#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
APBB1IP	54518	broad.mit.edu	37	10	26849737	26849737	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr10:26849737A>G	ENST00000376236.4	+	13	1788	c.1333A>G	c.(1333-1335)Aca>Gca	p.T445A		NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	445					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)		p.T445A(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						AAACTTGGGGACAGTCAATGC	0.488																																					p.T445A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1333G	10						.						111.0	108.0	109.0					10																	26849737		2203	4300	6503	26889743	SO:0001583	missense	54518	exon13			AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.1333A>G	10.37:g.26849737A>G	ENSP00000365411:p.Thr445Ala	Somatic		Capture	Illumina HiSeq	Phase_I	26889743	NM_019043	Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	ENST00000376236.4	37	CCDS31167.1	.	.	.	.	.	.	.	.	.	.	A	9.894	1.205155	0.22205	.	.	ENSG00000077420	ENST00000445780;ENST00000376236	T	0.32988	1.43	5.75	3.4	0.38934	.	0.307748	0.38217	N	0.001763	T	0.33904	0.0879	M	0.79805	2.47	0.80722	D	1	B	0.23806	0.091	B	0.25614	0.062	T	0.09930	-1.0652	10	0.45353	T	0.12	.	7.3874	0.26891	0.7798:0.1452:0.075:0.0	.	445	Q7Z5R6	AB1IP_HUMAN	A	445	ENSP00000365411:T445A	ENSP00000365411:T445A	T	+	1	0	APBB1IP	26889743	0.033000	0.19621	0.560000	0.28344	0.033000	0.12548	2.359000	0.44142	0.444000	0.26612	0.528000	0.53228	ACA		APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047270.1	NM_019043	
KIAA1462	57608	broad.mit.edu	37	10	30317736	30317736	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr10:30317736C>A	ENST00000375377.1	-	3	1442	c.1341G>T	c.(1339-1341)aaG>aaT	p.K447N		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	447					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)		p.K447N(1)		breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						TATCGTCAAGCTTTATGTCTT	0.468																																					p.K447N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1341T	10						.						76.0	77.0	77.0					10																	30317736		1913	4134	6047	30357742	SO:0001583	missense	57608	exon3			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.1341G>T	10.37:g.30317736C>A	ENSP00000364526:p.Lys447Asn	Somatic		Capture	Illumina HiSeq	Phase_I	30357742	NM_020848	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	ENST00000375377.1	37	CCDS41500.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.347564	0.24426	.	.	ENSG00000165757	ENST00000375377	T	0.15603	2.41	5.42	0.899	0.19271	.	0.451834	0.23636	N	0.046071	T	0.13970	0.0338	M	0.62723	1.935	0.09310	N	1	B	0.21225	0.053	B	0.21917	0.037	T	0.21075	-1.0256	10	0.42905	T	0.14	-10.8638	1.6811	0.02832	0.1391:0.4073:0.1367:0.3169	.	447	Q9P266	K1462_HUMAN	N	447	ENSP00000364526:K447N	ENSP00000364526:K447N	K	-	3	2	KIAA1462	30357742	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.479000	0.06567	0.269000	0.21961	-0.254000	0.11334	AAG		KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848	
EMX2	2018	broad.mit.edu	37	10	119303090	119303090	+	Silent	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr10:119303090G>A	ENST00000553456.3	+	1	1136	c.312G>A	c.(310-312)tcG>tcA	p.S104S	EMX2OS_ENST00000551288.1_RNA|EMX2OS_ENST00000450314.2_RNA|EMX2_ENST00000442245.4_Silent_p.S104S|EMX2OS_ENST00000440007.1_RNA	NM_004098.3	NP_004089.1	Q04743	EMX2_HUMAN	empty spiracles homeobox 2	104				S -> P (in Ref. 3; BAB70842). {ECO:0000305}.	anterior/posterior pattern specification (GO:0009952)|cell proliferation in forebrain (GO:0021846)|cerebral cortex regionalization (GO:0021796)|dentate gyrus development (GO:0021542)|forebrain cell migration (GO:0021885)|neuron differentiation (GO:0030182)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|response to drug (GO:0042493)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.S104S(1)		endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(2)	12		Colorectal(252;0.109)|Lung NSC(174;0.179)|all_lung(145;0.22)		all cancers(201;0.0133)		CCTCGCACTCGCCACACCCCC	0.701																																					p.S104S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G312A	10						.						64.0	62.0	62.0					10																	119303090		2203	4300	6503	119293080	SO:0001819	synonymous_variant	2018	exon1			AF301598	CCDS7601.1, CCDS53583.1	10q26.11	2011-06-20	2007-02-15		ENSG00000170370	ENSG00000170370		"""Homeoboxes / ANTP class : NKL subclass"""	3341	protein-coding gene	gene with protein product		600035	"""empty spiracles homolog 2 (Drosophila)"""			7959790	Standard	NM_004098		Approved		uc001ldh.4	Q04743	OTTHUMG00000019123	ENST00000553456.3:c.312G>A	10.37:g.119303090G>A		Somatic		Capture	Illumina HiSeq	Phase_I	119293080	NM_004098	G3V305|Q96NN8|Q9BQF4	Silent	SNP	ENST00000553456.3	37	CCDS7601.1																																																																																				EMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050569.4	NM_004098	
OR51F2	119694	broad.mit.edu	37	11	4842657	4842657	+	Silent	SNP	G	G	A	rs369696129		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr11:4842657G>A	ENST00000322110.5	+	1	107	c.42G>A	c.(40-42)tcG>tcA	p.S14S	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S14S(2)		breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCCCTATGTCGGTCCTCAATA	0.443																																					p.S14S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|pancreas(1)	c.G42A	11						.	G		0,4402		0,0,2201	268.0	254.0	259.0		42	0.3	0.2	11		259	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous	OR51F2	NM_001004753.1		0,1,6498	AA,AG,GG		0.0116,0.0,0.0077		14/343	4842657	1,12997	2201	4298	6499	4799233	SO:0001819	synonymous_variant	119694	exon1			BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.42G>A	11.37:g.4842657G>A		Somatic		Capture	Illumina HiSeq	Phase_I	4799233	NM_001004753	Q6IFI1	Silent	SNP	ENST00000322110.5	37	CCDS31361.1																																																																																				OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142181.1	NM_001004753	
LDHC	3948	broad.mit.edu	37	11	18472565	18472565	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr11:18472565G>A	ENST00000541669.1	+	8	1001	c.890G>A	c.(889-891)cGg>cAg	p.R297Q	LDHC_ENST00000546146.1_3'UTR|LDHC_ENST00000536880.1_Missense_Mutation_p.R283Q|LDHC_ENST00000544105.1_3'UTR|LDHC_ENST00000537486.1_Silent_p.A158A|LDHC_ENST00000535809.1_Silent_p.A216A|LDHC_ENST00000280704.4_Missense_Mutation_p.R297Q			P07864	LDHC_HUMAN	lactate dehydrogenase C	297					ATP biosynthetic process (GO:0006754)|cellular carbohydrate metabolic process (GO:0044262)|lactate biosynthetic process from pyruvate (GO:0019244)|lactate oxidation (GO:0019516)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|motile cilium (GO:0031514)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)	p.R297Q(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GTCTTGGGGCGGAATGGTGTC	0.373																																					p.R297Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G890A	11						.						115.0	113.0	114.0					11																	18472565		2199	4293	6492	18429141	SO:0001583	missense	3948	exon8			AY286300	CCDS7840.1	11p15.1	2012-10-02			ENSG00000166796	ENSG00000166796	1.1.1.27		6544	protein-coding gene	gene with protein product	"""cancer/testis antigen 32"""	150150					Standard	NM_002301		Approved	CT32	uc001mom.4	P07864	OTTHUMG00000167722	ENST00000541669.1:c.890G>A	11.37:g.18472565G>A	ENSP00000437783:p.Arg297Gln	Somatic		Capture	Illumina HiSeq	Phase_I	18429141	NM_002301	D3DQY4|Q6GSG8|Q7Z7J4	Missense_Mutation	SNP	ENST00000541669.1	37	CCDS7840.1	.	.	.	.	.	.	.	.	.	.	G	1.537	-0.542792	0.04053	.	.	ENSG00000166796	ENST00000541669;ENST00000280704;ENST00000536880	T;T;T	0.65178	-0.14;-0.14;-0.14	4.65	-5.13	0.02884	Lactate/malate dehydrogenase, C-terminal (1);Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (2);	0.636045	0.15498	N	0.259167	T	0.26340	0.0643	N	0.03029	-0.43	0.09310	N	1	B	0.14438	0.01	B	0.10450	0.005	T	0.32613	-0.9900	10	0.12103	T	0.63	-0.6244	7.432	0.27132	0.4933:0.0:0.398:0.1087	.	297	P07864	LDHC_HUMAN	Q	297;297;283	ENSP00000437783:R297Q;ENSP00000280704:R297Q;ENSP00000439555:R283Q	ENSP00000280704:R297Q	R	+	2	0	LDHC	18429141	0.000000	0.05858	0.114000	0.21550	0.936000	0.57629	-1.390000	0.02528	-0.948000	0.03668	-0.258000	0.10820	CGG		LDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395892.1	NM_017448	
KIAA1549L	25758	broad.mit.edu	37	11	33640205	33640205	+	Silent	SNP	C	C	T	rs551823874		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr11:33640205C>T	ENST00000321505.4	+	15	4695	c.4515C>T	c.(4513-4515)taC>taT	p.Y1505Y	KIAA1549L_ENST00000389726.3_Silent_p.Y1511Y			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1505						integral component of membrane (GO:0016021)		p.Y1505Y(1)									ACAGCGGATACGATGTGAGTC	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		16292	0.001		0.0	False		,,,				2504	0.0				p.Y1505Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4515T	11						.						16.0	18.0	17.0					11																	33640205		1877	4104	5981	33596781	SO:0001819	synonymous_variant	25758	exon15			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.4515C>T	11.37:g.33640205C>T		Somatic		Capture	Illumina HiSeq	Phase_I	33596781	NM_012194	B0QYU0	Silent	SNP	ENST00000321505.4	37	CCDS44565.2																																																																																				KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
OR5AP2	338675	broad.mit.edu	37	11	56409492	56409492	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr11:56409492C>T	ENST00000302981.1	-	1	423	c.424G>A	c.(424-426)Gtg>Atg	p.V142M	OR5AP2_ENST00000544374.1_Missense_Mutation_p.V143M	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V142M(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						CTCCCAGACACGAGAACTGGG	0.488																																					p.V142M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G424A	11						.						68.0	71.0	70.0					11																	56409492		2201	4296	6497	56166068	SO:0001583	missense	338675	exon1			AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.424G>A	11.37:g.56409492C>T	ENSP00000303111:p.Val142Met	Somatic		Capture	Illumina HiSeq	Phase_I	56166068	NM_001002925	B2RNM8	Missense_Mutation	SNP	ENST00000302981.1	37	CCDS31534.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.413566	0.00191	.	.	ENSG00000172464	ENST00000544374;ENST00000302981	T;T	0.01099	5.34;5.34	4.82	1.16	0.20824	GPCR, rhodopsin-like superfamily (1);	0.203156	0.34777	N	0.003683	T	0.00300	0.0009	N	0.00097	-2.15	0.09310	N	0.999998	B	0.12630	0.006	B	0.09377	0.004	T	0.46748	-0.9169	10	0.02654	T	1	.	9.7232	0.40315	0.0:0.2601:0.0:0.7399	.	142	Q8NGF4	O5AP2_HUMAN	M	143;142	ENSP00000442701:V143M;ENSP00000303111:V142M	ENSP00000303111:V142M	V	-	1	0	OR5AP2	56166068	1.000000	0.71417	0.942000	0.38095	0.003000	0.03518	1.614000	0.36911	-0.229000	0.09854	-2.711000	0.00134	GTG		OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391613.1	NM_001002925	
PRKRIR	5612	broad.mit.edu	37	11	76062524	76062524	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr11:76062524C>T	ENST00000260045.3	-	5	1775	c.1670G>A	c.(1669-1671)cGc>cAc	p.R557H	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	557					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R557H(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						GTGAGCTCTGCGGAATTTCCC	0.398																																					p.R557H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1670A	11						.						29.0	25.0	27.0					11																	76062524		2068	4164	6232	75740172	SO:0001583	missense	5612	exon5			AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.1670G>A	11.37:g.76062524C>T	ENSP00000260045:p.Arg557His	Somatic		Capture	Illumina HiSeq	Phase_I	75740172	NM_004705	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	ENST00000260045.3	37	CCDS8243.1	.	.	.	.	.	.	.	.	.	.	C	9.410	1.080185	0.20309	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	.	.	.	5.13	5.13	0.70059	Ribonuclease H-like (1);	0.324194	0.38492	N	0.001675	T	0.38506	0.1043	N	0.16478	0.41	0.38405	D	0.945771	B	0.09022	0.002	B	0.01281	0.0	T	0.29549	-1.0008	9	0.14252	T	0.57	.	12.4854	0.55871	0.0:0.9229:0.0:0.0771	.	557	O43422	P52K_HUMAN	H	382;557	.	ENSP00000260045:R557H	R	-	2	0	PRKRIR	75740172	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.637000	0.37155	2.607000	0.88179	0.644000	0.83932	CGC		PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	NM_004705	
CDON	50937	broad.mit.edu	37	11	125831690	125831690	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr11:125831690C>T	ENST00000392693.3	-	19	3687	c.3560G>A	c.(3559-3561)cGt>cAt	p.R1187H	CDON_ENST00000531738.1_Missense_Mutation_p.R564H|CDON_ENST00000263577.7_Missense_Mutation_p.R1187H	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	1187					anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R1187H(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		ACAGCAGGTACGCTGAGTAGG	0.532																																					p.R1187H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3560A	11						.						107.0	79.0	89.0					11																	125831690		2201	4299	6500	125336900	SO:0001583	missense	50937	exon19			AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.3560G>A	11.37:g.125831690C>T	ENSP00000376458:p.Arg1187His	Somatic		Capture	Illumina HiSeq	Phase_I	125336900	NM_016952	O14631	Missense_Mutation	SNP	ENST00000392693.3	37	CCDS58192.1	.	.	.	.	.	.	.	.	.	.	c	3.074	-0.190416	0.06299	.	.	ENSG00000064309	ENST00000392693;ENST00000531738;ENST00000263577	T;T;T	0.67171	-0.25;0.45;-0.24	5.98	-3.01	0.05463	.	0.736194	0.12103	N	0.499281	T	0.26882	0.0658	N	0.01109	-1.01	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.35968	-0.9767	10	0.08837	T	0.75	-2.8656	6.9563	0.24574	0.0:0.2446:0.2009:0.5545	.	1187;1187;564	Q4KMG0;Q4KMG0-2;E9PN78	CDON_HUMAN;.;.	H	1187;564;1187	ENSP00000376458:R1187H;ENSP00000432901:R564H;ENSP00000263577:R1187H	ENSP00000263577:R1187H	R	-	2	0	CDON	125336900	0.068000	0.21057	0.000000	0.03702	0.088000	0.18126	0.179000	0.16840	-0.343000	0.08351	-1.363000	0.01210	CGT		CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952	
KIAA1467	57613	broad.mit.edu	37	12	13208859	13208859	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr12:13208859C>T	ENST00000197268.8	+	2	532	c.412C>T	c.(412-414)Cgc>Tgc	p.R138C		NM_020853.1	NP_065904.1	A2RU67	K1467_HUMAN	KIAA1467	138						integral component of membrane (GO:0016021)		p.R138C(1)		NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(4)	36		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		CACCTGGAGCCGCCACTTGGG	0.512																																					p.R138C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C412T	12						.						27.0	28.0	28.0					12																	13208859		2181	4246	6427	13100126	SO:0001583	missense	57613	exon2			AB040900	CCDS31750.1	12p13.1	2006-01-23				ENSG00000084444			29288	protein-coding gene	gene with protein product						10819331	Standard	XM_005253450		Approved		uc001rbi.3	A2RU67		ENST00000197268.8:c.412C>T	12.37:g.13208859C>T	ENSP00000197268:p.Arg138Cys	Somatic		Capture	Illumina HiSeq	Phase_I	13100126	NM_020853	Q49AF2|Q5CZ81|Q6ZUV7|Q9P261	Missense_Mutation	SNP	ENST00000197268.8	37	CCDS31750.1	.	.	.	.	.	.	.	.	.	.	c	19.74	3.883532	0.72410	.	.	ENSG00000084444	ENST00000197268	T	0.25912	1.77	5.13	5.13	0.70059	Quinonprotein alcohol dehydrogenase-like (1);	0.337591	0.30446	N	0.009614	T	0.41534	0.1163	M	0.63843	1.955	0.48452	D	0.999658	D	0.67145	0.996	P	0.52554	0.702	T	0.33624	-0.9861	10	0.54805	T	0.06	-19.9499	18.6304	0.91358	0.0:1.0:0.0:0.0	.	138	A2RU67	K1467_HUMAN	C	138	ENSP00000197268:R138C	ENSP00000197268:R138C	R	+	1	0	KIAA1467	13100126	0.999000	0.42202	0.816000	0.32577	0.477000	0.33069	2.835000	0.48175	2.388000	0.81334	0.598000	0.82781	CGC		KIAA1467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401007.1	NM_020853	
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	T	rs121913530		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr12:25398285C>T	ENST00000256078.4	-	2	97	c.34G>A	c.(34-36)Ggt>Agt	p.G12S	KRAS_ENST00000557334.1_Missense_Mutation_p.G12S|KRAS_ENST00000556131.1_Missense_Mutation_p.G12S|KRAS_ENST00000311936.3_Missense_Mutation_p.G12S	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12S	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,+1 	.	5144	Substitution - Missense(5142)|Insertion - In frame(2)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	c.G34A	12	GRCh37	CM076251	KRAS	M	rs121913530	.						93.0	83.0	86.0					12																	25398285		2203	4300	6503	25289552	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>A	12.37:g.25398285C>T	ENSP00000256078:p.Gly12Ser	Somatic		Capture	Illumina HiSeq	Phase_I	25289552	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	35	5.441396	0.96187	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.78559	0.4302	L	0.28344	0.845	0.80722	D	1	P;P	0.39665	0.557;0.682	P;P	0.50570	0.525;0.644	T	0.80254	-0.1459	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	S	12	ENSP00000308495:G12S;ENSP00000452512:G12S;ENSP00000256078:G12S;ENSP00000451856:G12S	ENSP00000256078:G12S	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
ANO2	57101	broad.mit.edu	37	12	5936968	5936968	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr12:5936968G>A	ENST00000356134.5	-	8	921	c.850C>T	c.(850-852)Cgc>Tgc	p.R284C	ANO2_ENST00000327087.8_Missense_Mutation_p.R283C|ANO2_ENST00000546188.1_Missense_Mutation_p.R284C	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	288					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.R284C(1)		central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						CAGGCTGTGCGCTTCAGGATC	0.662																																					p.R283C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C847T	12						.						34.0	39.0	37.0					12																	5936968		2026	4192	6218	5807229	SO:0001583	missense	57101	exon7			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.850C>T	12.37:g.5936968G>A	ENSP00000348453:p.Arg284Cys	Somatic		Capture	Illumina HiSeq	Phase_I	5807229	NM_020373	C4N787|Q9H847	Missense_Mutation	SNP	ENST00000356134.5	37		.	.	.	.	.	.	.	.	.	.	G	24.9	4.581394	0.86748	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277	T;T;T	0.71698	-0.59;-0.59;-0.59	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.88797	0.6534	H	0.95850	3.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91908	0.5537	10	0.87932	D	0	.	14.4646	0.67475	0.0:0.0:1.0:0.0	.	283	Q9NQ90-3	.	C	283;284;284;288	ENSP00000314048:R283C;ENSP00000348453:R284C;ENSP00000440981:R284C	ENSP00000314048:R283C	R	-	1	0	ANO2	5807229	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.519000	0.60517	2.500000	0.84329	0.561000	0.74099	CGC		ANO2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000399019.4	NM_020373	
ARHGAP9	64333	broad.mit.edu	37	12	57872904	57872904	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr12:57872904C>T	ENST00000356411.2	-	2	424	c.286G>A	c.(286-288)Gtc>Atc	p.V96I	ARHGAP9_ENST00000550288.1_Missense_Mutation_p.V175I|ARHGAP9_ENST00000424809.2_Missense_Mutation_p.V96I|ARHGAP9_ENST00000393791.3_Missense_Mutation_p.V96I|ARHGAP9_ENST00000393797.2_Missense_Mutation_p.V167I|ARHGAP9_ENST00000550454.1_5'Flank|ARHGAP9_ENST00000430041.2_5'Flank			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	96					positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)	p.V96I(1)		endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			CCGGGGATGACGGTAGTTGGA	0.567																																					p.V96I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G286A	12						.						157.0	138.0	145.0					12																	57872904		2203	4300	6503	56159171	SO:0001583	missense	64333	exon2			AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.286G>A	12.37:g.57872904C>T	ENSP00000348782:p.Val96Ile	Somatic		Capture	Illumina HiSeq	Phase_I	56159171	NM_032496	B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Missense_Mutation	SNP	ENST00000356411.2	37		.	.	.	.	.	.	.	.	.	.	C	4.337	0.061919	0.08339	.	.	ENSG00000123329	ENST00000393791;ENST00000356411;ENST00000424809;ENST00000393797;ENST00000340423;ENST00000552249	T;T;T;T;T	0.40476	1.58;1.58;1.58;1.58;1.03	4.79	0.539	0.17156	Src homology-3 domain (1);	2.287270	0.01637	N	0.023855	T	0.15998	0.0385	N	0.00926	-1.1	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.13361	-1.0512	10	0.27785	T	0.31	.	3.7526	0.08572	0.0:0.2072:0.1886:0.6042	.	96;175;96;96;96	B4E248;Q6ZN13;Q9BRR9;Q9BRR9-2;E9PDX9	.;.;RHG09_HUMAN;.;.	I	96;96;96;167;145;14	ENSP00000377380:V96I;ENSP00000348782:V96I;ENSP00000394307:V96I;ENSP00000377386:V167I;ENSP00000448358:V14I	ENSP00000344852:V145I	V	-	1	0	ARHGAP9	56159171	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.935000	0.03950	0.283000	0.22279	-0.290000	0.09829	GTC		ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_032496	
SLC2A14	144195	broad.mit.edu	37	12	7970484	7970484	+	Silent	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr12:7970484G>A	ENST00000543909.1	-	15	2046	c.1287C>T	c.(1285-1287)gcC>gcT	p.A429A	SLC2A14_ENST00000340749.5_Silent_p.A406A|SLC2A14_ENST00000535295.1_Silent_p.A320A|SLC2A14_ENST00000542505.1_Silent_p.A70A|SLC2A14_ENST00000539924.1_Silent_p.A444A|SLC2A14_ENST00000431042.2_Silent_p.A406A|SLC2A14_ENST00000396589.2_Silent_p.A429A|SLC2A14_ENST00000542546.1_Silent_p.A320A			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	429					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)	p.A429A(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		TGGAGCAGCCGGCCACTGCCA	0.522																																					p.A429A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1287T	12						.						40.0	43.0	42.0					12																	7970484		2203	4296	6499	7861751	SO:0001819	synonymous_variant	144195	exon11			AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.1287C>T	12.37:g.7970484G>A		Somatic		Capture	Illumina HiSeq	Phase_I	7861751	NM_153449	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Silent	SNP	ENST00000543909.1	37	CCDS8585.1																																																																																				SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449	
IL22	50616	broad.mit.edu	37	12	68647116	68647116	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr12:68647116G>A	ENST00000538666.1	-	2	183	c.113C>T	c.(112-114)tCc>tTc	p.S38F	IL22_ENST00000328087.4_Missense_Mutation_p.S38F			Q9GZX6	IL22_HUMAN	interleukin 22	38					acute-phase response (GO:0006953)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-22 receptor binding (GO:0045518)	p.S38F(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)	14		Myeloproliferative disorder(1001;0.0255)	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;5.06e-05)|BRCA - Breast invasive adenocarcinoma(357;0.00104)		CCTGCAGTGGGAGCTGATGGG	0.552																																					p.S38F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C113T	12						.						88.0	77.0	81.0					12																	68647116		2203	4300	6503	66933383	SO:0001583	missense	50616	exon1			AF279437	CCDS8982.1	12q15	2014-05-22			ENSG00000127318	ENSG00000127318		"""Interleukins and interleukin receptors"""	14900	protein-coding gene	gene with protein product	"""IL-10-related T-cell-derived inducible factor"""	605330				10954742, 10875937	Standard	NM_020525		Approved	ILTIF, IL-21, zcyto18, IL-TIF, IL-D110, TIFa, TIFIL-23, IL-22, MGC79382, MGC79384	uc001sty.1	Q9GZX6	OTTHUMG00000169119	ENST00000538666.1:c.113C>T	12.37:g.68647116G>A	ENSP00000442424:p.Ser38Phe	Somatic		Capture	Illumina HiSeq	Phase_I	66933383	NM_020525		Missense_Mutation	SNP	ENST00000538666.1	37	CCDS8982.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.906438	0.52333	.	.	ENSG00000127318	ENST00000538666;ENST00000328087	T;T	0.48836	0.8;0.8	5.31	2.24	0.28232	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.639407	0.15496	N	0.259320	T	0.38612	0.1047	L	0.54323	1.7	0.09310	N	1	B	0.10296	0.003	B	0.14578	0.011	T	0.23226	-1.0194	9	.	.	.	-3.6915	7.2605	0.26201	0.081:0.0:0.6227:0.2962	.	38	Q9GZX6	IL22_HUMAN	F	38	ENSP00000442424:S38F;ENSP00000329384:S38F	.	S	-	2	0	IL22	66933383	0.001000	0.12720	0.003000	0.11579	0.818000	0.46254	0.888000	0.28268	0.873000	0.35799	0.561000	0.74099	TCC		IL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402318.1	NM_020525	
ZMYM2	7750	broad.mit.edu	37	13	20659966	20659966	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr13:20659966C>A	ENST00000382874.2	+	26	4136	c.3946C>A	c.(3946-3948)Cag>Aag	p.Q1316K	ZMYM2_ENST00000382871.2_Missense_Mutation_p.Q1316K|ZMYM2_ENST00000382869.3_Missense_Mutation_p.Q1316K	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1316					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.Q1316K(1)		large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		CCAAAGTCCACAGAATCTTAA	0.378																																					p.Q1316K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3946A	13						.						66.0	60.0	62.0					13																	20659966		1817	4076	5893	19557966	SO:0001583	missense	7750	exon25			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3946C>A	13.37:g.20659966C>A	ENSP00000372327:p.Gln1316Lys	Somatic		Capture	Illumina HiSeq	Phase_I	19557966	NM_197968	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	ENST00000382874.2	37	CCDS45016.1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.925809	0.34002	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382870	T	0.16897	2.31	5.34	5.34	0.76211	.	0.222938	0.47093	D	0.000249	T	0.15912	0.0383	L	0.34521	1.04	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.02294	-1.1181	10	0.66056	D	0.02	-8.9131	14.9425	0.71006	0.0:0.8573:0.1427:0.0	.	1316	Q9UBW7	ZMYM2_HUMAN	K	1316;1316;1314;1314;694	ENSP00000372322:Q1316K	ENSP00000372322:Q1316K	Q	+	1	0	ZMYM2	19557966	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.540000	0.60664	2.657000	0.90304	0.585000	0.79938	CAG		ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2	NM_003453	
TNFSF11	8600	broad.mit.edu	37	13	43181003	43181003	+	Silent	SNP	G	G	A	rs9566999		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr13:43181003G>A	ENST00000239849.6	+	5	1054	c.903G>A	c.(901-903)ccG>ccA	p.P301P	TNFSF11_ENST00000398795.2_Silent_p.P228P|TNFSF11_ENST00000358545.2_Silent_p.P228P|TNFSF11_ENST00000544862.1_Silent_p.P228P|TNFSF11_ENST00000405262.2_Silent_p.P228P			O14788	TNF11_HUMAN	tumor necrosis factor (ligand) superfamily, member 11	301					activation of JUN kinase activity (GO:0007257)|bone resorption (GO:0045453)|calcium ion homeostasis (GO:0055074)|cytokine-mediated signaling pathway (GO:0019221)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|monocyte chemotaxis (GO:0002548)|organ morphogenesis (GO:0009887)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of bone resorption (GO:0045780)|positive regulation of corticotropin-releasing hormone secretion (GO:0051466)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast development (GO:2001206)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	cytokine activity (GO:0005125)|tumor necrosis factor receptor binding (GO:0005164)|tumor necrosis factor receptor superfamily binding (GO:0032813)	p.P301P(1)		kidney(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	10		Lung NSC(96;1.11e-05)|Breast(139;0.00868)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000249)|GBM - Glioblastoma multiforme(144;0.00119)|BRCA - Breast invasive adenocarcinoma(63;0.073)	Denosumab(DB06643)|Lenalidomide(DB00480)	TACTGGATCCGGATCAGGATG	0.408																																					p.P301P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G903A	13						.						93.0	96.0	95.0					13																	43181003		2203	4300	6503	42079003	SO:0001819	synonymous_variant	8600	exon5			AF013171	CCDS9384.1, CCDS9385.1	13q14	2008-02-05			ENSG00000120659	ENSG00000120659		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11926	protein-coding gene	gene with protein product		602642				9312132, 9367155	Standard	NM_003701		Approved	TRANCE, RANKL, OPGL, ODF, CD254	uc001uyu.2	O14788	OTTHUMG00000016807	ENST00000239849.6:c.903G>A	13.37:g.43181003G>A		Somatic		Capture	Illumina HiSeq	Phase_I	42079003	NM_003701	O14723|Q96Q17|Q9P2Q3	Silent	SNP	ENST00000239849.6	37	CCDS9384.1																																																																																				TNFSF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044702.2		
CDC16	8881	broad.mit.edu	37	13	115008794	115008794	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr13:115008794C>T	ENST00000356221.3	+	7	712	c.604C>T	c.(604-606)Cgt>Tgt	p.R202C	CDC16_ENST00000375310.1_Missense_Mutation_p.R108C|CDC16_ENST00000252457.5_Missense_Mutation_p.R201C|CDC16_ENST00000375312.3_Missense_Mutation_p.R108C|CDC16_ENST00000360383.3_Missense_Mutation_p.R202C|CDC16_ENST00000375308.1_Missense_Mutation_p.R108C|MIR548AR_ENST00000582191.1_RNA|CDC16_ENST00000252458.6_Missense_Mutation_p.R108C			Q13042	CDC16_HUMAN	cell division cycle 16	202					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of mitosis (GO:0007088)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|spindle (GO:0005819)		p.R201C(1)		endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			GGAATTGCTGCGTTTTCTATT	0.303																																					p.R202C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C604T	13						.						72.0	77.0	75.0					13																	115008794		2203	4297	6500	114026896	SO:0001583	missense	8881	exon7			U18291	CCDS9542.2	13q34	2013-01-17	2013-01-17		ENSG00000130177	ENSG00000130177		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1720	protein-coding gene	gene with protein product	"""anaphase-promoting complex, subunit 6"""	603461	"""CDC16 (cell division cycle 16, S. cerevisiae, homolog)"", ""CDC16 cell division cycle 16 homolog (S. cerevisiae)"", ""cell division cycle 16 homolog (S. cerevisiae)"""			7736578	Standard	NM_001078645		Approved	APC6, ANAPC6, CUT9	uc001vul.1	Q13042	OTTHUMG00000017402	ENST00000356221.3:c.604C>T	13.37:g.115008794C>T	ENSP00000348554:p.Arg202Cys	Somatic		Capture	Illumina HiSeq	Phase_I	114026896	NM_001078645	A2A365|Q5T8C8|Q96AE6|Q9Y564	Missense_Mutation	SNP	ENST00000356221.3	37	CCDS9542.2	.	.	.	.	.	.	.	.	.	.	C	16.28	3.079749	0.55753	.	.	ENSG00000130177	ENST00000360383;ENST00000375312;ENST00000356221;ENST00000375310;ENST00000252457;ENST00000375308;ENST00000252458	.	.	.	5.75	4.88	0.63580	.	0.174773	0.51477	D	0.000092	T	0.70254	0.3203	M	0.78637	2.42	0.46279	D	0.998962	P;D;P	0.53619	0.917;0.961;0.935	P;P;B	0.48921	0.595;0.595;0.391	T	0.73613	-0.3927	8	.	.	.	-10.1082	16.2216	0.82262	0.1333:0.8666:0.0:0.0	.	201;201;202	Q13042-3;Q13042-2;Q13042	.;.;CDC16_HUMAN	C	202;108;202;108;201;108;108	.	.	R	+	1	0	CDC16	114026896	0.998000	0.40836	0.996000	0.52242	0.981000	0.71138	4.328000	0.59253	2.715000	0.92844	0.650000	0.86243	CGT		CDC16-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276737.1	NM_003903	
SLC7A7	9056	broad.mit.edu	37	14	23282374	23282374	+	Silent	SNP	G	G	A	rs139776370	byFrequency	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr14:23282374G>A	ENST00000397532.3	-	2	759	c.234C>T	c.(232-234)gtC>gtT	p.V78V	SLC7A7_ENST00000397529.2_Silent_p.V78V|SLC7A7_ENST00000554517.1_Intron|SLC7A7_ENST00000285850.7_Silent_p.V78V|SLC7A7_ENST00000555702.1_Silent_p.V78V|SLC7A7_ENST00000397528.4_Silent_p.V78V			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7	78					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)	p.V78V(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		AGAGGCCCCCGACAGCCCAGA	0.547													G|||	4	0.000798722	0.0	0.0	5008	,	,		16439	0.0		0.003	False		,,,				2504	0.001				p.V78V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C234T	14						.	G	,,	1,4405	2.1+/-5.4	0,1,2202	109.0	119.0	116.0		234,234,234	-11.2	0.0	14	dbSNP_134	116	9,8591	7.1+/-27.0	0,9,4291	yes	coding-synonymous,coding-synonymous,coding-synonymous	SLC7A7	NM_001126105.2,NM_001126106.2,NM_003982.3	,,	0,10,6493	AA,AG,GG		0.1047,0.0227,0.0769	,,	78/512,78/512,78/512	23282374	10,12996	2203	4300	6503	22352214	SO:0001819	synonymous_variant	9056	exon3			AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692	ENST00000397532.3:c.234C>T	14.37:g.23282374G>A		Somatic		Capture	Illumina HiSeq	Phase_I	22352214	NM_001126106	B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Silent	SNP	ENST00000397532.3	37	CCDS9574.1																																																																																				SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071636.3		
VRTN	55237	broad.mit.edu	37	14	74823752	74823752	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr14:74823752C>T	ENST00000256362.4	+	2	507	c.266C>T	c.(265-267)gCg>gTg	p.A89V		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	89					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)	p.A89V(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						CTGTTCGAGGCGGCCAGCATG	0.652																																					p.A89V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C266T	14						.						50.0	45.0	46.0					14																	74823752		2203	4300	6503	73893505	SO:0001583	missense	55237	exon2			AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.266C>T	14.37:g.74823752C>T	ENSP00000256362:p.Ala89Val	Somatic		Capture	Illumina HiSeq	Phase_I	73893505	NM_018228	Q9NVC7	Missense_Mutation	SNP	ENST00000256362.4	37	CCDS9830.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.873032	0.91664	.	.	ENSG00000133980	ENST00000256362	T	0.35236	1.32	4.91	4.91	0.64330	.	0.000000	0.64402	D	0.000001	T	0.42787	0.1218	N	0.24115	0.695	0.54753	D	0.999982	D	0.89917	1.0	P	0.59221	0.854	T	0.44128	-0.9348	10	0.87932	D	0	0.1307	16.4306	0.83841	0.0:1.0:0.0:0.0	.	89	Q9H8Y1	VRTN_HUMAN	V	89	ENSP00000256362:A89V	ENSP00000256362:A89V	A	+	2	0	VRTN	73893505	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.858000	0.75461	2.540000	0.85666	0.561000	0.74099	GCG		VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228	
LTBP2	4053	broad.mit.edu	37	14	74999214	74999214	+	Silent	SNP	G	G	A	rs200919399		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr14:74999214G>A	ENST00000261978.4	-	10	2288	c.1902C>T	c.(1900-1902)gaC>gaT	p.D634D	LTBP2_ENST00000556690.1_Silent_p.D634D	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	634	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.D634D(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CACACTCCGCGTCCTTGCACA	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		17252	0.0		0.001	False		,,,				2504	0.0				p.D634D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1902T	14						.						125.0	85.0	98.0					14																	74999214		2203	4300	6503	74068967	SO:0001819	synonymous_variant	4053	exon10				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.1902C>T	14.37:g.74999214G>A		Somatic		Capture	Illumina HiSeq	Phase_I	74068967	NM_000428	Q99907|Q9NS51	Silent	SNP	ENST00000261978.4	37	CCDS9831.1																																																																																				LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
AHNAK2	113146	broad.mit.edu	37	14	105418160	105418160	+	Missense_Mutation	SNP	C	C	T	rs371315830		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr14:105418160C>T	ENST00000333244.5	-	7	3747	c.3628G>A	c.(3628-3630)Gac>Aac	p.D1210N	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1210						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.D1210N(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ATGCTGAGGTCAGTGGTCTTG	0.647																																					p.D1210N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3628A	14						.						107.0	82.0	90.0					14																	105418160		1925	3789	5714	104489205	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.3628G>A	14.37:g.105418160C>T	ENSP00000353114:p.Asp1210Asn	Somatic		Capture	Illumina HiSeq	Phase_I	104489205	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	15.02	2.707832	0.48412	.	.	ENSG00000185567	ENST00000333244	T	0.01265	5.08	4.46	1.33	0.21861	.	.	.	.	.	T	0.03651	0.0104	M	0.82923	2.615	0.09310	N	1	B	0.19073	0.033	B	0.24269	0.052	T	0.19679	-1.0298	9	0.51188	T	0.08	.	13.2275	0.59922	0.0:0.4958:0.5042:0.0	.	1210	Q8IVF2	AHNK2_HUMAN	N	1210	ENSP00000353114:D1210N	ENSP00000353114:D1210N	D	-	1	0	AHNAK2	104489205	0.000000	0.05858	0.001000	0.08648	0.031000	0.12232	0.122000	0.15687	0.320000	0.23234	-0.334000	0.08254	GAC		AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
HERC2	8924	broad.mit.edu	37	15	28514429	28514429	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr15:28514429G>A	ENST00000261609.7	-	11	1519	c.1411C>T	c.(1411-1413)Cgc>Tgc	p.R471C		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.R471C(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GTGTACACGCGGCCATTGCGT	0.557																																					p.R471C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1411T	15						.						98.0	75.0	83.0					15																	28514429		2203	4300	6503	26188024	SO:0001583	missense	8924	exon11			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.1411C>T	15.37:g.28514429G>A	ENSP00000261609:p.Arg471Cys	Somatic		Capture	Illumina HiSeq	Phase_I	26188024	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	9.599	1.128311	0.21041	.	.	ENSG00000128731	ENST00000261609	T	0.81330	-1.48	5.74	1.35	0.21983	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.192193	0.44097	D	0.000485	T	0.67363	0.2885	L	0.39898	1.24	0.27044	N	0.963946	D	0.55385	0.971	B	0.37550	0.253	T	0.63941	-0.6523	10	0.51188	T	0.08	.	10.4787	0.44680	0.0644:0.0:0.4859:0.4497	.	471	O95714	HERC2_HUMAN	C	471	ENSP00000261609:R471C	ENSP00000261609:R471C	R	-	1	0	HERC2	26188024	0.990000	0.36364	0.976000	0.42696	0.070000	0.16714	1.780000	0.38634	0.772000	0.33382	-0.927000	0.02713	CGC		HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
NTRK3	4916	broad.mit.edu	37	15	88669523	88669523	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr15:88669523G>A	ENST00000360948.2	-	12	1536	c.1375C>T	c.(1375-1377)Cgg>Tgg	p.R459W	NTRK3_ENST00000394480.2_Missense_Mutation_p.R459W|NTRK3_ENST00000317501.3_Missense_Mutation_p.R459W|NTRK3_ENST00000558676.1_Missense_Mutation_p.R451W|NTRK3_ENST00000557856.1_Missense_Mutation_p.R451W|NTRK3_ENST00000357724.2_Missense_Mutation_p.R451W|NTRK3_ENST00000542733.2_Missense_Mutation_p.R361W|NTRK3_ENST00000558306.1_Intron|NTRK3_ENST00000540489.2_Missense_Mutation_p.R459W|NTRK3_ENST00000355254.2_Missense_Mutation_p.R459W	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	459					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R459W(3)|p.R459G(3)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			AATTTGGACCGTCGACCATAT	0.433			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.R459W			Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	.	6	Substitution - Missense(6)	large_intestine(3)|lung(3)	c.C1375T	15						.						111.0	96.0	101.0					15																	88669523		2201	4299	6500	86470527	SO:0001583	missense	4916	exon12			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1375C>T	15.37:g.88669523G>A	ENSP00000354207:p.Arg459Trp	Somatic		Capture	Illumina HiSeq	Phase_I	86470527	NM_001007156	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.631612	0.87660	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.75154	-0.91;-0.86;-0.9;-0.91;-0.79;-0.09;-0.09	5.39	4.45	0.53987	.	0.000000	0.85682	D	0.000000	D	0.83751	0.5322	M	0.64404	1.975	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.993;0.982;0.999;0.998;0.982	D	0.85379	0.1118	10	0.87932	D	0	.	14.0241	0.64575	0.0:0.0:0.8361:0.1639	.	361;451;451;459;459;459	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	W	459;459;451;459;361;459;459	ENSP00000377990:R459W;ENSP00000354207:R459W;ENSP00000350356:R451W;ENSP00000347397:R459W;ENSP00000437773:R361W;ENSP00000444673:R459W;ENSP00000318328:R459W	ENSP00000318328:R459W	R	-	1	2	NTRK3	86470527	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	6.303000	0.72794	1.213000	0.43380	0.655000	0.94253	CGG		NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
CCNF	899	broad.mit.edu	37	16	2503294	2503294	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr16:2503294A>C	ENST00000397066.4	+	14	1659	c.1571A>C	c.(1570-1572)gAa>gCa	p.E524A	RP11-715J22.3_ENST00000561653.1_RNA|RP11-715J22.4_ENST00000566085.1_lincRNA	NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	524					mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)		p.E524A(2)		breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				CGCTATGGAGAAATCAGCCAG	0.632																																					p.E524A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1571C	16						.						71.0	71.0	71.0					16																	2503294		2198	4300	6498	2443295	SO:0001583	missense	899	exon14			Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.1571A>C	16.37:g.2503294A>C	ENSP00000380256:p.Glu524Ala	Somatic		Capture	Illumina HiSeq	Phase_I	2443295	NM_001761	B2R8H3|Q96EG9	Missense_Mutation	SNP	ENST00000397066.4	37	CCDS10467.1	.	.	.	.	.	.	.	.	.	.	A	11.39	1.624771	0.28889	.	.	ENSG00000162063	ENST00000397066;ENST00000293968	T	0.22336	1.96	4.29	1.9	0.25705	Cyclin, C-terminal (1);Cyclin-like (2);	0.294672	0.37095	N	0.002243	T	0.12987	0.0315	L	0.34521	1.04	0.27840	N	0.941134	P	0.35527	0.507	B	0.34590	0.186	T	0.17592	-1.0364	10	0.19590	T	0.45	-10.0972	8.017	0.30387	0.8064:0.0:0.1936:0.0	.	524	P41002	CCNF_HUMAN	A	524;439	ENSP00000380256:E524A	ENSP00000293968:E439A	E	+	2	0	CCNF	2443295	1.000000	0.71417	0.175000	0.22980	0.887000	0.51463	5.481000	0.66826	0.591000	0.29711	0.460000	0.39030	GAA		CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250801.1	NM_001761	
INO80E	283899	broad.mit.edu	37	16	30012335	30012336	+	Missense_Mutation	DNP	GG	GG	CA	rs201014829	byFrequency	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	GG	GG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr16:30012335_30012336GG>CA	ENST00000563197.1	+	5	1387_1388	c.370_371GG>CA	c.(370-372)GGg>CAg	p.G124Q	INO80E_ENST00000567705.1_Missense_Mutation_p.G124Q|INO80E_ENST00000567254.1_Missense_Mutation_p.G124Q|INO80E_ENST00000304516.7_Missense_Mutation_p.G124Q	NM_173618.1	NP_775889.1	Q8NBZ0	IN80E_HUMAN	INO80 complex subunit E	124	Pro-rich.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.G124>?(1)		endometrium(1)|large_intestine(2)|lung(1)|skin(1)|urinary_tract(1)	6						TCAGGCCTCCGGGGTCCCCTCC	0.653																																					.												.	.	1	Complex(1)	large_intestine(1)	c.370_371CA	16						.																																			29919837	SO:0001583	missense	283899	exon5			AK075133	CCDS10665.1	16p11.2	2011-07-06	2008-08-07	2008-08-07	ENSG00000169592	ENSG00000169592		"""INO80 complex subunits"""	26905	protein-coding gene	gene with protein product			"""coiled-coil domain containing 95"""	CCDC95		16230350	Standard	NM_173618		Approved	FLJ90652	uc002dvg.1	Q8NBZ0	OTTHUMG00000132114	Exception_encountered	16.37:g.30012335_30012336delinsCA	ENSP00000457016:p.Gly124Gln	Somatic		Capture	Illumina HiSeq	Phase_I	29919836	NM_173618	Q6Y2K3	Missense_Mutation	DNP	ENST00000563197.1	37	CCDS10665.1																																																																																				INO80E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255156.2	NM_173618	
TP53	7157	broad.mit.edu	37	17	7578508	7578508	+	Missense_Mutation	SNP	C	C	G	rs587781288		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr17:7578508C>G	ENST00000269305.4	-	5	611	c.422G>C	c.(421-423)tGc>tCc	p.C141S	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.C141S|TP53_ENST00000420246.2_Missense_Mutation_p.C141S|TP53_ENST00000359597.4_Missense_Mutation_p.C141S|TP53_ENST00000413465.2_Missense_Mutation_p.C141S|TP53_ENST00000445888.2_Missense_Mutation_p.C141S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	141	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> A (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C141Y(79)|p.0?(8)|p.C9Y(5)|p.C48Y(5)|p.A138_P142delAKTCP(4)|p.C141F(4)|p.C141S(3)|p.N131fs*27(2)|p.C9S(1)|p.K139_C141>N(1)|p.L137_W146del10(1)|p.C141A(1)|p.A6_P10delAKTCP(1)|p.K139fs*4(1)|p.A45_P49delAKTCP(1)|p.T140fs*28(1)|p.A138_V143delAKTCPV(1)|p.C48S(1)|p.C141fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGCACAGGGCAGGTCTTGGC	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C141S	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	121	Substitution - Missense(99)|Whole gene deletion(8)|Deletion - In frame(8)|Deletion - Frameshift(5)|Complex - deletion inframe(1)	large_intestine(23)|breast(17)|ovary(12)|haematopoietic_and_lymphoid_tissue(7)|oesophagus(7)|liver(7)|upper_aerodigestive_tract(6)|central_nervous_system(6)|endometrium(6)|urinary_tract(6)|lung(5)|prostate(5)|bone(5)|stomach(4)|soft_tissue(2)|biliary_tract(1)|testis(1)|pancreas(1)	c.G422C	17	GRCh37	CM993216	TP53	M		.						56.0	55.0	55.0					17																	7578508		2203	4300	6503	7519233	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.422G>C	17.37:g.7578508C>G	ENSP00000269305:p.Cys141Ser	Somatic		Capture	Illumina HiSeq	Phase_I	7519233	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	14.75	2.627859	0.46944	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99795	-6.78;-6.78;-6.78;-6.78;-6.78;-6.78;-6.78;-6.78;-6.78	5.48	4.5	0.54988	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.046412	0.85682	D	0.000000	D	0.99677	0.9879	M	0.78344	2.41	0.58432	D	0.999996	D;P;D;D;P;D;D	0.89917	1.0;0.933;0.998;1.0;0.945;1.0;1.0	D;P;D;D;P;D;D	0.97110	0.999;0.841;0.978;0.999;0.859;1.0;0.999	D	0.97827	1.0260	10	0.45353	T	0.12	-26.1094	13.743	0.62860	0.1552:0.8448:0.0:0.0	.	102;141;141;48;141;141;141	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	S	141;141;141;141;141;141;130;48;9;48;9;141	ENSP00000410739:C141S;ENSP00000352610:C141S;ENSP00000269305:C141S;ENSP00000398846:C141S;ENSP00000391127:C141S;ENSP00000391478:C141S;ENSP00000425104:C9S;ENSP00000423862:C48S;ENSP00000424104:C141S	ENSP00000269305:C141S	C	-	2	0	TP53	7519233	1.000000	0.71417	0.996000	0.52242	0.022000	0.10575	6.016000	0.70798	1.427000	0.47276	-0.182000	0.12963	TGC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MAP2K4	6416	broad.mit.edu	37	17	12028668	12028668	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr17:12028668T>C	ENST00000353533.5	+	8	934	c.871T>C	c.(871-873)Tgg>Cgg	p.W291R	MAP2K4_ENST00000415385.3_Missense_Mutation_p.W302R	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	291	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(3)|p.W291R(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		CTCTGATGTCTGGAGTTTGGG	0.388			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																p.W291R			Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	.	.	14	Whole gene deletion(10)|Unknown(3)|Substitution - Missense(1)	breast(4)|ovary(4)|large_intestine(2)|lung(2)|biliary_tract(1)|pancreas(1)	c.T871C	17						.						253.0	197.0	216.0					17																	12028668		2203	4300	6503	11969393	SO:0001583	missense	6416	exon8			L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.871T>C	17.37:g.12028668T>C	ENSP00000262445:p.Trp291Arg	Somatic		Capture	Illumina HiSeq	Phase_I	11969393	NM_003010	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Missense_Mutation	SNP	ENST00000353533.5	37	CCDS11162.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.689425	0.88735	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465;ENST00000536413	T;T	0.40225	1.04;1.04	5.1	5.1	0.69264	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.78387	0.4275	H	0.98786	4.33	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87047	0.2144	10	0.87932	D	0	.	14.2907	0.66275	0.0:0.0:0.0:1.0	.	163;302;291	B7ZA62;P45985-2;P45985	.;.;MP2K4_HUMAN	R	291;302;268;163	ENSP00000262445:W291R;ENSP00000410402:W302R	ENSP00000262445:W291R	W	+	1	0	MAP2K4	11969393	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.793000	0.85851	2.270000	0.75569	0.460000	0.39030	TGG		MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441226.1		
WIPF2	147179	broad.mit.edu	37	17	38421041	38421044	+	Frame_Shift_Del	DEL	AGAG	AGAG	-			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	AGAG	AGAG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr17:38421041_38421044delAGAG	ENST00000323571.4	+	5	853_856	c.613_616delAGAG	c.(613-618)agagagfs	p.RE205fs	WIPF2_ENST00000585043.1_Frame_Shift_Del_p.RE205fs|WIPF2_ENST00000394103.3_Intron|WIPF2_ENST00000583130.1_Frame_Shift_Del_p.RE205fs|WIPF2_ENST00000536600.1_Intron|WIPF2_ENST00000494757.1_3'UTR	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	205					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)		p.E206fs*31(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						CGCCTACAACAGAGAGAAACCCTT	0.642										HNSCC(43;0.11)																											p.205_206del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.613_616del	17						.																																			35674570	SO:0001589	frameshift_variant	147179	exon5			BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.613_616delAGAG	17.37:g.38421041_38421044delAGAG	ENSP00000320924:p.Arg205fs	Somatic		Capture	Illumina HiSeq	Phase_I	35674567	NM_133264	A8K0L3|Q658J8|Q71RE1|Q8TE44	Frame_Shift_Del	DEL	ENST00000323571.4	37	CCDS11364.1																																																																																				WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257157.2	NM_133264	
ZNF207	7756	broad.mit.edu	37	17	30677208	30677208	+	5'UTR	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr17:30677208G>A	ENST00000321233.6	+	0	58				ZNF207_ENST00000341711.6_5'UTR|ZNF207_ENST00000394673.2_5'UTR|ZNF207_ENST00000342555.6_5'UTR|MIR632_ENST00000385193.1_RNA|ZNF207_ENST00000577908.1_5'UTR|ZNF207_ENST00000394670.4_5'UTR|RP11-227G15.3_ENST00000581915.1_RNA	NM_003457.3	NP_003448.1	O43670	ZN207_HUMAN	zinc finger protein 207						attachment of spindle microtubules to kinetochore (GO:0008608)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein stabilization (GO:0050821)|regulation of chromosome segregation (GO:0051983)|regulation of transcription, DNA-templated (GO:0006355)	kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|lung(3)|urinary_tract(2)	10		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			CCTGTGGGACGTGGTGGTAGC	0.577																																					.												.	.	0			.	17						.						171.0	166.0	167.0					17																	30677208		1568	3582	5150	27701321	SO:0001623	5_prime_UTR_variant	7756	.			AF046001	CCDS11271.1, CCDS32614.1, CCDS42294.1	17q11.2	2008-07-10			ENSG00000010244	ENSG00000010244		"""Zinc fingers, C2H2-type"""	12998	protein-coding gene	gene with protein product		603428				9799612	Standard	NM_001098507		Approved		uc002hhj.4	O43670	OTTHUMG00000132810	ENST00000321233.6:c.-97G>A	17.37:g.30677208G>A		Somatic		Capture	Illumina HiSeq	Phase_I	27701321	.	A8K6Y6|E1P660|E1P661|E1P662|Q53XS9|Q96HW5|Q9BUQ7	De_novo_Start_OutOfFrame	SNP	ENST00000321233.6	37	CCDS11271.1																																																																																				ZNF207-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256251.2		
WIZ	58525	broad.mit.edu	37	19	15538075	15538075	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr19:15538075C>G	ENST00000389282.4	-	6	3583	c.3370G>C	c.(3370-3372)Gaa>Caa	p.E1124Q	WIZ_ENST00000263381.7_Missense_Mutation_p.E267Q|WIZ_ENST00000599686.3_Missense_Mutation_p.E308Q|WIZ_ENST00000545156.1_Missense_Mutation_p.E438Q|WIZ_ENST00000599910.2_Missense_Mutation_p.E441Q			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	1124	Pro-rich.				positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.E1124Q(1)|p.E267Q(1)|p.E438Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						CTGCGGGCTTCCAGTGAGCTG	0.667																																					p.E267Q												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G799C	19						.						32.0	38.0	36.0					19																	15538075		2029	4182	6211	15399075	SO:0001583	missense	58525	exon4			AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.3370G>C	19.37:g.15538075C>G	ENSP00000373933:p.Glu1124Gln	Somatic		Capture	Illumina HiSeq	Phase_I	15399075	NM_021241	B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Missense_Mutation	SNP	ENST00000389282.4	37		.	.	.	.	.	.	.	.	.	.	C	23.5	4.429629	0.83776	.	.	ENSG00000011451	ENST00000389282;ENST00000263381;ENST00000416927;ENST00000545156	T;T;T	0.29655	1.56;1.56;1.56	5.51	5.51	0.81932	.	0.485962	0.21854	N	0.068130	T	0.33030	0.0849	N	0.24115	0.695	0.41448	D	0.987962	P;P;D	0.54047	0.534;0.821;0.964	B;P;P	0.52672	0.203;0.515;0.706	T	0.02713	-1.1120	10	0.16896	T	0.51	-7.6489	18.1957	0.89820	0.0:1.0:0.0:0.0	.	1124;267;308	O95785;O95785-2;B3KVH1	WIZ_HUMAN;.;.	Q	1124;267;308;438	ENSP00000373933:E1124Q;ENSP00000263381:E267Q;ENSP00000445824:E438Q	ENSP00000263381:E267Q	E	-	1	0	WIZ	15399075	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	3.080000	0.50112	2.590000	0.87494	0.561000	0.74099	GAA		WIZ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021241	
CYP4F2	8529	broad.mit.edu	37	19	15990704	15990704	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr19:15990704G>T	ENST00000221700.6	-	10	1214	c.1119C>A	c.(1117-1119)gaC>gaA	p.D373E		NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2									p.D373E(1)		NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GGGCCAGGTCGTCCCTAAGGA	0.557																																					p.D373E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1119A	19						.						94.0	99.0	97.0					19																	15990704		2203	4300	6503	15851704	SO:0001583	missense	8529	exon10			U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.1119C>A	19.37:g.15990704G>T	ENSP00000221700:p.Asp373Glu	Somatic		Capture	Illumina HiSeq	Phase_I	15851704	NM_001082		Missense_Mutation	SNP	ENST00000221700.6	37	CCDS12336.1	.	.	.	.	.	.	.	.	.	.	g	2.829	-0.242970	0.05906	.	.	ENSG00000186115	ENST00000221700;ENST00000392846	T	0.67523	-0.27	2.78	-0.644	0.11479	.	0.081041	0.47852	U	0.000219	T	0.47967	0.1474	L	0.27053	0.805	0.80722	D	1	B	0.28258	0.205	B	0.35114	0.196	T	0.10019	-1.0648	10	0.26408	T	0.33	.	5.5933	0.17313	0.5701:0.0:0.4299:0.0	.	373	P78329	CP4F2_HUMAN	E	373;224	ENSP00000221700:D373E	ENSP00000221700:D373E	D	-	3	2	CYP4F2	15851704	0.899000	0.30636	0.998000	0.56505	0.363000	0.29612	-0.117000	0.10708	0.059000	0.16252	-0.424000	0.05967	GAC		CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460372.3	NM_001082	
ATP4A	495	broad.mit.edu	37	19	36050944	36050944	+	Silent	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr19:36050944G>A	ENST00000262623.3	-	7	847	c.819C>T	c.(817-819)ggC>ggT	p.G273G		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	273					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)	p.G273G(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	TGGTGCGGTCGCCCGTGTTCA	0.642																																					p.G273G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C819T	19						.						61.0	49.0	53.0					19																	36050944		2203	4300	6503	40742784	SO:0001819	synonymous_variant	495	exon7				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.819C>T	19.37:g.36050944G>A		Somatic		Capture	Illumina HiSeq	Phase_I	40742784	NM_000704	O00738	Silent	SNP	ENST00000262623.3	37	CCDS12467.1																																																																																				ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
ZNF285	26974	broad.mit.edu	37	19	44891508	44891508	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr19:44891508C>A	ENST00000330997.4	-	4	963	c.899G>T	c.(898-900)aGc>aTc	p.S300I	ZNF285_ENST00000591679.1_Missense_Mutation_p.S307I|ZNF285_ENST00000544719.2_Missense_Mutation_p.S300I|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	300					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S300I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						AAGGTCTGAGCTCTGTTTGCA	0.463																																					p.S300I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G899T	19						.						84.0	93.0	90.0					19																	44891508		2203	4300	6503	49583348	SO:0001583	missense	26974	exon4			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.899G>T	19.37:g.44891508C>A	ENSP00000333595:p.Ser300Ile	Somatic		Capture	Illumina HiSeq	Phase_I	49583348	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	C	8.226	0.803564	0.16467	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.15952	2.38	3.8	0.261	0.15592	.	.	.	.	.	T	0.16514	0.0397	M	0.69523	2.12	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.001	T	0.30001	-0.9993	9	0.38643	T	0.18	.	3.5704	0.07916	0.1691:0.4509:0.0:0.3799	.	324;300	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	I	323;300	ENSP00000333595:S300I	ENSP00000333595:S300I	S	-	2	0	ZNF285	49583348	0.000000	0.05858	0.013000	0.15412	0.015000	0.08874	-1.432000	0.02430	-0.060000	0.13132	-0.512000	0.04463	AGC		ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
ZNF264	9422	broad.mit.edu	37	19	57724114	57724114	+	Missense_Mutation	SNP	G	G	A	rs115695746	byFrequency	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr19:57724114G>A	ENST00000263095.6	+	4	2063	c.1649G>A	c.(1648-1650)cGc>cAc	p.R550H	ZNF264_ENST00000536056.1_Missense_Mutation_p.R550H	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	550					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R550H(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		GCCTTCAGTCGCAGCTCGTCC	0.463													g|||	5	0.000998403	0.0	0.0029	5008	,	,		20560	0.003		0.0	False		,,,				2504	0.0				p.R550H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1649A	19						.						102.0	98.0	99.0					19																	57724114		2203	4300	6503	62415926	SO:0001583	missense	9422	exon4			AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.1649G>A	19.37:g.57724114G>A	ENSP00000263095:p.Arg550His	Somatic		Capture	Illumina HiSeq	Phase_I	62415926	NM_003417	A8K8Y9|Q9P1V0	Missense_Mutation	SNP	ENST00000263095.6	37	CCDS33127.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	14.03	2.412462	0.42817	.	.	ENSG00000083844	ENST00000263095;ENST00000536056	T;T	0.17854	2.25;2.25	2.35	1.25	0.21368	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22399	0.0540	N	0.25957	0.775	0.21325	N	0.999725	D	0.89917	1.0	D	0.66716	0.946	T	0.22977	-1.0201	9	0.19590	T	0.45	.	9.8583	0.41098	0.0:0.0:0.794:0.206	.	550	O43296	ZN264_HUMAN	H	550	ENSP00000263095:R550H;ENSP00000440376:R550H	ENSP00000263095:R550H	R	+	2	0	ZNF264	62415926	0.000000	0.05858	0.968000	0.41197	0.994000	0.84299	0.176000	0.16782	0.534000	0.28695	0.491000	0.48974	CGC		ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465080.1		
NPPA	4878	broad.mit.edu	37	1	11907639	11907639	+	Missense_Mutation	SNP	C	C	T	rs202145205		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:11907639C>T	ENST00000376480.3	-	1	201	c.103G>A	c.(103-105)Gca>Aca	p.A35T	NPPA-AS1_ENST00000446542.1_RNA|NPPA_ENST00000376476.1_Intron|NPPA-AS1_ENST00000400892.2_RNA	NM_006172.3	NP_006163.1	P01160	ANF_HUMAN	natriuretic peptide A	35					cardiac muscle hypertrophy in response to stress (GO:0014898)|cellular response to mechanical stimulus (GO:0071260)|cGMP biosynthetic process (GO:0006182)|female pregnancy (GO:0007565)|gene expression (GO:0010467)|negative regulation of cell growth (GO:0030308)|negative regulation of systemic arterial blood pressure (GO:0003085)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|transcription initiation from RNA polymerase II promoter (GO:0006367)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mast cell granule (GO:0042629)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)	p.A35T(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATCAGGTCTGCGTTGGACACG	0.552																																					p.A35T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G103A	1						.						186.0	173.0	178.0					1																	11907639		2203	4300	6503	11830226	SO:0001583	missense	4878	exon1			BC005893	CCDS139.1	1p36.21	2014-09-17	2010-11-09		ENSG00000175206	ENSG00000175206		"""Endogenous ligands"""	7939	protein-coding gene	gene with protein product		108780	"""natriuretic peptide precursor A"""	ANP, PND			Standard	NM_006172		Approved		uc001ati.3	P01160	OTTHUMG00000002388	ENST00000376480.3:c.103G>A	1.37:g.11907639C>T	ENSP00000365663:p.Ala35Thr	Somatic		Capture	Illumina HiSeq	Phase_I	11830226	NM_006172	Q13766|Q5JZE1	Missense_Mutation	SNP	ENST00000376480.3	37	CCDS139.1	.	.	.	.	.	.	.	.	.	.	C	8.703	0.910106	0.17833	.	.	ENSG00000175206	ENST00000376480	T	0.42513	0.97	5.84	2.57	0.30868	.	0.676525	0.14223	N	0.333273	T	0.30386	0.0763	L	0.47016	1.485	0.20489	N	0.999892	B	0.21452	0.056	B	0.10450	0.005	T	0.17592	-1.0364	10	0.22706	T	0.39	-0.8554	5.4405	0.16507	0.0:0.6025:0.0:0.3975	.	35	P01160	ANF_HUMAN	T	35	ENSP00000365663:A35T	ENSP00000365663:A35T	A	-	1	0	NPPA	11830226	0.072000	0.21174	0.688000	0.30117	0.510000	0.34073	0.144000	0.16135	0.792000	0.33850	0.491000	0.48974	GCA		NPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006852.1	NM_006172	
AGL	178	broad.mit.edu	37	1	100350132	100350132	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:100350132C>A	ENST00000294724.4	+	20	3032	c.2554C>A	c.(2554-2556)Ctt>Att	p.L852I	AGL_ENST00000370163.3_Missense_Mutation_p.L852I|AGL_ENST00000361302.3_Missense_Mutation_p.L836I|AGL_ENST00000370161.2_Missense_Mutation_p.L836I|AGL_ENST00000361915.3_Missense_Mutation_p.L852I|AGL_ENST00000370165.3_Missense_Mutation_p.L852I|AGL_ENST00000361522.4_Missense_Mutation_p.L835I	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	852					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)	p.L852I(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		CAGAGTTAGTCTTGATCCACA	0.323																																					p.L835I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2503A	1						.						60.0	60.0	60.0					1																	100350132		2203	4300	6503	100122720	SO:0001583	missense	178	exon18			BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.2554C>A	1.37:g.100350132C>A	ENSP00000294724:p.Leu852Ile	Somatic		Capture	Illumina HiSeq	Phase_I	100122720	NM_000645	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	37	CCDS759.1	.	.	.	.	.	.	.	.	.	.	C	16.81	3.226262	0.58668	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	T;T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5;1.5	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.24314	0.0589	L	0.28344	0.845	0.58432	D	0.999995	P;P;P	0.51351	0.944;0.944;0.908	P;P;P	0.56700	0.804;0.804;0.692	T	0.01460	-1.1349	10	0.25751	T	0.34	-22.0042	14.5832	0.68305	0.1461:0.8539:0.0:0.0	.	835;836;852	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	I	852;852;852;852;836;836;835	ENSP00000355106:L852I;ENSP00000359184:L852I;ENSP00000359182:L852I;ENSP00000294724:L852I;ENSP00000354971:L836I;ENSP00000359180:L836I;ENSP00000354635:L835I	ENSP00000294724:L852I	L	+	1	0	AGL	100122720	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	2.489000	0.45285	2.677000	0.91161	0.557000	0.71058	CTT		AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
B4GALT3	8703	broad.mit.edu	37	1	161144815	161144815	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:161144815G>T	ENST00000319769.5	-	4	679	c.457C>A	c.(457-459)Cag>Aag	p.Q153K	B4GALT3_ENST00000470882.1_5'UTR|PPOX_ENST00000535223.1_Intron|PPOX_ENST00000495483.1_Intron|B4GALT3_ENST00000367998.1_Missense_Mutation_p.Q153K|PPOX_ENST00000432542.2_Intron	NM_001199873.1|NM_003779.3	NP_001186802.1|NP_003770.1	O60512	B4GT3_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3	153					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)	p.Q153K(1)		cervix(1)|endometrium(5)|large_intestine(6)|lung(6)	18	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		N-Acetyl-D-glucosamine(DB00141)	TAAGCAAGCTGCTGGCGCTGC	0.567																																					p.Q153K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C457A	1						.						72.0	73.0	73.0					1																	161144815		2203	4300	6503	159411439	SO:0001583	missense	8703	exon4			BC006099	CCDS1222.1	1q21-q23	2013-02-19			ENSG00000158850	ENSG00000158850		"""Beta 4-glycosyltransferases"""	926	protein-coding gene	gene with protein product		604014				9405390, 9597550	Standard	NM_001199873		Approved	beta4Gal-T3	uc001fys.2	O60512	OTTHUMG00000034348	ENST00000319769.5:c.457C>A	1.37:g.161144815G>T	ENSP00000320965:p.Gln153Lys	Somatic		Capture	Illumina HiSeq	Phase_I	159411439	NM_001199874	D3DVG3|O60910|Q9BPZ4|Q9H8T2	Missense_Mutation	SNP	ENST00000319769.5	37	CCDS1222.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.6|28.6	4.935853|4.935853	0.92458|0.92458	.|.	.|.	ENSG00000158850|ENSG00000158850	ENST00000310413|ENST00000319769;ENST00000407555;ENST00000541560;ENST00000367998;ENST00000367997	.|T;T	.|0.21191	.|2.02;2.02	4.9|4.9	4.9|4.9	0.64082|0.64082	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.35128|0.35128	0.0921|0.0921	L|L	0.56396|0.56396	1.775|1.775	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.986;1.0	.|D;D	.|0.97110	.|0.966;1.0	T|T	0.04140|0.04140	-1.0974|-1.0974	6|10	0.54805|0.51188	T|T	0.06|0.08	.|.	17.0151|17.0151	0.86416|0.86416	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|153;153	.|B3KPV4;O60512	.|.;B4GT3_HUMAN	E|K	130|153;130;153;153;153	.|ENSP00000320965:Q153K;ENSP00000356977:Q153K	ENSP00000308551:A130E|ENSP00000320965:Q153K	A|Q	-|-	2|1	0|0	B4GALT3|B4GALT3	159411439|159411439	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	6.339000|6.339000	0.72969|0.72969	2.539000|2.539000	0.85634|0.85634	0.563000|0.563000	0.77884|0.77884	GCA|CAG		B4GALT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083054.1	NM_003779	
TNR	7143	broad.mit.edu	37	1	175331866	175331866	+	Silent	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:175331866G>A	ENST00000367674.2	-	14	3495	c.2787C>T	c.(2785-2787)taC>taT	p.Y929Y	TNR_ENST00000263525.2_Silent_p.Y929Y			Q92752	TENR_HUMAN	tenascin R	929	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.Y929Y(2)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GGCTGATTTCGTATTCGGTAG	0.532																																					p.Y929Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2787T	1						.						218.0	185.0	196.0					1																	175331866		2203	4300	6503	173598489	SO:0001819	synonymous_variant	7143	exon14			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2787C>T	1.37:g.175331866G>A		Somatic		Capture	Illumina HiSeq	Phase_I	173598489	NM_003285	C9J563|Q15568|Q5R3G0	Silent	SNP	ENST00000367674.2	37	CCDS1318.1																																																																																				TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
IGFN1	91156	broad.mit.edu	37	1	201195001	201195001	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:201195001G>A	ENST00000295591.8	+	21	10470	c.1820G>A	c.(1819-1821)gGa>gAa	p.G607E	RP11-567E21.3_ENST00000453155.1_RNA|IGFN1_ENST00000335211.4_Silent_p.G3512G			Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)		p.G672G(2)|p.G3512G(2)		autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						ACGTGCCTGGGACGGTGACGG	0.687																																					p.G3512G												.	.	4	Substitution - coding silent(4)	large_intestine(2)|lung(2)	c.G10536A	1						.						44.0	41.0	42.0					1																	201195001		2203	4300	6503	199461624	SO:0001583	missense	91156	exon22			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000295591.8:c.1820G>A	1.37:g.201195001G>A	ENSP00000295591:p.Gly607Glu	Somatic		Capture	Illumina HiSeq	Phase_I	199461624	NM_001164586	F8WAI1|Q9NT72	Silent	SNP	ENST00000295591.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.69|12.69	2.014738|2.014738	0.35511|0.35511	.|.	.|.	ENSG00000163395|ENSG00000163395	ENST00000412892|ENST00000295591	.|T	.|0.53640	.|0.61	5.19|5.19	-0.263|-0.263	0.12954|0.12954	.|.	.|0.124363	.|0.53938	.|D	.|0.000050	T|T	0.38188|0.38188	0.1031|0.1031	.|.	.|.	.|.	0.21604|0.21604	N|N	0.999626|0.999626	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.32981|0.32981	-0.9886|-0.9886	4|7	.|0.87932	.|D	.|0	.|.	1.961|1.961	0.03386|0.03386	0.1415:0.3156:0.2546:0.2883|0.1415:0.3156:0.2546:0.2883	.|.	.|.	.|.	.|.	N|E	930|607	.|ENSP00000295591:G607E	.|ENSP00000295591:G607E	D|G	+|+	1|2	0|0	IGFN1|IGFN1	199461624|199461624	0.234000|0.234000	0.23783|0.23783	0.282000|0.282000	0.24776|0.24776	0.448000|0.448000	0.32197|0.32197	-0.588000|-0.588000	0.05774|0.05774	0.047000|0.047000	0.15862|0.15862	-0.304000|-0.304000	0.09214|0.09214	GAC|GGA		IGFN1-201	KNOWN	basic	protein_coding	protein_coding		NM_178275	
KCNH1	3756	broad.mit.edu	37	1	210971070	210971070	+	Silent	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:210971070G>A	ENST00000271751.4	-	9	1722	c.1695C>T	c.(1693-1695)gcC>gcT	p.A565A	KCNH1_ENST00000367007.4_Silent_p.A538A			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	565					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)	p.A565A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		CGCAGATGTCGGCTCTCATGT	0.597																																					p.A538A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1614T	1						.						59.0	55.0	56.0					1																	210971070		2203	4300	6503	209037693	SO:0001819	synonymous_variant	3756	exon9			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.1695C>T	1.37:g.210971070G>A		Somatic		Capture	Illumina HiSeq	Phase_I	209037693	NM_002238	B1AQ26|O76035|Q14CL3	Silent	SNP	ENST00000271751.4	37	CCDS1496.1																																																																																				KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238	
ZBTB40	9923	broad.mit.edu	37	1	22846665	22846665	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:22846665C>T	ENST00000375647.4	+	14	3152	c.2945C>T	c.(2944-2946)aCg>aTg	p.T982M	ZBTB40_ENST00000404138.1_Missense_Mutation_p.T982M|ZBTB40-IT1_ENST00000438551.1_RNA|ZBTB40_ENST00000374651.4_Missense_Mutation_p.T870M	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	982					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T982M(1)		endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		CCCTGCCCCACGTGTGGGAAG	0.582																																					p.T982M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2945T	1						.						140.0	115.0	123.0					1																	22846665		2203	4300	6503	22719252	SO:0001583	missense	9923	exon14			AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.2945C>T	1.37:g.22846665C>T	ENSP00000364798:p.Thr982Met	Somatic		Capture	Illumina HiSeq	Phase_I	22719252	NM_014870	O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	ENST00000375647.4	37	CCDS224.1	.	.	.	.	.	.	.	.	.	.	C	15.44	2.834051	0.50951	.	.	ENSG00000184677	ENST00000404138;ENST00000375647;ENST00000374651	T;T;T	0.07444	3.19;3.19;3.19	5.79	4.82	0.62117	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.125944	0.36374	N	0.002631	T	0.14227	0.0344	N	0.25094	0.71	0.31924	N	0.613033	D;D	0.89917	1.0;1.0	P;D	0.65773	0.897;0.938	T	0.01326	-1.1384	10	0.66056	D	0.02	-13.3149	10.9601	0.47381	0.1428:0.7188:0.1385:0.0	.	870;982	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	M	982;982;870	ENSP00000384527:T982M;ENSP00000364798:T982M;ENSP00000363782:T870M	ENSP00000363782:T870M	T	+	2	0	ZBTB40	22719252	0.019000	0.18553	0.964000	0.40570	0.886000	0.51366	0.912000	0.28597	2.735000	0.93741	0.561000	0.74099	ACG		ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870	
DUSP10	11221	broad.mit.edu	37	1	221879789	221879789	+	Silent	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:221879789C>T	ENST00000366899.3	-	3	1069	c.831G>A	c.(829-831)aaG>aaA	p.K277K	DUSP10_ENST00000544095.1_5'UTR|DUSP10_ENST00000323825.3_5'UTR|DUSP10_ENST00000468085.1_5'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10	277	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.K277K(1)		NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CATGGTTCTGCTTAAAACTAC	0.537																																					p.K277K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G831A	1						.						45.0	53.0	50.0					1																	221879789		2200	4300	6500	219946412	SO:0001819	synonymous_variant	11221	exon3			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.831G>A	1.37:g.221879789C>T		Somatic		Capture	Illumina HiSeq	Phase_I	219946412	NM_007207	D3DTB4|Q6GSI4|Q9H9Z5	Silent	SNP	ENST00000366899.3	37	CCDS1528.1																																																																																				DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090716.1	NM_007207	
URB2	9816	broad.mit.edu	37	1	229763492	229763492	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:229763492C>A	ENST00000258243.2	+	2	248	c.112C>A	c.(112-114)Cca>Aca	p.P38T	TAF5L_ENST00000258281.2_5'Flank|TAF5L_ENST00000366675.3_5'Flank|TAF5L_ENST00000366674.1_5'Flank|TAF5L_ENST00000477957.1_5'Flank	NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	38						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.P38T(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						GTGCTTTCTTCCAAATAAAGA	0.308																																					p.P38T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C112A	1						.						83.0	94.0	90.0					1																	229763492		2203	4300	6503	227830115	SO:0001583	missense	9816	exon2			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.112C>A	1.37:g.229763492C>A	ENSP00000258243:p.Pro38Thr	Somatic		Capture	Illumina HiSeq	Phase_I	227830115	NM_014777	Q5VYC9	Missense_Mutation	SNP	ENST00000258243.2	37	CCDS31052.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319222	0.81469	.	.	ENSG00000135763	ENST00000258243	T	0.77358	-1.09	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.82683	0.5090	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81331	-0.0981	9	.	.	.	-12.8261	16.7865	0.85575	0.0:1.0:0.0:0.0	.	38	Q14146	URB2_HUMAN	T	38	ENSP00000258243:P38T	.	P	+	1	0	URB2	227830115	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.326000	0.79133	2.464000	0.83262	0.561000	0.74099	CCA		URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777	
OR2T8	343172	broad.mit.edu	37	1	248084629	248084629	+	Missense_Mutation	SNP	A	A	T	rs201244365	byFrequency	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:248084629A>T	ENST00000319968.4	+	1	310	c.310A>T	c.(310-312)Aca>Tca	p.T104S		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T104S(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CTTCCTCCCCACACTGGGTGG	0.592																																					p.T104S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A310T	1						.						7.0	2.0	4.0					1																	248084629		1598	2961	4559	246151252	SO:0001583	missense	343172	exon1				CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.310A>T	1.37:g.248084629A>T	ENSP00000326225:p.Thr104Ser	Somatic		Capture	Illumina HiSeq	Phase_I	246151252	NM_001005522		Missense_Mutation	SNP	ENST00000319968.4	37	CCDS31100.1	.	.	.	.	.	.	.	.	.	.	A	0.047	-1.261457	0.01445	.	.	ENSG00000177462	ENST00000319968	T	0.00453	7.33	3.63	2.46	0.29980	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36303	U	0.002677	T	0.00144	0.0004	N	0.02736	-0.51	0.09310	N	1	P	0.35307	0.494	B	0.31191	0.125	T	0.23119	-1.0197	10	0.21540	T	0.41	.	2.943	0.05836	0.4987:0.0:0.1102:0.3911	.	104	A6NH00	OR2T8_HUMAN	S	104	ENSP00000326225:T104S	ENSP00000326225:T104S	T	+	1	0	OR2T8	246151252	0.000000	0.05858	0.022000	0.16811	0.002000	0.02628	-0.894000	0.04123	0.441000	0.26529	-0.420000	0.06012	ACA		OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096862.1	NM_001005522	
OR2T12	127064	broad.mit.edu	37	1	248458721	248458721	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:248458721G>A	ENST00000317996.1	-	1	159	c.160C>T	c.(160-162)Cac>Tac	p.H54Y		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H54Y(1)		endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			ATGGGCCTGTGGAGCCGGTGG	0.537																																					p.H54Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C160T	1						.						85.0	68.0	74.0					1																	248458721		2203	4300	6503	246525344	SO:0001583	missense	127064	exon1			BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.160C>T	1.37:g.248458721G>A	ENSP00000324583:p.His54Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	246525344	NM_001004692		Missense_Mutation	SNP	ENST00000317996.1	37	CCDS31110.1	.	.	.	.	.	.	.	.	.	.	g	14.79	2.639964	0.47153	.	.	ENSG00000177201	ENST00000317996	T	0.15952	2.38	1.55	1.55	0.23275	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36854	U	0.002375	T	0.40570	0.1122	M	0.91920	3.255	0.35326	D	0.785227	D	0.67145	0.996	P	0.62560	0.904	T	0.54675	-0.8258	10	0.87932	D	0	.	6.8222	0.23862	0.0:0.0:0.7225:0.2775	.	54	Q8NG77	O2T12_HUMAN	Y	54	ENSP00000324583:H54Y	ENSP00000324583:H54Y	H	-	1	0	OR2T12	246525344	0.977000	0.34250	0.193000	0.23327	0.165000	0.22458	2.953000	0.49105	0.645000	0.30675	0.175000	0.17021	CAC		OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692	
DFFB	1677	broad.mit.edu	37	1	3782464	3782464	+	Silent	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:3782464G>A	ENST00000378209.3	+	3	653	c.330G>A	c.(328-330)gaG>gaA	p.E110E	DFFB_ENST00000338895.3_Silent_p.E110E	NM_004402.2	NP_004393.1	O76075	DFFB_HUMAN	DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)	110					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.E110E(1)		endometrium(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		TGTGTGATGAGCAGGCCCCAC	0.637																																					p.E110E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G330A	1						.						34.0	35.0	34.0					1																	3782464		2203	4300	6503	3772324	SO:0001819	synonymous_variant	1677	exon3				CCDS52.1, CCDS72693.1	1p36.3	2014-03-06	2002-08-29		ENSG00000169598	ENSG00000169598			2773	protein-coding gene	gene with protein product		601883				9108473, 9560346	Standard	NM_004402		Approved	CAD, CPAN, DFF-40, DFF40	uc001alc.3	O76075	OTTHUMG00000003525	ENST00000378209.3:c.330G>A	1.37:g.3782464G>A		Somatic		Capture	Illumina HiSeq	Phase_I	3772324	NM_004402	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Silent	SNP	ENST00000378209.3	37	CCDS52.1																																																																																				DFFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009821.2	NM_001282669	
PTPRU	10076	broad.mit.edu	37	1	29633642	29633642	+	Intron	SNP	T	T	C			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:29633642T>C	ENST00000345512.3	+	19	2979				PTPRU_ENST00000428026.2_Intron|PTPRU_ENST00000415600.2_Intron|PTPRU_ENST00000460170.2_Splice_Site_p.I941T|PTPRU_ENST00000356870.3_Splice_Site_p.I941T|PTPRU_ENST00000373779.3_Intron|PTPRU_ENST00000323874.8_Intron	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U						canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.I941T(1)		breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		ATCATTAAGATTCGGATAAAC	0.507																																					p.I941T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2822C	1						.						118.0	124.0	122.0					1																	29633642		2057	4207	6264	29506229	SO:0001627	intron_variant	10076	exon19			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.2850+1702T>C	1.37:g.29633642T>C		Somatic		Capture	Illumina HiSeq	Phase_I	29506229	NM_133177	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	ENST00000345512.3	37	CCDS334.1	.	.	.	.	.	.	.	.	.	.	T	13.40	2.225300	0.39300	.	.	ENSG00000060656	ENST00000356870;ENST00000460170	T;T	0.29655	1.56;1.56	4.51	3.36	0.38483	.	.	.	.	.	T	0.25717	0.0626	N	0.13168	0.305	0.80722	D	1	P;P	0.52170	0.939;0.951	P;P	0.52758	0.584;0.708	T	0.01940	-1.1243	8	.	.	.	.	10.0024	0.41938	0.1514:0.0:0.0:0.8486	.	941;941	Q92729-4;E9PH42	.;.	T	941	ENSP00000349333:I941T;ENSP00000432906:I941T	.	I	+	2	0	PTPRU	29506229	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.196000	0.77805	0.839000	0.34971	-0.336000	0.08194	ATT		PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1		
GRIK3	2899	broad.mit.edu	37	1	37291268	37291268	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:37291268C>A	ENST00000373091.3	-	11	1706	c.1690G>T	c.(1690-1692)Gac>Tac	p.D564Y	GRIK3_ENST00000373093.4_Missense_Mutation_p.D564Y	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	564					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.D564Y(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				ATCCAGATGTCTGGGGACAGG	0.562																																					p.D564Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1690T	1						.						106.0	106.0	106.0					1																	37291268		2203	4300	6503	37063855	SO:0001583	missense	2899	exon11			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1690G>T	1.37:g.37291268C>A	ENSP00000362183:p.Asp564Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	37063855	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.254052	0.80135	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.54675	0.56;0.56	5.46	4.55	0.56014	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.70107	0.3186	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73940	-0.3824	10	0.87932	D	0	.	14.3191	0.66473	0.0:0.9286:0.0:0.0714	.	564;564	A9Z1Z8;Q13003	.;GRIK3_HUMAN	Y	564	ENSP00000362183:D564Y;ENSP00000362185:D564Y	ENSP00000362183:D564Y	D	-	1	0	GRIK3	37063855	1.000000	0.71417	0.977000	0.42913	0.989000	0.77384	7.720000	0.84759	1.300000	0.44818	0.462000	0.41574	GAC		GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
OR14C36	127066	broad.mit.edu	37	1	248512884	248512884	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr1:248512884C>A	ENST00000317861.1	+	1	808	c.808C>A	c.(808-810)Ctg>Atg	p.L270M		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L270M(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						CACCCAGGATCTGATCCTTTC	0.453																																					p.L270M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C808A	1						.						122.0	102.0	109.0					1																	248512884		2203	4300	6503	246579507	SO:0001583	missense	127066	exon1			BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.808C>A	1.37:g.248512884C>A	ENSP00000324534:p.Leu270Met	Somatic		Capture	Illumina HiSeq	Phase_I	246579507	NM_001001918	Q6IEZ6	Missense_Mutation	SNP	ENST00000317861.1	37	CCDS31112.1	.	.	.	.	.	.	.	.	.	.	c	0.203	-1.042916	0.01997	.	.	ENSG00000177174	ENST00000317861	T	0.00207	8.55	3.81	-1.74	0.08056	GPCR, rhodopsin-like superfamily (1);	1.172610	0.06723	N	0.775262	T	0.00109	0.0003	N	0.13168	0.305	0.09310	N	1	B	0.15930	0.015	B	0.20184	0.028	T	0.08848	-1.0702	10	0.49607	T	0.09	.	5.8042	0.18430	0.3523:0.3979:0.2498:0.0	.	270	Q8NHC7	O14CZ_HUMAN	M	270	ENSP00000324534:L270M	ENSP00000324534:L270M	L	+	1	2	OR14C36	246579507	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-1.037000	0.03557	-0.557000	0.06126	-2.294000	0.00264	CTG		OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918	
SLC32A1	140679	broad.mit.edu	37	20	37353509	37353509	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr20:37353509G>A	ENST00000217420.1	+	1	405	c.142G>A	c.(142-144)Gac>Aac	p.D48N		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	48					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)	p.D48N(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CGCGCATTGCGACGACCTCGA	0.657																																					p.D48N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G142A	20						.						40.0	31.0	34.0					20																	37353509		2203	4299	6502	36786923	SO:0001583	missense	140679	exon1			AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.142G>A	20.37:g.37353509G>A	ENSP00000217420:p.Asp48Asn	Somatic		Capture	Illumina HiSeq	Phase_I	36786923	NM_080552	Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	G	35	5.469376	0.96274	.	.	ENSG00000101438	ENST00000217420	T	0.11930	2.73	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.07999	0.0200	L	0.27053	0.805	0.58432	D	0.999998	P	0.44429	0.835	B	0.25405	0.06	T	0.32161	-0.9917	10	0.31617	T	0.26	-33.7928	15.4432	0.75204	0.0:0.0:1.0:0.0	.	48	Q9H598	VIAAT_HUMAN	N	48	ENSP00000217420:D48N	ENSP00000217420:D48N	D	+	1	0	SLC32A1	36786923	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.493000	0.97960	2.230000	0.72887	0.561000	0.74099	GAC		SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552	
CLTCL1	8218	broad.mit.edu	37	22	19223298	19223298	+	Missense_Mutation	SNP	C	C	T	rs201700885		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr22:19223298C>T	ENST00000263200.10	-	6	962	c.890G>A	c.(889-891)cGt>cAt	p.R297H	CLTCL1_ENST00000353891.5_Missense_Mutation_p.R297H|CLTCL1_ENST00000427926.1_Missense_Mutation_p.R297H	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	297	Globular terminal domain.|WD40-like repeat 6.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)	p.R297H(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					AGCACTAATACGGTTCATGCA	0.408			T	?	ALCL																																p.R297H			Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G890A	22						.						214.0	213.0	213.0					22																	19223298		2052	4207	6259	17603298	SO:0001583	missense	8218	exon6				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.890G>A	22.37:g.19223298C>T	ENSP00000445677:p.Arg297His	Somatic		Capture	Illumina HiSeq	Phase_I	17603298	NM_001835	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.470671	0.43942	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.30182	1.54;1.54;1.54	3.65	1.53	0.23141	Clathrin, heavy chain, propeller, N-terminal (1);Clathrin, heavy chain, linker/propeller domain (1);	0.075480	0.56097	N	0.000040	T	0.50480	0.1618	H	0.96861	3.895	0.58432	D	0.999994	B;B	0.26935	0.021;0.164	B;B	0.36244	0.088;0.22	T	0.54583	-0.8272	10	0.87932	D	0	-4.7441	9.1253	0.36812	0.0:0.8176:0.0:0.1824	.	297;297	P53675-2;P53675	.;CLH2_HUMAN	H	297	ENSP00000439662:R297H;ENSP00000445677:R297H;ENSP00000441158:R297H	ENSP00000445677:R297H	R	-	2	0	CLTCL1	17603298	1.000000	0.71417	0.973000	0.42090	0.172000	0.22775	2.615000	0.46368	0.244000	0.21351	-0.218000	0.12543	CGT		CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098	
SEC14L4	284904	broad.mit.edu	37	22	30887832	30887832	+	Silent	SNP	G	G	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr22:30887832G>T	ENST00000255858.7	-	10	983	c.900C>A	c.(898-900)ggC>ggA	p.G300G	RP4-539M6.14_ENST00000610156.1_RNA|SEC14L4_ENST00000381982.3_Silent_p.G300G|RP4-539M6.14_ENST00000442126.1_RNA|SEC14L4_ENST00000392772.2_Silent_p.G246G|SEC14L4_ENST00000540456.1_Silent_p.G285G	NM_001161368.1|NM_174977.3	NP_001154840.1|NP_777637.1	Q9UDX3	S14L4_HUMAN	SEC14-like 4 (S. cerevisiae)	300	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.G300G(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|pancreas(1)|skin(1)	21					Vitamin E(DB00163)	TGAGCACACAGCCCGGGAACA	0.652																																					p.G300G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C900A	22						.						16.0	15.0	15.0					22																	30887832		2201	4270	6471	29217832	SO:0001819	synonymous_variant	284904	exon10			AY158085	CCDS13878.1, CCDS54517.1	22q12.1	2003-03-10			ENSG00000133488	ENSG00000133488			20627	protein-coding gene	gene with protein product		612825					Standard	NM_174977		Approved	TAP3, dJ130H16.5	uc003aid.2	Q9UDX3	OTTHUMG00000151258	ENST00000255858.7:c.900C>A	22.37:g.30887832G>T		Somatic		Capture	Illumina HiSeq	Phase_I	29217832	NM_001161368	A5D6W7|A6NCV4	Silent	SNP	ENST00000255858.7	37	CCDS13878.1																																																																																				SEC14L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321946.1	NM_174977	
LIMK2	3985	broad.mit.edu	37	22	31655980	31655980	+	Silent	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr22:31655980G>A	ENST00000331728.4	+	5	582	c.468G>A	c.(466-468)ccG>ccA	p.P156P	LIMK2_ENST00000406516.1_Silent_p.P78P|LIMK2_ENST00000444929.2_Intron|LIMK2_ENST00000333611.4_Silent_p.P135P|LIMK2_ENST00000340552.4_Silent_p.P135P	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2	156	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.P156P(1)		endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						TCTCCATGCCGGCCACCACTG	0.562																																					p.P156P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G468A	22						.						67.0	59.0	62.0					22																	31655980		2203	4300	6503	29985980	SO:0001819	synonymous_variant	3985	exon5			D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.468G>A	22.37:g.31655980G>A		Somatic		Capture	Illumina HiSeq	Phase_I	29985980	NM_005569	A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Silent	SNP	ENST00000331728.4	37	CCDS13891.1																																																																																				LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321911.1	NM_016733	
BPIFC	254240	broad.mit.edu	37	22	32831697	32831697	+	Silent	SNP	G	G	A	rs375648599		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr22:32831697G>A	ENST00000397452.1	-	9	1028	c.918C>T	c.(916-918)acC>acT	p.T306T	BPIFC_ENST00000534972.1_Silent_p.T30T|BPIFC_ENST00000432451.2_Silent_p.T120T|BPIFC_ENST00000300399.3_Silent_p.T306T			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	306						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)	p.T306T(1)									TCACCTCTTCGGTGGAGAGAG	0.423																																					p.T306T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C918T	22						.						60.0	61.0	61.0					22																	32831697		2203	4300	6503	31161697	SO:0001819	synonymous_variant	254240	exon8			AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.918C>T	22.37:g.32831697G>A		Somatic		Capture	Illumina HiSeq	Phase_I	31161697	NM_174932	A2RRF1	Silent	SNP	ENST00000397452.1	37	CCDS13906.1																																																																																				BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129029.2	NM_174932	
LGALS1	3956	broad.mit.edu	37	22	38075664	38075664	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr22:38075664G>A	ENST00000215909.5	+	4	411	c.316G>A	c.(316-318)Gaa>Aaa	p.E106K	LGALS1_ENST00000489315.1_3'UTR	NM_002305.3	NP_002296.1	P09382	LEG1_HUMAN	lectin, galactoside-binding, soluble, 1	106	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|cellular response to glucose stimulus (GO:0071333)|cellular response to organic cyclic compound (GO:0071407)|multicellular organismal response to stress (GO:0033555)|myoblast differentiation (GO:0045445)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of neuron projection development (GO:0010977)|plasma cell differentiation (GO:0002317)|positive regulation of erythrocyte aggregation (GO:0034120)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	galactoside binding (GO:0016936)|lactose binding (GO:0030395)|poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)	p.E106K(1)		endometrium(1)|large_intestine(1)|lung(1)	3	Melanoma(58;0.0574)					AGATGGATACGAATTCAAGTT	0.567																																					p.E106K	Pancreas(23;406 890 14304 26016)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G316A	22						.						140.0	102.0	115.0					22																	38075664		2203	4300	6503	36405610	SO:0001583	missense	3956	exon4				CCDS13954.1	22q13.1	2014-01-30	2008-07-25		ENSG00000100097	ENSG00000100097		"""Lectins, galactoside-binding"", ""Endogenous ligands"""	6561	protein-coding gene	gene with protein product	"""galectin 1"""	150570				1988031, 12271131	Standard	NM_002305		Approved	GBP	uc003atn.3	P09382	OTTHUMG00000150661	ENST00000215909.5:c.316G>A	22.37:g.38075664G>A	ENSP00000215909:p.Glu106Lys	Somatic		Capture	Illumina HiSeq	Phase_I	36405610	NM_002305	B2R5E8|Q9UDK5	Missense_Mutation	SNP	ENST00000215909.5	37	CCDS13954.1	.	.	.	.	.	.	.	.	.	.	G	13.12	2.141473	0.37825	.	.	ENSG00000100097	ENST00000215909	T	0.05513	3.43	6.08	-12.2	0.00006	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	1.762380	0.02920	N	0.137886	T	0.04861	0.0131	L	0.49778	1.585	0.09310	N	1	B	0.27316	0.175	B	0.32211	0.142	T	0.28744	-1.0034	10	0.09084	T	0.74	-8.015	4.5201	0.11956	0.0818:0.2123:0.4143:0.2915	.	106	P09382	LEG1_HUMAN	K	106	ENSP00000215909:E106K	ENSP00000215909:E106K	E	+	1	0	LGALS1	36405610	0.000000	0.05858	0.000000	0.03702	0.325000	0.28411	-0.895000	0.04118	-2.540000	0.00486	-0.895000	0.02911	GAA		LGALS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319482.1	NM_002305	
PNPLA3	80339	broad.mit.edu	37	22	44333040	44333040	+	Silent	SNP	G	G	A	rs139896256		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr22:44333040G>A	ENST00000216180.3	+	6	1040	c.867G>A	c.(865-867)tcG>tcA	p.S289S	PNPLA3_ENST00000423180.2_Silent_p.S285S	NM_025225.2	NP_079501.2	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	289					acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	diolein transacylation activity (GO:0051265)|mono-olein transacylation activity (GO:0051264)|phospholipase A2 activity (GO:0004623)|triglyceride lipase activity (GO:0004806)	p.S289S(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|prostate(1)|skin(1)|stomach(2)	19		Ovarian(80;0.024)|all_neural(38;0.0416)				CCCCGGAGTCGGCTGCCTTGG	0.617																																					p.S289S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G867A	22						.	G		0,4406		0,0,2203	107.0	86.0	93.0		867	-2.8	0.0	22	dbSNP_134	93	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	PNPLA3	NM_025225.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		289/482	44333040	2,13004	2203	4300	6503	42664373	SO:0001819	synonymous_variant	80339	exon6				CCDS14054.1	22q13.31	2014-03-14	2006-05-26	2006-05-26	ENSG00000100344	ENSG00000100344	3.1.1.3	"""Patatin-like phospholipase domain containing"""	18590	protein-coding gene	gene with protein product		609567	"""chromosome 22 open reading frame 20"", ""adiponutrin"""	C22orf20, ADPN		16799181, 19029121	Standard	NM_025225		Approved	dJ796I17.1, FLJ22012, adiponutrin, iPLA2epsilon	uc003bei.1	Q9NST1	OTTHUMG00000150555	ENST00000216180.3:c.867G>A	22.37:g.44333040G>A		Somatic		Capture	Illumina HiSeq	Phase_I	42664373	NM_025225	B0QYI0|B2RCL3|B3KW00|Q6P1A1|Q96CB4	Silent	SNP	ENST00000216180.3	37	CCDS14054.1																																																																																				PNPLA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318891.1	NM_025225	
SBF1	6305	broad.mit.edu	37	22	50898755	50898755	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr22:50898755T>G	ENST00000390679.3	-	25	3413	c.3229A>C	c.(3229-3231)Agc>Cgc	p.S1077R	SBF1_ENST00000380817.3_Missense_Mutation_p.S1077R|SBF1_ENST00000348911.6_Missense_Mutation_p.S1078R|SBF1_ENST00000476293.1_5'Flank			O95248	MTMR5_HUMAN	SET binding factor 1	1077					cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		TGCTCCCAGCTGGGGGGGTTG	0.647																																					p.S1077R												.	.	0			c.A3229C	22						.						49.0	56.0	53.0					22																	50898755		1997	4167	6164	49245621	SO:0001583	missense	6305	exon25			U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.3229A>C	22.37:g.50898755T>G	ENSP00000375097:p.Ser1077Arg	None		Capture	Illumina HiSeq	Phase_I	49245621	NM_002972	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	37		.	.	.	.	.	.	.	.	.	.	T	6.989	0.552608	0.13374	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000337034;ENST00000390679	T;T;T	0.10477	2.87;2.87;2.87	3.88	-0.682	0.11339	.	0.534882	0.19294	N	0.117801	T	0.06600	0.0169	L	0.40543	1.245	0.09310	N	1	B;B	0.22983	0.078;0.045	B;B	0.27262	0.078;0.062	T	0.38329	-0.9666	10	0.17832	T	0.49	.	1.6272	0.02725	0.1344:0.3411:0.2735:0.251	.	1077;1077	O95248;O95248-4	MTMR5_HUMAN;.	R	1077;1078;1087;1077	ENSP00000370196:S1077R;ENSP00000252027:S1078R;ENSP00000375097:S1077R	ENSP00000336522:S1087R	S	-	1	0	SBF1	49245621	0.428000	0.25522	0.424000	0.26647	0.815000	0.46073	0.761000	0.26489	-0.398000	0.07679	0.260000	0.18958	AGC		SBF1-201	KNOWN	basic	protein_coding	protein_coding			
TMEM182	130827	broad.mit.edu	37	2	103378756	103378756	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr2:103378756C>T	ENST00000412401.2	+	1	285	c.80C>T	c.(79-81)tCg>tTg	p.S27L	TMEM182_ENST00000409528.1_Intron|TMEM182_ENST00000409173.1_Intron	NM_144632.3	NP_653233.3	Q6ZP80	TM182_HUMAN	transmembrane protein 182	27						integral component of membrane (GO:0016021)		p.S27L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11						GCTTTTGGATCGGATTATTGG	0.398																																					p.S27L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C80T	2						.						170.0	164.0	166.0					2																	103378756		2203	4300	6503	102745188	SO:0001583	missense	130827	exon1			AK054856	CCDS2064.1	2q12.1	2009-08-25			ENSG00000170417	ENSG00000170417			26391	protein-coding gene	gene with protein product						12477932	Standard	NM_144632		Approved	FLJ30294	uc010fjb.3	Q6ZP80	OTTHUMG00000130779	ENST00000412401.2:c.80C>T	2.37:g.103378756C>T	ENSP00000394178:p.Ser27Leu	Somatic		Capture	Illumina HiSeq	Phase_I	102745188	NM_144632	C9JML7|Q3B7B8|Q53TT9|Q6GMU0|Q8WW45|Q96NR4	Missense_Mutation	SNP	ENST00000412401.2	37	CCDS2064.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.997101	0.74818	.	.	ENSG00000170417	ENST00000412401	T	0.70516	-0.49	6.02	6.02	0.97574	.	0.049435	0.85682	D	0.000000	T	0.64461	0.2600	L	0.43152	1.355	0.39266	D	0.964296	P	0.44429	0.835	B	0.38327	0.271	T	0.71606	-0.4542	10	0.87932	D	0	-19.2839	15.9588	0.79910	0.0:0.866:0.134:0.0	.	27	Q6ZP80	TM182_HUMAN	L	27	ENSP00000394178:S27L	ENSP00000394178:S27L	S	+	2	0	TMEM182	102745188	0.978000	0.34361	0.998000	0.56505	0.973000	0.67179	2.471000	0.45127	2.865000	0.98341	0.655000	0.94253	TCG		TMEM182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253293.1	NM_144632	
TMEM163	81615	broad.mit.edu	37	2	135309655	135309655	+	Silent	SNP	G	G	A	rs145798414		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr2:135309655G>A	ENST00000281924.6	-	3	394	c.330C>T	c.(328-330)tcC>tcT	p.S110S		NM_030923.4	NP_112185.1	Q8TC26	TM163_HUMAN	transmembrane protein 163	110						cell junction (GO:0030054)|early endosome membrane (GO:0031901)|integral component of synaptic vesicle membrane (GO:0030285)	zinc ion binding (GO:0008270)	p.S110S(1)		endometrium(1)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.154)		ACCTCATAACGGAGACAGCTA	0.338																																					p.S110S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C330T	2						.	G		0,4406		0,0,2203	63.0	56.0	59.0		330	4.9	1.0	2	dbSNP_134	59	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TMEM163	NM_030923.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		110/290	135309655	1,13005	2203	4300	6503	135026125	SO:0001819	synonymous_variant	81615	exon3				CCDS2172.1	2q21.3	2008-02-05			ENSG00000152128	ENSG00000152128			25380	protein-coding gene	gene with protein product						17623043	Standard	NM_030923		Approved	DKFZP566N034, SV31	uc002ttx.3	Q8TC26	OTTHUMG00000131713	ENST00000281924.6:c.330C>T	2.37:g.135309655G>A		Somatic		Capture	Illumina HiSeq	Phase_I	135026125	NM_030923	Q53QM3|Q53SV7|Q69YH3|Q9UFG3	Silent	SNP	ENST00000281924.6	37	CCDS2172.1																																																																																				TMEM163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254631.2	NM_030923	
HNMT	3176	broad.mit.edu	37	2	138759758	138759758	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr2:138759758G>A	ENST00000280097.3	+	4	605	c.423G>A	c.(421-423)atG>atA	p.M141I	HNMT_ENST00000410115.1_Missense_Mutation_p.M141I|HNMT_ENST00000485653.1_3'UTR	NM_006895.2	NP_008826.1	P50135	HNMT_HUMAN	histamine N-methyltransferase	141					brain development (GO:0007420)|hyperosmotic response (GO:0006972)|respiratory gaseous exchange (GO:0007585)|response to amine (GO:0014075)|response to cocaine (GO:0042220)|response to glucocorticoid (GO:0051384)|response to interleukin-1 (GO:0070555)|response to tumor cell (GO:0002347)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)	histamine N-methyltransferase activity (GO:0046539)	p.M141I(2)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.125)	Amodiaquine(DB00613)|Chlorhexidine(DB00878)|Histamine Phosphate(DB00667)|Quinacrine(DB01103)	TTATTCATATGATTCAAGTAA	0.279																																					p.M141I												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G423A	2						.						33.0	34.0	34.0					2																	138759758		2202	4300	6502	138476228	SO:0001583	missense	3176	exon4				CCDS2181.1, CCDS33296.1, CCDS33297.1	2q22.1	2008-02-05			ENSG00000150540	ENSG00000150540	2.1.1.8		5028	protein-coding gene	gene with protein product		605238					Standard	NM_001024074		Approved		uc002tvf.3	P50135	OTTHUMG00000131751	ENST00000280097.3:c.423G>A	2.37:g.138759758G>A	ENSP00000280097:p.Met141Ile	Somatic		Capture	Illumina HiSeq	Phase_I	138476228	NM_006895	B2R9J3|Q546Z6|Q7Z7I2|Q8IU56|Q8WW98|Q9BRW6	Missense_Mutation	SNP	ENST00000280097.3	37	CCDS2181.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000398	0.74818	.	.	ENSG00000150540	ENST00000410115;ENST00000280097	T;T	0.42513	0.97;0.97	5.9	4.97	0.65823	Methyltransferase type 12 (1);	0.037179	0.85682	D	0.000000	T	0.61677	0.2366	M	0.78637	2.42	0.80722	D	1	D	0.61080	0.989	P	0.61477	0.889	T	0.62077	-0.6930	10	0.45353	T	0.12	-5.9319	14.921	0.70838	0.0:0.1422:0.8578:0.0	.	141	P50135	HNMT_HUMAN	I	141	ENSP00000386940:M141I;ENSP00000280097:M141I	ENSP00000280097:M141I	M	+	3	0	HNMT	138476228	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.924000	0.63418	2.788000	0.95919	0.650000	0.86243	ATG		HNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254673.1		
SCN7A	6332	broad.mit.edu	37	2	167273363	167273363	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr2:167273363G>C	ENST00000409855.1	-	20	3394	c.3268C>G	c.(3268-3270)Cca>Gca	p.P1090A		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1090					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.P1090A(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CCACTTGTTGGGTCAATGCAT	0.398																																					p.P1090A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3268G	2						.						106.0	93.0	97.0					2																	167273363		1886	4113	5999	166981609	SO:0001583	missense	6332	exon20			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.3268C>G	2.37:g.167273363G>C	ENSP00000386796:p.Pro1090Ala	Somatic		Capture	Illumina HiSeq	Phase_I	166981609	NM_002976		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	G	7.297	0.612218	0.14066	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.98296	-4.85	5.08	4.14	0.48551	Ion transport (1);	0.119724	0.38005	N	0.001860	D	0.92912	0.7745	N	0.12527	0.23	0.09310	N	1	B	0.23735	0.09	B	0.28385	0.089	T	0.82608	-0.0373	10	0.12103	T	0.63	.	7.6375	0.28274	0.0:0.1646:0.6423:0.1931	.	1090	Q01118	SCN7A_HUMAN	A	1090	ENSP00000386796:P1090A	ENSP00000259060:P1090A	P	-	1	0	SCN7A	166981609	0.000000	0.05858	1.000000	0.80357	0.963000	0.63663	0.814000	0.27239	2.657000	0.90304	0.650000	0.86243	CCA		SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
SMC6	79677	broad.mit.edu	37	2	17881568	17881568	+	Silent	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr2:17881568C>T	ENST00000448223.2	-	21	2570	c.2301G>A	c.(2299-2301)gaG>gaA	p.E767E	SMC6_ENST00000351948.4_Silent_p.E767E|SMC6_ENST00000402989.1_Silent_p.E767E|SMC6_ENST00000381272.4_Silent_p.E793E	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	767					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)	p.E767E(1)		NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TTTTAAGATGCTCCATATTTT	0.303																																					p.E767E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2301A	2						.						174.0	164.0	167.0					2																	17881568		2201	4299	6500	17745049	SO:0001819	synonymous_variant	79677	exon21			AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.2301G>A	2.37:g.17881568C>T		Somatic		Capture	Illumina HiSeq	Phase_I	17745049	NM_001142286	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Silent	SNP	ENST00000448223.2	37	CCDS1690.1																																																																																				SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207359.1	NM_024624	
XIRP2	129446	broad.mit.edu	37	2	168098326	168098326	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr2:168098326C>A	ENST00000409728.1	+	9	1270	c.1181C>A	c.(1180-1182)tCg>tAg	p.S394*	XIRP2_ENST00000409273.1_Nonsense_Mutation_p.S139*|XIRP2_ENST00000409605.1_Nonsense_Mutation_p.S139*|XIRP2_ENST00000409195.1_Nonsense_Mutation_p.S361*|XIRP2_ENST00000409043.1_Nonsense_Mutation_p.S361*|XIRP2_ENST00000295237.9_Nonsense_Mutation_p.S361*|XIRP2_ENST00000409756.2_Nonsense_Mutation_p.S361*|XIRP2_ENST00000420519.1_Nonsense_Mutation_p.S394*	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	186					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.S394*(1)|p.S361*(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CCAAAGGTTTCGACTAAGTTG	0.363																																					p.S394X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1181A	2						.						115.0	110.0	112.0					2																	168098326		1819	4081	5900	167806572	SO:0001587	stop_gained	129446	exon9			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.1181C>A	2.37:g.168098326C>A	ENSP00000386619:p.Ser394*	Somatic		Capture	Illumina HiSeq	Phase_I	167806572	NM_001199143	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Nonsense_Mutation	SNP	ENST00000409728.1	37	CCDS56143.1	.	.	.	.	.	.	.	.	.	.	C	35	5.436410	0.96168	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237;ENST00000409273;ENST00000409605	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.6559	14.4827	0.67594	0.0:0.9267:0.0:0.0733	.	.	.	.	X	361;394;361;361;394;361;139;139	.	ENSP00000295237:S361X	S	+	2	0	XIRP2	167806572	1.000000	0.71417	1.000000	0.80357	0.289000	0.27227	5.195000	0.65131	2.633000	0.89246	0.591000	0.81541	TCG		XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381	
ERBB4	2066	broad.mit.edu	37	2	212495285	212495285	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr2:212495285G>C	ENST00000342788.4	-	17	2291	c.1981C>G	c.(1981-1983)Ctc>Gtc	p.L661V	ERBB4_ENST00000436443.1_Missense_Mutation_p.L661V|ERBB4_ENST00000402597.1_Missense_Mutation_p.L651V	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	661					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L661V(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	AGAATGAAGAGCCCACCAATT	0.393										TSP Lung(8;0.080)																											p.L661V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1981G	2						.						88.0	93.0	91.0					2																	212495285		2203	4300	6503	212203530	SO:0001583	missense	2066	exon17			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1981C>G	2.37:g.212495285G>C	ENSP00000342235:p.Leu661Val	Somatic		Capture	Illumina HiSeq	Phase_I	212203530	NM_005235	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.293555	0.60086	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.75938	-0.96;-0.96;-0.98	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.73505	0.3595	L	0.51422	1.61	0.80722	D	1	P;P;B;P;P	0.43857	0.644;0.634;0.108;0.644;0.819	B;B;B;B;B	0.41510	0.356;0.359;0.091;0.356;0.355	T	0.76408	-0.2970	10	0.59425	D	0.04	.	19.6404	0.95755	0.0:0.0:1.0:0.0	.	651;651;520;661;661	Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303	.;.;.;.;ERBB4_HUMAN	V	661;661;651	ENSP00000342235:L661V;ENSP00000403204:L661V;ENSP00000385565:L651V	ENSP00000342235:L661V	L	-	1	0	ERBB4	212203530	1.000000	0.71417	0.995000	0.50966	0.974000	0.67602	7.573000	0.82421	2.653000	0.90120	0.580000	0.79431	CTC		ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
IQCA1	79781	broad.mit.edu	37	2	237272564	237272564	+	Silent	SNP	C	C	T	rs374874665		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr2:237272564C>T	ENST00000409907.3	-	15	2002	c.1728G>A	c.(1726-1728)ccG>ccA	p.P576P	IQCA1_ENST00000431676.2_Silent_p.P535P|IQCA1_ENST00000309507.5_Silent_p.P573P	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	576							ATP binding (GO:0005524)	p.P584P(1)|p.P576P(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						CTACCCCAGACGGCCCGGCTA	0.507																																					p.P576P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1728A	2						.	C		0,3922		0,0,1961	136.0	132.0	133.0		1728	-9.3	0.0	2		133	1,8273		0,1,4136	no	coding-synonymous	IQCA1	NM_024726.3		0,1,6097	TT,TC,CC		0.0121,0.0,0.0082		576/823	237272564	1,12195	1961	4137	6098	236937303	SO:0001819	synonymous_variant	79781	exon15			AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.1728G>A	2.37:g.237272564C>T		Somatic		Capture	Illumina HiSeq	Phase_I	236937303	NM_024726	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Silent	SNP	ENST00000409907.3	37	CCDS46549.1																																																																																				IQCA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000329266.1	NM_024726	
GALNT14	79623	broad.mit.edu	37	2	31189100	31189100	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr2:31189100G>A	ENST00000349752.5	-	3	1007	c.368C>T	c.(367-369)gCc>gTc	p.A123V	GALNT14_ENST00000406653.1_Missense_Mutation_p.A103V|GALNT14_ENST00000356174.3_Intron|GALNT14_ENST00000420311.2_Missense_Mutation_p.A88V|GALNT14_ENST00000324589.5_Missense_Mutation_p.A128V	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	123	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.A123V(1)		cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					CGTGGAGCGGGCCTCGTTGTG	0.592																																					p.A123V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C368T	2						.						253.0	198.0	216.0					2																	31189100		2203	4300	6503	31042604	SO:0001583	missense	79623	exon3			AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.368C>T	2.37:g.31189100G>A	ENSP00000288988:p.Ala123Val	Somatic		Capture	Illumina HiSeq	Phase_I	31042604	NM_024572	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	g	31	5.092539	0.94149	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000420311	T;T;T;T	0.62105	0.05;0.05;0.05;0.05	4.85	4.85	0.62838	Glycosyl transferase, family 2 (1);	0.117464	0.56097	D	0.000021	T	0.81927	0.4926	M	0.89163	3.01	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.998;1.0;0.999	D	0.85884	0.1424	10	0.87932	D	0	.	15.1833	0.72978	0.0:0.0:1.0:0.0	.	88;88;128;123;103	F5H263;B7Z5C5;Q96FL9-3;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	V	123;128;103;88	ENSP00000288988:A123V;ENSP00000314500:A128V;ENSP00000385435:A103V;ENSP00000415514:A88V	ENSP00000314500:A128V	A	-	2	0	GALNT14	31042604	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	8.444000	0.90323	2.236000	0.73375	0.480000	0.44947	GCC		GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572	
XDH	7498	broad.mit.edu	37	2	31588394	31588394	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr2:31588394G>A	ENST00000379416.3	-	23	2521	c.2473C>T	c.(2473-2475)Cga>Tga	p.R825*		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	825					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)	p.R825*(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	AGCATGCATCGCACAGGGCGG	0.572																																					p.R825X	Colon(66;682 1445 30109 40147)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2473T	2						.						116.0	102.0	107.0					2																	31588394		2203	4300	6503	31441898	SO:0001587	stop_gained	7498	exon23			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.2473C>T	2.37:g.31588394G>A	ENSP00000368727:p.Arg825*	Somatic		Capture	Illumina HiSeq	Phase_I	31441898	NM_000379	Q16681|Q16712|Q4PJ16	Nonsense_Mutation	SNP	ENST00000379416.3	37	CCDS1775.1	.	.	.	.	.	.	.	.	.	.	G	41	9.016899	0.99037	.	.	ENSG00000158125	ENST00000379416	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.2378	0.73443	0.0:0.0:0.8595:0.1405	.	.	.	.	X	825	.	ENSP00000368727:R825X	R	-	1	2	XDH	31441898	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	3.598000	0.54038	2.941000	0.99782	0.655000	0.94253	CGA		XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
PCBP1	5093	broad.mit.edu	37	2	70315180	70315180	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr2:70315180T>C	ENST00000303577.5	+	1	596	c.305T>C	c.(304-306)cTg>cCg	p.L102P	PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000596665.1_RNA|PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000418308.1_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	102	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.L102Q(2)|p.L102P(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						ACCCTGAGGCTGGTGGTGCCG	0.612																																					p.L102P	Colon(85;1146 1307 3484 18706 25380)											.	.	3	Substitution - Missense(3)	large_intestine(3)	c.T305C	2						.						57.0	70.0	66.0					2																	70315180		2200	4299	6499	70168684	SO:0001583	missense	5093	exon1				CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.305T>C	2.37:g.70315180T>C	ENSP00000305556:p.Leu102Pro	Somatic		Capture	Illumina HiSeq	Phase_I	70168684	NM_006196	Q13157|Q14975	Missense_Mutation	SNP	ENST00000303577.5	37	CCDS1898.1	.	.	.	.	.	.	.	.	.	.	T	16.94	3.260341	0.59431	.	.	ENSG00000169564	ENST00000303577	T	0.34859	1.34	4.16	4.16	0.48862	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.082382	0.49916	U	0.000122	T	0.65544	0.2701	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73563	-0.3943	10	0.87932	D	0	.	11.8577	0.52449	0.0:0.0:0.0:1.0	.	102	Q15365	PCBP1_HUMAN	P	102	ENSP00000305556:L102P	ENSP00000305556:L102P	L	+	2	0	PCBP1	70168684	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	4.781000	0.62389	2.120000	0.65058	0.477000	0.44152	CTG		PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251844.1	NM_006196	
ACKR3	57007	broad.mit.edu	37	2	237489970	237489970	+	Missense_Mutation	SNP	C	C	T	rs201423512		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr2:237489970C>T	ENST00000272928.3	+	2	1172	c.862C>T	c.(862-864)Cgg>Tgg	p.R288W		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	288					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)	p.R288W(1)									TTTCACCTGCCGGCTGGAGCA	0.592																																					p.R288W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C862T	2						.						153.0	129.0	137.0					2																	237489970		2203	4300	6503	237154709	SO:0001583	missense	57007	exon2			BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.862C>T	2.37:g.237489970C>T	ENSP00000272928:p.Arg288Trp	Somatic		Capture	Illumina HiSeq	Phase_I	237154709	NM_020311	A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Missense_Mutation	SNP	ENST00000272928.3	37	CCDS2516.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.048780	0.36181	.	.	ENSG00000144476	ENST00000272928	T	0.38077	1.16	5.41	5.41	0.78517	GPCR, rhodopsin-like superfamily (1);	0.821320	0.11438	N	0.564114	T	0.28333	0.0700	L	0.31476	0.935	0.24045	N	0.996062	B	0.02656	0.0	B	0.01281	0.0	T	0.09509	-1.0671	9	.	.	.	.	12.5386	0.56156	0.0:0.9242:0.0:0.0758	.	288	P25106	CXCR7_HUMAN	W	288	ENSP00000272928:R288W	.	R	+	1	2	CXCR7	237154709	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	1.613000	0.36900	2.535000	0.85469	0.655000	0.94253	CGG		ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257079.2	NM_020311	
PHLDB2	90102	broad.mit.edu	37	3	111632176	111632176	+	Missense_Mutation	SNP	G	G	A	rs534767460		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr3:111632176G>A	ENST00000431670.2	+	3	1757	c.1346G>A	c.(1345-1347)cGt>cAt	p.R449H	PHLDB2_ENST00000481953.1_Missense_Mutation_p.R449H|PHLDB2_ENST00000393923.3_Missense_Mutation_p.R476H|PHLDB2_ENST00000495180.1_Missense_Mutation_p.R35H|PHLDB2_ENST00000393925.3_Missense_Mutation_p.R449H|PHLDB2_ENST00000412622.1_Missense_Mutation_p.R449H|PHLDB2_ENST00000477695.1_Missense_Mutation_p.R449H	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	449						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)		p.R449H(2)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						GAGAGACAGCGTCTGGAGACC	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		18776	0.0		0.0	False		,,,				2504	0.001				p.R449H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1346A	3						.						120.0	119.0	119.0					3																	111632176		2203	4300	6503	113114866	SO:0001583	missense	90102	exon3				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.1346G>A	3.37:g.111632176G>A	ENSP00000405405:p.Arg449His	Somatic		Capture	Illumina HiSeq	Phase_I	113114866	NM_001134439	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	ENST00000431670.2	37	CCDS46886.1	.	.	.	.	.	.	.	.	.	.	G	33	5.242128	0.95272	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000477695;ENST00000393925;ENST00000481953;ENST00000495180	T;T;T;T;T;T;T	0.61980	0.08;0.17;0.1;0.06;0.17;0.1;0.32	5.67	5.67	0.87782	.	0.116985	0.64402	D	0.000020	T	0.79387	0.4437	M	0.76170	2.325	0.58432	D	0.999999	D;P;D;D;D	0.89917	1.0;0.918;1.0;0.996;0.998	D;B;D;P;P	0.91635	0.996;0.212;0.999;0.766;0.844	T	0.80959	-0.1149	10	0.72032	D	0.01	.	16.6617	0.85242	0.0:0.0:1.0:0.0	.	35;449;449;449;476	E9PGF6;Q86SQ0;G5E9V3;Q86SQ0-2;Q86SQ0-3	.;PHLB2_HUMAN;.;.;.	H	476;476;449;449;449;449;449;449;35	ENSP00000377500:R476H;ENSP00000405405:R449H;ENSP00000405292:R449H;ENSP00000418296:R449H;ENSP00000377502:R449H;ENSP00000418319:R449H;ENSP00000420303:R35H	ENSP00000352764:R476H	R	+	2	0	PHLDB2	113114866	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.813000	0.75231	2.674000	0.91012	0.655000	0.94253	CGT		PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753	
GRAMD1C	54762	broad.mit.edu	37	3	113563377	113563377	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr3:113563377G>A	ENST00000358160.4	+	2	547	c.55G>A	c.(55-57)Gcc>Acc	p.A19T	GRAMD1C_ENST00000452134.2_5'UTR|GRAMD1C_ENST00000479212.1_3'UTR	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	19						integral component of membrane (GO:0016021)		p.A19T(1)		NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						TTCAAGCCTTGCCACCGACTT	0.348																																					p.A19T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G55A	3						.						120.0	124.0	122.0					3																	113563377		2203	4300	6503	115046067	SO:0001583	missense	54762	exon2				CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.55G>A	3.37:g.113563377G>A	ENSP00000350881:p.Ala19Thr	Somatic		Capture	Illumina HiSeq	Phase_I	115046067	NM_017577	A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Missense_Mutation	SNP	ENST00000358160.4	37	CCDS33826.1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.651977	0.29336	.	.	ENSG00000178075	ENST00000358160	T	0.32753	1.44	5.47	3.36	0.38483	.	4.007170	0.00424	N	0.000076	T	0.20210	0.0486	N	0.19112	0.55	0.20926	N	0.999828	B	0.26935	0.164	B	0.25405	0.06	T	0.22977	-1.0201	10	0.18276	T	0.48	.	3.6173	0.08082	0.144:0.0:0.6079:0.2481	.	19	Q8IYS0	GRM1C_HUMAN	T	19	ENSP00000350881:A19T	ENSP00000350881:A19T	A	+	1	0	GRAMD1C	115046067	0.151000	0.22747	0.537000	0.28052	0.387000	0.30353	0.578000	0.23773	1.275000	0.44379	0.655000	0.94253	GCC		GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354733.1	NM_017577	
CASR	846	broad.mit.edu	37	3	121980617	121980617	+	Silent	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr3:121980617G>A	ENST00000490131.1	+	4	1107	c.735G>A	c.(733-735)caG>caA	p.Q245Q	CASR_ENST00000498619.1_Silent_p.Q245Q|CASR_ENST00000296154.5_Silent_p.Q245Q	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	245					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.Q245Q(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TCATCTCCCAGTACTCTGATG	0.512																																					p.Q245Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G735A	3						.						157.0	169.0	165.0					3																	121980617		2203	4300	6503	123463307	SO:0001819	synonymous_variant	846	exon4			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.735G>A	3.37:g.121980617G>A		Somatic		Capture	Illumina HiSeq	Phase_I	123463307	NM_000388	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Silent	SNP	ENST00000490131.1	37	CCDS3010.1																																																																																				CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
GRM7	2917	broad.mit.edu	37	3	6903442	6903442	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr3:6903442G>A	ENST00000357716.4	+	1	641	c.367G>A	c.(367-369)Gtc>Atc	p.V123I	GRM7_ENST00000486284.1_Missense_Mutation_p.V123I|GRM7_ENST00000402647.2_Missense_Mutation_p.V123I|GRM7_ENST00000389336.4_Missense_Mutation_p.V123I|GRM7_ENST00000403881.1_Missense_Mutation_p.V123I	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	123					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.V123I(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						GCTTACTTTCGTCCAGGCGCT	0.597																																					p.V123I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G367A	3						.						71.0	68.0	69.0					3																	6903442		2203	4300	6503	6878442	SO:0001583	missense	2917	exon1			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.367G>A	3.37:g.6903442G>A	ENSP00000350348:p.Val123Ile	Somatic		Capture	Illumina HiSeq	Phase_I	6878442	NM_000844	Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	G	17.46	3.394840	0.62066	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03	5.27	5.27	0.74061	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000011	T	0.56396	0.1982	L	0.46885	1.475	0.53005	D	0.999964	D;D;P	0.76494	0.998;0.999;0.581	D;D;B	0.74674	0.972;0.984;0.217	T	0.46871	-0.9160	10	0.20046	T	0.44	.	17.462	0.87622	0.0:0.0:1.0:0.0	.	123;123;123	Q14831-5;Q14831;Q14831-2	.;GRM7_HUMAN;.	I	123	ENSP00000350348:V123I;ENSP00000417536:V123I;ENSP00000373987:V123I;ENSP00000385664:V123I;ENSP00000384585:V123I	ENSP00000350348:V123I	V	+	1	0	GRM7	6878442	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.649000	0.98487	2.448000	0.82819	0.563000	0.77884	GTC		GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844	
SCN11A	11280	broad.mit.edu	37	3	38913075	38913075	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr3:38913075C>A	ENST00000302328.3	-	21	3818	c.3620G>T	c.(3619-3621)tGc>tTc	p.C1207F	SCN11A_ENST00000450244.1_Missense_Mutation_p.C1207F|SCN11A_ENST00000444237.2_Missense_Mutation_p.C1207F|SCN11A_ENST00000456224.3_Missense_Mutation_p.C1169F	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1207					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.C1207F(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCCATTAATGCATTTCCCAAA	0.353																																					p.C1207F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3620T	3						.						77.0	73.0	74.0					3																	38913075		2203	4300	6503	38888079	SO:0001583	missense	11280	exon21			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3620G>T	3.37:g.38913075C>A	ENSP00000307599:p.Cys1207Phe	Somatic		Capture	Illumina HiSeq	Phase_I	38888079	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936506	0.73442	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.98602	-5.02;-5.02;-5.02;-5.02	4.85	4.85	0.62838	Ion transport (1);	0.097992	0.64402	D	0.000001	D	0.99429	0.9798	H	0.98682	4.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98150	1.0441	10	0.72032	D	0.01	.	17.564	0.87914	0.0:1.0:0.0:0.0	.	1207	Q9UI33	SCNBA_HUMAN	F	1207;1207;1169;1207	ENSP00000307599:C1207F;ENSP00000400945:C1207F;ENSP00000416757:C1169F;ENSP00000408028:C1207F	ENSP00000307599:C1207F	C	-	2	0	SCN11A	38888079	1.000000	0.71417	0.877000	0.34402	0.781000	0.44180	7.561000	0.82288	2.221000	0.72209	0.655000	0.94253	TGC		SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
MIR138-1	406929	broad.mit.edu	37	3	44155723	44155723	+	RNA	SNP	G	G	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr3:44155723G>T	ENST00000385219.1	+	0	20					NR_029700.1				microRNA 138-1																		GGTGTGGTGGGGCAGCTGGTG	0.602											OREG0015518	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.												.	.	0			.	3						.						16.0	18.0	18.0					3																	44155723		1534	3529	5063	44130727			406929	.					3p21.32	2011-09-12		2008-12-18	ENSG00000207954	ENSG00000207954		"""ncRNAs / Micro RNAs"""	31524	non-coding RNA	RNA, micro		613394		MIRN138-1			Standard	NR_029700		Approved	hsa-mir-138-1	uc011azu.1				3.37:g.44155723G>T		Somatic	921	Capture	Illumina HiSeq	Phase_I	44130727	.		RNA	SNP	ENST00000385219.1	37																																																																																					MIR138-1-201	KNOWN	basic	miRNA	miRNA		NR_029700	
KIF15	56992	broad.mit.edu	37	3	44815895	44815895	+	Missense_Mutation	SNP	C	C	T	rs369068128		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr3:44815895C>T	ENST00000326047.4	+	2	177	c.28C>T	c.(28-30)Cgc>Tgc	p.R10C		NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	10					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R10C(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		AGCTGAGTTACGCAGCGTGAC	0.353																																					p.R10C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C28T	3						.	C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	57.0	57.0	57.0		28	5.4	1.0	3		57	0,8600		0,0,4300	no	missense	KIF15	NM_020242.2	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	10/1389	44815895	1,13005	2203	4300	6503	44790899	SO:0001583	missense	56992	exon2			AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.28C>T	3.37:g.44815895C>T	ENSP00000324020:p.Arg10Cys	Somatic		Capture	Illumina HiSeq	Phase_I	44790899	NM_020242	Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	ENST00000326047.4	37	CCDS33744.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.303223	0.81136	2.27E-4	0.0	ENSG00000163808	ENST00000326047;ENST00000396031	T	0.70045	-0.45	5.42	5.42	0.78866	.	0.344851	0.20409	N	0.092884	T	0.63486	0.2515	L	0.27053	0.805	0.80722	D	1	D	0.76494	0.999	P	0.50490	0.642	T	0.66156	-0.5994	10	0.56958	D	0.05	.	15.0902	0.72188	0.0:1.0:0.0:0.0	.	10	Q9NS87	KIF15_HUMAN	C	10;9	ENSP00000324020:R10C	ENSP00000324020:R10C	R	+	1	0	KIF15	44790899	1.000000	0.71417	0.998000	0.56505	0.941000	0.58515	3.344000	0.52174	2.717000	0.92951	0.655000	0.94253	CGC		KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343831.2		
ITIH3	3699	broad.mit.edu	37	3	52830616	52830616	+	Silent	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr3:52830616C>T	ENST00000449956.2	+	3	240	c.234C>T	c.(232-234)tcC>tcT	p.S78S	ITIH3_ENST00000416872.2_Silent_p.S78S	NM_002217.3	NP_002208.3	Q06033	ITIH3_HUMAN	inter-alpha-trypsin inhibitor heavy chain 3	78	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.S78S(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(6)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		AGGAGGTTTCCTTTGATGTGG	0.562																																					p.S78S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C234T	3						.						75.0	81.0	79.0					3																	52830616		2121	4275	6396	52805656	SO:0001819	synonymous_variant	3699	exon3				CCDS46845.1	3p21.1	2011-10-26	2011-10-26		ENSG00000162267	ENSG00000162267			6168	protein-coding gene	gene with protein product	"""pre-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha-trypsin inhibitor heavy chain H3"""	146650	"""inter-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha (globulin) inhibitor H3"""			2465147, 10100603	Standard	NM_002217		Approved	H3P	uc003dfv.2	Q06033	OTTHUMG00000158956	ENST00000449956.2:c.234C>T	3.37:g.52830616C>T		Somatic		Capture	Illumina HiSeq	Phase_I	52805656	NM_002217	Q3B7H5|Q53F06|Q6LAM2|Q99085	Silent	SNP	ENST00000449956.2	37	CCDS46845.1																																																																																				ITIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352668.2	NM_002217	
ROBO2	6092	broad.mit.edu	37	3	77671489	77671489	+	Silent	SNP	C	C	T	rs201339466		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr3:77671489C>T	ENST00000461745.1	+	23	4566	c.3666C>T	c.(3664-3666)gaC>gaT	p.D1222D	ROBO2_ENST00000332191.8_Silent_p.D1222D|ROBO2_ENST00000487694.3_Silent_p.D1238D	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	1222					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.D1222D(1)|p.D1238D(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		ATGATGCCGACGACGAAGAGG	0.507																																					p.R1203X												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3607T	3						.	C	,	0,3838		0,0,1919	119.0	119.0	119.0		3714,3666	-1.5	0.9	3		119	1,8291		0,1,4145	yes	coding-synonymous,coding-synonymous	ROBO2	NM_001128929.2,NM_002942.4	,	0,1,6064	TT,TC,CC		0.0121,0.0,0.0082	,	1238/1395,1222/1379	77671489	1,12129	1919	4146	6065	77754179	SO:0001819	synonymous_variant	6092	exon22			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3666C>T	3.37:g.77671489C>T		Somatic		Capture	Illumina HiSeq	Phase_I	77754179	NM_001128929	O43608|Q19AB4|Q19AB5	Silent	SNP	ENST00000461745.1	37	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	C	0.021	-1.425439	0.01126	0.0	1.21E-4	ENSG00000185008	ENST00000475334	.	.	.	5.56	-1.54	0.08584	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.6087	0.22739	0.0:0.248:0.1155:0.6364	.	.	.	.	X	54	.	.	R	+	1	2	ROBO2	77754179	0.382000	0.25148	0.934000	0.37439	0.008000	0.06430	-0.502000	0.06390	-0.463000	0.06973	-1.000000	0.02509	CGA		ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
COL6A6	131873	broad.mit.edu	37	3	130287403	130287403	+	Missense_Mutation	SNP	C	C	T	rs556475574		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr3:130287403C>T	ENST00000358511.6	+	5	2387	c.2356C>T	c.(2356-2358)Cgc>Tgc	p.R786C	COL6A6_ENST00000453409.2_Missense_Mutation_p.R786C	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	786	Nonhelical region.|VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.R786C(1)|p.R786S(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CATTCTGCAGCGCATTGAAGA	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		18848	0.0		0.0	False		,,,				2504	0.001				p.R786C												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C2356T	3						.						121.0	120.0	120.0					3																	130287403		1883	4106	5989	131770093	SO:0001583	missense	131873	exon5			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2356C>T	3.37:g.130287403C>T	ENSP00000351310:p.Arg786Cys	Somatic		Capture	Illumina HiSeq	Phase_I	131770093	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	C	10.86	1.470071	0.26423	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.83755	-1.76;-1.76	5.47	4.6	0.57074	von Willebrand factor, type A (3);	0.433344	0.21860	N	0.068056	T	0.76234	0.3959	L	0.49126	1.545	0.09310	N	1	P	0.43431	0.807	B	0.38056	0.264	T	0.70274	-0.4917	10	0.56958	D	0.05	.	8.9774	0.35944	0.2968:0.5595:0.1437:0.0	.	786	A6NMZ7	CO6A6_HUMAN	C	786	ENSP00000351310:R786C;ENSP00000399236:R786C	ENSP00000351310:R786C	R	+	1	0	COL6A6	131770093	0.023000	0.18921	0.986000	0.45419	0.649000	0.38597	0.352000	0.20113	1.318000	0.45170	-0.218000	0.12543	CGC		COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
ADH1C	126	broad.mit.edu	37	4	100264034	100264034	+	RNA	SNP	T	T	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr4:100264034T>A	ENST00000510055.1	-	0	872				ADH1C_ENST00000515683.1_RNA			P00326	ADH1G_HUMAN	alcohol dehydrogenase 1C (class I), gamma polypeptide						ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|zinc ion binding (GO:0008270)								OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	CTGAATGGGTTTCTTGTAGTC	0.463																																					p.K249I												.	.	0			c.A746T	4						.						372.0	370.0	370.0					4																	100264034		2203	4298	6501	100483057			126	exon6			M12272		4q23	2010-03-16			ENSG00000248144	ENSG00000248144	1.1.1.1	"""Alcohol dehydrogenases"""	251	protein-coding gene	gene with protein product		103730		ADH3		3006456	Standard	NM_000669		Approved		uc031sgp.1	P00326	OTTHUMG00000161422		4.37:g.100264034T>A		Somatic		Capture	Illumina HiSeq	Phase_I	100483057	NM_000669	Q4PJ18|Q5WRV0|Q6LBW4|Q6NWV0|Q6NZA7	Missense_Mutation	SNP	ENST00000510055.1	37																																																																																					ADH1C-004	KNOWN	mRNA_end_NF|basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000365189.2	NM_000669	
SYNPO2	171024	broad.mit.edu	37	4	119951286	119951286	+	Silent	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr4:119951286C>T	ENST00000429713.2	+	4	1538	c.1356C>T	c.(1354-1356)gaC>gaT	p.D452D	SYNPO2_ENST00000307142.4_Silent_p.D452D|SYNPO2_ENST00000434046.2_Silent_p.D452D|SYNPO2_ENST00000448416.2_Intron	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	452						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)	p.D452D(2)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TATTGTCTGACGTTGACGACA	0.468																																					p.D452D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1356T	4						.						177.0	172.0	173.0					4																	119951286		2203	4300	6503	120170734	SO:0001819	synonymous_variant	171024	exon4			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.1356C>T	4.37:g.119951286C>T		Somatic		Capture	Illumina HiSeq	Phase_I	120170734	NM_133477	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Silent	SNP	ENST00000429713.2	37	CCDS47129.1	.	.	.	.	.	.	.	.	.	.	C	5.164	0.215875	0.09810	.	.	ENSG00000172403	ENST00000504178	.	.	.	5.69	3.87	0.44632	.	.	.	.	.	T	0.56321	0.1977	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53107	-0.8485	4	.	.	.	-21.972	7.2429	0.26106	0.0:0.5943:0.2692:0.1365	.	.	.	.	C	404	.	.	R	+	1	0	SYNPO2	120170734	0.814000	0.29104	0.228000	0.23943	0.016000	0.09150	1.377000	0.34317	1.365000	0.46057	0.563000	0.77884	CGT		SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
TRPC3	7222	broad.mit.edu	37	4	122853579	122853579	+	Silent	SNP	G	G	A	rs200018915		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr4:122853579G>A	ENST00000379645.3	-	2	907	c.834C>T	c.(832-834)caC>caT	p.H278H	TRPC3_ENST00000513531.1_Silent_p.H205H|TRPC3_ENST00000264811.5_Silent_p.H205H	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	193					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.H205H(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TGAAGGAGTCGTGCCTCTGCT	0.602																																					p.H205H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C615T	4						.						50.0	45.0	46.0					4																	122853579		2203	4300	6503	123073029	SO:0001819	synonymous_variant	7222	exon1			Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.834C>T	4.37:g.122853579G>A		Somatic		Capture	Illumina HiSeq	Phase_I	123073029	NM_003305	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Silent	SNP	ENST00000379645.3	37	CCDS47130.1																																																																																				TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305	
KLF3	51274	broad.mit.edu	37	4	38696440	38696440	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr4:38696440C>T	ENST00000261438.5	+	5	1074	c.769C>T	c.(769-771)Cgg>Tgg	p.R257W		NM_016531.5	NP_057615.3	P57682	KLF3_HUMAN	Kruppel-like factor 3 (basic)	257					cellular response to peptide (GO:1901653)|multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R257W(2)		endometrium(5)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18						TCAAAGGAAGCGGAGGATACA	0.468																																					p.R257W												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C769T	4						.						121.0	114.0	116.0					4																	38696440		2203	4300	6503	38372835	SO:0001583	missense	51274	exon5			AF285837	CCDS3444.1	4p16.1-p15.2	2013-01-08			ENSG00000109787	ENSG00000109787		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16516	protein-coding gene	gene with protein product	"""basic Kruppel-like factor"""	609392				18391014	Standard	NM_016531		Approved	BKLF	uc003gth.4	P57682	OTTHUMG00000097821	ENST00000261438.5:c.769C>T	4.37:g.38696440C>T	ENSP00000261438:p.Arg257Trp	Somatic		Capture	Illumina HiSeq	Phase_I	38372835	NM_016531	Q6PIR1|Q86TN0|Q9P2X6	Missense_Mutation	SNP	ENST00000261438.5	37	CCDS3444.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.673687	0.88445	.	.	ENSG00000109787	ENST00000261438	T	0.10960	2.82	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000001	T	0.36635	0.0974	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.03306	-1.1050	10	0.87932	D	0	.	15.581	0.76439	0.1377:0.8623:0.0:0.0	.	257	P57682	KLF3_HUMAN	W	257	ENSP00000261438:R257W	ENSP00000261438:R257W	R	+	1	2	KLF3	38372835	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.569000	0.53827	2.941000	0.99782	0.655000	0.94253	CGG		KLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215093.2		
CXCL5	6374	broad.mit.edu	37	4	74864043	74864043	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr4:74864043G>A	ENST00000296027.4	-	2	319	c.122C>T	c.(121-123)gCt>gTt	p.A41V		NM_002994.3	NP_002985.1	P42830	CXCL5_HUMAN	chemokine (C-X-C motif) ligand 5	41					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)	p.A41V(2)		endometrium(3)|large_intestine(2)|lung(3)|urinary_tract(1)	9	Breast(15;0.00136)		all cancers(17;0.00273)|Lung(101;0.196)			CAACACAGCAGCGGCAGGACC	0.557																																					p.A41V												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C122T	4						.						62.0	64.0	64.0					4																	74864043		2203	4300	6503	75082907	SO:0001583	missense	6374	exon2			X78686	CCDS34006.1	4q13.3	2013-02-25	2002-08-22	2002-08-23		ENSG00000163735		"""Endogenous ligands"""	10642	protein-coding gene	gene with protein product		600324	"""small inducible cytokine subfamily B (Cys-X-Cys), member 5 (epithelial-derived neutrophil-activating peptide 78)"""	SCYB5		7929219	Standard	NM_002994		Approved	ENA-78	uc003hhk.4	P42830		ENST00000296027.4:c.122C>T	4.37:g.74864043G>A	ENSP00000296027:p.Ala41Val	Somatic		Capture	Illumina HiSeq	Phase_I	75082907	NM_002994	Q96QE1	Missense_Mutation	SNP	ENST00000296027.4	37	CCDS34006.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.990243	0.54041	.	.	ENSG00000163735	ENST00000296027	.	.	.	3.45	-2.51	0.06365	Chemokine interleukin-8-like domain (1);	0.685869	0.14472	N	0.317539	T	0.30417	0.0764	L	0.43554	1.36	0.09310	N	1	P	0.41784	0.762	P	0.48063	0.565	T	0.18618	-1.0331	9	0.34782	T	0.22	.	4.2619	0.10745	0.317:0.3252:0.3578:0.0	.	41	P42830	CXCL5_HUMAN	V	41	.	ENSP00000296027:A41V	A	-	2	0	CXCL5	75082907	0.022000	0.18835	0.000000	0.03702	0.210000	0.24377	1.150000	0.31639	-0.789000	0.04498	0.306000	0.20318	GCT		CXCL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362749.1	NM_002994	
TRIML1	339976	broad.mit.edu	37	4	189067977	189067977	+	Splice_Site	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr4:189067977G>A	ENST00000332517.3	+	6	998	c.858G>A	c.(856-858)acG>acA	p.T286T	TRIML1_ENST00000507581.1_3'UTR	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	286	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.T286T(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		CTCTTGCAGCGGAGATAACGC	0.468																																					p.T286T	Melanoma(31;213 1036 16579 23968 32372)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G858A	4						.						139.0	144.0	142.0					4																	189067977		2203	4300	6503	189304971	SO:0001630	splice_region_variant	339976	exon6			AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.857-1G>A	4.37:g.189067977G>A		Somatic		Capture	Illumina HiSeq	Phase_I	189304971	NM_178556	Q96BE5	Silent	SNP	ENST00000332517.3	37	CCDS3851.1																																																																																				TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359813.1	NM_178556	Silent
APC	324	broad.mit.edu	37	5	112175513	112175513	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr5:112175513G>T	ENST00000457016.1	+	16	4602	c.4222G>T	c.(4222-4224)Gaa>Taa	p.E1408*	APC_ENST00000257430.4_Nonsense_Mutation_p.E1408*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.E1408*			P25054	APC_HUMAN	adenomatous polyposis coli	1408	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E1408*(12)|p.Y1376fs*41(1)|p.?(1)|p.K1192fs*3(1)|p.E1408fs*8(1)|p.S1407fs*15(1)|p.E1408fs*7(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CGTTCAGAGTGAACCATGCAG	0.473		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1390X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0 	.	18	Substitution - Nonsense(12)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(15)|soft_tissue(1)|breast(1)|skin(1)	c.G4168T	5						.						116.0	107.0	110.0					5																	112175513		2202	4300	6502	112203412	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4222G>T	5.37:g.112175513G>T	ENSP00000413133:p.Glu1408*	Somatic		Capture	Illumina HiSeq	Phase_I	112203412	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	41	8.766917	0.98945	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.07	6.07	0.98685	.	0.101580	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-24.1639	15.3709	0.74564	0.0:0.0:0.8606:0.1393	.	.	.	.	X	1408	.	.	E	+	1	0	APC	112203412	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.500000	0.81588	2.884000	0.98904	0.655000	0.94253	GAA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
SPEF2	79925	broad.mit.edu	37	5	35727900	35727900	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr5:35727900T>A	ENST00000356031.3	+	21	3192	c.3038T>A	c.(3037-3039)gTc>gAc	p.V1013D	SPEF2_ENST00000440995.2_Missense_Mutation_p.V1008D|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1013					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.V1013D(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GAAGAATGGGTCTATGTGAAT	0.433																																					p.V1013D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3038A	5						.						123.0	125.0	125.0					5																	35727900		1947	4135	6082	35763657	SO:0001583	missense	79925	exon21			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.3038T>A	5.37:g.35727900T>A	ENSP00000348314:p.Val1013Asp	Somatic		Capture	Illumina HiSeq	Phase_I	35763657	NM_024867	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	T	18.00	3.525206	0.64747	.	.	ENSG00000152582	ENST00000356031;ENST00000440995	T;T	0.06068	3.35;3.35	5.3	4.12	0.48240	.	0.302480	0.29806	N	0.011151	T	0.20659	0.0497	M	0.72479	2.2	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.83275	0.996;0.991	T	0.00300	-1.1835	10	0.45353	T	0.12	.	9.4914	0.38962	0.1577:0.0:0.0:0.8423	.	1008;1013	Q9C093-2;Q9C093	.;SPEF2_HUMAN	D	1013;1008	ENSP00000348314:V1013D;ENSP00000412125:V1008D	ENSP00000348314:V1013D	V	+	2	0	SPEF2	35763657	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	4.540000	0.60664	0.936000	0.37367	-0.341000	0.08007	GTC		SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
CMYA5	202333	broad.mit.edu	37	5	79027202	79027202	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr5:79027202C>T	ENST00000446378.2	+	2	2645	c.2614C>T	c.(2614-2616)Ctt>Ttt	p.L872F		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	872					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.L872F(2)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GGCCCCACCACTTTCAGCCAC	0.483																																					p.L872F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2614T	5						.						75.0	74.0	74.0					5																	79027202		1968	4155	6123	79062958	SO:0001583	missense	202333	exon2			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.2614C>T	5.37:g.79027202C>T	ENSP00000394770:p.Leu872Phe	Somatic		Capture	Illumina HiSeq	Phase_I	79062958	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.425778	0.43020	.	.	ENSG00000164309	ENST00000446378	T	0.46063	0.88	5.67	0.252	0.15545	.	2.085870	0.01988	N	0.045310	T	0.24812	0.0602	N	0.05031	-0.125	0.09310	N	1	B	0.25609	0.13	B	0.19391	0.025	T	0.22836	-1.0205	10	0.38643	T	0.18	.	8.9617	0.35851	0.0:0.5588:0.0:0.4412	.	872	Q8N3K9	CMYA5_HUMAN	F	872	ENSP00000394770:L872F	ENSP00000394770:L872F	L	+	1	0	CMYA5	79062958	0.000000	0.05858	0.000000	0.03702	0.449000	0.32228	-0.047000	0.11963	0.195000	0.20347	0.655000	0.94253	CTT		CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
IL12B	3593	broad.mit.edu	37	5	158747504	158747504	+	Silent	SNP	C	C	T	rs369160771		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr5:158747504C>T	ENST00000231228.2	-	5	962	c.507G>A	c.(505-507)acG>acA	p.T169T	RNU4ATAC2P_ENST00000408674.1_RNA	NM_002187.2	NP_002178.2	P29460	IL12B_HUMAN	interleukin 12B	169					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|interferon-gamma biosynthetic process (GO:0042095)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of cell adhesion (GO:0045785)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to UV-B (GO:0010224)|sensory perception of pain (GO:0019233)|sexual reproduction (GO:0019953)|T-helper 1 type immune response (GO:0042088)|T-helper cell differentiation (GO:0042093)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)|interleukin-23 complex (GO:0070743)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)|identical protein binding (GO:0042802)|interleukin-12 alpha subunit binding (GO:0042164)|interleukin-12 receptor binding (GO:0005143)|protein heterodimerization activity (GO:0046982)	p.T169T(1)		cervix(1)|endometrium(1)|large_intestine(5)|lung(4)	11	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGCTCCGCACGTCACCCCTT	0.537																																					p.T169T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G507A	5						.						66.0	62.0	64.0					5																	158747504		2203	4300	6503	158680082	SO:0001819	synonymous_variant	3593	exon5			M65290	CCDS4346.1	5q31.1-q33.1	2014-09-17	2014-04-04		ENSG00000113302	ENSG00000113302		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5970	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor-2"", ""cytotoxic lymphocyte maturation factor 2, p40"", ""interleukin 12, p40"", ""natural killer cell stimulatory factor, 40 kD subunit"", ""interleukin-12 beta chain"", ""IL12, subunit p40"""	161561	"""interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)"""	NKSF2		1673147	Standard	NM_002187		Approved	CLMF, IL-12B, NKSF, CLMF2	uc003lxr.1	P29460	OTTHUMG00000130307	ENST00000231228.2:c.507G>A	5.37:g.158747504C>T		Somatic		Capture	Illumina HiSeq	Phase_I	158680082	NM_002187		Silent	SNP	ENST00000231228.2	37	CCDS4346.1																																																																																				IL12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252652.2	NM_002187	
TULP4	56995	broad.mit.edu	37	6	158925150	158925151	+	Frame_Shift_Ins	INS	-	-	G	rs199660698		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr6:158925150_158925151insG	ENST00000367097.3	+	13	5812_5813	c.4455_4456insG	c.(4456-4458)gggfs	p.G1486fs	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	1486	TUB.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		AGCTGGACTTCGGGGGGCGGGT	0.649																																					p.F1485fs												.	.	0			c.4455_4456insG	6						.																																			158845139	SO:0001589	frameshift_variant	56995	exon13				CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.4461dupG	6.37:g.158925156_158925156dupG	ENSP00000356064:p.Gly1486fs	None		Capture	Illumina HiSeq	Phase_I	158845138	NM_020245	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Frame_Shift_Ins	INS	ENST00000367097.3	37	CCDS34561.1																																																																																				TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245	
GRIK2	2898	broad.mit.edu	37	6	102483221	102483221	+	Silent	SNP	A	A	C			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr6:102483221A>C	ENST00000421544.1	+	14	2581	c.2091A>C	c.(2089-2091)tcA>tcC	p.S697S	GRIK2_ENST00000413795.1_Silent_p.S697S|GRIK2_ENST00000369134.4_Silent_p.S648S|GRIK2_ENST00000318991.6_Silent_p.S697S|GRIK2_ENST00000369137.3_Silent_p.S621S|GRIK2_ENST00000369138.1_Silent_p.S697S	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	697					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.S697S(2)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TTCAGAAATCAAAAATCTCCA	0.373																																					p.S697S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A2091C	6						.						62.0	63.0	62.0					6																	102483221		2202	4297	6499	102589914	SO:0001819	synonymous_variant	2898	exon14				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2091A>C	6.37:g.102483221A>C		Somatic		Capture	Illumina HiSeq	Phase_I	102589914	NM_021956	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Silent	SNP	ENST00000421544.1	37	CCDS5048.1																																																																																				GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		
RSPH4A	345895	broad.mit.edu	37	6	116948892	116948892	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr6:116948892T>A	ENST00000229554.5	+	3	1159	c.1022T>A	c.(1021-1023)cTc>cAc	p.L341H	RSPH4A_ENST00000368580.4_Intron|RSPH4A_ENST00000368581.4_Missense_Mutation_p.L341H	NM_001010892.2	NP_001010892.1	Q5TD94	RSH4A_HUMAN	radial spoke head 4 homolog A (Chlamydomonas)	341					axoneme assembly (GO:0035082)|cilium movement (GO:0003341)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|radial spoke (GO:0001534)		p.L341H(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						TTTCTTGCCCTCAAGCAGCTT	0.433									Kartagener syndrome																												p.L341H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1022A	6						.						115.0	116.0	116.0					6																	116948892		2203	4300	6503	117055585	SO:0001583	missense	345895	exon3	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome		CCDS34521.1, CCDS55051.1	6q22.1	2012-05-03	2009-02-17	2009-02-17	ENSG00000111834	ENSG00000111834			21558	protein-coding gene	gene with protein product		612647	"""radial spokehead-like 3"""	RSHL3		19200523	Standard	NM_001010892		Approved	dJ412I7.1, FLJ37974, RSPH6B, CILD11	uc003pxe.2	Q5TD94	OTTHUMG00000015444	ENST00000229554.5:c.1022T>A	6.37:g.116948892T>A	ENSP00000229554:p.Leu341His	Somatic		Capture	Illumina HiSeq	Phase_I	117055585	NM_001161664	B4DSI1|Q3KP24|Q5TD95	Missense_Mutation	SNP	ENST00000229554.5	37	CCDS34521.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.260172	0.80246	.	.	ENSG00000111834	ENST00000368581;ENST00000229554;ENST00000447842	T;T	0.27402	1.67;1.67	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.52645	0.1747	M	0.87900	2.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.985	T	0.62978	-0.6739	10	0.87932	D	0	-5.6781	13.5051	0.61479	0.0:0.0:0.0:1.0	.	341;341	Q5TD94-3;Q5TD94	.;RSH4A_HUMAN	H	341;341;136	ENSP00000357570:L341H;ENSP00000229554:L341H	ENSP00000229554:L341H	L	+	2	0	RSPH4A	117055585	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.716000	0.84723	2.055000	0.61198	0.482000	0.46254	CTC		RSPH4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041960.1	NM_001010892	
ECT2L	345930	broad.mit.edu	37	6	139135630	139135630	+	Silent	SNP	C	C	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr6:139135630C>A	ENST00000423192.1	+	3	230	c.69C>A	c.(67-69)ctC>ctA	p.L23L	ECT2L_ENST00000541398.1_5'Flank|ECT2L_ENST00000367682.2_Silent_p.L23L			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	23							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L23L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						CCTTATAGCTCTTTCAGGAAA	0.383			"""N, Splice, Mis"""		ETP ALL																																p.L23L			Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C69A	6						.						65.0	65.0	65.0					6																	139135630		1851	4094	5945	139177323	SO:0001819	synonymous_variant	345930	exon4				CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.69C>A	6.37:g.139135630C>A		Somatic		Capture	Illumina HiSeq	Phase_I	139177323	NM_001077706	B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Silent	SNP	ENST00000423192.1	37	CCDS43508.1																																																																																				ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3	NM_001077706	
PKHD1	5314	broad.mit.edu	37	6	51512850	51512850	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr6:51512850C>T	ENST00000371117.3	-	63	11652	c.11377G>A	c.(11377-11379)Gca>Aca	p.A3793T		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3793					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.A3793T(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GAGTCTGATGCTCCTTCCAGG	0.428																																					p.A3793T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G11377A	6						.						123.0	123.0	123.0					6																	51512850		2203	4300	6503	51620809	SO:0001583	missense	5314	exon63			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.11377G>A	6.37:g.51512850C>T	ENSP00000360158:p.Ala3793Thr	Somatic		Capture	Illumina HiSeq	Phase_I	51620809	NM_138694	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	6.587	0.476671	0.12521	.	.	ENSG00000170927	ENST00000371117	D	0.85411	-1.98	5.34	-6.22	0.02058	.	0.728203	0.13018	N	0.420267	T	0.33177	0.0854	N	0.02391	-0.57	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.51052	-0.8754	10	0.12103	T	0.63	.	8.061	0.30633	0.302:0.5159:0.0:0.1821	.	3793	P08F94	PKHD1_HUMAN	T	3793	ENSP00000360158:A3793T	ENSP00000360158:A3793T	A	-	1	0	PKHD1	51620809	0.000000	0.05858	0.002000	0.10522	0.942000	0.58702	-0.781000	0.04648	-1.049000	0.03234	-0.781000	0.03364	GCA		PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
PKHD1	5314	broad.mit.edu	37	6	51612774	51612774	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr6:51612774A>C	ENST00000371117.3	-	58	9915	c.9640T>G	c.(9640-9642)Tgc>Ggc	p.C3214G	PKHD1_ENST00000340994.4_Missense_Mutation_p.C3214G	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3214					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.C3214G(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TCCTGAATGCAGTCAAAAGAA	0.458																																					p.C3214G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T9640G	6						.						108.0	110.0	110.0					6																	51612774		2203	4300	6503	51720733	SO:0001583	missense	5314	exon58			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.9640T>G	6.37:g.51612774A>C	ENSP00000360158:p.Cys3214Gly	Somatic		Capture	Illumina HiSeq	Phase_I	51720733	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	A	18.94	3.730563	0.69074	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.94330	-3.25;-3.4	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.96112	0.8733	M	0.80746	2.51	0.43152	D	0.99492	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.997	D	0.96329	0.9242	10	0.54805	T	0.06	.	15.2351	0.73422	1.0:0.0:0.0:0.0	.	3214;3214;3214	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	G	3214	ENSP00000360158:C3214G;ENSP00000341097:C3214G	ENSP00000341097:C3214G	C	-	1	0	PKHD1	51720733	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.087000	0.71362	2.193000	0.70182	0.533000	0.62120	TGC		PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
TBX18	9096	broad.mit.edu	37	6	85453986	85453986	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr6:85453986G>A	ENST00000369663.5	-	6	1334	c.997C>T	c.(997-999)Cgc>Tgc	p.R333C	TBX18_ENST00000606521.1_5'UTR|TBX18_ENST00000606784.1_Missense_Mutation_p.R175C	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	333					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.R333C(2)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		CACCTGTTGCGCCCGGAGTCT	0.338																																					p.R333C												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C997T	6						.						47.0	47.0	47.0					6																	85453986		2203	4299	6502	85510705	SO:0001583	missense	9096	exon6			AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.997C>T	6.37:g.85453986G>A	ENSP00000358677:p.Arg333Cys	Somatic		Capture	Illumina HiSeq	Phase_I	85510705	NM_001080508	A2RU13|Q7Z6U4|Q9UJI6	Missense_Mutation	SNP	ENST00000369663.5	37	CCDS34495.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107078	0.77096	.	.	ENSG00000112837	ENST00000416980;ENST00000369663	T	0.80909	-1.43	5.92	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.80363	0.4609	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.65874	0.932;0.939	D	0.83916	0.0298	10	0.72032	D	0.01	.	15.2612	0.73625	0.0:0.0:0.836:0.1639	.	249;333	Q8IW86;O95935	.;TBX18_HUMAN	C	248;333	ENSP00000358677:R333C	ENSP00000358677:R333C	R	-	1	0	TBX18	85510705	1.000000	0.71417	0.999000	0.59377	0.863000	0.49368	4.813000	0.62620	1.409000	0.46915	0.650000	0.86243	CGC		TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041378.2	NM_001080508	
FNDC1	84624	broad.mit.edu	37	6	159650863	159650863	+	Silent	SNP	C	C	T	rs377223835		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr6:159650863C>T	ENST00000297267.9	+	10	1397	c.1197C>T	c.(1195-1197)taC>taT	p.Y399Y	FNDC1_ENST00000340366.6_Intron	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	399	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.Y399Y(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		TTCTTTCATACGCCCCGGCTC	0.498																																					p.Y399Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1197T	6						.	C		0,3820		0,0,1910	139.0	144.0	143.0		1197	3.1	1.0	6		143	1,8249		0,1,4124	no	coding-synonymous	FNDC1	NM_032532.2		0,1,6034	TT,TC,CC		0.0121,0.0,0.0083		399/1895	159650863	1,12069	1910	4125	6035	159570851	SO:0001819	synonymous_variant	84624	exon10			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.1197C>T	6.37:g.159650863C>T		Somatic		Capture	Illumina HiSeq	Phase_I	159570851	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Silent	SNP	ENST00000297267.9	37	CCDS47512.1																																																																																				FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
KMT2C	58508	broad.mit.edu	37	7	151845451	151845451	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr7:151845451C>T	ENST00000262189.6	-	52	13779	c.13561G>A	c.(13561-13563)Gtc>Atc	p.V4521I	KMT2C_ENST00000355193.2_Missense_Mutation_p.V4578I	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4521					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.V4578I(1)|p.V4521I(1)									CTCCTGAAGACTGCAAAGTAA	0.463																																					p.V4521I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G13561A	7						.						122.0	106.0	112.0					7																	151845451		2203	4300	6503	151476384	SO:0001583	missense	58508	exon52			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.13561G>A	7.37:g.151845451C>T	ENSP00000262189:p.Val4521Ile	Somatic		Capture	Illumina HiSeq	Phase_I	151476384	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.012322|4.012322	0.75046|0.75046	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000360104|ENST00000262189;ENST00000355193;ENST00000424877	.|D;D;D	.|0.92446	.|-2.55;-2.5;-3.04	5.19|5.19	5.19|5.19	0.71726|0.71726	.|.	.|0.000000	.|0.37577	.|U	.|0.002031	D|D	0.95430|0.95430	0.8516|0.8516	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.994;0.999;0.999	.|D;D;D	.|0.80764	.|0.978;0.994;0.994	D|D	0.95757|0.95757	0.8797|0.8797	5|10	.|0.72032	.|D	.|0.01	.|.	18.7084|18.7084	0.91646|0.91646	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|4521;3639;4578	.|Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	.|MLL3_HUMAN;.;.	N|I	2081|4521;4578;1138	.|ENSP00000262189:V4521I;ENSP00000347325:V4578I;ENSP00000410411:V1138I	.|ENSP00000262189:V4521I	S|V	-|-	2|1	0|0	MLL3|MLL3	151476384|151476384	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.990000|0.990000	0.78478|0.78478	7.818000|7.818000	0.86416|0.86416	2.419000|2.419000	0.82065|0.82065	0.460000|0.460000	0.39030|0.39030	AGT|GTC		KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
SDK1	221935	broad.mit.edu	37	7	4153028	4153028	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr7:4153028C>T	ENST00000404826.2	+	24	3681	c.3542C>T	c.(3541-3543)aCg>aTg	p.T1181M	SDK1_ENST00000389531.3_Missense_Mutation_p.T1181M	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1181	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.T1181M(3)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ACCAGCGTCACGGTCCGTACT	0.647																																					p.T1181M												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C3542T	7						.						101.0	107.0	105.0					7																	4153028		2203	4300	6503	4119554	SO:0001583	missense	221935	exon24			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3542C>T	7.37:g.4153028C>T	ENSP00000385899:p.Thr1181Met	Somatic		Capture	Illumina HiSeq	Phase_I	4119554	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	C	16.63	3.177758	0.57692	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.59638	0.25;0.25	4.92	4.04	0.47022	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.339119	0.27976	N	0.017099	T	0.75882	0.3910	M	0.87971	2.92	0.44181	D	0.996997	D;D	0.89917	0.999;1.0	P;D	0.67103	0.891;0.949	T	0.79412	-0.1814	10	0.87932	D	0	.	10.8848	0.46960	0.0:0.7979:0.1297:0.0724	.	1181;1181	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	M	1181	ENSP00000385899:T1181M;ENSP00000374182:T1181M	ENSP00000374182:T1181M	T	+	2	0	SDK1	4119554	1.000000	0.71417	0.607000	0.28956	0.505000	0.33919	4.552000	0.60747	1.213000	0.43380	-0.126000	0.14955	ACG		SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
DPP6	1804	broad.mit.edu	37	7	154561166	154561166	+	Missense_Mutation	SNP	C	C	T	rs537661099		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr7:154561166C>T	ENST00000377770.3	+	9	1064	c.923C>T	c.(922-924)cCg>cTg	p.P308L	DPP6_ENST00000404039.1_Missense_Mutation_p.P244L|DPP6_ENST00000332007.3_Missense_Mutation_p.P246L|DPP6_ENST00000427557.1_Missense_Mutation_p.P201L			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	308					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)	p.P244L(1)		NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TGGTGGTCTCCGGATGGCACG	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		19132	0.001		0.0	False		,,,				2504	0.0				p.P244L	NSCLC(125;1384 1783 2490 7422 34254)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C731T	7						.						87.0	89.0	88.0					7																	154561166		2026	4173	6199	154192099	SO:0001583	missense	1804	exon9			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.923C>T	7.37:g.154561166C>T	ENSP00000367001:p.Pro308Leu	Somatic		Capture	Illumina HiSeq	Phase_I	154192099	NM_001039350		Missense_Mutation	SNP	ENST00000377770.3	37		.	.	.	.	.	.	.	.	.	.	C	18.73	3.685449	0.68157	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	5.28	5.28	0.74379	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.78660	0.4318	H	0.94423	3.535	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.941;1.0;0.956;0.956	D	0.85152	0.0987	10	0.87932	D	0	-15.237	18.9302	0.92561	0.0:1.0:0.0:0.0	.	201;246;308;244	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	L	244;308;246;201	ENSP00000385578:P244L;ENSP00000367001:P308L;ENSP00000328226:P246L;ENSP00000397303:P201L	ENSP00000328226:P246L	P	+	2	0	DPP6	154192099	1.000000	0.71417	0.185000	0.23176	0.139000	0.21198	7.501000	0.81600	2.469000	0.83416	0.655000	0.94253	CCG		DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
KIF13B	23303	broad.mit.edu	37	8	29006250	29006250	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr8:29006250G>A	ENST00000524189.1	-	16	1695	c.1657C>T	c.(1657-1659)Cga>Tga	p.R553*	KIF13B_ENST00000521515.1_Nonsense_Mutation_p.R553*	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	553					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)	p.R553*(1)		endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		TCATCCTCTCGTTCTGCTTTC	0.418																																					p.R553X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1657T	8						.						168.0	161.0	163.0					8																	29006250		1923	4142	6065	29062169	SO:0001587	stop_gained	23303	exon16			AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.1657C>T	8.37:g.29006250G>A	ENSP00000427900:p.Arg553*	Somatic		Capture	Illumina HiSeq	Phase_I	29062169	NM_015254	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Nonsense_Mutation	SNP	ENST00000524189.1	37	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	G	18.29	3.590485	0.66219	.	.	ENSG00000197892	ENST00000524189;ENST00000521515	.	.	.	4.74	0.657	0.17850	.	0.456909	0.22575	N	0.058295	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.8582	0.41098	0.0:0.1919:0.4576:0.3504	.	.	.	.	X	553	.	ENSP00000429201:R553X	R	-	1	2	KIF13B	29062169	0.004000	0.15560	0.047000	0.18901	0.416000	0.31233	0.241000	0.18065	0.238000	0.21222	0.561000	0.74099	CGA		KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
PXDNL	137902	broad.mit.edu	37	8	52252313	52252313	+	Splice_Site	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr8:52252313C>T	ENST00000356297.4	-	21	4117	c.4017G>A	c.(4015-4017)agG>agA	p.R1339R	PXDNL_ENST00000543296.1_Intron	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1339					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.R1339R(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TATCTTGTTGCCTATTTATAA	0.338																																					p.R1339R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4017A	8						.						109.0	103.0	105.0					8																	52252313		1807	4065	5872	52414866	SO:0001630	splice_region_variant	137902	exon21				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.4017-1G>A	8.37:g.52252313C>T		Somatic		Capture	Illumina HiSeq	Phase_I	52414866	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Silent	SNP	ENST00000356297.4	37	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	C	11.07	1.529424	0.27387	.	.	ENSG00000147485	ENST00000522933	.	.	.	5.0	4.13	0.48395	.	.	.	.	.	T	0.37433	0.1003	.	.	.	0.25725	N	0.98533	.	.	.	.	.	.	T	0.20672	-1.0268	4	.	.	.	.	9.4253	0.38576	0.0:0.9001:0.0:0.0999	.	.	.	.	D	413	.	.	G	-	2	0	PXDNL	52414866	0.073000	0.21202	0.027000	0.17364	0.380000	0.30137	1.615000	0.36922	1.101000	0.41535	0.591000	0.81541	GGC		PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	Silent
PXDNL	137902	broad.mit.edu	37	8	52321351	52321351	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr8:52321351C>T	ENST00000356297.4	-	17	2933	c.2833G>A	c.(2833-2835)Gcg>Acg	p.A945T	PXDNL_ENST00000543296.1_Missense_Mutation_p.A945T	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	945					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.A945T(1)|p.A144T(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TCCTGTCGCGCGCACTCGGTG	0.647																																					p.A945T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2833A	8						.						15.0	17.0	16.0					8																	52321351		1959	4139	6098	52483904	SO:0001583	missense	137902	exon17				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2833G>A	8.37:g.52321351C>T	ENSP00000348645:p.Ala945Thr	Somatic		Capture	Illumina HiSeq	Phase_I	52483904	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	C	5.961	0.361280	0.11296	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.72942	-0.7;-0.7	3.8	-7.59	0.01308	.	1.234380	0.06407	N	0.719947	T	0.29028	0.0721	N	0.01464	-0.85	0.09310	N	0.999999	B	0.02656	0.0	B	0.09377	0.004	T	0.26608	-1.0098	10	0.09590	T	0.72	.	0.2894	0.00256	0.2712:0.2021:0.138:0.3887	.	945	A1KZ92	PXDNL_HUMAN	T	945	ENSP00000348645:A945T;ENSP00000444865:A945T	ENSP00000348645:A945T	A	-	1	0	PXDNL	52483904	0.945000	0.32115	0.000000	0.03702	0.000000	0.00434	1.226000	0.32563	-1.213000	0.02617	-0.857000	0.03018	GCG		PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
FAM110B	90362	broad.mit.edu	37	8	59059311	59059311	+	Silent	SNP	G	G	A	rs183366212	byFrequency	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr8:59059311G>A	ENST00000361488.3	+	5	1402	c.522G>A	c.(520-522)ccG>ccA	p.P174P	FAM110B_ENST00000520369.1_Intron	NM_147189.2	NP_671722.1	Q8TC76	F110B_HUMAN	family with sequence similarity 110, member B	174						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.P174P(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)	26		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				GCAGGAGCCCGCAGGAGGGCG	0.682																																					p.P174P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G522A	8						.						23.0	23.0	23.0					8																	59059311		2203	4300	6503	59221865	SO:0001819	synonymous_variant	90362	exon5			U79298	CCDS6170.1	8q12.1	2007-06-21	2007-03-21	2007-03-21		ENSG00000169122			28587	protein-coding gene	gene with protein product		611394	"""chromosome 8 open reading frame 72"""	C8orf72		8619474, 9110174, 17499476	Standard	XM_005251324		Approved	MGC39325	uc003xtj.1	Q8TC76		ENST00000361488.3:c.522G>A	8.37:g.59059311G>A		Somatic		Capture	Illumina HiSeq	Phase_I	59221865	NM_147189	Q5BM08|Q9Y4K2	Silent	SNP	ENST00000361488.3	37	CCDS6170.1																																																																																				FAM110B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378095.2	NM_147189	
TRIM55	84675	broad.mit.edu	37	8	67066511	67066511	+	Missense_Mutation	SNP	C	C	T	rs150677263		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr8:67066511C>T	ENST00000315962.4	+	9	1839	c.1466C>T	c.(1465-1467)gCg>gTg	p.A489V	TRIM55_ENST00000353317.5_Intron|TRIM55_ENST00000350034.4_Intron|TRIM55_ENST00000276573.7_Missense_Mutation_p.A489V	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	489					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.A489V(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			GCAGCCGCAGCGAGTGAGAGG	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		14824	0.001		0.0	False		,,,				2504	0.0				p.A489V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1466T	8						.	C	VAL/ALA,VAL/ALA,,	3,4403	4.2+/-10.8	0,3,2200	67.0	64.0	65.0		1466,1466,,	5.9	1.0	8	dbSNP_134	65	0,8600		0,0,4300	yes	missense,missense,intron,intron	TRIM55	NM_033058.2,NM_184085.1,NM_184086.1,NM_184087.1	64,64,,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign,benign,,	489/541,489/549,,	67066511	3,13003	2203	4300	6503	67229065	SO:0001583	missense	84675	exon9			AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.1466C>T	8.37:g.67066511C>T	ENSP00000323913:p.Ala489Val	Somatic		Capture	Illumina HiSeq	Phase_I	67229065	NM_184085	B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Missense_Mutation	SNP	ENST00000315962.4	37	CCDS6184.1	.	.	.	.	.	.	.	.	.	.	C	9.983	1.228810	0.22542	6.81E-4	0.0	ENSG00000147573	ENST00000315962;ENST00000276573	T;T	0.27402	1.67;1.67	5.89	5.89	0.94794	.	0.443343	0.21197	N	0.078534	T	0.21509	0.0518	L	0.32530	0.975	0.32538	N	0.534068	B;B	0.15473	0.007;0.013	B;B	0.10450	0.002;0.005	T	0.19289	-1.0310	10	0.12766	T	0.61	.	10.3311	0.43823	0.0:0.8506:0.0:0.1494	.	489;489	Q9BYV6;Q9BYV6-3	TRI55_HUMAN;.	V	489	ENSP00000323913:A489V;ENSP00000276573:A489V	ENSP00000276573:A489V	A	+	2	0	TRIM55	67229065	0.683000	0.27633	0.977000	0.42913	0.046000	0.14306	3.780000	0.55386	2.801000	0.96364	0.650000	0.86243	GCG		TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378921.1	NM_184085	
PREX2	80243	broad.mit.edu	37	8	69021745	69021745	+	Silent	SNP	C	C	G			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr8:69021745C>G	ENST00000288368.4	+	25	3310	c.3033C>G	c.(3031-3033)ctC>ctG	p.L1011L		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1011					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.L1011L(1)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						GCCATGGTCTCAGGTATCTGC	0.498																																					p.L1011L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3033G	8						.						103.0	100.0	101.0					8																	69021745		2203	4300	6503	69184299	SO:0001819	synonymous_variant	80243	exon25			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3033C>G	8.37:g.69021745C>G		Somatic		Capture	Illumina HiSeq	Phase_I	69184299	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	ENST00000288368.4	37	CCDS6201.1																																																																																				PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
SLC10A5	347051	broad.mit.edu	37	8	82606469	82606469	+	Silent	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr8:82606469G>A	ENST00000518568.1	-	1	1940	c.739C>T	c.(739-741)Ctg>Ttg	p.L247L		NM_001010893.2	NP_001010893.1	Q5PT55	NTCP5_HUMAN	solute carrier family 10, member 5	247						integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)	p.L247L(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)	15						ATCATGATCAGAGCCAATAAT	0.418																																					p.L247L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C739T	8						.						82.0	84.0	83.0					8																	82606469		2203	4300	6503	82769024	SO:0001819	synonymous_variant	347051	exon1				CCDS34915.1	8q21.13	2013-07-18	2013-07-18		ENSG00000253598	ENSG00000253598		"""Solute carriers"""	22981	protein-coding gene	gene with protein product							Standard	NM_001010893		Approved		uc011lfs.2	Q5PT55	OTTHUMG00000164683	ENST00000518568.1:c.739C>T	8.37:g.82606469G>A		Somatic		Capture	Illumina HiSeq	Phase_I	82769024	NM_001010893	B2RN26	Silent	SNP	ENST00000518568.1	37	CCDS34915.1																																																																																				SLC10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379736.1	XM_294493	
DECR1	1666	broad.mit.edu	37	8	91033189	91033189	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr8:91033189C>T	ENST00000220764.2	+	5	558	c.470C>T	c.(469-471)tCt>tTt	p.S157F	DECR1_ENST00000519007.1_3'UTR|DECR1_ENST00000522161.1_Missense_Mutation_p.S148F	NM_001359.1	NP_001350.1	Q16698	DECR_HUMAN	2,4-dienoyl CoA reductase 1, mitochondrial	157					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|NADPH binding (GO:0070402)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.S157F(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	15			BRCA - Breast invasive adenocarcinoma(11;0.00953)			GAAAGACTTTCTCCTAATGCT	0.348																																					p.S157F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C470T	8						.						85.0	84.0	84.0					8																	91033189		2203	4300	6503	91102365	SO:0001583	missense	1666	exon5			L26050	CCDS6250.1	8q21.3	2011-09-14			ENSG00000104325	ENSG00000104325		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2753	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 18C, member 1"""	222745		DECR		7818482, 19027726	Standard	NM_001359		Approved	SDR18C1	uc003yek.1	Q16698	OTTHUMG00000163829	ENST00000220764.2:c.470C>T	8.37:g.91033189C>T	ENSP00000220764:p.Ser157Phe	Somatic		Capture	Illumina HiSeq	Phase_I	91102365	NM_001359	B7Z6B8|Q2M304|Q93085	Missense_Mutation	SNP	ENST00000220764.2	37	CCDS6250.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.872434	0.91587	.	.	ENSG00000104325	ENST00000220764;ENST00000519410;ENST00000522161;ENST00000517761;ENST00000520227	T;D;T;D;D	0.88741	1.7;-2.42;1.7;-2.42;-2.42	5.5	5.5	0.81552	NAD(P)-binding domain (1);	0.102326	0.64402	D	0.000001	D	0.96941	0.9001	H	0.98005	4.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.987;0.994	D	0.98233	1.0484	10	0.87932	D	0	.	19.3822	0.94542	0.0:1.0:0.0:0.0	.	148;157	B7Z6B8;Q16698	.;DECR_HUMAN	F	157;135;148;148;107	ENSP00000220764:S157F;ENSP00000430561:S135F;ENSP00000429779:S148F;ENSP00000427936:S148F;ENSP00000429096:S107F	ENSP00000220764:S157F	S	+	2	0	DECR1	91102365	1.000000	0.71417	0.754000	0.31244	0.962000	0.63368	7.729000	0.84864	2.596000	0.87737	0.561000	0.74099	TCT		DECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375822.1		
GDF6	392255	broad.mit.edu	37	8	97156985	97156985	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr8:97156985G>A	ENST00000287020.5	-	2	1273	c.1174C>T	c.(1174-1176)Cgc>Tgc	p.R392C		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	392					activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)		p.R392C(1)|p.R392G(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					AGGTGCGAGCGCAGCGGGAAG	0.632																																					p.R392C												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C1174T	8						.						118.0	106.0	110.0					8																	97156985		2203	4300	6503	97226161	SO:0001583	missense	392255	exon2				CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.1174C>T	8.37:g.97156985G>A	ENSP00000287020:p.Arg392Cys	Somatic		Capture	Illumina HiSeq	Phase_I	97226161	NM_001001557	Q6PI58	Missense_Mutation	SNP	ENST00000287020.5	37	CCDS34926.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.26|19.26	3.792524|3.792524	0.70452|0.70452	.|.	.|.	ENSG00000156466|ENSG00000156466	ENST00000435084|ENST00000287020	.|D	.|0.84516	.|-1.86	4.82|4.82	4.82|4.82	0.62117|0.62117	.|Transforming growth factor-beta, C-terminal (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.92136|0.92136	0.7507|0.7507	M|M	0.84683|0.84683	2.71|2.71	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.92417|0.92417	0.5942|0.5942	6|10	0.22706|0.56958	T|D	0.39|0.05	.|.	11.9995|11.9995	0.53222|0.53222	0.0:0.0:0.8269:0.1731|0.0:0.0:0.8269:0.1731	.|.	.|392	.|Q6KF10	.|GDF6_HUMAN	V|C	308|392	.|ENSP00000287020:R392C	ENSP00000412749:A308V|ENSP00000287020:R392C	A|R	-|-	2|1	0|0	GDF6|GDF6	97226161|97226161	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.562000|2.562000	0.45914|0.45914	2.498000|2.498000	0.84270|0.84270	0.557000|0.557000	0.71058|0.71058	GCG|CGC		GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379862.2	NM_001001557	
FRMPD1	22844	broad.mit.edu	37	9	37744838	37744838	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr9:37744838C>T	ENST00000539465.1	+	16	3402	c.2809C>T	c.(2809-2811)Cga>Tga	p.R937*	FRMPD1_ENST00000377765.3_Nonsense_Mutation_p.R937*|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	937						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.R937*(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		CATCGACTCTCGAGTGTCTTC	0.537																																					p.R937X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2809T	9						.						116.0	101.0	106.0					9																	37744838		2203	4300	6503	37734838	SO:0001587	stop_gained	22844	exon16			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.2809C>T	9.37:g.37744838C>T	ENSP00000444411:p.Arg937*	Somatic		Capture	Illumina HiSeq	Phase_I	37734838	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Nonsense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	C	45	11.286179	0.99542	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	.	.	.	5.11	2.97	0.34412	.	0.507006	0.17428	N	0.174571	.	.	.	.	.	.	0.25583	N	0.986775	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-9.3817	2.3918	0.04380	0.1979:0.5022:0.1904:0.1096	.	.	.	.	X	937	.	ENSP00000366995:R937X	R	+	1	2	FRMPD1	37734838	0.008000	0.16893	1.000000	0.80357	0.995000	0.86356	0.866000	0.27954	2.372000	0.80975	0.561000	0.74099	CGA		FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
SVEP1	79987	broad.mit.edu	37	9	113245902	113245902	+	Missense_Mutation	SNP	C	C	T	rs369953563		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chr9:113245902C>T	ENST00000401783.2	-	10	2338	c.2002G>A	c.(2002-2004)Gca>Aca	p.A668T	SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.A645T|SVEP1_ENST00000374461.1_Missense_Mutation_p.A645T|SVEP1_ENST00000302728.8_Missense_Mutation_p.A668T	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	668	HYR 2. {ECO:0000255|PROSITE- ProRule:PRU00113}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.A668T(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TCCCAGCTTGCGGCATGTACC	0.453																																					p.A668T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2002A	9						.	C	THR/ALA	1,3977		0,1,1988	63.0	62.0	63.0		2002	5.4	0.1	9		63	0,8352		0,0,4176	no	missense	SVEP1	NM_153366.3	58	0,1,6164	TT,TC,CC		0.0,0.0251,0.0081	benign	668/3572	113245902	1,12329	1989	4176	6165	112285723	SO:0001583	missense	79987	exon10			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.2002G>A	9.37:g.113245902C>T	ENSP00000384917:p.Ala668Thr	Somatic		Capture	Illumina HiSeq	Phase_I	112285723	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.281768	0.80692	2.51E-4	0.0	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	5.42	5.42	0.78866	Hyalin (2);	0.293564	0.37623	N	0.002010	T	0.35189	0.0923	M	0.77103	2.36	0.43214	D	0.995086	D;P;P	0.53885	0.963;0.911;0.891	P;P;B	0.45037	0.467;0.467;0.336	T	0.32719	-0.9896	10	0.62326	D	0.03	.	19.5792	0.95459	0.0:1.0:0.0:0.0	.	668;668;668	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	T	668;645;668;645	ENSP00000384917:A668T;ENSP00000363593:A645T;ENSP00000304118:A668T;ENSP00000363585:A645T	ENSP00000304118:A668T	A	-	1	0	SVEP1	112285723	0.857000	0.29778	0.131000	0.22000	0.350000	0.29205	7.252000	0.78309	2.718000	0.92993	0.591000	0.81541	GCA		SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
MID2	11043	broad.mit.edu	37	X	107148850	107148850	+	Missense_Mutation	SNP	C	C	A	rs138552159		TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3814-01A-01W-0900-09	TCGA-AA-3814-10A-01W-0900-09	g.chrX:107148850C>A	ENST00000262843.6	+	5	1615	c.1067C>A	c.(1066-1068)gCt>gAt	p.A356D	RP6-191P20.4_ENST00000430140.1_RNA|MID2_ENST00000443968.2_Missense_Mutation_p.A356D	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	356	COS. {ECO:0000255|PROSITE- ProRule:PRU00586}.				innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.A336D(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						AAAAATATTGCTGAGAGGTCA	0.428																																					p.A356D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1067A	X						.						135.0	127.0	130.0					X																	107148850		2203	4300	6503	107035506	SO:0001583	missense	11043	exon5				CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.1067C>A	X.37:g.107148850C>A	ENSP00000262843:p.Ala356Asp	Somatic		Capture	Illumina HiSeq	Phase_I	107035506	NM_012216	A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Missense_Mutation	SNP	ENST00000262843.6	37	CCDS14532.2	.	.	.	.	.	.	.	.	.	.	C	8.904	0.956952	0.18507	.	.	ENSG00000080561	ENST00000262843;ENST00000443968	T;T	0.59906	0.23;0.26	5.48	4.42	0.53409	B-box, C-terminal (1);COS domain (1);	0.166949	0.53938	D	0.000058	T	0.45935	0.1367	L	0.36672	1.1	0.49483	D	0.999799	B;B	0.22683	0.073;0.022	B;B	0.22880	0.042;0.038	T	0.40021	-0.9585	10	0.34782	T	0.22	.	11.1991	0.48730	0.0:0.8906:0.0:0.1094	.	356;356	Q9UJV3;Q9UJV3-2	TRIM1_HUMAN;.	D	356	ENSP00000262843:A356D;ENSP00000413976:A356D	ENSP00000262843:A356D	A	+	2	0	MID2	107035506	0.997000	0.39634	1.000000	0.80357	0.975000	0.68041	3.538000	0.53597	2.288000	0.76882	0.600000	0.82982	GCT		MID2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057852.2	NM_012216	
