#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CALML5	51806	broad.mit.edu	37	10	5541064	5541064	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr10:5541064G>A	ENST00000380332.3	-	1	469	c.338C>T	c.(337-339)cCg>cTg	p.P113L		NM_017422.4	NP_059118.2	Q9NZT1	CALL5_HUMAN	calmodulin-like 5	113	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				epidermis development (GO:0008544)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.P113L(1)		biliary_tract(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|stomach(1)	8						CTGCGGCAGCGGCTGCCCCAG	0.706																																					p.P113L	GBM(149;1055 3356 43077)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C338T	10						.						13.0	14.0	14.0					10																	5541064		2135	4158	6293	5531064	SO:0001583	missense	51806	exon1			AF172852	CCDS7068.1	10p15.1	2013-01-10			ENSG00000178372	ENSG00000178372		"""EF-hand domain containing"""	18180	protein-coding gene	gene with protein product	"""calmodulin-like skin protein"""	605183				10777582	Standard	NM_017422		Approved	CLSP	uc001iic.2	Q9NZT1	OTTHUMG00000017598	ENST00000380332.3:c.338C>T	10.37:g.5541064G>A	ENSP00000369689:p.Pro113Leu	Somatic		Capture	Illumina HiSeq	Phase_I	5531064	NM_017422	Q5SQI3|Q8IXU8	Missense_Mutation	SNP	ENST00000380332.3	37	CCDS7068.1	.	.	.	.	.	.	.	.	.	.	G	8.486	0.860863	0.17178	.	.	ENSG00000178372	ENST00000380332	T	0.37915	1.17	4.68	-5.0	0.03001	EF-hand-like domain (1);	2.606460	0.01591	N	0.021553	T	0.27313	0.0670	L	0.41961	1.31	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.24261	-1.0165	10	0.87932	D	0	-0.7571	2.5841	0.04826	0.2329:0.0752:0.3904:0.3016	.	113	Q9NZT1	CALL5_HUMAN	L	113	ENSP00000369689:P113L	ENSP00000369689:P113L	P	-	2	0	CALML5	5531064	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.283000	0.18846	-0.989000	0.03485	-1.394000	0.01149	CCG		CALML5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046556.1	NM_017422	
GDF10	2662	broad.mit.edu	37	10	48428876	48428876	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr10:48428876C>T	ENST00000224605.2	-	2	1275	c.1010G>A	c.(1009-1011)cGc>cAc	p.R337H		NM_004962.3	NP_004953.1	P55107	BMP3B_HUMAN	growth differentiation factor 10	337					fat cell differentiation (GO:0045444)|growth (GO:0040007)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)	p.R337H(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(20)|skin(1)	31						GCGGTCTTTGCGCCCTGGCCG	0.672																																					p.R337H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1010A	10						.						46.0	42.0	44.0					10																	48428876		2203	4300	6503	48048882	SO:0001583	missense	2662	exon2			L42113	CCDS73117.1	10q11.22	2014-04-10			ENSG00000107623	ENSG00000266524		"""Endogenous ligands"""	4215	protein-coding gene	gene with protein product		601361				8679252	Standard	NM_004962		Approved	BMP-3b	uc001jfb.3	P55107	OTTHUMG00000188319	ENST00000224605.2:c.1010G>A	10.37:g.48428876C>T	ENSP00000224605:p.Arg337His	Somatic		Capture	Illumina HiSeq	Phase_I	48048882	NM_004962	Q5VSQ8|Q9UCX6	Missense_Mutation	SNP	ENST00000224605.2	37	CCDS7220.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.840267	0.51057	.	.	ENSG00000107623	ENST00000374247;ENST00000224605	T	0.76186	-1.0	5.3	5.3	0.74995	.	0.105315	0.64402	D	0.000010	T	0.61627	0.2362	L	0.51422	1.61	0.34271	D	0.681025	B;P	0.43607	0.088;0.812	B;B	0.25759	0.012;0.063	T	0.76594	-0.2902	10	0.59425	D	0.04	.	11.7366	0.51769	0.0:0.9193:0.0:0.0807	.	147;337	Q8N6T2;P55107	.;BMP3B_HUMAN	H	147;337	ENSP00000224605:R337H	ENSP00000224605:R337H	R	-	2	0	GDF10	48048882	1.000000	0.71417	0.676000	0.29932	0.811000	0.45836	2.135000	0.42112	2.653000	0.90120	0.561000	0.74099	CGC		GDF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047884.1	NM_004962	
BICC1	80114	broad.mit.edu	37	10	60273049	60273049	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr10:60273049A>G	ENST00000373886.3	+	1	150	c.146A>G	c.(145-147)gAg>gGg	p.E49G		NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	49					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.E49G(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						TGGAGCGAGGAGCGCTTCCGC	0.642																																					p.E49G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A146G	10						.						43.0	41.0	42.0					10																	60273049		2203	4300	6503	59943055	SO:0001583	missense	80114	exon1			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.146A>G	10.37:g.60273049A>G	ENSP00000362993:p.Glu49Gly	Somatic		Capture	Illumina HiSeq	Phase_I	59943055	NM_001080512		Missense_Mutation	SNP	ENST00000373886.3	37	CCDS31206.1	.	.	.	.	.	.	.	.	.	.	a	22.1	4.239256	0.79800	.	.	ENSG00000122870	ENST00000373886	T	0.37915	1.17	2.86	2.86	0.33363	K Homology (1);	0.226553	0.26499	U	0.024032	T	0.50735	0.1633	L	0.60455	1.87	0.80722	D	1	D	0.71674	0.998	D	0.70227	0.968	T	0.51268	-0.8727	10	0.59425	D	0.04	-8.8865	9.6103	0.39659	1.0:0.0:0.0:0.0	.	49	Q9H694	BICC1_HUMAN	G	49	ENSP00000362993:E49G	ENSP00000362993:E49G	E	+	2	0	BICC1	59943055	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	4.766000	0.62279	1.326000	0.45319	0.228000	0.17796	GAG		BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	NM_025044	
STOX1	219736	broad.mit.edu	37	10	70645060	70645060	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr10:70645060G>A	ENST00000298596.6	+	3	1591	c.1508G>A	c.(1507-1509)cGa>cAa	p.R503Q	STOX1_ENST00000399169.4_Missense_Mutation_p.R503Q|STOX1_ENST00000399162.2_Intron|STOX1_ENST00000399165.4_Intron|STOX1_ENST00000421961.2_Missense_Mutation_p.R393Q	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	503						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R503Q(1)		breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						TTGTCTCACCGAGGAAGCACA	0.448																																					p.R503Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1508A	10						.						54.0	51.0	52.0					10																	70645060		1867	4092	5959	70315066	SO:0001583	missense	219736	exon3			AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.1508G>A	10.37:g.70645060G>A	ENSP00000298596:p.Arg503Gln	Somatic		Capture	Illumina HiSeq	Phase_I	70315066	NM_152709	A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Missense_Mutation	SNP	ENST00000298596.6	37	CCDS41535.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497940	0.64186	.	.	ENSG00000165730	ENST00000399169;ENST00000298596;ENST00000421961	T;T;T	0.78595	-1.19;-1.19;-0.86	5.98	4.04	0.47022	.	0.422230	0.25217	N	0.032261	T	0.73659	0.3615	M	0.72894	2.215	0.09310	N	0.999998	D	0.58268	0.982	B	0.39339	0.297	T	0.70880	-0.4752	10	0.72032	D	0.01	.	11.4894	0.50373	0.0673:0.1257:0.807:0.0	.	503	Q6ZVD7	STOX1_HUMAN	Q	503;503;393	ENSP00000382121:R503Q;ENSP00000298596:R503Q;ENSP00000394509:R393Q	ENSP00000298596:R503Q	R	+	2	0	STOX1	70315066	0.881000	0.30235	0.411000	0.26484	0.751000	0.42716	2.414000	0.44627	1.553000	0.49476	0.591000	0.81541	CGA		STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276849.3	NM_152709	
DLG5	9231	broad.mit.edu	37	10	79576424	79576424	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr10:79576424G>A	ENST00000372391.2	-	20	3915	c.3910C>T	c.(3910-3912)Cag>Tag	p.Q1304*	DLG5_ENST00000459739.1_5'UTR|DLG5_ENST00000372388.2_Nonsense_Mutation_p.Q964*	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1304					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)	p.Q1304*(1)		breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			AGGGGTGACTGTGGAGGAGTG	0.577																																					p.Q1304X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3910T	10						.						199.0	170.0	180.0					10																	79576424		2203	4300	6503	79246430	SO:0001587	stop_gained	9231	exon20			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.3910C>T	10.37:g.79576424G>A	ENSP00000361467:p.Gln1304*	Somatic		Capture	Illumina HiSeq	Phase_I	79246430	NM_004747	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Nonsense_Mutation	SNP	ENST00000372391.2	37	CCDS7353.2	.	.	.	.	.	.	.	.	.	.	G	37	6.032372	0.97221	.	.	ENSG00000151208	ENST00000372391;ENST00000424842;ENST00000372388	.	.	.	5.8	5.8	0.92144	.	0.440891	0.16946	N	0.193109	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.063	0.97692	0.0:0.0:1.0:0.0	.	.	.	.	X	1304;265;964	.	ENSP00000361464:Q964X	Q	-	1	0	DLG5	79246430	1.000000	0.71417	0.906000	0.35671	0.944000	0.59088	7.561000	0.82288	2.735000	0.93741	0.655000	0.94253	CAG		DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2		
BMPR1A	657	broad.mit.edu	37	10	88649981	88649981	+	Splice_Site	DEL	T	T	-			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr10:88649981delT	ENST00000372037.3	+	4	767	c.230delT	c.(229-231)ata>aa	p.I77fs	RNU1-19P_ENST00000363306.1_RNA	NM_004329.2	NP_004320.2	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA	77					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|developmental growth (GO:0048589)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic digit morphogenesis (GO:0042733)|embryonic organ development (GO:0048568)|endocardial cushion formation (GO:0003272)|heart formation (GO:0060914)|hindlimb morphogenesis (GO:0035137)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lateral mesoderm development (GO:0048368)|lung development (GO:0030324)|mesendoderm development (GO:0048382)|mesoderm formation (GO:0001707)|Mullerian duct regression (GO:0001880)|negative regulation of neurogenesis (GO:0050768)|neural crest cell development (GO:0014032)|neural plate mediolateral regionalization (GO:0021998)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|paraxial mesoderm structural organization (GO:0048352)|pituitary gland development (GO:0021983)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of lateral mesodermal cell fate specification (GO:0048378)|somitogenesis (GO:0001756)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway (GO:0007179)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.I77fs*10(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|skin(1)|stomach(1)	24						AACACATGCATGTAAGTATTT	0.353			"""Mis, N, F"""			gastrointestinal polyps			Juvenile Polyposis;Hereditary Mixed Polyposis syndrome type 2																												p.I77fs	Ovarian(190;603 2086 22044 30335 47971)	yes	Rec		Juvenile polyposis	10	10q22.3	657	"""bone morphogenetic protein receptor, type IA"""		E	.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.230delT	10						.						136.0	127.0	130.0					10																	88649981		2203	4300	6503	88639961	SO:0001630	splice_region_variant	657	exon4	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HMPS2	BC028383	CCDS7378.1	10q22.3	2014-09-17			ENSG00000107779	ENSG00000107779		"""CD molecules"""	1076	protein-coding gene	gene with protein product		601299		ACVRLK3		8397373, 9730621	Standard	NM_004329		Approved	ALK3, CD292	uc001kdy.3	P36894	OTTHUMG00000018657	ENST00000372037.3:c.230+1T>-	10.37:g.88649981delT		Somatic		Capture	Illumina HiSeq	Phase_I	88639961	NM_004329	A8K6U9|Q8NEN8	Frame_Shift_Del	DEL	ENST00000372037.3	37	CCDS7378.1																																																																																				BMPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049170.3	NM_004329	Frame_Shift_Del
KIF20B	9585	broad.mit.edu	37	10	91498348	91498348	+	Silent	SNP	A	A	G			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr10:91498348A>G	ENST00000371728.3	+	20	3815	c.3750A>G	c.(3748-3750)gaA>gaG	p.E1250E	KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000260753.4_Silent_p.E1210E|KIF20B_ENST00000416354.1_Silent_p.E1280E|KIF20B_ENST00000394289.2_Silent_p.E1250E	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1250	Poly-Glu.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)	p.E1210E(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						AAGAAGAAGAAGAAACCAACA	0.264																																					p.E1210E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3630G	10						.						31.0	33.0	32.0					10																	91498348		1996	4180	6176	91488328	SO:0001819	synonymous_variant	9585	exon20			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.3750A>G	10.37:g.91498348A>G		Somatic		Capture	Illumina HiSeq	Phase_I	91488328	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Silent	SNP	ENST00000371728.3	37																																																																																					KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
DOCK1	1793	broad.mit.edu	37	10	129183154	129183154	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr10:129183154A>G	ENST00000280333.6	+	38	3954	c.3845A>G	c.(3844-3846)cAc>cGc	p.H1282R		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1282	DHR-2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.H1282R(1)		NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		GAAATCATCCACTACTTCGAC	0.517																																					p.H1282R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3845G	10						.						110.0	108.0	109.0					10																	129183154		2087	4231	6318	129073144	SO:0001583	missense	1793	exon38			D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.3845A>G	10.37:g.129183154A>G	ENSP00000280333:p.His1282Arg	Somatic		Capture	Illumina HiSeq	Phase_I	129073144	NM_001380	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	37		.	.	.	.	.	.	.	.	.	.	A	13.52	2.263160	0.39995	.	.	ENSG00000150760	ENST00000280333	T	0.01516	4.81	4.84	4.84	0.62591	.	0.058295	0.64402	D	0.000002	T	0.02533	0.0077	L	0.41492	1.28	0.51482	D	0.999928	B;B;B	0.24092	0.009;0.097;0.043	B;B;B	0.25759	0.005;0.023;0.063	T	0.55958	-0.8058	10	0.42905	T	0.14	.	14.5734	0.68229	1.0:0.0:0.0:0.0	.	1282;1348;1282	B2RUU3;A8MU08;Q14185	.;.;DOCK1_HUMAN	R	1282	ENSP00000280333:H1282R	ENSP00000280333:H1282R	H	+	2	0	DOCK1	129073144	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.953000	0.63624	2.041000	0.60428	0.460000	0.39030	CAC		DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
ATM	472	broad.mit.edu	37	11	108213987	108213987	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr11:108213987G>A	ENST00000452508.2	+	58	8496	c.8307G>A	c.(8305-8307)tgG>tgA	p.W2769*	C11orf65_ENST00000526725.1_Intron|C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Nonsense_Mutation_p.W2769*			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2769	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.W2769*(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TTCTTGAATGGTGCACAGGAA	0.398			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.W2769X		yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G8307A	11	GRCh37	CM960109	ATM	M		.						169.0	156.0	160.0					11																	108213987		2201	4298	6499	107719197	SO:0001587	stop_gained	472	exon57	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8307G>A	11.37:g.108213987G>A	ENSP00000388058:p.Trp2769*	Somatic		Capture	Illumina HiSeq	Phase_I	107719197	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Nonsense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	51	18.114354	0.99899	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8788	0.96888	0.0:0.0:1.0:0.0	.	.	.	.	X	2769	.	ENSP00000278616:W2769X	W	+	3	0	ATM	107719197	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.391000	0.97249	2.779000	0.95612	0.561000	0.74099	TGG		ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
OR6M1	390261	broad.mit.edu	37	11	123676682	123676682	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr11:123676682C>T	ENST00000309154.2	-	1	413	c.376G>A	c.(376-378)Gac>Aac	p.D126N		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D126N(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		TGCAGTGGGTCGCAGATAGCC	0.522																																					p.D126N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G376A	11						.						48.0	50.0	49.0					11																	123676682		2202	4299	6501	123181892	SO:0001583	missense	390261	exon1			AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.376G>A	11.37:g.123676682C>T	ENSP00000311038:p.Asp126Asn	Somatic		Capture	Illumina HiSeq	Phase_I	123181892	NM_001005325	B2RNK0|Q6IEW9|Q96R37	Missense_Mutation	SNP	ENST00000309154.2	37	CCDS31696.1	.	.	.	.	.	.	.	.	.	.	C	0.266	-0.996397	0.02145	.	.	ENSG00000196099	ENST00000309154	T	0.00388	7.59	3.68	2.55	0.30701	GPCR, rhodopsin-like superfamily (1);	0.217059	0.22881	N	0.054507	T	0.00073	0.0002	N	0.00569	-1.365	0.23314	N	0.997928	B	0.02656	0.0	B	0.01281	0.0	T	0.32640	-0.9899	10	0.33940	T	0.23	.	2.6393	0.04966	0.227:0.1321:0.0:0.6409	.	126	Q8NGM8	OR6M1_HUMAN	N	126	ENSP00000311038:D126N	ENSP00000311038:D126N	D	-	1	0	OR6M1	123181892	0.002000	0.14202	0.987000	0.45799	0.104000	0.19210	0.095000	0.15127	0.485000	0.27652	-0.302000	0.09304	GAC		OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387437.1	NM_001005325	
SMPD1	6609	broad.mit.edu	37	11	6413166	6413166	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr11:6413166C>A	ENST00000342245.4	+	2	1039	c.871C>A	c.(871-873)Cgt>Agt	p.R291S	SMPD1_ENST00000299397.3_Missense_Mutation_p.R291S|SMPD1_ENST00000527275.1_Missense_Mutation_p.R290S|SMPD1_ENST00000356761.2_Missense_Mutation_p.R291S|SMPD1_ENST00000533196.1_Intron	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	289					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)	p.R291S(2)		breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	GCACCAGACTCGTCAGGACCA	0.602																																					p.R290S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C868A	11						.						94.0	100.0	98.0					11																	6413166		2201	4296	6497	6369742	SO:0001583	missense	6609	exon2			AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.871C>A	11.37:g.6413166C>A	ENSP00000340409:p.Arg291Ser	Somatic		Capture	Illumina HiSeq	Phase_I	6369742	NM_001007593	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Missense_Mutation	SNP	ENST00000342245.4	37	CCDS44531.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.714637	0.48622	.	.	ENSG00000166311	ENST00000299397;ENST00000356761;ENST00000342245;ENST00000530395;ENST00000527275	D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86	4.91	4.91	0.64330	Metallophosphoesterase domain (1);	0.000000	0.64402	D	0.000001	D	0.90393	0.6993	L	0.56124	1.755	0.53688	D	0.999976	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.987;0.993	D	0.91201	0.4991	10	0.62326	D	0.03	-36.0	16.6557	0.85227	0.0:1.0:0.0:0.0	.	290;291;289	E9PKS3;G3XAB5;P17405	.;.;ASM_HUMAN	S	291;291;291;18;290	ENSP00000299397:R291S;ENSP00000349203:R291S;ENSP00000340409:R291S;ENSP00000431479:R18S;ENSP00000435350:R290S	ENSP00000299397:R291S	R	+	1	0	SMPD1	6369742	1.000000	0.71417	0.992000	0.48379	0.156000	0.22039	3.520000	0.53465	2.279000	0.76181	0.561000	0.74099	CGT		SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
OR10AG1	282770	broad.mit.edu	37	11	55735603	55735603	+	Missense_Mutation	SNP	G	G	A	rs150679428		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr11:55735603G>A	ENST00000312345.2	-	1	387	c.337C>T	c.(337-339)Cgc>Tgc	p.R113C		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R113C(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					GCCACGTAGCGGTCATAGGCC	0.428													G|||	1	0.000199681	0.0	0.0	5008	,	,		18841	0.0		0.0	False		,,,				2504	0.001				p.R113C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C337T	11						.	G	CYS/ARG	1,4401	2.1+/-5.4	0,1,2200	88.0	86.0	86.0		337	4.6	1.0	11	dbSNP_134	86	0,8592		0,0,4296	no	missense	OR10AG1	NM_001005491.1	180	0,1,6496	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	113/302	55735603	1,12993	2201	4296	6497	55492179	SO:0001583	missense	282770	exon1			AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.337C>T	11.37:g.55735603G>A	ENSP00000311477:p.Arg113Cys	Somatic		Capture	Illumina HiSeq	Phase_I	55492179	NM_001005491	B2RNH4|Q6IEU3	Missense_Mutation	SNP	ENST00000312345.2	37	CCDS31514.1	.	.	.	.	.	.	.	.	.	.	G	10.14	1.269384	0.23221	2.27E-4	0.0	ENSG00000174970	ENST00000312345	T	0.77358	-1.09	5.47	4.56	0.56223	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000159	T	0.74673	0.3747	M	0.79614	2.46	0.40228	D	0.977813	P	0.46277	0.875	B	0.39738	0.308	T	0.77632	-0.2515	10	0.72032	D	0.01	.	7.4436	0.27198	0.0851:0.0:0.7504:0.1645	.	113	Q8NH19	O10AG_HUMAN	C	113	ENSP00000311477:R113C	ENSP00000311477:R113C	R	-	1	0	OR10AG1	55492179	0.972000	0.33761	0.961000	0.40146	0.030000	0.12068	1.405000	0.34635	1.357000	0.45904	0.477000	0.44152	CGC		OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491	
PRG2	5553	broad.mit.edu	37	11	57156738	57156738	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr11:57156738C>A	ENST00000311862.5	-	3	184	c.111G>T	c.(109-111)gaG>gaT	p.E37D	PRG2_ENST00000533605.1_Missense_Mutation_p.E37D|RP11-872D17.8_ENST00000529411.1_Missense_Mutation_p.E142D|PRG2_ENST00000525955.1_Missense_Mutation_p.E37D	NM_001243245.1|NM_002728.4	NP_001230174.1|NP_002719.3	P13727	PRG2_HUMAN	proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)	37					defense response to bacterium (GO:0042742)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of interleukin-4 production (GO:0032753)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)	p.E37D(1)		central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Sargramostim(DB00020)	TCTCCTCATCCTCAGGCAGCG	0.562																																					p.E37D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G111T	11						.						71.0	71.0	71.0					11																	57156738		2201	4296	6497	56913314	SO:0001583	missense	5553	exon3			BC005929	CCDS7955.1, CCDS58133.1	11q12	2005-11-25				ENSG00000186652			9362	protein-coding gene	gene with protein product		605601				1565101	Standard	NM_001243245		Approved	MBP, BMPG		P13727		ENST00000311862.5:c.111G>T	11.37:g.57156738C>A	ENSP00000312134:p.Glu37Asp	Somatic		Capture	Illumina HiSeq	Phase_I	56913314	NM_002728	A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	Missense_Mutation	SNP	ENST00000311862.5	37	CCDS7955.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.424312	0.43020	.	.	ENSG00000186652;ENSG00000186652;ENSG00000186652;ENSG00000254979	ENST00000311862;ENST00000533605;ENST00000525955;ENST00000529411	T;T;T;T	0.33438	3.06;2.86;3.06;1.41	5.24	1.08	0.20341	.	0.977547	0.08312	N	0.965250	T	0.19765	0.0475	L	0.29908	0.895	0.09310	N	1	B;B	0.25105	0.118;0.118	B;B	0.21917	0.037;0.037	T	0.32455	-0.9906	10	0.66056	D	0.02	-10.2308	2.1048	0.03688	0.1592:0.5111:0.1543:0.1754	.	37;37	A6XMW0;P13727	.;PRG2_HUMAN	D	37;37;37;142	ENSP00000312134:E37D;ENSP00000433231:E37D;ENSP00000433016:E37D;ENSP00000431536:E142D	ENSP00000312134:E37D	E	-	3	2	RP11-872D17.8;PRG2	56913314	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-0.619000	0.05572	-0.055000	0.13244	0.655000	0.94253	GAG		PRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392468.1	NM_002728	
SLC43A1	8501	broad.mit.edu	37	11	57268319	57268319	+	Missense_Mutation	SNP	G	G	A	rs202015221		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr11:57268319G>A	ENST00000278426.3	-	5	753	c.398C>T	c.(397-399)cCg>cTg	p.P133L	SLC43A1_ENST00000528450.1_Missense_Mutation_p.P133L|SLC43A1_ENST00000533515.1_5'Flank	NM_003627.5	NP_003618.1			solute carrier family 43 (amino acid system L transporter), member 1									p.P133L(2)		breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						GAATATCAACGGAGACAGAGC	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		18928	0.001		0.0	False		,,,				2504	0.0				p.P133L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C398T	11						.						109.0	110.0	109.0					11																	57268319		2201	4296	6497	57024895	SO:0001583	missense	8501	exon5			AF045584	CCDS7958.1	11q12.1	2013-07-17	2013-07-17	2003-09-12	ENSG00000149150	ENSG00000149150		"""Solute carriers"""	9225	protein-coding gene	gene with protein product		603733	"""prostate cancer overexpressed gene 1"""	POV1		9255310, 9722952	Standard	NM_003627		Approved	R00504, PB39	uc001nkk.3	O75387	OTTHUMG00000167030	ENST00000278426.3:c.398C>T	11.37:g.57268319G>A	ENSP00000278426:p.Pro133Leu	Somatic		Capture	Illumina HiSeq	Phase_I	57024895	NM_003627		Missense_Mutation	SNP	ENST00000278426.3	37	CCDS7958.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	12.53	1.965630	0.34659	.	.	ENSG00000149150	ENST00000278426;ENST00000528450;ENST00000533066	T;T;T	0.58940	0.3;0.3;0.3	5.25	4.31	0.51392	Major facilitator superfamily domain, general substrate transporter (1);	0.237019	0.42294	D	0.000724	T	0.50069	0.1594	L	0.60455	1.87	0.47819	D	0.999522	B	0.17268	0.021	B	0.18263	0.021	T	0.41805	-0.9488	10	0.10902	T	0.67	-20.4826	12.2509	0.54597	0.0:0.0:0.8294:0.1705	.	133	O75387	LAT3_HUMAN	L	133	ENSP00000278426:P133L;ENSP00000435673:P133L;ENSP00000435647:P133L	ENSP00000278426:P133L	P	-	2	0	SLC43A1	57024895	0.496000	0.26059	0.884000	0.34674	0.819000	0.46315	1.670000	0.37502	1.163000	0.42636	0.655000	0.94253	CCG		SLC43A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392541.1	NM_003627	
TMEM216	51259	broad.mit.edu	37	11	61165382	61165382	+	Silent	SNP	C	C	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr11:61165382C>A	ENST00000515837.2	+	4	1311	c.366C>A	c.(364-366)ggC>ggA	p.G122G	TMEM216_ENST00000398979.3_Silent_p.G61G|TMEM216_ENST00000334888.5_Silent_p.G122G			Q9P0N5	TM216_HUMAN	transmembrane protein 216	122					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)		p.G122G(1)		endometrium(1)|large_intestine(2)|lung(1)|prostate(2)	6						TCATGAATGGCATCTTGCTCT	0.517																																					p.G61G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C183A	11						.						223.0	212.0	216.0					11																	61165382		2104	4238	6342	60921958	SO:0001819	synonymous_variant	51259	exon4				CCDS53640.1	11q13.1	2014-09-17			ENSG00000187049	ENSG00000187049			25018	protein-coding gene	gene with protein product		613277	"""cerebello-oculo-renal syndrome 2"", ""Meckel syndrome, type 2"""	CORS2, MKS2		11042152, 20036350, 20512146	Standard	NM_016499		Approved	MGC13379, HSPC244, JBTS2	uc021qkf.1	Q9P0N5		ENST00000515837.2:c.366C>A	11.37:g.61165382C>A		Somatic		Capture	Illumina HiSeq	Phase_I	60921958	NM_016499	A8MZ23|B7Z8N1	Silent	SNP	ENST00000515837.2	37	CCDS53640.1																																																																																				TMEM216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398430.1	NM_016499	
ACTN3	89	broad.mit.edu	37	11	66319084	66319084	+	RNA	SNP	C	C	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr11:66319084C>A	ENST00000502692.1	+	0	593				ACTN3_ENST00000513398.1_RNA	NM_001258371.1	NP_001245300.1	Q08043	ACTN3_HUMAN	actinin, alpha 3 (gene/pseudogene)						focal adhesion assembly (GO:0048041)|muscle filament sliding (GO:0030049)|regulation of apoptotic process (GO:0042981)	actin filament (GO:0005884)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)	p.S115R(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(2)	10						TCATTGCCAGCAAGGGGGTTA	0.547																																					p.S116R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C348A	11						.						70.0	74.0	72.0					11																	66319084		2168	4286	6454	66075660			89	exon3			M86407		11q13.2	2013-10-02	2012-10-05		ENSG00000248746	ENSG00000248746			165	protein-coding gene	gene with protein product		102574	"""actinin, alpha 3"""			1339456	Standard	NM_001104		Approved		uc031qbp.1	Q08043	OTTHUMG00000160815		11.37:g.66319084C>A		Somatic		Capture	Illumina HiSeq	Phase_I	66075660	NM_001104	A6NP77|Q4KKV2	Missense_Mutation	SNP	ENST00000502692.1	37																																																																																					ACTN3-003	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000362465.1	NM_001104	
NOX4	50507	broad.mit.edu	37	11	89073236	89073236	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr11:89073236T>C	ENST00000263317.4	-	15	1679	c.1441A>G	c.(1441-1443)Aac>Gac	p.N481D	NOX4_ENST00000424319.1_Missense_Mutation_p.N457D|NOX4_ENST00000534731.1_Missense_Mutation_p.N441D|NOX4_ENST00000542487.1_Missense_Mutation_p.N457D|NOX4_ENST00000535633.1_Missense_Mutation_p.N457D|NOX4_ENST00000343727.5_Missense_Mutation_p.N457D|NOX4_ENST00000375979.3_Missense_Mutation_p.N174D|NOX4_ENST00000527956.1_Missense_Mutation_p.N457D|NOX4_ENST00000532825.1_Missense_Mutation_p.N417D|NOX4_ENST00000525196.1_Missense_Mutation_p.N245D|NOX4_ENST00000531342.1_Missense_Mutation_p.N134D|NOX4_ENST00000413594.2_Missense_Mutation_p.N502D|NOX4_ENST00000527626.1_Intron|NOX4_ENST00000528341.1_Missense_Mutation_p.N456D			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	481	Mediates interaction with TLR4.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)	p.N481D(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				GTTACCTTGTTATGCAACATA	0.323																																					p.N481D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1441G	11						.						102.0	102.0	102.0					11																	89073236		2201	4298	6499	88712884	SO:0001583	missense	50507	exon15			AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1441A>G	11.37:g.89073236T>C	ENSP00000263317:p.Asn481Asp	Somatic		Capture	Illumina HiSeq	Phase_I	88712884	NM_016931	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	ENST00000263317.4	37	CCDS8285.1	.	.	.	.	.	.	.	.	.	.	T	9.133	1.011779	0.19277	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000525196;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000528341;ENST00000413594;ENST00000531342;ENST00000375979	D;D;D;D;D;D;D;D;D;D;D;D;D	0.94828	-3.53;-3.53;-3.53;-3.53;-3.53;-3.53;-3.53;-3.53;-3.53;-3.53;-3.53;-3.53;-3.53	5.34	5.34	0.76211	Ferric reductase, NAD binding (1);	0.203246	0.51477	D	0.000092	D	0.86314	0.5903	N	0.05383	-0.06	0.32688	N	0.514526	B;B;B;B;B;B;B	0.20164	0.0;0.001;0.042;0.004;0.003;0.0;0.0	B;B;B;B;B;B;B	0.25987	0.001;0.006;0.065;0.006;0.002;0.001;0.003	D	0.83556	0.0104	9	.	.	.	-11.3835	10.2532	0.43381	0.0:0.0787:0.0:0.9213	.	417;456;245;134;174;441;481	E9PMY6;E9PPP2;E9PI95;Q9NPH5-3;Q9NPH5-4;Q9NPH5-6;Q9NPH5	.;.;.;.;.;.;NOX4_HUMAN	D	457;457;457;441;245;481;417;457;457;456;502;134;174	ENSP00000412446:N457D;ENSP00000440172:N457D;ENSP00000344747:N457D;ENSP00000436892:N441D;ENSP00000436716:N245D;ENSP00000263317:N481D;ENSP00000434924:N417D;ENSP00000433797:N457D;ENSP00000439373:N457D;ENSP00000436970:N456D;ENSP00000405705:N502D;ENSP00000435039:N134D;ENSP00000365146:N174D	.	N	-	1	0	NOX4	88712884	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	1.500000	0.35682	2.022000	0.59522	0.377000	0.23210	AAC		NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1	NM_016931	
ATM	472	broad.mit.edu	37	11	108205764	108205766	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	AGG	AGG	AGG	-	AGG	AGG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr11:108205764_108205766delAGG	ENST00000452508.2	+	56	8268_8270	c.8079_8081delAGG	c.(8077-8082)gcagga>gca	p.G2695del	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_In_Frame_Del_p.G2695del			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2695			G -> A (in T-prolymphocytic leukemia and B-cell chronic lymphocytic leukemia). {ECO:0000269|PubMed:10023947, ECO:0000269|PubMed:9288106}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.G2695delG(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TTCGCTTAGCAGGAGGTGTAAAT	0.399			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.2693_2694del		yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	.	1	Deletion - In frame(1)	large_intestine(1)	c.8079_8081del	11						.																																			107710976	SO:0001651	inframe_deletion	472	exon55	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8079_8081delAGG	11.37:g.108205767_108205769delAGG	ENSP00000388058:p.Gly2695del	Somatic		Capture	Illumina HiSeq	Phase_I	107710974	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	In_Frame_Del	DEL	ENST00000452508.2	37	CCDS31669.1																																																																																				ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
FAM118B	79607	broad.mit.edu	37	11	126124304	126124304	+	Silent	SNP	C	C	T	rs183812072	byFrequency	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr11:126124304C>T	ENST00000533050.1	+	6	1165	c.672C>T	c.(670-672)aaC>aaT	p.N224N	FAM118B_ENST00000360194.4_Silent_p.N224N|FAM118B_ENST00000529731.1_Silent_p.N148N	NM_024556.3	NP_078832.1	Q9BPY3	F118B_HUMAN	family with sequence similarity 118, member B	224								p.N224N(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)	13	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0784)		GATATCAGAACGTGCTCAGGA	0.498													C|||	2	0.000399361	0.0	0.0	5008	,	,		20917	0.002		0.0	False		,,,				2504	0.0				p.N224N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C672T	11						.						228.0	178.0	195.0					11																	126124304		2201	4299	6500	125629514	SO:0001819	synonymous_variant	79607	exon6			BC001340	CCDS8470.1	11q24.2	2014-03-13				ENSG00000197798			26110	protein-coding gene	gene with protein product						24569877	Standard	NM_024556		Approved	FLJ21103	uc001qdf.3	Q9BPY3		ENST00000533050.1:c.672C>T	11.37:g.126124304C>T		Somatic		Capture	Illumina HiSeq	Phase_I	125629514	NM_024556	Q9H7B0	Silent	SNP	ENST00000533050.1	37	CCDS8470.1																																																																																				FAM118B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386346.1	NM_024556	
CLEC7A	64581	broad.mit.edu	37	12	10271176	10271176	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr12:10271176T>C	ENST00000304084.8	-	6	779	c.625A>G	c.(625-627)Acc>Gcc	p.T209A	CLEC7A_ENST00000353231.5_Missense_Mutation_p.T163A|CLEC7A_ENST00000396484.2_Missense_Mutation_p.T130A|CLEC7A_ENST00000298523.5_Missense_Mutation_p.N123S|CLEC7A_ENST00000533022.1_Missense_Mutation_p.N169S	NM_197947.2	NP_922938.1	Q9BXN2	CLC7A_HUMAN	C-type lectin domain family 7, member A	209	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate mediated signaling (GO:0009756)|cell recognition (GO:0008037)|defense response to protozoan (GO:0042832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|MHC protein binding (GO:0042287)|signaling pattern recognition receptor activity (GO:0008329)	p.T163A(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						GTAGCTGTGGTTCTGATCTGA	0.358																																					p.T163A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A487G	12						.						148.0	143.0	145.0					12																	10271176		2203	4300	6503	10162443	SO:0001583	missense	64581	exon5			AY009090	CCDS8613.1, CCDS8614.1, CCDS8617.1, CCDS41753.1, CCDS41754.1, CCDS53744.1	12p13.2-p12.3	2014-09-17		2005-02-09	ENSG00000172243	ENSG00000172243		"""C-type lectin domain containing"""	14558	protein-coding gene	gene with protein product		606264	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 12"""	CLECSF12			Standard	XM_005253468		Approved	dectin-1, hDectin-1	uc001qxg.2	Q9BXN2	OTTHUMG00000133597	ENST00000304084.8:c.625A>G	12.37:g.10271176T>C	ENSP00000302569:p.Thr209Ala	Somatic		Capture	Illumina HiSeq	Phase_I	10162443	NM_022570	B2R861|B7Z494|B7Z5A9|B7Z5B9|Q6IPS7|Q96D32|Q96DR9|Q96LD3|Q96PA4|Q96PA5|Q96PA6|Q96PA7|Q96PA8|Q9H1K3	Missense_Mutation	SNP	ENST00000304084.8	37	CCDS41753.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.716|4.716	0.133057|0.133057	0.09032|0.09032	.|.	.|.	ENSG00000172243|ENSG00000172243	ENST00000298523;ENST00000533022|ENST00000353231;ENST00000396484;ENST00000304084	T;T|T;T;T	0.05513|0.16897	3.43;3.62|2.31;2.31;2.31	4.03|4.03	4.03|4.03	0.46877|0.46877	.|C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.|0.362598	.|0.24020	.|N	.|0.042289	T|T	0.09202|0.09202	0.0227|0.0227	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B;B|B;B;B	0.20368|0.26902	0.017;0.044|0.141;0.163;0.066	B;B|B;B;B	0.20955|0.27380	0.022;0.032|0.054;0.079;0.049	T|T	0.14783|0.14783	-1.0460|-1.0460	8|9	0.02654|0.09843	T|T	1|0.71	.|.	9.6574|9.6574	0.39934|0.39934	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	169;123|130;209;163	Q9BXN2-3;Q9BXN2-7|Q9BXN2-5;Q9BXN2;Q9BXN2-2	.;.|.;CLC7A_HUMAN;.	S|A	123;169|163;130;209	ENSP00000298523:N123S;ENSP00000431461:N169S|ENSP00000266456:T163A;ENSP00000379743:T130A;ENSP00000302569:T209A	ENSP00000298523:N123S|ENSP00000302569:T209A	N|T	-|-	2|1	0|0	CLEC7A|CLEC7A	10162443|10162443	0.614000|0.614000	0.27017|0.27017	0.938000|0.938000	0.37757|0.37757	0.819000|0.819000	0.46315|0.46315	0.925000|0.925000	0.28791|0.28791	2.059000|2.059000	0.61396|0.61396	0.528000|0.528000	0.53228|0.53228	AAC|ACC		CLEC7A-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390772.1	NM_197954	
TAS2R10	50839	broad.mit.edu	37	12	10978637	10978637	+	Missense_Mutation	SNP	C	C	T	rs201510957		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr12:10978637C>T	ENST00000240619.2	-	1	320	c.232G>A	c.(232-234)Ggt>Agt	p.G78S		NM_023921.1	NP_076410.1	Q9NYW0	T2R10_HUMAN	taste receptor, type 2, member 10	78					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.G78S(1)		breast(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17						ATTAGGTTACCGGAGGCATAT	0.338													c|||	1	0.000199681	0.0008	0.0	5008	,	,		18136	0.0		0.0	False		,,,				2504	0.0				p.G78S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G232A	12						.	T	SER/GLY	3,4403	6.2+/-15.9	0,3,2200	47.0	51.0	50.0		232	-3.4	0.0	12		50	0,8594		0,0,4297	no	missense	TAS2R10	NM_023921.1	56	0,3,6497	TT,TC,CC		0.0,0.0681,0.0231	benign	78/308	10978637	3,12997	2203	4297	6500	10869904	SO:0001583	missense	50839	exon1			AF227136	CCDS8634.1	12p13	2012-08-22			ENSG00000121318	ENSG00000121318		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14918	protein-coding gene	gene with protein product		604791				10761934, 10766242	Standard	NM_023921		Approved	T2R10, TRB2	uc001qyy.1	Q9NYW0	OTTHUMG00000168508	ENST00000240619.2:c.232G>A	12.37:g.10978637C>T	ENSP00000240619:p.Gly78Ser	Somatic		Capture	Illumina HiSeq	Phase_I	10869904	NM_023921	Q3MIM9|Q6NTD9	Missense_Mutation	SNP	ENST00000240619.2	37	CCDS8634.1	.	.	.	.	.	.	.	.	.	.	c	7.915	0.737309	0.15574	6.81E-4	0.0	ENSG00000121318	ENST00000240619	T	0.35789	1.29	4.4	-3.44	0.04796	.	1.475580	0.03980	N	0.293049	T	0.24928	0.0605	L	0.31804	0.96	0.09310	N	1	B	0.23937	0.094	B	0.21708	0.036	T	0.28586	-1.0039	10	0.08599	T	0.76	.	11.9348	0.52868	0.0:0.2265:0.0:0.7735	.	78	Q9NYW0	T2R10_HUMAN	S	78	ENSP00000240619:G78S	ENSP00000240619:G78S	G	-	1	0	TAS2R10	10869904	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.315000	0.02713	-0.694000	0.05113	-0.941000	0.02677	GGT		TAS2R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399934.1		
DTX1	1840	broad.mit.edu	37	12	113515278	113515278	+	Silent	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr12:113515278G>A	ENST00000257600.3	+	2	812	c.309G>A	c.(307-309)ccG>ccA	p.P103P		NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	103	WWE 2. {ECO:0000255|PROSITE- ProRule:PRU00248}.				cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P103P(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						CGTCGGCGCCGGGCAAGGGCA	0.652																																					p.P103P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G309A	12						.						58.0	54.0	55.0					12																	113515278		2203	4300	6503	111999661	SO:0001819	synonymous_variant	1840	exon2			AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.309G>A	12.37:g.113515278G>A		Somatic		Capture	Illumina HiSeq	Phase_I	111999661	NM_004416	O60630|Q9BS04	Silent	SNP	ENST00000257600.3	37	CCDS9164.1																																																																																				DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2		
CLIP1	6249	broad.mit.edu	37	12	122821269	122821269	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr12:122821269C>T	ENST00000540338.1	-	11	2519	c.2478G>A	c.(2476-2478)caG>caA	p.Q826Q	CLIP1_ENST00000361654.4_Silent_p.Q704Q|CLIP1_ENST00000302528.7_Silent_p.Q815Q|CLIP1_ENST00000545889.1_Intron|CLIP1_ENST00000358808.2_Silent_p.Q815Q|CLIP1_ENST00000537178.1_Silent_p.Q780Q			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	826					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.Q815Q(1)		NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		GCTCTCTCCCCTGGAGCTCTC	0.368																																					p.Q780Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2340A	12						.						88.0	87.0	87.0					12																	122821269		2203	4300	6503	121387222	SO:0001819	synonymous_variant	6249	exon10				CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.2478G>A	12.37:g.122821269C>T		Somatic		Capture	Illumina HiSeq	Phase_I	121387222	NM_198240	A0AVD3|Q17RS4|Q29RG0	Silent	SNP	ENST00000540338.1	37	CCDS58285.1																																																																																				CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	NM_002956	
GALNT8	26290	broad.mit.edu	37	12	4874639	4874639	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr12:4874639C>T	ENST00000252318.2	+	10	2025	c.1688C>T	c.(1687-1689)gCg>gTg	p.A563V		NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	563	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.A563V(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						CCTGGCAAGGCGGAGAAGCCC	0.463																																					p.A563V	Colon(108;631 1558 7270 20097 39846)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1688T	12						.						124.0	118.0	120.0					12																	4874639		2203	4300	6503	4744900	SO:0001583	missense	26290	exon10			AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.1688C>T	12.37:g.4874639C>T	ENSP00000252318:p.Ala563Val	Somatic		Capture	Illumina HiSeq	Phase_I	4744900	NM_017417	B2RU02	Missense_Mutation	SNP	ENST00000252318.2	37	CCDS8533.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.99|13.99	2.402959|2.402959	0.42613|0.42613	.|.	.|.	ENSG00000130035|ENSG00000130035	ENST00000252318|ENST00000542998;ENST00000535354	T|.	0.30448|.	1.53|.	4.19|4.19	3.3|3.3	0.37823|0.37823	Ricin B-related lectin (1);Ricin B lectin (3);|.	0.544168|.	0.16565|.	N|.	0.208875|.	T|T	0.36799|0.36799	0.0980|0.0980	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	D|.	0.58620|.	0.983|.	P|.	0.45310|.	0.476|.	T|T	0.20371|0.20371	-1.0277|-1.0277	10|5	0.66056|.	D|.	0.02|.	.|.	9.6776|9.6776	0.40050|0.40050	0.0:0.2271:0.7729:0.0|0.0:0.2271:0.7729:0.0	.|.	563|.	Q9NY28|.	GALT8_HUMAN|.	V|W	563|80;59	ENSP00000252318:A563V|.	ENSP00000252318:A563V|.	A|R	+|+	2|1	0|2	GALNT8|GALNT8	4744900|4744900	1.000000|1.000000	0.71417|0.71417	0.026000|0.026000	0.17262|0.17262	0.004000|0.004000	0.04260|0.04260	3.747000|3.747000	0.55134|0.55134	0.966000|0.966000	0.38159|0.38159	-0.165000|-0.165000	0.13383|0.13383	GCG|CGG		GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388277.2	NM_017417	
VWF	7450	broad.mit.edu	37	12	6094751	6094751	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr12:6094751C>T	ENST00000261405.5	-	39	7133	c.6879G>A	c.(6877-6879)acG>acA	p.T2293T		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2293	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.T2293T(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GGCAGGGCTGCGTTGTGCAGT	0.647																																					p.T2293T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G6879A	12						.						60.0	54.0	56.0					12																	6094751		2203	4300	6503	5965012	SO:0001819	synonymous_variant	7450	exon39				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.6879G>A	12.37:g.6094751C>T		Somatic		Capture	Illumina HiSeq	Phase_I	5965012	NM_000552	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	37	CCDS8539.1																																																																																				VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
GPR19	2842	broad.mit.edu	37	12	12815045	12815045	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr12:12815045A>G	ENST00000540510.1	-	2	530	c.338T>C	c.(337-339)cTc>cCc	p.L113P	GPR19_ENST00000332427.2_Missense_Mutation_p.L113P			P46093	GPR4_HUMAN	G protein-coupled receptor 19	65					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L113P(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		AACGCTGATGAGAAGGTCAGC	0.507																																					p.L113P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T338C	12						.						131.0	111.0	118.0					12																	12815045		2203	4300	6503	12706312	SO:0001583	missense	2842	exon4				CCDS8652.1	12p12.3	2014-01-30				ENSG00000183150		"""GPCR / Class A : Orphans"""	4473	protein-coding gene	gene with protein product		602927					Standard	NM_006143		Approved		uc001raq.2	Q15760		ENST00000540510.1:c.338T>C	12.37:g.12815045A>G	ENSP00000441832:p.Leu113Pro	Somatic		Capture	Illumina HiSeq	Phase_I	12706312	NM_006143	A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	ENST00000540510.1	37	CCDS8652.1	.	.	.	.	.	.	.	.	.	.	A	13.31	2.200277	0.38905	.	.	ENSG00000183150	ENST00000540510;ENST00000332427	T;T	0.51574	0.7;0.7	5.15	5.15	0.70609	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.74989	0.3789	M	0.92219	3.285	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.81938	-0.0704	10	0.72032	D	0.01	-24.815	14.8141	0.70017	1.0:0.0:0.0:0.0	.	113	Q15760	GPR19_HUMAN	P	113	ENSP00000441832:L113P;ENSP00000333744:L113P	ENSP00000333744:L113P	L	-	2	0	GPR19	12706312	1.000000	0.71417	0.060000	0.19600	0.017000	0.09413	8.908000	0.92640	2.161000	0.67846	0.460000	0.39030	CTC		GPR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400662.1	NM_006143	
SLC38A2	54407	broad.mit.edu	37	12	46756304	46756304	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr12:46756304T>C	ENST00000256689.5	-	14	1741	c.1297A>G	c.(1297-1299)Act>Gct	p.T433A	SLC38A2_ENST00000547252.1_5'Flank|SLC38A2_ENST00000551374.1_Missense_Mutation_p.T271A	NM_018976.4	NP_061849.2	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2	433					amino acid transport (GO:0006865)|glutamate secretion (GO:0014047)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|sodium ion transport (GO:0006814)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)	p.T433A(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	18	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		TCCCTAATAGTTGGGACAAAG	0.353																																					p.T433A	Ovarian(9;448 492 8335 28722 40361)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1297G	12						.						83.0	80.0	81.0					12																	46756304		2202	4299	6501	45042571	SO:0001583	missense	54407	exon14			AB037803	CCDS8749.1	12q13.11	2014-08-12			ENSG00000134294	ENSG00000134294		"""Solute carriers"""	13448	protein-coding gene	gene with protein product		605180				10747860, 17237199	Standard	NM_018976		Approved	SAT2, ATA2, KIAA1382, SNAT2	uc001rpg.3	Q96QD8	OTTHUMG00000169471	ENST00000256689.5:c.1297A>G	12.37:g.46756304T>C	ENSP00000256689:p.Thr433Ala	Somatic		Capture	Illumina HiSeq	Phase_I	45042571	NM_018976	Q6IA88|Q6ZMG2|Q9HAV3|Q9NVA8|Q9P2G5	Missense_Mutation	SNP	ENST00000256689.5	37	CCDS8749.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.241063	0.58995	.	.	ENSG00000134294	ENST00000256689;ENST00000551374	T;T	0.02177	4.41;4.41	5.79	4.65	0.58169	.	0.044548	0.85682	D	0.000000	T	0.04137	0.0115	M	0.66378	2.025	0.58432	D	0.999993	B;B;P	0.36683	0.036;0.023;0.565	B;B;B	0.36378	0.014;0.043;0.223	T	0.39057	-0.9632	10	0.51188	T	0.08	-8.0059	11.6423	0.51240	0.0:0.0692:0.0:0.9308	.	271;333;433	F8VQW8;Q96QD8-2;Q96QD8	.;.;S38A2_HUMAN	A	433;271	ENSP00000256689:T433A;ENSP00000450406:T271A	ENSP00000256689:T433A	T	-	1	0	SLC38A2	45042571	1.000000	0.71417	0.872000	0.34217	0.984000	0.73092	5.985000	0.70556	1.025000	0.39708	0.529000	0.55759	ACT		SLC38A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404226.1		
KRT80	144501	broad.mit.edu	37	12	52585639	52585639	+	Silent	SNP	A	A	G			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr12:52585639A>G	ENST00000394815.2	-	1	145	c.48T>C	c.(46-48)tgT>tgC	p.C16C	KRT80_ENST00000313234.5_Silent_p.C16C	NM_182507.2	NP_872313.2	Q6KB66	K2C80_HUMAN	keratin 80	16	Head.					cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.C16C(1)		endometrium(2)|large_intestine(2)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.108)		GGGTCACCTCACAGCTGCTGA	0.726																																					p.C16C	GBM(178;2309 2916 15678 35873)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T48C	12						.						4.0	5.0	5.0					12																	52585639		1767	3865	5632	50871906	SO:0001819	synonymous_variant	144501	exon1			BX537567	CCDS8821.2, CCDS41784.1	12q13.13	2013-01-16			ENSG00000167767	ENSG00000167767		"""-"", ""Intermediate filaments type II, keratins (basic)"""	27056	protein-coding gene	gene with protein product		611161				16831889	Standard	NM_001081492		Approved	KB20	uc001rzx.3	Q6KB66	OTTHUMG00000150193	ENST00000394815.2:c.48T>C	12.37:g.52585639A>G		Somatic		Capture	Illumina HiSeq	Phase_I	50871906	NM_182507	Q6P1A5|Q7Z3Q0	Silent	SNP	ENST00000394815.2	37	CCDS8821.2																																																																																				KRT80-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316757.1	NM_182507	
SP1	6667	broad.mit.edu	37	12	53777269	53777269	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr12:53777269C>T	ENST00000327443.4	+	3	1636	c.1538C>T	c.(1537-1539)gCt>gTt	p.A513V	SP1_ENST00000426431.2_Missense_Mutation_p.A506V	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	513	Transactivation domain C (highly charged).				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A513V(1)		breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		TCCATTCCTGCTGGCACAGTC	0.547																																					p.A513V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1538T	12						.						182.0	153.0	163.0					12																	53777269		2203	4300	6503	52063536	SO:0001583	missense	6667	exon3			J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.1538C>T	12.37:g.53777269C>T	ENSP00000329357:p.Ala513Val	Somatic		Capture	Illumina HiSeq	Phase_I	52063536	NM_138473	E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Missense_Mutation	SNP	ENST00000327443.4	37	CCDS8857.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673515	0.29693	.	.	ENSG00000185591	ENST00000327443;ENST00000426431	T;T	0.09723	2.99;2.95	4.67	4.67	0.58626	.	0.106321	0.38217	N	0.001780	T	0.05090	0.0136	N	0.12182	0.205	0.42993	D	0.994497	P	0.40731	0.728	B	0.25140	0.058	T	0.46596	-0.9180	10	0.39692	T	0.17	.	13.2563	0.60081	0.0:0.8392:0.1608:0.0	.	513	P08047	SP1_HUMAN	V	513;506	ENSP00000329357:A513V;ENSP00000404263:A506V	ENSP00000329357:A513V	A	+	2	0	SP1	52063536	0.893000	0.30496	0.994000	0.49952	0.983000	0.72400	3.168000	0.50801	2.595000	0.87683	0.467000	0.42956	GCT		SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407044.1		
GPR84	53831	broad.mit.edu	37	12	54757475	54757475	+	Missense_Mutation	SNP	C	C	T	rs147285081	byFrequency	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr12:54757475C>T	ENST00000551809.1	-	1	796	c.161G>A	c.(160-162)cGa>cAa	p.R54Q	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA|GPR84_ENST00000267015.3_Missense_Mutation_p.R54Q			Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.R54Q(1)		NS(1)|breast(2)|kidney(2)|large_intestine(6)|lung(5)|skin(1)|urinary_tract(1)	18						CAGGTTGAATCGGGTACGGAG	0.597													C|||	2	0.000399361	0.0	0.0	5008	,	,		21025	0.002		0.0	False		,,,				2504	0.0				p.R54Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G161A	12						.	C	GLN/ARG	0,4406		0,0,2203	183.0	158.0	166.0		161	3.0	1.0	12	dbSNP_134	166	1,8599	1.2+/-3.3	0,1,4299	yes	missense	GPR84	NM_020370.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	54/397	54757475	1,13005	2203	4300	6503	53043742	SO:0001583	missense	53831	exon2			AF237762	CCDS8878.1	12q13.13	2012-08-20						"""GPCR / Class A : Fatty acid receptors"""	4535	protein-coding gene	gene with protein product		606383				11273702	Standard	NM_020370		Approved	EX33	uc001sfu.3	Q9NQS5		ENST00000551809.1:c.161G>A	12.37:g.54757475C>T	ENSP00000450310:p.Arg54Gln	Somatic		Capture	Illumina HiSeq	Phase_I	53043742	NM_020370	B6V9G7	Missense_Mutation	SNP	ENST00000551809.1	37	CCDS8878.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	17.82	3.482155	0.63962	0.0	1.16E-4	ENSG00000139572	ENST00000267015;ENST00000551809	T;T	0.37411	1.2;1.2	4.81	2.98	0.34508	GPCR, rhodopsin-like superfamily (1);	0.151610	0.43747	D	0.000524	T	0.34629	0.0904	L	0.58101	1.795	0.45822	D	0.998697	P	0.46952	0.887	B	0.43623	0.425	T	0.07908	-1.0748	10	0.40728	T	0.16	-7.7585	9.4136	0.38507	0.0:0.8205:0.0:0.1795	.	54	Q9NQS5	GPR84_HUMAN	Q	54	ENSP00000267015:R54Q;ENSP00000450310:R54Q	ENSP00000267015:R54Q	R	-	2	0	GPR84	53043742	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	1.995000	0.40767	0.709000	0.31976	0.555000	0.69702	CGA		GPR84-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406156.1		
OR6C76	390326	broad.mit.edu	37	12	55820743	55820743	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr12:55820743T>C	ENST00000328314.3	+	1	706	c.706T>C	c.(706-708)Tca>Cca	p.S236P		NM_001005183.1	NP_001005183.1	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C, member 76	236						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S236P(1)		NS(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						AAAAGCCTTTTCAACCTGCTC	0.373																																					p.S236P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T706C	12						.						127.0	113.0	118.0					12																	55820743		2203	4300	6503	54107010	SO:0001583	missense	390326	exon1				CCDS31823.1	12q13.2	2013-09-23			ENSG00000185821	ENSG00000185821		"""GPCR / Class A : Olfactory receptors"""	31305	protein-coding gene	gene with protein product							Standard	NM_001005183		Approved		uc010spm.2	A6NM76	OTTHUMG00000169956	ENST00000328314.3:c.706T>C	12.37:g.55820743T>C	ENSP00000328402:p.Ser236Pro	Somatic		Capture	Illumina HiSeq	Phase_I	54107010	NM_001005183		Missense_Mutation	SNP	ENST00000328314.3	37	CCDS31823.1	.	.	.	.	.	.	.	.	.	.	t	12.59	1.983118	0.34942	.	.	ENSG00000185821	ENST00000328314	T	0.00309	8.16	4.02	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.174737	0.27411	U	0.019488	T	0.00845	0.0028	H	0.94503	3.545	0.09310	N	1	P	0.39862	0.692	P	0.54629	0.757	T	0.01015	-1.1480	10	0.72032	D	0.01	.	13.0451	0.58922	0.0:0.0:0.0:1.0	.	236	A6NM76	O6C76_HUMAN	P	236	ENSP00000328402:S236P	ENSP00000328402:S236P	S	+	1	0	OR6C76	54107010	0.001000	0.12720	0.103000	0.21229	0.361000	0.29550	0.922000	0.28734	1.815000	0.52974	0.434000	0.28630	TCA		OR6C76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406675.1	NM_001005183	
MSRB3	253827	broad.mit.edu	37	12	65702390	65702390	+	Intron	SNP	A	A	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr12:65702390A>T	ENST00000355192.3	+	2	223				MSRB3_ENST00000538725.1_3'UTR|MSRB3_ENST00000540804.1_Intron|MSRB3_ENST00000535664.1_Missense_Mutation_p.T11S|MSRB3_ENST00000308259.5_Missense_Mutation_p.T11S	NM_198080.3	NP_932346.1	Q8IXL7	MSRB3_HUMAN	methionine sulfoxide reductase B3						protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	peptide-methionine (R)-S-oxide reductase activity (GO:0033743)|zinc ion binding (GO:0008270)	p.T11S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)		GCATTTGGTGACAAAGAGCCA	0.493																																					p.T11S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A31T	12						.						137.0	121.0	127.0					12																	65702390		2203	4300	6503	63988657	SO:0001627	intron_variant	253827	exon2			BX640871	CCDS8973.1, CCDS31853.1	12q14.3	2011-11-29			ENSG00000174099	ENSG00000174099			27375	protein-coding gene	gene with protein product		613719	"""deafness, autosomal recessive 74"""	DFNB74		21185009	Standard	NM_198080		Approved	FLJ36866, DKFZp686C1178	uc021qzy.1	Q8IXL7	OTTHUMG00000168866	ENST00000355192.3:c.98-18216A>T	12.37:g.65702390A>T		Somatic		Capture	Illumina HiSeq	Phase_I	63988657	NM_001193461	B4DR19|B7ZAQ0|Q6UXS2	Missense_Mutation	SNP	ENST00000355192.3	37	CCDS8973.1	.	.	.	.	.	.	.	.	.	.	A	8.450	0.852887	0.17106	.	.	ENSG00000174099	ENST00000308259;ENST00000535664;ENST00000538045;ENST00000535239	T;T;T;T	0.63255	-0.03;-0.03;0.0;0.02	6.01	4.85	0.62838	.	.	.	.	.	T	0.39036	0.1063	N	0.04508	-0.205	0.31182	N	0.701969	B	0.21753	0.06	B	0.20184	0.028	T	0.35500	-0.9786	8	.	.	.	.	12.6089	0.56540	0.8756:0.0:0.0:0.1244	.	11	Q8IXL7-2	.	S	11	ENSP00000312274:T11S;ENSP00000441650:T11S;ENSP00000442620:T11S;ENSP00000445843:T11S	.	T	+	1	0	MSRB3	63988657	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.548000	0.67255	1.078000	0.41014	-0.341000	0.08007	ACA		MSRB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401421.1	NM_198080	
DNAH10	196385	broad.mit.edu	37	12	124403278	124403278	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr12:124403278G>A	ENST00000409039.3	+	64	10959	c.10934G>A	c.(10933-10935)cGg>cAg	p.R3645Q		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3645					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R3645Q(1)|p.R2237Q(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GACAGGCTGCGGGATGGCTAC	0.572																																					p.R3645Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G10934A	12						.						37.0	40.0	39.0					12																	124403278		1916	4125	6041	122969231	SO:0001583	missense	196385	exon64			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.10934G>A	12.37:g.124403278G>A	ENSP00000386770:p.Arg3645Gln	Somatic		Capture	Illumina HiSeq	Phase_I	122969231	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	G	25.8	4.673619	0.88445	.	.	ENSG00000197653	ENST00000409039	T	0.54279	0.58	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.81536	0.4843	H	0.96269	3.795	0.80722	D	1	D	0.71674	0.998	D	0.65010	0.931	D	0.86111	0.1562	10	0.56958	D	0.05	.	20.0407	0.97588	0.0:0.0:1.0:0.0	.	3645	Q8IVF4	DYH10_HUMAN	Q	3645	ENSP00000386770:R3645Q	ENSP00000386770:R3645Q	R	+	2	0	DNAH10	122969231	1.000000	0.71417	0.991000	0.47740	0.233000	0.25261	9.869000	0.99810	2.746000	0.94184	0.561000	0.74099	CGG		DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
TUBA3C	7278	broad.mit.edu	37	13	19752431	19752431	+	Silent	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr13:19752431G>A	ENST00000400113.3	-	3	434	c.330C>T	c.(328-330)atC>atT	p.I110I		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	110					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.I110I(2)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		TCTCCTTGCCGATGGTGTAAT	0.542																																					p.I110I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C330T	13						.						222.0	188.0	200.0					13																	19752431		2203	4300	6503	18650431	SO:0001819	synonymous_variant	7278	exon3			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.330C>T	13.37:g.19752431G>A		Somatic		Capture	Illumina HiSeq	Phase_I	18650431	NM_006001	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																				TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
POSTN	10631	broad.mit.edu	37	13	38164595	38164595	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr13:38164595C>T	ENST00000379747.4	-	4	472	c.355G>A	c.(355-357)Gcc>Acc	p.A119T	POSTN_ENST00000379742.4_Missense_Mutation_p.A119T|POSTN_ENST00000379743.4_Missense_Mutation_p.A119T|POSTN_ENST00000541481.1_Missense_Mutation_p.A119T|POSTN_ENST00000541179.1_Missense_Mutation_p.A119T|POSTN_ENST00000379749.4_Missense_Mutation_p.A119T	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	119	FAS1 1. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)	p.A119T(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		AGTTTTGAGGCGTCAGAATAG	0.453																																					p.A119T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G355A	13						.						113.0	98.0	103.0					13																	38164595		2203	4300	6503	37062595	SO:0001583	missense	10631	exon4			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.355G>A	13.37:g.38164595C>T	ENSP00000369071:p.Ala119Thr	Somatic		Capture	Illumina HiSeq	Phase_I	37062595	NM_001135934	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	37	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	C	10.29	1.308940	0.23821	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481;ENST00000538347	D;D;D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73;-2.73;-2.73	5.36	4.5	0.54988	FAS1 domain (4);	0.286888	0.37577	N	0.002026	D	0.86389	0.5921	M	0.81112	2.525	0.24986	N	0.99157	B;B;B;B;B;B;B	0.33318	0.408;0.236;0.018;0.236;0.355;0.014;0.018	B;B;B;B;B;B;B	0.27608	0.081;0.049;0.01;0.049;0.049;0.006;0.01	T	0.73126	-0.4081	10	0.13470	T	0.59	.	4.7453	0.13035	0.0:0.6147:0.1959:0.1894	.	119;119;119;119;119;119;119	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	T	119;119;119;119;119;119;36	ENSP00000437959:A119T;ENSP00000369073:A119T;ENSP00000369071:A119T;ENSP00000369067:A119T;ENSP00000369066:A119T;ENSP00000437953:A119T	ENSP00000369066:A119T	A	-	1	0	POSTN	37062595	1.000000	0.71417	0.986000	0.45419	0.735000	0.41995	2.426000	0.44731	1.224000	0.43551	0.650000	0.86243	GCC		POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
NHLRC3	387921	broad.mit.edu	37	13	39621992	39621992	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr13:39621992G>C	ENST00000379600.3	+	7	1295	c.973G>C	c.(973-975)Gca>Cca	p.A325P	NHLRC3_ENST00000379599.2_Missense_Mutation_p.A258P|NHLRC3_ENST00000470258.1_Missense_Mutation_p.A128P	NM_001012754.3	NP_001012772.1	Q5JS37	NHLC3_HUMAN	NHL repeat containing 3	325						extracellular vesicular exosome (GO:0070062)		p.A325P(1)		breast(1)|kidney(1)|large_intestine(3)|lung(4)|skin(2)	11		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;2.37e-08)|Epithelial(112;3.14e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00101)|BRCA - Breast invasive adenocarcinoma(63;0.00335)|GBM - Glioblastoma multiforme(144;0.0128)		AGTCTATGTAGCAGAAATTGG	0.398																																					p.A258P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G772C	13						.						81.0	74.0	76.0					13																	39621992		2203	4300	6503	38519992	SO:0001583	missense	387921	exon6				CCDS31961.1, CCDS31962.1	13q13.3	2007-12-18			ENSG00000188811	ENSG00000188811			33751	protein-coding gene	gene with protein product							Standard	NM_001017370		Approved		uc001uxc.4	Q5JS37	OTTHUMG00000016765	ENST00000379600.3:c.973G>C	13.37:g.39621992G>C	ENSP00000368920:p.Ala325Pro	Somatic		Capture	Illumina HiSeq	Phase_I	38519992	NM_001017370	B2RTZ2|B4DTL0|Q69YI9	Missense_Mutation	SNP	ENST00000379600.3	37	CCDS31961.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226891	0.79576	.	.	ENSG00000188811	ENST00000470258;ENST00000379600;ENST00000379599	D;D;D	0.91351	-2.83;-2.83;-2.83	4.95	4.1	0.47936	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.93923	0.8055	M	0.65498	2.005	0.43399	D	0.995523	D;D	0.89917	1.0;1.0	D;D	0.74674	0.984;0.98	D	0.93351	0.6718	9	.	.	.	-15.6447	14.0868	0.64962	0.0:0.0:0.8484:0.1516	.	258;325	B4DTL0;Q5JS37	.;NHLC3_HUMAN	P	128;325;258	ENSP00000418127:A128P;ENSP00000368920:A325P;ENSP00000368919:A258P	.	A	+	1	0	NHLRC3	38519992	1.000000	0.71417	0.993000	0.49108	0.947000	0.59692	7.057000	0.76669	1.183000	0.42943	0.563000	0.77884	GCA		NHLRC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044616.2	NM_001012754	
UTP14C	9724	broad.mit.edu	37	13	52603876	52603876	+	Silent	SNP	C	C	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr13:52603876C>A	ENST00000521776.2	+	2	1669	c.936C>A	c.(934-936)gcC>gcA	p.A312A		NM_021645.5	NP_067677.4	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)	312					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|rRNA processing (GO:0006364)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)		p.A312A(1)		breast(4)|cervix(1)|endometrium(1)|large_intestine(10)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	32		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		CAATTATGGCCAAATATGACC	0.453																																					p.A312A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C936A	13						.						132.0	136.0	134.0					13																	52603876		2203	4300	6503	51501877	SO:0001819	synonymous_variant	9724	exon2			D87455	CCDS31978.1	13q12.2-q13.3	2010-11-23	2004-06-15	2004-06-16	ENSG00000253797	ENSG00000253797			20321	protein-coding gene	gene with protein product		608969	"""KIAA0266"""	KIAA0266		9039502, 16354793	Standard	NM_021645		Approved	2700066J21Rik	uc021rjw.1	Q5TAP6	OTTHUMG00000164353	ENST00000521776.2:c.936C>A	13.37:g.52603876C>A		Somatic		Capture	Illumina HiSeq	Phase_I	51501877	NM_021645	Q5FWG3|Q92555	Silent	SNP	ENST00000521776.2	37	CCDS31978.1																																																																																				UTP14C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045049.2	NM_021645	
TBC1D4	9882	broad.mit.edu	37	13	75936234	75936234	+	Silent	SNP	T	T	C			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr13:75936234T>C	ENST00000377636.3	-	2	1354	c.1008A>G	c.(1006-1008)cgA>cgG	p.R336R	TBC1D4_ENST00000431480.2_Silent_p.R336R|TBC1D4_ENST00000425511.1_5'UTR|TBC1D4_ENST00000377625.2_Silent_p.R336R	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	336	PID 2. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)	p.R336R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		CGTGTCTCCGTCGCGGCTGGG	0.612																																					p.R336R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1008G	13						.						72.0	80.0	77.0					13																	75936234		2126	4242	6368	74834235	SO:0001819	synonymous_variant	9882	exon2			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.1008A>G	13.37:g.75936234T>C		Somatic		Capture	Illumina HiSeq	Phase_I	74834235	NM_014832	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Silent	SNP	ENST00000377636.3	37	CCDS41901.1																																																																																				TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045283.1	NM_014832	
OR4M1	441670	broad.mit.edu	37	14	20249092	20249092	+	Missense_Mutation	SNP	G	G	T	rs140877715	byFrequency	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr14:20249092G>T	ENST00000315957.4	+	1	692	c.611G>T	c.(610-612)gGt>gTt	p.G204V		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	204						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G204V(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGTAGTAGTGGTCTGATCTCT	0.473																																					p.G204V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G611T	14						.						489.0	401.0	430.0					14																	20249092		2203	4300	6503	19318932	SO:0001583	missense	441670	exon1				CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.611G>T	14.37:g.20249092G>T	ENSP00000319654:p.Gly204Val	Somatic		Capture	Illumina HiSeq	Phase_I	19318932	NM_001005500	B9EH18|Q6IFA3	Missense_Mutation	SNP	ENST00000315957.4	37	CCDS32021.1	.	.	.	.	.	.	.	.	.	.	.	15.91	2.971073	0.53614	.	.	ENSG00000176299	ENST00000315957	T	0.33865	1.39	4.43	4.43	0.53597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000107	T	0.48677	0.1513	L	0.46614	1.455	0.58432	D	0.999998	D	0.89917	1.0	D	0.77557	0.99	T	0.48127	-0.9062	10	0.87932	D	0	-8.1112	8.4925	0.33108	0.1044:0.0:0.8956:0.0	.	204	Q8NGD0	OR4M1_HUMAN	V	204	ENSP00000319654:G204V	ENSP00000319654:G204V	G	+	2	0	OR4M1	19318932	0.000000	0.05858	1.000000	0.80357	0.930000	0.56654	0.509000	0.22707	2.464000	0.83262	0.506000	0.49869	GGT		OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1		
HEATR5A	25938	broad.mit.edu	37	14	31856440	31856440	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr14:31856440G>A	ENST00000389961.3	-	7	1056	c.1057C>T	c.(1057-1059)Cgt>Tgt	p.R353C	HEATR5A_ENST00000439727.1_Missense_Mutation_p.R66C|HEATR5A_ENST00000439348.1_Missense_Mutation_p.R353C|HEATR5A_ENST00000543095.2_Missense_Mutation_p.R359C|HEATR5A_ENST00000404677.3_Missense_Mutation_p.R359C			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	353								p.R353C(2)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		GAAACACAACGGCGACAGCAG	0.458																																					p.R66C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C196T	14						.						122.0	116.0	118.0					14																	31856440		1906	4125	6031	30926191	SO:0001583	missense	25938	exon2			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.1057C>T	14.37:g.31856440G>A	ENSP00000374611:p.Arg353Cys	Somatic		Capture	Illumina HiSeq	Phase_I	30926191	NM_015473	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	ENST00000389961.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.47|13.47	2.245981|2.245981	0.39697|0.39697	.|.	.|.	ENSG00000129493|ENSG00000129493	ENST00000550366|ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095;ENST00000404677	.|T;T;T;T;T	.|0.08896	.|3.04;3.04;3.04;3.04;3.04	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	.|0.231132	.|0.44902	.|N	.|0.000417	T|T	0.07818|0.07818	0.0196|0.0196	L|L	0.35288|0.35288	1.05|1.05	0.58432|0.58432	D|D	0.999993|0.999993	.|B	.|0.18741	.|0.03	.|B	.|0.11329	.|0.006	T|T	0.16070|0.16070	-1.0415|-1.0415	5|10	.|0.45353	.|T	.|0.12	.|.	11.2307|11.2307	0.48910|0.48910	0.1416:0.0:0.8584:0.0|0.1416:0.0:0.8584:0.0	.|.	.|359	.|B5MC49	.|.	L|C	17|353;353;66;359;359	.|ENSP00000374611:R353C;ENSP00000405407:R353C;ENSP00000408681:R66C;ENSP00000437968:R359C;ENSP00000384646:R359C	.|ENSP00000374611:R353C	P|R	-|-	2|1	0|0	HEATR5A|HEATR5A	30926191|30926191	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.791000|0.791000	0.44710|0.44710	3.986000|3.986000	0.56937|0.56937	2.675000|2.675000	0.91044|0.91044	0.491000|0.491000	0.48974|0.48974	CCG|CGT		HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015473	
SPTLC2	9517	broad.mit.edu	37	14	77978688	77978688	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr14:77978688C>A	ENST00000216484.2	-	12	1821	c.1628G>T	c.(1627-1629)cGg>cTg	p.R543L		NM_004863.3	NP_004854.1	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base subunit 2	543					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)	p.R543L(1)		kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(5)	19			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)	AGGTACCAACCGATGACGGGA	0.483																																					p.R543L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1628T	14						.						164.0	144.0	151.0					14																	77978688		2203	4300	6503	77048441	SO:0001583	missense	9517	exon12			AB011098	CCDS9865.1	14q24.3	2014-09-17			ENSG00000100596	ENSG00000100596	2.3.1.50		11278	protein-coding gene	gene with protein product		605713				8921873, 9363775	Standard	NM_004863		Approved	KIAA0526, LCB2, LCB2A, hLCB2a	uc001xub.3	O15270		ENST00000216484.2:c.1628G>T	14.37:g.77978688C>A	ENSP00000216484:p.Arg543Leu	Somatic		Capture	Illumina HiSeq	Phase_I	77048441	NM_004863	Q16685	Missense_Mutation	SNP	ENST00000216484.2	37	CCDS9865.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.169375	0.57584	.	.	ENSG00000100596	ENST00000216484	D	0.95205	-3.64	5.56	5.56	0.83823	.	0.268920	0.36002	N	0.002852	D	0.85513	0.5714	N	0.08118	0	0.52501	D	0.999951	B	0.14438	0.01	B	0.10450	0.005	T	0.80600	-0.1310	10	0.07644	T	0.81	-13.3986	12.8661	0.57939	0.0:0.9254:0.0:0.0745	.	543	O15270	SPTC2_HUMAN	L	543	ENSP00000216484:R543L	ENSP00000216484:R543L	R	-	2	0	SPTLC2	77048441	0.995000	0.38212	0.956000	0.39512	0.804000	0.45430	3.375000	0.52410	2.617000	0.88574	0.644000	0.83932	CGG		SPTLC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414030.1	NM_004863	
NRDE2	55051	broad.mit.edu	37	14	90756929	90756929	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr14:90756929T>C	ENST00000354366.3	-	10	2097	c.1865A>G	c.(1864-1866)cAa>cGa	p.Q622R	NRDE2_ENST00000357904.3_Missense_Mutation_p.Q391R	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	622								p.Q622R(1)									GATCAAAGATTGCCCAATATC	0.448																																					p.Q622R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1865G	14						.						77.0	79.0	78.0					14																	90756929		2203	4300	6503	89826682	SO:0001583	missense	55051	exon10			AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.1865A>G	14.37:g.90756929T>C	ENSP00000346335:p.Gln622Arg	Somatic		Capture	Illumina HiSeq	Phase_I	89826682	NM_017970	B4DH71|Q4G0A7|Q9NWH6	Missense_Mutation	SNP	ENST00000354366.3	37	CCDS9890.1	.	.	.	.	.	.	.	.	.	.	T	10.58	1.389169	0.25118	.	.	ENSG00000119720	ENST00000354366;ENST00000357904;ENST00000554464	T;T	0.33216	1.42;1.42	5.9	3.26	0.37387	.	0.313613	0.33515	N	0.004826	T	0.20414	0.0491	L	0.29908	0.895	0.09310	N	1	P	0.37398	0.593	B	0.38378	0.272	T	0.09907	-1.0653	10	0.23302	T	0.38	-13.911	8.2992	0.32004	0.1088:0.0:0.3608:0.5304	.	622	Q9H7Z3	CN102_HUMAN	R	622;391;201	ENSP00000346335:Q622R;ENSP00000350579:Q391R	ENSP00000346335:Q622R	Q	-	2	0	C14orf102	89826682	0.996000	0.38824	0.027000	0.17364	0.429000	0.31625	2.398000	0.44486	1.033000	0.39918	0.528000	0.53228	CAA		NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411264.1	NM_017970	
COX8C	341947	broad.mit.edu	37	14	93813687	93813687	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr14:93813687G>A	ENST00000342144.2	+	1	151	c.73G>A	c.(73-75)Gct>Act	p.A25T	UNC79_ENST00000256339.4_Intron	NM_182971.2	NP_892016.1	Q7Z4L0	COX8C_HUMAN	cytochrome c oxidase subunit VIIIC	25						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)	p.A25T(1)		large_intestine(1)|lung(1)|prostate(2)|skin(1)	5		all_cancers(154;0.083)		Epithelial(152;0.176)|all cancers(159;0.197)|COAD - Colon adenocarcinoma(157;0.202)		CCTGCAGCCCGCTCCCCGCTT	0.736																																					p.A25T	GBM(134;630 1800 8342 13106 15419)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G73A	14						.						14.0	15.0	14.0					14																	93813687		2182	4232	6414	92883440	SO:0001583	missense	341947	exon1			AY161004	CCDS9910.1	14q32.13	2011-07-04	2011-05-25			ENSG00000187581		"""Mitochondrial respiratory chain complex / Complex IV"""	24382	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit VIII isoform 3"""		"""cytochrome c oxidase subunit 8C"""			12909344	Standard	NM_182971		Approved	COX8-3	uc001ybt.1	Q7Z4L0		ENST00000342144.2:c.73G>A	14.37:g.93813687G>A	ENSP00000340568:p.Ala25Thr	Somatic		Capture	Illumina HiSeq	Phase_I	92883440	NM_182971	Q495K7	Missense_Mutation	SNP	ENST00000342144.2	37	CCDS9910.1	.	.	.	.	.	.	.	.	.	.	G	6.476	0.455927	0.12283	.	.	ENSG00000187581	ENST00000342144	.	.	.	2.09	-1.97	0.07503	.	.	.	.	.	T	0.13415	0.0325	.	.	.	0.09310	N	1	P	0.41420	0.749	B	0.17979	0.02	T	0.11179	-1.0598	7	0.56958	D	0.05	.	5.254	0.15537	0.1507:0.5463:0.303:0.0	.	25	Q7Z4L0	COX8C_HUMAN	T	25	.	ENSP00000340568:A25T	A	+	1	0	COX8C	92883440	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.913000	0.04042	-0.495000	0.06659	0.298000	0.19748	GCT		COX8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412769.1	NM_182971	
AHNAK2	113146	broad.mit.edu	37	14	105412263	105412263	+	Silent	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr14:105412263G>A	ENST00000333244.5	-	7	9644	c.9525C>T	c.(9523-9525)gcC>gcT	p.A3175A	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3175						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.A3175A(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCTCAGGTCGGCCTCCACCT	0.602																																					p.A3175A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C9525T	14						.						152.0	120.0	132.0					14																	105412263		1913	3555	5468	104483308	SO:0001819	synonymous_variant	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9525C>T	14.37:g.105412263G>A		Somatic		Capture	Illumina HiSeq	Phase_I	104483308	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																				AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
MAGEL2	54551	broad.mit.edu	37	15	23890798	23890798	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr15:23890798C>T	ENST00000532292.1	-	1	377	c.283G>A	c.(283-285)Gga>Aga	p.G95R		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	0					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		ACCGGGGGTCCGGGCTGGGCC	0.652																																					p.G698R												.	.	0			c.G2092A	15						.						10.0	11.0	11.0					15																	23890798		1855	4081	5936	21441891	SO:0001583	missense	54551	exon1			AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.283G>A	15.37:g.23890798C>T	ENSP00000433433:p.Gly95Arg	Somatic		Capture	Illumina HiSeq	Phase_I	21441891	NM_019066		Missense_Mutation	SNP	ENST00000532292.1	37																																																																																					MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
UNC13C	440279	broad.mit.edu	37	15	54308005	54308005	+	Missense_Mutation	SNP	C	C	T	rs191961732		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr15:54308005C>T	ENST00000260323.11	+	1	2905	c.2905C>T	c.(2905-2907)Cgt>Tgt	p.R969C	UNC13C_ENST00000545554.1_Missense_Mutation_p.R969C|UNC13C_ENST00000537900.1_Missense_Mutation_p.R969C	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	969					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.R969C(2)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AAAGAGAATTCGTCCTTCTTT	0.393													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20961	0.0		0.0	False		,,,				2504	0.0				p.R969C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2905T	15						.	C	CYS/ARG	2,3694		0,2,1846	61.0	59.0	60.0		2905	3.7	0.4	15		60	0,8188		0,0,4094	yes	missense	UNC13C	NM_001080534.1	180	0,2,5940	TT,TC,CC		0.0,0.0541,0.0168	probably-damaging	969/2215	54308005	2,11882	1848	4094	5942	52095297	SO:0001583	missense	440279	exon1			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.2905C>T	15.37:g.54308005C>T	ENSP00000260323:p.Arg969Cys	Somatic		Capture	Illumina HiSeq	Phase_I	52095297	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	14.54	2.567396	0.45694	5.41E-4	0.0	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.82526	-1.62;-1.54;-1.62	5.58	3.68	0.42216	.	.	.	.	.	T	0.73218	0.3559	L	0.29908	0.895	0.53688	D	0.999978	B	0.14012	0.009	B	0.04013	0.001	T	0.67209	-0.5728	9	0.59425	D	0.04	.	10.3628	0.44006	0.1333:0.7959:0.0:0.0708	.	969	Q8NB66	UN13C_HUMAN	C	969	ENSP00000260323:R969C;ENSP00000438156:R969C;ENSP00000442569:R969C	ENSP00000260323:R969C	R	+	1	0	UNC13C	52095297	0.971000	0.33674	0.412000	0.26496	0.974000	0.67602	2.383000	0.44354	0.702000	0.31825	0.650000	0.86243	CGT		UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
NTRK3	4916	broad.mit.edu	37	15	88678589	88678589	+	Missense_Mutation	SNP	C	C	T	rs201426743		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr15:88678589C>T	ENST00000360948.2	-	9	1108	c.947G>A	c.(946-948)cGc>cAc	p.R316H	NTRK3_ENST00000394480.2_Missense_Mutation_p.R316H|NTRK3_ENST00000558676.1_Missense_Mutation_p.R316H|NTRK3_ENST00000317501.3_Missense_Mutation_p.R316H|NTRK3_ENST00000540489.2_Missense_Mutation_p.R316H|NTRK3_ENST00000557856.1_Missense_Mutation_p.R316H|NTRK3_ENST00000542733.2_Missense_Mutation_p.R218H|NTRK3_ENST00000355254.2_Missense_Mutation_p.R316H|NTRK3_ENST00000357724.2_Missense_Mutation_p.R316H	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	316	Ig-like C2-type 2.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R316H(3)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GTGCTCCAGGCGCAGCTCAGG	0.607			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)			C|||	1	0.000199681	0.0	0.0	5008	,	,		17456	0.0		0.001	False		,,,				2504	0.0				p.R316H			Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G947A	15						.						42.0	44.0	43.0					15																	88678589		2201	4299	6500	86479593	SO:0001583	missense	4916	exon9			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.947G>A	15.37:g.88678589C>T	ENSP00000354207:p.Arg316His	Somatic		Capture	Illumina HiSeq	Phase_I	86479593	NM_001007156	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	CCDS32322.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	13.91	2.377654	0.42105	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.74947	-0.89;-0.84;-0.83;-0.89;-0.75;0.02;0.02	5.28	5.28	0.74379	.	0.051662	0.85682	D	0.000000	T	0.57460	0.2055	N	0.20685	0.6	0.47698	D	0.999495	B;B;B;B;B;B	0.11235	0.0;0.002;0.0;0.004;0.004;0.0	B;B;B;B;B;B	0.12837	0.001;0.002;0.001;0.002;0.008;0.001	T	0.52764	-0.8532	10	0.16420	T	0.52	.	11.3397	0.49525	0.0:0.9079:0.0:0.0921	.	218;316;316;316;316;316	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	H	316;316;316;316;218;316;316	ENSP00000377990:R316H;ENSP00000354207:R316H;ENSP00000350356:R316H;ENSP00000347397:R316H;ENSP00000437773:R218H;ENSP00000444673:R316H;ENSP00000318328:R316H	ENSP00000318328:R316H	R	-	2	0	NTRK3	86479593	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.777000	0.55364	2.454000	0.82982	0.563000	0.77884	CGC		NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
CERS3	204219	broad.mit.edu	37	15	101024836	101024836	+	Missense_Mutation	SNP	G	G	A	rs138661052	byFrequency	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr15:101024836G>A	ENST00000394113.1	-	7	1016	c.326C>T	c.(325-327)aCg>aTg	p.T109M	CERS3_ENST00000538112.2_Missense_Mutation_p.T109M|CERS3_ENST00000284382.4_Missense_Mutation_p.T109M|CERS3_ENST00000560944.1_Intron			Q8IU89	CERS3_HUMAN	ceramide synthase 3	109					ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)	p.T109M(1)									CTGGCGCTCCGTCAAGTTACA	0.478																																					p.T109M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C326T	15						.	G	MET/THR	2,4404	4.2+/-10.8	0,2,2201	80.0	67.0	71.0		326	5.3	1.0	15	dbSNP_134	71	1,8599		0,1,4299	yes	missense	CERS3	NM_178842.3	81	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	probably-damaging	109/384	101024836	3,13003	2203	4300	6503	98842359	SO:0001583	missense	204219	exon6				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.326C>T	15.37:g.101024836G>A	ENSP00000377672:p.Thr109Met	Somatic		Capture	Illumina HiSeq	Phase_I	98842359	NM_178842	Q8NE64|Q8NEN6	Missense_Mutation	SNP	ENST00000394113.1	37	CCDS10384.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.675801	0.88445	4.54E-4	1.16E-4	ENSG00000154227	ENST00000284382;ENST00000394113;ENST00000538112	D;D	0.96745	-4.11;-4.11	5.26	5.26	0.73747	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.111460	0.64402	D	0.000007	D	0.98340	0.9449	M	0.88105	2.93	0.54753	D	0.999989	D	0.89917	1.0	D	0.72625	0.978	D	0.99474	1.0946	10	0.87932	D	0	-12.3621	17.6304	0.88104	0.0:0.0:1.0:0.0	.	109	Q8IU89	CERS3_HUMAN	M	109;120;109	ENSP00000284382:T109M;ENSP00000437640:T109M	ENSP00000284382:T109M	T	-	2	0	CERS3	98842359	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	8.188000	0.89710	2.448000	0.82819	0.655000	0.94253	ACG		CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313594.4	NM_178842	
SBK1	388228	broad.mit.edu	37	16	28331532	28331532	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr16:28331532C>T	ENST00000341901.4	+	4	1354	c.565C>T	c.(565-567)Cgc>Tgc	p.R189C		NM_001024401.2	NP_001019572.1	Q52WX2	SBK1_HUMAN	SH3 domain binding kinase 1	189	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R189C(1)		kidney(1)|lung(3)|ovary(1)	5						CGAGTGCCGCCGCGTAAAGCT	0.697																																					p.R189C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C565T	16						.						9.0	10.0	10.0					16																	28331532		2163	4243	6406	28239033	SO:0001583	missense	388228	exon4				CCDS32416.1	16p11.2	2013-09-27	2013-09-27			ENSG00000188322			17699	protein-coding gene	gene with protein product			"""SH3-binding domain kinase 1"""				Standard	XM_005255315		Approved	Sbk	uc002dpd.3	Q52WX2		ENST00000341901.4:c.565C>T	16.37:g.28331532C>T	ENSP00000343248:p.Arg189Cys	Somatic		Capture	Illumina HiSeq	Phase_I	28239033	NM_001024401		Missense_Mutation	SNP	ENST00000341901.4	37	CCDS32416.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.774078	0.90108	.	.	ENSG00000188322	ENST00000341901	T	0.66460	-0.21	4.44	4.44	0.53790	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79493	0.4455	M	0.69523	2.12	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	T	0.82236	-0.0557	10	0.66056	D	0.02	-21.741	14.5432	0.68011	0.0:1.0:0.0:0.0	.	189	Q52WX2	SBK1_HUMAN	C	189	ENSP00000343248:R189C	ENSP00000343248:R189C	R	+	1	0	SBK1	28239033	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.692000	0.61746	1.991000	0.58162	0.561000	0.74099	CGC		SBK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387677.1	XM_370948	
ZNF423	23090	broad.mit.edu	37	16	49670349	49670349	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr16:49670349C>T	ENST00000561648.1	-	4	2767	c.2714G>A	c.(2713-2715)cGg>cAg	p.R905Q	ZNF423_ENST00000262383.2_Missense_Mutation_p.R905Q|ZNF423_ENST00000562871.1_Missense_Mutation_p.R845Q|ZNF423_ENST00000563137.2_Missense_Mutation_p.R845Q|ZNF423_ENST00000562520.1_Missense_Mutation_p.R845Q|ZNF423_ENST00000535559.1_Missense_Mutation_p.R788Q|ZNF423_ENST00000567169.1_Missense_Mutation_p.R788Q	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	905					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R905Q(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GTCCCGCAGCCGGTGATTCTG	0.597																																					p.R905Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2714A	16						.						63.0	61.0	62.0					16																	49670349		2198	4299	6497	48227850	SO:0001583	missense	23090	exon5			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2714G>A	16.37:g.49670349C>T	ENSP00000455426:p.Arg905Gln	Somatic		Capture	Illumina HiSeq	Phase_I	48227850	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	C	13.48	2.248433	0.39797	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.09073	3.02;3.09	4.81	4.81	0.61882	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.07413	0.0187	L	0.37507	1.11	0.46437	D	0.99904	B	0.34181	0.44	B	0.17979	0.02	T	0.36456	-0.9747	9	.	.	.	-25.9397	17.8857	0.88854	0.0:1.0:0.0:0.0	.	905	Q2M1K9	ZN423_HUMAN	Q	905;788	ENSP00000262383:R905Q;ENSP00000442321:R788Q	.	R	-	2	0	ZNF423	48227850	0.987000	0.35691	1.000000	0.80357	0.989000	0.77384	2.741000	0.47426	2.234000	0.73211	0.561000	0.74099	CGG		ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
GPR97	222487	broad.mit.edu	37	16	57714440	57714440	+	Silent	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr16:57714440G>A	ENST00000333493.4	+	8	953	c.792G>A	c.(790-792)acG>acA	p.T264T	RP11-405F3.4_ENST00000563062.1_RNA|GPR97_ENST00000450388.3_Silent_p.T144T|GPR97_ENST00000327655.6_Silent_p.T54T	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	264					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T264T(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						ACCAGTCCACGGTGCATATCC	0.587																																					p.T264T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G792A	16						.						136.0	119.0	125.0					16																	57714440		2198	4300	6498	56271941	SO:0001819	synonymous_variant	222487	exon8			AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.792G>A	16.37:g.57714440G>A		Somatic		Capture	Illumina HiSeq	Phase_I	56271941	NM_170776	Q6ZMF4|Q86SL9|Q8IZF1	Silent	SNP	ENST00000333493.4	37	CCDS10786.1																																																																																				GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257333.2	NM_170776	
CDH8	1006	broad.mit.edu	37	16	61851501	61851501	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr16:61851501C>G	ENST00000577390.1	-	7	2113	c.1159G>C	c.(1159-1161)Gag>Cag	p.E387Q	CDH8_ENST00000299345.6_Missense_Mutation_p.E387Q|CDH8_ENST00000577730.1_Missense_Mutation_p.E387Q|CDH8_ENST00000584337.1_Missense_Mutation_p.E387Q	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	387	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.E387Q(2)|p.E387*(2)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		ACCGGAGGCTCATCAGCATCT	0.498																																					p.E387Q												.	.	4	Substitution - Missense(2)|Substitution - Nonsense(2)	lung(3)|large_intestine(1)	c.G1159C	16						.						112.0	93.0	99.0					16																	61851501		2203	4300	6503	60409002	SO:0001583	missense	1006	exon7			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1159G>C	16.37:g.61851501C>G	ENSP00000462701:p.Glu387Gln	Somatic		Capture	Illumina HiSeq	Phase_I	60409002	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.738946	0.89573	.	.	ENSG00000150394	ENST00000299345	T	0.65549	-0.16	6.17	6.17	0.99709	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.84347	0.5452	M	0.90705	3.14	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.971;0.994	D	0.85784	0.1363	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	203;387	Q3LID3;P55286	.;CADH8_HUMAN	Q	387	ENSP00000299345:E387Q	ENSP00000299345:E387Q	E	-	1	0	CDH8	60409002	1.000000	0.71417	0.998000	0.56505	0.875000	0.50365	7.440000	0.80464	2.941000	0.99782	0.655000	0.94253	GAG		CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
CDH8	1006	broad.mit.edu	37	16	61854921	61854921	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr16:61854921G>A	ENST00000577390.1	-	6	1886	c.932C>T	c.(931-933)tCa>tTa	p.S311L	CDH8_ENST00000299345.6_Missense_Mutation_p.S311L|CDH8_ENST00000577730.1_Missense_Mutation_p.S311L|CDH8_ENST00000584337.1_Missense_Mutation_p.S311L	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	311	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.S311L(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		ATCATATGATGACTGTGCATT	0.433																																					p.S311L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C932T	16						.						174.0	132.0	147.0					16																	61854921		2203	4300	6503	60412422	SO:0001583	missense	1006	exon6			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.932C>T	16.37:g.61854921G>A	ENSP00000462701:p.Ser311Leu	Somatic		Capture	Illumina HiSeq	Phase_I	60412422	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.991444	0.54041	.	.	ENSG00000150394	ENST00000299345	T	0.03094	4.05	6.16	6.16	0.99307	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.02380	0.0073	N	0.00347	-1.61	0.58432	D	0.999998	P;B	0.34724	0.465;0.007	B;B	0.42188	0.379;0.021	T	0.69183	-0.5212	10	0.56958	D	0.05	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	127;311	Q3LID3;P55286	.;CADH8_HUMAN	L	311	ENSP00000299345:S311L	ENSP00000299345:S311L	S	-	2	0	CDH8	60412422	0.999000	0.42202	0.943000	0.38184	0.700000	0.40528	3.745000	0.55119	2.937000	0.99478	0.650000	0.86243	TCA		CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
KCTD19	146212	broad.mit.edu	37	16	67325601	67325601	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr16:67325601C>T	ENST00000304372.5	-	13	2413	c.2358G>A	c.(2356-2358)acG>acA	p.T786T		NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	786					protein homooligomerization (GO:0051260)			p.T786T(1)		endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		TGTCCATCTCCGTGGTATAGA	0.607																																					p.T786T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2358A	16						.						80.0	89.0	86.0					16																	67325601		2079	4192	6271	65883102	SO:0001819	synonymous_variant	146212	exon13			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.2358G>A	16.37:g.67325601C>T		Somatic		Capture	Illumina HiSeq	Phase_I	65883102	NM_001100915	B4DZ49|Q8N804	Silent	SNP	ENST00000304372.5	37	CCDS42179.1																																																																																				KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422061.1	XM_085367	
COX4I1	1327	broad.mit.edu	37	16	85839440	85839440	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr16:85839440G>A	ENST00000562336.1	+	4	536	c.343G>A	c.(343-345)Gcg>Acg	p.A115T	COX4I1_ENST00000564903.1_Missense_Mutation_p.A115T|COX4I1_ENST00000568794.1_Missense_Mutation_p.A115T|COX4I1_ENST00000561569.1_Missense_Mutation_p.A115T|COX4I1_ENST00000253452.2_Missense_Mutation_p.A115T			P13073	COX41_HUMAN	cytochrome c oxidase subunit IV isoform 1	115					cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cytochrome-c oxidase activity (GO:0004129)	p.A115T(1)		endometrium(1)|large_intestine(2)|lung(5)|skin(1)	9		Renal(780;0.228)				CGGTTTCACCGCGCTCGTTAT	0.567																																					p.A115T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G343A	16						.						173.0	148.0	156.0					16																	85839440		2198	4300	6498	84396941	SO:0001583	missense	1327	exon4			AF005889	CCDS10955.1	16q24.1	2012-10-02	2001-11-30	2001-12-07	ENSG00000131143	ENSG00000131143	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2265	protein-coding gene	gene with protein product		123864	"""cytochrome c oxidase subunit IV"""	COX4		2444497, 2157630	Standard	NM_001861		Approved	COX4-1	uc002fje.3	P13073	OTTHUMG00000137649	ENST00000562336.1:c.343G>A	16.37:g.85839440G>A	ENSP00000457513:p.Ala115Thr	Somatic		Capture	Illumina HiSeq	Phase_I	84396941	NM_001861	B2R4J2|D3DUM7|Q6P666	Missense_Mutation	SNP	ENST00000562336.1	37	CCDS10955.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.445336	0.43429	.	.	ENSG00000131143	ENST00000253452	T	0.54675	0.56	4.93	4.93	0.64822	.	0.214788	0.47852	N	0.000219	T	0.54271	0.1848	M	0.86178	2.8	0.43782	D	0.996314	P	0.48834	0.916	B	0.33521	0.165	T	0.65421	-0.6172	10	0.33940	T	0.23	-14.3979	18.5171	0.90938	0.0:0.0:1.0:0.0	.	115	P13073	COX41_HUMAN	T	115	ENSP00000253452:A115T	ENSP00000253452:A115T	A	+	1	0	COX4I1	84396941	1.000000	0.71417	0.007000	0.13788	0.007000	0.05969	9.121000	0.94375	2.450000	0.82876	0.655000	0.94253	GCG		COX4I1-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430873.1	NM_001861	
ANKRD11	29123	broad.mit.edu	37	16	89346533	89346533	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr16:89346533C>T	ENST00000301030.4	-	9	6877	c.6417G>A	c.(6415-6417)ccG>ccA	p.P2139P	ANKRD11_ENST00000378330.2_Silent_p.P2139P	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2139	Pro-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.P2139P(1)		breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GGGGAAGCTCCGGCAGGGAGA	0.692																																					p.P2139P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G6417A	16						.						11.0	13.0	12.0					16																	89346533		2174	4247	6421	87874034	SO:0001819	synonymous_variant	29123	exon9			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.6417G>A	16.37:g.89346533C>T		Somatic		Capture	Illumina HiSeq	Phase_I	87874034	NM_013275	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	37	CCDS32513.1																																																																																				ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
C17orf97	400566	broad.mit.edu	37	17	263226	263226	+	Missense_Mutation	SNP	C	C	T	rs376770602		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr17:263226C>T	ENST00000360127.6	+	2	608	c.592C>T	c.(592-594)Cgg>Tgg	p.R198W	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	198								p.R198W(2)		breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						AAAACGGTACCGGTGCTTGGC	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		11322	0.0		0.0	False		,,,				2504	0.001				p.R198W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C592T	17						.	C	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	51.0	59.0	56.0		592	-1.0	0.2	17		56	0,8600		0,0,4300	no	missense	C17orf97	NM_001013672.4	101	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	198/424	263226	2,13004	2203	4300	6503	263542	SO:0001583	missense	400566	exon2			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.592C>T	17.37:g.263226C>T	ENSP00000353245:p.Arg198Trp	Somatic		Capture	Illumina HiSeq	Phase_I	263542	NM_001013672	A5D8T6|Q6NSI2|Q6PFW9	Missense_Mutation	SNP	ENST00000360127.6	37	CCDS32519.2	.	.	.	.	.	.	.	.	.	.	C	11.97	1.796599	0.31777	4.54E-4	0.0	ENSG00000187624	ENST00000360127	T	0.37235	1.21	4.91	-0.996	0.10218	.	0.393988	0.18625	N	0.135756	T	0.17916	0.0430	N	0.19112	0.55	0.58432	D	0.999997	B	0.18461	0.028	B	0.16722	0.016	T	0.05370	-1.0889	10	0.56958	D	0.05	-5.9142	2.9689	0.05916	0.329:0.3936:0.0:0.2774	.	198	Q6ZQX7-4	.	W	198	ENSP00000353245:R198W	ENSP00000353245:R198W	R	+	1	2	C17orf97	263542	0.998000	0.40836	0.173000	0.22940	0.016000	0.09150	-0.263000	0.08670	0.060000	0.16281	-0.136000	0.14681	CGG		C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255648.4	NM_001013672	
SUPT6H	6830	broad.mit.edu	37	17	27030791	27030791	+	IGR	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr17:27030791C>T	ENST00000314616.6	+	0	6518				PROCA1_ENST00000579650.1_5'Flank|PROCA1_ENST00000301039.2_Missense_Mutation_p.E266K|PROCA1_ENST00000581289.1_3'UTR|PROCA1_ENST00000439862.3_Missense_Mutation_p.E268K	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E266K(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GGGCTGGACTCGGACATCCTG	0.557																																					p.E266K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G796A	17						.						100.0	100.0	100.0					17																	27030791		2203	4300	6503	24054918	SO:0001628	intergenic_variant	147011	exon4			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27030791C>T		Somatic		Capture	Illumina HiSeq	Phase_I	24054918	NM_152465	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	C	31	5.075033	0.94000	.	.	ENSG00000167525	ENST00000301039;ENST00000439862;ENST00000415329	T;T	0.05382	3.45;3.45	5.27	5.27	0.74061	.	0.215647	0.32753	N	0.005685	T	0.16085	0.0387	L	0.34521	1.04	0.36447	D	0.865871	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.986;0.994;0.994	T	0.02491	-1.1151	10	0.72032	D	0.01	-4.6504	14.739	0.69440	0.0:1.0:0.0:0.0	.	294;268;266	Q8NCQ7;G5E9R8;Q8NCQ7-2	PRCA1_HUMAN;.;.	K	266;268;294	ENSP00000301039:E266K;ENSP00000411400:E268K	ENSP00000301039:E266K	E	-	1	0	PROCA1	24054918	0.999000	0.42202	0.989000	0.46669	0.973000	0.67179	3.687000	0.54692	2.599000	0.87857	0.655000	0.94253	GAG		SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
LPO	4025	broad.mit.edu	37	17	56343598	56343598	+	Missense_Mutation	SNP	G	G	A	rs144914036		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr17:56343598G>A	ENST00000262290.4	+	11	1920	c.1604G>A	c.(1603-1605)cGc>cAc	p.R535H	LPO_ENST00000421678.2_Missense_Mutation_p.R452H|LPO_ENST00000543544.1_Missense_Mutation_p.R476H|LPO_ENST00000582328.1_Missense_Mutation_p.R452H	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	535					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)	p.R535H(1)		breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						GGAGAGCTGCGCAACAAGCTT	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		18016	0.0		0.0	False		,,,				2504	0.001				p.R535H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1604A	17						.	G	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	64.0	57.0	60.0		1355,1604	5.1	1.0	17	dbSNP_134	60	5,8595	4.3+/-15.6	0,5,4295	yes	missense,missense	LPO	NM_001160102.1,NM_006151.2	29,29	0,6,6497	AA,AG,GG		0.0581,0.0227,0.0461	probably-damaging,probably-damaging	452/630,535/713	56343598	6,13000	2203	4300	6503	53698597	SO:0001583	missense	4025	exon11			M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.1604G>A	17.37:g.56343598G>A	ENSP00000262290:p.Arg535His	Somatic		Capture	Illumina HiSeq	Phase_I	53698597	NM_006151	A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Missense_Mutation	SNP	ENST00000262290.4	37	CCDS32689.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301331	0.81136	2.27E-4	5.81E-4	ENSG00000167419	ENST00000262290;ENST00000421678;ENST00000543544;ENST00000389576	T;T;T	0.71222	-0.55;-0.55;-0.55	6.06	5.08	0.68730	.	0.212137	0.46442	D	0.000298	D	0.84647	0.5518	M	0.89904	3.07	0.44619	D	0.99759	D;D	0.89917	1.0;1.0	D;D	0.91635	0.984;0.999	D	0.85488	0.1183	10	0.51188	T	0.08	-18.0602	8.3164	0.32102	0.0805:0.3021:0.6174:0.0	.	452;535	E7EMJ3;P22079	.;PERL_HUMAN	H	535;452;476;280	ENSP00000262290:R535H;ENSP00000400245:R452H;ENSP00000445344:R476H	ENSP00000262290:R535H	R	+	2	0	LPO	53698597	0.998000	0.40836	0.986000	0.45419	0.995000	0.86356	1.205000	0.32308	1.532000	0.49169	0.655000	0.94253	CGC		LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443961.1		
RAD51C	5889	broad.mit.edu	37	17	56801430	56801430	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr17:56801430C>T	ENST00000337432.4	+	7	1005	c.934C>T	c.(934-936)Cgg>Tgg	p.R312W	RAD51C_ENST00000583539.1_Missense_Mutation_p.R312W	NM_058216.1	NP_478123.1	O43502	RA51C_HUMAN	RAD51 paralog C	312					blood coagulation (GO:0007596)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|female meiosis sister chromatid cohesion (GO:0007066)|male meiosis I (GO:0007141)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|reciprocal meiotic recombination (GO:0007131)|sister chromatid cohesion (GO:0007062)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|Rad51C-XRCC3 complex (GO:0033065)|replication fork (GO:0005657)	ATP binding (GO:0005524)|crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)	p.R312W(1)		upper_aerodigestive_tract(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGCTACAATACGGCTAATCTT	0.383								Homologous recombination	Hereditary Breast-Ovarian Cancer, non-BRCA1/2																												p.R312W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C934T	17						.						134.0	125.0	128.0					17																	56801430		2203	4300	6503	54156429	SO:0001583	missense	5889	exon7	Familial Cancer Database	BRCAX	AF029670	CCDS11611.1, CCDS45745.1	17q25.1	2014-09-17	2013-07-02		ENSG00000108384	ENSG00000108384		"""Fanconi anemia, complementation groups"""	9820	protein-coding gene	gene with protein product		602774	"""RAD51 (S. cerevisiae) homolog C"", ""RAD51 homolog C (S. cerevisiae)"""			9469824, 22167183	Standard	NM_058216		Approved	RAD51L2, FANCO	uc002iwu.3	O43502	OTTHUMG00000141292	ENST00000337432.4:c.934C>T	17.37:g.56801430C>T	ENSP00000336701:p.Arg312Trp	Somatic		Capture	Illumina HiSeq	Phase_I	54156429	NM_058216	O43503|Q3B783	Missense_Mutation	SNP	ENST00000337432.4	37	CCDS11611.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.18|19.18	3.778012|3.778012	0.70107|0.70107	.|.	.|.	ENSG00000108384|ENSG00000108384	ENST00000337432|ENST00000413590	T|.	0.59502|.	0.26|.	6.07|6.07	3.97|3.97	0.46021|0.46021	ATPase, AAA+ type, core (1);DNA recombination and repair protein Rad51, C-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86096|0.86096	0.5851|0.5851	H|H	0.95850|0.95850	3.73|3.73	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.89098|0.89098	0.3487|0.3487	10|5	0.87932|.	D|.	0|.	-12.6312|-12.6312	13.0779|13.0779	0.59097|0.59097	0.3066:0.6934:0.0:0.0|0.3066:0.6934:0.0:0.0	.|.	303;312|.	B4E0G0;O43502|.	.;RA51C_HUMAN|.	W|M	312|191	ENSP00000336701:R312W|.	ENSP00000336701:R312W|.	R|T	+|+	1|2	2|0	RAD51C|RAD51C	54156429|54156429	0.999000|0.999000	0.42202|0.42202	0.996000|0.996000	0.52242|0.52242	0.997000|0.997000	0.91878|0.91878	0.753000|0.753000	0.26376|0.26376	0.720000|0.720000	0.32209|0.32209	0.655000|0.655000	0.94253|0.94253	CGG|ACG		RAD51C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280540.2	NM_058216	
KCNH6	81033	broad.mit.edu	37	17	61613230	61613230	+	Silent	SNP	C	C	T	rs190171184		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr17:61613230C>T	ENST00000583023.1	+	6	1313	c.1302C>T	c.(1300-1302)atC>atT	p.I434I	KCNH6_ENST00000314672.5_Silent_p.I434I|KCNH6_ENST00000580652.1_Silent_p.I434I|KCNH6_ENST00000581784.1_Intron|KCNH6_ENST00000456941.2_Intron	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	434					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.I434I(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	AACACAAGATCGGCTGGCTGG	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		20723	0.001		0.0	False		,,,				2504	0.0				p.I434I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1302T	17						.						72.0	66.0	68.0					17																	61613230		2203	4300	6503	58966962	SO:0001819	synonymous_variant	81033	exon6			AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.1302C>T	17.37:g.61613230C>T		Somatic		Capture	Illumina HiSeq	Phase_I	58966962	NM_030779	Q9BRD7	Silent	SNP	ENST00000583023.1	37	CCDS11638.1																																																																																				KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779	
MARCH10	162333	broad.mit.edu	37	17	60837288	60837288	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr17:60837288delG	ENST00000311269.5	-	4	564	c.290delC	c.(289-291)ccafs	p.P97fs	MARCH10_ENST00000583600.1_Frame_Shift_Del_p.P97fs|MARCH10_ENST00000544856.2_Frame_Shift_Del_p.P97fs|MARCH10_ENST00000456609.2_Frame_Shift_Del_p.P97fs	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	97					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.P97fs*16(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						GTCAATTGCTGGAAGTTTGGA	0.433																																					p.P97fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.290delC	17						.						256.0	203.0	221.0					17																	60837288		2203	4300	6503	58191020	SO:0001589	frameshift_variant	162333	exon4			AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.290delC	17.37:g.60837288delG	ENSP00000311496:p.Pro97fs	Somatic		Capture	Illumina HiSeq	Phase_I	58191020	NM_001100875	D3DU09|Q8IYS7|Q8N7Z7	Frame_Shift_Del	DEL	ENST00000311269.5	37	CCDS11635.1																																																																																				MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445252.1	NM_152598	
SDK2	54549	broad.mit.edu	37	17	71415391	71415391	+	Silent	SNP	G	G	A	rs201245646		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr17:71415391G>A	ENST00000392650.3	-	16	2100	c.2100C>T	c.(2098-2100)agC>agT	p.S700S	SDK2_ENST00000388726.3_Silent_p.S700S	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	700	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.S700S(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TGGTTCGACCGCTGGCGATGA	0.582													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15366	0.0		0.0	False		,,,				2504	0.0				p.S700S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2100T	17						.	G		2,4404	4.2+/-10.8	0,2,2201	63.0	55.0	58.0		2100	-2.8	1.0	17		58	0,8600		0,0,4300	no	coding-synonymous	SDK2	NM_001144952.1		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		700/2173	71415391	2,13004	2203	4300	6503	68926986	SO:0001819	synonymous_variant	54549	exon16			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.2100C>T	17.37:g.71415391G>A		Somatic		Capture	Illumina HiSeq	Phase_I	68926986	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	ENST00000392650.3	37	CCDS45769.1																																																																																				SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
PPP4R1	9989	broad.mit.edu	37	18	9549240	9549240	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr18:9549240G>A	ENST00000400556.3	-	19	2717	c.2644C>T	c.(2644-2646)Cga>Tga	p.R882*	PPP4R1_ENST00000400555.3_Nonsense_Mutation_p.R865*	NM_001042388.2	NP_001035847.1	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	882					dephosphorylation (GO:0016311)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase 4 complex (GO:0030289)	protein phosphatase type 4 regulator activity (GO:0030362)	p.R882*(1)		large_intestine(1)|skin(2)	3						AGCAGCACTCGCACGTTAGGA	0.483																																					p.R882X	Melanoma(188;1232 2082 5061 11948 35994)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2644T	18						.						178.0	174.0	176.0					18																	9549240		1993	4173	6166	9539240	SO:0001587	stop_gained	9989	exon19			AF111106	CCDS42412.1, CCDS42413.1	18p11.22	2010-06-18			ENSG00000154845	ENSG00000154845		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	9320	protein-coding gene	gene with protein product		604908				10026142	Standard	NM_001042388		Approved	PP4R1	uc002koe.2	Q8TF05	OTTHUMG00000137466	ENST00000400556.3:c.2644C>T	18.37:g.9549240G>A	ENSP00000383402:p.Arg882*	Somatic		Capture	Illumina HiSeq	Phase_I	9539240	NM_001042388	Q99774|Q9UNQ7	Nonsense_Mutation	SNP	ENST00000400556.3	37	CCDS42412.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.708386	0.68615	.	.	ENSG00000154845	ENST00000400556;ENST00000400555	.	.	.	5.65	-1.54	0.08584	.	0.134082	0.53938	D	0.000055	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.6575	19.3609	0.94438	0.0:0.0:0.6522:0.3478	.	.	.	.	X	882;865	.	.	R	-	1	2	PPP4R1	9539240	0.997000	0.39634	0.123000	0.21794	0.021000	0.10359	1.775000	0.38584	-0.076000	0.12775	-0.262000	0.10625	CGA		PPP4R1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268571.1	NM_005134	
SLC44A2	57153	broad.mit.edu	37	19	10742577	10742577	+	Silent	SNP	C	C	T	rs148167135		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr19:10742577C>T	ENST00000335757.5	+	9	1036	c.660C>T	c.(658-660)ctC>ctT	p.L220L	SLC44A2_ENST00000586078.1_Silent_p.L220L|SLC44A2_ENST00000407327.4_Silent_p.L218L			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	220					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)	p.L220L(1)		NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	CGCGGCAACTCGCCATGCGCA	0.572																																					p.L220L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C660T	19						.	C	,	1,4405	2.1+/-5.4	0,1,2202	87.0	84.0	85.0		654,660	1.1	1.0	19	dbSNP_134	85	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	SLC44A2	NM_001145056.1,NM_020428.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	218/705,220/707	10742577	1,13005	2203	4300	6503	10603577	SO:0001819	synonymous_variant	57153	exon9			AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.660C>T	19.37:g.10742577C>T		Somatic		Capture	Illumina HiSeq	Phase_I	10603577	NM_020428	B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Silent	SNP	ENST00000335757.5	37	CCDS12245.1																																																																																				SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452045.1		
ZNF682	91120	broad.mit.edu	37	19	20118011	20118011	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr19:20118011C>T	ENST00000397165.2	-	4	460	c.300G>A	c.(298-300)ctG>ctA	p.L100L	ZNF682_ENST00000595736.1_Silent_p.L24L|ZNF682_ENST00000358523.5_Silent_p.L68L|ZNF682_ENST00000597972.1_Silent_p.L106L|ZNF682_ENST00000397162.1_Silent_p.L68L|ZNF682_ENST00000593468.1_3'UTR|ZNF682_ENST00000596019.1_Intron	NM_033196.2	NP_149973.1	O95780	ZN682_HUMAN	zinc finger protein 682	100					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L100L(1)		endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	14						CATATCTTCTCAGTATCACTT	0.358																																					p.L100L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G300A	19						.						92.0	85.0	87.0					19																	20118011		1916	4170	6086	19979011	SO:0001819	synonymous_variant	91120	exon4			AC006539	CCDS42533.1, CCDS42534.1	19p12	2014-02-13			ENSG00000197124	ENSG00000197124		"""Zinc fingers, C2H2-type"", ""-"""	28857	protein-coding gene	gene with protein product							Standard	NM_033196		Approved	BC39498_3	uc002noq.3	O95780	OTTHUMG00000182650	ENST00000397165.2:c.300G>A	19.37:g.20118011C>T		Somatic		Capture	Illumina HiSeq	Phase_I	19979011	NM_033196	B3KU64|E9PFJ5|Q96JV9	Silent	SNP	ENST00000397165.2	37	CCDS42533.1																																																																																				ZNF682-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462888.1	NM_033196	
ZNF536	9745	broad.mit.edu	37	19	30934921	30934921	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr19:30934921C>T	ENST00000355537.3	+	2	599	c.452C>T	c.(451-453)aCg>aTg	p.T151M		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	151					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.T151M(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CACATGCGCACGCACACGGGC	0.637																																					p.T151M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C452T	19						.						59.0	50.0	53.0					19																	30934921		2203	4300	6503	35626761	SO:0001583	missense	9745	exon2				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.452C>T	19.37:g.30934921C>T	ENSP00000347730:p.Thr151Met	Somatic		Capture	Illumina HiSeq	Phase_I	35626761	NM_014717	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	19.40	3.820006	0.71028	.	.	ENSG00000198597	ENST00000355537	T	0.13089	2.62	5.67	5.67	0.87782	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.32852	0.0843	L	0.45137	1.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00577	-1.1662	10	0.49607	T	0.09	-27.3257	19.7691	0.96356	0.0:1.0:0.0:0.0	.	151;151	A7E228;O15090	.;ZN536_HUMAN	M	151	ENSP00000347730:T151M	ENSP00000347730:T151M	T	+	2	0	ZNF536	35626761	1.000000	0.71417	0.975000	0.42487	0.988000	0.76386	7.811000	0.86092	2.689000	0.91719	0.462000	0.41574	ACG		ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
SLC7A10	56301	broad.mit.edu	37	19	33703781	33703781	+	Missense_Mutation	SNP	G	G	A	rs200120655		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr19:33703781G>A	ENST00000253188.4	-	3	630	c.484C>T	c.(484-486)Cgg>Tgg	p.R162W		NM_019849.2	NP_062823.1	Q9NS82	AAA1_HUMAN	solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10	162					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|D-alanine transport (GO:0042941)|D-serine transport (GO:0042942)|ion transport (GO:0006811)|L-serine transport (GO:0015825)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)	p.R162W(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	18	Esophageal squamous(110;0.137)					GACAGCACCCGGGAGGCTGTG	0.627																																					p.R162W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C484T	19						.						59.0	63.0	61.0					19																	33703781		2203	4300	6503	38395621	SO:0001583	missense	56301	exon3			AB037670	CCDS12431.1	19q13.11	2013-05-28	2011-07-12		ENSG00000130876	ENSG00000130876		"""Solute carriers"""	11058	protein-coding gene	gene with protein product		607959				10734121, 10863037	Standard	NM_019849		Approved	asc-1	uc002num.2	Q9NS82	OTTHUMG00000180344	ENST00000253188.4:c.484C>T	19.37:g.33703781G>A	ENSP00000253188:p.Arg162Trp	Somatic		Capture	Illumina HiSeq	Phase_I	38395621	NM_019849	B2RE84	Missense_Mutation	SNP	ENST00000253188.4	37	CCDS12431.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035562	0.54896	.	.	ENSG00000130876	ENST00000253188	D	0.90261	-2.64	4.34	3.26	0.37387	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.95294	0.8473	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.95070	0.8203	10	0.87932	D	0	.	8.9738	0.35924	0.0:0.0:0.5281:0.4719	.	162	Q9NS82	AAA1_HUMAN	W	162	ENSP00000253188:R162W	ENSP00000253188:R162W	R	-	1	2	SLC7A10	38395621	1.000000	0.71417	0.938000	0.37757	0.434000	0.31775	3.699000	0.54778	1.963000	0.57068	0.462000	0.41574	CGG		SLC7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450846.2	NM_019849	
NPHS1	4868	broad.mit.edu	37	19	36339007	36339007	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr19:36339007G>T	ENST00000378910.5	-	11	1375	c.1376C>A	c.(1375-1377)aCc>aAc	p.T459N	NPHS1_ENST00000353632.6_Missense_Mutation_p.T459N	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	459	Ig-like C2-type 5.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)	p.T459N(1)		NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCTCACCCGGGTCCCAGCCCG	0.627																																					p.T459N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1376A	19						.						43.0	53.0	50.0					19																	36339007		2203	4300	6503	41030847	SO:0001583	missense	4868	exon11				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.1376C>A	19.37:g.36339007G>T	ENSP00000368190:p.Thr459Asn	Somatic		Capture	Illumina HiSeq	Phase_I	41030847	NM_004646	A6NDH2|C3RX61	Missense_Mutation	SNP	ENST00000378910.5	37	CCDS32996.1	.	.	.	.	.	.	.	.	.	.	G	13.45	2.241377	0.39598	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	D;D	0.83419	-1.72;-1.72	5.04	2.79	0.32731	Immunoglobulin subtype (1);CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.178073	0.47455	N	0.000228	T	0.72890	0.3517	L	0.38531	1.155	0.38779	D	0.954728	B	0.17465	0.022	B	0.17979	0.02	T	0.67169	-0.5738	10	0.18276	T	0.48	-19.0864	11.9241	0.52808	0.0:0.0:0.6748:0.3252	.	459	O60500	NPHN_HUMAN	N	459	ENSP00000368190:T459N;ENSP00000343634:T459N	ENSP00000343634:T459N	T	-	2	0	NPHS1	41030847	0.995000	0.38212	0.998000	0.56505	0.998000	0.95712	2.129000	0.42055	1.333000	0.45449	0.655000	0.94253	ACC		NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1		
DHX34	9704	broad.mit.edu	37	19	47876903	47876903	+	Silent	SNP	G	G	C			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr19:47876903G>C	ENST00000328771.4	+	9	2359	c.2010G>C	c.(2008-2010)cgG>cgC	p.R670R		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	670					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.R670R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		GCCGCCGCCGGGGCATAGAGG	0.652																																					p.R670R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2010C	19						.						67.0	59.0	62.0					19																	47876903		2202	4300	6502	52568703	SO:0001819	synonymous_variant	9704	exon9			D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.2010G>C	19.37:g.47876903G>C		Somatic		Capture	Illumina HiSeq	Phase_I	52568703	NM_014681	B4DMY8	Silent	SNP	ENST00000328771.4	37	CCDS12700.1																																																																																				DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681	
HAS1	3036	broad.mit.edu	37	19	52219552	52219552	+	Missense_Mutation	SNP	G	G	A	rs191873019		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr19:52219552G>A	ENST00000222115.1	-	4	1052	c.1018C>T	c.(1018-1020)Cgg>Tgg	p.R340W	HAS1_ENST00000601714.1_Missense_Mutation_p.R347W|HAS1_ENST00000594621.1_Intron|HAS1_ENST00000540069.2_Missense_Mutation_p.R339W	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	340					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)	p.R340W(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GTGAGGTGCCGGTCATCCCCA	0.537													g|||	1	0.000199681	0.0	0.0014	5008	,	,		19814	0.0		0.0	False		,,,				2504	0.0				p.R340W	NSCLC(132;636 2450 45807 47979)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1018T	19						.						117.0	106.0	110.0					19																	52219552		2203	4300	6503	56911364	SO:0001583	missense	3036	exon4			U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.1018C>T	19.37:g.52219552G>A	ENSP00000222115:p.Arg340Trp	Somatic		Capture	Illumina HiSeq	Phase_I	56911364	NM_001523	Q14470|Q9NS49	Missense_Mutation	SNP	ENST00000222115.1	37	CCDS12838.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	g	15.48	2.845486	0.51164	.	.	ENSG00000105509	ENST00000540069;ENST00000222115	T;T	0.40756	1.02;1.02	3.35	2.24	0.28232	.	0.139389	0.46442	U	0.000285	T	0.71307	0.3324	H	0.96111	3.77	0.52501	D	0.999958	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.74976	-0.3480	10	0.87932	D	0	-15.3192	9.3207	0.37962	0.0:0.0:0.7736:0.2264	.	339;340;339	G3V1S7;Q92839;Q8IYH3	.;HAS1_HUMAN;.	W	339;340	ENSP00000445021:R339W;ENSP00000222115:R340W	ENSP00000222115:R340W	R	-	1	2	HAS1	56911364	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	2.272000	0.43373	0.467000	0.27218	0.165000	0.16767	CGG		HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	NM_001523	
RFX2	5990	broad.mit.edu	37	19	6040251	6040251	+	Splice_Site	SNP	G	G	A	rs201817157		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr19:6040251G>A	ENST00000303657.5	-	5	411	c.262C>T	c.(262-264)Cga>Tga	p.R88*	RFX2_ENST00000592546.1_Splice_Site_p.R88*|RFX2_ENST00000359161.3_Splice_Site_p.R88*	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	88					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R88*(1)		breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						TAGGCTGTTCGTCTGTTAGAA	0.552																																					p.R88X	Colon(38;171 817 19800 47433 48051)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C262T	19						.						96.0	93.0	94.0					19																	6040251		2147	4217	6364	5991251	SO:0001630	splice_region_variant	5990	exon5				CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.261-1C>T	19.37:g.6040251G>A		Somatic		Capture	Illumina HiSeq	Phase_I	5991251	NM_000635	A8K581|B3KNC4|Q6IQ44|Q8SNA2	Nonsense_Mutation	SNP	ENST00000303657.5	37	CCDS12157.1	.	.	.	.	.	.	.	.	.	.	g	39	7.644561	0.98409	.	.	ENSG00000087903	ENST00000303657;ENST00000359161;ENST00000537791	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-30.0724	17.6605	0.88192	0.0:0.0:1.0:0.0	.	.	.	.	X	88;88;43	.	ENSP00000306335:R88X	R	-	1	2	RFX2	5991251	1.000000	0.71417	0.360000	0.25837	0.762000	0.43233	8.893000	0.92498	2.504000	0.84457	0.604000	0.83254	CGA		RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452687.1	NM_000635	Nonsense_Mutation
LAIR1	3903	broad.mit.edu	37	19	54866901	54866901	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr19:54866901C>T	ENST00000391742.2	-	10	992	c.840G>A	c.(838-840)acG>acA	p.T280T	CTD-2587H19.1_ENST00000596234.1_lincRNA|LAIR1_ENST00000391743.3_Silent_p.T262T|LAIR1_ENST00000313038.6_Silent_p.T273T|LAIR1_ENST00000463489.1_5'Flank|LAIR1_ENST00000434277.2_Silent_p.T279T|LAIR1_ENST00000474878.1_Silent_p.T262T|LAIR1_ENST00000348231.4_Silent_p.T263T			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	280					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T280T(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		CGGCTGCATACGTGATGGACT	0.592																																					p.T263T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G789A	19						.						142.0	135.0	137.0					19																	54866901		2203	4300	6503	59558713	SO:0001819	synonymous_variant	3903	exon9			AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.840G>A	19.37:g.54866901C>T		Somatic		Capture	Illumina HiSeq	Phase_I	59558713	NM_021706		Silent	SNP	ENST00000391742.2	37	CCDS12891.1																																																																																				LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140506.1		
ZFP28	140612	broad.mit.edu	37	19	57061473	57061473	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr19:57061473G>A	ENST00000301318.3	+	6	796	c.725G>A	c.(724-726)cGc>cAc	p.R242H	ZFP28_ENST00000591844.1_Missense_Mutation_p.R242H|AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	242	KRAB 2. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R242H(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		GTTGACTTCCGCCAGCAGCTA	0.468																																					p.R242H	Ovarian(124;554 1662 19430 21141 52494)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G725A	19						.						57.0	52.0	54.0					19																	57061473		2203	4300	6503	61753285	SO:0001583	missense	140612	exon6				CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.725G>A	19.37:g.57061473G>A	ENSP00000301318:p.Arg242His	Somatic		Capture	Illumina HiSeq	Phase_I	61753285	NM_020828	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	37	CCDS12946.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.450025	0.63290	.	.	ENSG00000196867	ENST00000301318	T	0.01787	4.64	4.16	3.13	0.36017	Krueppel-associated box (4);	1.079710	0.07281	N	0.870778	T	0.00875	0.0029	N	0.08118	0	0.09310	N	1	B;P	0.41546	0.013;0.754	B;B	0.19946	0.002;0.027	T	0.46261	-0.9204	10	0.20519	T	0.43	.	5.7885	0.18347	0.0:0.6965:0.1981:0.1054	.	242;242	Q8NHY6;A8K0L8	ZFP28_HUMAN;.	H	242	ENSP00000301318:R242H	ENSP00000301318:R242H	R	+	2	0	ZFP28	61753285	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	0.779000	0.26746	0.710000	0.31997	-0.187000	0.12897	CGC		ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
RAB11B	9230	broad.mit.edu	37	19	8464842	8464842	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr19:8464842G>A	ENST00000328024.6	+	2	354	c.136G>A	c.(136-138)Gtg>Atg	p.V46M	RAB11B_ENST00000601897.1_Intron|RAB11B_ENST00000594216.1_Missense_Mutation_p.V46M	NM_004218.3	NP_004209.2	Q15907	RB11B_HUMAN	RAB11B, member RAS oncogene family	46					cellular response to acidic pH (GO:0071468)|constitutive secretory pathway (GO:0045054)|establishment of protein localization to membrane (GO:0090150)|GTP catabolic process (GO:0006184)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|melanosome transport (GO:0032402)|receptor recycling (GO:0001881)|regulated secretory pathway (GO:0045055)|regulation of anion transport (GO:0044070)|regulation of endocytic recycling (GO:2001135)|regulation of protein localization to cell surface (GO:2000008)|retrograde transport, endosome to plasma membrane (GO:1990126)|small GTPase mediated signal transduction (GO:0007264)|transferrin transport (GO:0033572)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|phagocytic vesicle (GO:0045335)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)|synaptic vesicle (GO:0008021)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.V46M(1)		large_intestine(2)|lung(1)|ovary(1)	4						CACCATCGGCGTGGAGTTCGC	0.652																																					p.V46M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G136A	19						.						90.0	75.0	80.0					19																	8464842		2203	4300	6503	8370842	SO:0001583	missense	9230	exon2			X79780	CCDS12201.1	19p13.2	2012-07-02			ENSG00000185236	ENSG00000185236		"""RAB, member RAS oncogene"""	9761	protein-coding gene	gene with protein product		604198				7811277	Standard	NM_004218		Approved	H-YPT3	uc002mju.4	Q15907		ENST00000328024.6:c.136G>A	19.37:g.8464842G>A	ENSP00000333547:p.Val46Met	Somatic		Capture	Illumina HiSeq	Phase_I	8370842	NM_004218	A5YM50|B2R7I4|B4DMK0|D6W671|Q2YDT2|Q5U0I1|Q6FHR0|Q6FI42|Q8NI07	Missense_Mutation	SNP	ENST00000328024.6	37	CCDS12201.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.750187	0.89753	.	.	ENSG00000185236	ENST00000328024	D	0.81499	-1.5	4.23	4.23	0.50019	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.89901	0.6849	M	0.83118	2.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.987	D	0.91635	0.5322	10	0.87932	D	0	.	15.6927	0.77466	0.0:0.0:1.0:0.0	.	46;46	B4DMK0;Q15907	.;RB11B_HUMAN	M	46	ENSP00000333547:V46M	ENSP00000333547:V46M	V	+	1	0	RAB11B	8370842	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.657000	0.98554	2.341000	0.79615	0.462000	0.41574	GTG		RAB11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460343.2	NM_004218	
COL5A3	50509	broad.mit.edu	37	19	10091774	10091774	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr19:10091774C>T	ENST00000264828.3	-	33	2580	c.2495G>A	c.(2494-2496)cGg>cAg	p.R832Q		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	832	Collagen-like 3.|Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.R832Q(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TGGTGGTCCCCGCTCTCCTTC	0.537																																					p.R832Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2495A	19						.						109.0	91.0	97.0					19																	10091774		2203	4300	6503	9952774	SO:0001583	missense	50509	exon33			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.2495G>A	19.37:g.10091774C>T	ENSP00000264828:p.Arg832Gln	Somatic		Capture	Illumina HiSeq	Phase_I	9952774	NM_015719	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297575	0.60086	.	.	ENSG00000080573	ENST00000264828	D	0.96011	-3.88	4.81	3.77	0.43336	.	0.000000	0.64402	D	0.000001	D	0.91088	0.7195	N	0.17922	0.545	0.47276	D	0.999373	P	0.51537	0.946	P	0.48334	0.574	D	0.88555	0.3119	10	0.26408	T	0.33	.	10.0695	0.42324	0.0:0.9018:0.0:0.0982	.	832	P25940	CO5A3_HUMAN	Q	832	ENSP00000264828:R832Q	ENSP00000264828:R832Q	R	-	2	0	COL5A3	9952774	0.991000	0.36638	0.993000	0.49108	0.815000	0.46073	3.144000	0.50616	2.220000	0.72140	0.313000	0.20887	CGG		COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
ZNF135	7694	broad.mit.edu	37	19	58572957	58572957	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr19:58572957A>G	ENST00000313434.5	+	3	144	c.43A>G	c.(43-45)Acg>Gcg	p.T15A	ZNF135_ENST00000506786.1_5'UTR|ZNF135_ENST00000401053.4_Missense_Mutation_p.T27A|ZNF135_ENST00000359978.6_Missense_Mutation_p.T27A|ZNF135_ENST00000511556.1_Missense_Mutation_p.T15A|ZNF135_ENST00000439855.2_Missense_Mutation_p.T15A	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	15	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T15A(1)		breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		GGAGCAAGTGACGTTTGAGGA	0.597																																					p.T15A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A43G	19						.						132.0	115.0	121.0					19																	58572957		2203	4300	6503	63264769	SO:0001583	missense	7694	exon3			U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.43A>G	19.37:g.58572957A>G	ENSP00000321406:p.Thr15Ala	Somatic		Capture	Illumina HiSeq	Phase_I	63264769	NM_003436	B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Missense_Mutation	SNP	ENST00000313434.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.59|10.59	1.391887|1.391887	0.25118|0.25118	.|.	.|.	ENSG00000176293|ENSG00000176293	ENST00000504540;ENST00000401053;ENST00000359978;ENST00000439855;ENST00000313434;ENST00000511556|ENST00000391699	T;T;T;T;T|.	0.02812|.	4.15;4.15;4.15;4.15;4.15|.	2.52|2.52	0.292|0.292	0.15737|0.15737	Krueppel-associated box (4);|.	.|.	.|.	.|.	.|.	T|.	0.44074|.	0.1276|.	M|M	0.67700|0.67700	2.07|2.07	0.20307|0.20307	N|N	0.999911|0.999911	B;B|.	0.11235|.	0.004;0.004|.	B;B|.	0.14023|.	0.01;0.01|.	T|.	0.37820|.	-0.9689|.	9|.	0.51188|.	T|.	0.08|.	.|.	5.9774|5.9774	0.19389|0.19389	0.7348:0.0:0.2652:0.0|0.7348:0.0:0.2652:0.0	.|.	15;15|.	E9PEV2;P52742|.	.;ZN135_HUMAN|.	A|W	27;27;27;15;15;15|20	ENSP00000441410:T27A;ENSP00000369437:T27A;ENSP00000444828:T15A;ENSP00000321406:T15A;ENSP00000422074:T15A|.	ENSP00000321406:T15A|.	T|X	+|+	1|3	0|0	ZNF135|ZNF135	63264769|63264769	0.076000|0.076000	0.21285|0.21285	0.985000|0.985000	0.45067|0.45067	0.908000|0.908000	0.53690|0.53690	0.092000|0.092000	0.15066|0.15066	0.001000|0.001000	0.14605|0.14605	0.383000|0.383000	0.25322|0.25322	ACG|TGA		ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436	
TTC24	164118	broad.mit.edu	37	1	156552843	156552843	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:156552843G>A	ENST00000368237.3	+	3	920	c.920G>A	c.(919-921)gGg>gAg	p.G307E	TTC24_ENST00000368236.3_Missense_Mutation_p.G307E|TTC24_ENST00000478081.1_Intron			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	307								p.G307E(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCTCTGTGGGGCAGCGGTGG	0.647																																					p.G307E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G920A	1						.						32.0	37.0	35.0					1																	156552843		2021	4166	6187	154819467	SO:0001583	missense	164118	exon4				CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.920G>A	1.37:g.156552843G>A	ENSP00000357220:p.Gly307Glu	Somatic		Capture	Illumina HiSeq	Phase_I	154819467	NM_001105669	Q5T3H7	Missense_Mutation	SNP	ENST00000368237.3	37	CCDS53379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.1|23.1	4.371119|4.371119	0.82573|0.82573	.|.	.|.	ENSG00000187862|ENSG00000187862	ENST00000368236;ENST00000368237|ENST00000340086;ENST00000413282	D;D|D;D	0.81996|0.96856	-1.56;-1.56|-1.55;-4.15	4.72|4.72	4.72|4.72	0.59763|0.59763	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);|.	0.000000|0.000000	0.48767|0.48767	D|D	0.000170|0.000170	D|D	0.97056|0.97056	0.9038|0.9038	M|M	0.74258|0.74258	2.255|2.255	0.48236|0.48236	D|D	0.999612|0.999612	D|.	0.71674|.	0.998|.	P|.	0.60117|.	0.869|.	D|D	0.97253|0.97253	0.9899|0.9899	10|8	0.59425|0.56958	D|D	0.04|0.05	-31.717|-31.717	16.4337|16.4337	0.83864|0.83864	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	307|.	A2A3L6|.	TTC24_HUMAN|.	E|S	307|80;72	ENSP00000357219:G307E;ENSP00000357220:G307E|ENSP00000339487:G80S;ENSP00000400414:G72S	ENSP00000357219:G307E|ENSP00000339487:G80S	G|G	+|+	2|1	0|0	TTC24|TTC24	154819467|154819467	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.994000|0.994000	0.84299|0.84299	7.837000|7.837000	0.86796|0.86796	2.474000|2.474000	0.83562|0.83562	0.455000|0.455000	0.32223|0.32223	GGG|GGC		TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158547.1	XM_089384	
VANGL2	57216	broad.mit.edu	37	1	160389361	160389361	+	Silent	SNP	C	C	T	rs139084368		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:160389361C>T	ENST00000368061.2	+	4	1236	c.762C>T	c.(760-762)acC>acT	p.T254T	VANGL2_ENST00000483408.1_3'UTR	NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	254					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)		p.T254T(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGCGCTCCACCGACGGCGCCA	0.632																																					p.T254T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C762T	1						.	C		1,4405	2.1+/-5.4	0,1,2202	23.0	27.0	26.0		762	-7.1	0.9	1	dbSNP_134	26	0,8598		0,0,4299	no	coding-synonymous	VANGL2	NM_020335.2		0,1,6501	TT,TC,CC		0.0,0.0227,0.0077		254/522	160389361	1,13003	2203	4299	6502	158655985	SO:0001819	synonymous_variant	57216	exon4			AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.762C>T	1.37:g.160389361C>T		Somatic		Capture	Illumina HiSeq	Phase_I	158655985	NM_020335	D3DVE9|Q5T212	Silent	SNP	ENST00000368061.2	37	CCDS30915.1																																																																																				VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080677.1	NM_020335	
PRRC2C	23215	broad.mit.edu	37	1	171501777	171501777	+	Missense_Mutation	SNP	G	G	A	rs139995932	byFrequency	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:171501777G>A	ENST00000338920.4	+	12	1781	c.1544G>A	c.(1543-1545)cGt>cAt	p.R515H	PRRC2C_ENST00000426496.2_Missense_Mutation_p.R515H|PRRC2C_ENST00000476522.1_3'UTR|PRRC2C_ENST00000367742.3_Missense_Mutation_p.R517H|PRRC2C_ENST00000392078.3_Missense_Mutation_p.R517H	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	515	Glu-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.R517H(1)									GAACGGGAGCGTGAGAAAGAA	0.468																																					p.R515H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1544A	1						.	G	HIS/ARG	3,4263		0,3,2130	34.0	32.0	33.0		1544	4.6	1.0	1	dbSNP_134	33	0,8274		0,0,4137	no	missense	PRRC2C	NM_015172.3	29	0,3,6267	AA,AG,GG		0.0,0.0703,0.0239	benign	515/2818	171501777	3,12537	2133	4137	6270	169768401	SO:0001583	missense	23215	exon12			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.1544G>A	1.37:g.171501777G>A	ENSP00000343629:p.Arg515His	Somatic		Capture	Illumina HiSeq	Phase_I	169768401	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	G	4.031	0.003355	0.07866	7.03E-4	0.0	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000483654	T;T;T;T	0.08008	3.14;3.14;3.14;3.14	5.55	4.64	0.57946	.	0.179120	0.27043	N	0.021219	T	0.03220	0.0094	L	0.57536	1.79	0.09310	N	1	B;B	0.18013	0.025;0.014	B;B	0.14578	0.011;0.003	T	0.32534	-0.9903	10	0.45353	T	0.12	.	6.6598	0.23009	0.1995:0.1378:0.6627:0.0	.	515;517	Q9Y520-4;E7EPN9	.;.	H	517;515;515;517;515;271;273	ENSP00000375928:R517H;ENSP00000410219:R515H;ENSP00000356716:R517H;ENSP00000343629:R515H	ENSP00000343629:R515H	R	+	2	0	PRRC2C	169768401	0.837000	0.29446	0.991000	0.47740	0.023000	0.10783	2.460000	0.45031	1.347000	0.45714	-0.142000	0.14014	CGT		PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
ASTN1	460	broad.mit.edu	37	1	176918356	176918356	+	Silent	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:176918356G>A	ENST00000367654.3	-	12	2254	c.2043C>T	c.(2041-2043)gaC>gaT	p.D681D	ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000424564.2_Silent_p.D673D|ASTN1_ENST00000367657.3_Silent_p.D673D|ASTN1_ENST00000361833.2_Silent_p.D673D	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	681	EGF-like 3.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.D673D(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						AGGTGGGGTCGTCCGGGAAGG	0.617											OREG0014004	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D673D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2019T	1						.						80.0	77.0	78.0					1																	176918356		2203	4300	6503	175184979	SO:0001819	synonymous_variant	460	exon12			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2043C>T	1.37:g.176918356G>A		Somatic	1934	Capture	Illumina HiSeq	Phase_I	175184979	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	ENST00000367654.3	37																																																																																					ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
BRINP3	339479	broad.mit.edu	37	1	190068114	190068114	+	Silent	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:190068114G>A	ENST00000367462.3	-	8	1566	c.1335C>T	c.(1333-1335)gaC>gaT	p.D445D	BRINP3_ENST00000534846.1_Silent_p.D343D	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	445					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.D445D(1)									AGGCAGAGGCGTCTCCCACTG	0.632																																					p.D445D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1335T	1						.						62.0	52.0	55.0					1																	190068114		2203	4300	6503	188334737	SO:0001819	synonymous_variant	339479	exon8			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1335C>T	1.37:g.190068114G>A		Somatic		Capture	Illumina HiSeq	Phase_I	188334737	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Silent	SNP	ENST00000367462.3	37	CCDS1373.1																																																																																				BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
G0S2	50486	broad.mit.edu	37	1	209849221	209849221	+	Silent	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:209849221G>A	ENST00000367029.4	+	2	354	c.192G>A	c.(190-192)gcG>gcA	p.A64A	RP1-28O10.1_ENST00000445272.1_RNA|RP1-28O10.1_ENST00000441672.1_RNA	NM_015714.3	NP_056529.1	P27469	G0S2_HUMAN	G0/G1 switch 2	64					cellular lipid metabolic process (GO:0044255)|extrinsic apoptotic signaling pathway (GO:0097191)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|small molecule metabolic process (GO:0044281)	lipid particle (GO:0005811)|mitochondrion (GO:0005739)		p.A64A(1)		large_intestine(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.041)		CAGCCGTGGCGGAGCTGCAGG	0.701																																					p.A64A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G192A	1						.						14.0	16.0	15.0					1																	209849221		2196	4288	6484	207915844	SO:0001819	synonymous_variant	50486	exon2				CCDS1488.1	1q32.2	2014-04-22	2014-04-22		ENSG00000123689	ENSG00000123689			30229	protein-coding gene	gene with protein product	"""putative lymphocyte G0/G1 switch gene"""	614447	"""G0/G1switch 2"""			1930693, 10645953	Standard	NM_015714		Approved		uc001hhi.4	P27469	OTTHUMG00000036479	ENST00000367029.4:c.192G>A	1.37:g.209849221G>A		Somatic		Capture	Illumina HiSeq	Phase_I	207915844	NM_015714	Q6FGC8	Silent	SNP	ENST00000367029.4	37	CCDS1488.1																																																																																				G0S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088732.1	NM_015714	
RD3	343035	broad.mit.edu	37	1	211652529	211652529	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:211652529G>A	ENST00000367002.4	-	3	1600	c.437C>T	c.(436-438)cCc>cTc	p.P146L	RD3_ENST00000484910.1_5'UTR	NM_001164688.1|NM_183059.2	NP_001158160.1|NP_898882.1	Q7Z3Z2	RD3_HUMAN	retinal degeneration 3	146					response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)			p.P146L(1)		central_nervous_system(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10				OV - Ovarian serous cystadenocarcinoma(81;0.00284)|all cancers(67;0.0279)|Epithelial(68;0.0689)		GCTGCCGCGGGGCCGCAGGCT	0.687																																					p.P146L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C437T	1						.						24.0	23.0	23.0					1																	211652529		2200	4296	6496	209719152	SO:0001583	missense	343035	exon3			AY191519	CCDS1498.1	1q32.3	2008-02-05	2006-11-13	2006-11-13	ENSG00000198570	ENSG00000198570			19689	protein-coding gene	gene with protein product		180040	"""chromosome 1 open reading frame 36"""	C1orf36		12914764	Standard	NM_183059		Approved	LCA12	uc001hin.2	Q7Z3Z2	OTTHUMG00000037002	ENST00000367002.4:c.437C>T	1.37:g.211652529G>A	ENSP00000355969:p.Pro146Leu	Somatic		Capture	Illumina HiSeq	Phase_I	209719152	NM_001164688	A8K595	Missense_Mutation	SNP	ENST00000367002.4	37	CCDS1498.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494920	0.64186	.	.	ENSG00000198570	ENST00000367002	T	0.09350	2.99	4.33	4.33	0.51752	.	0.273852	0.32970	N	0.005431	T	0.14830	0.0358	M	0.62723	1.935	0.39016	D	0.959659	P	0.41848	0.763	P	0.44897	0.463	T	0.01914	-1.1248	10	0.41790	T	0.15	-27.6551	8.0093	0.30344	0.0:0.1404:0.6357:0.2239	.	146	Q7Z3Z2	RD3_HUMAN	L	146	ENSP00000355969:P146L	ENSP00000355969:P146L	P	-	2	0	RD3	209719152	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.652000	0.46682	2.131000	0.65755	0.555000	0.69702	CCC		RD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089837.1	NM_183059	
HSPG2	3339	broad.mit.edu	37	1	22205500	22205500	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:22205500C>T	ENST00000374695.3	-	18	2537	c.2458G>A	c.(2458-2460)Gat>Aat	p.D820N		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	820	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.D820N(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	CGGGAGGCATCGATGTATGGG	0.642																																					p.D820N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2458A	1						.						37.0	39.0	39.0					1																	22205500		2203	4300	6503	22078087	SO:0001583	missense	3339	exon18			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.2458G>A	1.37:g.22205500C>T	ENSP00000363827:p.Asp820Asn	Somatic		Capture	Illumina HiSeq	Phase_I	22078087	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.927244	0.52759	.	.	ENSG00000142798	ENST00000374695	T	0.61158	0.13	5.24	5.24	0.73138	EGF-like, laminin (3);	0.000000	0.39909	N	0.001235	T	0.53400	0.1794	N	0.03115	-0.41	0.45076	D	0.998097	D	0.89917	1.0	D	0.85130	0.997	T	0.57289	-0.7837	10	0.18710	T	0.47	.	16.3123	0.82883	0.0:1.0:0.0:0.0	.	820	P98160	PGBM_HUMAN	N	820	ENSP00000363827:D820N	ENSP00000363827:D820N	D	-	1	0	HSPG2	22078087	1.000000	0.71417	0.990000	0.47175	0.544000	0.35116	6.636000	0.74299	2.433000	0.82419	0.555000	0.69702	GAT		HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
KCNK2	3776	broad.mit.edu	37	1	215345523	215345523	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:215345523G>T	ENST00000444842.2	+	5	970	c.820G>T	c.(820-822)Gca>Tca	p.A274S	KCNK2_ENST00000391895.2_Missense_Mutation_p.A270S|KCNK2_ENST00000391894.2_Missense_Mutation_p.A259S	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	274					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)	p.A259S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	TGACTACGTTGCAGGTAAGCT	0.408																																					p.A270S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G808T	1						.						136.0	114.0	122.0					1																	215345523		2203	4300	6503	213412146	SO:0001583	missense	3776	exon5			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.820G>T	1.37:g.215345523G>T	ENSP00000394033:p.Ala274Ser	Somatic		Capture	Illumina HiSeq	Phase_I	213412146	NM_001017424	A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	ENST00000444842.2	37	CCDS41467.1	.	.	.	.	.	.	.	.	.	.	G	33	5.231127	0.95207	.	.	ENSG00000082482	ENST00000391895;ENST00000391894;ENST00000444842	T;T;T	0.25250	1.81;1.81;1.81	5.5	5.5	0.81552	Ion transport 2 (1);	0.147072	0.64402	D	0.000012	T	0.47248	0.1435	M	0.62209	1.925	0.80722	D	1	D;D;D	0.58620	0.959;0.967;0.983	P;P;P	0.62014	0.835;0.897;0.881	T	0.17137	-1.0379	10	0.30854	T	0.27	.	19.4128	0.94681	0.0:0.0:1.0:0.0	.	259;274;270	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	S	270;259;274	ENSP00000375765:A270S;ENSP00000375764:A259S;ENSP00000394033:A274S	ENSP00000375764:A259S	A	+	1	0	KCNK2	213412146	1.000000	0.71417	0.998000	0.56505	0.827000	0.46813	9.869000	0.99810	2.581000	0.87130	0.563000	0.77884	GCA		KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217	
CSMD2	114784	broad.mit.edu	37	1	34312569	34312569	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:34312569C>T	ENST00000373381.4	-	6	1125	c.949G>A	c.(949-951)Gtt>Att	p.V317I		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	277						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V277I(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CTGCTGATAACGGGGGCTGGG	0.587																																					p.V277I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G829A	1						.						59.0	55.0	56.0					1																	34312569		2203	4300	6503	34085156	SO:0001583	missense	114784	exon6			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.949G>A	1.37:g.34312569C>T	ENSP00000362479:p.Val317Ile	Somatic		Capture	Illumina HiSeq	Phase_I	34085156	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	C	10.68	1.418650	0.25552	.	.	ENSG00000121904	ENST00000373381	D	0.81996	-1.56	4.82	4.82	0.62117	CUB (5);	0.065139	0.64402	D	0.000008	T	0.54431	0.1858	N	0.01188	-0.97	0.80722	D	1	B;B	0.31485	0.021;0.325	B;B	0.21708	0.016;0.036	T	0.65627	-0.6122	10	0.02654	T	1	.	15.733	0.77819	0.0:1.0:0.0:0.0	.	277;317	Q7Z408;E7EUA6	CSMD2_HUMAN;.	I	317	ENSP00000362479:V317I	ENSP00000241312:V277I	V	-	1	0	CSMD2	34085156	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.310000	0.59141	2.378000	0.81104	0.561000	0.74099	GTT		CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
CLSPN	63967	broad.mit.edu	37	1	36216997	36216997	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:36216997A>G	ENST00000318121.3	-	10	1939	c.1882T>C	c.(1882-1884)Ttt>Ctt	p.F628L	CLSPN_ENST00000373220.3_Missense_Mutation_p.F564L|CLSPN_ENST00000520551.1_Missense_Mutation_p.F628L|CLSPN_ENST00000251195.5_Missense_Mutation_p.F628L	NM_022111.3	NP_071394.2	Q9HAW4	CLSPN_HUMAN	claspin	628				F -> S (in Ref. 1; AAG24515). {ECO:0000305}.	activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|mitotic DNA replication checkpoint (GO:0033314)|peptidyl-serine phosphorylation (GO:0018105)	nucleoplasm (GO:0005654)	anaphase-promoting complex binding (GO:0010997)|DNA binding (GO:0003677)	p.F628L(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TCTTCCTCAAACCCATCTTCA	0.433																																					p.F564L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1690C	1						.						62.0	62.0	62.0					1																	36216997		2203	4300	6503	35989584	SO:0001583	missense	63967	exon9			AF297866	CCDS396.1, CCDS53297.1	1p34.3	2010-06-24	2010-06-24		ENSG00000092853	ENSG00000092853			19715	protein-coding gene	gene with protein product		605434	"""claspin homolog (Xenopus laevis)"""			11090622, 12766152	Standard	NM_022111		Approved		uc001bzi.3	Q9HAW4	OTTHUMG00000004168	ENST00000318121.3:c.1882T>C	1.37:g.36216997A>G	ENSP00000312995:p.Phe628Leu	Somatic		Capture	Illumina HiSeq	Phase_I	35989584	NM_001190481	A6NFL4|Q1RMC6|Q2KHM3|Q5VYG0|Q6P6H5|Q8IWI1	Missense_Mutation	SNP	ENST00000318121.3	37	CCDS396.1	.	.	.	.	.	.	.	.	.	.	A	9.386	1.074252	0.20227	.	.	ENSG00000092853	ENST00000251195;ENST00000318121;ENST00000373220;ENST00000520551;ENST00000544356	T;T;T;T	0.23950	1.88;1.88;1.94;1.92	5.58	5.58	0.84498	.	0.337558	0.32901	N	0.005508	T	0.18882	0.0453	L	0.49640	1.575	0.37125	D	0.900974	B;B	0.27559	0.181;0.181	B;B	0.30943	0.122;0.122	T	0.12967	-1.0527	10	0.02654	T	1	-4.8872	6.0408	0.19732	0.7707:0.0:0.0824:0.1469	.	564;628	Q9HAW4-2;Q9HAW4	.;CLSPN_HUMAN	L	628;628;564;628;628	ENSP00000251195:F628L;ENSP00000312995:F628L;ENSP00000362317:F564L;ENSP00000428848:F628L	ENSP00000251195:F628L	F	-	1	0	CLSPN	35989584	0.997000	0.39634	0.999000	0.59377	0.845000	0.48019	2.359000	0.44142	2.130000	0.65690	0.377000	0.23210	TTT		CLSPN-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377857.1	NM_022111	
RSPO1	284654	broad.mit.edu	37	1	38095329	38095329	+	Missense_Mutation	SNP	C	C	T	rs377442675		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:38095329C>T	ENST00000401069.1	-	3	717	c.5G>A	c.(4-6)cGg>cAg	p.R2Q	RSPO1_ENST00000401068.1_Missense_Mutation_p.R2Q|RSPO1_ENST00000401070.1_Missense_Mutation_p.R2Q|RSPO1_ENST00000373059.1_Intron|RSPO1_ENST00000401071.2_Missense_Mutation_p.R2Q|RSPO1_ENST00000356545.2_Missense_Mutation_p.R2Q	NM_001242908.1	NP_001229837.1	Q2MKA7	RSPO1_HUMAN	R-spondin 1	2					canonical Wnt signaling pathway (GO:0060070)|male meiosis (GO:0007140)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of gene expression (GO:0010468)|regulation of male germ cell proliferation (GO:2000254)|regulation of receptor internalization (GO:0002090)	extracellular space (GO:0005615)|nucleus (GO:0005634)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.R2Q(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CAGCCCAAGCCGCATAGTCAC	0.647																																					p.R2Q	GBM(122;680 2230 27822 42821)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5A	1						.	C	GLN/ARG,GLN/ARG,,GLN/ARG	1,4085		0,1,2042	36.0	42.0	40.0		5,5,,5	4.3	1.0	1		40	1,8349		0,1,4174	no	missense,missense,intron,missense	RSPO1	NM_001038633.3,NM_001242908.1,NM_001242909.1,NM_001242910.1	43,43,,43	0,2,6216	TT,TC,CC		0.012,0.0245,0.0161	benign,benign,,benign	2/264,2/264,,2/201	38095329	2,12434	2043	4175	6218	37867916	SO:0001583	missense	284654	exon4			AK098225	CCDS41304.1, CCDS55590.1, CCDS55591.1	1p34.2	2014-01-30	2011-06-29		ENSG00000169218	ENSG00000169218		"""Endogenous ligands"""	21679	protein-coding gene	gene with protein product		609595	"""R-spondin homolog (Xenopus laevis)"""				Standard	NM_001038633		Approved	FLJ40906, RSPONDIN	uc001cbm.2	Q2MKA7	OTTHUMG00000004321	ENST00000401069.1:c.5G>A	1.37:g.38095329C>T	ENSP00000383847:p.Arg2Gln	Somatic		Capture	Illumina HiSeq	Phase_I	37867916	NM_001038633	A2A420|Q0H8S6|Q14C72|Q5T0F2|Q8N7L5	Missense_Mutation	SNP	ENST00000401069.1	37	CCDS41304.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.782981	0.49891	2.45E-4	1.2E-4	ENSG00000169218	ENST00000401070;ENST00000356545;ENST00000401071;ENST00000401069;ENST00000401068	D;T;D;T;T	0.85955	-2.05;-1.43;-2.05;-1.43;-1.43	5.27	4.35	0.52113	.	0.481154	0.18428	U	0.141527	T	0.57080	0.2029	N	0.01352	-0.895	0.31643	N	0.64775	B;B	0.24132	0.098;0.056	B;B	0.12156	0.007;0.002	T	0.58387	-0.7645	10	0.06365	T	0.9	.	8.8373	0.35119	0.0:0.8999:0.0:0.1001	.	2;2	Q0H8S6;Q2MKA7	.;RSPO1_HUMAN	Q	2	ENSP00000383848:R2Q;ENSP00000348944:R2Q;ENSP00000383849:R2Q;ENSP00000383847:R2Q;ENSP00000383846:R2Q	ENSP00000348944:R2Q	R	-	2	0	RSPO1	37867916	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.012000	0.29924	2.468000	0.83385	0.462000	0.41574	CGG		RSPO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012477.2	NM_173640	
SMAP2	64744	broad.mit.edu	37	1	40874370	40874370	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:40874370G>A	ENST00000539317.1	+	3	236	c.43G>A	c.(43-45)Gcc>Acc	p.A15T		NM_001198980.1	NP_001185909.1	Q8WU79	SMAP2_HUMAN	small ArfGAP2	95	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.A95T(1)		central_nervous_system(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24	Lung NSC(20;1.56e-05)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.04e-17)			ACTTTATGAAGCCTATCTTCC	0.448																																					p.A90T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G268A	1						.						200.0	166.0	178.0					1																	40874370		2203	4300	6503	40646957	SO:0001583	missense	64744	exon3			AL137764	CCDS451.1, CCDS55592.1, CCDS55593.1, CCDS72763.1	1p35.3-p34.1	2008-09-22	2008-09-05	2008-01-09	ENSG00000084070	ENSG00000084070		"""ADP-ribosylation factor GTPase activating proteins"""	25082	protein-coding gene	gene with protein product			"""stromal membrane-associated protein 1-like"", ""stromal membrane-associated GTPase-activating protein 2"""	SMAP1L		16571680	Standard	NM_001198978		Approved		uc001cfj.3	Q8WU79	OTTHUMG00000007301	ENST00000539317.1:c.43G>A	1.37:g.40874370G>A	ENSP00000442835:p.Ala15Thr	Somatic		Capture	Illumina HiSeq	Phase_I	40646957	NM_001198979	B2R7T1|B7Z5B5|B7Z8V2|D3DPV2|Q5QPL2|Q96C93|Q9NST2|Q9UJL8	Missense_Mutation	SNP	ENST00000539317.1	37	CCDS55593.1	.	.	.	.	.	.	.	.	.	.	G	35	5.589627	0.96590	.	.	ENSG00000084070	ENST00000435168;ENST00000372718;ENST00000372708;ENST00000539317	T;T;T	0.47177	0.85;0.85;0.88	5.59	5.59	0.84812	.	0.098719	0.64402	D	0.000001	T	0.73385	0.3580	M	0.87269	2.87	0.80722	D	1	P;D;P	0.67145	0.946;0.996;0.507	P;D;B	0.77557	0.781;0.99;0.188	T	0.77892	-0.2418	10	0.72032	D	0.01	-0.2466	17.0736	0.86581	0.0:0.0:1.0:0.0	.	15;65;95	B7Z5B5;Q8WU79-2;Q8WU79	.;.;SMAP2_HUMAN	T	95;95;65;15	ENSP00000361803:A95T;ENSP00000361793:A65T;ENSP00000442835:A15T	ENSP00000361793:A65T	A	+	1	0	SMAP2	40646957	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.627000	0.88993	0.655000	0.94253	GCC		SMAP2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022733	
HPDL	84842	broad.mit.edu	37	1	45793270	45793270	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:45793270C>T	ENST00000334815.3	+	1	726	c.450C>T	c.(448-450)tcC>tcT	p.S150S		NM_032756.2	NP_116145.1	Q96IR7	HPDL_HUMAN	4-hydroxyphenylpyruvate dioxygenase-like	150					aromatic amino acid family metabolic process (GO:0009072)		4-hydroxyphenylpyruvate dioxygenase activity (GO:0003868)|metal ion binding (GO:0046872)	p.S150S(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4	Acute lymphoblastic leukemia(166;0.155)					GGCCCGTGTCCTCTGCGCCTG	0.701																																					p.S150S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C450T	1						.						15.0	15.0	15.0					1																	45793270		2192	4285	6477	45565857	SO:0001819	synonymous_variant	84842	exon1			BC007293	CCDS519.1	1p34.1	2008-02-05	2007-03-14	2007-03-14	ENSG00000186603	ENSG00000186603			28242	protein-coding gene	gene with protein product			"""glyoxalase domain containing 1"""	GLOXD1		12477932	Standard	NM_032756		Approved	MGC15668, 4-HPPD-L	uc001cne.3	Q96IR7	OTTHUMG00000007681	ENST00000334815.3:c.450C>T	1.37:g.45793270C>T		Somatic		Capture	Illumina HiSeq	Phase_I	45565857	NM_032756	B2R9B0	Silent	SNP	ENST00000334815.3	37	CCDS519.1																																																																																				HPDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020527.1	NM_032756	
ZYG11B	79699	broad.mit.edu	37	1	53236946	53236946	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:53236946G>A	ENST00000294353.6	+	3	596	c.451G>A	c.(451-453)Gag>Aag	p.E151K	ZYG11B_ENST00000443756.2_Missense_Mutation_p.E151K|ZYG11B_ENST00000545132.1_Missense_Mutation_p.E151K	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	151								p.E151K(1)		breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						TCTCTCCCTCGAGGATCCTTA	0.478																																					p.E151K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G451A	1						.						84.0	83.0	83.0					1																	53236946		2203	4300	6503	53009534	SO:0001583	missense	79699	exon3			AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.451G>A	1.37:g.53236946G>A	ENSP00000294353:p.Glu151Lys	Somatic		Capture	Illumina HiSeq	Phase_I	53009534	NM_024646	Q8N2X3|Q9H8L8	Missense_Mutation	SNP	ENST00000294353.6	37	CCDS30717.1	.	.	.	.	.	.	.	.	.	.	G	15.37	2.814159	0.50527	.	.	ENSG00000162378	ENST00000443756;ENST00000545132;ENST00000294353	T;T;T	0.05925	3.37;3.37;3.37	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.22282	0.0537	M	0.71581	2.175	0.58432	D	0.999994	D;D	0.76494	0.999;0.962	D;B	0.76575	0.988;0.239	T	0.10613	-1.0622	10	0.06891	T	0.86	.	19.6182	0.95643	0.0:0.0:1.0:0.0	.	151;151	B4DK95;Q9C0D3	.;ZY11B_HUMAN	K	151	ENSP00000400522:E151K;ENSP00000441315:E151K;ENSP00000294353:E151K	ENSP00000294353:E151K	E	+	1	0	ZYG11B	53009534	1.000000	0.71417	0.959000	0.39883	0.511000	0.34104	7.408000	0.80041	2.653000	0.90120	0.650000	0.86243	GAG		ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024749.1	NM_024646	
CCBL2	56267	broad.mit.edu	37	1	89454016	89454016	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:89454016C>T	ENST00000260508.4	-	2	355	c.18G>A	c.(16-18)agG>agA	p.R6R	CCBL2_ENST00000370485.2_Silent_p.R6R|RBMXL1_ENST00000413769.1_5'UTR|RBMXL1_ENST00000399794.2_5'UTR|CCBL2_ENST00000370491.3_Intron|RBMXL1_ENST00000321792.5_Intron|CCBL2_ENST00000446900.2_5'UTR	NM_001008661.2	NP_001008661.1	Q6YP21	KAT3_HUMAN	cysteine conjugate-beta lyase 2	6					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	mitochondrion (GO:0005739)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|kynurenine-glyoxylate transaminase activity (GO:0047315)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)	p.R6R(1)		endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|ovary(2)|skin(2)|soft_tissue(1)	18		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)		AGCAGAGGCTCCTCTGGGCCA	0.383																																					p.R6R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G18A	1						.						44.0	47.0	46.0					1																	89454016		2201	4300	6501	89226604	SO:0001819	synonymous_variant	56267	exon2			AF091090	CCDS30766.1, CCDS30767.1	1p22.2	2009-06-23			ENSG00000137944	ENSG00000137944			33238	protein-coding gene	gene with protein product		610656				16376499	Standard	NM_001008662		Approved	RBM1, RP11-82K18.3, KAT3	uc001dmp.2	Q6YP21	OTTHUMG00000010617	ENST00000260508.4:c.18G>A	1.37:g.89454016C>T		Somatic		Capture	Illumina HiSeq	Phase_I	89226604	NM_001008661	B3KQ13|O95335|Q5JS27|Q5T9T7|Q5T9T8|Q6AI27|Q6ICW1|Q9BVY5	Silent	SNP	ENST00000260508.4	37	CCDS30766.1																																																																																				CCBL2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000029300.3	NM_001008661	
NLRP3	114548	broad.mit.edu	37	1	247608058	247608058	+	Silent	SNP	C	C	T	rs199649583		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr1:247608058C>T	ENST00000336119.3	+	8	3692	c.2946C>T	c.(2944-2946)ggC>ggT	p.G982G	NLRP3_ENST00000391827.2_Silent_p.G925G|NLRP3_ENST00000366496.2_Silent_p.G925G|NLRP3_ENST00000391828.3_Silent_p.G982G|NLRP3_ENST00000348069.2_Silent_p.G868G|NLRP3_ENST00000366497.2_Silent_p.G925G	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	982					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.G982G(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			ATGACCTGGGCGACCTGGGGG	0.582																																					p.G982G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2946T	1						.						64.0	57.0	59.0					1																	247608058		2203	4300	6503	245674681	SO:0001819	synonymous_variant	114548	exon8			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2946C>T	1.37:g.247608058C>T		Somatic		Capture	Illumina HiSeq	Phase_I	245674681	NM_004895	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Silent	SNP	ENST00000336119.3	37	CCDS1632.1																																																																																				NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
XRN2	22803	broad.mit.edu	37	20	21314590	21314590	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr20:21314590C>T	ENST00000377191.3	+	12	1178	c.1083C>T	c.(1081-1083)gaC>gaT	p.D361D	XRN2_ENST00000539513.1_Silent_p.D307D|XRN2_ENST00000430571.2_Silent_p.D285D	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	361					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.D361D(1)		endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						ATGCAATTGACCGTTTGGTTA	0.353																																					p.D361D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1083T	20						.						173.0	163.0	166.0					20																	21314590		2203	4300	6503	21262590	SO:0001819	synonymous_variant	22803	exon12			AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.1083C>T	20.37:g.21314590C>T		Somatic		Capture	Illumina HiSeq	Phase_I	21262590	NM_012255	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Silent	SNP	ENST00000377191.3	37	CCDS13144.1																																																																																				XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078273.2	NM_012255	
BPIFB3	359710	broad.mit.edu	37	20	31652477	31652477	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr20:31652477C>T	ENST00000375494.3	+	8	750	c.750C>T	c.(748-750)atC>atT	p.I250I		NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	250					innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.I250I(1)									TGCAGCCTATCGTGAAGAGTG	0.607																																					p.I250I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C750T	20						.						65.0	62.0	63.0					20																	31652477		2203	4300	6503	31116138	SO:0001819	synonymous_variant	359710	exon8			AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.750C>T	20.37:g.31652477C>T		Somatic		Capture	Illumina HiSeq	Phase_I	31116138	NM_182658	Q5TDX7	Silent	SNP	ENST00000375494.3	37	CCDS13212.1																																																																																				BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078654.2	NM_182658	
BPIFA3	128861	broad.mit.edu	37	20	31811757	31811757	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr20:31811757C>A	ENST00000375454.3	+	2	478	c.268C>A	c.(268-270)Caa>Aaa	p.Q90K	BPIFA3_ENST00000490499.1_3'UTR|BPIFA3_ENST00000375452.3_Missense_Mutation_p.Q90K	NM_178466.3	NP_848561.2	Q9BQP9	BPIA3_HUMAN	BPI fold containing family A, member 3	90	Poly-Gln.					extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.Q90K(1)									CCAGCAGCAGCAAGAGAGCAG	0.562																																					p.Q90K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C268A	20						.						72.0	62.0	66.0					20																	31811757		2203	4300	6503	31275418	SO:0001583	missense	128861	exon2				CCDS13216.2, CCDS42865.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131059	ENSG00000131059		"""BPI fold containing"""	16204	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 71"""	C20orf71		11971875, 21787333	Standard	XR_244132		Approved	bA49G10.4, SPLUNC3	uc002wyr.3	Q9BQP9	OTTHUMG00000032245	ENST00000375454.3:c.268C>A	20.37:g.31811757C>A	ENSP00000364603:p.Gln90Lys	Somatic		Capture	Illumina HiSeq	Phase_I	31275418	NM_178466	Q5JWG8|Q6NZ38	Missense_Mutation	SNP	ENST00000375454.3	37	CCDS13216.2	.	.	.	.	.	.	.	.	.	.	C	9.431	1.085630	0.20390	.	.	ENSG00000131059	ENST00000375454;ENST00000375452	T;T	0.26957	3.67;1.7	4.27	1.12	0.20585	.	0.339704	0.21507	N	0.073432	T	0.35422	0.0931	L	0.32530	0.975	0.09310	N	1	P;D	0.62365	0.884;0.991	B;D	0.74023	0.426;0.982	T	0.17018	-1.0383	10	0.45353	T	0.12	-0.643	12.1173	0.53872	0.0:0.4841:0.5159:0.0	.	90;90	Q9BQP9-2;Q9BQP9	.;BPIA3_HUMAN	K	90	ENSP00000364603:Q90K;ENSP00000364601:Q90K	ENSP00000364601:Q90K	Q	+	1	0	BPIFA3	31275418	0.961000	0.32948	0.025000	0.17156	0.050000	0.14768	0.175000	0.16762	0.298000	0.22638	0.655000	0.94253	CAA		BPIFA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078672.1	NM_178466	
TGM2	7052	broad.mit.edu	37	20	36775177	36775177	+	Silent	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr20:36775177G>A	ENST00000361475.2	-	6	974	c.801C>T	c.(799-801)caC>caT	p.H267H	TGM2_ENST00000536701.1_Silent_p.H186H|TGM2_ENST00000536724.1_Silent_p.H207H	NM_004613.2|NM_198951.1	NP_004604.2|NP_945189.1	P21980	TGM2_HUMAN	transglutaminase 2	267					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|branching involved in salivary gland morphogenesis (GO:0060445)|isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein homooligomerization (GO:0051260)|salivary gland cavitation (GO:0060662)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.H267H(1)		endometrium(2)|large_intestine(11)|liver(1)|lung(7)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	GCTGGCAGCCGTGGTTCTTCC	0.667																																					p.H267H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C801T	20						.						42.0	34.0	37.0					20																	36775177		2202	4297	6499	36208591	SO:0001819	synonymous_variant	7052	exon6			M98478	CCDS13302.1	20q12	2013-05-02	2013-05-02		ENSG00000198959	ENSG00000198959	2.3.2.13	"""Transglutaminases"""	11778	protein-coding gene	gene with protein product	"""C polypeptide, protein-glutamine-gamma-glutamyltransferase"""	190196	"""transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7912692, 11390390	Standard	NM_004613		Approved	TGC	uc002xhr.3	P21980	OTTHUMG00000032437	ENST00000361475.2:c.801C>T	20.37:g.36775177G>A		Somatic		Capture	Illumina HiSeq	Phase_I	36208591	NM_198951	E1P5V9|Q16436|Q6B838|Q9BTN7|Q9UH35	Silent	SNP	ENST00000361475.2	37	CCDS13302.1																																																																																				TGM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079151.2	NM_198951	
NTSR1	4923	broad.mit.edu	37	20	61386125	61386125	+	Missense_Mutation	SNP	G	G	A	rs373051104		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr20:61386125G>A	ENST00000370501.3	+	2	1174	c.803G>A	c.(802-804)cGc>cAc	p.R268H		NM_002531.2	NP_002522.2	P30989	NTR1_HUMAN	neurotensin receptor 1 (high affinity)	268					adult locomotory behavior (GO:0008344)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)	p.R268H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(16)|prostate(1)|skin(3)	27	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			GTCATGGTACGCCAGGCGGCC	0.627																																					p.R268H	GBM(37;400 780 6403 19663 35669)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G803A	20						.		HIS/ARG	0,4406		0,0,2203	125.0	102.0	110.0		803	1.5	1.0	20		110	2,8598	2.2+/-6.3	0,2,4298	no	missense	NTSR1	NM_002531.2	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	268/419	61386125	2,13004	2203	4300	6503	60856570	SO:0001583	missense	4923	exon2				CCDS13502.1	20q13	2012-08-08			ENSG00000101188	ENSG00000101188		"""GPCR / Class A : Neurotensin receptors"""	8039	protein-coding gene	gene with protein product		162651				8075503	Standard	NM_002531		Approved	NTR	uc002ydf.3	P30989	OTTHUMG00000032932	ENST00000370501.3:c.803G>A	20.37:g.61386125G>A	ENSP00000359532:p.Arg268His	Somatic		Capture	Illumina HiSeq	Phase_I	60856570	NM_002531	Q9H4H1|Q9H4T5	Missense_Mutation	SNP	ENST00000370501.3	37	CCDS13502.1	.	.	.	.	.	.	.	.	.	.	g	8.088	0.773898	0.16051	0.0	2.33E-4	ENSG00000101188	ENST00000370501	T	0.42513	0.97	4.01	1.47	0.22746	GPCR, rhodopsin-like superfamily (1);	0.999600	0.08092	N	0.999188	T	0.30479	0.0766	L	0.37507	1.11	0.31431	N	0.673159	B	0.11235	0.004	B	0.06405	0.002	T	0.37150	-0.9718	10	0.42905	T	0.14	-15.9644	4.5602	0.12156	0.6383:0.0:0.3617:0.0	.	268	P30989	NTR1_HUMAN	H	268	ENSP00000359532:R268H	ENSP00000359532:R268H	R	+	2	0	NTSR1	60856570	1.000000	0.71417	0.998000	0.56505	0.229000	0.25112	1.250000	0.32850	0.762000	0.33152	0.306000	0.20318	CGC		NTSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080061.1		
IL17RA	23765	broad.mit.edu	37	22	17589845	17589845	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr22:17589845T>G	ENST00000319363.6	+	13	1869	c.1736T>G	c.(1735-1737)gTc>gGc	p.V579G		NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	579					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)	p.V579G(1)		endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		GACTGGCAGGTCCGCTGTCCC	0.662																																					p.V579G												.	.	1	Substitution - Missense(1)	ovary(1)	c.T1736G	22						.						14.0	14.0	14.0					22																	17589845		2192	4292	6484	15969845	SO:0001583	missense	23765	exon13			U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.1736T>G	22.37:g.17589845T>G	ENSP00000320936:p.Val579Gly	None		Capture	Illumina HiSeq	Phase_I	15969845	NM_014339	O43844|Q20WK1	Missense_Mutation	SNP	ENST00000319363.6	37	CCDS13739.1	.	.	.	.	.	.	.	.	.	.	T	1.371	-0.586111	0.03827	.	.	ENSG00000177663	ENST00000425985;ENST00000319363	T	0.05855	3.38	4.95	-0.89	0.10577	.	1.292530	0.04879	N	0.447413	T	0.06416	0.0165	L	0.43152	1.355	0.09310	N	1	B;B	0.20887	0.049;0.012	B;B	0.19666	0.026;0.01	T	0.43861	-0.9365	10	0.25106	T	0.35	-1.6283	5.5317	0.16989	0.1231:0.5173:0.0:0.3596	.	527;579	D3YTB4;Q96F46	.;I17RA_HUMAN	G	527;579	ENSP00000320936:V579G	ENSP00000320936:V579G	V	+	2	0	IL17RA	15969845	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-0.627000	0.05521	-0.005000	0.14395	-0.232000	0.12228	GTC		IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315820.1	NM_014339	
EIF4ENIF1	56478	broad.mit.edu	37	22	31859896	31859896	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr22:31859896C>T	ENST00000397525.1	-	5	579	c.356G>A	c.(355-357)cGg>cAg	p.R119Q	RP11-247I13.8_ENST00000439588.1_RNA|EIF4ENIF1_ENST00000330125.5_Missense_Mutation_p.R119Q|EIF4ENIF1_ENST00000344710.5_Intron|EIF4ENIF1_ENST00000397523.1_Missense_Mutation_p.R119Q|RP11-247I13.11_ENST00000483736.1_RNA|RP11-247I13.11_ENST00000464523.1_RNA	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	119						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)	p.R119Q(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TCCAAAGCTCCGTCTCTGAGG	0.522																																					p.R119Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G356A	22						.						76.0	75.0	75.0					22																	31859896		2203	4300	6503	30189896	SO:0001583	missense	56478	exon5			AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.356G>A	22.37:g.31859896C>T	ENSP00000380659:p.Arg119Gln	Somatic		Capture	Illumina HiSeq	Phase_I	30189896	NM_019843	B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Missense_Mutation	SNP	ENST00000397525.1	37	CCDS13898.1	.	.	.	.	.	.	.	.	.	.	C	35	5.500705	0.96371	.	.	ENSG00000184708	ENST00000397525;ENST00000330125;ENST00000397523;ENST00000420671;ENST00000423097	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.78304	0.4262	M	0.62088	1.915	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79220	-0.1893	9	0.87932	D	0	-8.7952	18.8921	0.92408	0.0:1.0:0.0:0.0	.	119	Q9NRA8	4ET_HUMAN	Q	119	.	ENSP00000328103:R119Q	R	-	2	0	EIF4ENIF1	30189896	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.174000	0.77620	2.792000	0.96026	0.557000	0.71058	CGG		EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127926.1	NM_019843	
PARVB	29780	broad.mit.edu	37	22	44528887	44528887	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr22:44528887C>T	ENST00000338758.7	+	6	694	c.631C>T	c.(631-633)Cgg>Tgg	p.R211W	PARVB_ENST00000404989.1_Missense_Mutation_p.R174W|PARVB_ENST00000406477.3_Missense_Mutation_p.R244W	NM_013327.4	NP_037459.2	Q9HBI1	PARVB_HUMAN	parvin, beta	211					actin cytoskeleton reorganization (GO:0031532)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell projection assembly (GO:0030031)|establishment or maintenance of cell polarity regulating cell shape (GO:0071963)|lamellipodium assembly (GO:0030032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)		p.R244W(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Ovarian(80;0.0246)|all_neural(38;0.0423)				GGTGGTCGTGCGGGTGAGTAT	0.612																																					p.R244W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C730T	22						.						74.0	62.0	66.0					22																	44528887		2203	4300	6503	42860220	SO:0001583	missense	29780	exon7			AF151814	CCDS14056.1, CCDS46724.1, CCDS58808.1, CCDS74874.1	22q13.2-q13.33	2013-01-24			ENSG00000188677	ENSG00000188677		"""Parvins"""	14653	protein-coding gene	gene with protein product	"""affixin"""	608121				10810093, 11171322	Standard	NM_001003828		Approved	CGI-56	uc003ben.3	Q9HBI1	OTTHUMG00000150665	ENST00000338758.7:c.631C>T	22.37:g.44528887C>T	ENSP00000342492:p.Arg211Trp	Somatic		Capture	Illumina HiSeq	Phase_I	42860220	NM_001003828	B0QYM8|B0QYN1|B2R9X6|Q5TGJ5|Q86X93|Q96PN1|Q9NSP7|Q9UGT3|Q9Y368|Q9Y3L6|Q9Y3L7	Missense_Mutation	SNP	ENST00000338758.7	37	CCDS14056.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.290878	0.80914	.	.	ENSG00000188677	ENST00000406477;ENST00000338758;ENST00000404989	T;T;T	0.33654	1.4;1.44;1.44	5.38	3.01	0.34805	Calponin homology domain (1);	0.056250	0.64402	D	0.000001	T	0.50240	0.1604	L	0.47716	1.5	0.80722	D	1	D;D;D;D	0.76494	0.998;0.995;0.995;0.999	P;P;P;D	0.69307	0.702;0.462;0.776;0.963	T	0.55010	-0.8207	10	0.87932	D	0	-16.9368	13.5671	0.61824	0.373:0.627:0.0:0.0	.	211;174;211;244	A6NG58;B0QYM8;Q9HBI1;Q9HBI1-2	.;.;PARVB_HUMAN;.	W	244;211;174	ENSP00000384515:R244W;ENSP00000342492:R211W;ENSP00000384353:R174W	ENSP00000342492:R211W	R	+	1	2	PARVB	42860220	0.474000	0.25886	0.998000	0.56505	0.992000	0.81027	0.664000	0.25068	1.218000	0.43458	0.655000	0.94253	CGG		PARVB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319518.2	NM_001003828	
CCDC138	165055	broad.mit.edu	37	2	109492648	109492648	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr2:109492648C>T	ENST00000295124.4	+	15	1997	c.1937C>T	c.(1936-1938)tCa>tTa	p.S646L	CCDC138_ENST00000412964.2_3'UTR	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	646								p.S646L(1)		endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						AATCTAAATTCAACTCTGTTC	0.348																																					p.S646L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1937T	2						.						79.0	81.0	80.0					2																	109492648		2203	4299	6502	108859080	SO:0001583	missense	165055	exon15			AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.1937C>T	2.37:g.109492648C>T	ENSP00000295124:p.Ser646Leu	Somatic		Capture	Illumina HiSeq	Phase_I	108859080	NM_144978	Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Missense_Mutation	SNP	ENST00000295124.4	37	CCDS2080.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.903846	0.92035	.	.	ENSG00000163006	ENST00000295124	T	0.55930	0.49	5.84	5.84	0.93424	.	0.000000	0.64402	D	0.000001	T	0.73877	0.3643	M	0.69823	2.125	0.54753	D	0.99998	D	0.89917	1.0	D	0.85130	0.997	T	0.75059	-0.3451	10	0.87932	D	0	-15.0536	19.7637	0.96333	0.0:1.0:0.0:0.0	.	646	Q96M89	CC138_HUMAN	L	646	ENSP00000295124:S646L	ENSP00000295124:S646L	S	+	2	0	CCDC138	108859080	1.000000	0.71417	0.987000	0.45799	0.984000	0.73092	5.693000	0.68264	2.758000	0.94735	0.655000	0.94253	TCA		CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253593.1	NM_144978	
MARCO	8685	broad.mit.edu	37	2	119750740	119750740	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr2:119750740C>A	ENST00000327097.4	+	16	1428	c.1293C>A	c.(1291-1293)aaC>aaA	p.N431K	MARCO_ENST00000541757.1_Missense_Mutation_p.N353K	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	431	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)	p.N431K(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						GCAGTAGTAACCGAGGCCGGG	0.532																																					p.N431K	GBM(8;18 374 7467 11269 32796)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1293A	2						.						132.0	124.0	126.0					2																	119750740		2203	4300	6503	119467210	SO:0001583	missense	8685	exon16			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.1293C>A	2.37:g.119750740C>A	ENSP00000318916:p.Asn431Lys	Somatic		Capture	Illumina HiSeq	Phase_I	119467210	NM_006770	B4DW79|Q9Y5S3	Missense_Mutation	SNP	ENST00000327097.4	37	CCDS2124.1	.	.	.	.	.	.	.	.	.	.	C	11.72	1.722967	0.30503	.	.	ENSG00000019169	ENST00000327097;ENST00000541757	T;T	0.35048	1.33;1.33	6.07	-4.64	0.03349	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	2.803580	0.00982	N	0.003397	T	0.56949	0.2020	M	0.73753	2.245	0.09310	N	1	P	0.39424	0.673	P	0.58970	0.849	T	0.60821	-0.7187	9	.	.	.	.	9.6516	0.39902	0.0:0.5787:0.1166:0.3047	.	431	Q9UEW3	MARCO_HUMAN	K	431;353	ENSP00000318916:N431K;ENSP00000441769:N353K	.	N	+	3	2	MARCO	119467210	0.000000	0.05858	0.015000	0.15790	0.103000	0.19146	-1.158000	0.03153	-0.341000	0.08376	-0.302000	0.09304	AAC		MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770	
KIF5C	3800	broad.mit.edu	37	2	149853785	149853785	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr2:149853785G>A	ENST00000435030.1	+	18	2399	c.2031G>A	c.(2029-2031)atG>atA	p.M677I	KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000414838.2_Missense_Mutation_p.M582I|KIF5C_ENST00000397413.1_Missense_Mutation_p.M445I			O60282	KIF5C_HUMAN	kinesin family member 5C	677					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.M677I(1)|p.M580I(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		CAGAAAAAATGCACGAAGTCA	0.408																																					p.M653I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1959A	2						.						100.0	97.0	98.0					2																	149853785		1984	4179	6163	149562031	SO:0001583	missense	3800	exon17			AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.2031G>A	2.37:g.149853785G>A	ENSP00000393379:p.Met677Ile	Somatic		Capture	Illumina HiSeq	Phase_I	149562031	NM_004522	O95079|Q2YDC5	Missense_Mutation	SNP	ENST00000435030.1	37		.	.	.	.	.	.	.	.	.	.	G	16.87	3.242699	0.58995	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436;ENST00000397413	D;D;D	0.85484	-1.99;-1.99;-1.99	5.76	5.76	0.90799	.	0.046980	0.85682	D	0.000000	T	0.80297	0.4597	.	.	.	0.49582	D	0.999803	B;B	0.15473	0.002;0.013	B;B	0.17979	0.004;0.02	T	0.73052	-0.4104	8	.	.	.	.	19.9759	0.97304	0.0:0.0:1.0:0.0	.	677;243	O60282;Q3LIE3	KIF5C_HUMAN;.	I	677;582;580;445	ENSP00000393379:M677I;ENSP00000410115:M582I;ENSP00000380560:M445I	.	M	+	3	0	KIF5C	149562031	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.463000	0.80869	2.713000	0.92767	0.655000	0.94253	ATG		KIF5C-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000332562.3	NM_004522	
PTH2R	5746	broad.mit.edu	37	2	209308143	209308143	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr2:209308143A>T	ENST00000272847.2	+	6	793	c.580A>T	c.(580-582)Atc>Ttc	p.I194F	PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	194					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)	p.I194F(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	AGCTACAAGCATCTTTGTCAA	0.403																																					p.I194F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A580T	2						.						128.0	116.0	120.0					2																	209308143		2203	4300	6503	209016388	SO:0001583	missense	5746	exon6			BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.580A>T	2.37:g.209308143A>T	ENSP00000272847:p.Ile194Phe	Somatic		Capture	Illumina HiSeq	Phase_I	209016388	NM_005048	Q8N429	Missense_Mutation	SNP	ENST00000272847.2	37	CCDS2383.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.587727	0.86851	.	.	ENSG00000144407	ENST00000272847	T	0.44881	0.91	5.08	5.08	0.68730	GPCR, family 2-like (1);	0.000000	0.48767	D	0.000176	T	0.63094	0.2482	M	0.76433	2.335	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.995	T	0.66646	-0.5871	10	0.59425	D	0.04	.	12.7812	0.57479	1.0:0.0:0.0:0.0	.	83;194	B4DFN8;P49190	.;PTH2R_HUMAN	F	194	ENSP00000272847:I194F	ENSP00000272847:I194F	I	+	1	0	PTH2R	209016388	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.510000	0.90532	1.914000	0.55421	0.477000	0.44152	ATC		PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048	
CRIM1	51232	broad.mit.edu	37	2	36706715	36706715	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr2:36706715G>A	ENST00000280527.2	+	7	1617	c.1250G>A	c.(1249-1251)cGg>cAg	p.R417Q		NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	417	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.R417Q(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				GACCGGTGGCGGGAAGACGAC	0.552																																					p.R417Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1250A	2						.						116.0	108.0	110.0					2																	36706715		2203	4300	6503	36560219	SO:0001583	missense	51232	exon7			AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.1250G>A	2.37:g.36706715G>A	ENSP00000280527:p.Arg417Gln	Somatic		Capture	Illumina HiSeq	Phase_I	36560219	NM_016441	Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Missense_Mutation	SNP	ENST00000280527.2	37	CCDS1783.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.175883	0.78564	.	.	ENSG00000150938	ENST00000280527	T	0.71103	-0.54	5.34	5.34	0.76211	von Willebrand factor, type C (3);	0.053175	0.64402	D	0.000002	T	0.68238	0.2979	N	0.11255	0.115	0.50632	D	0.999882	D	0.76494	0.999	D	0.67725	0.953	T	0.63319	-0.6664	10	0.09843	T	0.71	-12.312	18.4034	0.90525	0.0:0.0:1.0:0.0	.	417	Q9NZV1	CRIM1_HUMAN	Q	417	ENSP00000280527:R417Q	ENSP00000280527:R417Q	R	+	2	0	CRIM1	36560219	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.732000	0.84908	2.664000	0.90586	0.650000	0.86243	CGG		CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	NM_016441	
ATP6V1B1	525	broad.mit.edu	37	2	71190373	71190373	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr2:71190373C>T	ENST00000234396.4	+	10	1064	c.991C>T	c.(991-993)Cgg>Tgg	p.R331W	ATP6V1B1_ENST00000412314.1_Missense_Mutation_p.R331W|RN7SL160P_ENST00000468558.2_RNA|AC007040.11_ENST00000606025.1_Intron	NM_001692.3	NP_001683.2	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1	331					ATP hydrolysis coupled proton transport (GO:0015991)|ATP metabolic process (GO:0046034)|calcium ion homeostasis (GO:0055074)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|pH reduction (GO:0045851)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)	p.R331W(1)		endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(1)	19						CATCTACGAGCGGGCGGGCCG	0.617																																					p.R331W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C991T	2						.						72.0	70.0	70.0					2																	71190373		2203	4300	6503	71043881	SO:0001583	missense	525	exon10			AF107466	CCDS1912.1	2p13	2010-04-21	2008-07-31	2002-05-10	ENSG00000116039	ENSG00000116039	3.6.3.14	"""ATPases / V-type"""	853	protein-coding gene	gene with protein product	"""Renal tubular acidosis with deafness"""	192132	"""vacuolar proton pump 3"""	VPP3, ATP6B1		9916796, 2527371	Standard	XM_005264368		Approved	VATB, RTA1B, Vma2	uc002shj.3	P15313	OTTHUMG00000129711	ENST00000234396.4:c.991C>T	2.37:g.71190373C>T	ENSP00000234396:p.Arg331Trp	Somatic		Capture	Illumina HiSeq	Phase_I	71043881	NM_001692	Q53FY0|Q6P4H6	Missense_Mutation	SNP	ENST00000234396.4	37	CCDS1912.1	.	.	.	.	.	.	.	.	.	.	C	19.32	3.804237	0.70682	.	.	ENSG00000116039	ENST00000234396;ENST00000483246;ENST00000412314	D;D	0.87491	-2.26;-2.26	4.9	2.01	0.26516	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.078331	0.49305	N	0.000158	D	0.94902	0.8352	H	0.98256	4.185	0.58432	D	0.999992	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92471	0.5985	10	0.87932	D	0	-7.9259	7.003	0.24820	0.2742:0.6398:0.0:0.086	.	306;331;331	B4DWH7;C9JL73;P15313	.;.;VATB1_HUMAN	W	331;306;331	ENSP00000234396:R331W;ENSP00000388353:R331W	ENSP00000234396:R331W	R	+	1	2	ATP6V1B1	71043881	1.000000	0.71417	0.996000	0.52242	0.950000	0.60333	1.438000	0.35002	0.236000	0.21180	0.650000	0.86243	CGG		ATP6V1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251920.2	NM_001692	
DCTN1	1639	broad.mit.edu	37	2	74593971	74593971	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr2:74593971C>T	ENST00000361874.3	-	21	2722	c.2405G>A	c.(2404-2406)cGa>cAa	p.R802Q	DCTN1_ENST00000409240.1_Missense_Mutation_p.R765Q|DCTN1_ENST00000409438.1_Missense_Mutation_p.R668Q|DCTN1_ENST00000394003.3_Missense_Mutation_p.R795Q|DCTN1_ENST00000409567.3_Missense_Mutation_p.R782Q|DCTN1_ENST00000495643.1_5'UTR|DCTN1_ENST00000407639.2_Missense_Mutation_p.R668Q|DCTN1_ENST00000409868.1_Missense_Mutation_p.R785Q	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	802					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)	p.R802Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						CATTCGCCTTCGGATCTTCTT	0.552																																					p.R668Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2003A	2						.						79.0	76.0	77.0					2																	74593971		2203	4300	6503	74447479	SO:0001583	missense	1639	exon16				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.2405G>A	2.37:g.74593971C>T	ENSP00000354791:p.Arg802Gln	Somatic		Capture	Illumina HiSeq	Phase_I	74447479	NM_023019	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	ENST00000361874.3	37	CCDS1939.1	.	.	.	.	.	.	.	.	.	.	C	31	5.097741	0.94197	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	D;D;D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57;-1.57;-1.57	5.32	5.32	0.75619	.	0.000000	0.35495	N	0.003167	D	0.89918	0.6854	L	0.61036	1.89	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.998;0.989;0.996;0.998	D;D;D;P;P;D	0.76575	0.979;0.973;0.988;0.769;0.794;0.979	D	0.90082	0.4171	10	0.62326	D	0.03	-3.1884	17.9185	0.88959	0.0:1.0:0.0:0.0	.	782;765;802;795;668;668	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4	.;.;DCTN1_HUMAN;.;.;.	Q	802;795;785;668;668;765;785;782	ENSP00000354791:R802Q;ENSP00000377571:R795Q;ENSP00000384844:R668Q;ENSP00000387270:R668Q;ENSP00000386406:R765Q;ENSP00000387327:R785Q;ENSP00000386843:R782Q	ENSP00000354791:R802Q	R	-	2	0	DCTN1	74447479	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.117000	0.77129	2.769000	0.95229	0.563000	0.77884	CGA		DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082	
CTNNA2	1496	broad.mit.edu	37	2	80136861	80136861	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr2:80136861G>A	ENST00000402739.4	+	6	999	c.994G>A	c.(994-996)Gtg>Atg	p.V332M	CTNNA2_ENST00000541047.1_Missense_Mutation_p.V332M|CTNNA2_ENST00000466387.1_Missense_Mutation_p.V332M|CTNNA2_ENST00000361291.4_Missense_Mutation_p.V366M|CTNNA2_ENST00000496558.1_Missense_Mutation_p.V332M|CTNNA2_ENST00000540488.1_Missense_Mutation_p.V332M	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	332					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.V332M(2)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						CGAGAGGATCGTGGCGGAGTG	0.622																																					p.V333M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G997A	2						.						48.0	54.0	52.0					2																	80136861		2084	4226	6310	79990372	SO:0001583	missense	1496	exon7				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.994G>A	2.37:g.80136861G>A	ENSP00000384638:p.Val332Met	Somatic		Capture	Illumina HiSeq	Phase_I	79990372	NM_004389	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	G	32	5.127655	0.94473	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000002	T	0.71195	0.3311	M	0.86805	2.84	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.989;0.989	T	0.74711	-0.3573	10	0.56958	D	0.05	.	19.6081	0.95588	0.0:0.0:1.0:0.0	.	332;332;332	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	M	332;332;366;332;332;332	ENSP00000418191:V332M;ENSP00000419295:V332M;ENSP00000355398:V366M;ENSP00000384638:V332M;ENSP00000444675:V332M;ENSP00000441705:V332M	ENSP00000355398:V366M	V	+	1	0	CTNNA2	79990372	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.803000	0.99136	2.652000	0.90054	0.591000	0.81541	GTG		CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
IGFBP2	3485	broad.mit.edu	37	2	217528720	217528720	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr2:217528720G>A	ENST00000233809.4	+	4	1000	c.871G>A	c.(871-873)Ggg>Agg	p.G291R	IGFBP2_ENST00000456764.1_Missense_Mutation_p.G147R	NM_000597.2	NP_000588	P18065	IBP2_HUMAN	insulin-like growth factor binding protein 2, 36kDa	291	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of activated T cell proliferation (GO:0042104)|regulation of cell growth (GO:0001558)|regulation of insulin-like growth factor receptor signaling pathway (GO:0043567)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)	p.G291R(1)		endometrium(2)|large_intestine(1)|lung(2)	5		Renal(323;0.0458)		Epithelial(149;2.9e-06)|all cancers(144;0.000223)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00968)		CCCCAACACCGGGAAGCTGAT	0.637																																					p.G291R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G871A	2						.						32.0	39.0	37.0					2																	217528720		1987	4162	6149	217236965	SO:0001583	missense	3485	exon4				CCDS42815.1	2q35	2014-09-16	2002-08-29		ENSG00000115457	ENSG00000115457			5471	protein-coding gene	gene with protein product		146731	"""insulin-like growth factor binding protein 2 (36kD)"""	IBP2		1697583	Standard	NM_000597		Approved		uc021vwn.1	P18065	OTTHUMG00000155341	ENST00000233809.4:c.871G>A	2.37:g.217528720G>A	ENSP00000233809:p.Gly291Arg	Somatic		Capture	Illumina HiSeq	Phase_I	217236965	NM_000597	Q14619|Q9UCL3	Missense_Mutation	SNP	ENST00000233809.4	37	CCDS42815.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793522	0.90453	.	.	ENSG00000115457	ENST00000233809;ENST00000456764	D;D	0.93547	-3.24;-3.24	4.57	4.57	0.56435	Thyroglobulin type-1 (6);	0.000000	0.85682	D	0.000000	D	0.97977	0.9334	H	0.97564	4.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99312	1.0904	10	0.87932	D	0	-18.4473	16.8816	0.86064	0.0:0.0:1.0:0.0	.	291	P18065	IBP2_HUMAN	R	291;147	ENSP00000233809:G291R;ENSP00000389646:G147R	ENSP00000233809:G291R	G	+	1	0	IGFBP2	217236965	1.000000	0.71417	0.976000	0.42696	0.980000	0.70556	9.162000	0.94745	2.516000	0.84829	0.561000	0.74099	GGG		IGFBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339540.1	NM_000597	
WNT7A	7476	broad.mit.edu	37	3	13916501	13916501	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr3:13916501G>A	ENST00000285018.4	-	2	545	c.241C>T	c.(241-243)Cgc>Tgc	p.R81C	WNT7A_ENST00000497808.1_5'UTR	NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	81					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)	p.R81C(1)|p.R81S(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						CAGTTCCAGCGGCCATTGCGG	0.602																																					p.R81C												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C241T	3						.						58.0	50.0	53.0					3																	13916501		2203	4300	6503	13891502	SO:0001583	missense	7476	exon2			D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.241C>T	3.37:g.13916501G>A	ENSP00000285018:p.Arg81Cys	Somatic		Capture	Illumina HiSeq	Phase_I	13891502	NM_004625	Q96H90|Q9Y560	Missense_Mutation	SNP	ENST00000285018.4	37	CCDS2616.1	.	.	.	.	.	.	.	.	.	.	g	27.1	4.804149	0.90623	.	.	ENSG00000154764	ENST00000285018	T	0.81163	-1.46	5.31	5.31	0.75309	.	0.059225	0.64402	D	0.000003	D	0.93825	0.8025	H	0.97758	4.07	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95884	0.8901	10	0.87932	D	0	.	18.9939	0.92804	0.0:0.0:1.0:0.0	.	81	O00755	WNT7A_HUMAN	C	81	ENSP00000285018:R81C	ENSP00000285018:R81C	R	-	1	0	WNT7A	13891502	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.550000	0.73905	2.481000	0.83766	0.651000	0.88453	CGC		WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252031.2	NM_004625	
CBLB	868	broad.mit.edu	37	3	105412432	105412432	+	Splice_Site	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr3:105412432C>T	ENST00000264122.4	-	13	2281	c.1960G>A	c.(1960-1962)Gtc>Atc	p.V654I	CBLB_ENST00000394027.3_Splice_Site_p.V676I|CBLB_ENST00000403724.1_Splice_Site_p.V654I|CBLB_ENST00000405772.1_Splice_Site_p.V654I	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	654	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V654I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						TTGGAAAAGACCTGAAAGTAA	0.418			Mis S		AML																																p.V654I	GBM(93;588 1337 9788 29341 43499)		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1960A	3						.						88.0	85.0	86.0					3																	105412432		2202	4300	6502	106895122	SO:0001630	splice_region_variant	868	exon13			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.1960-1G>A	3.37:g.105412432C>T		Somatic		Capture	Illumina HiSeq	Phase_I	106895122	NM_170662	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	ENST00000264122.4	37	CCDS2948.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.645054	0.47258	.	.	ENSG00000114423	ENST00000394030;ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	T;D;D;D;D	0.83837	-1.15;-1.74;-1.74;-1.77;-1.77	5.63	5.63	0.86233	.	0.254005	0.39834	N	0.001249	T	0.81791	0.4897	M	0.61703	1.905	0.80722	D	1	B;B;B	0.22683	0.035;0.073;0.049	B;B;B	0.18871	0.016;0.022;0.023	T	0.79403	-0.1818	10	0.87932	D	0	-16.9818	15.9798	0.80097	0.0:0.8653:0.1347:0.0	.	676;654;654	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	I	37;654;676;654;654	ENSP00000377598:V37I;ENSP00000264122:V654I;ENSP00000377595:V676I;ENSP00000384816:V654I;ENSP00000384938:V654I	ENSP00000264122:V654I	V	-	1	0	CBLB	106895122	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.663000	0.37429	2.665000	0.90641	0.591000	0.81541	GTC		CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662	Missense_Mutation
ATR	545	broad.mit.edu	37	3	142277508	142277508	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr3:142277508C>T	ENST00000350721.4	-	8	1964	c.1843G>A	c.(1843-1845)Gct>Act	p.A615T	ATR_ENST00000383101.3_Missense_Mutation_p.A551T	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	615					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A615T(1)		NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						AGAAGATTAGCGGCAAATGTG	0.348								Other conserved DNA damage response genes																													p.A615T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1843A	3						.						249.0	256.0	253.0					3																	142277508		2203	4300	6503	143760198	SO:0001583	missense	545	exon8			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.1843G>A	3.37:g.142277508C>T	ENSP00000343741:p.Ala615Thr	Somatic		Capture	Illumina HiSeq	Phase_I	143760198	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	T	1.564	-0.535919	0.04082	.	.	ENSG00000175054	ENST00000350721;ENST00000383101;ENST00000515149	T;T	0.66460	-0.21;-0.21	5.77	1.96	0.26148	Armadillo-like helical (1);Armadillo-type fold (1);	0.465632	0.24375	N	0.039071	T	0.29126	0.0724	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22906	-1.0203	10	0.02654	T	1	-1.4466	0.4549	0.00507	0.2779:0.1376:0.2221:0.3624	.	615	Q13535	ATR_HUMAN	T	615;551;232	ENSP00000343741:A615T;ENSP00000372581:A551T	ENSP00000343741:A615T	A	-	1	0	ATR	143760198	0.546000	0.26457	0.039000	0.18376	0.934000	0.57294	0.416000	0.21198	-0.064000	0.13043	-0.254000	0.11334	GCT		ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
CNTN4	152330	broad.mit.edu	37	3	3078980	3078980	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr3:3078980G>A	ENST00000397461.1	+	17	2444	c.2060G>A	c.(2059-2061)cGc>cAc	p.R687H	CNTN4_ENST00000427331.1_Missense_Mutation_p.R687H|CNTN4_ENST00000448906.2_Missense_Mutation_p.R359H|CNTN4-AS1_ENST00000442749.2_RNA|CNTN4_ENST00000358480.3_Missense_Mutation_p.R468H|CNTN4_ENST00000418658.1_Missense_Mutation_p.R687H|CNTN4_ENST00000397459.2_Missense_Mutation_p.R359H	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	687	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.R359H(1)|p.R687H(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		GAGCCCAGCCGCCCCTCAGAG	0.522																																					p.R359H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1076A	3						.						155.0	168.0	163.0					3																	3078980		2203	4300	6503	3053980	SO:0001583	missense	152330	exon9			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.2060G>A	3.37:g.3078980G>A	ENSP00000380602:p.Arg687His	Somatic		Capture	Illumina HiSeq	Phase_I	3053980	NM_175613	B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	ENST00000397461.1	37	CCDS43041.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.591651	0.46214	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906	T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61	5.48	0.315	0.15852	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.185910	0.45867	D	0.000330	T	0.34890	0.0913	L	0.31371	0.925	0.25784	N	0.984695	P;P;P	0.46952	0.784;0.887;0.815	P;B;B	0.46543	0.52;0.321;0.321	T	0.19679	-1.0298	10	0.45353	T	0.12	.	6.1053	0.20069	0.2696:0.3432:0.3872:0.0	.	686;687;687	Q8IWV2-3;B3KTK4;Q8IWV2	.;.;CNTN4_HUMAN	H	687;687;687;468;359;359	ENSP00000396010:R687H;ENSP00000380602:R687H;ENSP00000413642:R687H;ENSP00000351267:R468H;ENSP00000380600:R359H;ENSP00000392077:R359H	ENSP00000351267:R468H	R	+	2	0	CNTN4	3053980	0.957000	0.32711	0.981000	0.43875	0.565000	0.35776	1.783000	0.38664	0.027000	0.15297	0.655000	0.94253	CGC		CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2		
ITPR1	3708	broad.mit.edu	37	3	4703815	4703815	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr3:4703815C>T	ENST00000443694.2	+	12	1256	c.1256C>T	c.(1255-1257)cCg>cTg	p.P419L	ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000456211.2_Missense_Mutation_p.P419L|ITPR1_ENST00000302640.8_Missense_Mutation_p.P419L|ITPR1_ENST00000423119.2_Missense_Mutation_p.P434L|ITPR1_ENST00000354582.6_Missense_Mutation_p.P434L|ITPR1_ENST00000357086.4_Missense_Mutation_p.P434L			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	434	MIR 5. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.P419L(1)		NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GCCATAGTTCCGGTTTCTCCT	0.507																																					p.P434L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1301T	3						.						124.0	120.0	121.0					3																	4703815		1948	4146	6094	4678815	SO:0001583	missense	3708	exon15			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.1256C>T	3.37:g.4703815C>T	ENSP00000401671:p.Pro419Leu	Somatic		Capture	Illumina HiSeq	Phase_I	4678815	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.061752	0.76187	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.91894	-2.93;-2.93;-2.93;-2.93;-2.93;-2.93	5.23	5.23	0.72850	MIR motif (1);MIR (1);	0.000000	0.85682	D	0.000000	D	0.95059	0.8400	M	0.67700	2.07	0.80722	D	1	D;D;P	0.76494	0.966;0.999;0.842	P;D;B	0.64042	0.493;0.921;0.216	D	0.94131	0.7388	10	0.37606	T	0.19	.	18.8419	0.92188	0.0:1.0:0.0:0.0	.	419;434;434	E7EPX7;Q14643;G5E9P1	.;ITPR1_HUMAN;.	L	434;419;434;434;434;419;419	ENSP00000306253:P419L;ENSP00000346595:P434L;ENSP00000405934:P434L;ENSP00000349597:P434L;ENSP00000397885:P419L;ENSP00000401671:P419L	ENSP00000306253:P419L	P	+	2	0	ITPR1	4678815	1.000000	0.71417	0.432000	0.26747	0.266000	0.26442	7.755000	0.85180	2.451000	0.82905	0.650000	0.86243	CCG		ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
SUSD5	26032	broad.mit.edu	37	3	33194395	33194395	+	Missense_Mutation	SNP	C	C	T	rs369886584		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr3:33194395C>T	ENST00000309558.3	-	5	2146	c.1729G>A	c.(1729-1731)Gcc>Acc	p.A577T		NM_015551.1	NP_056366.1	O60279	SUSD5_HUMAN	sushi domain containing 5	577					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	hyaluronic acid binding (GO:0005540)	p.A577T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						ACAATGGTGGCGATCACAGGG	0.622																																					p.A577T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1729A	3						.	C	THR/ALA	0,4406		0,0,2203	58.0	62.0	61.0		1729	4.9	0.8	3		61	1,8593	1.2+/-3.3	0,1,4296	no	missense	SUSD5	NM_015551.1	58	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	577/630	33194395	1,12999	2203	4297	6500	33169399	SO:0001583	missense	26032	exon5			AB011099	CCDS46787.1	3p23	2014-02-12	2006-01-13		ENSG00000173705	ENSG00000173705			29061	protein-coding gene	gene with protein product							Standard	NM_015551		Approved	KIAA0527	uc003cfo.1	O60279	OTTHUMG00000155829	ENST00000309558.3:c.1729G>A	3.37:g.33194395C>T	ENSP00000308727:p.Ala577Thr	Somatic		Capture	Illumina HiSeq	Phase_I	33169399	NM_015551		Missense_Mutation	SNP	ENST00000309558.3	37	CCDS46787.1	.	.	.	.	.	.	.	.	.	.	C	16.70	3.195073	0.58017	0.0	1.16E-4	ENSG00000173705	ENST00000309558	T	0.22539	1.95	5.74	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.22820	0.0551	M	0.69823	2.125	0.52099	D	0.999944	D	0.56287	0.975	B	0.36845	0.234	T	0.12426	-1.0548	10	0.87932	D	0	-19.8076	13.0214	0.58789	0.0:0.9254:0.0:0.0746	.	577	O60279	SUSD5_HUMAN	T	577	ENSP00000308727:A577T	ENSP00000308727:A577T	A	-	1	0	SUSD5	33169399	1.000000	0.71417	0.754000	0.31244	0.067000	0.16453	5.650000	0.67944	1.425000	0.47237	0.650000	0.86243	GCC		SUSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341902.1	XM_171054	
SMARCC1	6599	broad.mit.edu	37	3	47651739	47651739	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr3:47651739C>T	ENST00000254480.5	-	26	2979	c.2860G>A	c.(2860-2862)Gca>Aca	p.A954T	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	954					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)	p.A954T(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		TGCTGTCGTGCTCGTAATTCA	0.537																																					p.A954T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2860A	3						.						302.0	266.0	278.0					3																	47651739		2203	4300	6503	47626743	SO:0001583	missense	6599	exon26			U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.2860G>A	3.37:g.47651739C>T	ENSP00000254480:p.Ala954Thr	Somatic		Capture	Illumina HiSeq	Phase_I	47626743	NM_003074	Q17RS0|Q6P172|Q8IWH2	Missense_Mutation	SNP	ENST00000254480.5	37	CCDS2758.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.464785	0.63513	.	.	ENSG00000173473	ENST00000254480	T	0.43294	0.95	6.06	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.64327	0.2588	M	0.75447	2.3	0.80722	D	1	D	0.61697	0.99	D	0.65573	0.936	T	0.69383	-0.5160	10	0.72032	D	0.01	-4.6322	16.5153	0.84299	0.0:0.8692:0.1307:0.0	.	954	Q92922	SMRC1_HUMAN	T	954	ENSP00000254480:A954T	ENSP00000254480:A954T	A	-	1	0	SMARCC1	47626743	1.000000	0.71417	0.918000	0.36340	0.005000	0.04900	7.783000	0.85696	1.547000	0.49401	-0.176000	0.13171	GCA		SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257491.1		
MCCC1	56922	broad.mit.edu	37	3	182756876	182756876	+	Missense_Mutation	SNP	C	C	T	rs398124352		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr3:182756876C>T	ENST00000265594.4	-	12	1461	c.1315G>A	c.(1315-1317)Gtg>Atg	p.V439M	MCCC1_ENST00000489909.1_5'Flank|MCCC1_ENST00000492597.1_Missense_Mutation_p.V330M|MCCC1_ENST00000539926.1_Missense_Mutation_p.V304M	NM_020166.3	NP_064551.3	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-CoA carboxylase 1 (alpha)	439	Biotin carboxylation.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)	p.V439M(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(17)|ovary(1)|pancreas(2)|prostate(1)|skin(2)	40	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	GCTGCCCACACGACCAGCTTC	0.483																																					p.V439M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1315A	3						.						132.0	111.0	118.0					3																	182756876		2203	4300	6503	184239570	SO:0001583	missense	56922	exon12			AF310972	CCDS3241.1	3q27.1	2010-04-30	2010-04-30		ENSG00000078070	ENSG00000078070	6.4.1.4		6936	protein-coding gene	gene with protein product		609010	"""methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)"""			11170888	Standard	XR_241502		Approved	MCCA	uc003fle.3	Q96RQ3	OTTHUMG00000158355	ENST00000265594.4:c.1315G>A	3.37:g.182756876C>T	ENSP00000265594:p.Val439Met	Somatic		Capture	Illumina HiSeq	Phase_I	184239570	NM_020166	Q59ES4|Q9H959|Q9NS97	Missense_Mutation	SNP	ENST00000265594.4	37	CCDS3241.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.024696	0.93518	.	.	ENSG00000078070	ENST00000265594;ENST00000492597;ENST00000392616;ENST00000539926;ENST00000476176;ENST00000448585	D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81	6.02	6.02	0.97574	Rudiment single hybrid motif (1);ATP-grasp fold, subdomain 2 (1);Biotin carboxylation domain (1);Biotin carboxylase, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.96034	0.8708	H	0.98351	4.21	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.79108	0.958;0.975;0.992	D	0.96933	0.9682	10	0.87932	D	0	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	392;330;439	E9PG35;E9PHF7;Q96RQ3	.;.;MCCA_HUMAN	M	439;330;289;304;392;392	ENSP00000265594:V439M;ENSP00000419898:V330M;ENSP00000441253:V304M;ENSP00000420433:V392M	ENSP00000265594:V439M	V	-	1	0	MCCC1	184239570	1.000000	0.71417	0.222000	0.23844	0.928000	0.56348	5.763000	0.68818	2.857000	0.98124	0.650000	0.86243	GTG		MCCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350775.1	NM_020166	
CXXC4	80319	broad.mit.edu	37	4	105412095	105412095	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr4:105412095A>C	ENST00000426831.1	-	1	372	c.358T>G	c.(358-360)Tcg>Gcg	p.S120A	AC004053.1_ENST00000500179.1_RNA|AC093628.1_ENST00000606234.1_RNA|CXXC4_ENST00000466963.1_Intron|CXXC4_ENST00000394767.2_Missense_Mutation_p.S289A			Q9H2H0	CXXC4_HUMAN	CXXC finger protein 4	120	Poly-Ser.				negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)|zygotic specification of dorsal/ventral axis (GO:0007352)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)	DNA binding (GO:0003677)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)	p.S120A(1)		kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11				OV - Ovarian serous cystadenocarcinoma(123;3.05e-08)		GAGGAGGACGAGGAGGAGGAG	0.602																																					p.S120A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T358G	4						.						73.0	79.0	77.0					4																	105412095		2203	4300	6503	105631544	SO:0001583	missense	80319	exon1				CCDS3665.1, CCDS3665.2	4q22-q24	2014-02-18	2011-12-01		ENSG00000168772	ENSG00000168772			24593	protein-coding gene	gene with protein product	"""Dvl-binding protein IDAX (inhibition of the Dvl and Axin complex)"""	611645				11113207	Standard	NM_025212		Approved	IDAX	uc003hxf.2	Q9H2H0	OTTHUMG00000131121	ENST00000426831.1:c.358T>G	4.37:g.105412095A>C	ENSP00000412267:p.Ser120Ala	Somatic		Capture	Illumina HiSeq	Phase_I	105631544	NM_025212		Missense_Mutation	SNP	ENST00000426831.1	37		.	.	.	.	.	.	.	.	.	.	A	13.98	2.398796	0.42512	.	.	ENSG00000168772	ENST00000394767;ENST00000426831	.	.	.	4.7	4.7	0.59300	.	86.564400	0.06669	U	0.765789	T	0.21921	0.0528	N	0.08118	0	0.30743	N	0.746003	B	0.06786	0.001	B	0.10450	0.005	T	0.19778	-1.0295	9	0.02654	T	1	-5.4014	8.506	0.33188	0.9077:0.0:0.0923:0.0	.	120	Q9H2H0	CXXC4_HUMAN	A	120	.	ENSP00000378248:S120A	S	-	1	0	CXXC4	105631544	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.443000	0.44881	1.876000	0.54355	0.477000	0.44152	TCG		CXXC4-201	KNOWN	basic	protein_coding	protein_coding		NM_025212	
ENPEP	2028	broad.mit.edu	37	4	111474532	111474532	+	Nonsense_Mutation	SNP	C	C	T	rs201624755		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr4:111474532C>T	ENST00000265162.5	+	18	2905	c.2563C>T	c.(2563-2565)Cga>Tga	p.R855*		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	855					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R855*(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		TACAGTCATTCGATATATCTC	0.388																																					p.R855X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2563T	4						.	C	stop/ARG	0,4406		0,0,2203	202.0	197.0	199.0		2563	5.4	1.0	4		199	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	ENPEP	NM_001977.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		855/958	111474532	1,13005	2203	4300	6503	111693981	SO:0001587	stop_gained	2028	exon18			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.2563C>T	4.37:g.111474532C>T	ENSP00000265162:p.Arg855*	Somatic		Capture	Illumina HiSeq	Phase_I	111693981	NM_001977	Q504U2	Nonsense_Mutation	SNP	ENST00000265162.5	37	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	C	43	10.236666	0.99366	0.0	1.16E-4	ENSG00000138792	ENST00000265162	.	.	.	5.4	5.4	0.78164	.	0.262599	0.39909	N	0.001237	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	8.5648	0.33534	0.1634:0.7578:0.0:0.0789	.	.	.	.	X	855	.	ENSP00000265162:R855X	R	+	1	2	ENPEP	111693981	0.919000	0.31177	0.980000	0.43619	0.988000	0.76386	1.807000	0.38902	2.524000	0.85096	0.650000	0.86243	CGA		ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
UGDH	7358	broad.mit.edu	37	4	39512349	39512349	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr4:39512349G>A	ENST00000316423.6	-	4	739	c.397C>T	c.(397-399)Cca>Tca	p.P133S	UGDH_ENST00000507089.1_Missense_Mutation_p.P36S|UGDH_ENST00000501493.2_Intron|UGDH_ENST00000515398.1_5'Flank|UGDH_ENST00000506179.1_Missense_Mutation_p.P133S	NM_001184701.1|NM_003359.3	NP_001171630.1|NP_003350.1	O60701	UGDH_HUMAN	UDP-glucose 6-dehydrogenase	133					cellular glucuronidation (GO:0052695)|gastrulation with mouth forming second (GO:0001702)|glycosaminoglycan biosynthetic process (GO:0006024)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|UDP-glucose 6-dehydrogenase activity (GO:0003979)	p.P133S(1)		breast(1)|central_nervous_system(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(2)	27						GCCCGCACTGGAACTGTGCTT	0.408																																					p.P36S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C106T	4						.						180.0	171.0	174.0					4																	39512349		2203	4300	6503	39188744	SO:0001583	missense	7358	exon3			AF061016	CCDS3455.1, CCDS54757.1, CCDS54758.1	4p14	2011-11-16	2010-04-28		ENSG00000109814	ENSG00000109814	1.1.1.22		12525	protein-coding gene	gene with protein product		603370	"""UDP-glucose dehydrogenase"""			9737970, 10575217	Standard	NM_003359		Approved		uc003guk.2	O60701	OTTHUMG00000099371	ENST00000316423.6:c.397C>T	4.37:g.39512349G>A	ENSP00000319501:p.Pro133Ser	Somatic		Capture	Illumina HiSeq	Phase_I	39188744	NM_001184701	B3KUU2|B4DN25|O60589	Missense_Mutation	SNP	ENST00000316423.6	37	CCDS3455.1	.	.	.	.	.	.	.	.	.	.	G	33	5.205393	0.95033	.	.	ENSG00000109814	ENST00000316423;ENST00000506179;ENST00000507089;ENST00000515021;ENST00000514106	T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37	5.95	5.95	0.96441	UDP-glucose/GDP-mannose dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.047722	0.85682	N	0.000000	D	0.93959	0.8066	H	0.97682	4.055	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95370	0.8463	10	0.87932	D	0	-7.9294	19.3906	0.94581	0.0:0.0:1.0:0.0	.	133	O60701	UGDH_HUMAN	S	133;133;36;146;133	ENSP00000319501:P133S;ENSP00000421757:P133S;ENSP00000426560:P36S;ENSP00000421954:P146S;ENSP00000425834:P133S	ENSP00000319501:P133S	P	-	1	0	UGDH	39188744	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	9.137000	0.94496	2.827000	0.97445	0.650000	0.86243	CCA		UGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216818.3	NM_003359	
EPHA5	2044	broad.mit.edu	37	4	66189898	66189898	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr4:66189898C>T	ENST00000273854.3	-	18	3648	c.3048G>A	c.(3046-3048)caG>caA	p.Q1016Q	EPHA5_ENST00000354839.4_Silent_p.Q994Q|EPHA5_ENST00000432638.2_Silent_p.Q853Q	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	1016	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.Q1016Q(2)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TGATCTTCTTCTGGTGACCGA	0.418										TSP Lung(17;0.13)																											p.Q1016Q												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G3048A	4						.						117.0	106.0	109.0					4																	66189898		2203	4300	6503	65872493	SO:0001819	synonymous_variant	2044	exon18			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.3048G>A	4.37:g.66189898C>T		Somatic		Capture	Illumina HiSeq	Phase_I	65872493	NM_004439	Q7Z3F2	Silent	SNP	ENST00000273854.3	37	CCDS3513.1																																																																																				EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
HERC5	51191	broad.mit.edu	37	4	89425437	89425437	+	Silent	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr4:89425437G>A	ENST00000264350.3	+	21	2790	c.2637G>A	c.(2635-2637)gcG>gcA	p.A879A	HERC5_ENST00000508159.1_Silent_p.A517A	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	879	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.A879A(1)		NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		CTGTAAAGGCGGTTTATGAAG	0.328																																					p.A879A	Esophageal Squamous(39;887 1012 34045 50514)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2637A	4						.						78.0	83.0	81.0					4																	89425437		2203	4299	6502	89644460	SO:0001819	synonymous_variant	51191	exon21			AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.2637G>A	4.37:g.89425437G>A		Somatic		Capture	Illumina HiSeq	Phase_I	89644460	NM_016323	B2RTQ1|Q69G20	Silent	SNP	ENST00000264350.3	37	CCDS3630.1																																																																																				HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	NM_016323	
BMPR1B	658	broad.mit.edu	37	4	96025651	96025651	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr4:96025651C>T	ENST00000515059.1	+	4	359	c.76C>T	c.(76-78)Cgt>Tgt	p.R26C	BMPR1B_ENST00000394931.1_Missense_Mutation_p.R26C|BMPR1B_ENST00000440890.2_Missense_Mutation_p.R56C|BMPR1B_ENST00000502683.1_Missense_Mutation_p.R26C|BMPR1B_ENST00000264568.4_Missense_Mutation_p.R26C	NM_001203.2	NP_001194.1	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB	26					BMP signaling pathway (GO:0030509)|cartilage condensation (GO:0001502)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|eye development (GO:0001654)|inflammatory response (GO:0006954)|limb morphogenesis (GO:0035108)|ovarian cumulus expansion (GO:0001550)|ovulation cycle (GO:0042698)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell differentiation (GO:0045597)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|skeletal system development (GO:0001501)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.R26C(2)		breast(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		CCCCACCCCCCGTCCAAAGGT	0.433																																					p.R26C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C76T	4						.						110.0	105.0	107.0					4																	96025651		2203	4300	6503	96244674	SO:0001583	missense	658	exon4			D89675	CCDS3642.1, CCDS58919.1	4q23-q24	2008-02-05			ENSG00000138696	ENSG00000138696		"""CD molecules"""	1077	protein-coding gene	gene with protein product		603248				8140412, 9730621	Standard	NM_001203		Approved	ALK6, CDw293	uc031sgn.1	O00238	OTTHUMG00000130991	ENST00000515059.1:c.76C>T	4.37:g.96025651C>T	ENSP00000426617:p.Arg26Cys	Somatic		Capture	Illumina HiSeq	Phase_I	96244674	NM_001203	B2R953|B4DSV1|P78366	Missense_Mutation	SNP	ENST00000515059.1	37	CCDS3642.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.612927	0.46631	.	.	ENSG00000138696	ENST00000515059;ENST00000506363;ENST00000512312;ENST00000509540;ENST00000440890;ENST00000502683;ENST00000264568;ENST00000394931	D;D;D;D;D;D;D;D	0.93604	-1.6;-3.25;-1.6;-1.6;-1.57;-2.72;-1.6;-1.6	5.68	4.84	0.62591	.	0.205916	0.40728	N	0.001027	D	0.85553	0.5723	N	0.08118	0	0.44302	D	0.99717	B	0.20459	0.045	B	0.10450	0.005	T	0.81575	-0.0870	10	0.52906	T	0.07	.	13.7344	0.62809	0.0:0.9246:0.0:0.0754	.	26	O00238	BMR1B_HUMAN	C	26;26;26;26;56;26;26;26	ENSP00000426617:R26C;ENSP00000421144:R26C;ENSP00000425444:R26C;ENSP00000421671:R26C;ENSP00000401907:R56C;ENSP00000424693:R26C;ENSP00000264568:R26C;ENSP00000378389:R26C	ENSP00000264568:R26C	R	+	1	0	BMPR1B	96244674	0.987000	0.35691	0.996000	0.52242	0.806000	0.45545	2.555000	0.45854	1.399000	0.46721	0.591000	0.81541	CGT		BMPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253609.3	NM_001203	
TUBB7P	56604	broad.mit.edu	37	4	190903996	190903996	+	IGR	SNP	C	C	T	rs4277823		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr4:190903996C>T								FRG1 (19637 upstream) : RNA5SP174 (32296 downstream)																							TGTTGAACATCTGTTCATCCA	0.537																																					p.D329N												.	.	0			c.G985A	4						.						42.0	57.0	52.0					4																	190903996		2099	4255	6354	191140990	SO:0001628	intergenic_variant	56604	exon4																															4.37:g.190903996C>T		Somatic		Capture	Illumina HiSeq	Phase_I	191140990	NM_020040		Silent	SNP		37																																																																																				0								
PIK3R1	5295	broad.mit.edu	37	5	67522774	67522775	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	-	-	-	CA	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr5:67522774_67522775insCA	ENST00000521381.1	+	2	887_888	c.271_272insCA	c.(271-273)ccafs	p.P91fs	PIK3R1_ENST00000274335.5_Frame_Shift_Ins_p.P91fs|PIK3R1_ENST00000521657.1_Frame_Shift_Ins_p.P91fs|PIK3R1_ENST00000396611.1_Frame_Shift_Ins_p.P91fs	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	91					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.P92fs*23(1)|p.0?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	AAAGCCCCGGCCACCTCGGCCT	0.475			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.P91fs			Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	.	2	Whole gene deletion(1)|Insertion - Frameshift(1)	large_intestine(2)	c.271_272insCA	5						.																																			67558531	SO:0001589	frameshift_variant	5295	exon1			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.272_273dupCA	5.37:g.67522775_67522776dupCA	ENSP00000428056:p.Pro91fs	Somatic		Capture	Illumina HiSeq	Phase_I	67558530	NM_181523	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Frame_Shift_Ins	INS	ENST00000521381.1	37	CCDS3993.1																																																																																				PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
LVRN	206338	broad.mit.edu	37	5	115320327	115320327	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr5:115320327C>T	ENST00000357872.4	+	3	1023	c.899C>T	c.(898-900)aCg>aTg	p.T300M	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		300						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T300M(1)									TTTTCCACTACGCCCCACATG	0.398																																					p.T300M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C899T	5						.						132.0	103.0	113.0					5																	115320327		2202	4300	6502	115348226	SO:0001583	missense	206338	exon3																														ENST00000357872.4:c.899C>T	5.37:g.115320327C>T	ENSP00000350541:p.Thr300Met	Somatic		Capture	Illumina HiSeq	Phase_I	115348226	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	37	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125535	0.77436	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.04406	3.63	4.93	4.93	0.64822	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.64402	D	0.000003	T	0.33498	0.0865	H	0.95187	3.635	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.51857	-0.8652	10	0.87932	D	0	.	17.274	0.87110	0.0:1.0:0.0:0.0	.	300	Q6Q4G3	AMPQ_HUMAN	M	300;289	ENSP00000350541:T300M	ENSP00000350541:T300M	T	+	2	0	AC010282.1	115348226	0.998000	0.40836	0.990000	0.47175	0.919000	0.55068	6.165000	0.71891	2.449000	0.82847	0.557000	0.71058	ACG		AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
RAD50	10111	broad.mit.edu	37	5	131924497	131924497	+	Silent	SNP	A	A	G			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr5:131924497A>G	ENST00000265335.6	+	8	1557	c.1170A>G	c.(1168-1170)gaA>gaG	p.E390E	RAD50_ENST00000487596.1_3'UTR|RAD50_ENST00000378823.3_Silent_p.E251E			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	390					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.E251E(1)|p.E390E(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CATTCAGTGAAAGACAGATTA	0.393								Homologous recombination																													p.E390E												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A1170G	5						.						92.0	91.0	91.0					5																	131924497		2203	4300	6503	131952396	SO:0001819	synonymous_variant	10111	exon8			Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.1170A>G	5.37:g.131924497A>G		Somatic		Capture	Illumina HiSeq	Phase_I	131952396	NM_005732	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Silent	SNP	ENST00000265335.6	37	CCDS34233.1																																																																																				RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
KIF3A	11127	broad.mit.edu	37	5	132051569	132051569	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr5:132051569G>A	ENST00000378746.4	-	8	1227	c.1009C>T	c.(1009-1011)Cgg>Tgg	p.R337W	KIF3A_ENST00000403231.1_Missense_Mutation_p.R337W|KIF3A_ENST00000378735.1_Missense_Mutation_p.R337W|AC004237.1_ENST00000431165.1_RNA	NM_007054.5	NP_008985.3	Q9Y496	KIF3A_HUMAN	kinesin family member 3A	337	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterior/posterior pattern specification (GO:0009952)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|organelle organization (GO:0006996)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of receptor-mediated endocytosis (GO:0048260)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|spectrin binding (GO:0030507)	p.R337W(2)		endometrium(1)|kidney(4)|large_intestine(8)|lung(3)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	25		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTGGCATACCGTAATGTACTG	0.328																																					p.R337W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1009T	5						.						61.0	58.0	59.0					5																	132051569		2202	4297	6499	132079468	SO:0001583	missense	11127	exon8			AF041853	CCDS34235.1, CCDS75295.1, CCDS75296.1	5q31	2012-08-01			ENSG00000131437	ENSG00000131437		"""Kinesins"""	6319	protein-coding gene	gene with protein product	"""kinesin family protein 3A"""	604683				1054846	Standard	XM_005271868		Approved	FLA10, KLP-20	uc003kxo.3	Q9Y496	OTTHUMG00000059725	ENST00000378746.4:c.1009C>T	5.37:g.132051569G>A	ENSP00000368020:p.Arg337Trp	Somatic		Capture	Illumina HiSeq	Phase_I	132079468	NM_007054	A8MSW9|Q59EN1|Q86XE9|Q9Y6V4	Missense_Mutation	SNP	ENST00000378746.4	37	CCDS34235.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.411505	0.83340	.	.	ENSG00000131437	ENST00000378746;ENST00000378735;ENST00000541316;ENST00000403231;ENST00000450914	T;T;T	0.77750	-1.12;-1.12;-1.12	5.82	5.82	0.92795	Kinesin, motor domain (3);	0.051984	0.85682	D	0.000000	D	0.92841	0.7723	H	0.98951	4.38	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.997	D	0.94909	0.8063	10	0.87932	D	0	.	14.0014	0.64436	0.0:0.0:0.7483:0.2517	.	337;337;337;337	E9PES4;B4DHG8;Q9Y496;Q2UVF2	.;.;KIF3A_HUMAN;.	W	337;337;337;337;307	ENSP00000368020:R337W;ENSP00000368009:R337W;ENSP00000385808:R337W	ENSP00000368009:R337W	R	-	1	2	KIF3A	132079468	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.717000	0.54911	2.756000	0.94617	0.563000	0.77884	CGG		KIF3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132788.3	NM_007054	
PCDHGA9	56107	broad.mit.edu	37	5	140783171	140783171	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr5:140783171G>A	ENST00000573521.1	+	1	652	c.652G>A	c.(652-654)Ggc>Agc	p.G218S	PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	218	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCGGATGGCGGCGAGCCGCG	0.582																																					p.G218S												.	.	0			c.G652A	5						.						26.0	31.0	29.0					5																	140783171		2045	4182	6227	140763355	SO:0001583	missense	56107	exon1			AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.652G>A	5.37:g.140783171G>A	ENSP00000460274:p.Gly218Ser	Somatic		Capture	Illumina HiSeq	Phase_I	140763355	NM_018921	A2RU65|Q9Y5C9	Missense_Mutation	SNP	ENST00000573521.1	37	CCDS58981.1																																																																																				PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437105.1	NM_018921	
ADAMTS12	81792	broad.mit.edu	37	5	33576233	33576233	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr5:33576233G>T	ENST00000504830.1	-	19	4233	c.3898C>A	c.(3898-3900)Cta>Ata	p.L1300I	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.L1215I|ADAMTS12_ENST00000504582.1_5'Flank	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1300	Spacer 2.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L1300I(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GAGGCATTTAGCAAAAAGCCC	0.483										HNSCC(64;0.19)																											p.L1300I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3898A	5						.						163.0	163.0	163.0					5																	33576233		2203	4300	6503	33611990	SO:0001583	missense	81792	exon19			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3898C>A	5.37:g.33576233G>T	ENSP00000422554:p.Leu1300Ile	Somatic		Capture	Illumina HiSeq	Phase_I	33611990	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	G	12.19	1.864038	0.32884	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.61158	0.13;0.14	5.61	4.75	0.60458	.	0.950786	0.08759	N	0.898006	T	0.52917	0.1764	N	0.20986	0.625	0.80722	D	1	D;P	0.55800	0.973;0.954	P;P	0.53593	0.73;0.541	T	0.23476	-1.0187	10	0.20046	T	0.44	.	7.7449	0.28862	0.0822:0.0:0.7168:0.2011	.	1215;1300	P58397-3;P58397	.;ATS12_HUMAN	I	1300;1215	ENSP00000422554:L1300I;ENSP00000344847:L1215I	ENSP00000344847:L1215I	L	-	1	2	ADAMTS12	33611990	0.021000	0.18746	1.000000	0.80357	0.356000	0.29392	0.227000	0.17795	1.390000	0.46547	0.655000	0.94253	CTA		ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
C5orf42	65250	broad.mit.edu	37	5	37180275	37180275	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr5:37180275T>C	ENST00000508244.1	-	27	5674	c.5581A>G	c.(5581-5583)Act>Gct	p.T1861A	C5orf42_ENST00000425232.2_Missense_Mutation_p.T1861A|C5orf42_ENST00000274258.7_Missense_Mutation_p.T741A			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1861						integral component of membrane (GO:0016021)		p.T1861A(1)|p.T741A(1)		breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TTTGCTTCAGTTGGCATTCTA	0.244																																					p.T1861A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A5581G	5						.						23.0	26.0	25.0					5																	37180275		2175	4244	6419	37216032	SO:0001583	missense	65250	exon28				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.5581A>G	5.37:g.37180275T>C	ENSP00000421690:p.Thr1861Ala	Somatic		Capture	Illumina HiSeq	Phase_I	37216032	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	T	6.304	0.424220	0.11928	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.21543	2.01;2.01;2.0;2.0	5.61	-0.752	0.11072	.	1.335230	0.05107	N	0.488138	T	0.13543	0.0328	N	0.25647	0.755	0.09310	N	1	B;B	0.20052	0.01;0.041	B;B	0.16722	0.016;0.016	T	0.30621	-0.9972	10	0.28530	T	0.3	.	4.3667	0.11228	0.1464:0.3333:0.0:0.5203	.	1861;741	E9PH94;Q9H799	.;CE042_HUMAN	A	1861;1861;741;909;741	ENSP00000421690:T1861A;ENSP00000389014:T1861A;ENSP00000274258:T741A;ENSP00000424223:T909A	ENSP00000274258:T741A	T	-	1	0	C5orf42	37216032	0.010000	0.17322	0.027000	0.17364	0.157000	0.22087	-0.218000	0.09240	-0.114000	0.11936	-1.182000	0.01712	ACT		C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
NAIP	4671	broad.mit.edu	37	5	70308403	70308403	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr5:70308403T>C	ENST00000517649.1	-	4	630	c.340A>G	c.(340-342)Ata>Gta	p.I114V	NAIP_ENST00000508426.2_Missense_Mutation_p.I114V|NAIP_ENST00000503719.2_Intron|NAIP_ENST00000523981.1_Intron|NAIP_ENST00000194097.4_Missense_Mutation_p.I114V	NM_004536.2	NP_004527.2	Q13075	BIRC1_HUMAN	NLR family, apoptosis inhibitory protein	114					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|metal ion binding (GO:0046872)	p.I114V(1)		central_nervous_system(1)	1		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		TGGTCTTCTATGGGGAGTCTC	0.488																																					p.I114V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A340G	5						.						114.0	102.0	106.0					5																	70308403		2202	4296	6498	70344159	SO:0001583	missense	4671	exon4			U19251	CCDS4009.1, CCDS43327.1	5q13.2	2010-06-16	2006-12-08	2006-12-08	ENSG00000249437	ENSG00000249437		"""Baculoviral IAP repeat containing"", ""Nucleotide-binding domain and leucine rich repeat containing"""	7634	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and BIR domain containing 1"", ""NLR family, BIR domain containing 1"""	600355	"""baculoviral IAP repeat-containing 1"""	BIRC1		7813013	Standard	NM_022892		Approved	NLRB1	uc003jyj.1	Q13075	OTTHUMG00000163318	ENST00000517649.1:c.340A>G	5.37:g.70308403T>C	ENSP00000428657:p.Ile114Val	Somatic		Capture	Illumina HiSeq	Phase_I	70344159	NM_004536	B9EG72|E9PHD1|O75857|Q13730|Q59GI6|Q8TDZ4|Q99796	Missense_Mutation	SNP	ENST00000517649.1	37	CCDS4009.1	.	.	.	.	.	.	.	.	.	.	t	3.579	-0.086086	0.07097	.	.	ENSG00000249437	ENST00000517649;ENST00000194097;ENST00000508426	T;T;T	0.72167	-0.63;-0.63;-0.63	3.26	-2.56	0.06268	Baculoviral inhibition of apoptosis protein repeat (5);	1.474120	0.04850	N	0.442091	T	0.54886	0.1886	L	0.37897	1.145	0.09310	N	1	B;B	0.17465	0.022;0.01	B;B	0.15052	0.012;0.005	T	0.28202	-1.0051	10	0.36615	T	0.2	.	2.0657	0.03602	0.1404:0.1969:0.4279:0.2349	.	114;114	E7EQW0;Q13075	.;BIRC1_HUMAN	V	114	ENSP00000428657:I114V;ENSP00000443944:I114V;ENSP00000429545:I114V	ENSP00000443944:I114V	I	-	1	0	NAIP	70344159	0.000000	0.05858	0.009000	0.14445	0.494000	0.33585	-1.089000	0.03376	-0.481000	0.06792	0.358000	0.22013	ATA		NAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372649.6	NM_004536	
RASA1	5921	broad.mit.edu	37	5	86564559	86564582	+	In_Frame_Del	DEL	TGCTGCTGCTGGCGTGGCCGGTGC	TGCTGCTGCTGGCGTGGCCGGTGC	-	rs115606026|rs111840875	byFrequency	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	TGCTGCTGCTGGCGTGGCCGGTGC	TGCTGCTGCTGGCGTGGCCGGTGC	TGCTGCTGCTGGCGTGGCCGGTGC	-	TGCTGCTGCTGGCGTGGCCGGTGC	TGCTGCTGCTGGCGTGGCCGGTGC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr5:86564559_86564582delTGCTGCTGCTGGCGTGGCCGGTGC	ENST00000274376.6	+	1	855_878	c.291_314delTGCTGCTGCTGGCGTGGCCGGTGC	c.(289-315)ggtgctgctgctggcgtggccggtgct>ggt	p.AAAGVAGA98del	RASA1_ENST00000506290.1_5'Flank|RASA1_ENST00000512763.1_5'Flank|RASA1_ENST00000456692.2_5'Flank	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	98					blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)	p.A99_A106delAAGVAGAA(1)		NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		gcgtagctggtgctgctgctggcgtggccggtgctgctgttgct	0.652																																					p.97_105del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.291_314del	5						.																																			86600338	SO:0001651	inframe_deletion	5921	exon1				CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.291_314delTGCTGCTGCTGGCGTGGCCGGTGC	5.37:g.86564559_86564582delTGCTGCTGCTGGCGTGGCCGGTGC	ENSP00000274376:p.Ala98_Ala105del	Somatic		Capture	Illumina HiSeq	Phase_I	86600315	NM_002890	B2R6W3|Q9UDI1	In_Frame_Del	DEL	ENST00000274376.6	37	CCDS34200.1																																																																																				RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
PHYKPL	85007	broad.mit.edu	37	5	177652373	177652373	+	Silent	SNP	G	G	A	rs528494634		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr5:177652373G>A	ENST00000308158.5	-	4	630	c.396C>T	c.(394-396)gaC>gaT	p.D132D	PHYKPL_ENST00000481811.1_Intron	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	132						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)	p.D132D(2)								L-Alanine(DB00160)	ATACCACCACGTCCTGGTGTC	0.562																																					p.D132D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C396T	5						.						99.0	81.0	87.0					5																	177652373		2203	4300	6503	177584979	SO:0001819	synonymous_variant	85007	exon4			BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.396C>T	5.37:g.177652373G>A		Somatic		Capture	Illumina HiSeq	Phase_I	177584979	NM_153373	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	De_novo_Start_OutOfFrame	SNP	ENST00000308158.5	37	CCDS4434.1																																																																																				PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1	NM_032921	
TBC1D7	51256	broad.mit.edu	37	6	13306729	13306729	+	Silent	SNP	A	A	G			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr6:13306729A>G	ENST00000379300.3	-	7	939	c.696T>C	c.(694-696)tgT>tgC	p.C232C	TBC1D7_ENST00000343141.4_Silent_p.C186C|TBC1D7_ENST00000607658.1_3'UTR|TBC1D7_ENST00000379307.2_Silent_p.C205C|TBC1D7_ENST00000356436.4_Silent_p.C232C|TBC1D7_ENST00000607532.1_5'Flank	NM_001143964.2|NM_016495.4	NP_001137436.1|NP_057579.1	Q9P0N9	TBCD7_HUMAN	TBC1 domain family, member 7	232					activation of Rho GTPase activity (GO:0032862)|negative regulation of cilium assembly (GO:1902018)|negative regulation of TOR signaling (GO:0032007)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of Rab GTPase activity (GO:0032851)|response to growth factor (GO:0070848)	ciliary basal body (GO:0036064)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.C232C(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)	22	Breast(50;0.0296)|Ovarian(93;0.0339)	all_hematologic(90;0.135)	Epithelial(50;0.0784)|BRCA - Breast invasive adenocarcinoma(129;0.13)|all cancers(50;0.21)			CTAGGATCTTACAGGATCCAC	0.313																																					p.C232C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T696C	6						.						67.0	76.0	73.0					6																	13306729		2202	4296	6498	13414708	SO:0001819	synonymous_variant	51256	exon7			AF151073	CCDS4523.1, CCDS47376.1, CCDS58995.1	6p23	2013-07-10			ENSG00000145979	ENSG00000145979			21066	protein-coding gene	gene with protein product		612655				11042152, 17646400	Standard	XM_005249163		Approved	dJ257A7.3, FLJ32666	uc003nan.3	Q9P0N9	OTTHUMG00000014272	ENST00000379300.3:c.696T>C	6.37:g.13306729A>G		Somatic		Capture	Illumina HiSeq	Phase_I	13414708	NM_001143965	E7EV96|Q2TU37|Q53F44|Q5SZL7|Q86VM8|Q96MB8	Silent	SNP	ENST00000379300.3	37	CCDS4523.1																																																																																				TBC1D7-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039896.2	NM_016495	
TCF21	6943	broad.mit.edu	37	6	134210721	134210721	+	Silent	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr6:134210721G>A	ENST00000367882.4	+	1	446	c.186G>A	c.(184-186)gcG>gcA	p.A62A	RP3-323P13.2_ENST00000607573.1_RNA|RP3-323P13.2_ENST00000607033.1_RNA|TCF21_ENST00000237316.3_Silent_p.A62A|RP3-323P13.2_ENST00000607641.1_RNA|RP3-323P13.2_ENST00000606544.1_RNA	NM_003206.3	NP_003197.2	O43680	TCF21_HUMAN	transcription factor 21	62					branching involved in ureteric bud morphogenesis (GO:0001658)|branchiomeric skeletal muscle development (GO:0014707)|bronchiole development (GO:0060435)|diaphragm development (GO:0060539)|embryonic digestive tract morphogenesis (GO:0048557)|epithelial cell differentiation (GO:0030855)|gland development (GO:0048732)|glomerulus development (GO:0032835)|kidney development (GO:0001822)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lung vasculature development (GO:0060426)|metanephric glomerular capillary formation (GO:0072277)|metanephric mesenchymal cell differentiation (GO:0072162)|morphogenesis of a branching structure (GO:0001763)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|reproductive structure development (GO:0048608)|respiratory system development (GO:0060541)|Sertoli cell differentiation (GO:0060008)|sex determination (GO:0007530)|spleen development (GO:0048536)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.A62A(1)		cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	13	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)		GGAGGAAGGCGCCCACCAAGA	0.667																																					p.A62A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G186A	6						.						25.0	35.0	32.0					6																	134210721		2202	4300	6502	134252414	SO:0001819	synonymous_variant	6943	exon1			AF047419	CCDS5167.1	6q23.2	2014-09-17			ENSG00000118526	ENSG00000118526		"""Basic helix-loop-helix proteins"""	11632	protein-coding gene	gene with protein product		603306				9507058	Standard	NM_198392		Approved	POD1, bHLHa23	uc003qei.4	O43680	OTTHUMG00000015608	ENST00000367882.4:c.186G>A	6.37:g.134210721G>A		Somatic		Capture	Illumina HiSeq	Phase_I	134252414	NM_198392	E1P581|O43545|Q6ICV0|Q9BZ14	Silent	SNP	ENST00000367882.4	37	CCDS5167.1																																																																																				TCF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042292.1	NM_198392	
HIVEP2	3097	broad.mit.edu	37	6	143091508	143091508	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr6:143091508C>A	ENST00000367604.1	-	4	5007	c.4368G>T	c.(4366-4368)caG>caT	p.Q1456H	HIVEP2_ENST00000012134.2_Missense_Mutation_p.Q1456H|HIVEP2_ENST00000367603.2_Missense_Mutation_p.Q1456H			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1456					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q1456H(1)		NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CCCTTTTCTGCTGCTTGGTTT	0.517																																					p.Q1456H	Esophageal Squamous(107;843 1510 13293 16805 42198)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4368T	6						.						148.0	154.0	152.0					6																	143091508		1986	4161	6147	143133201	SO:0001583	missense	3097	exon5			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.4368G>T	6.37:g.143091508C>A	ENSP00000356576:p.Gln1456His	Somatic		Capture	Illumina HiSeq	Phase_I	143133201	NM_006734	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.436437	0.43224	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.03386	3.95;3.95;3.95	5.81	2.09	0.27110	.	0.000000	0.85682	D	0.000000	T	0.04679	0.0127	L	0.39566	1.225	0.53688	D	0.999977	D	0.89917	1.0	D	0.83275	0.996	T	0.35599	-0.9782	10	0.52906	T	0.07	-15.6421	9.4766	0.38875	0.0:0.6564:0.0:0.3436	.	1456	P31629	ZEP2_HUMAN	H	1456	ENSP00000356576:Q1456H;ENSP00000356575:Q1456H;ENSP00000012134:Q1456H	ENSP00000012134:Q1456H	Q	-	3	2	HIVEP2	143133201	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	1.441000	0.35035	0.100000	0.17581	-0.794000	0.03295	CAG		HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1		
HFE	3077	broad.mit.edu	37	6	26091309	26091309	+	Missense_Mutation	SNP	T	T	G	rs199988202		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr6:26091309T>G	ENST00000357618.5	+	2	439	c.317T>G	c.(316-318)aTg>aGg	p.M106R	HFE_ENST00000309234.6_Missense_Mutation_p.M106R|HFE_ENST00000349999.4_Intron|HFE_ENST00000353147.5_Intron|HFE_ENST00000352392.4_Intron|HFE_ENST00000317896.7_Missense_Mutation_p.M106R|HFE_ENST00000461397.1_Missense_Mutation_p.M106R|HFE_ENST00000397022.3_Missense_Mutation_p.M83R|HFE_ENST00000336625.8_Missense_Mutation_p.M106R|HFE_ENST00000470149.1_Missense_Mutation_p.M106R|HFE_ENST00000488199.1_Intron	NM_000410.3|NM_139006.2	NP_000401.1|NP_620575.1	Q30201	HFE_HUMAN	hemochromatosis	106	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular iron ion homeostasis (GO:0006879)|cellular response to iron ion starvation (GO:0010106)|female pregnancy (GO:0007565)|hormone biosynthetic process (GO:0042446)|immune response (GO:0006955)|iron ion import into cell (GO:0097459)|multicellular organismal iron ion homeostasis (GO:0060586)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein complex assembly (GO:0006461)	apical part of cell (GO:0045177)|basal part of cell (GO:0045178)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|integral component of plasma membrane (GO:0005887)|MHC class I protein complex (GO:0042612)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	peptide antigen binding (GO:0042605)|receptor binding (GO:0005102)	p.M106R(1)		endometrium(3)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGGACTATTATGGAAAATCAC	0.473									Hemochromatosis																												p.M106R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T317G	6						.						112.0	113.0	113.0					6																	26091309		2203	4300	6503	26199288	SO:0001583	missense	3077	exon2	Familial Cancer Database			CCDS4578.1, CCDS4579.1, CCDS4580.1, CCDS4581.1, CCDS4582.1, CCDS47386.1, CCDS47387.1, CCDS54974.1, CCDS54975.1, CCDS75412.1	6p21.3	2014-09-17			ENSG00000010704	ENSG00000010704		"""Immunoglobulin superfamily / C1-set domain containing"""	4886	protein-coding gene	gene with protein product	"""high Fe"""	613609				3460331	Standard	XR_241893		Approved	HLA-H	uc003nfx.1	Q30201	OTTHUMG00000016348	ENST00000357618.5:c.317T>G	6.37:g.26091309T>G	ENSP00000417404:p.Met106Arg	Somatic		Capture	Illumina HiSeq	Phase_I	26199288	NM_139004	B2CKL0|O75929|O75930|O75931|Q17RT0|Q96KU5|Q96KU6|Q96KU7|Q96KU8|Q9HC64|Q9HC68|Q9HC70|Q9HC83	Missense_Mutation	SNP	ENST00000357618.5	37	CCDS4578.1	.	.	.	.	.	.	.	.	.	.	T	9.436	1.086919	0.20390	.	.	ENSG00000010704	ENST00000397022;ENST00000317896;ENST00000535098;ENST00000539147;ENST00000357618;ENST00000470149;ENST00000336625;ENST00000461397;ENST00000309234	D;T;D;D;T;D;D	0.89270	-2.49;5.94;-2.49;-2.49;5.94;-2.49;-2.49	4.91	4.91	0.64330	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.378307	0.24120	N	0.041371	T	0.81389	0.4812	N	0.17723	0.515	0.50632	D	0.999889	D;D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0;0.999	D;D;D;D;D;D	0.83275	0.955;0.996;0.996;0.925;0.988;0.955	T	0.80190	-0.1485	10	0.02654	T	1	.	10.8374	0.46696	0.0:0.0:0.0:1.0	.	106;106;106;106;83;106	Q6B0J5;Q30201-7;Q30201-10;Q30201-3;Q30201-5;Q30201	.;.;.;.;.;HFE_HUMAN	R	83;106;106;1;106;106;106;106;106	ENSP00000380217:M83R;ENSP00000313776:M106R;ENSP00000417404:M106R;ENSP00000419725:M106R;ENSP00000337819:M106R;ENSP00000420802:M106R;ENSP00000311698:M106R	ENSP00000311698:M106R	M	+	2	0	HFE	26199288	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.180000	0.42537	2.051000	0.60960	0.533000	0.62120	ATG		HFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356133.1		
DHX16	8449	broad.mit.edu	37	6	30624195	30624195	+	Silent	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr6:30624195G>A	ENST00000376442.3	-	15	2598	c.2403C>T	c.(2401-2403)gcC>gcT	p.A801A	DHX16_ENST00000376437.5_Silent_p.A320A	NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	801					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.A801A(1)		kidney(2)|ovary(2)	4						GGTGGTTGAGGGCTCCCAGAG	0.567																																					p.A801A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2403T	6						.						75.0	74.0	74.0					6																	30624195		2203	4300	6503	30732174	SO:0001819	synonymous_variant	8449	exon15			AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.2403C>T	6.37:g.30624195G>A		Somatic		Capture	Illumina HiSeq	Phase_I	30732174	NM_003587	O60322|Q5JP45|Q969X7|Q96QC1	Silent	SNP	ENST00000376442.3	37	CCDS4685.1																																																																																				DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	
VARS2	57176	broad.mit.edu	37	6	30892136	30892136	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr6:30892136delT	ENST00000321897.5	+	25	3104	c.2472delT	c.(2470-2472)gctfs	p.A824fs	VARS2_ENST00000541562.1_Frame_Shift_Del_p.A854fs|VARS2_ENST00000416670.2_Frame_Shift_Del_p.A824fs|VARS2_ENST00000476162.1_3'UTR|VARS2_ENST00000542001.1_Frame_Shift_Del_p.A684fs			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	824					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)	p.V825fs*1(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						TCCAGGAGGCTGTGAAGCCCG	0.697																																					p.A684fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2052delT	6						.						27.0	34.0	31.0					6																	30892136		1500	2694	4194	31000115	SO:0001589	frameshift_variant	57176	exon25			AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.2472delT	6.37:g.30892136delT	ENSP00000316092:p.Ala824fs	Somatic		Capture	Illumina HiSeq	Phase_I	31000115	NM_001167733	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Frame_Shift_Del	DEL	ENST00000321897.5	37	CCDS34387.1																																																																																				VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442	
ABCC10	89845	broad.mit.edu	37	6	43400987	43400987	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr6:43400987C>T	ENST00000372530.4	+	3	1484	c.1269C>T	c.(1267-1269)ttC>ttT	p.F423F	ABCC10_ENST00000443426.2_3'UTR|ABCC10_ENST00000244533.3_Silent_p.F380F	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	423	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.F380F(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	GCGTGGCCTTCGTGGGTGGTC	0.582																																					p.F423F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1269T	6						.						60.0	57.0	58.0					6																	43400987		2203	4300	6503	43508965	SO:0001819	synonymous_variant	89845	exon3			U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.1269C>T	6.37:g.43400987C>T		Somatic		Capture	Illumina HiSeq	Phase_I	43508965	NM_001198934	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Silent	SNP	ENST00000372530.4	37	CCDS56430.1																																																																																				ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450	
TFAP2D	83741	broad.mit.edu	37	6	50686807	50686807	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr6:50686807C>A	ENST00000008391.3	+	3	770	c.542C>A	c.(541-543)tCt>tAt	p.S181Y	TFAP2D_ENST00000492804.1_3'UTR	NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)									p.S181Y(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					ATTAAGGGCTCTGTGGAGGCC	0.408																																					p.S181Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C542A	6						.						109.0	105.0	106.0					6																	50686807		2203	4300	6503	50794766	SO:0001583	missense	83741	exon3			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.542C>A	6.37:g.50686807C>A	ENSP00000008391:p.Ser181Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	50794766	NM_172238		Missense_Mutation	SNP	ENST00000008391.3	37	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.247640	0.59103	.	.	ENSG00000008197	ENST00000008391	D	0.97352	-4.35	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.92629	0.7658	N	0.08118	0	0.80722	D	1	D	0.56968	0.978	P	0.49140	0.601	D	0.92483	0.5994	10	0.30854	T	0.27	-9.1543	20.2192	0.98319	0.0:1.0:0.0:0.0	.	181	Q7Z6R9	AP2D_HUMAN	Y	181	ENSP00000008391:S181Y	ENSP00000008391:S181Y	S	+	2	0	TFAP2D	50794766	1.000000	0.71417	0.986000	0.45419	0.848000	0.48234	5.767000	0.68850	2.780000	0.95670	0.655000	0.94253	TCT		TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238	
NDUFAF4	29078	broad.mit.edu	37	6	97339216	97339216	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr6:97339216C>T	ENST00000316149.7	-	3	371	c.292G>A	c.(292-294)Gac>Aac	p.D98N	NDUFAF4_ENST00000489477.1_5'UTR	NM_014165.3	NP_054884.1	Q9P032	NDUF4_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 4	98					mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)		p.D98N(1)		large_intestine(5)|lung(3)|ovary(1)|skin(1)	10						AAATGATGGTCTTTCGGCAAT	0.343																																					p.D98N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G292A	6						.						76.0	80.0	79.0					6																	97339216		2202	4300	6502	97445937	SO:0001583	missense	29078	exon3			AF161474	CCDS5037.1	6q16.3	2012-10-12	2012-05-08	2009-03-18	ENSG00000123545	ENSG00000123545		"""Mitochondrial respiratory chain complex assembly factors"""	21034	protein-coding gene	gene with protein product		611776	"""chromosome 6 open reading frame 66"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4"""	C6orf66		11042152, 18179882	Standard	NM_014165		Approved	HSPC125, bA22L21.1, My013, HRPAP20	uc003pow.3	Q9P032	OTTHUMG00000015246	ENST00000316149.7:c.292G>A	6.37:g.97339216C>T	ENSP00000358272:p.Asp98Asn	Somatic		Capture	Illumina HiSeq	Phase_I	97445937	NM_014165	B2R4J5	Missense_Mutation	SNP	ENST00000316149.7	37	CCDS5037.1	.	.	.	.	.	.	.	.	.	.	C	2.868	-0.234580	0.05983	.	.	ENSG00000123545	ENST00000316149	D	0.83673	-1.75	5.27	5.27	0.74061	.	0.447495	0.25648	N	0.029231	T	0.59528	0.2200	L	0.58810	1.83	0.09310	N	1	B	0.20887	0.049	B	0.24541	0.054	T	0.46034	-0.9220	10	0.11485	T	0.65	.	4.6189	0.12440	0.1577:0.6087:0.1519:0.0818	.	98	Q9P032	NDUF4_HUMAN	N	98	ENSP00000358272:D98N	ENSP00000358272:D98N	D	-	1	0	NDUFAF4	97445937	0.997000	0.39634	0.236000	0.24074	0.010000	0.07245	2.276000	0.43408	2.465000	0.83290	0.655000	0.94253	GAC		NDUFAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041567.1	NM_014165	
SYNE1	23345	broad.mit.edu	37	6	152730241	152730241	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr6:152730241T>C	ENST00000367255.5	-	44	7103	c.6502A>G	c.(6502-6504)Aaa>Gaa	p.K2168E	SYNE1_ENST00000341594.5_Missense_Mutation_p.K2205E|SYNE1_ENST00000423061.1_Missense_Mutation_p.K2175E|RNA5SP223_ENST00000365174.1_RNA|SYNE1_ENST00000265368.4_Missense_Mutation_p.K2168E|SYNE1_ENST00000448038.1_Missense_Mutation_p.K2175E	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2168					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.K2168E(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATGTCTGTTTTCACCAAGCTG	0.363										HNSCC(10;0.0054)																											p.K2175E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A6523G	6						.						139.0	134.0	136.0					6																	152730241		2203	4300	6503	152771934	SO:0001583	missense	23345	exon44			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.6502A>G	6.37:g.152730241T>C	ENSP00000356224:p.Lys2168Glu	Somatic		Capture	Illumina HiSeq	Phase_I	152771934	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	15.54	2.865292	0.51588	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.34667	1.38;1.38;1.38;1.38;1.35	5.57	5.57	0.84162	.	0.094143	0.45867	D	0.000323	T	0.31327	0.0793	M	0.63843	1.955	0.80722	D	1	P;B;B;B	0.52316	0.952;0.016;0.016;0.06	P;B;B;B	0.51016	0.656;0.015;0.015;0.032	T	0.14200	-1.0481	10	0.11182	T	0.66	.	15.7357	0.77842	0.0:0.0:0.0:1.0	.	2151;2168;2168;2175	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	E	2168;2175;2168;2175;2205	ENSP00000356224:K2168E;ENSP00000396024:K2175E;ENSP00000265368:K2168E;ENSP00000390975:K2175E;ENSP00000341887:K2205E	ENSP00000265368:K2168E	K	-	1	0	SYNE1	152771934	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	6.275000	0.72594	2.125000	0.65367	0.533000	0.62120	AAA		SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
CUX1	1523	broad.mit.edu	37	7	101845321	101845321	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr7:101845321C>T	ENST00000292535.7	+	18	2782	c.2744C>T	c.(2743-2745)cCg>cTg	p.P915L	CUX1_ENST00000560541.1_Intron|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000546411.2_Missense_Mutation_p.P813L|CUX1_ENST00000360264.3_Missense_Mutation_p.P926L|CUX1_ENST00000550008.2_Missense_Mutation_p.P859L|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000556210.1_Missense_Mutation_p.P757L|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000549414.2_Missense_Mutation_p.P893L|CUX1_ENST00000292538.4_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	915					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.P915L(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						CCATCCTCCCCGATCGTGCCC	0.657																																					p.P915L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2744T	7						.						130.0	123.0	125.0					7																	101845321		2203	4300	6503	101632041	SO:0001583	missense	1523	exon18			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.2744C>T	7.37:g.101845321C>T	ENSP00000292535:p.Pro915Leu	Somatic		Capture	Illumina HiSeq	Phase_I	101632041	NM_181552	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	37	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891211	0.72524	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.70869	-0.5;-0.43;-0.52;-0.52;-0.43;-0.43	5.29	5.29	0.74685	.	0.147599	0.46758	D	0.000273	T	0.68016	0.2955	M	0.62723	1.935	0.80722	D	1	B;B	0.33637	0.42;0.382	B;B	0.23150	0.02;0.044	T	0.72083	-0.4397	10	0.87932	D	0	-22.7136	18.9374	0.92590	0.0:1.0:0.0:0.0	.	915;926	P39880;P39880-3	CUX1_HUMAN;.	L	926;915;893;859;813;757	ENSP00000353401:P926L;ENSP00000292535:P915L;ENSP00000446630:P893L;ENSP00000447373:P859L;ENSP00000450125:P813L;ENSP00000451558:P757L	ENSP00000292535:P915L	P	+	2	0	CUX1	101632041	1.000000	0.71417	0.948000	0.38648	0.594000	0.36715	7.427000	0.80284	2.483000	0.83821	0.655000	0.94253	CCG		CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
RELN	5649	broad.mit.edu	37	7	103206800	103206800	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr7:103206800G>T	ENST00000428762.1	-	33	4966	c.4807C>A	c.(4807-4809)Caa>Aaa	p.Q1603K	RELN_ENST00000343529.5_Missense_Mutation_p.Q1603K|RELN_ENST00000424685.2_Missense_Mutation_p.Q1603K	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1603					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.Q1603E(1)|p.Q1603K(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AATCCAGTTTGAGAGCTGTCA	0.403																																					p.Q1603K	NSCLC(146;835 1944 15585 22231 52158)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C4807A	7						.						96.0	93.0	94.0					7																	103206800		2203	4300	6503	102994036	SO:0001583	missense	5649	exon33				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4807C>A	7.37:g.103206800G>T	ENSP00000392423:p.Gln1603Lys	Somatic		Capture	Illumina HiSeq	Phase_I	102994036	NM_005045	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302504	0.40795	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.41065	1.01;1.98;1.01	6.08	6.08	0.98989	.	0.173332	0.53938	D	0.000055	T	0.33847	0.0877	L	0.29908	0.895	0.36952	D	0.892891	B;B	0.21821	0.035;0.061	B;B	0.22152	0.038;0.022	T	0.27365	-1.0076	10	0.07813	T	0.8	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	1603;1603	P78509-2;P78509	.;RELN_HUMAN	K	1603	ENSP00000392423:Q1603K;ENSP00000345694:Q1603K;ENSP00000388446:Q1603K	ENSP00000345694:Q1603K	Q	-	1	0	RELN	102994036	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.856000	0.75450	2.894000	0.99253	0.655000	0.94253	CAA		RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
PLXNA4	91584	broad.mit.edu	37	7	131815244	131815244	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr7:131815244G>T	ENST00000359827.3	-	32	6641	c.5679C>A	c.(5677-5679)gaC>gaA	p.D1893E	PLXNA4_ENST00000321063.4_Missense_Mutation_p.D1893E			Q9HCM2	PLXA4_HUMAN	plexin A4	1893					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.D1893E(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GTTCTCAGCTGTCTAAGCTCA	0.542																																					p.D1893E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C5679A	7						.						210.0	215.0	213.0					7																	131815244		1989	4155	6144	131465784	SO:0001583	missense	91584	exon32			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.5679C>A	7.37:g.131815244G>T	ENSP00000352882:p.Asp1893Glu	Somatic		Capture	Illumina HiSeq	Phase_I	131465784	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	G	8.359	0.832710	0.16820	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.00902	5.56;5.56	5.29	5.29	0.74685	.	0.051641	0.85682	D	0.000000	T	0.00724	0.0024	N	0.10685	0.025	0.51482	D	0.999923	B	0.06786	0.001	B	0.04013	0.001	T	0.53308	-0.8457	10	0.02654	T	1	.	18.9382	0.92594	0.0:0.0:1.0:0.0	.	1893	Q9HCM2	PLXA4_HUMAN	E	1893	ENSP00000323194:D1893E;ENSP00000352882:D1893E	ENSP00000323194:D1893E	D	-	3	2	PLXNA4	131465784	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.118000	0.71583	2.443000	0.82685	0.650000	0.86243	GAC		PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
HDAC9	9734	broad.mit.edu	37	7	19015496	19015496	+	Missense_Mutation	SNP	G	G	T	rs531869853		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr7:19015496G>T	ENST00000441542.2	+	24	3090	c.3090G>T	c.(3088-3090)ttG>ttT	p.L1030F	HDAC9_ENST00000401921.1_Missense_Mutation_p.L986F|HDAC9_ENST00000406451.4_Missense_Mutation_p.L1027F	NM_178425.2	NP_848512.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	0					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.L1030F(2)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	GTGCTCAGTTGCAAGAGGAGA	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		20012	0.001		0.0	False		,,,				2504	0.0				p.L1027F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3081T	7						.						114.0	125.0	121.0					7																	19015496		2119	4230	6349	18982021	SO:0001583	missense	9734	exon25			AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000441542.2:c.3090G>T	7.37:g.19015496G>T	ENSP00000408617:p.Leu1030Phe	Somatic		Capture	Illumina HiSeq	Phase_I	18982021	NM_178423	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000441542.2	37	CCDS47553.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.682462	0.47991	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000441542	T;T;T	0.58210	0.35;0.35;0.35	5.65	1.76	0.24704	.	2.471140	0.02109	N	0.054617	T	0.44138	0.1279	N	0.22421	0.69	0.80722	D	1	B;B;B;B	0.28933	0.05;0.228;0.228;0.228	B;B;B;B	0.30943	0.122;0.056;0.056;0.056	T	0.25572	-1.0128	10	0.66056	D	0.02	-33.2023	9.2816	0.37731	0.3887:0.0:0.6113:0.0	.	275;986;1030;1027	Q8N926;Q9UKV0-6;Q9UKV0-7;Q9UKV0-5	.;.;.;.	F	1027;986;1030	ENSP00000384657:L1027F;ENSP00000383912:L986F;ENSP00000408617:L1030F	ENSP00000383912:L986F	L	+	3	2	HDAC9	18982021	1.000000	0.71417	0.969000	0.41365	0.992000	0.81027	1.594000	0.36697	0.716000	0.32124	0.591000	0.81541	TTG		HDAC9-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376088.1		
GRM3	2913	broad.mit.edu	37	7	86415876	86415876	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr7:86415876C>T	ENST00000361669.2	+	3	1867	c.768C>T	c.(766-768)taC>taT	p.Y256Y	GRM3_ENST00000439827.1_Silent_p.Y256Y|GRM3_ENST00000536043.1_Silent_p.Y128Y|GRM3_ENST00000394720.2_Silent_p.Y254Y|AC005009.2_ENST00000452471.1_RNA|GRM3_ENST00000546348.1_Intron|AC005009.2_ENST00000418031.1_RNA	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	256					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.Y256Y(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					GCAAGTCCTACGACAGCGTGA	0.647																																					p.Y256Y	GBM(52;969 1098 3139 52280)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C768T	7						.						48.0	50.0	50.0					7																	86415876		2203	4300	6503	86253812	SO:0001819	synonymous_variant	2913	exon3				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.768C>T	7.37:g.86415876C>T		Somatic		Capture	Illumina HiSeq	Phase_I	86253812	NM_000840	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Silent	SNP	ENST00000361669.2	37	CCDS5600.1																																																																																				GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2		
CCDC132	55610	broad.mit.edu	37	7	92883194	92883194	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr7:92883194T>A	ENST00000305866.5	+	4	375	c.247T>A	c.(247-249)Ttg>Atg	p.L83M	CCDC132_ENST00000544910.1_Missense_Mutation_p.L53M|CCDC132_ENST00000317751.6_5'UTR|CCDC132_ENST00000535481.1_Intron|CCDC132_ENST00000251739.5_Missense_Mutation_p.L83M|CCDC132_ENST00000541136.1_5'UTR	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	83						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.L83M(2)		endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			TGTTCTCAATTTGCAAGAATT	0.328																																					p.L83M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T247A	7						.						39.0	40.0	40.0					7																	92883194		2203	4300	6503	92721130	SO:0001583	missense	55610	exon4			AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.247T>A	7.37:g.92883194T>A	ENSP00000307666:p.Leu83Met	Somatic		Capture	Illumina HiSeq	Phase_I	92721130	NM_024553	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	37	CCDS43617.1	.	.	.	.	.	.	.	.	.	.	T	17.27	3.347047	0.61183	.	.	ENSG00000004766	ENST00000251739;ENST00000305866;ENST00000544910;ENST00000458530	.	.	.	4.37	2.0	0.26442	Vacuolar protein sorting-associated protein 54 (1);	0.148196	0.46758	D	0.000268	T	0.64538	0.2607	L	0.50333	1.59	0.80722	D	1	D;D;D	0.76494	0.994;0.999;0.996	P;D;D	0.87578	0.904;0.998;0.93	T	0.59867	-0.7373	9	0.44086	T	0.13	-5.2943	6.6416	0.22913	0.0:0.487:0.0:0.513	.	53;83;83	F5H5U7;Q96JG6;Q96JG6-2	.;CC132_HUMAN;.	M	83;83;53;82	.	ENSP00000251739:L83M	L	+	1	2	CCDC132	92721130	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.463000	0.35277	0.331000	0.23511	0.528000	0.53228	TTG		CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667	
BRAF	673	broad.mit.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	A	T	rs121913377|rs113488022|rs121913227|rs397516897		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr7:140453136A>T	ENST00000288602.6	-	15	1859	c.1799T>A	c.(1798-1800)gTg>gAg	p.V600E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:12068308}.|V -> E (in CRC; also found in sarcoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis; loss of regulation by PMRT5). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:12198537, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:23263490, ECO:0000269|PubMed:24455489}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V600E(15453)|p.V600K(252)|p.V600R(44)|p.V600D(16)|p.V600A(12)|p.V600_K601>E(12)|p.V600G(11)|p.T599_R603>I(2)|p.V600Q(2)|p.V600_S605>EK(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insDFGLAT(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TCGAGATTTCACTGTAGCTAG	0.368	V600D(K029AX_SKIN)|V600D(WM115_SKIN)|V600D(WM2664_SKIN)|V600E(8505C_THYROID)|V600E(A101D_SKIN)|V600E(A2058_SKIN)|V600E(A375_SKIN)|V600E(A673_BONE)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(BCPAP_THYROID)|V600E(BHT101_THYROID)|V600E(BT474_BREAST)|V600E(C32_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(COLO205_LARGE_INTESTINE)|V600E(COLO679_SKIN)|V600E(COLO741_SKIN)|V600E(COLO783_SKIN)|V600E(COLO800_SKIN)|V600E(COLO818_SKIN)|V600E(COLO829_SKIN)|V600E(COLO849_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(DU4475_BREAST)|V600E(ES2_OVARY)|V600E(G361_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(HS294T_SKIN)|V600E(HS695T_SKIN)|V600E(HS939T_SKIN)|V600E(IGR1_SKIN)|V600E(IGR37_SKIN)|V600E(IGR39_SKIN)|V600E(K029AX_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(LOXIMVI_SKIN)|V600E(MALME3M_SKIN)|V600E(MELHO_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(RKO_LARGE_INTESTINE)|V600E(RPMI7951_SKIN)|V600E(RVH421_SKIN)|V600E(SH4_SKIN)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(SKHEP1_LIVER)|V600E(SKMEL24_SKIN)|V600E(SKMEL28_SKIN)|V600E(SKMEL5_SKIN)|V600E(SW1417_LARGE_INTESTINE)|V600E(UACC257_SKIN)|V600E(UACC62_SKIN)|V600E(WM793_SKIN)|V600E(WM88_SKIN)|V600E(WM983B_SKIN)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.V600E	Colon(40;35 892 2973 5743 27438)		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	BRAF,pituitary,NS,Substitution - Missense,0 	.	15808	Substitution - Missense(15790)|Complex - deletion inframe(17)|Insertion - In frame(1)	thyroid(7476)|skin(3822)|large_intestine(3288)|NS(360)|haematopoietic_and_lymphoid_tissue(336)|ovary(211)|lung(58)|eye(57)|central_nervous_system(53)|soft_tissue(30)|biliary_tract(18)|liver(17)|prostate(13)|breast(10)|upper_aerodigestive_tract(9)|endometrium(8)|pancreas(8)|testis(7)|small_intestine(7)|genital_tract(4)|stomach(4)|bone(3)|autonomic_ganglia(2)|oesophagus(2)|urinary_tract(2)|adrenal_gland(2)|pituitary(1)	c.T1799A	7						.						112.0	104.0	107.0					7																	140453136		2203	4300	6503	140099605	SO:0001583	missense	673	exon15	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1799T>A	7.37:g.140453136A>T	ENSP00000288602:p.Val600Glu	Somatic		Capture	Illumina HiSeq	Phase_I	140099605	NM_004333	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.0|24.0	4.486113|4.486113	0.84854|0.84854	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.81739|.	-1.53|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61565|.	0.2357|.	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D|.	0.55385|.	0.971|.	D|.	0.66351|.	0.943|.	T|.	0.58160|.	-0.7685|.	10|.	0.87932|.	D|.	0|.	.|.	15.9326|15.9326	0.79675|0.79675	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	600|.	P15056|.	BRAF_HUMAN|.	E|R	600|208	ENSP00000288602:V600E|.	ENSP00000288602:V600E|.	V|X	-|-	2|1	0|0	BRAF|BRAF	140099605|140099605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.197000|9.197000	0.94985|0.94985	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	GTG|TGA		BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	
MYOM2	9172	broad.mit.edu	37	8	2041893	2041893	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr8:2041893C>T	ENST00000262113.4	+	17	2241	c.2100C>T	c.(2098-2100)gaC>gaT	p.D700D	MYOM2_ENST00000523438.1_Silent_p.D125D	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	700	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.D700D(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		AGGAATCAGACGTCATAAAAG	0.493																																					p.D700D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2100T	8						.						173.0	140.0	151.0					8																	2041893		2203	4300	6503	2029300	SO:0001819	synonymous_variant	9172	exon17				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.2100C>T	8.37:g.2041893C>T		Somatic		Capture	Illumina HiSeq	Phase_I	2029300	NM_003970	Q7Z3Y2	Silent	SNP	ENST00000262113.4	37	CCDS5957.1																																																																																				MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
CSMD1	64478	broad.mit.edu	37	8	2967726	2967726	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr8:2967726A>C	ENST00000520002.1	-	44	7120	c.6565T>G	c.(6565-6567)Ttc>Gtc	p.F2189V	CSMD1_ENST00000537824.1_Missense_Mutation_p.F2188V|CSMD1_ENST00000602723.1_Missense_Mutation_p.F2189V|CSMD1_ENST00000400186.3_Missense_Mutation_p.F2189V|CSMD1_ENST00000602557.1_Missense_Mutation_p.F2189V|CSMD1_ENST00000542608.1_Missense_Mutation_p.F2188V			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2189	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.F1917V(1)|p.F2188V(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AACAGGGTGAAGTTGATGTAA	0.468																																					p.L2188R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T6563G	8						.						96.0	97.0	97.0					8																	2967726		1970	4144	6114	2955133	SO:0001583	missense	64478	exon43					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6565T>G	8.37:g.2967726A>C	ENSP00000430733:p.Phe2189Val	Somatic		Capture	Illumina HiSeq	Phase_I	2955133	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.5|21.5	4.165639|4.165639	0.78339|0.78339	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	T;T;T;T|.	0.25414|.	1.8;1.8;1.8;1.8|.	5.2|5.2	5.2|5.2	0.72013|0.72013	CUB (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78842|0.78842	0.4347|0.4347	M|M	0.85630|0.85630	2.765|2.765	0.80722|0.80722	D|D	1|1	D;P;D|.	0.69078|.	0.994;0.751;0.997|.	D;P;D|.	0.81914|.	0.985;0.741;0.995|.	T|T	0.81782|0.81782	-0.0775|-0.0775	10|5	0.34782|.	T|.	0.22|.	.|.	15.3482|15.3482	0.74359|0.74359	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	2189;2189;2188|.	E5RIG2;Q96PZ7;F5H2I8|.	.;CSMD1_HUMAN;.|.	V|R	2189;2189;2050;2188;2188|1668	ENSP00000383047:F2189V;ENSP00000430733:F2189V;ENSP00000441462:F2188V;ENSP00000446243:F2188V|.	ENSP00000320445:F2050V|.	F|L	-|-	1|2	0|0	CSMD1|CSMD1	2955133|2955133	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.638000|0.638000	0.38207|0.38207	8.859000|8.859000	0.92264|0.92264	2.082000|2.082000	0.62665|0.62665	0.372000|0.372000	0.22366|0.22366	TTC|CTT		CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
SPAG11B	10407	broad.mit.edu	37	8	7320247	7320247	+	Missense_Mutation	SNP	G	G	A	rs369319310		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr8:7320247G>A	ENST00000297498.2	-	2	362	c.196C>T	c.(196-198)Cgc>Tgc	p.R66C	SPAG11B_ENST00000398462.2_Missense_Mutation_p.R66C|SPAG11B_ENST00000359758.5_Missense_Mutation_p.R66C|SPAG11B_ENST00000361111.2_Missense_Mutation_p.R66C|SPAG11B_ENST00000317900.5_Missense_Mutation_p.R66C	NM_016512.3	NP_057596.1	Q08648	SG11B_HUMAN	sperm associated antigen 11B	66					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)		p.R66C(2)		large_intestine(2)|lung(3)|urinary_tract(1)	6				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		GGTGGGGTGCGCGGTGGTAAG	0.577																																					p.R66C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C196T	8						.						8.0	11.0	10.0					8																	7320247		2035	4112	6147	7307657	SO:0001583	missense	10407	exon2			AF168616	CCDS5964.1, CCDS5965.1, CCDS5966.1, CCDS5967.1, CCDS47774.1	8p23.1	2014-02-21	2007-03-15	2007-03-15	ENSG00000164871	ENSG00000164871			14534	protein-coding gene	gene with protein product	"""epididymal protein 2B"""	606560				8167223, 1693137	Standard	NM_058200		Approved	HE2, EP2, EP2C, EP2D, EDDM2B	uc003wrl.3	Q08648	OTTHUMG00000129219	ENST00000297498.2:c.196C>T	8.37:g.7320247G>A	ENSP00000297498:p.Arg66Cys	Somatic		Capture	Illumina HiSeq	Phase_I	7307657	NM_058200	E9PFH0|Q546A0|Q6ZYB2|Q9H4P8|Q9H4P9|Q9H4Q0|Q9H4Q1|Q9H4Q2|Q9NRT3|Q9NRV4|Q9NRV5|Q9NRV6|Q9NRV7|Q9NRV8	Missense_Mutation	SNP	ENST00000297498.2	37	CCDS5966.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.206279	0.39003	.	.	ENSG00000164871	ENST00000528943;ENST00000359758;ENST00000361111;ENST00000297498;ENST00000398462;ENST00000317900	T;T;T	0.62788	1.02;0.0;0.76	2.78	2.78	0.32641	.	.	.	.	.	T	0.72301	0.3443	L	0.54323	1.7	0.09310	N	0.999997	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;0.993;0.988;0.998	T	0.58370	-0.7648	9	0.87932	D	0	.	9.3141	0.37924	0.0:0.0:1.0:0.0	.	66;66;66;66;66	Q08648-3;A8MZA0;Q08648;Q6PDA7-3;E9PAK7	.;.;SG11B_HUMAN;.;.	C	49;66;66;66;66;66	ENSP00000437154:R49C;ENSP00000354411:R66C;ENSP00000297498:R66C	ENSP00000297498:R66C	R	-	1	0	SPAG11B	7307657	0.000000	0.05858	0.048000	0.18961	0.014000	0.08584	0.440000	0.21592	1.867000	0.54127	0.454000	0.30748	CGC		SPAG11B-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251390.2	NM_058202, NM_058200, NM_058201, NM_016512, NM_058203, NM_058206, NM_058207	
NEFM	4741	broad.mit.edu	37	8	24775498	24775498	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr8:24775498G>T	ENST00000221166.5	+	3	2912	c.2130G>T	c.(2128-2130)aaG>aaT	p.K710N	NEFM_ENST00000437366.2_Missense_Mutation_p.K671N|NEFM_ENST00000518131.1_Intron|NEFM_ENST00000521540.1_Intron|NEFM_ENST00000433454.2_Missense_Mutation_p.K334N			P07197	NFM_HUMAN	neurofilament, medium polypeptide	710	Tail.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)	p.K710N(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		aggaagtcaaggaagctccca	0.463																																					p.K334N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1002T	8						.						59.0	60.0	60.0					8																	24775498		2203	4300	6503	24831403	SO:0001583	missense	4741	exon3			BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.2130G>T	8.37:g.24775498G>T	ENSP00000221166:p.Lys710Asn	Somatic		Capture	Illumina HiSeq	Phase_I	24831403	NM_001105541	B4DGN2|E9PBF7|Q4QRK6	Missense_Mutation	SNP	ENST00000221166.5	37	CCDS6046.1	.	.	.	.	.	.	.	.	.	.	G	2.009	-0.427504	0.04701	.	.	ENSG00000104722	ENST00000221166;ENST00000437366;ENST00000433454	D;D;D	0.94457	-1.86;-1.71;-3.43	3.8	1.86	0.25419	.	0.654770	0.13250	N	0.402131	D	0.90882	0.7135	L	0.60455	1.87	0.19575	N	0.999961	B	0.33694	0.421	B	0.29942	0.109	T	0.80834	-0.1205	10	0.27785	T	0.31	.	9.9344	0.41541	0.3078:0.0:0.6922:0.0	.	710	P07197	NFM_HUMAN	N	710;671;334	ENSP00000221166:K710N;ENSP00000410137:K671N;ENSP00000412295:K334N	ENSP00000221166:K710N	K	+	3	2	NEFM	24831403	1.000000	0.71417	0.894000	0.35097	0.561000	0.35649	2.106000	0.41835	0.668000	0.31126	0.185000	0.17295	AAG		NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254954.2	NM_005382	
TOX	9760	broad.mit.edu	37	8	59750831	59750831	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr8:59750831T>C	ENST00000361421.1	-	5	953	c.733A>G	c.(733-735)Aaa>Gaa	p.K245E		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	245						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K245E(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				TTTGGTTTTTTCCCCATATCA	0.448																																					p.K245E	Pancreas(161;610 1969 17913 21374 22725)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A733G	8						.						70.0	78.0	75.0					8																	59750831		2203	4300	6503	59913385	SO:0001583	missense	9760	exon5				CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.733A>G	8.37:g.59750831T>C	ENSP00000354842:p.Lys245Glu	Somatic		Capture	Illumina HiSeq	Phase_I	59913385	NM_014729	Q96AV5	Missense_Mutation	SNP	ENST00000361421.1	37	CCDS34897.1	.	.	.	.	.	.	.	.	.	.	T	30	5.050789	0.93740	.	.	ENSG00000198846	ENST00000361421;ENST00000456290	T	0.16743	2.32	5.79	5.79	0.91817	High mobility group, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.43722	0.1260	M	0.78637	2.42	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	T	0.33574	-0.9863	9	.	.	.	.	16.1304	0.81428	0.0:0.0:0.0:1.0	.	245	O94900	TOX_HUMAN	E	245;3	ENSP00000354842:K245E	.	K	-	1	0	TOX	59913385	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.040000	0.89188	2.202000	0.70862	0.482000	0.46254	AAA		TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378307.1	NM_014729	
RUNX1T1	862	broad.mit.edu	37	8	92988170	92988170	+	Silent	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr8:92988170C>T	ENST00000523629.1	-	10	1765	c.1311G>A	c.(1309-1311)gcG>gcA	p.A437A	RUNX1T1_ENST00000518844.1_Silent_p.A410A|RUNX1T1_ENST00000436581.2_Silent_p.A448A|RUNX1T1_ENST00000396218.1_Silent_p.A410A|RUNX1T1_ENST00000520724.1_Silent_p.A400A|RUNX1T1_ENST00000360348.2_Silent_p.A400A|RUNX1T1_ENST00000265814.3_Silent_p.A437A|GS1-5L10.1_ENST00000522980.1_RNA|RUNX1T1_ENST00000422361.2_Silent_p.A400A	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	437					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A400A(1)|p.A448A(1)|p.A437A(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			CGTATCCAGACGCAGGCCTGT	0.483																																					p.A437A												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G1311A	8						.						123.0	123.0	123.0					8																	92988170		2203	4300	6503	93057346	SO:0001819	synonymous_variant	862	exon11			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1311G>A	8.37:g.92988170C>T		Somatic		Capture	Illumina HiSeq	Phase_I	93057346	NM_001198626	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Silent	SNP	ENST00000523629.1	37	CCDS6256.1																																																																																				RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
MTERF3	51001	broad.mit.edu	37	8	97258092	97258092	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr8:97258092A>T	ENST00000287025.3	-	6	991	c.893T>A	c.(892-894)aTg>aAg	p.M298K	MTERFD1_ENST00000522822.1_Missense_Mutation_p.M177K|MTERFD1_ENST00000523821.1_Missense_Mutation_p.M298K|MTERFD1_ENST00000524341.1_Missense_Mutation_p.M108K	NM_015942.3	NP_057026.3	Q96E29	MTEF3_HUMAN		298					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)	transcription regulatory region DNA binding (GO:0044212)	p.M298K(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	24	Breast(36;5.16e-05)					TCCTACCTTCATATTTTCTTT	0.368																																					p.M298K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T893A	8						.						84.0	89.0	88.0					8																	97258092		2203	4300	6503	97327268	SO:0001583	missense	51001	exon6																														ENST00000287025.3:c.893T>A	8.37:g.97258092A>T	ENSP00000287025:p.Met298Lys	Somatic		Capture	Illumina HiSeq	Phase_I	97327268	NM_015942	B3KMG6|G3V130|Q9Y301	Missense_Mutation	SNP	ENST00000287025.3	37	CCDS6270.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.923300	0.92319	.	.	ENSG00000156469	ENST00000523821;ENST00000522822;ENST00000524341;ENST00000287025	T;T;T	0.46451	1.54;0.87;1.49	6.16	6.16	0.99307	.	0.048921	0.85682	D	0.000000	T	0.47135	0.1429	L	0.47716	1.5	0.53005	D	0.999964	P;P	0.49447	0.924;0.852	P;P	0.52309	0.695;0.566	T	0.27226	-1.0080	10	0.13470	T	0.59	-16.847	15.3771	0.74615	1.0:0.0:0.0:0.0	.	298;298	E5RIK9;Q96E29	.;MTER1_HUMAN	K	298;177;108;298	ENSP00000430138:M177K;ENSP00000429267:M108K;ENSP00000287025:M298K	ENSP00000287025:M298K	M	-	2	0	MTERFD1	97327268	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.816000	0.75247	2.367000	0.80283	0.528000	0.53228	ATG		MTERFD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379876.1		
LRP12	29967	broad.mit.edu	37	8	105510130	105510130	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr8:105510130T>G	ENST00000276654.5	-	5	758	c.650A>C	c.(649-651)tAc>tCc	p.Y217S	LRP12_ENST00000424843.2_Missense_Mutation_p.Y198S|LRP12_ENST00000518375.1_5'Flank	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	217	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)	p.Y217S(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GAACTGGTTGTAAGCACAGGG	0.423																																					p.Y217S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A650C	8						.						180.0	161.0	167.0					8																	105510130		2203	4300	6503	105579306	SO:0001583	missense	29967	exon5			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.650A>C	8.37:g.105510130T>G	ENSP00000276654:p.Tyr217Ser	Somatic		Capture	Illumina HiSeq	Phase_I	105579306	NM_013437	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	T	9.437	1.087129	0.20390	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	D;D	0.94862	-3.54;-3.54	5.66	5.66	0.87406	.	0.504438	0.22273	N	0.062229	T	0.78972	0.4368	N	0.00648	-1.295	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.75013	-0.3467	10	0.14656	T	0.56	-19.4254	7.0022	0.24815	0.1325:0.0715:0.0:0.796	.	198;217	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	S	198;217	ENSP00000399148:Y198S;ENSP00000276654:Y217S	ENSP00000276654:Y217S	Y	-	2	0	LRP12	105579306	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.634000	0.46528	2.153000	0.67306	0.460000	0.39030	TAC		LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437	
COL15A1	1306	broad.mit.edu	37	9	101785711	101785711	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr9:101785711G>A	ENST00000375001.3	+	14	2257	c.1834G>A	c.(1834-1836)Ggc>Agc	p.G612S		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	612	Nonhelical region 2 (NC2).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.G612S(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				TGACCTGGTGGGCAGTGAGCA	0.602																																					p.G612S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1834A	9						.						58.0	55.0	56.0					9																	101785711		2203	4300	6503	100825532	SO:0001583	missense	1306	exon14			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.1834G>A	9.37:g.101785711G>A	ENSP00000364140:p.Gly612Ser	Somatic		Capture	Illumina HiSeq	Phase_I	100825532	NM_001855	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	G	2.753	-0.259498	0.05791	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.89939	-2.59	3.46	0.42	0.16444	.	1.173110	0.06406	N	0.719717	T	0.81312	0.4796	L	0.34521	1.04	0.09310	N	0.999995	B	0.22276	0.067	B	0.15052	0.012	T	0.63791	-0.6557	10	0.27082	T	0.32	0.084	6.4253	0.21766	0.0:0.2937:0.5509:0.1554	.	612	P39059	COFA1_HUMAN	S	612;582	ENSP00000364140:G612S	ENSP00000364140:G612S	G	+	1	0	COL15A1	100825532	0.000000	0.05858	0.394000	0.26270	0.097000	0.18754	0.472000	0.22116	0.092000	0.17331	0.462000	0.41574	GGC		COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
BRINP1	1620	broad.mit.edu	37	9	121930009	121930009	+	Missense_Mutation	SNP	G	G	A	rs548234862		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr9:121930009G>A	ENST00000265922.3	-	8	2100	c.1639C>T	c.(1639-1641)Cgc>Tgc	p.R547C	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	547					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)		p.R547C(1)									TGGCAGATGCGCATGGACATG	0.567																																					p.R547C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1639T	9						.						69.0	59.0	63.0					9																	121930009		2203	4300	6503	120969830	SO:0001583	missense	1620	exon8			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1639C>T	9.37:g.121930009G>A	ENSP00000265922:p.Arg547Cys	Somatic		Capture	Illumina HiSeq	Phase_I	120969830	NM_014618	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	37	CCDS6822.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.424258	0.43020	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.16073	2.37	5.59	5.59	0.84812	.	0.051160	0.85682	D	0.000000	T	0.18923	0.0454	L	0.29908	0.895	0.80722	D	1	D	0.61697	0.99	P	0.44597	0.454	T	0.00931	-1.1510	10	0.87932	D	0	-21.1596	19.5908	0.95509	0.0:0.0:1.0:0.0	.	547	O60477	DBC1_HUMAN	C	547	ENSP00000265922:R547C	ENSP00000265922:R547C	R	-	1	0	DBC1	120969830	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.837000	0.62796	2.611000	0.88343	0.655000	0.94253	CGC		BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618	
LURAP1L	286343	broad.mit.edu	37	9	12775862	12775870	+	In_Frame_Del	DEL	GGCGGCGGC	GGCGGCGGC	-	rs534390977		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	GGCGGCGGC	GGCGGCGGC	GGCGGCGGC	-	GGCGGCGGC	GGCGGCGGC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr9:12775862_12775870delGGCGGCGGC	ENST00000319264.3	+	1	843_851	c.148_156delGGCGGCGGC	c.(148-156)ggcggcggcdel	p.GGG53del	LURAP1L_ENST00000489107.1_3'UTR|RP11-3L8.3_ENST00000417638.1_RNA	NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like	56	Gly-rich.							p.G49_G50insGGG(2)|p.G50_G52delGGG(1)									cggtggtggtggcggcggcggcggcggct	0.689																																					p.50_52del												.	.	3	Insertion - In frame(2)|Deletion - In frame(1)	large_intestine(1)|prostate(1)|central_nervous_system(1)	c.148_156del	9						.																																			12765870	SO:0001651	inframe_deletion	286343	exon1			AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557	ENST00000319264.3:c.148_156delGGCGGCGGC	9.37:g.12775871_12775879delGGCGGCGGC	ENSP00000321026:p.Gly53_Gly55del	Somatic		Capture	Illumina HiSeq	Phase_I	12765862	NM_203403	Q5VZX7|Q8N923|Q8NCG2	In_Frame_Del	DEL	ENST00000319264.3	37	CCDS6473.1																																																																																				LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051730.1	NM_203403	
CNTLN	54875	broad.mit.edu	37	9	17464498	17464498	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr9:17464498A>G	ENST00000380647.3	+	21	3492	c.3408A>G	c.(3406-3408)atA>atG	p.I1136M	CNTLN_ENST00000262360.5_Missense_Mutation_p.I1136M|CNTLN_ENST00000425824.1_Missense_Mutation_p.I1136M			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	1136					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.I1136M(1)		breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		TTTCAAGGATATCTCGAATGG	0.303																																					p.I1136M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3408G	9						.						84.0	86.0	85.0					9																	17464498		1808	4045	5853	17454498	SO:0001583	missense	54875	exon21			AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.3408A>G	9.37:g.17464498A>G	ENSP00000370021:p.Ile1136Met	Somatic		Capture	Illumina HiSeq	Phase_I	17454498	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	37	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	G	0.019	-1.458838	0.01062	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.18810	2.19;2.19;2.45	5.26	-0.9	0.10544	.	.	.	.	.	T	0.05227	0.0139	N	0.01576	-0.805	0.18873	N	0.999987	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.08055	0.003;0.003;0.003	T	0.37103	-0.9720	9	0.20046	T	0.44	.	0.3052	0.00279	0.2896:0.1522:0.1851:0.373	.	1136;1136;1136	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	M	1136	ENSP00000370021:I1136M;ENSP00000392798:I1136M;ENSP00000262360:I1136M	ENSP00000262360:I1136M	I	+	3	3	CNTLN	17454498	0.957000	0.32711	0.984000	0.44739	0.313000	0.28021	-0.076000	0.11412	-0.157000	0.11059	-0.927000	0.02713	ATA		CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
GNE	10020	broad.mit.edu	37	9	36249330	36249330	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr9:36249330C>T	ENST00000539815.1	-	1	63	c.23G>A	c.(22-24)cGa>cAa	p.R8Q	GNE_ENST00000539208.1_Intron|GNE_ENST00000396594.3_Missense_Mutation_p.R39Q|GNE_ENST00000543356.2_Intron|GNE_ENST00000377902.5_Missense_Mutation_p.R8Q|GNE_ENST00000447283.2_Missense_Mutation_p.R8Q			Q9Y223	GLCNE_HUMAN	glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase	8					carbohydrate phosphorylation (GO:0046835)|cell adhesion (GO:0007155)|N-acetylglucosamine biosynthetic process (GO:0006045)|N-acetylneuraminate metabolic process (GO:0006054)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|metal ion binding (GO:0046872)|N-acylmannosamine kinase activity (GO:0009384)|UDP-N-acetylglucosamine 2-epimerase activity (GO:0008761)	p.R8Q(1)		endometrium(8)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			STAD - Stomach adenocarcinoma(86;0.228)			CCGCAGCTTTCGGTTATTTCC	0.363																																					p.R39Q	GBM(184;106 2118 20004 35750 50727)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G116A	9						.						169.0	143.0	152.0					9																	36249330		2203	4300	6503	36239330	SO:0001583	missense	10020	exon2			AF051852	CCDS6602.1, CCDS47965.1, CCDS55308.1, CCDS55309.1, CCDS55310.1	9p13.1	2008-02-05	2003-12-01		ENSG00000159921	ENSG00000159921			23657	protein-coding gene	gene with protein product		603824	"""UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase"""	IBM2		9305887, 9305888	Standard	NM_005476		Approved	Uae1	uc010mli.3	Q9Y223	OTTHUMG00000019899	ENST00000539815.1:c.23G>A	9.37:g.36249330C>T	ENSP00000439155:p.Arg8Gln	Somatic		Capture	Illumina HiSeq	Phase_I	36239330	NM_001128227	A6PZH2|A6PZH3|A7UNU7|B2R6E1|B7Z372|B7Z428|D3DRP7|F5H499|H0YFA7|Q0VA94	Missense_Mutation	SNP	ENST00000539815.1	37	CCDS6602.1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.634883	0.67130	.	.	ENSG00000159921	ENST00000377902;ENST00000396594;ENST00000539815;ENST00000447283	D;D;D;D	0.99652	-6.29;-6.3;-6.29;-6.22	5.13	5.13	0.70059	.	0.172344	0.51477	D	0.000085	D	0.97892	0.9307	N	0.19112	0.55	0.52099	D	0.999947	B;B;B	0.25105	0.061;0.118;0.01	B;B;B	0.18561	0.011;0.022;0.002	D	0.96422	0.9312	10	0.52906	T	0.07	-8.5615	16.141	0.81522	0.0:1.0:0.0:0.0	.	39;8;8	Q9Y223-2;Q9Y223;A7UNU7	.;GLCNE_HUMAN;.	Q	8;39;8;8	ENSP00000367134:R8Q;ENSP00000379839:R39Q;ENSP00000439155:R8Q;ENSP00000414760:R8Q	ENSP00000367134:R8Q	R	-	2	0	GNE	36239330	0.975000	0.34042	0.922000	0.36590	0.990000	0.78478	2.101000	0.41787	2.684000	0.91462	0.561000	0.74099	CGA		GNE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052412.4	NM_005476	
SARDH	1757	broad.mit.edu	37	9	136573437	136573437	+	Missense_Mutation	SNP	C	C	T	rs35699831	byFrequency	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chr9:136573437C>T	ENST00000371872.4	-	11	1699	c.1442G>A	c.(1441-1443)cGc>cAc	p.R481H	SARDH_ENST00000422262.2_Missense_Mutation_p.R313H|SARDH_ENST00000439388.1_Missense_Mutation_p.R481H	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	481					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)	p.R481H(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CCTCATGTTGCGCCCGGCCAG	0.657													C|||	3	0.000599042	0.0	0.0014	5008	,	,		17372	0.0		0.002	False		,,,				2504	0.0				p.R481H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1442A	9						.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	85.0	80.0	81.0		1442,1442	5.2	1.0	9	dbSNP_126	81	11,8589	9.1+/-34.3	0,11,4289	yes	missense,missense	SARDH	NM_001134707.1,NM_007101.3	29,29	0,11,6492	TT,TC,CC		0.1279,0.0,0.0846	probably-damaging,probably-damaging	481/919,481/919	136573437	11,12995	2203	4300	6503	135563258	SO:0001583	missense	1757	exon11				CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.1442G>A	9.37:g.136573437C>T	ENSP00000360938:p.Arg481His	Somatic		Capture	Illumina HiSeq	Phase_I	135563258	NM_007101	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	ENST00000371872.4	37	CCDS6978.1	3	0.0013736263736263737	0	0.0	1	0.0027624309392265192	0	0.0	2	0.002638522427440633	C	32	5.165712	0.94768	0.0	0.001279	ENSG00000123453	ENST00000371872;ENST00000439388;ENST00000422262;ENST00000427237	D;D;D	0.86497	-2.13;-2.13;-2.13	5.16	5.16	0.70880	.	0.117883	0.64402	D	0.000015	D	0.94679	0.8284	M	0.88512	2.96	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95548	0.8618	10	0.87932	D	0	-39.698	18.6318	0.91363	0.0:1.0:0.0:0.0	rs35699831	481	Q9UL12	SARDH_HUMAN	H	481;481;313;481	ENSP00000360938:R481H;ENSP00000403084:R481H;ENSP00000415537:R313H	ENSP00000360938:R481H	R	-	2	0	SARDH	135563258	1.000000	0.71417	0.993000	0.49108	0.708000	0.40852	7.679000	0.84048	2.382000	0.81193	0.563000	0.77884	CGC		SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		
TIMM17B	10245	broad.mit.edu	37	X	48751486	48751487	+	Frame_Shift_Ins	INS	-	-	C	rs367759797		TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chrX:48751486_48751487insC	ENST00000376582.3	-	5	360_361	c.212_213insG	c.(211-213)ggcfs	p.G71fs	TIMM17B_ENST00000465150.2_Frame_Shift_Ins_p.G121fs|TIMM17B_ENST00000396779.3_Frame_Shift_Ins_p.G121fs|TIMM17B_ENST00000472645.1_5'UTR|TIMM17B_ENST00000495490.2_Frame_Shift_Ins_p.G91fs	NM_005834.3	NP_005825.1	O60830	TI17B_HUMAN	translocase of inner mitochondrial membrane 17 homolog B (yeast)	71					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane presequence translocase complex (GO:0005744)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)	6						TGGAGAACAGGCCCCCCCACAC	0.574																																					p.G71fs												.	.	0			c.213_214insG	X						.																																			48636431	SO:0001589	frameshift_variant	10245	exon5			AF034790	CCDS14308.1, CCDS55411.1	Xp11.23	2008-02-05			ENSG00000126768	ENSG00000126768			17310	protein-coding gene	gene with protein product		300249				10339406	Standard	NM_001167947		Approved	DXS9822, JM3	uc004dla.2	O60830	OTTHUMG00000034498	ENST00000376582.3:c.213dupG	X.37:g.48751493_48751493dupC	ENSP00000365766:p.Gly71fs	None		Capture	Illumina HiSeq	Phase_I	48636430	NM_005834	A8K2E2|J3KPV3|Q9UJV0	Frame_Shift_Ins	INS	ENST00000376582.3	37	CCDS14308.1																																																																																				TIMM17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083411.2	NM_005834	
MXRA5	25878	broad.mit.edu	37	X	3248773	3248773	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chrX:3248773C>G	ENST00000217939.6	-	3	384	c.230G>C	c.(229-231)gGa>gCa	p.G77A		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	77						extracellular vesicular exosome (GO:0070062)		p.G77A(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CTTGGTCAGTCCTGCAAATGA	0.388																																					p.G77A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G230C	X						.						108.0	91.0	97.0					X																	3248773		2203	4300	6503	3258773	SO:0001583	missense	25878	exon3			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.230G>C	X.37:g.3248773C>G	ENSP00000217939:p.Gly77Ala	Somatic		Capture	Illumina HiSeq	Phase_I	3258773	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	C	16.13	3.035978	0.54896	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.02606	4.23	3.68	2.8	0.32819	.	0.000000	0.36234	U	0.002706	T	0.11580	0.0282	M	0.63428	1.95	0.30503	N	0.770211	D	0.89917	1.0	D	0.85130	0.997	T	0.00759	-1.1578	10	0.87932	D	0	.	12.2654	0.54674	0.1715:0.8285:0.0:0.0	.	77	Q9NR99	MXRA5_HUMAN	A	77	ENSP00000217939:G77A	ENSP00000217939:G77A	G	-	2	0	MXRA5	3258773	0.984000	0.35163	0.027000	0.17364	0.898000	0.52572	3.556000	0.53734	0.537000	0.28751	0.417000	0.27973	GGA		MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
CHRDL1	91851	broad.mit.edu	37	X	110002961	110002961	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3664-01A-01W-0900-09	TCGA-AA-3664-10A-01W-0900-09	g.chrX:110002961G>A	ENST00000372045.1	-	4	342	c.211C>T	c.(211-213)Cga>Tga	p.R71*	CHRDL1_ENST00000218054.4_Nonsense_Mutation_p.R77*|CHRDL1_ENST00000482160.1_Nonsense_Mutation_p.R77*|CHRDL1_ENST00000394797.4_Nonsense_Mutation_p.R77*|CHRDL1_ENST00000444321.2_Nonsense_Mutation_p.R77*|CHRDL1_ENST00000372042.1_Nonsense_Mutation_p.R77*|CHRDL1_ENST00000434224.1_Nonsense_Mutation_p.R77*			Q9BU40	CRDL1_HUMAN	chordin-like 1	71	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|compound eye development (GO:0048749)|eye development (GO:0001654)|negative regulation of BMP signaling pathway (GO:0030514)|nervous system development (GO:0007399)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.R77*(1)		endometrium(1)|large_intestine(12)|liver(1)|lung(15)|prostate(1)|skin(1)	31						CATCTGACTCGGCTGCAAAGC	0.438																																					p.R77X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C229T	X						.						156.0	134.0	141.0					X																	110002961		2203	4300	6503	109889617	SO:0001587	stop_gained	91851	exon4			AL049176	CCDS14553.1, CCDS48148.1, CCDS48149.1, CCDS48150.1, CCDS48148.2	Xq23	2014-01-31			ENSG00000101938	ENSG00000101938			29861	protein-coding gene	gene with protein product		300350	"""megalocornea 1 (X-linked)"""	MGC1		11441185, 11118896, 22284829	Standard	NM_001143981		Approved	NRLN1, CHL	uc004eow.3	Q9BU40	OTTHUMG00000022199	ENST00000372045.1:c.211C>T	X.37:g.110002961G>A	ENSP00000361115:p.Arg71*	Somatic		Capture	Illumina HiSeq	Phase_I	109889617	NM_001143981	B1AKD0|B4DMP3|D3DUY6|E9PGS5|Q539E4|Q9Y3H7	Nonsense_Mutation	SNP	ENST00000372045.1	37		.	.	.	.	.	.	.	.	.	.	G	35	5.441083	0.96187	.	.	ENSG00000101938	ENST00000372045;ENST00000434224;ENST00000218054;ENST00000394797;ENST00000372042;ENST00000482160;ENST00000444321	.	.	.	5.45	1.51	0.23008	.	0.059052	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.5114	15.1509	0.72696	0.0:0.0:0.2908:0.7092	.	.	.	.	X	71;77;77;77;77;77;77	.	.	R	-	1	2	CHRDL1	109889617	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	0.834000	0.27518	0.017000	0.15025	-0.222000	0.12452	CGA		CHRDL1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057912.1	NM_145234	
