#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PTEN	5728	broad.mit.edu	37	10	89692889	89692889	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr10:89692889delA	ENST00000371953.3	+	5	1730	c.373delA	c.(373-375)aaafs	p.K125fs		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	125	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(5)|p.R55fs*1(5)|p.Y27fs*1(2)|p.K125E(2)|p.A121_F145del(1)|p.A126fs*8(1)|p.K125*(1)|p.F56fs*2(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AATTCACTGTAAAGCTGGAAA	0.408		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.K125fs		yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	PTEN,central_nervous_system,brain,Substitution - Missense,+2 	.	55	Whole gene deletion(37)|Deletion - Frameshift(9)|Unknown(5)|Substitution - Missense(2)|Deletion - In frame(1)|Substitution - Nonsense(1)	prostate(16)|central_nervous_system(11)|skin(6)|lung(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(3)|breast(3)|ovary(3)|endometrium(2)|soft_tissue(1)|urinary_tract(1)	c.373delA	10						.						138.0	127.0	131.0					10																	89692889		2203	4300	6503	89682869	SO:0001589	frameshift_variant	5728	exon5	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.373delA	10.37:g.89692889delA	ENSP00000361021:p.Lys125fs	Somatic		Capture	Illumina HiSeq	Phase_I	89682869	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	ENST00000371953.3	37	CCDS31238.1																																																																																				PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
GRK5	2869	broad.mit.edu	37	10	121212783	121212783	+	Missense_Mutation	SNP	C	C	T	rs556570876		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr10:121212783C>T	ENST00000392870.2	+	15	1998	c.1669C>T	c.(1669-1671)Cgg>Tgg	p.R557W	GRK5_ENST00000369108.3_Missense_Mutation_p.R452W	NM_005308.2	NP_005299.1	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5	557	Sufficient for membrane localization.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|phospholipid binding (GO:0005543)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)	p.R557W(1)		endometrium(2)|large_intestine(5)|lung(15)|skin(3)|stomach(1)|urinary_tract(1)	27		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		ACTCTTCAAGCGGCAGGTGAG	0.587													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16923	0.0		0.0	False		,,,				2504	0.0				p.R557W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1669T	10						.						68.0	71.0	70.0					10																	121212783		2203	4300	6503	121202773	SO:0001583	missense	2869	exon15			L15388	CCDS7612.1	10q26.11	2013-09-19	2004-02-04	2004-02-06	ENSG00000198873	ENSG00000198873			4544	protein-coding gene	gene with protein product		600870		GPRK5		7685906	Standard	NM_005308		Approved		uc001led.3	P34947	OTTHUMG00000019149	ENST00000392870.2:c.1669C>T	10.37:g.121212783C>T	ENSP00000376609:p.Arg557Trp	Somatic		Capture	Illumina HiSeq	Phase_I	121202773	NM_005308	D3DRD0|Q5T059	Missense_Mutation	SNP	ENST00000392870.2	37	CCDS7612.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.116696	0.77323	.	.	ENSG00000198873	ENST00000392870;ENST00000457057;ENST00000369108	T;T	0.71934	-0.59;-0.61	4.67	4.67	0.58626	.	0.000000	0.64402	D	0.000019	D	0.85423	0.5693	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.99	D	0.88264	0.2925	10	0.87932	D	0	-7.5405	17.5825	0.87972	0.0:1.0:0.0:0.0	.	557;557	B2R7K0;P34947	.;GRK5_HUMAN	W	557;300;452	ENSP00000376609:R557W;ENSP00000358104:R452W	ENSP00000358104:R452W	R	+	1	2	GRK5	121202773	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	6.182000	0.71995	2.162000	0.67917	0.655000	0.94253	CGG		GRK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050652.2	NM_005308	
DYNC2H1	79659	broad.mit.edu	37	11	103091470	103091470	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr11:103091470G>A	ENST00000375735.2	+	57	9209	c.9065G>A	c.(9064-9066)aGg>aAg	p.R3022K	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.R3022K	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3022	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R455K(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GGAGTTTTAAGGTTGATGGGT	0.358																																					p.R3022K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G9065A	11						.						84.0	80.0	81.0					11																	103091470		1859	4107	5966	102596680	SO:0001583	missense	79659	exon57			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.9065G>A	11.37:g.103091470G>A	ENSP00000364887:p.Arg3022Lys	Somatic		Capture	Illumina HiSeq	Phase_I	102596680	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.949691	0.92660	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.74002	-0.8;-0.8	6.17	6.17	0.99709	Dynein heavy chain, coiled coil stalk (1);	0.081632	0.64402	D	0.000002	D	0.82481	0.5046	M	0.63843	1.955	0.80722	D	1	P;P	0.51240	0.943;0.86	P;P	0.53722	0.733;0.535	T	0.82390	-0.0481	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	3022;3022	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	K	3022	ENSP00000364887:R3022K;ENSP00000381167:R3022K	ENSP00000364887:R3022K	R	+	2	0	DYNC2H1	102596680	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.021000	0.88750	2.941000	0.99782	0.655000	0.94253	AGG		DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
KIAA1549L	25758	broad.mit.edu	37	11	33573746	33573746	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr11:33573746G>T	ENST00000321505.4	+	5	3103	c.2923G>T	c.(2923-2925)Gag>Tag	p.E975*	KIAA1549L_ENST00000265654.5_Nonsense_Mutation_p.E981*|KIAA1549L_ENST00000389726.3_Nonsense_Mutation_p.E981*			Q6ZVL6	K154L_HUMAN	KIAA1549-like	975						integral component of membrane (GO:0016021)		p.E975*(1)|p.E981*(1)									CCAGGATGCCGAGAGGAAAGT	0.493																																					p.E975X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G2923T	11						.						69.0	67.0	68.0					11																	33573746		1937	4141	6078	33530322	SO:0001587	stop_gained	25758	exon5			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.2923G>T	11.37:g.33573746G>T	ENSP00000315295:p.Glu975*	Somatic		Capture	Illumina HiSeq	Phase_I	33530322	NM_012194	B0QYU0	Nonsense_Mutation	SNP	ENST00000321505.4	37	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	G	42	9.794241	0.99266	.	.	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568	.	.	.	6.02	5.11	0.69529	.	0.154450	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-21.0112	15.8515	0.78934	0.0:0.1346:0.8654:0.0	.	.	.	.	X	975;981;981;814	.	ENSP00000265654:E981X	E	+	1	0	C11orf41	33530322	1.000000	0.71417	0.773000	0.31616	0.622000	0.37654	5.612000	0.67681	1.558000	0.49541	0.655000	0.94253	GAG		KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
DPP3	10072	broad.mit.edu	37	11	66262911	66262911	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr11:66262911C>T	ENST00000360510.2	+	14	1593	c.1528C>T	c.(1528-1530)Cgg>Tgg	p.R510W	DPP3_ENST00000531863.1_Missense_Mutation_p.R530W|DPP3_ENST00000541961.1_Missense_Mutation_p.R510W|DPP3_ENST00000530165.1_Missense_Mutation_p.R480W|DPP3_ENST00000453114.1_Missense_Mutation_p.R510W|DPP3_ENST00000532677.1_Missense_Mutation_p.R529W			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	510					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R510W(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						CGAAGAGTGCCGGGCTGAGAG	0.637																																					p.R510W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1528T	11						.						33.0	29.0	30.0					11																	66262911		2200	4293	6493	66019487	SO:0001583	missense	10072	exon14			AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.1528C>T	11.37:g.66262911C>T	ENSP00000353701:p.Arg510Trp	Somatic		Capture	Illumina HiSeq	Phase_I	66019487	NM_005700	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Missense_Mutation	SNP	ENST00000360510.2	37	CCDS8141.1	.	.	.	.	.	.	.	.	.	.	C	36	5.653490	0.96724	.	.	ENSG00000254986	ENST00000531863;ENST00000532677;ENST00000360510;ENST00000453114;ENST00000541961;ENST00000530165;ENST00000543807	T;T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;1.21;1.21	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.71986	0.3405	H	0.94345	3.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79378	-0.1828	10	0.87932	D	0	.	17.9074	0.88923	0.0:1.0:0.0:0.0	.	529;510	G3V1D3;Q9NY33	.;DPP3_HUMAN	W	530;529;510;510;510;480;408	ENSP00000432782:R530W;ENSP00000435284:R529W;ENSP00000353701:R510W;ENSP00000389943:R510W;ENSP00000440502:R510W;ENSP00000436941:R480W	ENSP00000353701:R510W	R	+	1	2	DPP3	66019487	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.023000	0.49666	2.835000	0.97688	0.591000	0.81541	CGG		DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393424.2		
USP28	57646	broad.mit.edu	37	11	113670047	113670047	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr11:113670047C>T	ENST00000003302.4	-	25	3217	c.3149G>A	c.(3148-3150)cGa>cAa	p.R1050Q	USP28_ENST00000260188.5_Missense_Mutation_p.R1018Q|USP28_ENST00000545540.1_Missense_Mutation_p.R893Q|USP28_ENST00000544967.1_Missense_Mutation_p.R726Q	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	1050					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.R1050Q(1)		breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		AGAATTGGGTCGAATTGTTGG	0.468																																					p.R1050Q	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3149A	11						.						119.0	120.0	120.0					11																	113670047		2201	4296	6497	113175257	SO:0001583	missense	57646	exon25			AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.3149G>A	11.37:g.113670047C>T	ENSP00000003302:p.Arg1050Gln	Somatic		Capture	Illumina HiSeq	Phase_I	113175257	NM_020886	B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	ENST00000003302.4	37	CCDS31680.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.117159	0.77323	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540	T;T;T;T	0.45276	1.47;1.48;0.9;1.48	5.71	4.79	0.61399	.	0.059016	0.64402	D	0.000005	T	0.55893	0.1949	L	0.53249	1.67	0.41272	D	0.986859	D;D;D	0.89917	0.999;0.999;1.0	P;P;D	0.65573	0.865;0.848;0.936	T	0.47699	-0.9097	10	0.26408	T	0.33	-11.2308	15.102	0.72288	0.0:0.9312:0.0:0.0688	.	893;1050;726	B4E3L3;Q96RU2;G3V1N5	.;UBP28_HUMAN;.	Q	1050;1018;726;893	ENSP00000003302:R1050Q;ENSP00000260188:R1018Q;ENSP00000442431:R726Q;ENSP00000444991:R893Q	ENSP00000003302:R1050Q	R	-	2	0	USP28	113175257	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	4.091000	0.57700	2.709000	0.92574	0.655000	0.94253	CGA		USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1		
VWF	7450	broad.mit.edu	37	12	6127535	6127535	+	Silent	SNP	T	T	G	rs200368994		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr12:6127535T>G	ENST00000261405.5	-	28	5303	c.5049A>C	c.(5047-5049)gcA>gcC	p.A1683A		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1683					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.A1683A(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GCATACCAGGTGCAGGGGAGA	0.627																																					p.A1683A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A5049C	12						.						13.0	14.0	13.0					12																	6127535		2198	4297	6495	5997796	SO:0001819	synonymous_variant	7450	exon28				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.5049A>C	12.37:g.6127535T>G		Somatic		Capture	Illumina HiSeq	Phase_I	5997796	NM_000552	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	37	CCDS8539.1																																																																																				VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
CLEC4D	338339	broad.mit.edu	37	12	8667841	8667841	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr12:8667841G>A	ENST00000299665.2	+	2	231	c.38G>A	c.(37-39)gGc>gAc	p.G13D		NM_080387.4	NP_525126.2	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D	13					innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.G13D(1)		large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Lung SC(5;0.184)					GTGGAAGGAGGCATGCATCCC	0.403																																					p.G13D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G38A	12						.						224.0	190.0	201.0					12																	8667841		2203	4300	6503	8559108	SO:0001583	missense	338339	exon2			AF411850	CCDS8593.1	12p13.31	2005-09-21	2005-02-09	2005-02-11		ENSG00000166527		"""C-type lectin domain containing"""	14554	protein-coding gene	gene with protein product		609964	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 8"""	CLECSF8			Standard	NM_080387		Approved	Mpcl	uc001qun.3	Q8WXI8		ENST00000299665.2:c.38G>A	12.37:g.8667841G>A	ENSP00000299665:p.Gly13Asp	Somatic		Capture	Illumina HiSeq	Phase_I	8559108	NM_080387	Q8N5J5	Missense_Mutation	SNP	ENST00000299665.2	37	CCDS8593.1	.	.	.	.	.	.	.	.	.	.	G	0.821	-0.748739	0.03065	.	.	ENSG00000166527	ENST00000382064;ENST00000299665	T;T	0.05025	3.51;3.75	3.39	-5.91	0.02269	.	.	.	.	.	T	0.05731	0.0150	M	0.64404	1.975	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39014	-0.9634	9	0.34782	T	0.22	.	2.7763	0.05348	0.5645:0.1394:0.164:0.1322	.	13	Q8WXI8	CLC4D_HUMAN	D	13	ENSP00000371496:G13D;ENSP00000299665:G13D	ENSP00000299665:G13D	G	+	2	0	CLEC4D	8559108	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.471000	0.06631	-1.507000	0.01803	0.549000	0.68633	GGC		CLEC4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400565.1	NM_080387	
SLC4A8	9498	broad.mit.edu	37	12	51853816	51853816	+	Missense_Mutation	SNP	C	C	T	rs578147476		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr12:51853816C>T	ENST00000453097.2	+	8	1154	c.937C>T	c.(937-939)Cgt>Tgt	p.R313C	SLC4A8_ENST00000535225.2_Missense_Mutation_p.R260C|SLC4A8_ENST00000514353.3_Missense_Mutation_p.R260C|SLC4A8_ENST00000358657.3_Missense_Mutation_p.R340C|SLC4A8_ENST00000394856.1_Missense_Mutation_p.R260C	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8									p.R260C(1)|p.R313C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		TATTTTGGACCGTCCCATTGT	0.463													C|||	1	0.000199681	0.0	0.0	5008	,	,		16001	0.001		0.0	False		,,,				2504	0.0				p.R313C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C937T	12						.						229.0	226.0	227.0					12																	51853816		2203	4300	6503	50140083	SO:0001583	missense	9498	exon8			AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.937C>T	12.37:g.51853816C>T	ENSP00000405812:p.Arg313Cys	Somatic		Capture	Illumina HiSeq	Phase_I	50140083	NM_001039960		Missense_Mutation	SNP	ENST00000453097.2	37	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	C	19.27	3.796078	0.70567	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000547697;ENST00000551071	T;T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44;-0.44	5.63	4.72	0.59763	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.136335	0.64402	D	0.000005	T	0.81269	0.4787	M	0.82923	2.615	0.58432	D	0.999998	D;B;D;D;D;D;D	0.89917	0.998;0.397;0.999;0.967;0.983;0.992;1.0	P;B;P;D;P;D;D	0.67900	0.817;0.056;0.88;0.927;0.88;0.954;0.921	D	0.84199	0.0449	10	0.87932	D	0	.	12.8204	0.57690	0.297:0.703:0.0:0.0	.	260;340;260;313;313;313;260	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6;F8VSA8	.;.;.;S4A8_HUMAN;.;.;.	C	260;340;313;260;313;260;260;260	ENSP00000441520:R260C;ENSP00000351483:R340C;ENSP00000405812:R313C;ENSP00000378325:R260C;ENSP00000442561:R260C	ENSP00000315789:R313C	R	+	1	0	SLC4A8	50140083	0.001000	0.12720	1.000000	0.80357	0.997000	0.91878	0.730000	0.26043	1.478000	0.48253	0.655000	0.94253	CGT		SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858	
PCDH17	27253	broad.mit.edu	37	13	58207403	58207403	+	Silent	SNP	G	G	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr13:58207403G>A	ENST00000377918.3	+	1	749	c.723G>A	c.(721-723)ccG>ccA	p.P241P		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	241	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P241P(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		ACAACAGCCCGGTCTTCGAGG	0.607																																					p.P241P	Melanoma(72;952 1291 1619 12849 33676)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G723A	13						.						72.0	61.0	64.0					13																	58207403		2203	4300	6503	57105404	SO:0001819	synonymous_variant	27253	exon1			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.723G>A	13.37:g.58207403G>A		Somatic		Capture	Illumina HiSeq	Phase_I	57105404	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	ENST00000377918.3	37	CCDS31986.1																																																																																				PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
SNAPC1	6617	broad.mit.edu	37	14	62233659	62233660	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr14:62233659_62233660insT	ENST00000216294.4	+	2	298_299	c.194_195insT	c.(193-198)tattttfs	p.YF65fs	RP11-618G20.1_ENST00000555937.1_RNA	NM_003082.3	NP_003073.1	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex, polypeptide 1, 43kDa	65	SNAPC3-binding.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		GCTTGGCGATATTTTTTACCTC	0.337																																					p.Y65fs	NSCLC(27;223 907 37180 39193 46568)											.	.	0			c.194_195insT	14						.			1,4263		0,1,2131						4.9	1.0			119	1,8251		0,1,4125	no	frameshift	SNAPC1	NM_003082.3		0,2,6256	A1A1,A1R,RR		0.0121,0.0235,0.016				2,12514				61303413	SO:0001589	frameshift_variant	6617	exon2			Z47542	CCDS9755.1	14q22	2008-08-11	2002-08-29		ENSG00000023608	ENSG00000023608			11134	protein-coding gene	gene with protein product		600591	"""small nuclear RNA activating complex, polypeptide 1, 43kD"""			9644240	Standard	NM_003082		Approved	SNAP43, PTFgamma	uc001xft.3	Q16533	OTTHUMG00000140343	ENST00000216294.4:c.200dupT	14.37:g.62233665_62233665dupT	ENSP00000216294:p.Tyr65fs	None		Capture	Illumina HiSeq	Phase_I	61303412	NM_003082		Frame_Shift_Ins	INS	ENST00000216294.4	37	CCDS9755.1																																																																																				SNAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276976.2	NM_003082	
LTBP2	4053	broad.mit.edu	37	14	74995228	74995228	+	Missense_Mutation	SNP	C	C	T	rs145507464		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr14:74995228C>T	ENST00000261978.4	-	12	2712	c.2326G>A	c.(2326-2328)Gtc>Atc	p.V776I	LTBP2_ENST00000556690.1_Missense_Mutation_p.V776I	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	776					protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.V776I(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GTGTCCGTGACGACCCGGAGG	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		15457	0.0		0.001	False		,,,				2504	0.0				p.V776I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2326A	14						.	C	ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	37.0	41.0	40.0		2326	2.2	0.1	14	dbSNP_134	40	12,8588	9.1+/-34.3	0,12,4288	yes	missense	LTBP2	NM_000428.2	29	0,14,6489	TT,TC,CC		0.1395,0.0454,0.1076	benign	776/1822	74995228	14,12992	2203	4300	6503	74064981	SO:0001583	missense	4053	exon12				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.2326G>A	14.37:g.74995228C>T	ENSP00000261978:p.Val776Ile	Somatic		Capture	Illumina HiSeq	Phase_I	74064981	NM_000428	Q99907|Q9NS51	Missense_Mutation	SNP	ENST00000261978.4	37	CCDS9831.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	0.786	-0.760580	0.02996	4.54E-4	0.001395	ENSG00000119681	ENST00000261978;ENST00000556690;ENST00000556359	T;T	0.78595	-1.18;-1.19	4.97	2.18	0.27775	.	0.774326	0.10908	N	0.620853	T	0.59528	0.2200	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.34502	-0.9826	10	0.11794	T	0.64	.	11.1892	0.48675	0.0:0.8314:0.0:0.1686	.	776	Q14767	LTBP2_HUMAN	I	776;776;36	ENSP00000261978:V776I;ENSP00000451477:V776I	ENSP00000261978:V776I	V	-	1	0	LTBP2	74064981	0.017000	0.18338	0.100000	0.21137	0.002000	0.02628	0.750000	0.26334	0.377000	0.24735	-0.940000	0.02684	GTC		LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
YLPM1	56252	broad.mit.edu	37	14	75279409	75279409	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr14:75279409G>T	ENST00000552421.1	+	10	3432	c.3308G>T	c.(3307-3309)cGa>cTa	p.R1103L	YLPM1_ENST00000325680.7_Missense_Mutation_p.R1809L|YLPM1_ENST00000238571.3_Missense_Mutation_p.R1614L			P49750	YLPM1_HUMAN	YLP motif containing 1	1614	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.R1809L(1)|p.R1614L(1)		breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CCAGCTCCACGAGTCGAGAAG	0.522																																					p.R1809L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G5426T	14						.						37.0	40.0	39.0					14																	75279409		1990	4184	6174	74349162	SO:0001583	missense	56252	exon11			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.3308G>T	14.37:g.75279409G>T	ENSP00000447921:p.Arg1103Leu	Somatic		Capture	Illumina HiSeq	Phase_I	74349162	NM_019589	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000552421.1	37		.	.	.	.	.	.	.	.	.	.	G	31	5.070769	0.93950	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000238571;ENST00000423680;ENST00000547879	.	.	.	5.89	5.89	0.94794	.	0.000000	0.56097	D	0.000026	T	0.61640	0.2363	L	0.29908	0.895	0.48511	D	0.999669	P;D	0.63046	0.695;0.992	P;P	0.54965	0.586;0.765	T	0.61845	-0.6979	9	0.52906	T	0.07	-7.6733	18.447	0.90688	0.0:0.0:1.0:0.0	.	1614;1809	P49750-3;P49750-4	.;.	L	1103;1809;1614;1522;218	.	ENSP00000238571:R1614L	R	+	2	0	YLPM1	74349162	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.512000	0.73737	2.796000	0.96246	0.650000	0.86243	CGA		YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	NM_019589	
APBA2	321	broad.mit.edu	37	15	29346257	29346257	+	Missense_Mutation	SNP	C	C	T	rs141358568	byFrequency	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr15:29346257C>T	ENST00000558402.1	+	5	769	c.170C>T	c.(169-171)gCg>gTg	p.A57V	APBA2_ENST00000561069.1_Missense_Mutation_p.A57V|APBA2_ENST00000558259.1_Missense_Mutation_p.A57V|APBA2_ENST00000411764.1_Missense_Mutation_p.A57V|APBA2_ENST00000558330.1_Missense_Mutation_p.A57V			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	57					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)	p.A57V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		GAGAGCCCCGCGCCAGAGGAA	0.657													C|||	4	0.000798722	0.0	0.0043	5008	,	,		17859	0.0		0.001	False		,,,				2504	0.0				p.A57V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C170T	15						.	C	VAL/ALA,VAL/ALA	3,4403	6.2+/-15.9	0,3,2200	56.0	67.0	64.0		170,170	1.7	0.0	15	dbSNP_134	64	6,8594	5.0+/-18.6	0,6,4294	yes	missense,missense	APBA2	NM_001130414.1,NM_005503.3	64,64	0,9,6494	TT,TC,CC		0.0698,0.0681,0.0692	benign,benign	57/738,57/750	29346257	9,12997	2203	4300	6503	27133549	SO:0001583	missense	321	exon3			AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.170C>T	15.37:g.29346257C>T	ENSP00000453293:p.Ala57Val	Somatic		Capture	Illumina HiSeq	Phase_I	27133549	NM_005503	E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	ENST00000558402.1	37	CCDS10022.1	3	0.0013736263736263737	0	0.0	3	0.008287292817679558	0	0.0	0	0.0	C	6.412	0.444058	0.12164	6.81E-4	6.98E-4	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.40756	1.02	4.83	1.71	0.24356	.	1.249360	0.05773	N	0.607052	T	0.16557	0.0398	N	0.03115	-0.41	0.09310	N	0.999998	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.20605	-1.0270	10	0.41790	T	0.15	.	9.1865	0.37174	0.0:0.7636:0.0:0.2364	.	57;57;57	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	V	57	ENSP00000409312:A57V	ENSP00000219865:A57V	A	+	2	0	APBA2	27133549	0.000000	0.05858	0.006000	0.13384	0.337000	0.28794	-0.285000	0.08410	0.360000	0.24265	0.650000	0.86243	GCG		APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503	
RMDN3	55177	broad.mit.edu	37	15	41036338	41036338	+	Missense_Mutation	SNP	G	G	A	rs201035155		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr15:41036338G>A	ENST00000260385.6	-	5	1884	c.817C>T	c.(817-819)Cgg>Tgg	p.R273W	RMDN3_ENST00000338376.3_Missense_Mutation_p.R273W|RMDN3_ENST00000558560.1_Intron			Q96TC7	RMD3_HUMAN	regulator of microtubule dynamics 3	273					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)	integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.R273W(1)									AAGTCCTGCCGGCTTCCATAC	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		18578	0.0		0.001	False		,,,				2504	0.0				p.R273W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C817T	15						.						65.0	62.0	63.0					15																	41036338		2203	4300	6503	38823630	SO:0001583	missense	55177	exon6			AK001441	CCDS10063.1	15q15.1	2013-01-11	2013-01-11	2013-01-11	ENSG00000137824	ENSG00000137824			25550	protein-coding gene	gene with protein product		611873	"""family with sequence similarity 82, member A2"""	FAM82C, FAM82A2		12975309	Standard	XM_005254531		Approved	FLJ10579, PTPIP51, RMD3	uc001zmp.1	Q96TC7	OTTHUMG00000130066	ENST00000260385.6:c.817C>T	15.37:g.41036338G>A	ENSP00000260385:p.Arg273Trp	Somatic		Capture	Illumina HiSeq	Phase_I	38823630	NM_018145	A9UMZ9|B3KRR3|Q6ZWE9|Q96H23|Q96SD6|Q9H6G1|Q9NVQ6	Missense_Mutation	SNP	ENST00000260385.6	37	CCDS10063.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	23.4	4.407662	0.83340	.	.	ENSG00000137824	ENST00000260385;ENST00000338376;ENST00000426872	T;T	0.44083	0.93;0.93	6.17	6.17	0.99709	.	0.269164	0.42682	D	0.000678	T	0.49184	0.1542	L	0.54323	1.7	0.35214	D	0.775432	D	0.65815	0.995	P	0.49047	0.599	T	0.61422	-0.7066	10	0.72032	D	0.01	-3.5864	16.0287	0.80560	0.0:0.0:0.8651:0.1349	.	273	Q96TC7	RMD3_HUMAN	W	273;273;210	ENSP00000260385:R273W;ENSP00000342493:R273W	ENSP00000260385:R273W	R	-	1	2	FAM82A2	38823630	0.395000	0.25254	0.984000	0.44739	0.971000	0.66376	2.996000	0.49449	2.941000	0.99782	0.655000	0.94253	CGG		RMDN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252357.1	NM_018145	
INO80	54617	broad.mit.edu	37	15	41337221	41337221	+	Missense_Mutation	SNP	G	G	A	rs572481309		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr15:41337221G>A	ENST00000361937.3	-	24	3212	c.2788C>T	c.(2788-2790)Cgc>Tgc	p.R930C	INO80_ENST00000401393.3_Missense_Mutation_p.R930C			Q9ULG1	INO80_HUMAN	INO80 complex subunit	930	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.R930C(2)		NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CCCCAGGAGCGTAGCTGATGG	0.502																																					p.R930C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2788T	15						.						82.0	86.0	84.0					15																	41337221		2203	4300	6503	39124513	SO:0001583	missense	54617	exon24			AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.2788C>T	15.37:g.41337221G>A	ENSP00000355205:p.Arg930Cys	Somatic		Capture	Illumina HiSeq	Phase_I	39124513	NM_017553	A6H8X4|Q9NTG6	Missense_Mutation	SNP	ENST00000361937.3	37	CCDS10071.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.614200	0.87359	.	.	ENSG00000128908	ENST00000361937;ENST00000401393	D;D	0.91521	-2.86;-2.86	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.94069	0.8099	L	0.53249	1.67	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.94330	0.7561	10	0.72032	D	0.01	.	18.7309	0.91735	0.0:0.0:1.0:0.0	.	930	Q9ULG1	INO80_HUMAN	C	930	ENSP00000355205:R930C;ENSP00000384686:R930C	ENSP00000355205:R930C	R	-	1	0	INO80	39124513	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	7.241000	0.78201	2.744000	0.94065	0.561000	0.74099	CGC		INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2	NM_017553	
IL21R	50615	broad.mit.edu	37	16	27460466	27460466	+	Silent	SNP	C	C	A	rs147514663		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr16:27460466C>A	ENST00000337929.3	+	9	1952	c.1479C>A	c.(1477-1479)ggC>ggA	p.G493G	IL21R_ENST00000395755.1_Silent_p.G493G|IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000564089.1_Silent_p.G493G|IL21R_ENST00000395754.4_Silent_p.G493G	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	493					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)	p.G493G(1)		breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						TTGACAGTGGCTTTGTGGGCT	0.667			T	BCL6	NHL																																p.G515G			Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1545A	16						.						49.0	43.0	45.0					16																	27460466		2197	4299	6496	27367967	SO:0001819	synonymous_variant	50615	exon10			AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.1479C>A	16.37:g.27460466C>A		Somatic		Capture	Illumina HiSeq	Phase_I	27367967	NM_181079	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Silent	SNP	ENST00000337929.3	37	CCDS10630.1																																																																																				IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
RLTPR	146206	broad.mit.edu	37	16	67685868	67685868	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr16:67685868T>A	ENST00000334583.6	+	26	2961	c.2633T>A	c.(2632-2634)gTg>gAg	p.V878E	RLTPR_ENST00000545661.1_Missense_Mutation_p.V842E	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	878					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)		p.V878E(1)		breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		GAGAGCATTGTGGCTCAGGCT	0.592																																					p.V878E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2633A	16						.						132.0	139.0	137.0					16																	67685868		2148	4248	6396	66243369	SO:0001583	missense	146206	exon26			AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.2633T>A	16.37:g.67685868T>A	ENSP00000334958:p.Val878Glu	Somatic		Capture	Illumina HiSeq	Phase_I	66243369	NM_001013838	B8X2Z3	Missense_Mutation	SNP	ENST00000334583.6	37	CCDS45513.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.275612	0.80580	.	.	ENSG00000159753	ENST00000334583;ENST00000545661	T;T	0.23552	1.91;1.9	4.85	4.85	0.62838	.	0.163302	0.29940	N	0.010815	T	0.45296	0.1335	M	0.68952	2.095	0.40375	D	0.979382	D;D	0.76494	0.999;0.999	D;D	0.66196	0.942;0.942	T	0.48222	-0.9054	10	0.87932	D	0	-12.5648	10.7515	0.46211	0.0:0.0:0.0:1.0	.	842;878	B8X2Z3;Q6F5E8	.;LR16C_HUMAN	E	878;842	ENSP00000334958:V878E;ENSP00000441481:V842E	ENSP00000334958:V878E	V	+	2	0	RLTPR	66243369	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.156000	0.64905	2.028000	0.59812	0.533000	0.62120	GTG		RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1	NM_001013838	
TUBG2	27175	broad.mit.edu	37	17	40814997	40814997	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr17:40814997G>A	ENST00000251412.7	+	5	605	c.406G>A	c.(406-408)Gtg>Atg	p.V136M		NM_016437.2	NP_057521.1	Q9NRH3	TBG2_HUMAN	tubulin, gamma 2	136					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|pericentriolar material (GO:0000242)|spindle microtubule (GO:0005876)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)	p.V136M(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.141)		ACAGGGCTTCGTGCTGTGTCA	0.542																																					p.V136M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G406A	17						.						123.0	107.0	112.0					17																	40814997		2203	4300	6503	38068523	SO:0001583	missense	27175	exon5			AF225971	CCDS32658.1	17q21.2	2014-09-04			ENSG00000037042	ENSG00000037042		"""Tubulins"""	12419	protein-coding gene	gene with protein product		605785					Standard	NM_016437		Approved		uc010wgr.2	Q9NRH3	OTTHUMG00000180640	ENST00000251412.7:c.406G>A	17.37:g.40814997G>A	ENSP00000251412:p.Val136Met	Somatic		Capture	Illumina HiSeq	Phase_I	38068523	NM_016437	A6NDI4|Q32NB2	De_novo_Start_OutOfFrame	SNP	ENST00000251412.7	37	CCDS32658.1	.	.	.	.	.	.	.	.	.	.	G	14.10	2.433858	0.43224	.	.	ENSG00000037042	ENST00000251412	T	0.70399	-0.48	4.85	3.87	0.44632	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.85682	D	0.000000	T	0.52885	0.1762	N	0.13140	0.3	0.80722	D	1	D	0.57899	0.981	B	0.43360	0.417	T	0.49399	-0.8944	10	0.18276	T	0.48	-27.0994	13.2331	0.59955	0.078:0.0:0.922:0.0	.	136	Q9NRH3	TBG2_HUMAN	M	136	ENSP00000251412:V136M	ENSP00000251412:V136M	V	+	1	0	TUBG2	38068523	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	7.306000	0.78905	1.175000	0.42826	0.655000	0.94253	GTG		TUBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452326.1	NM_016437	
CALCOCO2	10241	broad.mit.edu	37	17	46919094	46919094	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr17:46919094C>T	ENST00000258947.3	+	2	126	c.25C>T	c.(25-27)Ccc>Tcc	p.P9S	CALCOCO2_ENST00000509507.1_Missense_Mutation_p.P9S|CALCOCO2_ENST00000416445.2_Missense_Mutation_p.P9S|CALCOCO2_ENST00000448105.2_Missense_Mutation_p.P9S|CALCOCO2_ENST00000508679.1_Intron	NM_001261390.1|NM_001261391.1|NM_001261393.1|NM_001261395.1|NM_005831.4	NP_001248319.1|NP_001248320.1|NP_001248322.1|NP_001248324.1|NP_005822.1	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2	9					response to interferon-gamma (GO:0034341)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)	p.P9S(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	15						CAAAGATCCCCCCACATCAGC	0.468																																					p.P9S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C25T	17						.						115.0	97.0	103.0					17																	46919094		2203	4300	6503	44274093	SO:0001583	missense	10241	exon2			BC004130	CCDS11538.1, CCDS58558.1, CCDS58559.1, CCDS58560.1, CCDS58561.1	17q21.32	2006-02-09				ENSG00000136436			29912	protein-coding gene	gene with protein product		604587				7540613	Standard	NM_001261390		Approved	MGC17318, NDP52	uc010wlr.3	Q13137		ENST00000258947.3:c.25C>T	17.37:g.46919094C>T	ENSP00000258947:p.Pro9Ser	Somatic		Capture	Illumina HiSeq	Phase_I	44274093	NM_005831	B2RBT0|B4DDC4|B4DDT4|B4DP36|B4E0C0|E7ENK0|E7ETP5|E9PBE5|Q53FQ5|Q53HB5|Q6IBN9|Q9BTF7	Missense_Mutation	SNP	ENST00000258947.3	37	CCDS11538.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.826955	0.71143	.	.	ENSG00000136436	ENST00000258947;ENST00000509507;ENST00000448105;ENST00000509415;ENST00000416445;ENST00000505071;ENST00000502761	T;T;T;T;T;T;T	0.56611	1.85;1.9;1.97;1.06;2.21;0.45;1.13	5.99	3.96	0.45880	.	0.099308	0.45126	N	0.000388	T	0.67933	0.2946	M	0.76574	2.34	0.80722	D	1	D;D;D;D	0.71674	0.998;0.997;0.997;0.996	P;D;D;P	0.64687	0.885;0.928;0.928;0.874	T	0.68667	-0.5348	10	0.51188	T	0.08	-3.99	11.4344	0.50060	0.0:0.8046:0.127:0.0685	.	9;9;9;9	E7ETP5;B4DP36;E9PBE5;Q13137	.;.;.;CACO2_HUMAN	S	9	ENSP00000258947:P9S;ENSP00000424352:P9S;ENSP00000398523:P9S;ENSP00000425692:P9S;ENSP00000406974:P9S;ENSP00000422697:P9S;ENSP00000424889:P9S	ENSP00000258947:P9S	P	+	1	0	CALCOCO2	44274093	0.955000	0.32602	0.816000	0.32577	0.814000	0.46013	1.994000	0.40757	0.830000	0.34757	0.591000	0.81541	CCC		CALCOCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360866.1	NM_005831	
SMAD4	4089	broad.mit.edu	37	18	48591919	48591919	+	Missense_Mutation	SNP	G	G	A	rs377767347		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr18:48591919G>A	ENST00000342988.3	+	9	1620	c.1082G>A	c.(1081-1083)cGc>cAc	p.R361H	SMAD4_ENST00000588745.1_Missense_Mutation_p.R265H|SMAD4_ENST00000398417.2_Missense_Mutation_p.R361H	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	361	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		R -> C (in JPS; dbSNP:rs80338963). {ECO:0000269|PubMed:9811934}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.R361H(12)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GGAGGAGATCGCTTTTGTTTG	0.413																																					p.R361H												SMAD4,small_intestine,duodenum,Substitution - Missense,+1 	.	50	Whole gene deletion(36)|Substitution - Missense(12)|Unknown(2)	pancreas(26)|large_intestine(13)|lung(3)|breast(3)|upper_aerodigestive_tract(2)|stomach(2)|oesophagus(1)	c.G1082A	18	GRCh37	CM004254	SMAD4	M		.						167.0	138.0	148.0					18																	48591919		2203	4300	6503	46845917	SO:0001583	missense	4089	exon9			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1082G>A	18.37:g.48591919G>A	ENSP00000341551:p.Arg361His	Somatic		Capture	Illumina HiSeq	Phase_I	46845917	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	G	35	5.477304	0.96291	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98120	-4.73;-4.73	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98852	0.9612	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99741	1.1015	10	0.87932	D	0	.	18.9646	0.92691	0.0:0.0:1.0:0.0	.	361	Q13485	SMAD4_HUMAN	H	361	ENSP00000341551:R361H;ENSP00000381452:R361H	ENSP00000341551:R361H	R	+	2	0	SMAD4	46845917	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.828000	0.86729	2.771000	0.95319	0.563000	0.77884	CGC		SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
RAVER1	125950	broad.mit.edu	37	19	10433827	10433828	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr19:10433827_10433828insC	ENST00000293677.6	-	5	1203_1204	c.1122_1123insG	c.(1120-1125)gggaagfs	p.K375fs	CTD-2369P2.12_ENST00000586529.1_5'Flank	NM_133452.2	NP_597709.2	Q8IY67	RAVR1_HUMAN	ribonucleoprotein, PTB-binding 1	358	Interaction with PTBP1. {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	18			OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)			TTACCCTGCTTCCCCCCCGCAC	0.668																																					p.K375fs												.	.	0			c.1123_1124insG	19						.																																			10294828	SO:0001589	frameshift_variant	125950	exon5				CCDS45960.1	19p13.2	2013-02-12				ENSG00000161847		"""RNA binding motif (RRM) containing"""	30296	protein-coding gene	gene with protein product		609950				11853319, 11724819	Standard	NM_133452		Approved	KIAA1978	uc002moa.3	Q8IY67		ENST00000293677.6:c.1123dupG	19.37:g.10433834_10433834dupC	ENSP00000293677:p.Lys375fs	None		Capture	Illumina HiSeq	Phase_I	10294827	NM_133452	A6NMU4|Q8IY60|Q8TF24	Frame_Shift_Ins	INS	ENST00000293677.6	37	CCDS45960.1																																																																																				RAVER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451227.1	NM_133452	
ARHGAP33	115703	broad.mit.edu	37	19	36279197	36279198	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr19:36279197_36279198insG	ENST00000007510.4	+	21	3874_3875	c.3730_3731insG	c.(3730-3732)aggfs	p.R1244fs	AC002398.5_ENST00000433059.1_lincRNA|ARHGAP33_ENST00000378944.5_Frame_Shift_Ins_p.R1080fs|ARHGAP33_ENST00000314737.5_Frame_Shift_Ins_p.R1083fs			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	1244					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						AGCCTACGGAAGGGGGGGCGAG	0.698																																					p.R1083fs												.	.	0			c.3247_3248insG	19						.																																			40971038	SO:0001589	frameshift_variant	115703	exon21			AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.3737dupG	19.37:g.36279204_36279204dupG	ENSP00000007510:p.Arg1244fs	None		Capture	Illumina HiSeq	Phase_I	40971037	NM_052948	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Frame_Shift_Ins	INS	ENST00000007510.4	37																																																																																					ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
LSM4	25804	broad.mit.edu	37	19	18423465	18423465	+	Silent	SNP	G	G	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr19:18423465G>A	ENST00000593829.1	-	3	346	c.93C>T	c.(91-93)agC>agT	p.S31S	LSM4_ENST00000252816.6_Silent_p.S17S	NM_001252129.1|NM_012321.4	NP_001239058.1|NP_036453.1	Q9Y4Z0	LSM4_HUMAN	LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)	31					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U6 snRNP (GO:0005688)	poly(A) RNA binding (GO:0044822)	p.S31S(1)		endometrium(1)|large_intestine(2)|lung(3)	6						AGTTGTCGCAGCTCACCAGGT	0.582																																					p.S31S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C93T	19						.						312.0	255.0	274.0					19																	18423465		2203	4300	6503	18284465	SO:0001819	synonymous_variant	25804	exon3			AF117235	CCDS12374.1, CCDS62601.1	19p13.1	2008-02-05				ENSG00000130520			17259	protein-coding gene	gene with protein product		607284				10369684, 10523320	Standard	NM_012321		Approved	YER112W	uc002niq.3	Q9Y4Z0		ENST00000593829.1:c.93C>T	19.37:g.18423465G>A		Somatic		Capture	Illumina HiSeq	Phase_I	18284465	NM_012321		Silent	SNP	ENST00000593829.1	37	CCDS12374.1																																																																																				LSM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466321.1		
PSG8	440533	broad.mit.edu	37	19	43258539	43258539	+	Missense_Mutation	SNP	G	G	A	rs375725440	byFrequency	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr19:43258539G>A	ENST00000306511.4	-	5	1286	c.1189C>T	c.(1189-1191)Cgt>Tgt	p.R397C	PSG8_ENST00000404209.4_Missense_Mutation_p.R397C|PSG8_ENST00000600709.1_5'UTR|PSG8_ENST00000401467.2_Missense_Mutation_p.R304C|PSG8_ENST00000406636.3_Missense_Mutation_p.R275C	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	397	Ig-like C2-type 3.					extracellular region (GO:0005576)		p.R397C(2)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GCTGAGTTACGAACAGAGCAA	0.448													.|||	3	0.000599042	0.0	0.0	5008	,	,		18576	0.0		0.0	False		,,,				2504	0.0031				p.R275C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C823T	19						.	G	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	184.0	199.0	194.0		1189,823,1189	0.2	0.0	19		194	1,8593		0,1,4296	no	missense,missense,missense	PSG8	NM_001130167.1,NM_001130168.1,NM_182707.2	180,180,180	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	397/420,275/298,397/427	43258539	1,12999	2203	4297	6500	47950379	SO:0001583	missense	440533	exon4			M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.1189C>T	19.37:g.43258539G>A	ENSP00000305005:p.Arg397Cys	Somatic		Capture	Illumina HiSeq	Phase_I	47950379	NM_001130168	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	ENST00000306511.4	37	CCDS33037.1	.	.	.	.	.	.	.	.	.	.	N	10.14	1.268799	0.23136	0.0	1.16E-4	ENSG00000124467	ENST00000404209;ENST00000292109;ENST00000406636;ENST00000401467;ENST00000426252;ENST00000407488;ENST00000306511	T;T;T;T	0.13778	2.56;2.56;2.56;2.56	1.28	0.152	0.14893	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.36799	0.0980	M	0.91920	3.255	0.09310	N	1	D;D;D;D;D;D	0.89917	0.997;0.997;1.0;0.999;0.998;0.998	P;P;D;D;D;D	0.74023	0.888;0.849;0.982;0.956;0.919;0.952	T	0.12604	-1.0541	9	0.72032	D	0.01	.	3.1043	0.06336	0.3257:0.0:0.6743:0.0	.	275;304;397;304;397;397	Q9UQ74-2;B5MCQ0;Q9UQ74;E7ENH0;Q9UQ74-3;A5PKV3	.;.;PSG8_HUMAN;.;.;.	C	397;179;275;304;209;304;397	ENSP00000385869:R397C;ENSP00000385081:R275C;ENSP00000386090:R304C;ENSP00000305005:R397C	ENSP00000292109:R179C	R	-	1	0	PSG8	47950379	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-0.287000	0.08388	0.663000	0.31027	0.298000	0.19748	CGT		PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1		
ZNF235	9310	broad.mit.edu	37	19	44791658	44791658	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr19:44791658C>T	ENST00000291182.4	-	5	2032	c.1930G>A	c.(1930-1932)Gtc>Atc	p.V644I	ZNF235_ENST00000589248.1_Intron|ZNF235_ENST00000589799.1_Intron	NM_004234.4	NP_004225.3	Q14590	ZN235_HUMAN	zinc finger protein 235	644					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V644I(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29		Prostate(69;0.0352)|all_neural(266;0.116)				ATCTGATGGACTTGAAGATTT	0.473																																					p.V644I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1930A	19						.						116.0	110.0	112.0					19																	44791658		2203	4300	6503	49483498	SO:0001583	missense	9310	exon5			X78929	CCDS33048.1	19q13.2	2013-01-08	2002-11-04	2002-11-08	ENSG00000159917	ENSG00000159917		"""Zinc fingers, C2H2-type"", ""-"""	12866	protein-coding gene	gene with protein product		604749	"""zinc finger protein homologous to Zfp93 in mouse"""	ZNF270, ZFP93		7865130, 9570955	Standard	NM_004234		Approved	HZF6, ANF270	uc002oza.4	Q14590		ENST00000291182.4:c.1930G>A	19.37:g.44791658C>T	ENSP00000291182:p.Val644Ile	Somatic		Capture	Illumina HiSeq	Phase_I	49483498	NM_004234	B4DTQ7|O14898|O14899|Q17RR8	Missense_Mutation	SNP	ENST00000291182.4	37	CCDS33048.1	.	.	.	.	.	.	.	.	.	.	C	1.595	-0.528095	0.04112	.	.	ENSG00000159917	ENST00000391957;ENST00000291182;ENST00000359844	T	0.07567	3.18	4.88	2.63	0.31362	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37304	N	0.002153	T	0.05227	0.0139	N	0.24115	0.695	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.14023	0.004;0.01	T	0.29912	-0.9996	10	0.35671	T	0.21	-16.6898	6.9507	0.24544	0.0:0.5484:0.3497:0.1019	.	640;644	Q14590-2;Q14590	.;ZN235_HUMAN	I	644;644;536	ENSP00000291182:V644I	ENSP00000291182:V644I	V	-	1	0	ZNF235	49483498	0.000000	0.05858	1.000000	0.80357	0.972000	0.66771	-0.998000	0.03701	2.426000	0.82243	0.313000	0.20887	GTC		ZNF235-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460732.1		
WDR3	10885	broad.mit.edu	37	1	118479486	118479486	+	Missense_Mutation	SNP	G	G	A	rs139865932		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr1:118479486G>A	ENST00000349139.5	+	4	523	c.476G>A	c.(475-477)cGa>cAa	p.R159Q	WDR3_ENST00000471680.1_3'UTR|WDR3_ENST00000369441.3_3'UTR	NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	159						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R159Q(1)		breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		TTGTTTCTACGAGAAAAGAAC	0.368																																					p.R159Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G476A	1						.	G	GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	102.0	96.0	98.0		476	4.6	1.0	1	dbSNP_134	98	1,8597	1.2+/-3.3	0,1,4298	no	missense	WDR3	NM_006784.2	43	0,3,6499	AA,AG,GG		0.0116,0.0454,0.0231	possibly-damaging	159/944	118479486	3,13001	2203	4299	6502	118281009	SO:0001583	missense	10885	exon4			AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.476G>A	1.37:g.118479486G>A	ENSP00000308179:p.Arg159Gln	Somatic		Capture	Illumina HiSeq	Phase_I	118281009	NM_006784		Missense_Mutation	SNP	ENST00000349139.5	37	CCDS898.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.074514	0.36566	4.54E-4	1.16E-4	ENSG00000065183	ENST00000349139	T	0.58506	0.33	5.49	4.58	0.56647	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.277638	0.38326	N	0.001739	T	0.24470	0.0593	L	0.35487	1.065	0.54753	D	0.999982	P	0.45715	0.865	B	0.38156	0.266	T	0.06499	-1.0823	10	0.27082	T	0.32	-8.8866	7.3632	0.26758	0.1073:0.0:0.7282:0.1645	.	159	Q9UNX4	WDR3_HUMAN	Q	159	ENSP00000308179:R159Q	ENSP00000308179:R159Q	R	+	2	0	WDR3	118281009	0.993000	0.37304	0.982000	0.44146	0.987000	0.75469	2.685000	0.46959	1.328000	0.45358	0.650000	0.86243	CGA		WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033720.2	NM_006784	
PIP5K1A	8394	broad.mit.edu	37	1	151171540	151171540	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr1:151171540C>G	ENST00000368888.4	+	1	490	c.68C>G	c.(67-69)tCc>tGc	p.S23C	PIP5K1A_ENST00000368890.4_Missense_Mutation_p.S23C|PIP5K1A_ENST00000409426.1_Missense_Mutation_p.S23C|PIP5K1A_ENST00000441902.2_Missense_Mutation_p.S23C	NM_001135638.1	NP_001129110.1	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, alpha	23					actin cytoskeleton reorganization (GO:0031532)|activation of Rac GTPase activity (GO:0032863)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|fibroblast migration (GO:0010761)|focal adhesion assembly (GO:0048041)|glycerophospholipid metabolic process (GO:0006650)|keratinocyte differentiation (GO:0030216)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|protein targeting to plasma membrane (GO:0072661)|ruffle assembly (GO:0097178)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|kinase binding (GO:0019900)	p.S23F(1)|p.S23C(1)		breast(1)|central_nervous_system(1)|ovary(1)|skin(1)|stomach(1)	5	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			GCGGTCCCTTCCTGTACCTTG	0.627																																					p.S23C	Pancreas(80;36 1443 2325 16095 21302)											.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C68G	1						.						89.0	95.0	93.0					1																	151171540		2203	4300	6503	149438164	SO:0001583	missense	8394	exon1			U78575	CCDS990.1, CCDS44219.1, CCDS44220.1, CCDS44221.1	1q21.3	2010-04-08			ENSG00000143398	ENSG00000143398			8994	protein-coding gene	gene with protein product		603275				8955136, 10828584	Standard	NM_003557		Approved		uc001exj.3	Q99755	OTTHUMG00000012351	ENST00000368888.4:c.68C>G	1.37:g.151171540C>G	ENSP00000357883:p.Ser23Cys	Somatic		Capture	Illumina HiSeq	Phase_I	149438164	NM_001135636	A8K4Q0|B4DIN0|Q99754|Q99756	Missense_Mutation	SNP	ENST00000368888.4	37	CCDS44219.1	.	.	.	.	.	.	.	.	.	.	C	9.888	1.203378	0.22121	.	.	ENSG00000143398	ENST00000349792;ENST00000409426;ENST00000441902;ENST00000368890;ENST00000424999;ENST00000368888	T;T;T;T;T	0.33654	1.61;1.63;1.4;1.4;1.66	4.46	2.42	0.29668	.	1.555910	0.03354	N	0.196657	T	0.18676	0.0448	N	0.22421	0.69	0.18873	N	0.999986	P;B;B;B	0.36315	0.547;0.115;0.07;0.115	B;B;B;B	0.43331	0.416;0.16;0.077;0.16	T	0.43048	-0.9415	10	0.59425	D	0.04	.	10.6923	0.45877	0.0:0.6264:0.3736:0.0	.	23;23;23;23	Q99755-4;Q99755-2;Q99755;Q99755-3	.;.;PI51A_HUMAN;.	C	23	ENSP00000271663:S23C;ENSP00000386432:S23C;ENSP00000415648:S23C;ENSP00000357885:S23C;ENSP00000357883:S23C	ENSP00000271663:S23C	S	+	2	0	PIP5K1A	149438164	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	0.290000	0.18975	1.069000	0.40788	0.462000	0.41574	TCC		PIP5K1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034425.2	NM_003557	
CREB3L4	148327	broad.mit.edu	37	1	153941846	153941846	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr1:153941846G>A	ENST00000368607.3	+	4	724	c.458G>A	c.(457-459)tGc>tAc	p.C153Y	CREB3L4_ENST00000368603.1_Missense_Mutation_p.C153Y|CREB3L4_ENST00000405694.3_Missense_Mutation_p.C6Y|CREB3L4_ENST00000368600.3_Missense_Mutation_p.C133Y|CREB3L4_ENST00000271889.4_Missense_Mutation_p.C153Y|SLC39A1_ENST00000310483.6_5'Flank|RP11-422P24.10_ENST00000608147.1_RNA|CREB3L4_ENST00000368601.1_Missense_Mutation_p.C153Y	NM_001255978.1|NM_001255980.1|NM_130898.3	NP_001242907.1|NP_001242909.1|NP_570968.1	Q8TEY5	CR3L4_HUMAN	cAMP responsive element binding protein 3-like 4	153					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.C153Y(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(3)	13	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCTGATTCCTGCATGGTCAGT	0.572																																					p.C153Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G458A	1						.						133.0	119.0	124.0					1																	153941846		2203	4300	6503	152208470	SO:0001583	missense	148327	exon4			AF394167	CCDS1056.1, CCDS58029.1	1q21.2	2013-01-10			ENSG00000143578	ENSG00000143578		"""basic leucine zipper proteins"""	18854	protein-coding gene	gene with protein product		607138					Standard	NM_130898		Approved	AIbZIP, CREB4, CREB3, hJAL, ATCE1	uc001fdr.3	Q8TEY5	OTTHUMG00000037159	ENST00000368607.3:c.458G>A	1.37:g.153941846G>A	ENSP00000357596:p.Cys153Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	152208470	NM_130898	D3DV62|Q5T4L0|Q86YW6	Missense_Mutation	SNP	ENST00000368607.3	37	CCDS1056.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.831080	0.50845	.	.	ENSG00000143578	ENST00000405694;ENST00000449724;ENST00000368607;ENST00000271889;ENST00000368601;ENST00000368603;ENST00000368600;ENST00000431292	D;T;T;T;T;T;T;T	0.81499	-1.5;-0.12;-0.18;-0.18;0.81;-0.18;-0.17;0.24	4.64	4.64	0.57946	.	0.298887	0.36932	N	0.002328	T	0.67487	0.2898	M	0.74881	2.28	0.46774	D	0.999193	B;B	0.30455	0.132;0.28	B;B	0.33568	0.118;0.166	T	0.66524	-0.5902	10	0.07990	T	0.79	.	12.8699	0.57958	0.0:0.0:1.0:0.0	.	133;153	Q5T4L0;Q8TEY5	.;CR3L4_HUMAN	Y	6;133;153;153;153;153;133;153	ENSP00000385104:C6Y;ENSP00000391847:C133Y;ENSP00000357596:C153Y;ENSP00000271889:C153Y;ENSP00000357590:C153Y;ENSP00000357592:C153Y;ENSP00000357589:C133Y;ENSP00000402308:C153Y	ENSP00000271889:C153Y	C	+	2	0	CREB3L4	152208470	1.000000	0.71417	0.751000	0.31187	0.918000	0.54935	3.121000	0.50438	2.410000	0.81850	0.561000	0.74099	TGC		CREB3L4-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090291.1	NM_130898	
PAPPA2	60676	broad.mit.edu	37	1	176564116	176564116	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr1:176564116G>T	ENST00000367662.3	+	3	2540	c.1376G>T	c.(1375-1377)aGc>aTc	p.S459I	PAPPA2_ENST00000367661.3_Missense_Mutation_p.S459I	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	459	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.S459I(2)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CTGACAGCGAGCTTTGAGCCT	0.537																																					p.S459I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1376T	1						.						94.0	100.0	98.0					1																	176564116		2095	4218	6313	174830739	SO:0001583	missense	60676	exon3			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1376G>T	1.37:g.176564116G>T	ENSP00000356634:p.Ser459Ile	Somatic		Capture	Illumina HiSeq	Phase_I	174830739	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	4.954	0.177230	0.09443	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.33438	4.65;1.41	5.08	-5.97	0.02227	.	0.927736	0.09242	N	0.829091	T	0.19287	0.0463	L	0.55481	1.735	0.09310	N	1	P;B	0.36495	0.556;0.346	B;B	0.31869	0.137;0.095	T	0.16571	-1.0398	10	0.52906	T	0.07	-0.3748	2.789	0.05383	0.3218:0.3248:0.2618:0.0916	.	459;459	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	I	459	ENSP00000356634:S459I;ENSP00000356633:S459I	ENSP00000356633:S459I	S	+	2	0	PAPPA2	174830739	0.000000	0.05858	0.005000	0.12908	0.006000	0.05464	-0.493000	0.06459	-0.760000	0.04677	-0.182000	0.12963	AGC		PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
CR1	1378	broad.mit.edu	37	1	207758216	207758216	+	Missense_Mutation	SNP	G	G	A	rs200621891		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr1:207758216G>A	ENST00000367049.4	+	33	5525	c.5525G>A	c.(5524-5526)cGt>cAt	p.R1842H	CR1_ENST00000367051.1_Missense_Mutation_p.R1392H|RP11-78B10.2_ENST00000596003.1_RNA|RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000400960.2_Missense_Mutation_p.R1392H|CR1_ENST00000367053.1_Missense_Mutation_p.R1392H|CR1_ENST00000367052.1_Missense_Mutation_p.R1392H	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1392	Sushi 28. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.R1397H(3)|p.R1842H(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CTTTCTGTTCGTGCTGGTCAG	0.488																																					p.R1842H												.	.	5	Substitution - Missense(5)	lung(2)|kidney(2)|large_intestine(1)	c.G5525A	1						.	A	HIS/ARG,HIS/ARG	0,3914		0,0,1957	107.0	107.0	107.0		4175,5525	-4.0	0.0	1		107	1,8299		0,1,4149	no	missense,missense	CR1	NM_000573.3,NM_000651.4	29,29	0,1,6106	AA,AG,GG		0.012,0.0,0.0082	benign,benign	1392/2040,1842/2490	207758216	1,12213	1957	4150	6107	205824839	SO:0001583	missense	1378	exon33			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.5525G>A	1.37:g.207758216G>A	ENSP00000356016:p.Arg1842His	Somatic		Capture	Illumina HiSeq	Phase_I	205824839	NM_000651	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	g	2.643	-0.283651	0.05642	0.0	1.2E-4	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049	T;T;T;T;T;T	0.33654	1.4;1.52;1.4;1.4;1.54;1.4	3.03	-3.96	0.04106	.	.	.	.	.	T	0.28300	0.0699	N	0.19112	0.55	0.09310	N	1	D;D;B	0.76494	0.999;0.996;0.013	D;P;B	0.66602	0.945;0.504;0.003	T	0.14090	-1.0485	9	0.15066	T	0.55	.	0.1311	0.00074	0.2976:0.2403:0.1519:0.3102	.	1392;1392;1842	Q5SR44;P17927;E9PDY4	.;CR1_HUMAN;.	H	1392;1392;1392;1392;942;1842	ENSP00000356019:R1392H;ENSP00000356018:R1392H;ENSP00000356020:R1392H;ENSP00000383744:R1392H;ENSP00000436139:R942H;ENSP00000356016:R1842H	ENSP00000356016:R1842H	R	+	2	0	CR1	205824839	0.000000	0.05858	0.000000	0.03702	0.318000	0.28184	-0.184000	0.09698	-1.009000	0.03400	-1.770000	0.00663	CGT		CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
ACTN2	88	broad.mit.edu	37	1	236924412	236924412	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr1:236924412C>T	ENST00000366578.4	+	20	2631	c.2465C>T	c.(2464-2466)aCg>aTg	p.T822M	ACTN2_ENST00000542672.1_Missense_Mutation_p.T822M|ACTN2_ENST00000546208.1_Missense_Mutation_p.T316M	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	822	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.T822M(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			ACTAGAGAGACGGCTGACACC	0.542																																					p.T822M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2465T	1						.						123.0	107.0	113.0					1																	236924412		2203	4300	6503	234991035	SO:0001583	missense	88	exon20			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.2465C>T	1.37:g.236924412C>T	ENSP00000355537:p.Thr822Met	Somatic		Capture	Illumina HiSeq	Phase_I	234991035	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.446914	0.63178	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000546208;ENST00000545611	T;T;T	0.63255	-0.03;-0.03;-0.03	6.03	6.03	0.97812	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.83285	0.5221	M	0.87547	2.89	0.80722	D	1	D;P;D;D	0.89917	1.0;0.696;1.0;1.0	D;B;D;D	0.91635	0.999;0.226;0.999;0.996	D	0.84009	0.0347	10	0.59425	D	0.04	.	20.5666	0.99351	0.0:1.0:0.0:0.0	.	607;822;592;822	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	M	822;822;316;591	ENSP00000443495:T822M;ENSP00000355537:T822M;ENSP00000438384:T316M	ENSP00000355537:T822M	T	+	2	0	ACTN2	234991035	1.000000	0.71417	0.969000	0.41365	0.334000	0.28698	7.792000	0.85828	2.854000	0.98071	0.655000	0.94253	ACG		ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
C1orf94	84970	broad.mit.edu	37	1	34666597	34666597	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr1:34666597C>T	ENST00000488417.1	+	3	1354	c.1234C>T	c.(1234-1236)Cga>Tga	p.R412*	C1orf94_ENST00000373374.3_Nonsense_Mutation_p.R222*	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	412								p.R222*(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				GCCGAGACTTCGAAACAAAGT	0.577																																					p.R222X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C664T	1						.						35.0	34.0	34.0					1																	34666597		2202	4300	6502	34439184	SO:0001587	stop_gained	84970	exon3			AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.1234C>T	1.37:g.34666597C>T	ENSP00000435634:p.Arg412*	Somatic		Capture	Illumina HiSeq	Phase_I	34439184	NM_032884	B3KVT1|D3DPR3|E9PJ76|Q96IC8	Nonsense_Mutation	SNP	ENST00000488417.1	37	CCDS44108.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.889663	0.91889	.	.	ENSG00000142698	ENST00000373374;ENST00000488417	.	.	.	5.52	4.61	0.57282	.	0.000000	0.53938	D	0.000052	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.6044	10.1682	0.42893	0.0:0.9075:0.0:0.0925	.	.	.	.	X	222;412	.	ENSP00000362472:R222X	R	+	1	2	C1orf94	34439184	0.996000	0.38824	0.999000	0.59377	0.054000	0.15201	1.069000	0.30641	1.324000	0.45282	0.655000	0.94253	CGA		C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036845.2	NM_032884	
DNTTIP2	30836	broad.mit.edu	37	1	94342971	94342971	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr1:94342971G>C	ENST00000436063.2	-	2	577	c.520C>G	c.(520-522)Cca>Gca	p.P174A	DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	174					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.P174A(1)		NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		TCTTGGCTTGGATCTGTCAGA	0.403																																					p.P174A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C520G	1						.						147.0	140.0	142.0					1																	94342971		1851	4103	5954	94115559	SO:0001583	missense	30836	exon2			AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.520C>G	1.37:g.94342971G>C	ENSP00000411010:p.Pro174Ala	Somatic		Capture	Illumina HiSeq	Phase_I	94115559	NM_014597	Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	De_novo_Start_OutOfFrame	SNP	ENST00000436063.2	37	CCDS44174.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.380126	0.24944	.	.	ENSG00000067334	ENST00000436063	T	0.16457	2.34	5.27	2.28	0.28536	.	0.758800	0.12136	N	0.496317	T	0.05914	0.0154	M	0.65975	2.015	0.09310	N	1	B	0.18461	0.028	B	0.13407	0.009	T	0.32745	-0.9895	10	0.32370	T	0.25	.	3.5128	0.07714	0.1521:0.1318:0.5803:0.1359	.	174	Q5QJE6	TDIF2_HUMAN	A	174	ENSP00000411010:P174A	ENSP00000352137:P174A	P	-	1	0	DNTTIP2	94115559	0.001000	0.12720	0.349000	0.25694	0.836000	0.47400	0.026000	0.13599	0.764000	0.33197	0.650000	0.86243	CCA		DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028317.2	NM_014597	
OR2M2	391194	broad.mit.edu	37	1	248343450	248343450	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr1:248343450C>A	ENST00000359682.2	+	1	163	c.163C>A	c.(163-165)Ctc>Atc	p.L55I		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	55						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L55I(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GGACACCCAGCTCCACACCCC	0.542																																					p.L55I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C163A	1						.						310.0	296.0	301.0					1																	248343450		2203	4298	6501	246410073	SO:0001583	missense	391194	exon1			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.163C>A	1.37:g.248343450C>A	ENSP00000352710:p.Leu55Ile	Somatic		Capture	Illumina HiSeq	Phase_I	246410073	NM_001004688	A3KFT4	Missense_Mutation	SNP	ENST00000359682.2	37	CCDS31106.1	.	.	.	.	.	.	.	.	.	.	c	14.78	2.637505	0.47049	.	.	ENSG00000198601	ENST00000359682	T	0.13778	2.56	2.03	1.07	0.20283	GPCR, rhodopsin-like superfamily (1);	0.000000	0.28360	U	0.015630	T	0.46268	0.1384	H	0.97023	3.925	0.22066	N	0.999385	D	0.89917	1.0	D	0.91635	0.999	T	0.41161	-0.9524	10	0.87932	D	0	.	8.9445	0.35751	0.0:0.8757:0.0:0.1243	.	55	Q96R28	OR2M2_HUMAN	I	55	ENSP00000352710:L55I	ENSP00000352710:L55I	L	+	1	0	OR2M2	246410073	0.757000	0.28394	0.001000	0.08648	0.005000	0.04900	1.571000	0.36450	0.175000	0.19841	-0.717000	0.03617	CTC		OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688	
PTPRT	11122	broad.mit.edu	37	20	41100983	41100983	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr20:41100983A>G	ENST00000373187.1	-	8	1372	c.1373T>C	c.(1372-1374)aTc>aCc	p.I458T	PTPRT_ENST00000373198.4_Missense_Mutation_p.I458T|PTPRT_ENST00000373201.1_Missense_Mutation_p.I458T|PTPRT_ENST00000373190.1_Missense_Mutation_p.I458T|PTPRT_ENST00000373184.1_Missense_Mutation_p.I458T|PTPRT_ENST00000373193.3_Missense_Mutation_p.I458T|PTPRT_ENST00000356100.2_Missense_Mutation_p.I458T			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	458	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.I458T(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TCGCAGCCGGATGGTCATGAA	0.607																																					p.I458T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1373C	20						.						57.0	63.0	61.0					20																	41100983		2146	4245	6391	40534397	SO:0001583	missense	11122	exon8			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1373T>C	20.37:g.41100983A>G	ENSP00000362283:p.Ile458Thr	Somatic		Capture	Illumina HiSeq	Phase_I	40534397	NM_133170	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	A	16.81	3.225420	0.58668	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63	5.28	5.28	0.74379	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.066228	0.64402	D	0.000002	T	0.39517	0.1081	N	0.24115	0.695	0.48236	D	0.999615	B;B	0.31730	0.337;0.142	B;B	0.35727	0.209;0.103	T	0.41215	-0.9521	10	0.72032	D	0.01	.	15.1951	0.73081	1.0:0.0:0.0:0.0	.	458;458	O14522-1;O14522	.;PTPRT_HUMAN	T	458	ENSP00000362286:I458T;ENSP00000362283:I458T;ENSP00000362289:I458T;ENSP00000348408:I458T;ENSP00000362294:I458T;ENSP00000362280:I458T;ENSP00000362297:I458T	ENSP00000348408:I458T	I	-	2	0	PTPRT	40534397	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	9.136000	0.94489	2.005000	0.58758	0.374000	0.22700	ATC		PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
KCNG1	3755	broad.mit.edu	37	20	49626754	49626754	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr20:49626754C>T	ENST00000371571.4	-	2	407	c.122G>A	c.(121-123)cGc>cAc	p.R41H	KCNG1_ENST00000506387.1_5'Flank|KCNG1_ENST00000396017.3_Missense_Mutation_p.R41H|RP5-955M13.4_ENST00000424566.1_RNA	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	41					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)	p.R41H(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						CTGCGCCCGGCGGTAGAACGC	0.682																																					p.R41H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G122A	20						.						17.0	20.0	19.0					20																	49626754		2185	4244	6429	49060161	SO:0001583	missense	3755	exon2			AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.122G>A	20.37:g.49626754C>T	ENSP00000360626:p.Arg41His	Somatic		Capture	Illumina HiSeq	Phase_I	49060161	NM_002237	A8K3S4|O43528|Q5JXL5|Q9BRC1	Missense_Mutation	SNP	ENST00000371571.4	37	CCDS13436.1	.	.	.	.	.	.	.	.	.	.	C	14.75	2.629925	0.46944	.	.	ENSG00000026559	ENST00000371571;ENST00000396017;ENST00000439216;ENST00000424171;ENST00000433903;ENST00000447736	D;D;D;D	0.98028	-4.67;-2.74;-3.32;-3.6	5.87	4.93	0.64822	.	1.096560	0.06710	N	0.773060	D	0.96953	0.9005	L	0.53249	1.67	0.34128	D	0.664881	D;B	0.63046	0.992;0.015	P;B	0.51582	0.674;0.016	D	0.94084	0.7347	9	.	.	.	.	5.6701	0.17717	0.0:0.7438:0.0:0.2562	.	41;41	Q9UIX4-2;Q9UIX4	.;KCNG1_HUMAN	H	41	ENSP00000360626:R41H;ENSP00000379338:R41H;ENSP00000394075:R41H;ENSP00000394093:R41H	.	R	-	2	0	KCNG1	49060161	1.000000	0.71417	0.992000	0.48379	0.383000	0.30230	3.979000	0.56888	2.800000	0.96347	0.456000	0.33151	CGC		KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079726.4	NM_002237	
C20orf96	140680	broad.mit.edu	37	20	259048	259048	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr20:259048delT	ENST00000360321.2	-	6	626	c.488delA	c.(487-489)tacfs	p.Y163fs	C20orf96_ENST00000400269.3_Frame_Shift_Del_p.Y105fs|C20orf96_ENST00000382369.5_Frame_Shift_Del_p.Y128fs	NM_080571.1|NM_153269.2	NP_542138.1|NP_695001.2	Q9NUD7	CT096_HUMAN	chromosome 20 open reading frame 96	163								p.Y163fs*10(1)		endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CTTGTTTGAGTACTCCAAGAT	0.517																																					p.Y163fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.488delA	20						.						155.0	159.0	158.0					20																	259048		2203	4300	6503	207048	SO:0001589	frameshift_variant	140680	exon6			AL034548	CCDS12994.1, CCDS74685.1	20p13	2012-10-30			ENSG00000196476	ENSG00000196476			16227	protein-coding gene	gene with protein product							Standard	NM_153269		Approved	dJ1103G7.2	uc002wde.2	Q9NUD7	OTTHUMG00000031626	ENST00000360321.2:c.488delA	20.37:g.259048delT	ENSP00000353470:p.Tyr163fs	Somatic		Capture	Illumina HiSeq	Phase_I	207048	NM_153269	A3KPE0|B2RPH9|Q8N840|Q8NAX5	Frame_Shift_Del	DEL	ENST00000360321.2	37	CCDS12994.1																																																																																				C20orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077439.2	NM_153269	
TAF4	6874	broad.mit.edu	37	20	60572701	60572701	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr20:60572701T>C	ENST00000252996.4	-	14	2994	c.2995A>G	c.(2995-2997)Atg>Gtg	p.M999V		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	999					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.M999V(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CGCTGTCTCATTTGTGCCAGT	0.478																																					p.M999V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2995G	20						.						150.0	134.0	140.0					20																	60572701		2203	4300	6503	60006096	SO:0001583	missense	6874	exon14			Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.2995A>G	20.37:g.60572701T>C	ENSP00000252996:p.Met999Val	Somatic		Capture	Illumina HiSeq	Phase_I	60006096	NM_003185	A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Missense_Mutation	SNP	ENST00000252996.4	37	CCDS33500.1	.	.	.	.	.	.	.	.	.	.	T	15.46	2.838730	0.51057	.	.	ENSG00000130699	ENST00000252996;ENST00000436129	T;T	0.26810	1.73;1.71	5.78	4.64	0.57946	Transcription initiation factor TFIID component TAF4 (1);	0.092424	0.85682	D	0.000000	T	0.29850	0.0746	M	0.71036	2.16	0.47407	D	0.999412	B	0.27013	0.166	B	0.29353	0.101	T	0.03684	-1.1013	10	0.33940	T	0.23	-23.3567	11.9763	0.53094	0.1302:0.0:0.0:0.8698	.	999	O00268	TAF4_HUMAN	V	999;863	ENSP00000252996:M999V;ENSP00000399091:M863V	ENSP00000252996:M999V	M	-	1	0	TAF4	60006096	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.629000	0.61290	0.961000	0.38030	0.482000	0.46254	ATG		TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185	
ADAMTS5	11096	broad.mit.edu	37	21	28337953	28337953	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr21:28337953T>A	ENST00000284987.5	-	1	879	c.758A>T	c.(757-759)cAg>cTg	p.Q253L		NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	253					defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.Q253L(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						CCACCACGTCTGCGGTCCTGA	0.731																																					p.Q253L	Esophageal Squamous(53;683 1080 10100 14424 45938)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A758T	21						.						6.0	9.0	8.0					21																	28337953		2159	4219	6378	27259824	SO:0001583	missense	11096	exon1			AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.758A>T	21.37:g.28337953T>A	ENSP00000284987:p.Gln253Leu	Somatic		Capture	Illumina HiSeq	Phase_I	27259824	NM_007038	Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	T	11.97	1.797169	0.31777	.	.	ENSG00000154736	ENST00000284987	T	0.63417	-0.04	4.56	2.04	0.26737	.	0.689823	0.12978	N	0.423598	T	0.35307	0.0927	N	0.08118	0	0.33309	D	0.565831	B	0.23058	0.079	B	0.16289	0.015	T	0.37126	-0.9719	10	0.24483	T	0.36	.	5.8498	0.18685	0.0:0.0921:0.1669:0.741	.	253	Q9UNA0	ATS5_HUMAN	L	253	ENSP00000284987:Q253L	ENSP00000284987:Q253L	Q	-	2	0	ADAMTS5	27259824	0.848000	0.29623	0.915000	0.36163	0.931000	0.56810	0.003000	0.13083	0.779000	0.33543	0.459000	0.35465	CAG		ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1		
IL17RA	23765	broad.mit.edu	37	22	17590518	17590519	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr22:17590518_17590519insC	ENST00000319363.6	+	13	2542_2543	c.2409_2410insC	c.(2410-2412)cccfs	p.P804fs		NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	804					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)	p.E806fs*>62(1)		endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		GCTCCCCGCAGCCCCCCGAGGG	0.658																																					p.Q803fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2409_2410insC	22						.																																			15970519	SO:0001589	frameshift_variant	23765	exon13			U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.2415dupC	22.37:g.17590524_17590524dupC	ENSP00000320936:p.Pro804fs	None		Capture	Illumina HiSeq	Phase_I	15970518	NM_014339	O43844|Q20WK1	Frame_Shift_Ins	INS	ENST00000319363.6	37	CCDS13739.1																																																																																				IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315820.1	NM_014339	
MAP2	4133	broad.mit.edu	37	2	210594578	210594578	+	Silent	SNP	C	C	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr2:210594578C>T	ENST00000360351.4	+	14	5666	c.5160C>T	c.(5158-5160)ggC>ggT	p.G1720G	MAP2_ENST00000361559.4_Silent_p.G364G|MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000392194.1_Silent_p.G364G|MAP2_ENST00000199940.6_Silent_p.G452G|MAP2_ENST00000447185.1_Silent_p.G1716G	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1720					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.G1720G(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TCATAGGTGGCGGACGTGTGA	0.398																																					p.G395G	Pancreas(27;423 979 28787 29963)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1185T	2						.						101.0	94.0	96.0					2																	210594578		2203	4300	6503	210302823	SO:0001819	synonymous_variant	4133	exon12				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.5160C>T	2.37:g.210594578C>T		Somatic		Capture	Illumina HiSeq	Phase_I	210302823	NM_031847	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	ENST00000360351.4	37	CCDS2384.1																																																																																				MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
IQCA1	79781	broad.mit.edu	37	2	237374292	237374292	+	Missense_Mutation	SNP	C	C	T	rs200287685		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr2:237374292C>T	ENST00000409907.3	-	6	1056	c.782G>A	c.(781-783)cGc>cAc	p.R261H	IQCA1_ENST00000309507.5_Missense_Mutation_p.R257H|IQCA1_ENST00000431676.2_Missense_Mutation_p.R261H	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	261							ATP binding (GO:0005524)	p.R261H(1)|p.R268H(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						ATTCCGCAGGCGGTCCACCTT	0.438													c|||	1	0.000199681	0.0	0.0	5008	,	,		19213	0.001		0.0	False		,,,				2504	0.0				p.R261H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G782A	2						.						124.0	112.0	116.0					2																	237374292		1920	4137	6057	237039031	SO:0001583	missense	79781	exon6			AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.782G>A	2.37:g.237374292C>T	ENSP00000387347:p.Arg261His	Somatic		Capture	Illumina HiSeq	Phase_I	237039031	NM_024726	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Missense_Mutation	SNP	ENST00000409907.3	37	CCDS46549.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	c	11.61	1.690080	0.29962	.	.	ENSG00000132321	ENST00000409907;ENST00000457693;ENST00000309507;ENST00000431676;ENST00000412437	D;D;D	0.94417	-3.32;-3.31;-3.42	5.37	-9.1	0.00714	.	2.740640	0.00848	N	0.001805	T	0.82148	0.4974	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.11235	0.0;0.002;0.004	B;B;B	0.09377	0.0;0.002;0.004	T	0.72912	-0.4148	10	0.44086	T	0.13	.	1.9159	0.03297	0.2588:0.09:0.3405:0.3108	.	261;268;261	E7EWQ0;E9PH78;Q86XH1	.;.;IQCA1_HUMAN	H	261;268;257;261;257	ENSP00000387347:R261H;ENSP00000311951:R257H;ENSP00000407213:R261H	ENSP00000254653:R261H	R	-	2	0	IQCA1	237039031	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-2.848000	0.00733	-1.438000	0.01965	-0.213000	0.12676	CGC		IQCA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000329266.1	NM_024726	
ACKR3	57007	broad.mit.edu	37	2	237489344	237489344	+	Missense_Mutation	SNP	C	C	T	rs200095631		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr2:237489344C>T	ENST00000272928.3	+	2	546	c.236C>T	c.(235-237)aCg>aTg	p.T79M		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	79					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)	p.T79M(1)									GGCTATGACACGCACTGCTAC	0.542													C|||	1	0.000199681	0.0	0.0	5008	,	,		22998	0.001		0.0	False		,,,				2504	0.0				p.T79M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C236T	2						.						180.0	145.0	157.0					2																	237489344		2203	4300	6503	237154083	SO:0001583	missense	57007	exon2			BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.236C>T	2.37:g.237489344C>T	ENSP00000272928:p.Thr79Met	Somatic		Capture	Illumina HiSeq	Phase_I	237154083	NM_020311	A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Missense_Mutation	SNP	ENST00000272928.3	37	CCDS2516.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	14.40	2.523732	0.44866	.	.	ENSG00000144476	ENST00000447924;ENST00000272928	T;T	0.36520	1.25;1.25	5.57	4.7	0.59300	GPCR, rhodopsin-like superfamily (1);	0.051381	0.85682	N	0.000000	T	0.42517	0.1206	M	0.77820	2.39	0.58432	D	0.999996	B	0.24317	0.101	B	0.22601	0.04	T	0.44019	-0.9355	10	0.87932	D	0	.	14.2226	0.65839	0.0:0.9285:0.0:0.0715	.	79	P25106	CXCR7_HUMAN	M	79	ENSP00000405945:T79M;ENSP00000272928:T79M	ENSP00000272928:T79M	T	+	2	0	CXCR7	237154083	0.998000	0.40836	0.968000	0.41197	0.902000	0.53008	3.946000	0.56644	1.357000	0.45904	0.563000	0.77884	ACG		ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257079.2	NM_020311	
THRB	7068	broad.mit.edu	37	3	24188201	24188201	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr3:24188201A>T	ENST00000356447.4	-	6	781	c.497T>A	c.(496-498)tTt>tAt	p.F166Y	THRB_ENST00000416420.1_Missense_Mutation_p.F166Y|THRB_ENST00000280696.5_Missense_Mutation_p.F181Y|THRB_ENST00000396671.2_Missense_Mutation_p.F166Y	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	P10828	THB_HUMAN	thyroid hormone receptor, beta	166					female courtship behavior (GO:0008050)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of female receptivity (GO:0007621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|sensory perception of sound (GO:0007605)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.F166Y(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(2)|prostate(1)|skin(3)	19					Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GCATTTCTTAAAGCGACATTC	0.378																																					p.F166Y	Melanoma(21;896 1043 15021 37958)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T497A	3						.						160.0	145.0	150.0					3																	24188201		2203	4300	6503	24163205	SO:0001583	missense	7068	exon6				CCDS2641.1	3p24.2	2013-01-16	2011-05-19		ENSG00000151090	ENSG00000151090		"""Nuclear hormone receptors"""	11799	protein-coding gene	gene with protein product	"""avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2"", ""oncogene ERBA2"", ""generalized resistance to thyroid hormone"", ""thyroid hormone receptor beta 1"""	190160	"""thyroid hormone receptor, beta (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2)"", ""pituitary resistance to thyroid hormone"", ""thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)"""	ERBA2, PRTH		1973914, 8040303	Standard	NM_000461		Approved	THRB1, THRB2, NR1A2, THR1, ERBA-BETA, GRTH	uc003ccy.4	P10828	OTTHUMG00000130478	ENST00000356447.4:c.497T>A	3.37:g.24188201A>T	ENSP00000348827:p.Phe166Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	24163205	NM_000461	B3KU79|P37243|Q13986|Q3KP35|Q6WGL2|Q9UD41	Missense_Mutation	SNP	ENST00000356447.4	37	CCDS2641.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.125078	0.77436	.	.	ENSG00000151090	ENST00000396671;ENST00000356447;ENST00000416420;ENST00000280696	D;D;D;D	0.97430	-4.38;-4.38;-4.38;-4.38	5.93	5.93	0.95920	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.85682	D	0.000000	D	0.94778	0.8314	N	0.25957	0.775	0.80722	D	1	B	0.24618	0.107	B	0.32980	0.156	D	0.92632	0.6117	10	0.59425	D	0.04	.	16.3943	0.83563	1.0:0.0:0.0:0.0	.	166	P10828	THB_HUMAN	Y	166;166;166;181	ENSP00000379904:F166Y;ENSP00000348827:F166Y;ENSP00000414444:F166Y;ENSP00000280696:F181Y	ENSP00000280696:F181Y	F	-	2	0	THRB	24163205	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.327000	0.79147	2.281000	0.76405	0.533000	0.62120	TTT		THRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252877.3	NM_000461	
KLHL18	23276	broad.mit.edu	37	3	47364101	47364101	+	Missense_Mutation	SNP	G	G	T	rs62248948		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr3:47364101G>T	ENST00000232766.5	+	3	324	c.304G>T	c.(304-306)Gcc>Tcc	p.A102S	KLHL18_ENST00000455924.2_5'UTR	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	102	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.							p.A102S(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		CGGCAACCTTGCCATTGACCA	0.552																																					p.A102S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G304T	3						.						106.0	83.0	91.0					3																	47364101		2203	4300	6503	47339105	SO:0001583	missense	23276	exon3			AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.304G>T	3.37:g.47364101G>T	ENSP00000232766:p.Ala102Ser	Somatic		Capture	Illumina HiSeq	Phase_I	47339105	NM_025010	A8K612|Q7Z3E8|Q8N125	Missense_Mutation	SNP	ENST00000232766.5	37	CCDS33749.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.854480	0.51376	.	.	ENSG00000114648	ENST00000232766;ENST00000437353	T;T	0.66099	-0.19;-0.19	5.29	5.29	0.74685	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.056966	0.64402	D	0.000001	T	0.41073	0.1143	N	0.04820	-0.15	0.80722	D	1	B;B	0.33171	0.06;0.4	B;B	0.33960	0.029;0.173	T	0.38394	-0.9663	10	0.08599	T	0.76	.	18.0991	0.89500	0.0:0.0:1.0:0.0	.	102;37	O94889;O94889-2	KLH18_HUMAN;.	S	102	ENSP00000232766:A102S;ENSP00000411839:A102S	ENSP00000232766:A102S	A	+	1	0	KLHL18	47339105	1.000000	0.71417	0.989000	0.46669	0.997000	0.91878	7.630000	0.83225	2.761000	0.94854	0.655000	0.94253	GCC		KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344493.1	NM_025010	
APC	324	broad.mit.edu	37	5	112173704	112173704	+	Nonsense_Mutation	SNP	C	C	T	rs587779783		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr5:112173704C>T	ENST00000457016.1	+	16	2793	c.2413C>T	c.(2413-2415)Cga>Tga	p.R805*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.R805*|APC_ENST00000257430.4_Nonsense_Mutation_p.R805*			P25054	APC_HUMAN	adenomatous polyposis coli	805	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R805*(10)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGACACCAATCGACATGATGA	0.373		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R787X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,right,Substitution - Nonsense,0 	.	11	Substitution - Nonsense(10)|Unknown(1)	large_intestine(10)|skin(1)	c.C2359T	5	GRCh37	CM960067	APC	M		.						77.0	78.0	78.0					5																	112173704		2202	4300	6502	112201603	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2413C>T	5.37:g.112173704C>T	ENSP00000413133:p.Arg805*	Somatic		Capture	Illumina HiSeq	Phase_I	112201603	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	36	5.853935	0.97030	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	6.16	4.36	0.52297	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-10.8016	14.7295	0.69372	0.4961:0.5038:0.0:0.0	.	.	.	.	X	805;787;805;805;805	.	ENSP00000257430:R805X	R	+	1	2	APC	112201603	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.615000	0.36922	0.896000	0.36366	-0.188000	0.12872	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175411	112175411	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr5:112175411G>T	ENST00000457016.1	+	16	4500	c.4120G>T	c.(4120-4122)Gaa>Taa	p.E1374*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.E1374*|APC_ENST00000257430.4_Nonsense_Mutation_p.E1374*			P25054	APC_HUMAN	adenomatous polyposis coli	1374	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E1374*(6)|p.E1374K(2)|p.E1374fs*2(1)|p.?(1)|p.K1192fs*3(1)|p.P1373fs*41(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAGTCCACCTGAACACTATGT	0.453		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1356X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,pancreas,NS,Substitution - coding silent,-2 	.	12	Substitution - Nonsense(6)|Substitution - Missense(2)|Deletion - Frameshift(2)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(8)|urinary_tract(1)|pancreas(1)|soft_tissue(1)|skin(1)	c.G4066T	5						.						84.0	81.0	82.0					5																	112175411		2202	4300	6502	112203310	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4120G>T	5.37:g.112175411G>T	ENSP00000413133:p.Glu1374*	Somatic		Capture	Illumina HiSeq	Phase_I	112203310	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	41	8.982164	0.99025	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.9189	20.4898	0.99202	0.0:0.0:1.0:0.0	.	.	.	.	X	1374	.	.	E	+	1	0	APC	112203310	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GAA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PGGT1B	5229	broad.mit.edu	37	5	114572091	114572091	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr5:114572091C>G	ENST00000419445.1	-	5	628	c.608G>C	c.(607-609)aGt>aCt	p.S203T	PGGT1B_ENST00000379615.3_Missense_Mutation_p.S203T	NM_005023.3	NP_005014.2	P53609	PGTB1_HUMAN	protein geranylgeranyltransferase type I, beta subunit	203					negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|protein geranylgeranylation (GO:0018344)|response to cytokine (GO:0034097)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)	CAAX-protein geranylgeranyltransferase activity (GO:0004662)|protein geranylgeranyltransferase activity (GO:0004661)|zinc ion binding (GO:0008270)	p.S203T(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6		all_cancers(142;0.000523)|all_epithelial(76;6.45e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		Epithelial(69;2.95e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.98e-08)|all cancers(49;3.1e-06)		ACTCACCATACTCCTTCTAAT	0.378																																					p.S203T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G608C	5						.						138.0	129.0	132.0					5																	114572091		2202	4300	6502	114599990	SO:0001583	missense	5229	exon5				CCDS4116.1	5q23.1	2008-02-05			ENSG00000164219	ENSG00000164219			8895	protein-coding gene	gene with protein product		602031				8106351	Standard	NM_005023		Approved	GGTI, BGGI	uc003kqw.4	P53609	OTTHUMG00000128893	ENST00000419445.1:c.608G>C	5.37:g.114572091C>G	ENSP00000404676:p.Ser203Thr	Somatic		Capture	Illumina HiSeq	Phase_I	114599990	NM_005023	Q5MJP9	Missense_Mutation	SNP	ENST00000419445.1	37	CCDS4116.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.390711	0.82902	.	.	ENSG00000164219	ENST00000419445;ENST00000379615	T;T	0.41758	0.99;0.99	5.27	5.27	0.74061	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.084070	0.85682	D	0.000000	T	0.70780	0.3263	M	0.87180	2.865	0.80722	D	1	D;D	0.65815	0.995;0.973	D;D	0.83275	0.996;0.974	T	0.75436	-0.3318	10	0.56958	D	0.05	.	18.8934	0.92414	0.0:1.0:0.0:0.0	.	203;203	P53609-2;P53609	.;PGTB1_HUMAN	T	203	ENSP00000404676:S203T;ENSP00000368935:S203T	ENSP00000368935:S203T	S	-	2	0	PGGT1B	114599990	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	7.759000	0.85235	2.457000	0.83068	0.591000	0.81541	AGT		PGGT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250855.2	NM_005023	
PCDHGA10	56106	broad.mit.edu	37	5	140794465	140794465	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr5:140794465G>A	ENST00000398610.2	+	1	1723	c.1723G>A	c.(1723-1725)Ggt>Agt	p.G575S	PCDHGA8_ENST00000398604.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB7_ENST00000398594.2_5'Flank|PCDHGA6_ENST00000517434.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	575	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G575S(1)		breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCCACAGACGGTTCCACAGG	0.662																																					p.G575S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1723A	5						.						127.0	144.0	138.0					5																	140794465		2203	4300	6503	140774649	SO:0001583	missense	56106	exon1				CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.1723G>A	5.37:g.140794465G>A	ENSP00000381611:p.Gly575Ser	Somatic		Capture	Illumina HiSeq	Phase_I	140774649	NM_032090	Q9Y5E0	Missense_Mutation	SNP	ENST00000398610.2	37	CCDS47292.1	.	.	.	.	.	.	.	.	.	.	g	13.71	2.319172	0.41096	.	.	ENSG00000253846	ENST00000398610	T	0.53206	0.63	5.63	5.63	0.86233	Cadherin-like (1);	.	.	.	.	T	0.48223	0.1488	L	0.41906	1.305	0.29928	N	0.822132	P;P	0.52692	0.955;0.925	P;P	0.47118	0.538;0.484	T	0.53063	-0.8491	9	0.72032	D	0.01	.	14.9482	0.71050	0.07:0.0:0.93:0.0	.	575;575	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	S	575	ENSP00000381611:G575S	ENSP00000381611:G575S	G	+	1	0	PCDHGA10	140774649	1.000000	0.71417	0.252000	0.24328	0.090000	0.18270	6.446000	0.73460	2.673000	0.90976	0.650000	0.86243	GGT		PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	NM_018913	
TRIM10	10107	broad.mit.edu	37	6	30128594	30128594	+	Silent	SNP	G	G	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr6:30128594G>T	ENST00000449742.2	-	1	117	c.42C>A	c.(40-42)gtC>gtA	p.V14V	TRIM15_ENST00000376694.4_5'Flank|TRIM10_ENST00000376704.3_Silent_p.V14V|TRIM15_ENST00000376688.1_5'Flank	NM_006778.3	NP_006769.2	Q9UDY6	TRI10_HUMAN	tripartite motif containing 10	14					erythrocyte differentiation (GO:0030218)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)	p.V14V(1)		ovary(1)	1						TGGGGCAGTTGACTTCATCTG	0.612																																					p.V14V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C42A	6						.						39.0	41.0	40.0					6																	30128594		2203	4300	6503	30236573	SO:0001819	synonymous_variant	10107	exon1			Y07829	CCDS4676.1, CCDS34375.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000204613	ENSG00000204613		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10072	protein-coding gene	gene with protein product		605701	"""tripartite motif-containing 10"""	RNF9		9271628, 10207104	Standard	NM_052828		Approved	RFB30, HERF1	uc003npo.3	Q9UDY6	OTTHUMG00000031295	ENST00000449742.2:c.42C>A	6.37:g.30128594G>T		Somatic		Capture	Illumina HiSeq	Phase_I	30236573	NM_006778	A6NF84|Q5SRJ5|Q5SRK8|Q86Z08|Q96QB6|Q9C023|Q9C024	Silent	SNP	ENST00000449742.2	37	CCDS34375.1																																																																																				TRIM10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076634.1		
SYNGAP1	8831	broad.mit.edu	37	6	33408581	33408581	+	Silent	SNP	C	C	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr6:33408581C>T	ENST00000418600.2	+	11	1853	c.1752C>T	c.(1750-1752)atC>atT	p.I584I	SYNGAP1_ENST00000428982.2_Silent_p.I525I|SYNGAP1_ENST00000496374.1_3'UTR|MIR5004_ENST00000579078.1_RNA|SYNGAP1_ENST00000293748.5_Silent_p.I584I	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	584	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)	p.I569I(1)|p.I584I(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GGGAGGACATCGCAGACAGGC	0.627																																					p.I584I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1752T	6						.						72.0	62.0	66.0					6																	33408581		2203	4300	6503	33516559	SO:0001819	synonymous_variant	8831	exon11			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.1752C>T	6.37:g.33408581C>T		Somatic		Capture	Illumina HiSeq	Phase_I	33516559	NM_006772	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Silent	SNP	ENST00000418600.2	37	CCDS34434.2																																																																																				SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
GRM4	2914	broad.mit.edu	37	6	34059697	34059697	+	Silent	SNP	G	G	A	rs147871838	byFrequency	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr6:34059697G>A	ENST00000538487.2	-	3	1142	c.699C>T	c.(697-699)agC>agT	p.S233S	GRM4_ENST00000374177.3_Silent_p.S164S|GRM4_ENST00000455714.2_Silent_p.S93S|GRM4_ENST00000535756.1_Silent_p.S100S|GRM4_ENST00000544773.2_Silent_p.S64S|GRM4_ENST00000609222.1_Silent_p.S100S|GRM4_ENST00000374181.4_Silent_p.S233S	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	233					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.S233S(2)|p.S164S(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CCTCCACACCGCTCTCACCAT	0.632													G|||	9	0.00179712	0.0008	0.0	5008	,	,		18030	0.005		0.003	False		,,,				2504	0.0				p.S233S												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C699T	6						.	G		3,4403	6.2+/-15.9	0,3,2200	72.0	52.0	59.0		699	-1.7	1.0	6	dbSNP_134	59	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous	GRM4	NM_000841.1		0,8,6495	AA,AG,GG		0.0581,0.0681,0.0615		233/913	34059697	8,12998	2203	4300	6503	34167675	SO:0001819	synonymous_variant	2914	exon2			U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.699C>T	6.37:g.34059697G>A		Somatic		Capture	Illumina HiSeq	Phase_I	34167675	NM_000841	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Silent	SNP	ENST00000538487.2	37	CCDS4787.1																																																																																				GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2		
RPL10A	4736	broad.mit.edu	37	6	35438047	35438047	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr6:35438047delC	ENST00000322203.6	+	5	429	c.402delC	c.(400-402)ttcfs	p.F134fs	RPL10A_ENST00000467020.1_3'UTR	NM_007104.4	NP_009035.3	P62906	RL10A_HUMAN	ribosomal protein L10a	134					anatomical structure morphogenesis (GO:0009653)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.P135fs*17(1)		breast(1)|large_intestine(2)|ovary(1)	4						CAGGAAAGTTCCCTTCCCTGC	0.488																																					p.F134fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.402delC	6						.						58.0	52.0	54.0					6																	35438047		2203	4300	6503	35546025	SO:0001589	frameshift_variant	4736	exon5			U12404	CCDS4806.1	6p21.31	2011-04-06			ENSG00000198755	ENSG00000198755		"""L ribosomal proteins"""	10299	protein-coding gene	gene with protein product		615660		NEDD6		7609734, 9647638	Standard	NM_007104		Approved	Csa-19, L10A	uc003okp.1	P62906	OTTHUMG00000014566	ENST00000322203.6:c.402delC	6.37:g.35438047delC	ENSP00000363018:p.Phe134fs	Somatic		Capture	Illumina HiSeq	Phase_I	35546025	NM_007104	B2R801|P52859|P53025|Q5TZT6|Q8J013	Frame_Shift_Del	DEL	ENST00000322203.6	37	CCDS4806.1																																																																																				RPL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040283.1	NM_007104	
RAPGEF5	9771	broad.mit.edu	37	7	22259526	22259526	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr7:22259526A>C	ENST00000405243.1	-	9	1038	c.955T>G	c.(955-957)Ttt>Gtt	p.F319V	RAPGEF5_ENST00000475788.1_5'UTR|RAPGEF5_ENST00000344041.6_Missense_Mutation_p.F166V			Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	0					nervous system development (GO:0007399)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)	GTP-dependent protein binding (GO:0030742)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.F166V(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|ovary(1)	6						GTCTGCAAAAACTGATAGTTT	0.448																																					p.F166V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T496G	7						.						128.0	120.0	123.0					7																	22259526		1835	4094	5929	22226051	SO:0001583	missense	9771	exon9			D87467	CCDS55093.1	7p15.3	2004-03-01			ENSG00000136237	ENSG00000136237			16862	protein-coding gene	gene with protein product	"""M-Ras-regulated GEF"""	609527				9039502, 10486569	Standard	NM_012294		Approved	KIAA0277, GFR, MR-GEF	uc003svg.3	Q92565	OTTHUMG00000152525	ENST00000405243.1:c.955T>G	7.37:g.22259526A>C	ENSP00000384870:p.Phe319Val	Somatic		Capture	Illumina HiSeq	Phase_I	22226051	NM_012294	A4D140|Q8IXU5	Missense_Mutation	SNP	ENST00000405243.1	37		.	.	.	.	.	.	.	.	.	.	A	14.63	2.592771	0.46214	.	.	ENSG00000136237	ENST00000344041;ENST00000420196;ENST00000405243	D;D;D	0.86230	-2.09;-2.09;-2.09	5.69	3.15	0.36227	.	1.186920	0.05948	N	0.638209	D	0.85809	0.5783	M	0.72894	2.215	0.39879	D	0.973619	B	0.18741	0.03	B	0.14578	0.011	T	0.75695	-0.3228	10	0.87932	D	0	.	4.9737	0.14129	0.704:0.0:0.1626:0.1333	.	166	A8MQ07	.	V	166;47;319	ENSP00000343656:F166V;ENSP00000395729:F47V;ENSP00000384870:F319V	ENSP00000343656:F166V	F	-	1	0	RAPGEF5	22226051	0.802000	0.28943	0.845000	0.33349	0.977000	0.68977	1.506000	0.35747	0.350000	0.24002	0.459000	0.35465	TTT		RAPGEF5-002	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000326591.1	NM_012294	
INHBA	3624	broad.mit.edu	37	7	41729776	41729776	+	Silent	SNP	G	G	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr7:41729776G>A	ENST00000242208.4	-	3	999	c.753C>T	c.(751-753)ggC>ggT	p.G251G	INHBA_ENST00000464515.1_5'UTR|INHBA_ENST00000442711.1_Silent_p.G251G|AC005027.3_ENST00000416150.1_RNA	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	251					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.G251G(2)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CCAAGCTGGCGCCACTCTCCT	0.587										TSP Lung(11;0.080)																											p.G251G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C753T	7						.						39.0	40.0	40.0					7																	41729776		2203	4300	6503	41696301	SO:0001819	synonymous_variant	3624	exon3				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.753C>T	7.37:g.41729776G>A		Somatic		Capture	Illumina HiSeq	Phase_I	41696301	NM_002192	Q14599	Silent	SNP	ENST00000242208.4	37	CCDS5464.1																																																																																				INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1		
GTF2IRD1	9569	broad.mit.edu	37	7	73971992	73971992	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr7:73971992C>T	ENST00000265755.3	+	20	2485	c.2092C>T	c.(2092-2094)Cgg>Tgg	p.R698W	GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.R683W|GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.R715W|GTF2IRD1_ENST00000489094.1_3'UTR|GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.R683W	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	698					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R698W(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GAGGCTCTCACGGATCGACAT	0.488																																					p.R683W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2047T	7						.						61.0	55.0	57.0					7																	73971992		2203	4300	6503	73609928	SO:0001583	missense	9569	exon20			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.2092C>T	7.37:g.73971992C>T	ENSP00000265755:p.Arg698Trp	Somatic		Capture	Illumina HiSeq	Phase_I	73609928	NM_005685	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	ENST00000265755.3	37	CCDS5571.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.00|16.00	2.997651|2.997651	0.54147|0.54147	.|.	.|.	ENSG00000006704|ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977|ENST00000470715	T;T;T;T|.	0.39787|.	1.06;1.06;1.08;1.06|.	4.2|4.2	3.29|3.29	0.37713|0.37713	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.57636|0.57636	0.2067|0.2067	L|L	0.46157|0.46157	1.445|1.445	0.51767|0.51767	D|D	0.99993|0.99993	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	0.988;0.982;1.0;1.0|.	T|T	0.52601|0.52601	-0.8554|-0.8554	10|5	0.87932|.	D|.	0|.	-14.676|-14.676	11.2995|11.2995	0.49298|0.49298	0.348:0.652:0.0:0.0|0.348:0.652:0.0:0.0	.|.	715;683;698;683|.	Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2|.	.;.;GT2D1_HUMAN;.|.	W|M	698;715;683;683|60	ENSP00000265755:R698W;ENSP00000397566:R715W;ENSP00000408477:R683W;ENSP00000418383:R683W|.	ENSP00000265755:R698W|.	R|T	+|+	1|2	2|0	GTF2IRD1|GTF2IRD1	73609928|73609928	0.336000|0.336000	0.24757|0.24757	0.526000|0.526000	0.27913|0.27913	0.476000|0.476000	0.33039|0.33039	0.789000|0.789000	0.26886|0.26886	0.855000|0.855000	0.35359|0.35359	0.655000|0.655000	0.94253|0.94253	CGG|ACG		GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328	
HEPACAM2	253012	broad.mit.edu	37	7	92848457	92848457	+	Silent	SNP	A	A	G			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr7:92848457A>G	ENST00000394468.2	-	2	464	c.387T>C	c.(385-387)aaT>aaC	p.N129N	HEPACAM2_ENST00000341723.4_Silent_p.N117N|HEPACAM2_ENST00000453812.2_Silent_p.N152N|HEPACAM2_ENST00000440868.1_Silent_p.N117N	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	129					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)		p.N117N(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						ATAGAGTTCCATTTCCCTGAA	0.483																																					p.N117N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T351C	7						.						136.0	107.0	117.0					7																	92848457		2203	4300	6503	92686393	SO:0001819	synonymous_variant	253012	exon1			AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.387T>C	7.37:g.92848457A>G		Somatic		Capture	Illumina HiSeq	Phase_I	92686393	NM_198151	B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Silent	SNP	ENST00000394468.2	37	CCDS43616.1																																																																																				HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254651.1	NM_198151	
FOXP2	93986	broad.mit.edu	37	7	114294065	114294065	+	Splice_Site	SNP	G	G	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr7:114294065G>A	ENST00000393494.2	+	10	1545		c.e10+1		FOXP2_ENST00000390668.3_Missense_Mutation_p.V447I|FOXP2_ENST00000393489.3_Splice_Site|MIR3666_ENST00000607845.1_RNA|FOXP2_ENST00000408937.3_Splice_Site|FOXP2_ENST00000393498.2_Splice_Site|FOXP2_ENST00000403559.4_Splice_Site|FOXP2_ENST00000393491.3_Splice_Site|FOXP2_ENST00000393500.3_Splice_Site|FOXP2_ENST00000360232.4_Missense_Mutation_p.V423I|FOXP2_ENST00000350908.4_Splice_Site			O15409	FOXP2_HUMAN	forkhead box P2						camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V448I(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						TCCCAAACCtgtaagtgcata	0.393																																					p.V423I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1267A	7						.						158.0	146.0	150.0					7																	114294065		2203	4300	6503	114081301	SO:0001630	splice_region_variant	93986	exon9			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.1266+1G>A	7.37:g.114294065G>A		Somatic		Capture	Illumina HiSeq	Phase_I	114081301	NM_148899	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Missense_Mutation	SNP	ENST00000393494.2	37	CCDS5760.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.233090	0.79688	.	.	ENSG00000128573	ENST00000360232;ENST00000390668	T;T	0.48201	0.82;0.82	6.16	6.16	0.99307	.	.	.	.	.	D	0.82857	0.5128	H	0.99026	4.405	0.80722	D	1	P;P	0.47910	0.902;0.902	P;D	0.64595	0.893;0.927	D	0.88072	0.2801	8	.	.	.	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	423;447	O15409-6;Q8N6B5	.;.	I	423;447	ENSP00000353367:V423I;ENSP00000375084:V447I	.	V	+	1	0	FOXP2	114081301	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	GTA		FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491	Intron
CSMD3	114788	broad.mit.edu	37	8	113529341	113529341	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr8:113529341G>T	ENST00000297405.5	-	28	4922	c.4678C>A	c.(4678-4680)Ctt>Att	p.L1560I	CSMD3_ENST00000352409.3_Missense_Mutation_p.L1560I|CSMD3_ENST00000455883.2_Missense_Mutation_p.L1456I|CSMD3_ENST00000343508.3_Missense_Mutation_p.L1520I	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1560	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L1520F(1)|p.L1560I(1)|p.L1560F(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCTCCTTGAAGTTCATATCCT	0.468										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.L1560I												.	.	3	Substitution - Missense(3)	endometrium(2)|large_intestine(1)	c.C4678A	8						.						125.0	114.0	118.0					8																	113529341		2203	4300	6503	113598517	SO:0001583	missense	114788	exon28			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4678C>A	8.37:g.113529341G>T	ENSP00000297405:p.Leu1560Ile	Somatic		Capture	Illumina HiSeq	Phase_I	113598517	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	19.96	3.923669	0.73213	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44;-0.44	4.88	4.01	0.46588	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000020	T	0.69070	0.3070	M	0.75264	2.295	0.26300	N	0.977997	P;P;B	0.40578	0.675;0.722;0.04	B;P;B	0.45946	0.365;0.498;0.034	T	0.64778	-0.6327	10	0.59425	D	0.04	.	7.8916	0.29682	0.3015:0.0:0.6985:0.0	.	1456;1560;1520	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	I	1520;1560;900;1456;1560	ENSP00000345799:L1520I;ENSP00000297405:L1560I;ENSP00000341558:L900I;ENSP00000412263:L1456I;ENSP00000343124:L1560I	ENSP00000297405:L1560I	L	-	1	0	CSMD3	113598517	1.000000	0.71417	0.980000	0.43619	0.995000	0.86356	3.837000	0.55820	1.282000	0.44496	0.585000	0.79938	CTT		CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
LAPTM4B	55353	broad.mit.edu	37	8	98837351	98837351	+	Silent	SNP	C	C	G			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr8:98837351C>G	ENST00000521545.2	+	6	807	c.573C>G	c.(571-573)gtC>gtG	p.V191V	LAPTM4B_ENST00000445593.2_Silent_p.V282V			Q86VI4	LAP4B_HUMAN	lysosomal protein transmembrane 4 beta	335					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.V282V(1)		breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	10	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			CCTCTGATGTCCTGGTTTATG	0.398																																					p.V282V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C846G	8						.						214.0	172.0	186.0					8																	98837351		2203	4300	6503	98906527	SO:0001819	synonymous_variant	55353	exon6			AF317417	CCDS6275.1	8q22.1	2008-08-11	2008-08-11		ENSG00000104341	ENSG00000104341			13646	protein-coding gene	gene with protein product		613296					Standard	NM_018407		Approved	LC27	uc003yia.3	Q86VI4	OTTHUMG00000164740	ENST00000521545.2:c.573C>G	8.37:g.98837351C>G		Somatic		Capture	Illumina HiSeq	Phase_I	98906527	NM_018407	Q3ZCV5|Q7L909|Q86VH8|Q9H060	Silent	SNP	ENST00000521545.2	37																																																																																					LAPTM4B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000380016.2		
GRINA	2907	broad.mit.edu	37	8	145066740	145066740	+	Silent	SNP	C	C	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr8:145066740C>T	ENST00000313269.5	+	6	1208	c.930C>T	c.(928-930)atC>atT	p.I310I	GRINA_ENST00000395068.4_Silent_p.I310I	NM_000837.1	NP_000828.1	Q7Z429	LFG1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)	310						integral component of membrane (GO:0016021)		p.I310I(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	9	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCCTGGAGATCGTGTACGCCT	0.612																																					p.I310I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C930T	8						.						110.0	86.0	94.0					8																	145066740		2203	4300	6503	145138728	SO:0001819	synonymous_variant	2907	exon6			NM_001009184	CCDS34961.1	8q24.3	2010-03-18	2008-04-01						4589	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 3"""	138251		NMDARA1		1719427, 8406459	Standard	XM_005250899		Approved	HNRGW, TMBIM3, LFG1	uc003zao.1	Q7Z429		ENST00000313269.5:c.930C>T	8.37:g.145066740C>T		Somatic		Capture	Illumina HiSeq	Phase_I	145138728	NM_000837	B3KXM7|O43836|Q8IVW7	Silent	SNP	ENST00000313269.5	37	CCDS34961.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.922|8.922	0.961244|0.961244	0.18583|0.18583	.|.	.|.	ENSG00000178719|ENSG00000178719	ENST00000533044;ENST00000527194|ENST00000534791	.|.	.|.	.|.	5.17|5.17	-10.3|-10.3	0.00346|0.00346	.|.	.|.	.|.	.|.	.|.	T|T	0.49660|0.49660	0.1570|0.1570	.|.	.|.	.|.	0.53688|0.53688	D|D	0.999973|0.999973	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.62840|0.62840	-0.6769|-0.6769	4|4	.|.	.|.	.|.	-10.8187|-10.8187	11.4502|11.4502	0.50147|0.50147	0.0791:0.4035:0.0:0.5174|0.0791:0.4035:0.0:0.5174	.|.	.|.	.|.	.|.	C|L	133;123|289	.|.	.|.	R|S	+|+	1|2	0|0	GRINA|GRINA	145138728|145138728	0.001000|0.001000	0.12720|0.12720	0.345000|0.345000	0.25642|0.25642	0.859000|0.859000	0.49053|0.49053	-1.700000|-1.700000	0.01905|0.01905	-2.371000|-2.371000	0.00602|0.00602	-1.251000|-1.251000	0.01509|0.01509	CGT|TCG		GRINA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384048.1	NM_001009184	
TAF1L	138474	broad.mit.edu	37	9	32632840	32632840	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chr9:32632840G>T	ENST00000242310.4	-	1	2827	c.2738C>A	c.(2737-2739)gCa>gAa	p.A913E	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	913					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.A913E(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCGTTGCTTTGCAGCTATCAT	0.428																																					p.A913E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2738A	9						.						198.0	178.0	185.0					9																	32632840		2203	4300	6503	32622840	SO:0001583	missense	138474	exon1			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2738C>A	9.37:g.32632840G>T	ENSP00000418379:p.Ala913Glu	Somatic		Capture	Illumina HiSeq	Phase_I	32622840	NM_153809	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667851	0.47677	.	.	ENSG00000122728	ENST00000242310	T	0.15718	2.4	1.04	1.04	0.20106	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.000000	0.85682	D	0.000000	T	0.41696	0.1170	M	0.89095	3.005	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.35151	-0.9800	10	0.87932	D	0	.	7.4859	0.27432	0.0:0.0:1.0:0.0	.	913	Q8IZX4	TAF1L_HUMAN	E	913	ENSP00000418379:A913E	ENSP00000418379:A913E	A	-	2	0	TAF1L	32622840	1.000000	0.71417	0.979000	0.43373	0.636000	0.38137	4.487000	0.60293	0.507000	0.28148	0.195000	0.17529	GCA		TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
P2RY4	5030	broad.mit.edu	37	X	69478523	69478523	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chrX:69478523G>A	ENST00000374519.2	-	1	1131	c.952C>T	c.(952-954)Cgt>Tgt	p.R318C		NM_002565.3	NP_002556.1	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 4	318					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|transepithelial chloride transport (GO:0030321)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|uridine nucleotide receptor activity (GO:0015065)|UTP-activated nucleotide receptor activity (GO:0045030)	p.R318C(1)		cervix(2)|endometrium(2)|large_intestine(8)|lung(6)	18						CAGAGCTGACGGAGCTGACGT	0.622																																					p.R318C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C952T	X						.						47.0	40.0	42.0					X																	69478523		2203	4300	6503	69395248	SO:0001583	missense	5030	exon1			X91852	CCDS14398.1	Xq13	2012-08-08			ENSG00000186912	ENSG00000186912		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8542	protein-coding gene	gene with protein product		300038				8537336	Standard	NM_002565		Approved	NRU, P2Y4, UNR, P2P	uc004dxz.1	P51582	OTTHUMG00000021769	ENST00000374519.2:c.952C>T	X.37:g.69478523G>A	ENSP00000363643:p.Arg318Cys	Somatic		Capture	Illumina HiSeq	Phase_I	69395248	NM_002565	Q4VBB7|Q4VBB8|Q502W2|Q5JT22	Missense_Mutation	SNP	ENST00000374519.2	37	CCDS14398.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.568998	0.28003	.	.	ENSG00000186912	ENST00000374519	T	0.25085	1.82	4.7	1.78	0.24846	.	1.012330	0.07916	U	0.975151	T	0.16128	0.0388	N	0.08118	0	0.09310	N	1	D	0.64830	0.994	P	0.46452	0.517	T	0.20042	-1.0287	10	0.33141	T	0.24	.	7.738	0.28825	0.2628:0.0:0.7372:0.0	.	318	P51582	P2RY4_HUMAN	C	318	ENSP00000363643:R318C	ENSP00000363643:R318C	R	-	1	0	P2RY4	69395248	0.951000	0.32395	0.019000	0.16419	0.334000	0.28698	2.378000	0.44309	0.042000	0.15717	0.589000	0.80489	CGT		P2RY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057058.2	NM_002565	
P2RY4	5030	broad.mit.edu	37	X	69478883	69478883	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chrX:69478883C>A	ENST00000374519.2	-	1	771	c.592G>T	c.(592-594)Gtg>Ttg	p.V198L		NM_002565.3	NP_002556.1	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 4	198					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|transepithelial chloride transport (GO:0030321)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|uridine nucleotide receptor activity (GO:0015065)|UTP-activated nucleotide receptor activity (GO:0045030)	p.V198L(1)		cervix(2)|endometrium(2)|large_intestine(8)|lung(6)	18						CTGAAGTGCACATAGTGGTCA	0.577																																					p.V198L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G592T	X						.						89.0	79.0	83.0					X																	69478883		2203	4300	6503	69395608	SO:0001583	missense	5030	exon1			X91852	CCDS14398.1	Xq13	2012-08-08			ENSG00000186912	ENSG00000186912		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8542	protein-coding gene	gene with protein product		300038				8537336	Standard	NM_002565		Approved	NRU, P2Y4, UNR, P2P	uc004dxz.1	P51582	OTTHUMG00000021769	ENST00000374519.2:c.592G>T	X.37:g.69478883C>A	ENSP00000363643:p.Val198Leu	Somatic		Capture	Illumina HiSeq	Phase_I	69395608	NM_002565	Q4VBB7|Q4VBB8|Q502W2|Q5JT22	Missense_Mutation	SNP	ENST00000374519.2	37	CCDS14398.1	.	.	.	.	.	.	.	.	.	.	C	11.65	1.701861	0.30232	.	.	ENSG00000186912	ENST00000374519	T	0.31510	1.49	4.43	3.56	0.40772	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000001	T	0.21227	0.0511	N	0.13352	0.335	0.54753	D	0.99998	B	0.27910	0.193	B	0.38194	0.267	T	0.06534	-1.0821	10	0.19590	T	0.45	.	10.6611	0.45702	0.0:0.9043:0.0:0.0957	.	198	P51582	P2RY4_HUMAN	L	198	ENSP00000363643:V198L	ENSP00000363643:V198L	V	-	1	0	P2RY4	69395608	1.000000	0.71417	0.444000	0.26895	0.953000	0.61014	4.282000	0.58971	0.882000	0.36016	0.589000	0.80489	GTG		P2RY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057058.2	NM_002565	
CXorf65	158830	broad.mit.edu	37	X	70326216	70326216	+	Missense_Mutation	SNP	C	C	T	rs180690065		TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chrX:70326216C>T	ENST00000374251.5	-	2	134	c.86G>A	c.(85-87)cGc>cAc	p.R29H		NM_001025265.2	NP_001020436.1	A6NEN9	CX065_HUMAN	chromosome X open reading frame 65	29								p.R29H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)	10						TACTTTACTGCGGATGTAATA	0.483													C|||	1	0.000264901	0.0	0.0	3775	,	,		16259	0.001		0.0	False		,,,				2504	0.0				p.R29H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G86A	X						.	C	HIS/ARG	1,3834		0,1,1631,571	138.0	108.0	118.0		86	4.1	0.0	X		118	0,6728		0,0,2428,1872	no	missense	CXorf65	NM_001025265.2	29	0,1,4059,2443	TT,TC,CC,C		0.0,0.0261,0.0095	probably-damaging	29/184	70326216	1,10562	2203	4300	6503	70242941	SO:0001583	missense	158830	exon2			BC144434	CCDS35324.1	Xq13.1	2009-03-06			ENSG00000204165	ENSG00000204165			33713	protein-coding gene	gene with protein product							Standard	NM_001025265		Approved		uc011mpo.2	A6NEN9	OTTHUMG00000021785	ENST00000374251.5:c.86G>A	X.37:g.70326216C>T	ENSP00000363369:p.Arg29His	Somatic		Capture	Illumina HiSeq	Phase_I	70242941	NM_001025265		Missense_Mutation	SNP	ENST00000374251.5	37	CCDS35324.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	18.35	3.605088	0.66445	2.61E-4	0.0	ENSG00000204165	ENST00000374251;ENST00000438526	T;T	0.58358	0.34;0.38	4.93	4.05	0.47172	.	0.458124	0.23881	N	0.043652	T	0.62551	0.2437	L	0.47190	1.495	0.09310	N	1	D	0.89917	1.0	D	0.79108	0.992	T	0.52305	-0.8593	10	0.66056	D	0.02	.	9.9708	0.41752	0.0:0.8987:0.0:0.1013	.	29	A6NEN9	CX065_HUMAN	H	29	ENSP00000363369:R29H;ENSP00000411354:R29H	ENSP00000363369:R29H	R	-	2	0	CXorf65	70242941	0.002000	0.14202	0.017000	0.16124	0.005000	0.04900	1.454000	0.35178	2.274000	0.75844	0.600000	0.82982	CGC		CXorf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057089.2	NM_001025265	
DIAPH2	1730	broad.mit.edu	37	X	95993741	95993741	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chrX:95993741G>C	ENST00000324765.8	+	3	669	c.322G>C	c.(322-324)Gat>Cat	p.D108H	DIAPH2_ENST00000373054.4_Missense_Mutation_p.D97H|DIAPH2_ENST00000373061.3_Missense_Mutation_p.D108H|DIAPH2_ENST00000355827.4_Missense_Mutation_p.D108H|DIAPH2_ENST00000373049.4_Missense_Mutation_p.D108H			O60879	DIAP2_HUMAN	diaphanous-related formin 2	108	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)	p.D108H(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						GGAAGTATTGGATCTCTTTGA	0.363																																					p.D108H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G322C	X						.						76.0	71.0	73.0					X																	95993741		2203	4300	6503	95880397	SO:0001583	missense	1730	exon3			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.322G>C	X.37:g.95993741G>C	ENSP00000321348:p.Asp108His	Somatic		Capture	Illumina HiSeq	Phase_I	95880397	NM_006729	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	ENST00000324765.8	37	CCDS14467.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.193841	0.58017	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51	5.53	5.53	0.82687	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);Diaphanous GTPase-binding (1);	0.068203	0.56097	D	0.000028	D	0.90769	0.7102	N	0.22421	0.69	0.58432	D	0.999997	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.91635	0.966;0.999;0.999	D	0.91586	0.5283	10	0.49607	T	0.09	.	18.1042	0.89515	0.0:0.0:1.0:0.0	.	108;108;108	O60879;O60879-2;B7ZLJ0	DIAP2_HUMAN;.;.	H	108;97;108;108;108;108	ENSP00000362152:D108H;ENSP00000362145:D97H;ENSP00000348082:D108H;ENSP00000362140:D108H;ENSP00000321348:D108H	ENSP00000321348:D108H	D	+	1	0	DIAPH2	95880397	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.325000	0.96381	2.311000	0.77944	0.544000	0.68410	GAT		DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	NM_006729, NM_007309	
SLITRK4	139065	broad.mit.edu	37	X	142717307	142717307	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3692-01A-01W-0900-09	TCGA-AA-3692-10A-01W-0900-09	g.chrX:142717307C>A	ENST00000381779.4	-	2	1843	c.1618G>T	c.(1618-1620)Gtg>Ttg	p.V540L	SLITRK4_ENST00000338017.4_Missense_Mutation_p.V540L|SLITRK4_ENST00000356928.1_Missense_Mutation_p.V540L	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	540	LRRCT 2.					integral component of membrane (GO:0016021)		p.V540L(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TTTAATGCCACCAAGTCACAA	0.473																																					p.V540L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1618T	X						.						151.0	144.0	146.0					X																	142717307		2203	4300	6503	142544973	SO:0001583	missense	139065	exon2			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.1618G>T	X.37:g.142717307C>A	ENSP00000371198:p.Val540Leu	Somatic		Capture	Illumina HiSeq	Phase_I	142544973	NM_173078	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	37	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.201354	0.58234	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.47869	0.83;0.83;0.83	5.41	5.41	0.78517	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	U	0.000000	T	0.38268	0.1034	L	0.31207	0.915	0.80722	D	1	B	0.27853	0.191	B	0.27887	0.084	T	0.14364	-1.0475	10	0.25751	T	0.34	-8.0073	16.9315	0.86191	0.0:1.0:0.0:0.0	.	540	Q8IW52	SLIK4_HUMAN	L	540	ENSP00000371198:V540L;ENSP00000349400:V540L;ENSP00000336627:V540L	ENSP00000336627:V540L	V	-	1	0	SLITRK4	142544973	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.040000	0.70980	2.404000	0.81709	0.600000	0.82982	GTG		SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
