACAA	0.512																																					p.E1789D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5367T	9						.						132.0	124.0	127.0					9																	107558349		2203	4300	6503	106598170	SO:0001583	missense	19	exon39			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.5367G>T	9.37:g.107558349C>A	ENSP00000363868:p.Glu1789Asp	Somatic		Capture	SOLID	Phase_I	106598170	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	C	18.74	3.689368	0.68271	.	.	ENSG00000165029	ENST00000374736	D	0.83506	-1.73	5.76	3.89	0.44902	.	0.000000	0.85682	D	0.000000	T	0.80727	0.4678	L	0.47190	1.495	0.80722	D	1	B	0.24533	0.105	B	0.39531	0.302	T	0.77895	-0.2417	10	0.48119	T	0.1	.	8.4225	0.32710	0.0:0.7169:0.0:0.2831	.	1789	O95477	ABCA1_HUMAN	D	1789	ENSP00000363868:E1789D	ENSP00000363868:E1789D	E	-	3	2	ABCA1	106598170	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	2.250000	0.43178	1.565000	0.49641	0.655000	0.94253	GAG		ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
CDK5RAP2	55755	hgsc.bcm.edu	37	9	123170638	123170638	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:123170638G>C	ENST00000349780.4	-	31	4892	c.4713C>G	c.(4711-4713)caC>caG	p.H1571Q	CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.H1530Q|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.H1571Q|CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.H1539Q	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1571					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						TCAGTCTCCTGTGCTCTTCAT	0.557																																					p.H1571Q												.	.	0			c.C4713G	9						.						184.0	142.0	156.0					9																	123170638		2203	4300	6503	122210459	SO:0001583	missense	55755	exon31			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.4713C>G	9.37:g.123170638G>C	ENSP00000343818:p.His1571Gln	Somatic		Capture	SOLID	Phase_I	122210459	NM_018249	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	ENST00000349780.4	37	CCDS6823.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232156	0.39498	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449;ENST00000425647;ENST00000345313	T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98	5.61	3.74	0.42951	.	0.471757	0.21380	N	0.075481	T	0.45518	0.1346	L	0.38531	1.155	0.09310	N	1	D;B;B;P;B;D	0.71674	0.981;0.091;0.091;0.831;0.055;0.998	P;B;B;B;B;D	0.64687	0.788;0.047;0.026;0.249;0.012;0.928	T	0.21690	-1.0238	10	0.36615	T	0.2	.	5.1969	0.15243	0.076:0.2657:0.5213:0.137	.	581;1340;1539;1571;1571;965	Q5JTU8;Q6MZT4;Q96SN8-2;Q96SN8-4;Q96SN8;B1AMJ5	.;.;.;.;CK5P2_HUMAN;.	Q	1539;1530;1571;1571;965;581;1343	ENSP00000354065:H1539Q;ENSP00000352258:H1530Q;ENSP00000343818:H1571Q;ENSP00000353317:H1571Q;ENSP00000400395:H965Q;ENSP00000409941:H581Q	ENSP00000341695:H1343Q	H	-	3	2	CDK5RAP2	122210459	0.002000	0.14202	0.111000	0.21465	0.857000	0.48899	0.207000	0.17395	0.705000	0.31890	0.655000	0.94253	CAC		CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249	
CDK5RAP2	55755	hgsc.bcm.edu	37	9	123220738	123220738	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:123220738G>T	ENST00000349780.4	-	20	2544	c.2365C>A	c.(2365-2367)Ctg>Atg	p.L789M	CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.L789M|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.L789M|CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.L757M	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	789					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						CTGGATTCCAGTAATAATGTG	0.463																																					p.L789M												.	.	0			c.C2365A	9						.						85.0	77.0	80.0					9																	123220738		2203	4300	6503	122260559	SO:0001583	missense	55755	exon20			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.2365C>A	9.37:g.123220738G>T	ENSP00000343818:p.Leu789Met	Somatic		Capture	SOLID	Phase_I	122260559	NM_018249	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	ENST00000349780.4	37	CCDS6823.1	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449923	0.63290	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449	T;T;T;T;T	0.34072	3.0;3.28;3.41;3.32;1.38	6.17	5.28	0.74379	.	0.000000	0.49305	D	0.000144	T	0.49372	0.1553	L	0.36672	1.1	0.30741	N	0.746167	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.999;0.962;0.998;0.999	T	0.55114	-0.8191	10	0.66056	D	0.02	.	12.7222	0.57147	0.0759:0.0:0.9241:0.0	.	558;789;789;183	Q6MZT4;Q96SN8-4;Q96SN8;B1AMJ5	.;.;CK5P2_HUMAN;.	M	757;789;789;789;183	ENSP00000354065:L757M;ENSP00000352258:L789M;ENSP00000343818:L789M;ENSP00000353317:L789M;ENSP00000400395:L183M	ENSP00000343818:L789M	L	-	1	2	CDK5RAP2	122260559	0.998000	0.40836	0.913000	0.36048	0.635000	0.38103	3.607000	0.54102	1.625000	0.50366	0.655000	0.94253	CTG		CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249	
CIZ1	25792	hgsc.bcm.edu	37	9	130938660	130938660	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:130938660A>G	ENST00000393608.1	-	11	2115	c.1913T>C	c.(1912-1914)gTg>gCg	p.V638A	CIZ1_ENST00000277465.4_Missense_Mutation_p.V610A|CIZ1_ENST00000476727.2_Intron|CIZ1_ENST00000372938.5_Missense_Mutation_p.V638A|CIZ1_ENST00000357558.5_Missense_Mutation_p.V610A|CIZ1_ENST00000538431.1_Missense_Mutation_p.V638A|CIZ1_ENST00000372948.3_Missense_Mutation_p.V582A|CIZ1_ENST00000372954.1_Missense_Mutation_p.V558A|CIZ1_ENST00000541172.1_Missense_Mutation_p.V537A|CIZ1_ENST00000325721.8_Missense_Mutation_p.V609A	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	638			V -> M (in dbSNP:rs11549266). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.2}.		maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.V638A(2)|p.L636_R640delLPVPR(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						GTCCCGGGGCACGGGCAGCAG	0.637																																					p.V582A												.	.	3	Substitution - Missense(2)|Deletion - In frame(1)	large_intestine(2)|breast(1)	c.T1745C	9						.						100.0	102.0	101.0					9																	130938660		2203	4300	6503	129978481	SO:0001583	missense	25792	exon12			AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.1913T>C	9.37:g.130938660A>G	ENSP00000377232:p.Val638Ala	Somatic		Capture	SOLID	Phase_I	129978481	NM_001131015	A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Missense_Mutation	SNP	ENST00000393608.1	37	CCDS6894.1	.	.	.	.	.	.	.	.	.	.	A	7.958	0.746396	0.15710	.	.	ENSG00000148337	ENST00000372954;ENST00000393608;ENST00000538431;ENST00000357558;ENST00000325721;ENST00000537314;ENST00000541172;ENST00000277465;ENST00000372948;ENST00000372938;ENST00000415526	T;T;T;T;T;T;T;T;T;T	0.32753	1.44;1.61;1.54;1.77;1.61;2.04;1.77;1.45;1.61;2.22	5.43	3.04	0.35103	.	0.495363	0.16770	N	0.200242	T	0.12987	0.0315	N	0.08118	0	0.09310	N	0.999998	B;B;B;P;B;P;B	0.47350	0.129;0.245;0.058;0.629;0.034;0.894;0.034	B;B;B;B;B;B;B	0.43225	0.036;0.05;0.047;0.292;0.021;0.412;0.021	T	0.07309	-1.0779	10	0.08381	T	0.77	-5.4729	5.0495	0.14501	0.6608:0.167:0.1722:0.0	.	638;577;582;558;638;609;610	B7Z3U7;B4E0A3;Q9ULV3-4;Q9ULV3-3;Q9ULV3;Q9ULV3-2;Q5SYW2	.;.;.;.;CIZ1_HUMAN;.;.	A	558;638;638;610;609;577;537;610;582;638;560	ENSP00000362045:V558A;ENSP00000377232:V638A;ENSP00000439244:V638A;ENSP00000350169:V610A;ENSP00000320374:V609A;ENSP00000445057:V537A;ENSP00000277465:V610A;ENSP00000362039:V582A;ENSP00000362029:V638A;ENSP00000398011:V560A	ENSP00000277465:V610A	V	-	2	0	CIZ1	129978481	0.927000	0.31430	0.812000	0.32479	0.003000	0.03518	1.683000	0.37638	0.870000	0.35726	-0.648000	0.03929	GTG		CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054399.1	NM_012127	
SH3GLB2	56904	hgsc.bcm.edu	37	9	131776780	131776780	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:131776780C>G	ENST00000372564.3	-	5	616	c.471G>C	c.(469-471)aaG>aaC	p.K157N	SH3GLB2_ENST00000416629.1_Missense_Mutation_p.K157N|SH3GLB2_ENST00000372559.1_Missense_Mutation_p.K157N|SH3GLB2_ENST00000417224.1_Missense_Mutation_p.K157N|SH3GLB2_ENST00000372554.4_Missense_Mutation_p.K157N	NM_020145.2	NP_064530.1	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2	157	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.					cytoplasm (GO:0005737)		p.K157N(1)		NS(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)	12						GCCGCCTCTCCTTCTACAGGG	0.612																																					p.K157N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G471C	9						.						28.0	24.0	25.0					9																	131776780		2119	4135	6254	130816601	SO:0001583	missense	56904	exon5			AF257319	CCDS6916.1, CCDS69680.1	9q34	2008-02-05	2001-12-04		ENSG00000148341	ENSG00000148341			10834	protein-coding gene	gene with protein product		609288	"""SH3-domain, GRB2-like, endophilin B2"""			11161816	Standard	NM_020145		Approved	KIAA1848	uc004bwv.3	Q9NR46	OTTHUMG00000020769	ENST00000372564.3:c.471G>C	9.37:g.131776780C>G	ENSP00000361645:p.Lys157Asn	Somatic		Capture	SOLID	Phase_I	130816601	NM_020145	A6NC47|A8MPS4|Q8WY61|Q96JH9	Missense_Mutation	SNP	ENST00000372564.3	37	CCDS6916.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856480	0.71834	.	.	ENSG00000148341	ENST00000372564;ENST00000372559;ENST00000543311;ENST00000372554;ENST00000417224;ENST00000416629	T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3	6.08	2.94	0.34122	BAR (3);IRSp53/MIM homology domain (IMD) (1);	0.041534	0.85682	D	0.000000	T	0.78266	0.4256	M	0.82716	2.605	0.58432	D	0.999999	D;D	0.63046	0.992;0.988	P;D	0.66979	0.888;0.948	T	0.77032	-0.2738	10	0.51188	T	0.08	-3.663	7.1013	0.25338	0.0:0.6335:0.0:0.3665	.	157;157	Q9NR46-2;Q9NR46	.;SHLB2_HUMAN	N	157	ENSP00000361645:K157N;ENSP00000361640:K157N;ENSP00000361634:K157N;ENSP00000402566:K157N;ENSP00000388282:K157N	ENSP00000361634:K157N	K	-	3	2	SH3GLB2	130816601	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	1.047000	0.30367	0.918000	0.36919	0.655000	0.94253	AAG		SH3GLB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054535.2		
DDX31	64794	hgsc.bcm.edu	37	9	135505703	135505703	+	Silent	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:135505703A>G	ENST00000372159.3	-	16	2045	c.1894T>C	c.(1894-1896)Ttg>Ctg	p.L632L	DDX31_ENST00000372153.1_Silent_p.F623F|DDX31_ENST00000438527.3_Silent_p.L503L	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	632	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.L632L(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		GAAGGAGCCAAAATGAGCAGG	0.493																																					p.L632L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1894C	9						.						105.0	112.0	109.0					9																	135505703		2203	4300	6503	134495524	SO:0001819	synonymous_variant	64794	exon16			AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.1894T>C	9.37:g.135505703A>G		Somatic		Capture	SOLID	Phase_I	134495524	NM_022779	Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Silent	SNP	ENST00000372159.3	37	CCDS6951.1																																																																																				DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054794.1	NM_138620	
GTF3C5	9328	hgsc.bcm.edu	37	9	135917520	135917520	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:135917520A>T	ENST00000372097.5	+	2	523	c.200A>T	c.(199-201)aAg>aTg	p.K67M	GTF3C5_ENST00000485692.1_Intron|GTF3C5_ENST00000372108.5_Missense_Mutation_p.K67M|GTF3C5_ENST00000342018.8_Missense_Mutation_p.K67M|GTF3C5_ENST00000372099.6_Missense_Mutation_p.K58M|GTF3C5_ENST00000372095.5_Intron	NM_012087.3	NP_036219.2	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5, 63kDa	67					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.K67M(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		TTCCGGCCCAAGGACCCATAC	0.602																																					p.K67M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A200T	9						.						69.0	68.0	68.0					9																	135917520		2203	4300	6503	134907341	SO:0001583	missense	9328	exon2			AF133124	CCDS6958.1, CCDS48050.1, CCDS75927.1	9q34.13	2010-03-23	2002-08-29		ENSG00000148308	ENSG00000148308		"""General transcription factors"""	4668	protein-coding gene	gene with protein product	"""transcription factor IIIC, 63 kD"""	604890	"""general transcription factor IIIC, polypeptide 5 (63kD)"""			10373544	Standard	NM_012087		Approved	TFiiiC2-63, TFIIIC63, TFIIICepsilon	uc004ccj.4	Q9Y5Q8	OTTHUMG00000020856	ENST00000372097.5:c.200A>T	9.37:g.135917520A>T	ENSP00000361169:p.Lys67Met	Somatic		Capture	SOLID	Phase_I	134907341	NM_001122823	A6NI44|A6NJB9|Q5T7U2|Q5T7U3|Q8N2U7|Q8N857|Q96GD9|Q9H4P2	Missense_Mutation	SNP	ENST00000372097.5	37	CCDS6958.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.338243	0.81911	.	.	ENSG00000148308	ENST00000372097;ENST00000440319;ENST00000372099;ENST00000372108;ENST00000342018	T;T;T;T	0.49432	0.79;0.8;0.78;0.8	5.34	5.34	0.76211	.	0.157596	0.56097	D	0.000025	T	0.64811	0.2632	M	0.74881	2.28	0.80722	D	1	D;D	0.55172	0.963;0.97	P;P	0.59288	0.627;0.855	T	0.69015	-0.5257	10	0.62326	D	0.03	-31.5984	14.5168	0.67824	1.0:0.0:0.0:0.0	.	67;67	Q9Y5Q8-3;Q9Y5Q8	.;TF3C5_HUMAN	M	67;20;58;67;67	ENSP00000361169:K67M;ENSP00000361171:K58M;ENSP00000361180:K67M;ENSP00000339530:K67M	ENSP00000339530:K67M	K	+	2	0	GTF3C5	134907341	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.355000	0.52262	2.015000	0.59207	0.533000	0.62120	AAG		GTF3C5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054826.1	NM_001122823	
RIC1	57589	hgsc.bcm.edu	37	9	5738479	5738479	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:5738479A>T	ENST00000414202.2	+	8	1033	c.842A>T	c.(841-843)aAc>aTc	p.N281I	KIAA1432_ENST00000381532.2_Missense_Mutation_p.N202I|KIAA1432_ENST00000251879.6_Missense_Mutation_p.N281I|KIAA1432_ENST00000449720.2_Missense_Mutation_p.N202I|KIAA1432_ENST00000418622.3_Missense_Mutation_p.N202I	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		ACAATAGATAACAGCACTGGA	0.308																																					p.N202I												.	.	0			c.A605T	9						.						68.0	66.0	67.0					9																	5738479		2203	4300	6503	5728479	SO:0001583	missense	57589	exon7																														ENST00000414202.2:c.842A>T	9.37:g.5738479A>T	ENSP00000416696:p.Asn281Ile	Somatic		Capture	SOLID	Phase_I	5728479	NM_020829		Missense_Mutation	SNP	ENST00000414202.2	37	CCDS34982.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.66|13.66	2.302195|2.302195	0.40694|0.40694	.|.	.|.	ENSG00000107036|ENSG00000107036	ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720|ENST00000545641	T;T;T;T;T|.	0.71341|.	1.52;1.52;-0.56;-0.56;-0.56|.	5.75|5.75	4.61|4.61	0.57282|0.57282	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);|.	0.209834|.	0.49305|.	D|.	0.000153|.	T|.	0.51261|.	0.1664|.	L|L	0.47716|0.47716	1.5|1.5	0.34455|0.34455	D|D	0.701092|0.701092	P;P;P|.	0.37636|.	0.468;0.528;0.603|.	B;B;B|.	0.34242|.	0.125;0.165;0.178|.	T|.	0.60485|.	-0.7254|.	10|.	0.72032|.	D|.	0.01|.	-14.2674|-14.2674	8.5793|8.5793	0.33619|0.33619	0.7913:0.1387:0.07:0.0|0.7913:0.1387:0.07:0.0	.|.	202;281;281|.	B7ZM67;Q4ADV7;G5E932|.	.;RIC1_HUMAN;.|.	I|Y	281;281;202;202;202|209	ENSP00000251879:N281I;ENSP00000416696:N281I;ENSP00000370943:N202I;ENSP00000402240:N202I;ENSP00000398823:N202I|.	ENSP00000251879:N281I|.	N|X	+|+	2|3	0|2	KIAA1432|KIAA1432	5728479|5728479	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.916000|0.916000	0.54674|0.54674	2.134000|2.134000	0.42102|0.42102	1.007000|1.007000	0.39238|0.39238	-0.290000|-0.290000	0.09829|0.09829	AAC|TAA		KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		
FOCAD	54914	hgsc.bcm.edu	37	9	20740242	20740242	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:20740242C>T	ENST00000380249.1	+	7	659	c.295C>T	c.(295-297)Cat>Tat	p.H99Y	FOCAD_ENST00000338382.6_Missense_Mutation_p.H99Y	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	99						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											CAGAAATACACATGGCTTGAT	0.294																																					p.H99Y												.	.	0			c.C295T	9						.						65.0	67.0	66.0					9																	20740242		2203	4296	6499	20730242	SO:0001583	missense	54914	exon7			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.295C>T	9.37:g.20740242C>T	ENSP00000369599:p.His99Tyr	Somatic		Capture	SOLID	Phase_I	20730242	NM_017794	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.803228	0.50315	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.23950	1.88;1.88	5.55	3.67	0.42095	Domain of unknown function DUF3730 (1);	0.243836	0.42821	D	0.000647	T	0.20047	0.0482	N	0.24115	0.695	0.30099	N	0.8076	B	0.30937	0.301	B	0.38264	0.269	T	0.14008	-1.0488	10	0.62326	D	0.03	-14.3321	8.4928	0.33110	0.1527:0.7688:0.0:0.0785	.	99	Q5VW36	K1797_HUMAN	Y	99	ENSP00000369599:H99Y;ENSP00000344307:H99Y	ENSP00000344307:H99Y	H	+	1	0	KIAA1797	20730242	1.000000	0.71417	0.969000	0.41365	0.962000	0.63368	3.491000	0.53252	0.671000	0.31185	0.561000	0.74099	CAT		FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	
DDX58	23586	hgsc.bcm.edu	37	9	32467813	32467813	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:32467813A>T	ENST00000379883.2	-	15	2289	c.2132T>A	c.(2131-2133)cTt>cAt	p.L711H	DDX58_ENST00000379882.1_Missense_Mutation_p.L666H|DDX58_ENST00000542096.1_Missense_Mutation_p.L640H|DDX58_ENST00000379868.1_Missense_Mutation_p.L508H|DDX58_ENST00000545044.1_Missense_Mutation_p.L508H	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	711	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with ZC3HAV1.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		AAGGATGACAAGATTGCACTG	0.418																																					p.L711H												.	.	0			c.T2132A	9						.						194.0	160.0	171.0					9																	32467813		2203	4300	6503	32457813	SO:0001583	missense	23586	exon15			AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.2132T>A	9.37:g.32467813A>T	ENSP00000369213:p.Leu711His	Somatic		Capture	SOLID	Phase_I	32457813	NM_014314	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	ENST00000379883.2	37	CCDS6526.1	.	.	.	.	.	.	.	.	.	.	A	19.79	3.893011	0.72524	.	.	ENSG00000107201	ENST00000379882;ENST00000379883;ENST00000379868;ENST00000542096;ENST00000545044	T;T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01;-1.01	5.58	4.44	0.53790	Helicase, C-terminal (3);	0.382752	0.21360	N	0.075816	T	0.80071	0.4556	L	0.28054	0.825	0.44834	D	0.997846	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	T	0.80400	-0.1398	10	0.87932	D	0	-9.5369	10.5626	0.45154	0.9231:0.0:0.0769:0.0	.	508;666;640;711	F5H5W6;O95786-2;B3KWW1;O95786	.;.;.;DDX58_HUMAN	H	666;711;508;640;508	ENSP00000369212:L666H;ENSP00000369213:L711H;ENSP00000369197:L508H;ENSP00000442160:L640H;ENSP00000443055:L508H	ENSP00000369197:L508H	L	-	2	0	DDX58	32457813	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.163000	0.77524	0.950000	0.37743	0.533000	0.62120	CTT		DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314	
NFX1	4799	hgsc.bcm.edu	37	9	33313741	33313741	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:33313741A>T	ENST00000379540.3	+	7	1600	c.1538A>T	c.(1537-1539)gAg>gTg	p.E513V	NFX1_ENST00000379521.4_Missense_Mutation_p.E513V|NFX1_ENST00000318524.6_Missense_Mutation_p.E513V	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	513					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E513V(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		CAGTGTGCTGAGCTGTGCCAT	0.512																																					p.E513V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1538T	9						.						113.0	103.0	106.0					9																	33313741		2203	4300	6503	33303741	SO:0001583	missense	4799	exon7			U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.1538A>T	9.37:g.33313741A>T	ENSP00000368856:p.Glu513Val	Somatic		Capture	SOLID	Phase_I	33303741	NM_147134	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	ENST00000379540.3	37	CCDS6538.1	.	.	.	.	.	.	.	.	.	.	A	15.24	2.774262	0.49786	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000536210;ENST00000318524	T;T;T	0.42900	0.96;0.96;0.96	5.4	5.4	0.78164	Zinc finger, NF-X1-type (2);	0.110269	0.64402	D	0.000008	T	0.46229	0.1382	L	0.35487	1.065	0.33533	D	0.593874	D;D;B;P;B	0.62365	0.991;0.97;0.302;0.865;0.272	P;P;B;P;B	0.56474	0.799;0.787;0.166;0.503;0.176	T	0.60929	-0.7165	10	0.56958	D	0.05	-7.4006	11.8489	0.52399	1.0:0.0:0.0:0.0	.	513;397;513;513;513	F5GXD0;A0JLR2;Q12986;Q12986-2;Q12986-3	.;.;NFX1_HUMAN;.;.	V	513	ENSP00000368856:E513V;ENSP00000368836:E513V;ENSP00000317695:E513V	ENSP00000317695:E513V	E	+	2	0	NFX1	33303741	1.000000	0.71417	1.000000	0.80357	0.018000	0.09664	4.911000	0.63328	2.052000	0.61016	0.472000	0.43445	GAG		NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052069.1		
CCIN	881	hgsc.bcm.edu	37	9	36170858	36170858	+	Silent	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:36170858G>T	ENST00000335119.2	+	1	1470	c.1359G>T	c.(1357-1359)ggG>ggT	p.G453G		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	453					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			CCAGCACTGGGGACGTGGTCC	0.552																																					p.G453G												.	.	0			c.G1359T	9						.						129.0	110.0	116.0					9																	36170858		2203	4300	6503	36160858	SO:0001819	synonymous_variant	881	exon1			Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.1359G>T	9.37:g.36170858G>T		Somatic		Capture	SOLID	Phase_I	36160858	NM_005893	Q9BXG7	Silent	SNP	ENST00000335119.2	37	CCDS6599.1																																																																																				CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	NM_005893	
VPS13A	23230	hgsc.bcm.edu	37	9	79867195	79867195	+	Missense_Mutation	SNP	C	C	T	rs374188914		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:79867195C>T	ENST00000360280.3	+	22	2475	c.2215C>T	c.(2215-2217)Cat>Tat	p.H739Y	VPS13A_ENST00000376636.3_Missense_Mutation_p.H739Y|VPS13A_ENST00000376634.4_Missense_Mutation_p.H739Y|VPS13A_ENST00000357409.5_Missense_Mutation_p.H739Y	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	739					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ATCTACCCAGCATATTTTGGT	0.358																																					p.H739Y												.	.	0			c.C2215T	9						.						218.0	208.0	211.0					9																	79867195		2203	4300	6503	79057015	SO:0001583	missense	23230	exon22			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.2215C>T	9.37:g.79867195C>T	ENSP00000353422:p.His739Tyr	Somatic		Capture	SOLID	Phase_I	79057015	NM_001018037	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	37	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957324	0.73902	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.67411	0.2890	M	0.79123	2.44	0.80722	D	1	D;D;D;D	0.89917	0.997;0.999;1.0;1.0	D;D;D;D	0.72982	0.917;0.926;0.979;0.979	T	0.67166	-0.5739	10	0.39692	T	0.17	.	13.5938	0.61978	0.0:0.9232:0.0:0.0768	.	739;739;739;739	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	Y	739	ENSP00000365821:H739Y;ENSP00000365823:H739Y;ENSP00000353422:H739Y;ENSP00000349985:H739Y	ENSP00000349985:H739Y	H	+	1	0	VPS13A	79057015	1.000000	0.71417	0.971000	0.41717	0.876000	0.50452	4.670000	0.61583	2.552000	0.86080	0.561000	0.74099	CAT		VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
IPPK	64768	hgsc.bcm.edu	37	9	95400434	95400434	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:95400434C>A	ENST00000287996.3	-	9	1041	c.765G>T	c.(763-765)agG>agT	p.R255S	IPPK_ENST00000375522.1_5'Flank	NM_022755.5	NP_073592.1	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	255					inositol phosphate metabolic process (GO:0043647)|inositol phosphorylation (GO:0052746)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|inositol pentakisphosphate 2-kinase activity (GO:0035299)	p.R255S(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(2)|urinary_tract(1)	15						TGATCACAGCCCTTGTGCAGT	0.672																																					p.R255S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G765T	9						.						55.0	53.0	54.0					9																	95400434		2203	4300	6503	94440255	SO:0001583	missense	64768	exon9			AK023225	CCDS6699.1	9q22.31	2010-12-02	2005-10-20	2005-10-20	ENSG00000127080	ENSG00000127080			14645	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 12"""	C9orf12		12084730	Standard	NM_022755		Approved	INSP5K2, FLJ13163, IP5K, IPK1	uc004asl.1	Q9H8X2	OTTHUMG00000020231	ENST00000287996.3:c.765G>T	9.37:g.95400434C>A	ENSP00000287996:p.Arg255Ser	Somatic		Capture	SOLID	Phase_I	94440255	NM_022755	Q5T9F7|Q9H7V8	Missense_Mutation	SNP	ENST00000287996.3	37	CCDS6699.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.566605	0.28003	.	.	ENSG00000127080	ENST00000287996	T	0.31247	1.5	5.11	2.22	0.28083	.	0.200287	0.51477	N	0.000088	T	0.17238	0.0414	N	0.22421	0.69	0.80722	D	1	B	0.27910	0.193	B	0.34536	0.185	T	0.07177	-1.0786	10	0.09338	T	0.73	-9.831	5.8053	0.18436	0.2766:0.5817:0.0:0.1417	.	255	Q9H8X2	IPPK_HUMAN	S	255	ENSP00000287996:R255S	ENSP00000287996:R255S	R	-	3	2	IPPK	94440255	0.947000	0.32204	0.926000	0.36857	0.933000	0.57130	0.729000	0.26028	0.260000	0.21731	-0.521000	0.04368	AGG		IPPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053101.1	NM_022755	
ZNF169	169841	hgsc.bcm.edu	37	9	97054709	97054709	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:97054709G>T	ENST00000395395.2	+	3	210	c.120G>T	c.(118-120)agG>agT	p.R40S	ZNF169_ENST00000480716.1_Missense_Mutation_p.R40S|ZNF169_ENST00000375354.4_Missense_Mutation_p.R40S|ZNF169_ENST00000340911.4_Missense_Mutation_p.R40S|ZNF169_ENST00000481550.2_Missense_Mutation_p.R40S	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	40	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				CCCTGTACAGGGAGGTGATGC	0.502																																					p.R40S												.	.	0			c.G120T	9						.						145.0	136.0	139.0					9																	97054709		2203	4300	6503	96094530	SO:0001583	missense	169841	exon3			U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.120G>T	9.37:g.97054709G>T	ENSP00000378792:p.Arg40Ser	Somatic		Capture	SOLID	Phase_I	96094530	NM_194320	A2AGP5|A8K127|Q6PI28	Missense_Mutation	SNP	ENST00000395395.2	37	CCDS6709.2	.	.	.	.	.	.	.	.	.	.	g	18.26	3.584053	0.65992	.	.	ENSG00000175787	ENST00000395395;ENST00000375354	T;T	0.02656	4.21;4.21	2.91	2.91	0.33838	Krueppel-associated box (4);	.	.	.	.	T	0.17662	0.0424	M	0.92026	3.265	0.37492	D	0.91643	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.81914	0.995;0.995;0.978	T	0.11991	-1.0565	9	0.59425	D	0.04	.	11.6247	0.51138	0.0:0.0:1.0:0.0	.	40;40;40	Q6PIG1;Q7Z761;Q14929	.;.;ZN169_HUMAN	S	40	ENSP00000378792:R40S;ENSP00000364503:R40S	ENSP00000364503:R40S	R	+	3	2	ZNF169	96094530	0.984000	0.35163	0.993000	0.49108	0.967000	0.64934	2.345000	0.44018	1.658000	0.50742	0.603000	0.83216	AGG		ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253714.1	NM_194320	
CORO2A	7464	hgsc.bcm.edu	37	9	100887058	100887058	+	Nonstop_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:100887058A>T	ENST00000343933.5	-	12	1833	c.1576T>A	c.(1576-1578)Tga>Aga	p.*526R	CORO2A_ENST00000375077.4_Nonstop_Mutation_p.*526R	NM_003389.3	NP_003380.3	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	0					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	actin cytoskeleton (GO:0015629)|transcriptional repressor complex (GO:0017053)	actin filament binding (GO:0051015)	p.*526R(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|skin(4)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				GTCTCTGCTCAGAGCTGCTCT	0.567																																					p.X526R												.	.	1	Nonstop extension(1)	large_intestine(1)	c.T1576A	9						.						81.0	74.0	76.0					9																	100887058		2203	4300	6503	99926879	SO:0001578	stop_lost	7464	exon12			U57057	CCDS6735.1	9q22.3	2013-01-10	2001-11-28		ENSG00000106789	ENSG00000106789		"""Coronins"", ""WD repeat domain containing"""	2255	protein-coding gene	gene with protein product	"""coronin 2A"", ""coronin-like protein B"", ""WD protein IR10"", ""WD-repeat protein 2"""	602159	"""coronin, actin-binding protein, 2A"""			8985118	Standard	NM_052820		Approved	IR10, WDR2	uc004aym.3	Q92828	OTTHUMG00000020340	ENST00000343933.5:c.1576T>A	9.37:g.100887058A>T		Somatic		Capture	SOLID	Phase_I	99926879	NM_003389	Q5TBR5|Q92829|Q9BWS5	Missense_Mutation	SNP	ENST00000343933.5	37	CCDS6735.1	.	.	.	.	.	.	.	.	.	.	A	10.89	1.477625	0.26511	.	.	ENSG00000106789	ENST00000343933;ENST00000375077	.	.	.	5.6	4.45	0.53987	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4165	0.44325	0.8191:0.1809:0.0:0.0	.	.	.	.	R	526	.	.	X	-	1	0	CORO2A	99926879	1.000000	0.71417	0.124000	0.21820	0.635000	0.38103	4.016000	0.57159	0.958000	0.37956	0.533000	0.62120	TGA		CORO2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053357.1	NM_003389	
GTF3C5	9328	hgsc.bcm.edu	37	9	135917523	135917523	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:135917523delA	ENST00000372097.5	+	2	526	c.203delA	c.(202-204)gacfs	p.D68fs	GTF3C5_ENST00000485692.1_Intron|GTF3C5_ENST00000372108.5_Frame_Shift_Del_p.D68fs|GTF3C5_ENST00000342018.8_Frame_Shift_Del_p.D68fs|GTF3C5_ENST00000372099.6_Frame_Shift_Del_p.D59fs|GTF3C5_ENST00000372095.5_Intron	NM_012087.3	NP_036219.2	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5, 63kDa	68					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.D68fs*137(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		CGGCCCAAGGACCCATACTGC	0.602																																					p.D68fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.203delA	9						.						71.0	69.0	70.0					9																	135917523		2203	4300	6503	134907344	SO:0001589	frameshift_variant	9328	exon2			AF133124	CCDS6958.1, CCDS48050.1, CCDS75927.1	9q34.13	2010-03-23	2002-08-29		ENSG00000148308	ENSG00000148308		"""General transcription factors"""	4668	protein-coding gene	gene with protein product	"""transcription factor IIIC, 63 kD"""	604890	"""general transcription factor IIIC, polypeptide 5 (63kD)"""			10373544	Standard	NM_012087		Approved	TFiiiC2-63, TFIIIC63, TFIIICepsilon	uc004ccj.4	Q9Y5Q8	OTTHUMG00000020856	ENST00000372097.5:c.203delA	9.37:g.135917523delA	ENSP00000361169:p.Asp68fs	Somatic		Capture	SOLID	Phase_I	134907344	NM_001122823	A6NI44|A6NJB9|Q5T7U2|Q5T7U3|Q8N2U7|Q8N857|Q96GD9|Q9H4P2	Frame_Shift_Del	DEL	ENST00000372097.5	37	CCDS6958.1																																																																																				GTF3C5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054826.1	NM_001122823	
GRIN1	2902	hgsc.bcm.edu	37	9	140040243	140040243	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr9:140040243G>C	ENST00000371561.3	+	3	1556	c.459G>C	c.(457-459)gaG>gaC	p.E153D	GRIN1_ENST00000371553.3_Missense_Mutation_p.E153D|GRIN1_ENST00000371550.4_Missense_Mutation_p.E153D|GRIN1_ENST00000371560.3_Missense_Mutation_p.E153D|GRIN1_ENST00000350902.5_Missense_Mutation_p.E153D|GRIN1_ENST00000371555.4_Missense_Mutation_p.E153D|GRIN1_ENST00000371546.4_Missense_Mutation_p.E153D|GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000371559.4_Missense_Mutation_p.E153D|GRIN1_ENST00000315048.3_Missense_Mutation_p.E153D	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	153					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGTGGTTTGAGATGATGCGTG	0.662																																					p.E153D	NSCLC(113;717 1653 2089 20474 37618)											.	.	0			c.G459C	9						.						81.0	52.0	62.0					9																	140040243		2203	4299	6502	139160064	SO:0001583	missense	2902	exon3				CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.459G>C	9.37:g.140040243G>C	ENSP00000360616:p.Glu153Asp	Somatic		Capture	SOLID	Phase_I	139160064	NM_007327	A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Missense_Mutation	SNP	ENST00000371561.3	37	CCDS7031.1	.	.	.	.	.	.	.	.	.	.	G	12.51	1.960297	0.34565	.	.	ENSG00000176884	ENST00000371561;ENST00000315048;ENST00000350902;ENST00000371550;ENST00000371546;ENST00000371555;ENST00000371553;ENST00000371559;ENST00000371560	T;T;T;T;T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41;-1.41;-1.41;-1.41;-1.41	4.0	3.08	0.35506	Extracellular ligand-binding receptor (1);	0.246914	0.39274	N	0.001410	T	0.64853	0.2636	N	0.21282	0.65	0.48236	D	0.999612	B;B;B;B;B;B	0.11235	0.002;0.0;0.001;0.002;0.004;0.001	B;B;B;B;B;B	0.15870	0.014;0.008;0.003;0.006;0.01;0.013	T	0.57608	-0.7782	10	0.18276	T	0.48	.	9.7123	0.40254	0.1061:0.0:0.8939:0.0	.	153;153;153;153;153;153	Q5VSF4;Q5VSF5;Q05586-2;Q05586-3;Q05586;A2AVK2	.;.;.;.;NMDZ1_HUMAN;.	D	153	ENSP00000360616:E153D;ENSP00000316696:E153D;ENSP00000316915:E153D;ENSP00000360605:E153D;ENSP00000360601:E153D;ENSP00000360610:E153D;ENSP00000360608:E153D;ENSP00000360614:E153D;ENSP00000360615:E153D	ENSP00000316696:E153D	E	+	3	2	GRIN1	139160064	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.850000	0.55918	1.787000	0.52448	0.313000	0.20887	GAG		GRIN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055267.3	NM_007327	
TMTC4	84899	hgsc.bcm.edu	37	13	101287135	101287135	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr13:101287135A>G	ENST00000376234.3	-	11	1562	c.1373T>C	c.(1372-1374)gTg>gCg	p.V458A	TMTC4_ENST00000462211.1_5'UTR|TMTC4_ENST00000328767.5_Missense_Mutation_p.V347A|TMTC4_ENST00000342624.5_Missense_Mutation_p.V477A	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	458						integral component of membrane (GO:0016021)		p.V477A(1)		breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCTGCGCAGCACACATCTCAG	0.488																																					p.V477A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1430C	13						.						118.0	117.0	117.0					13																	101287135		2203	4300	6503	100085136	SO:0001583	missense	84899	exon12				CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1373T>C	13.37:g.101287135A>G	ENSP00000365408:p.Val458Ala	Somatic		Capture	SOLID	Phase_I	100085136	NM_032813	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	ENST00000376234.3	37	CCDS41904.1	.	.	.	.	.	.	.	.	.	.	A	10.78	1.446526	0.25987	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	T;T;T	0.52754	0.65;0.65;0.65	5.55	5.55	0.83447	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.686850	0.15656	N	0.251121	T	0.32675	0.0837	N	0.25789	0.76	0.20074	N	0.999933	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.001;0.001;0.002	T	0.17048	-1.0382	10	0.14252	T	0.57	.	10.4468	0.44499	0.918:0.0:0.082:0.0	.	347;458;458;477	B7Z666;Q5T4D3-2;Q5T4D3;Q5T4D3-3	.;.;TMTC4_HUMAN;.	A	458;477;347	ENSP00000365408:V458A;ENSP00000343871:V477A;ENSP00000365409:V347A	ENSP00000365409:V347A	V	-	2	0	TMTC4	100085136	0.668000	0.27493	0.497000	0.27552	0.030000	0.12068	4.529000	0.60588	2.134000	0.65973	0.456000	0.33151	GTG		TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2	NM_032813	
SACS	26278	hgsc.bcm.edu	37	13	23914494	23914494	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr13:23914494T>C	ENST00000382292.3	-	9	3794	c.3521A>G	c.(3520-3522)aAa>aGa	p.K1174R	SACS_ENST00000402364.1_Missense_Mutation_p.K424R|SACS_ENST00000382298.3_Missense_Mutation_p.K1174R			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1174					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GAGATCTCCTTTCCAGACCAA	0.433																																					p.K1174R												.	.	0			c.A3521G	13						.						76.0	75.0	75.0					13																	23914494		2203	4300	6503	22812494	SO:0001583	missense	26278	exon10			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.3521A>G	13.37:g.23914494T>C	ENSP00000371729:p.Lys1174Arg	Somatic		Capture	SOLID	Phase_I	22812494	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	T	3.951	-0.012256	0.07727	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.88046	-2.18;-2.33;-2.18	6.16	4.99	0.66335	.	0.111403	0.64402	D	0.000004	T	0.78773	0.4336	L	0.48362	1.52	0.27584	N	0.949481	B	0.09022	0.002	B	0.04013	0.001	T	0.60831	-0.7185	10	0.06891	T	0.86	.	7.4434	0.27196	0.1269:0.0665:0.0:0.8066	.	1174	Q9NZJ4	SACS_HUMAN	R	1174;424;1174	ENSP00000371729:K1174R;ENSP00000385844:K424R;ENSP00000371735:K1174R	ENSP00000371729:K1174R	K	-	2	0	SACS	22812494	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	1.979000	0.40608	1.156000	0.42514	0.528000	0.53228	AAA		SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
SACS	26278	hgsc.bcm.edu	37	13	23928841	23928841	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr13:23928841T>G	ENST00000382292.3	-	7	2183	c.1910A>C	c.(1909-1911)aAg>aCg	p.K637T	SACS_ENST00000402364.1_5'UTR|SACS_ENST00000382298.3_Missense_Mutation_p.K637T|SACS_ENST00000476776.1_5'UTR			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	637					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.K490T(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GTGTGCACACTTCCGCAGCAC	0.577																																					p.K637T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1910C	13						.						59.0	57.0	58.0					13																	23928841		2203	4300	6503	22826841	SO:0001583	missense	26278	exon8			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.1910A>C	13.37:g.23928841T>G	ENSP00000371729:p.Lys637Thr	Somatic		Capture	SOLID	Phase_I	22826841	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.31|13.31	2.198993|2.198993	0.38806|0.38806	.|.	.|.	ENSG00000151835|ENSG00000151835	ENST00000455470|ENST00000382292;ENST00000382298;ENST00000423156	.|T;T;T	.|0.17054	.|2.3;2.3;2.3	5.74|5.74	4.57|4.57	0.56435|0.56435	.|.	.|0.096228	.|0.64402	.|D	.|0.000001	T|T	0.30696|0.30696	0.0773|0.0773	L|L	0.61036|0.61036	1.89|1.89	0.40544|0.40544	D|D	0.981051|0.981051	.|D;P;B	.|0.54601	.|0.967;0.589;0.389	.|P;B;B	.|0.54965	.|0.765;0.372;0.093	T|T	0.04537|0.04537	-1.0944|-1.0944	5|10	.|0.54805	.|T	.|0.06	.|.	11.6919|11.6919	0.51521|0.51521	0.0:0.0688:0.0:0.9312|0.0:0.0688:0.0:0.9312	.|.	.|536;424;637	.|B2REB1;E9PAL4;Q9NZJ4	.|.;.;SACS_HUMAN	D|T	536|637;637;261	.|ENSP00000371729:K637T;ENSP00000371735:K637T;ENSP00000390925:K261T	.|ENSP00000371729:K637T	E|K	-|-	3|2	2|0	SACS|SACS	22826841|22826841	1.000000|1.000000	0.71417|0.71417	0.624000|0.624000	0.29186|0.29186	0.979000|0.979000	0.70002|0.70002	4.896000|4.896000	0.63222|0.63222	1.120000|1.120000	0.41904|0.41904	0.459000|0.459000	0.35465|0.35465	GAA|AAG		SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
SPATA13	221178	hgsc.bcm.edu	37	13	24864904	24864904	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr13:24864904C>A	ENST00000382095.4	+	8	1494	c.1087C>A	c.(1087-1089)Ctg>Atg	p.L363M	SPATA13_ENST00000409126.1_Missense_Mutation_p.L223M|SPATA13_ENST00000399949.2_Missense_Mutation_p.L285M|SPATA13_ENST00000382108.3_Missense_Mutation_p.L988M|SPATA13_ENST00000343003.6_Missense_Mutation_p.L307M|SPATA13_ENST00000424834.2_Missense_Mutation_p.L988M|RP11-307N16.6_ENST00000382141.4_Missense_Mutation_p.L866M	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	363	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.L363M(1)		breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		AGCCTGCCGCCTGCTGCAGCA	0.567																																					p.L988M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2962A	13						.						66.0	69.0	68.0					13																	24864904		2203	4300	6503	23762904	SO:0001583	missense	221178	exon9			AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.1087C>A	13.37:g.24864904C>A	ENSP00000371527:p.Leu363Met	Somatic		Capture	SOLID	Phase_I	23762904	NM_001166271	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	ENST00000382095.4	37	CCDS9305.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.9|20.9	4.069386|4.069386	0.76301|0.76301	.|.	.|.	ENSG00000182957|ENSG00000182957	ENST00000382108;ENST00000382095;ENST00000434675;ENST00000438694;ENST00000399949;ENST00000409126;ENST00000343003|ENST00000424834	T;T;T;T;T;T|.	0.64085|.	-0.08;-0.08;-0.08;-0.08;-0.08;-0.08|.	5.34|5.34	4.5|4.5	0.54988|0.54988	Dbl homology (DH) domain (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73799|0.73799	0.3633|0.3633	M|M	0.83852|0.83852	2.665|2.665	0.53005|0.53005	D|D	0.999965|0.999965	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;0.999;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	0.999;1.0;0.999;1.0;1.0;1.0|.	T|T	0.74999|0.74999	-0.3472|-0.3472	10|5	0.40728|.	T|.	0.16|.	.|.	9.6547|9.6547	0.39919|0.39919	0.0:0.8235:0.0:0.1765|0.0:0.8235:0.0:0.1765	.|.	223;307;247;309;285;363|.	E9PFR9;Q96N96-3;Q96N96-5;Q96N96-4;Q96N96-2;Q96N96|.	.;.;.;.;.;SPT13_HUMAN|.	M|H	988;363;261;309;285;223;307|1025	ENSP00000371542:L988M;ENSP00000371527:L363M;ENSP00000401605:L261M;ENSP00000382830:L285M;ENSP00000386471:L223M;ENSP00000343631:L307M|.	ENSP00000343631:L307M|.	L|P	+|+	1|2	2|0	SPATA13|SPATA13	23762904|23762904	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	3.045000|3.045000	0.49838|0.49838	1.264000|1.264000	0.44198|0.44198	0.555000|0.555000	0.69702|0.69702	CTG|CCT		SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044180.2	NM_153023	
SUPT20H	55578	hgsc.bcm.edu	37	13	37614565	37614565	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr13:37614565T>A	ENST00000350612.6	-	9	764	c.544A>T	c.(544-546)Agt>Tgt	p.S182C	SUPT20H_ENST00000360252.4_Missense_Mutation_p.S183C|SUPT20H_ENST00000470359.2_5'UTR|SUPT20H_ENST00000356185.3_Missense_Mutation_p.S183C|SUPT20H_ENST00000475892.1_Missense_Mutation_p.S182C|SUPT20H_ENST00000542180.1_Missense_Mutation_p.S170C|SUPT20H_ENST00000464744.1_Missense_Mutation_p.S183C	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	182					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										TGGTTATCACTTGTTATTGAA	0.244																																					p.S183C												.	.	0			c.A547T	13						.						39.0	43.0	42.0					13																	37614565		2198	4291	6489	36512565	SO:0001583	missense	55578	exon9			AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.544A>T	13.37:g.37614565T>A	ENSP00000218894:p.Ser182Cys	Somatic		Capture	SOLID	Phase_I	36512565	NM_017569	E7ER46|Q71RF3|Q9Y6A6	Missense_Mutation	SNP	ENST00000350612.6	37	CCDS31959.1	.	.	.	.	.	.	.	.	.	.	T	32	5.164858	0.94727	.	.	ENSG00000102710	ENST00000360252;ENST00000475892;ENST00000350612;ENST00000356185;ENST00000536874;ENST00000464744;ENST00000542180;ENST00000497318	T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78	6.1	6.1	0.99115	.	0.000000	0.85682	D	0.000000	T	0.71558	0.3354	M	0.80183	2.485	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.83275	0.986;0.987;0.976;0.996;0.996;0.996	T	0.75411	-0.3327	10	0.87932	D	0	-7.8871	16.686	0.85306	0.0:0.0:0.0:1.0	.	170;182;182;183;183;182	B4E2D5;B3KNI1;E7ER46;A8K8L1;Q8NEM7-2;Q8NEM7	.;.;.;.;.;FA48A_HUMAN	C	183;182;182;183;182;183;170;183	ENSP00000353388:S183C;ENSP00000417510:S182C;ENSP00000218894:S182C;ENSP00000348512:S183C;ENSP00000419754:S183C;ENSP00000439000:S170C;ENSP00000420170:S183C	ENSP00000218894:S182C	S	-	1	0	FAM48A	36512565	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.985000	0.88162	2.340000	0.79590	0.528000	0.53228	AGT		SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354766.1	NM_017569	
PCDH9	5101	hgsc.bcm.edu	37	13	66879116	66879116	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr13:66879116A>T	ENST00000377865.2	-	4	3519	c.3385T>A	c.(3385-3387)Tgc>Agc	p.C1129S	PCDH9_ENST00000328454.5_Missense_Mutation_p.C1095S|PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000456367.1_Missense_Mutation_p.C1095S|PCDH9_ENST00000544246.1_Missense_Mutation_p.C1129S			Q9HC56	PCDH9_HUMAN	protocadherin 9	1129					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.C1129S(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TCTTGAGTGCACATCTCTGTA	0.453																																					p.C1095S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3283A	13						.						65.0	59.0	61.0					13																	66879116		2203	4300	6503	65777117	SO:0001583	missense	5101	exon4			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3385T>A	13.37:g.66879116A>T	ENSP00000367096:p.Cys1129Ser	Somatic		Capture	SOLID	Phase_I	65777117	NM_020403	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	A	17.85	3.491189	0.64074	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	D;D;D;D	0.94966	-3.57;-3.57;-3.44;-3.44	6.07	6.07	0.98685	.	0.000000	0.53938	D	0.000052	D	0.93387	0.7891	M	0.65677	2.01	0.48975	D	0.999736	B;P;B	0.34587	0.384;0.458;0.384	B;B;B	0.31869	0.088;0.137;0.088	D	0.93115	0.6520	10	0.87932	D	0	.	16.6277	0.84984	1.0:0.0:0.0:0.0	.	1087;1095;1129	B7ZM79;Q9HC56-2;Q9HC56	.;.;PCDH9_HUMAN	S	1129;1129;1095;1095	ENSP00000442186:C1129S;ENSP00000367096:C1129S;ENSP00000401699:C1095S;ENSP00000332060:C1095S	ENSP00000332060:C1095S	C	-	1	0	PCDH9	65777117	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.330000	0.79161	0.528000	0.53228	TGC		PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
LMO7	4008	hgsc.bcm.edu	37	13	76335151	76335151	+	De_novo_Start_OutOfFrame	SNP	T	T	G	rs559563276	byFrequency	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr13:76335151T>G	ENST00000321797.8	+	0	316				LMO7_ENST00000357063.3_Missense_Mutation_p.D150E|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000377534.3_Missense_Mutation_p.D150E|LMO7_ENST00000341547.4_Missense_Mutation_p.D150E|LMO7_ENST00000526202.1_Missense_Mutation_p.D59E|LMO7_ENST00000465261.2_De_novo_Start_OutOfFrame			Q8WWI1	LMO7_HUMAN	LIM domain 7						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		ATCTACAGGATTTATCAAATC	0.333																																					p.D150E												.	.	0			c.T450G	13						.						68.0	66.0	67.0					13																	76335151		2203	4300	6503	75233152			4008	exon5			AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.-406T>G	13.37:g.76335151T>G		Somatic		Capture	SOLID	Phase_I	75233152	NM_005358	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	37		.	.	.	.	.	.	.	.	.	.	T	14.88	2.668121	0.47677	.	.	ENSG00000136153	ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000526202	T;T;T;T;T	0.62639	0.16;0.16;0.16;0.16;0.01	5.75	4.53	0.55603	.	0.133653	0.46442	D	0.000293	T	0.65688	0.2715	N	0.17674	0.51	0.41138	D	0.985937	D;D;D	0.89917	0.989;1.0;1.0	D;D;D	0.91635	0.91;0.996;0.999	T	0.69562	-0.5112	10	0.87932	D	0	-12.6265	12.03	0.53392	0.0:0.0682:0.0:0.9318	.	59;150;98	E9PMS6;Q8WWI1-3;F8J2B5	.;.;.	E	150;150;150;98;59	ENSP00000342112:D150E;ENSP00000349571:D150E;ENSP00000366757:D150E;ENSP00000366719:D98E;ENSP00000431129:D59E	ENSP00000342112:D150E	D	+	3	2	LMO7	75233152	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.048000	0.49862	0.957000	0.37930	0.528000	0.53228	GAT		LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
NALCN	259232	hgsc.bcm.edu	37	13	101728228	101728228	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr13:101728228T>G	ENST00000251127.6	-	35	4031	c.3950A>C	c.(3949-3951)aAa>aCa	p.K1317T		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1317					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ACTTACATGTTTTCCACAGAT	0.323																																					p.K1317T												.	.	0			c.A3950C	13						.						103.0	100.0	101.0					13																	101728228		2203	4296	6499	100526229	SO:0001583	missense	259232	exon35			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.3950A>C	13.37:g.101728228T>G	ENSP00000251127:p.Lys1317Thr	Somatic		Capture	SOLID	Phase_I	100526229	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.117371	0.77323	.	.	ENSG00000102452	ENST00000251127	D	0.98400	-4.91	5.93	5.93	0.95920	Ion transport (1);	0.087045	0.85682	D	0.000000	D	0.98723	0.9571	M	0.72624	2.21	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	D	0.99795	1.1033	10	0.56958	D	0.05	.	16.3789	0.83431	0.0:0.0:0.0:1.0	.	1317	Q8IZF0	NALCN_HUMAN	T	1317	ENSP00000251127:K1317T	ENSP00000251127:K1317T	K	-	2	0	NALCN	100526229	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.694000	0.84235	2.267000	0.75376	0.533000	0.62120	AAA		NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
PYROXD2	84795	hgsc.bcm.edu	37	10	100143620	100143620	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:100143620C>T	ENST00000370575.4	-	16	1729	c.1681G>A	c.(1681-1683)Ggt>Agt	p.G561S	PYROXD2_ENST00000483923.1_5'UTR	NM_032709.2	NP_116098.2	Q8N2H3	PYRD2_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 2	561							oxidoreductase activity (GO:0016491)	p.G561S(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	12						CCCATCACACCTCCTCCTGGA	0.557																																					p.G561S												C10orf33,central_nervous_system,brain,Substitution - Missense,+1	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1681A	10						.						136.0	130.0	132.0					10																	100143620		2203	4300	6503	100133610	SO:0001583	missense	84795	exon16			AK074429	CCDS7474.1	10q24.2	2009-04-22	2009-04-22	2009-04-22	ENSG00000119943	ENSG00000119943			23517	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 33"""	C10orf33			Standard	NM_032709		Approved	FLJ23849	uc001kpc.3	Q8N2H3	OTTHUMG00000018877	ENST00000370575.4:c.1681G>A	10.37:g.100143620C>T	ENSP00000359607:p.Gly561Ser	Somatic		Capture	SOLID	Phase_I	100133610	NM_032709	D3DR61|Q5TAA9|Q9BRQ1	Missense_Mutation	SNP	ENST00000370575.4	37	CCDS7474.1	.	.	.	.	.	.	.	.	.	.	C	33	5.214267	0.95104	.	.	ENSG00000119943	ENST00000370575	T	0.61627	0.09	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.77778	0.4181	M	0.86268	2.805	0.80722	D	1	D	0.65815	0.995	P	0.61722	0.893	T	0.81780	-0.0776	10	0.87932	D	0	-26.1769	18.7661	0.91873	0.0:1.0:0.0:0.0	.	561	Q8N2H3	PYRD2_HUMAN	S	561	ENSP00000359607:G561S	ENSP00000359607:G561S	G	-	1	0	PYROXD2	100133610	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.968000	0.76086	2.517000	0.84864	0.462000	0.41574	GGT		PYROXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049782.2	NM_032709	
CPN1	1369	hgsc.bcm.edu	37	10	101835814	101835814	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:101835814C>G	ENST00000370418.3	-	2	525	c.274G>C	c.(274-276)Ggc>Cgc	p.G92R		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	92	Catalytic.				response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.G92R(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		AGCTCGCGGCCCAACGCTTCG	0.557																																					p.G92R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G274C	10						.						122.0	102.0	109.0					10																	101835814		2203	4300	6503	101825804	SO:0001583	missense	1369	exon2			X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.274G>C	10.37:g.101835814C>G	ENSP00000359446:p.Gly92Arg	Somatic		Capture	SOLID	Phase_I	101825804	NM_001308	B1AP59	Missense_Mutation	SNP	ENST00000370418.3	37	CCDS7486.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.949836	0.73787	.	.	ENSG00000120054	ENST00000370418	T	0.05786	3.39	5.59	5.59	0.84812	Peptidase M14, carboxypeptidase A (3);	0.000000	0.85682	D	0.000000	T	0.42063	0.1186	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61262	-0.7098	10	0.87932	D	0	-13.8452	19.5966	0.95541	0.0:1.0:0.0:0.0	.	92	P15169	CBPN_HUMAN	R	92	ENSP00000359446:G92R	ENSP00000359446:G92R	G	-	1	0	CPN1	101825804	1.000000	0.71417	1.000000	0.80357	0.080000	0.17528	7.815000	0.86186	2.647000	0.89833	0.655000	0.94253	GGC		CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049828.1	NM_001308	
GBF1	8729	hgsc.bcm.edu	37	10	104135247	104135247	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:104135247G>T	ENST00000369983.3	+	30	4049	c.3789G>T	c.(3787-3789)tgG>tgT	p.W1263C		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	1263					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.W1263C(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		GTGATGACTGGGCCACACTCT	0.587																																					p.W1264C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3792T	10						.						123.0	95.0	104.0					10																	104135247		2203	4300	6503	104125237	SO:0001583	missense	8729	exon30			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.3789G>T	10.37:g.104135247G>T	ENSP00000359000:p.Trp1263Cys	Somatic		Capture	SOLID	Phase_I	104125237	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	37	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.261771	0.80358	.	.	ENSG00000107862	ENST00000369983	T	0.12879	2.64	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.45094	0.1325	M	0.86097	2.795	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.994	T	0.47497	-0.9113	10	0.87932	D	0	-7.0243	19.3333	0.94303	0.0:0.0:1.0:0.0	.	1263;1263;1263	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	C	1263	ENSP00000359000:W1263C	ENSP00000359000:W1263C	W	+	3	0	GBF1	104125237	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	9.657000	0.98554	2.793000	0.96121	0.655000	0.94253	TGG		GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
SUFU	51684	hgsc.bcm.edu	37	10	104268951	104268951	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:104268951T>C	ENST00000369902.3	+	2	374	c.208T>C	c.(208-210)Tat>Cat	p.Y70H	SUFU_ENST00000423559.2_Missense_Mutation_p.Y70H|SUFU_ENST00000369899.2_Missense_Mutation_p.Y70H	NM_016169.3	NP_057253.2	Q9UMX1	SUFU_HUMAN	suppressor of fused homolog (Drosophila)	70					cytoplasmic sequestering of transcription factor (GO:0042994)|heart looping (GO:0001947)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skin development (GO:0043588)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|primary cilium (GO:0072372)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(7)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	24		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		CCCCTTGGACTATGTTAGCAT	0.502			"""D, F, S"""		medulloblastoma	medulloblastoma			Medulloblastoma, associated with Germline SUFU Mutation																												p.Y70H		yes	Rec	yes	Medulloblastoma predisposition	10	10q24.32	51684	suppressor of fused homolog (Drosophila)		O	.	.	0			c.T208C	10						.						152.0	133.0	140.0					10																	104268951		2203	4300	6503	104258941	SO:0001583	missense	51684	exon2	Familial Cancer Database		AF175770	CCDS7537.1, CCDS53571.1	10q24.32	2014-09-17			ENSG00000107882	ENSG00000107882			16466	protein-coding gene	gene with protein product		607035				15367681	Standard	NM_016169		Approved	SUFUH, SUFUXL, PRO1280	uc001kvy.2	Q9UMX1	OTTHUMG00000018966	ENST00000369902.3:c.208T>C	10.37:g.104268951T>C	ENSP00000358918:p.Tyr70His	Somatic		Capture	SOLID	Phase_I	104258941	NM_016169	Q7LCP7|Q9NT90|Q9NZ07|Q9UHK2|Q9UHM8|Q9UMY0	Missense_Mutation	SNP	ENST00000369902.3	37	CCDS7537.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.433968	0.83776	.	.	ENSG00000107882	ENST00000369902;ENST00000369899;ENST00000423559	D;D;D	0.81908	-1.55;-1.55;-1.55	5.44	5.44	0.79542	Suppressor of fused domain (1);	0.000000	0.85682	D	0.000000	D	0.91509	0.7319	M	0.86651	2.83	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.995;0.998	D	0.90686	0.4609	10	0.26408	T	0.33	-10.1074	15.4866	0.75573	0.0:0.0:0.0:1.0	.	70;70;70	Q9UMX1;Q9UMX1-2;Q9UMX1-3	SUFU_HUMAN;.;.	H	70	ENSP00000358918:Y70H;ENSP00000358915:Y70H;ENSP00000411597:Y70H	ENSP00000358915:Y70H	Y	+	1	0	SUFU	104258941	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.291000	0.78721	2.056000	0.61249	0.459000	0.35465	TAT		SUFU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050089.1	NM_016169	
OBFC1	79991	hgsc.bcm.edu	37	10	105677321	105677321	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:105677321T>C	ENST00000224950.3	-	2	199	c.32A>G	c.(31-33)gAg>gGg	p.E11G	OBFC1_ENST00000369764.1_Missense_Mutation_p.E11G|OBFC1_ENST00000466828.1_5'UTR	NM_024928.4	NP_079204.2	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold containing 1	11					positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromosome, telomeric region (GO:0000784)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)|single-stranded telomeric DNA binding (GO:0043047)	p.E11G(1)		large_intestine(3)|lung(7)|ovary(1)|pancreas(2)	13		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		GGAAGGGGTCTCCTCTTCACA	0.532																																					p.E11G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A32G	10						.						92.0	91.0	92.0					10																	105677321		2203	4300	6503	105667311	SO:0001583	missense	79991	exon2			BC017400	CCDS7552.1	10q25.1	2011-06-14				ENSG00000107960			26200	protein-coding gene	gene with protein product		613128				12477932	Standard	NM_024928		Approved	FLJ22559, bA541N10.2	uc001kxm.3	Q9H668		ENST00000224950.3:c.32A>G	10.37:g.105677321T>C	ENSP00000224950:p.Glu11Gly	Somatic		Capture	SOLID	Phase_I	105667311	NM_024928	D3DR99|Q5TCZ0	Missense_Mutation	SNP	ENST00000224950.3	37	CCDS7552.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.689490	0.88735	.	.	ENSG00000107960	ENST00000224950;ENST00000369764	T;T	0.39056	1.1;1.1	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.62183	0.2407	M	0.76574	2.34	0.58432	D	0.999995	D	0.89917	1.0	D	0.69307	0.963	T	0.66208	-0.5981	10	0.66056	D	0.02	-24.192	12.5867	0.56421	0.0:0.0:0.0:1.0	.	11	Q9H668	STN1_HUMAN	G	11	ENSP00000224950:E11G;ENSP00000358779:E11G	ENSP00000224950:E11G	E	-	2	0	OBFC1	105667311	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.074000	0.71253	2.161000	0.67846	0.459000	0.35465	GAG		OBFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050174.1	NM_024928	
TECTB	6975	hgsc.bcm.edu	37	10	114053756	114053756	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:114053756G>A	ENST00000369422.3	+	6	608	c.608G>A	c.(607-609)aGc>aAc	p.S203N		NM_058222.1	NP_478129.1	Q96PL2	TECTB_HUMAN	tectorin beta	203	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	19		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)		GTCTTGAACAGCTGTTGGGCC	0.438																																					p.S203N												.	.	0			c.G608A	10						.						111.0	108.0	109.0					10																	114053756		2203	4300	6503	114043746	SO:0001583	missense	6975	exon6			AF312827	CCDS7571.1	10q25-q26	2005-06-09			ENSG00000119913	ENSG00000119913			11721	protein-coding gene	gene with protein product		602653				9079715	Standard	NM_058222		Approved		uc001kzr.1	Q96PL2	OTTHUMG00000019056	ENST00000369422.3:c.608G>A	10.37:g.114053756G>A	ENSP00000358430:p.Ser203Asn	Somatic		Capture	SOLID	Phase_I	114043746	NM_058222	Q5VW53	Missense_Mutation	SNP	ENST00000369422.3	37	CCDS7571.1	.	.	.	.	.	.	.	.	.	.	G	5.580	0.291796	0.10567	.	.	ENSG00000119913	ENST00000369422	D	0.83914	-1.78	5.43	5.43	0.79202	Endoglin/CD105 antigen conserved site (1);Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.042505	0.85682	D	0.000000	T	0.56920	0.2018	N	0.02103	-0.685	0.38185	D	0.939724	B	0.06786	0.001	B	0.10450	0.005	T	0.58912	-0.7552	10	0.09084	T	0.74	.	8.7262	0.34471	0.1284:0.0:0.8716:0.0	.	203	Q96PL2	TECTB_HUMAN	N	203	ENSP00000358430:S203N	ENSP00000358430:S203N	S	+	2	0	TECTB	114043746	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.859000	0.69539	2.721000	0.93114	0.655000	0.94253	AGC		TECTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050381.1	NM_058222	
PLEKHS1	79949	hgsc.bcm.edu	37	10	115527215	115527215	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:115527215A>C	ENST00000369310.3	+	4	880	c.318A>C	c.(316-318)gaA>gaC	p.E106D	PLEKHS1_ENST00000361048.1_Missense_Mutation_p.E112D|PLEKHS1_ENST00000369312.4_Missense_Mutation_p.E24D	NM_182601.1	NP_872407.1	Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	106	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.																CTAACAGGGAATACTTCCTCA	0.393																																					p.E24D												.	.	0			c.A72C	10						.						87.0	85.0	86.0					10																	115527215		2203	4300	6503	115517205	SO:0001583	missense	79949	exon3			AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000369310.3:c.318A>C	10.37:g.115527215A>C	ENSP00000358316:p.Glu106Asp	Somatic		Capture	SOLID	Phase_I	115517205	NM_001193435	A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Missense_Mutation	SNP	ENST00000369310.3	37	CCDS53580.1	.	.	.	.	.	.	.	.	.	.	A	0.086	-1.175724	0.01646	.	.	ENSG00000148735	ENST00000361048;ENST00000369312;ENST00000369310	T;T;T	0.26810	1.71;1.71;1.71	5.85	-11.7	0.00046	.	0.379281	0.27549	N	0.018877	T	0.04318	0.0119	N	0.02011	-0.69	0.09310	N	0.999999	B;B;B	0.14012	0.009;0.004;0.001	B;B;B	0.14023	0.01;0.005;0.003	T	0.45862	-0.9232	10	0.08837	T	0.75	-29.7692	2.6077	0.04882	0.1345:0.2508:0.3328:0.2819	.	106;106;112	Q5SXH7-5;Q5SXH7-2;Q5SXH7-4	.;.;.	D	112;24;106	ENSP00000354332:E112D;ENSP00000358318:E24D;ENSP00000358316:E106D	ENSP00000354332:E112D	E	+	3	2	C10orf81	115517205	0.032000	0.19561	0.005000	0.12908	0.472000	0.32918	-1.501000	0.02281	-5.111000	0.00021	-0.290000	0.09829	GAA		PLEKHS1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050432.1	NM_024889	
PNLIP	5406	hgsc.bcm.edu	37	10	118314941	118314941	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:118314941C>T	ENST00000369221.2	+	8	761	c.733C>T	c.(733-735)Cca>Tca	p.P245S		NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	245					intestinal cholesterol absorption (GO:0030299)|lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|triglyceride lipase activity (GO:0004806)	p.P245A(2)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)	AGATTTCTTTCCAAATGGAGG	0.388																																					p.P245S												.	.	2	Substitution - Missense(2)	lung(2)	c.C733T	10						.						121.0	123.0	122.0					10																	118314941		2203	4300	6503	118304931	SO:0001583	missense	5406	exon8			BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535	3.1.1.3		9155	protein-coding gene	gene with protein product		246600				1783385	Standard	NM_000936		Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.733C>T	10.37:g.118314941C>T	ENSP00000358223:p.Pro245Ser	Somatic		Capture	SOLID	Phase_I	118304931	NM_000936	Q5VSQ2	Missense_Mutation	SNP	ENST00000369221.2	37	CCDS7594.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.821870	0.90873	.	.	ENSG00000175535	ENST00000369221	D	0.92348	-3.02	6.16	6.16	0.99307	Lipase, N-terminal (1);	0.000000	0.64402	D	0.000001	D	0.98002	0.9342	H	0.98577	4.27	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98645	1.0677	10	0.87932	D	0	.	19.6313	0.95704	0.0:1.0:0.0:0.0	.	245	P16233	LIPP_HUMAN	S	245	ENSP00000358223:P245S	ENSP00000358223:P245S	P	+	1	0	PNLIP	118304931	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	4.624000	0.61254	2.937000	0.99478	0.650000	0.86243	CCA		PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050524.1	NM_000936	
KIAA1598	57698	hgsc.bcm.edu	37	10	118689402	118689402	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:118689402A>C	ENST00000355371.4	-	10	1467	c.970T>G	c.(970-972)Tat>Gat	p.Y324D	KIAA1598_ENST00000497044.1_5'UTR|KIAA1598_ENST00000392903.2_Missense_Mutation_p.Y324D|KIAA1598_ENST00000260777.10_Missense_Mutation_p.Y324D|KIAA1598_ENST00000392901.4_Missense_Mutation_p.Y264D	NM_001127211.2|NM_001258298.1|NM_001258299.1	NP_001120683.1|NP_001245227.1|NP_001245228.1	A0MZ66	SHOT1_HUMAN	KIAA1598	324					axon guidance (GO:0007411)|regulation of establishment of cell polarity (GO:2000114)|regulation of neuron migration (GO:2001222)	axonal growth cone (GO:0044295)				endometrium(1)|kidney(1)|large_intestine(5)|lung(3)	10				all cancers(201;0.00494)		GAATTCTGATATTTCAATTCC	0.348																																					p.Y324D												.	.	0			c.T970G	10						.						183.0	176.0	178.0					10																	118689402		2202	4298	6500	118679392	SO:0001583	missense	57698	exon10			BC022348	CCDS31293.1, CCDS44482.1, CCDS58097.1, CCDS73207.1, CCDS73208.1	10q26.12	2007-01-30			ENSG00000187164	ENSG00000187164			29319	protein-coding gene	gene with protein product		611171				10997877, 17030985	Standard	NM_001127211		Approved	shootin1, shootin-1	uc009xyw.4	A0MZ66	OTTHUMG00000019114	ENST00000355371.4:c.970T>G	10.37:g.118689402A>C	ENSP00000347532:p.Tyr324Asp	Somatic		Capture	SOLID	Phase_I	118679392	NM_018330	A8MYU7|B3KRD3|B3KRH2|B3KTE0|B3KTJ7|B3KTJ8|B4E3U1|B7Z7Z9|Q68DG1|Q6PIM5|Q9HCH4|Q9NUV0	Missense_Mutation	SNP	ENST00000355371.4	37	CCDS44482.1	.	.	.	.	.	.	.	.	.	.	A	15.42	2.827775	0.50845	.	.	ENSG00000187164	ENST00000392903;ENST00000260777;ENST00000355371;ENST00000392901	T;T;T;T	0.73575	2.89;2.88;2.89;-0.76	5.59	5.59	0.84812	.	0.456485	0.25549	N	0.029908	T	0.64494	0.2603	L	0.29908	0.895	0.33266	D	0.560323	P;P;P	0.47191	0.891;0.763;0.728	B;B;B	0.41088	0.347;0.241;0.24	T	0.74297	-0.3711	10	0.38643	T	0.18	-9.0844	14.2954	0.66308	1.0:0.0:0.0:0.0	.	324;324;294	A0MZ66;A0MZ66-2;A0MZ66-6	SHOT1_HUMAN;.;.	D	324;324;324;264	ENSP00000376636:Y324D;ENSP00000260777:Y324D;ENSP00000347532:Y324D;ENSP00000376635:Y264D	ENSP00000260777:Y324D	Y	-	1	0	KIAA1598	118679392	1.000000	0.71417	0.900000	0.35374	0.515000	0.34225	5.819000	0.69243	2.254000	0.74563	0.459000	0.35465	TAT		KIAA1598-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018330	
FAM204A	63877	hgsc.bcm.edu	37	10	120085686	120085686	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:120085686T>A	ENST00000369183.4	-	7	782	c.523A>T	c.(523-525)Aac>Tac	p.N175Y	FAM204A_ENST00000469758.1_5'UTR|FAM204A_ENST00000369172.4_Missense_Mutation_p.N175Y	NM_022063.2	NP_071346.1	Q9H8W3	F204A_HUMAN	family with sequence similarity 204, member A	175								p.N175Y(1)		kidney(1)|large_intestine(5)|lung(4)|ovary(1)	11						GCTAGCTGGTTGCTGAGTTCC	0.363																																					p.N175Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A523T	10						.						116.0	114.0	115.0					10																	120085686		2203	4300	6503	120075676	SO:0001583	missense	63877	exon6			AK023250	CCDS7605.1	10q26.12	2011-06-01	2011-06-01	2011-06-01	ENSG00000165669	ENSG00000165669			25794	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 84"""	C10orf84		12477932	Standard	NM_022063		Approved	FLJ13188, bA319I23.1	uc010qss.1	Q9H8W3	OTTHUMG00000019131	ENST00000369183.4:c.523A>T	10.37:g.120085686T>A	ENSP00000358183:p.Asn175Tyr	Somatic		Capture	SOLID	Phase_I	120075676	NM_001134672	D3DRC6|Q5T373|Q9H5V5	Missense_Mutation	SNP	ENST00000369183.4	37	CCDS7605.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.330451	0.81690	.	.	ENSG00000165669	ENST00000369183;ENST00000369172	.	.	.	5.72	4.59	0.56863	.	0.089544	0.85682	D	0.000000	T	0.65863	0.2732	M	0.76574	2.34	0.39731	D	0.971601	D	0.56968	0.978	P	0.55161	0.77	T	0.69540	-0.5118	9	0.72032	D	0.01	-15.3591	6.403	0.21648	0.0:0.286:0.0:0.714	.	175	Q9H8W3	F204A_HUMAN	Y	175	.	ENSP00000358170:N175Y	N	-	1	0	FAM204A	120075676	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.567000	0.45956	1.123000	0.41961	0.529000	0.55759	AAC		FAM204A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050596.2	NM_022063	
ANKRD16	54522	hgsc.bcm.edu	37	10	5925011	5925011	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:5925011T>A	ENST00000380094.5	-	5	1350	c.807A>T	c.(805-807)agA>agT	p.R269S	ANKRD16_ENST00000191063.8_Missense_Mutation_p.R269S|ANKRD16_ENST00000380092.4_Missense_Mutation_p.R269S	NM_019046.2	NP_061919.1	Q6P6B7	ANR16_HUMAN	ankyrin repeat domain 16	269								p.R269S(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(3)|stomach(2)	12						TTGATGTGGCTCTCACATCTA	0.522																																					p.R269S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A807T	10						.						169.0	132.0	144.0					10																	5925011		2203	4300	6503	5965017	SO:0001583	missense	54522	exon5			AL137614	CCDS31136.1, CCDS31137.1	10p15.1	2013-01-10			ENSG00000134461	ENSG00000134461		"""Ankyrin repeat domain containing"""	23471	protein-coding gene	gene with protein product							Standard	NM_019046		Approved	DKFZP434N1511	uc010qat.2	Q6P6B7	OTTHUMG00000017610	ENST00000380094.5:c.807A>T	10.37:g.5925011T>A	ENSP00000369436:p.Arg269Ser	Somatic		Capture	SOLID	Phase_I	5965017	NM_001009943	A6NEF0|F8WEI4|Q9NT01	Missense_Mutation	SNP	ENST00000380094.5	37	CCDS31136.1	.	.	.	.	.	.	.	.	.	.	T	11.33	1.606304	0.28623	.	.	ENSG00000134461	ENST00000380094;ENST00000380092;ENST00000191063	T;T;T	0.65178	2.45;2.45;-0.14	5.33	-1.09	0.09904	Ankyrin repeat-containing domain (4);	0.094831	0.64402	D	0.000001	T	0.52853	0.1760	L	0.33485	1.01	0.44388	D	0.997297	P;P	0.38223	0.623;0.57	B;B	0.44108	0.441;0.342	T	0.53194	-0.8473	10	0.87932	D	0	-6.3223	10.9237	0.47180	0.0:0.4252:0.0:0.5748	.	269;269	Q6P6B7;F8WEI4	ANR16_HUMAN;.	S	269	ENSP00000369436:R269S;ENSP00000369434:R269S;ENSP00000352361:R269S	ENSP00000352361:R269S	R	-	3	2	ANKRD16	5965017	1.000000	0.71417	0.008000	0.14137	0.034000	0.12701	0.565000	0.23578	-0.191000	0.10448	-0.379000	0.06801	AGA		ANKRD16-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046611.2	XM_166138	
ITIH5	80760	hgsc.bcm.edu	37	10	7621800	7621800	+	Silent	SNP	G	G	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:7621800G>A	ENST00000256861.6	-	9	1414	c.1336C>T	c.(1336-1338)Ctg>Ttg	p.L446L	ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000397145.2_Silent_p.L446L|ITIH5_ENST00000397146.2_Silent_p.L446L|ITIH5_ENST00000446830.2_Silent_p.L228L|ITIH5_ENST00000298441.6_Silent_p.L232L	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	446	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.L446L(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TTCTCCAGCAGCCTGAAGTCC	0.617																																					p.L446L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1336T	10						.						122.0	110.0	114.0					10																	7621800		2203	4300	6503	7661806	SO:0001819	synonymous_variant	80760	exon9					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1336C>T	10.37:g.7621800G>A		Somatic		Capture	SOLID	Phase_I	7661806	NM_030569	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	ENST00000256861.6	37																																																																																					ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
PRPF18	8559	hgsc.bcm.edu	37	10	13658460	13658460	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:13658460G>T	ENST00000378572.3	+	9	1015	c.855G>T	c.(853-855)atG>atT	p.M285I		NM_003675.3	NP_003666.1	Q99633	PRP18_HUMAN	pre-mRNA processing factor 18	285					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	potassium channel inhibitor activity (GO:0019870)			central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(5)|prostate(1)	17						GTGTCACTATGGTTGGTATCC	0.418																																					p.M285I												.	.	0			c.G855T	10						.						144.0	133.0	137.0					10																	13658460		2203	4300	6503	13698466	SO:0001583	missense	8559	exon9			U51990	CCDS7100.1	10p12.33	2013-06-10	2013-06-10		ENSG00000165630	ENSG00000165630			17351	protein-coding gene	gene with protein product		604993	"""PRP18 pre-mRNA processing factor 18 homolog (yeast)"", ""PRP18 pre-mRNA processing factor 18 homolog (S. cerevisiae)"""			9000057	Standard	XM_005252634		Approved	hPrp18	uc001imp.3	Q99633	OTTHUMG00000017702	ENST00000378572.3:c.855G>T	10.37:g.13658460G>T	ENSP00000367835:p.Met285Ile	Somatic		Capture	SOLID	Phase_I	13698466	NM_003675	Q5T9P9|Q9BUI9	Missense_Mutation	SNP	ENST00000378572.3	37	CCDS7100.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.745139	0.89663	.	.	ENSG00000165630	ENST00000378572;ENST00000298451	.	.	.	5.06	5.06	0.68205	Prp18 (3);	0.000000	0.85682	D	0.000000	D	0.86456	0.5937	M	0.94021	3.485	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	D	0.90363	0.4375	9	0.87932	D	0	-29.181	18.4128	0.90558	0.0:0.0:1.0:0.0	.	285	Q99633	PRP18_HUMAN	I	285;47	.	ENSP00000298451:M47I	M	+	3	0	PRPF18	13698466	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.761000	0.98940	2.332000	0.79248	0.650000	0.86243	ATG		PRPF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046879.1		
CACNB2	783	hgsc.bcm.edu	37	10	18803172	18803172	+	Silent	SNP	C	C	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:18803172C>T	ENST00000324631.7	+	7	738	c.678C>T	c.(676-678)gaC>gaT	p.D226D	CACNB2_ENST00000352115.6_Intron|CACNB2_ENST00000377319.3_Intron|CACNB2_ENST00000377329.4_Silent_p.D172D|CACNB2_ENST00000377315.4_Silent_p.D178D|RP11-499P20.2_ENST00000425669.1_RNA|CACNB2_ENST00000396576.2_Silent_p.D171D|CACNB2_ENST00000377331.2_Intron|CACNB2_ENST00000377328.1_Intron|CACNB2_ENST00000282343.8_Silent_p.D198D	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit	226					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TAGCTATAGACATAGATGCTA	0.378																																					p.D226D												.	.	0			c.C678T	10						.						106.0	100.0	102.0					10																	18803172		2203	4300	6503	18843178	SO:0001819	synonymous_variant	783	exon7			U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.678C>T	10.37:g.18803172C>T		Somatic		Capture	SOLID	Phase_I	18843178	NM_201596	A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Silent	SNP	ENST00000324631.7	37	CCDS7125.1																																																																																				CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047072.2	NM_000724	
NRP1	8829	hgsc.bcm.edu	37	10	33486611	33486611	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:33486611T>G	ENST00000265371.4	-	13	2416	c.1891A>C	c.(1891-1893)Aag>Cag	p.K631Q	NRP1_ENST00000395995.1_Missense_Mutation_p.K631Q|NRP1_ENST00000374875.1_Missense_Mutation_p.K443Q|NRP1_ENST00000374867.2_Missense_Mutation_p.K631Q|NRP1_ENST00000374822.4_Missense_Mutation_p.K631Q|NRP1_ENST00000374821.5_Missense_Mutation_p.K596Q			O14786	NRP1_HUMAN	neuropilin 1	631					angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	ACCGTGGGCTTTTCTGTGGCC	0.438																																					p.K631Q	Melanoma(104;886 1489 44640 45944 51153)											.	.	0			c.A1891C	10						.						208.0	171.0	184.0					10																	33486611		2203	4300	6503	33526617	SO:0001583	missense	8829	exon12			AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.1891A>C	10.37:g.33486611T>G	ENSP00000265371:p.Lys631Gln	Somatic		Capture	SOLID	Phase_I	33526617	NM_001024628	B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	Missense_Mutation	SNP	ENST00000265371.4	37	CCDS7177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.01|19.01	3.744013|3.744013	0.69418|0.69418	.|.	.|.	ENSG00000099250|ENSG00000099250	ENST00000418675;ENST00000431894|ENST00000265371;ENST00000374875;ENST00000374867;ENST00000395995;ENST00000374828;ENST00000374814;ENST00000374822;ENST00000374821	.|D;D;D;D;D;D	.|0.93906	.|-2.21;-3.31;-2.21;-2.22;-2.57;-2.61	5.93|5.93	4.8|4.8	0.61643|0.61643	.|.	0.466331|0.466331	0.26582|0.26582	N|N	0.023574|0.023574	D|D	0.86184|0.86184	0.5872|0.5872	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	.|P;B;P;P;P;P;B	.|0.38922	.|0.514;0.335;0.634;0.651;0.514;0.514;0.239	.|B;B;B;B;B;B;B	.|0.36766	.|0.075;0.058;0.232;0.216;0.075;0.059;0.035	D|D	0.85147|0.85147	0.0984|0.0984	6|10	.|0.48119	.|T	.|0.1	-19.3818|-19.3818	11.8306|11.8306	0.52293|0.52293	0.0:0.068:0.0:0.932|0.0:0.068:0.0:0.932	.|.	.|624;596;631;631;631;443;631	.|A8K9V7;Q5T7F1;O14786-2;Q68DN3;O14786;Q5JWQ6;E9PEP6	.|.;.;.;.;NRP1_HUMAN;.;.	N|Q	44;62|631;443;631;631;54;102;631;596	.|ENSP00000265371:K631Q;ENSP00000364009:K443Q;ENSP00000364001:K631Q;ENSP00000379317:K631Q;ENSP00000363955:K631Q;ENSP00000363954:K596Q	.|ENSP00000265371:K631Q	K|K	-|-	3|1	2|0	NRP1|NRP1	33526617|33526617	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.565000|0.565000	0.35776|0.35776	2.225000|2.225000	0.42954|0.42954	1.074000|1.074000	0.40909|0.40909	0.533000|0.533000	0.62120|0.62120	AAA|AAG		NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051203.2		
ALOX5	240	hgsc.bcm.edu	37	10	45936836	45936836	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:45936836G>T	ENST00000374391.2	+	9	1283	c.1230G>T	c.(1228-1230)aaG>aaT	p.K410N	ALOX5_ENST00000542434.1_Missense_Mutation_p.K410N	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	410	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	TCAACACCAAGGCCCGTGAGC	0.622																																					p.K410N												.	.	0			c.G1230T	10						.						179.0	167.0	171.0					10																	45936836		2203	4300	6503	45256842	SO:0001583	missense	240	exon9			J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.1230G>T	10.37:g.45936836G>T	ENSP00000363512:p.Lys410Asn	Somatic		Capture	SOLID	Phase_I	45256842	NM_000698	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	37	CCDS7212.1	.	.	.	.	.	.	.	.	.	.	G	18.59	3.657743	0.67586	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	T;T	0.77877	-1.13;-1.13	5.45	2.56	0.30785	Lipoxygenase, C-terminal (3);	0.135328	0.64402	D	0.000007	T	0.79528	0.4461	L	0.46947	1.48	0.58432	D	0.999999	D;D;D	0.69078	0.997;0.988;0.996	D;P;P	0.65684	0.937;0.843;0.861	T	0.76515	-0.2931	10	0.39692	T	0.17	-40.7086	7.0744	0.25197	0.3269:0.0:0.6731:0.0	.	410;410;410	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	N	410	ENSP00000437634:K410N;ENSP00000363512:K410N	ENSP00000363512:K410N	K	+	3	2	ALOX5	45256842	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.313000	0.43735	1.283000	0.44513	0.655000	0.94253	AAG		ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1		
A1CF	29974	hgsc.bcm.edu	37	10	52610453	52610453	+	Intron	SNP	G	G	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:52610453G>C	ENST00000373993.1	-	2	144				A1CF_ENST00000374001.2_Intron|A1CF_ENST00000282641.2_Intron|A1CF_ENST00000395495.1_Intron|A1CF_ENST00000373995.3_Missense_Mutation_p.S32C|A1CF_ENST00000395489.2_Missense_Mutation_p.S17C|A1CF_ENST00000373997.3_Intron			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor						cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						CAAAATGATGGACTGCAAAGC	0.448																																					p.S32C												.	.	0			c.C95G	10						.						152.0	150.0	150.0					10																	52610453		2203	4300	6503	52280459	SO:0001627	intron_variant	29974	exon4			AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.100-6571C>G	10.37:g.52610453G>C		Somatic		Capture	SOLID	Phase_I	52280459	NM_001198820	A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Missense_Mutation	SNP	ENST00000373993.1	37	CCDS7242.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.05|12.05	1.820237|1.820237	0.32145|0.32145	.|.	.|.	ENSG00000148584|ENSG00000148584	ENST00000395488|ENST00000373995;ENST00000395489	.|T;T	.|0.11712	.|2.75;2.78	3.58|3.58	-0.688|-0.688	0.11317|0.11317	.|.	.|.	.|.	.|.	.|.	T|T	0.08714|0.08714	0.0216|0.0216	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	.|P;B	.|0.35894	.|0.526;0.377	.|B;P	.|0.45474	.|0.296;0.482	T|T	0.36089|0.36089	-0.9762|-0.9762	6|9	0.02654|0.72032	T|D	1|0.01	-0.0985|-0.0985	2.0231|2.0231	0.03513|0.03513	0.1055:0.1702:0.388:0.3362|0.1055:0.1702:0.388:0.3362	.|.	.|17;32	.|F8W9F8;Q9NQ94-4	.|.;.	A|C	5|32;17	.|ENSP00000363107:S32C;ENSP00000378868:S17C	ENSP00000378867:P5A|ENSP00000363107:S32C	P|S	-|-	1|2	0|0	A1CF|A1CF	52280459|52280459	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.007000|0.007000	0.05969|0.05969	-1.156000|-1.156000	0.03160|0.03160	-0.123000|-0.123000	0.11745|0.11745	-0.314000|-0.314000	0.08810|0.08810	CCA|TCC		A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048086.2	NM_014576	
HK1	3098	hgsc.bcm.edu	37	10	71149023	71149023	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:71149023A>T	ENST00000359426.6	+	14	2110	c.2006A>T	c.(2005-2007)gAg>gTg	p.E669V	HK1_ENST00000404387.2_Missense_Mutation_p.E673V|HK1_ENST00000360289.2_Missense_Mutation_p.E657V|HK1_ENST00000448642.2_Missense_Mutation_p.E704V|HK1_ENST00000298649.3_Missense_Mutation_p.E668V	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	669	Catalytic.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						GCTTATGAGGAGCCCACCTGT	0.542																																					p.E673V												.	.	0			c.A2018T	10						.						201.0	150.0	167.0					10																	71149023		2203	4300	6503	70819029	SO:0001583	missense	3098	exon17			M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.2006A>T	10.37:g.71149023A>T	ENSP00000352398:p.Glu669Val	Somatic		Capture	SOLID	Phase_I	70819029	NM_033498	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	37	CCDS7292.1	.	.	.	.	.	.	.	.	.	.	A	31	5.088768	0.94100	.	.	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000298649;ENST00000359426;ENST00000405407	D;D;D;D;D	0.97505	-4.39;-4.41;-4.41;-4.39;-4.4	5.82	5.82	0.92795	.	0.089642	0.85682	D	0.000000	D	0.96852	0.8972	L	0.59436	1.845	0.80722	D	1	B;B;P;P;P;B	0.42357	0.142;0.221;0.62;0.509;0.777;0.433	B;B;P;B;P;B	0.48304	0.062;0.13;0.573;0.345;0.573;0.131	D	0.97366	0.9973	10	0.87932	D	0	-38.4532	15.8322	0.78764	1.0:0.0:0.0:0.0	.	669;669;668;704;673;657	A8K7J7;P19367;P19367-2;E7ENR4;P19367-3;P19367-4	.;HXK1_HUMAN;.;.;.;.	V	657;704;673;668;669;669	ENSP00000353433:E657V;ENSP00000402103:E704V;ENSP00000384774:E673V;ENSP00000298649:E668V;ENSP00000352398:E669V	ENSP00000298649:E668V	E	+	2	0	HK1	70819029	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.244000	0.95423	2.229000	0.72834	0.528000	0.53228	GAG		HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188	
PRF1	5551	hgsc.bcm.edu	37	10	72357890	72357890	+	Silent	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:72357890C>A	ENST00000441259.1	-	3	1747	c.1587G>T	c.(1585-1587)ctG>ctT	p.L529L	PRF1_ENST00000373209.2_Silent_p.L529L	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	529					apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)	p.L529L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						TGCCTCCTCCCAGGTGGGGCA	0.577			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																												p.L529L		yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1587T	10						.						84.0	81.0	82.0					10																	72357890		2203	4300	6503	72027896	SO:0001819	synonymous_variant	5551	exon3	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.1587G>T	10.37:g.72357890C>A		Somatic		Capture	SOLID	Phase_I	72027896	NM_005041	B2R6X4|Q59F57|Q86WX7	Silent	SNP	ENST00000441259.1	37	CCDS7305.1																																																																																				PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048517.2	NM_005041	
DYDC1	143241	hgsc.bcm.edu	37	10	82095923	82095923	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:82095923G>T	ENST00000372204.3	-	8	687	c.523C>A	c.(523-525)Caa>Aaa	p.Q175K	RP11-36D19.8_ENST00000416657.1_lincRNA|DYDC1_ENST00000372202.1_Missense_Mutation_p.Q175K	NM_138812.3	NP_620167.1	Q8WWB3	DYDC1_HUMAN	DPY30 domain containing 1	175								p.Q175K(1)		kidney(1)|large_intestine(3)|skin(1)	5			Colorectal(32;0.229)			TACAAATCTTGATCAATGTTT	0.294																																					p.Q175K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C523A	10						.						77.0	71.0	73.0					10																	82095923		2201	4299	6500	82085903	SO:0001583	missense	143241	exon8			BC019250	CCDS7366.1	10q22.3	2006-02-01			ENSG00000170788	ENSG00000170788			23460	protein-coding gene	gene with protein product		615154					Standard	NM_138812		Approved	bA36D19.5, DPY30D1	uc031pwj.1	Q8WWB3	OTTHUMG00000018609	ENST00000372204.3:c.523C>A	10.37:g.82095923G>T	ENSP00000361278:p.Gln175Lys	Somatic		Capture	SOLID	Phase_I	82085903	NM_138812	A8K927|Q5QP03|Q5QP04|Q6WNP4|Q6ZU87	Missense_Mutation	SNP	ENST00000372204.3	37	CCDS7366.1	.	.	.	.	.	.	.	.	.	.	G	10.51	1.369866	0.24771	.	.	ENSG00000170788	ENST00000372204;ENST00000372202	.	.	.	5.17	4.21	0.49690	.	58.304700	0.00166	N	0.000000	T	0.61974	0.2390	L	0.60455	1.87	0.80722	D	1	B	0.24618	0.107	B	0.23716	0.048	T	0.42447	-0.9451	9	0.16896	T	0.51	.	11.5354	0.50634	0.0:0.0:0.8218:0.1782	.	175	Q8WWB3	DYDC1_HUMAN	K	175	.	ENSP00000361276:Q175K	Q	-	1	0	DYDC1	82085903	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	2.448000	0.44926	2.566000	0.86566	0.655000	0.94253	CAA		DYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049059.1	NM_138812	
OPN4	94233	hgsc.bcm.edu	37	10	88415919	88415919	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:88415919G>T	ENST00000241891.5	+	2	319	c.152G>T	c.(151-153)gGg>gTg	p.G51V	OPN4_ENST00000372071.2_Missense_Mutation_p.G51V	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	51					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						CAGGCACCTGGGACTTGGGCT	0.562																																					p.G51V												.	.	0			c.G152T	10						.						102.0	93.0	96.0					10																	88415919		2203	4300	6503	88405899	SO:0001583	missense	94233	exon2			AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.152G>T	10.37:g.88415919G>T	ENSP00000241891:p.Gly51Val	Somatic		Capture	SOLID	Phase_I	88405899	NM_001030015	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Missense_Mutation	SNP	ENST00000241891.5	37	CCDS7376.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.376372	0.24857	.	.	ENSG00000122375	ENST00000372071;ENST00000241891;ENST00000443292	T;T;T	0.67523	-0.21;0.13;-0.27	5.24	-2.17	0.07059	.	2.352270	0.01317	N	0.010817	T	0.50735	0.1633	L	0.41236	1.265	0.09310	N	1	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.08055	0.001;0.001;0.003	T	0.08700	-1.0709	10	0.22109	T	0.4	.	0.2133	0.00159	0.255:0.256:0.2306:0.2585	.	51;51;51	C9JWU6;Q9UHM6;Q9UHM6-2	.;OPN4_HUMAN;.	V	51	ENSP00000361141:G51V;ENSP00000241891:G51V;ENSP00000393132:G51V	ENSP00000241891:G51V	G	+	2	0	OPN4	88405899	0.001000	0.12720	0.000000	0.03702	0.453000	0.32348	0.321000	0.19558	-0.043000	0.13513	0.561000	0.74099	GGG		OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2	NM_033282	
SLIT1	6585	hgsc.bcm.edu	37	10	98766383	98766383	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:98766383C>A	ENST00000266058.4	-	32	3681	c.3436G>T	c.(3436-3438)Ggc>Tgc	p.G1146C	ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Missense_Mutation_p.G1146C	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	1146	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.G1146C(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		GGCCTGTTGCCCTGGTCCACA	0.597																																					p.G1146C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3436T	10						.						62.0	49.0	54.0					10																	98766383		2203	4300	6503	98756373	SO:0001583	missense	6585	exon32			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.3436G>T	10.37:g.98766383C>A	ENSP00000266058:p.Gly1146Cys	Somatic		Capture	SOLID	Phase_I	98756373	NM_003061	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	37	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.006110	0.93287	.	.	ENSG00000187122	ENST00000266058;ENST00000371070	D;D	0.87412	-2.25;-2.25	5.19	5.19	0.71726	Follistatin-like, N-terminal (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.051818	0.85682	D	0.000000	D	0.91023	0.7176	M	0.69823	2.125	0.80722	D	1	D	0.65815	0.995	P	0.53450	0.726	D	0.91550	0.5256	10	0.59425	D	0.04	.	18.9192	0.92518	0.0:1.0:0.0:0.0	.	1146	O75093	SLIT1_HUMAN	C	1146	ENSP00000266058:G1146C;ENSP00000360109:G1146C	ENSP00000266058:G1146C	G	-	1	0	SLIT1	98756373	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.865000	0.69583	2.698000	0.92095	0.655000	0.94253	GGC		SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	
FAM196A	642938	hgsc.bcm.edu	37	10	128936219	128936219	+	Missense_Mutation	SNP	A	A	G	rs146739741		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr10:128936219A>G	ENST00000522781.1	-	6	1877	c.1322T>C	c.(1321-1323)aTt>aCt	p.I441T	DOCK1_ENST00000280333.6_Intron|FAM196A_ENST00000424811.2_Missense_Mutation_p.I417T	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	441										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						AGTTTCCTCAATAGGGTGGAG	0.433																																					p.I441T												.	.	0			c.T1322C	10						.	A	THR/ILE,	1,4405	2.1+/-5.4	0,1,2202	248.0	240.0	243.0		1322,	4.3	0.2	10	dbSNP_134	243	0,8600		0,0,4300	no	missense,intron	DOCK1,FAM196A	NM_001039762.2,NM_001380.3	89,	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	benign,	441/480,	128936219	1,13005	2203	4300	6503	128826209	SO:0001583	missense	642938	exon6				CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.1322T>C	10.37:g.128936219A>G	ENSP00000429763:p.Ile441Thr	Somatic		Capture	SOLID	Phase_I	128826209	NM_001039762	B2RNT4|B7ZME7	Missense_Mutation	SNP	ENST00000522781.1	37	CCDS31312.1	.	.	.	.	.	.	.	.	.	.	A	2.430	-0.331072	0.05314	2.27E-4	0.0	ENSG00000188916	ENST00000522781;ENST00000424811	T;T	0.43688	0.94;0.94	5.48	4.34	0.51931	.	0.436680	0.24091	N	0.041625	T	0.15132	0.0365	N	0.00707	-1.245	0.27982	N	0.936006	B;B	0.16396	0.017;0.017	B;B	0.18561	0.022;0.022	T	0.14062	-1.0486	10	0.31617	T	0.26	.	11.5426	0.50675	0.9298:0.0:0.0702:0.0	.	417;441	B7ZME7;Q6ZSG2	.;F196A_HUMAN	T	441;417	ENSP00000429763:I441T;ENSP00000428730:I417T	ENSP00000428730:I417T	I	-	2	0	FAM196A	128826209	0.028000	0.19301	0.246000	0.24233	0.005000	0.04900	1.273000	0.33121	1.020000	0.39573	-0.263000	0.10527	ATT		FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050978.2	NM_001039762	
APC	324	hgsc.bcm.edu	37	5	112175411	112175411	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr5:112175411G>T	ENST00000457016.1	+	16	4500	c.4120G>T	c.(4120-4122)Gaa>Taa	p.E1374*	APC_ENST00000508376.2_Nonsense_Mutation_p.E1374*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.E1374*			P25054	APC_HUMAN	adenomatous polyposis coli	1374	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E1374*(6)|p.E1374K(2)|p.E1374fs*2(1)|p.?(1)|p.K1192fs*3(1)|p.P1373fs*41(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAGTCCACCTGAACACTATGT	0.453		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1356X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,pancreas,NS,Substitution - coding silent,-2	.	12	Substitution - Nonsense(6)|Substitution - Missense(2)|Deletion - Frameshift(2)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(8)|urinary_tract(1)|pancreas(1)|soft_tissue(1)|skin(1)	c.G4066T	5						.						84.0	81.0	82.0					5																	112175411		2202	4300	6502	112203310	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4120G>T	5.37:g.112175411G>T	ENSP00000413133:p.Glu1374*	Somatic		Capture	SOLID	Phase_I	112203310	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	41	8.982164	0.99025	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.9189	20.4898	0.99202	0.0:0.0:1.0:0.0	.	.	.	.	X	1374	.	.	E	+	1	0	APC	112203310	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GAA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
FBN2	2201	hgsc.bcm.edu	37	5	127641602	127641602	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr5:127641602T>G	ENST00000508053.1	-	49	6435	c.5461A>C	c.(5461-5463)Aat>Cat	p.N1821H	FBN2_ENST00000262464.4_Missense_Mutation_p.N1821H			P35556	FBN2_HUMAN	fibrillin 2	1821	EGF-like 29; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CACACACCATTTGCACAAATG	0.368																																					p.N1821H												.	.	0			c.A5461C	5						.						143.0	133.0	136.0					5																	127641602		2203	4300	6503	127669501	SO:0001583	missense	2201	exon43			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5461A>C	5.37:g.127641602T>G	ENSP00000424571:p.Asn1821His	Somatic		Capture	SOLID	Phase_I	127669501	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	T	16.04	3.010689	0.54361	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.95788	-3.81;-3.81	5.1	5.1	0.69264	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.095869	0.46145	D	0.000319	D	0.92378	0.7581	L	0.39692	1.235	0.40263	D	0.978192	B	0.17852	0.024	B	0.19391	0.025	D	0.89490	0.3756	10	0.27785	T	0.31	.	15.3459	0.74337	0.0:0.0:0.0:1.0	.	1821	P35556	FBN2_HUMAN	H	1821	ENSP00000262464:N1821H;ENSP00000424571:N1821H	ENSP00000262464:N1821H	N	-	1	0	FBN2	127669501	1.000000	0.71417	0.439000	0.26833	0.842000	0.47809	3.289000	0.51747	2.277000	0.76020	0.528000	0.53228	AAT		FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
SLC22A4	6583	hgsc.bcm.edu	37	5	131670551	131670551	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr5:131670551C>G	ENST00000200652.3	+	7	1361	c.1187C>G	c.(1186-1188)cCc>cGc	p.P396R	AC034220.3_ENST00000437091.1_RNA|AC034220.3_ENST00000417795.1_RNA	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	396					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	CGAACCCTGCCCAGGCGTTAT	0.473																																					p.P396R												.	.	0			c.C1187G	5						.						201.0	194.0	196.0					5																	131670551		2203	4300	6503	131698450	SO:0001583	missense	6583	exon7			AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.1187C>G	5.37:g.131670551C>G	ENSP00000200652:p.Pro396Arg	Somatic		Capture	SOLID	Phase_I	131698450	NM_003059	O14546	Missense_Mutation	SNP	ENST00000200652.3	37	CCDS4153.1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294965	0.60086	.	.	ENSG00000197208	ENST00000200652	T	0.74002	-0.8	5.35	5.35	0.76521	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.258931	0.45867	D	0.000338	T	0.78110	0.4232	M	0.68317	2.08	0.58432	D	0.999999	B	0.31227	0.314	B	0.37387	0.248	T	0.78378	-0.2227	10	0.66056	D	0.02	.	19.4261	0.94741	0.0:1.0:0.0:0.0	.	396	Q9H015	S22A4_HUMAN	R	396	ENSP00000200652:P396R	ENSP00000200652:P396R	P	+	2	0	SLC22A4	131698450	0.996000	0.38824	0.982000	0.44146	0.668000	0.39293	7.221000	0.78016	2.660000	0.90430	0.643000	0.83706	CCC		SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132661.1	NM_003059	
PSD2	84249	hgsc.bcm.edu	37	5	139192919	139192919	+	Missense_Mutation	SNP	G	G	T	rs190893087		TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr5:139192919G>T	ENST00000274710.3	+	3	602	c.397G>T	c.(397-399)Gtg>Ttg	p.V133L		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	133					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)	p.V133L(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGCCAGATGTGCGGGATGG	0.607																																					p.V133L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G397T	5						.						80.0	79.0	79.0					5																	139192919		2203	4299	6502	139173103	SO:0001583	missense	84249	exon3			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.397G>T	5.37:g.139192919G>T	ENSP00000274710:p.Val133Leu	Somatic		Capture	SOLID	Phase_I	139173103	NM_032289	D3DQD3|Q8N3J8	Missense_Mutation	SNP	ENST00000274710.3	37	CCDS4216.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.022409	0.35701	.	.	ENSG00000146005	ENST00000274710	T	0.26957	1.7	4.52	2.26	0.28386	.	0.321304	0.25083	N	0.033264	T	0.12475	0.0303	L	0.36672	1.1	0.24440	N	0.994539	P	0.37441	0.595	B	0.27380	0.079	T	0.12218	-1.0556	10	0.20046	T	0.44	.	4.0288	0.09700	0.4629:0.0:0.5371:0.0	.	133	Q9BQI7	PSD2_HUMAN	L	133	ENSP00000274710:V133L	ENSP00000274710:V133L	V	+	1	0	PSD2	139173103	1.000000	0.71417	0.998000	0.56505	0.865000	0.49528	2.341000	0.43983	1.016000	0.39470	0.462000	0.41574	GTG		PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
PCDH12	51294	hgsc.bcm.edu	37	5	141335497	141335497	+	Silent	SNP	A	A	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr5:141335497A>G	ENST00000231484.3	-	1	3130	c.1920T>C	c.(1918-1920)agT>agC	p.S640S	PCDH12_ENST00000512221.1_5'Flank|AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	640	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.		S -> N (in dbSNP:rs164515). {ECO:0000269|PubMed:12975309, ECO:0000269|PubMed:14702039}.		calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S640S(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTCATTTCCACTGCGGATGC	0.567																																					p.S640S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1920C	5						.						74.0	68.0	70.0					5																	141335497		2203	4300	6503	141315681	SO:0001819	synonymous_variant	51294	exon1			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.1920T>C	5.37:g.141335497A>G		Somatic		Capture	SOLID	Phase_I	141315681	NM_016580	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Silent	SNP	ENST00000231484.3	37	CCDS4269.1																																																																																				PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
CSF1R	1436	hgsc.bcm.edu	37	5	149449813	149449813	+	Silent	SNP	A	A	C			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr5:149449813A>C	ENST00000286301.3	-	9	1542	c.1251T>G	c.(1249-1251)ctT>ctG	p.L417L		NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	417	Ig-like C2-type 5.				cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)	p.L417L(2)		NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	CAGCACACAAAAGGGTGCCAG	0.592																																					p.L417L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1251G	5						.						95.0	88.0	90.0					5																	149449813		2203	4300	6503	149430006	SO:0001819	synonymous_variant	1436	exon9			U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.1251T>G	5.37:g.149449813A>C		Somatic		Capture	SOLID	Phase_I	149430006	NM_005211	B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Silent	SNP	ENST00000286301.3	37	CCDS4302.1																																																																																				CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252329.2	NM_005211	
LIFR	3977	hgsc.bcm.edu	37	5	38506636	38506636	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr5:38506636G>T	ENST00000263409.4	-	8	1252	c.1090C>A	c.(1090-1092)Cca>Aca	p.P364T	LIFR_ENST00000503088.1_5'UTR|LIFR_ENST00000453190.2_Missense_Mutation_p.P364T	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	364	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.P364T(2)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					GTAGCACGTGGGCCCACCAAC	0.418			T	PLAG1	salivary adenoma																																p.P364T	Melanoma(13;4 730 6426 9861 34751)		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1090A	5						.						105.0	101.0	102.0					5																	38506636		2203	4300	6503	38542393	SO:0001583	missense	3977	exon8			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.1090C>A	5.37:g.38506636G>T	ENSP00000263409:p.Pro364Thr	Somatic		Capture	SOLID	Phase_I	38542393	NM_001127671	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.477948	0.26511	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.55052	0.54;0.54	5.38	4.5	0.54988	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.289199	0.36234	N	0.002710	T	0.53110	0.1776	M	0.63843	1.955	0.33096	D	0.538593	P	0.52692	0.955	P	0.45167	0.472	T	0.66196	-0.5984	10	0.32370	T	0.25	-5.366	13.9769	0.64279	0.0:0.408:0.592:0.0	.	364	P42702	LIFR_HUMAN	T	364	ENSP00000263409:P364T;ENSP00000398368:P364T	ENSP00000263409:P364T	P	-	1	0	LIFR	38542393	1.000000	0.71417	0.965000	0.40720	0.026000	0.11368	1.439000	0.35013	1.379000	0.46325	-0.181000	0.13052	CCA		LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
UIMC1	51720	hgsc.bcm.edu	37	5	176395589	176395589	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-3542-01A-02W-0831-10	TCGA-AA-3542-10A-01W-0831-10	g.chr5:176395589C>G	ENST00000377227.4	-	6	1299	c.1167G>C	c.(1165-1167)ttG>ttC	p.L389F	UIMC1_ENST00000506128.1_Intron|UIMC1_ENST00000377219.2_Missense_Mutation_p.L389F|UIMC1_ENST00000511320.1_Missense_Mutation_p.L389F|UIMC1_ENST00000503273.1_5'UTR			Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	389	AIR.				double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)	BRCA1-A complex (GO:0070531)|nucleus (GO:0005634)	histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)			NS(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	21	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTTCCTCCAACAAAAGTTTCT	0.398																																					p.L389F												.	.	0			c.G1167C	5						.						90.0	90.0	90.0					5																	176395589		2203	4300	6503	176328195	SO:0001583	missense	51720	exon6			AF349313	CCDS4408.1	5q35.2	2008-02-05			ENSG00000087206	ENSG00000087206			30298	protein-coding gene	gene with protein product	"""receptor associated protein 80"""	609433				12080054	Standard	NM_001199297		Approved	RAP80	uc021yin.1	Q96RL1	OTTHUMG00000130852	ENST00000377227.4:c.1167G>C	5.37:g.176395589C>G	ENSP00000366434:p.Leu389Phe	Somatic		Capture	SOLID	Phase_I	176328195	NM_001199298	A8MSA1|B3KMZ1|B4E3N2|Q5XKQ1|Q7Z3W7|Q8N5B9|Q9BZR1|Q9BZR5|Q9UHX7	Missense_Mutation	SNP	ENST00000377227.4	37	CCDS4408.1	.	.	.	.	.	.	.	.	.	.	C	14.93	2.683265	0.47991	.	.	ENSG00000087206	ENST00000377227;ENST00000377219;ENST00000511320;ENST00000377220	T;T;T	0.32272	1.46;1.46;1.46	5.92	4.13	0.48395	.	0.143042	0.33813	N	0.004522	T	0.34978	0.0916	L	0.59436	1.845	0.42283	D	0.992102	D;D	0.63880	0.993;0.993	P;P	0.55112	0.769;0.769	T	0.33420	-0.9869	10	0.10111	T	0.7	.	6.1768	0.20449	0.0:0.6304:0.1476:0.222	.	389;311	Q96RL1;Q96RL1-3	UIMC1_HUMAN;.	F	389;389;389;311	ENSP00000366434:L389F;ENSP00000366425:L389F;ENSP00000421926:L389F	ENSP00000366425:L389F	L	-	3	2	UIMC1	176328195	0.949000	0.32298	1.000000	0.80357	0.991000	0.79684	-0.047000	0.11963	1.509000	0.48786	0.555000	0.69702	TTG		UIMC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253422.1	NM_016290	
