#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PDCD11	22984	broad.mit.edu	37	10	105164790	105164790	+	Silent	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr10:105164790C>T	ENST00000369797.3	+	5	508	c.414C>T	c.(412-414)caC>caT	p.H138H		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	138	S1 motif 1. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.H138H(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		ACCTACTTCACTTGCCTGAAC	0.473																																					p.H138H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C414T	10						.						144.0	126.0	132.0					10																	105164790		2203	4300	6503	105154780	SO:0001819	synonymous_variant	22984	exon5			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.414C>T	10.37:g.105164790C>T		Somatic		Capture	Illumina HiSeq	Phase_I	105154780	NM_014976	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Silent	SNP	ENST00000369797.3	37	CCDS31276.1																																																																																				PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		
GRK5	2869	broad.mit.edu	37	10	121140380	121140380	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr10:121140380C>T	ENST00000392870.2	+	3	531	c.202C>T	c.(202-204)Cgg>Tgg	p.R68W	GRK5_ENST00000369108.3_5'UTR|MIR4681_ENST00000580598.1_RNA	NM_005308.2	NP_005299.1	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5	68	N-terminal.|RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|phospholipid binding (GO:0005543)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)	p.R68W(1)		endometrium(2)|large_intestine(5)|lung(15)|skin(3)|stomach(1)|urinary_tract(1)	27		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		GCTGCTTTTCCGGCAGTTTTG	0.517																																					p.R68W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C202T	10						.						123.0	121.0	122.0					10																	121140380		2203	4300	6503	121130370	SO:0001583	missense	2869	exon3			L15388	CCDS7612.1	10q26.11	2013-09-19	2004-02-04	2004-02-06	ENSG00000198873	ENSG00000198873			4544	protein-coding gene	gene with protein product		600870		GPRK5		7685906	Standard	NM_005308		Approved		uc001led.3	P34947	OTTHUMG00000019149	ENST00000392870.2:c.202C>T	10.37:g.121140380C>T	ENSP00000376609:p.Arg68Trp	Somatic		Capture	Illumina HiSeq	Phase_I	121130370	NM_005308	D3DRD0|Q5T059	Missense_Mutation	SNP	ENST00000392870.2	37	CCDS7612.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.142391	0.77888	.	.	ENSG00000198873	ENST00000392870	T	0.02606	4.23	4.99	4.08	0.47627	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.314194	0.21986	N	0.066237	T	0.14874	0.0359	M	0.78344	2.41	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00477	-1.1716	10	0.87932	D	0	-1.1981	13.7642	0.62983	0.1551:0.8449:0.0:0.0	.	68	P34947	GRK5_HUMAN	W	68	ENSP00000376609:R68W	ENSP00000376609:R68W	R	+	1	2	GRK5	121130370	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.243000	0.58721	1.307000	0.44944	0.655000	0.94253	CGG		GRK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050652.2	NM_005308	
PRPF18	8559	broad.mit.edu	37	10	13658471	13658471	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr10:13658471A>G	ENST00000378572.3	+	9	1026	c.866A>G	c.(865-867)cAt>cGt	p.H289R		NM_003675.3	NP_003666.1	Q99633	PRP18_HUMAN	pre-mRNA processing factor 18	289					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	potassium channel inhibitor activity (GO:0019870)	p.H289R(1)		central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(5)|prostate(1)	17						GTTGGTATCCATGCCAGAACT	0.423																																					p.H289R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A866G	10						.						141.0	131.0	134.0					10																	13658471		2203	4300	6503	13698477	SO:0001583	missense	8559	exon9			U51990	CCDS7100.1	10p12.33	2013-06-10	2013-06-10		ENSG00000165630	ENSG00000165630			17351	protein-coding gene	gene with protein product		604993	"""PRP18 pre-mRNA processing factor 18 homolog (yeast)"", ""PRP18 pre-mRNA processing factor 18 homolog (S. cerevisiae)"""			9000057	Standard	XM_005252634		Approved	hPrp18	uc001imp.3	Q99633	OTTHUMG00000017702	ENST00000378572.3:c.866A>G	10.37:g.13658471A>G	ENSP00000367835:p.His289Arg	Somatic		Capture	Illumina HiSeq	Phase_I	13698477	NM_003675	Q5T9P9|Q9BUI9	Missense_Mutation	SNP	ENST00000378572.3	37	CCDS7100.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.418465	0.83559	.	.	ENSG00000165630	ENST00000378572	.	.	.	5.16	5.16	0.70880	Prp18 (3);	0.000000	0.85682	D	0.000000	D	0.85600	0.5734	M	0.92784	3.345	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89348	0.3659	8	.	.	.	-27.729	14.9968	0.71439	1.0:0.0:0.0:0.0	.	289	Q99633	PRP18_HUMAN	R	289	.	.	H	+	2	0	PRPF18	13698477	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.234000	0.95347	1.927000	0.55829	0.528000	0.53228	CAT		PRPF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046879.1		
BAG3	9531	broad.mit.edu	37	10	121432139	121432139	+	Missense_Mutation	SNP	C	C	T	rs144585878		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr10:121432139C>T	ENST00000369085.3	+	3	1186	c.880C>T	c.(880-882)Cgt>Tgt	p.R294C		NM_004281.3	NP_004272.2	O95817	BAG3_HUMAN	BCL2-associated athanogene 3	294					brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of apoptotic process (GO:0043066)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|Z disc (GO:0030018)		p.R294C(1)		endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(5)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	20		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)		CTCGCCCATCCGTGTGCACAC	0.647																																					p.R294C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C880T	10						.	C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	46.0	53.0	51.0		880	5.6	0.9	10	dbSNP_134	51	0,8600		0,0,4300	no	missense	BAG3	NM_004281.3	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	294/576	121432139	1,13005	2203	4300	6503	121422129	SO:0001583	missense	9531	exon3			AF095193	CCDS7615.1	10q25.2-q26.2	2014-09-17			ENSG00000151929	ENSG00000151929			939	protein-coding gene	gene with protein product		603883				9873016, 18094623	Standard	XM_005270287		Approved		uc001lem.3	O95817	OTTHUMG00000019155	ENST00000369085.3:c.880C>T	10.37:g.121432139C>T	ENSP00000358081:p.Arg294Cys	Somatic		Capture	Illumina HiSeq	Phase_I	121422129	NM_004281	A8K5L8|Q3B763|Q9NT20|Q9P120	Missense_Mutation	SNP	ENST00000369085.3	37	CCDS7615.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065057	0.55432	2.27E-4	0.0	ENSG00000151929	ENST00000369085;ENST00000450186	T;T	0.77620	-0.97;-1.11	5.57	5.57	0.84162	.	0.163364	0.44483	D	0.000444	T	0.79997	0.4543	L	0.34521	1.04	0.43863	D	0.996469	D;D	0.89917	1.0;1.0	P;P	0.60117	0.869;0.869	T	0.81097	-0.1087	10	0.59425	D	0.04	-10.8689	14.0117	0.64500	0.2746:0.7254:0.0:0.0	.	294;294	O95817;Q53GY1	BAG3_HUMAN;.	C	294;236	ENSP00000358081:R294C;ENSP00000410036:R236C	ENSP00000358081:R294C	R	+	1	0	BAG3	121422129	1.000000	0.71417	0.886000	0.34754	0.341000	0.28922	2.553000	0.45837	2.636000	0.89361	0.467000	0.42956	CGT		BAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050662.1	NM_004281	
MUC5B	727897	broad.mit.edu	37	11	1267546	1267546	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr11:1267546G>C	ENST00000529681.1	+	31	9494	c.9436G>C	c.(9436-9438)Gca>Cca	p.A3146P	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.A3149P	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3146	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.A3125P(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CACTACAACTGCAGCCACTGG	0.667																																					p.A3146P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G9436C	11						.						46.0	60.0	56.0					11																	1267546		2011	4128	6139	1224122	SO:0001583	missense	727897	exon31			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.9436G>C	11.37:g.1267546G>C	ENSP00000436812:p.Ala3146Pro	Somatic		Capture	Illumina HiSeq	Phase_I	1224122	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	g	1.938	-0.444306	0.04604	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844;ENST00000538459	T;T	0.21734	1.99;2.17	0.654	-1.08	0.09936	.	.	.	.	.	T	0.09598	0.0236	N	0.11201	0.11	0.09310	N	1	B;B	0.20164	0.042;0.0	B;B	0.15052	0.012;0.0	T	0.28106	-1.0054	8	0.87932	D	0	.	.	.	.	.	3729;3149	A7Y9J9;E9PBJ0	.;.	P	3146;3149;3118;3106;36	ENSP00000436812:A3146P;ENSP00000415793:A3149P	ENSP00000343037:A3118P	A	+	1	0	MUC5B	1224122	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.923000	0.04000	-0.348000	0.08286	0.186000	0.17326	GCA		MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
PDGFD	80310	broad.mit.edu	37	11	103814350	103814350	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr11:103814350G>A	ENST00000393158.2	-	5	781	c.602C>T	c.(601-603)aCg>aTg	p.T201M	PDGFD_ENST00000302251.5_Missense_Mutation_p.T195M|RP11-617B3.2_ENST00000527804.1_RNA			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	201					cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)		p.T201M(2)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		AGTGGGATCCGTTACTGATGG	0.413																																					p.T195M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C584T	11						.						81.0	70.0	74.0					11																	103814350		2202	4299	6501	103319560	SO:0001583	missense	80310	exon5			AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.602C>T	11.37:g.103814350G>A	ENSP00000376865:p.Thr201Met	Somatic		Capture	Illumina HiSeq	Phase_I	103319560	NM_033135	A8K9T6|Q9BWV5	Missense_Mutation	SNP	ENST00000393158.2	37	CCDS41703.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.321767	0.60634	.	.	ENSG00000170962	ENST00000393158;ENST00000302251	T;T	0.27256	1.68;1.68	5.53	5.53	0.82687	.	0.167413	0.52532	D	0.000063	T	0.25269	0.0614	L	0.49350	1.555	0.58432	D	0.999999	B;P	0.43352	0.272;0.804	B;B	0.34536	0.036;0.185	T	0.02958	-1.1089	10	0.33940	T	0.23	-12.7101	19.823	0.96605	0.0:0.0:1.0:0.0	.	201;195	Q9GZP0;Q9GZP0-2	PDGFD_HUMAN;.	M	201;195	ENSP00000376865:T201M;ENSP00000302193:T195M	ENSP00000302193:T195M	T	-	2	0	PDGFD	103319560	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.384000	0.66225	2.770000	0.95276	0.650000	0.86243	ACG		PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387231.2	NM_025208	
TPP1	1200	broad.mit.edu	37	11	6638944	6638944	+	Missense_Mutation	SNP	G	G	A	rs140726254	byFrequency	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr11:6638944G>A	ENST00000299427.6	-	4	353	c.293C>T	c.(292-294)aCg>aTg	p.T98M	TPP1_ENST00000533371.1_De_novo_Start_InFrame|TPP1_ENST00000534644.1_5'UTR|RP11-732A19.9_ENST00000545572.1_RNA	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I	0	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)	p.T98M(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	TTTTTGCACCGTGTGGAGGGT	0.537													G|||	10	0.00199681	0.0038	0.0014	5008	,	,		21269	0.0		0.002	False		,,,				2504	0.002				p.T98M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C293T	11						.	G	MET/THR	14,4388	21.2+/-45.6	0,14,2187	170.0	158.0	162.0		293	5.7	0.7	11	dbSNP_134	162	13,8579	9.8+/-36.6	0,13,4283	yes	missense	TPP1	NM_000391.3	81	0,27,6470	AA,AG,GG		0.1513,0.318,0.2078	possibly-damaging	98/564	6638944	27,12967	2201	4296	6497	6595520	SO:0001583	missense	1200	exon4			AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.293C>T	11.37:g.6638944G>A	ENSP00000299427:p.Thr98Met	Somatic		Capture	Illumina HiSeq	Phase_I	6595520	NM_000391	Q71V64	Missense_Mutation	SNP	ENST00000299427.6	37	CCDS7770.1	5	0.0022893772893772895	3	0.006097560975609756	0	0.0	0	0.0	2	0.002638522427440633	G	10.86	1.471094	0.26423	0.00318	0.001513	ENSG00000166340	ENST00000299427;ENST00000453338;ENST00000436873	T;T	0.64085	-0.08;-0.08	5.7	5.7	0.88788	Proteinase inhibitor, propeptide (1);Peptidase S53, propeptide (2);	0.161948	0.56097	D	0.000029	T	0.49253	0.1546	L	0.47016	1.485	0.42771	D	0.993834	P;B	0.47034	0.889;0.022	B;B	0.40602	0.334;0.011	T	0.56914	-0.7900	10	0.39692	T	0.17	-8.086	17.0031	0.86385	0.0:0.0:1.0:0.0	.	98;98	B4DEQ3;O14773	.;TPP1_HUMAN	M	98	ENSP00000299427:T98M;ENSP00000398136:T98M	ENSP00000299427:T98M	T	-	2	0	TPP1	6595520	0.995000	0.38212	0.695000	0.30226	0.252000	0.25951	3.441000	0.52893	2.688000	0.91661	0.655000	0.94253	ACG		TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257261.2		
PPFIBP2	8495	broad.mit.edu	37	11	7614385	7614385	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr11:7614385C>A	ENST00000299492.4	+	4	690	c.302C>A	c.(301-303)gCt>gAt	p.A101D	PPFIBP2_ENST00000533792.1_5'UTR	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	101					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)	p.A101D(1)		breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CACCACAGTGCTGCTAGTAAT	0.413																																					p.A101D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C302A	11						.						109.0	101.0	104.0					11																	7614385		2201	4296	6497	7570961	SO:0001583	missense	8495	exon4			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.302C>A	11.37:g.7614385C>A	ENSP00000299492:p.Ala101Asp	Somatic		Capture	Illumina HiSeq	Phase_I	7570961	NM_003621	B7Z433|E9PK77|O75337|Q8WW26	Missense_Mutation	SNP	ENST00000299492.4	37	CCDS31419.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.3|26.3	4.727734|4.727734	0.89390|0.89390	.|.	.|.	ENSG00000166387|ENSG00000166387	ENST00000299492;ENST00000527790;ENST00000541115|ENST00000524548	T;T|.	0.14640|.	2.49;2.49|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.246265|.	0.28572|.	N|.	0.014880|.	T|T	0.69531|0.69531	0.3121|0.3121	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	P;P|.	0.47762|.	0.9;0.536|.	B;B|.	0.39840|.	0.311;0.114|.	T|T	0.65010|0.65010	-0.6272|-0.6272	10|5	0.13853|.	T|.	0.58|.	-3.0073|-3.0073	17.6089|17.6089	0.88047|0.88047	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	24;101|.	F5GWB0;Q8ND30|.	.;LIPB2_HUMAN|.	D|M	101;101;24|56	ENSP00000299492:A101D;ENSP00000434981:A101D|.	ENSP00000299492:A101D|.	A|L	+|+	2|1	0|2	PPFIBP2|PPFIBP2	7570961|7570961	0.993000|0.993000	0.37304|0.37304	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	3.592000|3.592000	0.53993|0.53993	2.761000|2.761000	0.94854|0.94854	0.650000|0.650000	0.86243|0.86243	GCT|CTG		PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385345.2	NM_003621	
TNKS1BP1	85456	broad.mit.edu	37	11	57069991	57069991	+	Missense_Mutation	SNP	C	C	T	rs377332391		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr11:57069991C>T	ENST00000532437.1	-	6	4936	c.4625G>A	c.(4624-4626)cGg>cAg	p.R1542Q	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.R1542Q			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	1542	Acidic.|Tankyrase-binding.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.R1542Q(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GGAGGGTCGCCGAGAAGTCTG	0.642																																					p.R1542Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4625A	11						.	C	GLN/ARG	0,4402		0,0,2201	32.0	37.0	35.0		4625	1.4	0.0	11		35	1,8591	1.2+/-3.3	0,1,4295	no	missense	TNKS1BP1	NM_033396.2	43	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1542/1730	57069991	1,12993	2201	4296	6497	56826567	SO:0001583	missense	85456	exon7			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.4625G>A	11.37:g.57069991C>T	ENSP00000437271:p.Arg1542Gln	Somatic		Capture	Illumina HiSeq	Phase_I	56826567	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	C	9.666	1.145480	0.21288	0.0	1.16E-4	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.30981	1.51;1.51	4.56	1.44	0.22558	.	1.115060	0.06850	N	0.797148	T	0.23532	0.0569	L	0.47716	1.5	0.09310	N	1	B;B	0.27498	0.18;0.048	B;B	0.15484	0.013;0.006	T	0.23868	-1.0176	10	0.31617	T	0.26	-6.4885	4.6441	0.12563	0.1725:0.6272:0.0:0.2003	.	1542;123	Q9C0C2;Q86TK2	TB182_HUMAN;.	Q	1542	ENSP00000350990:R1542Q;ENSP00000437271:R1542Q	ENSP00000350990:R1542Q	R	-	2	0	TNKS1BP1	56826567	0.132000	0.22450	0.034000	0.17996	0.020000	0.10135	-0.120000	0.10660	0.489000	0.27749	0.561000	0.74099	CGG		TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
BATF2	116071	broad.mit.edu	37	11	64756809	64756809	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr11:64756809G>A	ENST00000301887.4	-	3	747	c.617C>T	c.(616-618)cCa>cTa	p.P206L	BATF2_ENST00000435842.2_Missense_Mutation_p.P121L|BATF2_ENST00000527716.1_Missense_Mutation_p.P182L	NM_138456.3	NP_612465.3	Q8N1L9	BATF2_HUMAN	basic leucine zipper transcription factor, ATF-like 2	206					defense response to protozoan (GO:0042832)|myeloid dendritic cell differentiation (GO:0043011)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P206L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|skin(1)	9						GAGGGGCTGTGGAGGGGCAGT	0.652																																					p.P206L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C617T	11						.						35.0	37.0	36.0					11																	64756809		2201	4297	6498	64513385	SO:0001583	missense	116071	exon3			AK092453	CCDS8087.1, CCDS73317.1	11q13.1	2013-01-10			ENSG00000168062	ENSG00000168062		"""basic leucine zipper proteins"""	25163	protein-coding gene	gene with protein product		614983					Standard	NM_138456		Approved	MGC20410	uc001ocf.1	Q8N1L9	OTTHUMG00000165633	ENST00000301887.4:c.617C>T	11.37:g.64756809G>A	ENSP00000301887:p.Pro206Leu	Somatic		Capture	Illumina HiSeq	Phase_I	64513385	NM_138456	D9IC56|Q8NAF4|Q8NAL8|Q96EH4	Missense_Mutation	SNP	ENST00000301887.4	37	CCDS8087.1	.	.	.	.	.	.	.	.	.	.	G	4.180	0.031957	0.08101	.	.	ENSG00000168062	ENST00000301887;ENST00000435842;ENST00000527716	T	0.57436	0.4	4.82	-6.75	0.01738	.	1.534990	0.04680	N	0.412225	T	0.25457	0.0619	N	0.11201	0.11	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.08932	-1.0698	10	0.26408	T	0.33	4.8781	3.4308	0.07428	0.5848:0.1222:0.1695:0.1235	.	206	Q8N1L9	BATF2_HUMAN	L	206;121;182	ENSP00000301887:P206L	ENSP00000301887:P206L	P	-	2	0	BATF2	64513385	0.005000	0.15991	0.002000	0.10522	0.176000	0.22953	-0.006000	0.12833	-0.876000	0.04017	-0.378000	0.06908	CCA		BATF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385478.2	NM_138456	
DLG2	1740	broad.mit.edu	37	11	83770391	83770391	+	Missense_Mutation	SNP	C	C	T	rs201416435		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr11:83770391C>T	ENST00000532653.1	-	6	873	c.571G>A	c.(571-573)Gtt>Att	p.V191I	DLG2_ENST00000398309.2_Missense_Mutation_p.V191I|DLG2_ENST00000418306.2_Missense_Mutation_p.V140I|DLG2_ENST00000376106.3_5'UTR|DLG2_ENST00000398301.2_Missense_Mutation_p.V230I|DLG2_ENST00000524982.1_Missense_Mutation_p.V191I|DLG2_ENST00000537455.1_5'UTR|DLG2_ENST00000330014.6_Missense_Mutation_p.V130I|DLG2_ENST00000531015.1_Missense_Mutation_p.V158I|DLG2_ENST00000376104.2_Missense_Mutation_p.V296I|DLG2_ENST00000280241.8_Missense_Mutation_p.V230I|DLG2_ENST00000543673.1_Missense_Mutation_p.V296I			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.V191I(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				ATTTCCACAACGGTCTCCAAA	0.448																																					p.V140I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G418A	11						.						148.0	136.0	140.0					11																	83770391		1901	4113	6014	83448039	SO:0001583	missense	1740	exon4			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.571G>A	11.37:g.83770391C>T	ENSP00000435849:p.Val191Ile	Somatic		Capture	Illumina HiSeq	Phase_I	83448039	NM_001142700	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000532653.1	37		.	.	.	.	.	.	.	.	.	.	C	7.885	0.731142	0.15507	.	.	ENSG00000150672	ENST00000398309;ENST00000376104;ENST00000418306;ENST00000543673;ENST00000280241;ENST00000330014;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000531015;ENST00000398301;ENST00000398299	T;T;T;T;T;T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08	5.1	5.1	0.69264	PDZ/DHR/GLGF (1);	0.092218	0.44097	D	0.000482	T	0.23611	0.0571	N	0.04043	-0.29	0.47862	D	0.999539	B;B;B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001;0.001;0.0;0.0	B;B;B;B;B;B;B;B	0.04013	0.0;0.0;0.0;0.0;0.0;0.001;0.0;0.001	T	0.08848	-1.0702	9	.	.	.	.	18.5094	0.90910	0.0:1.0:0.0:0.0	.	158;191;191;130;230;296;191;140	E9PIW2;B7Z2T4;E9PN83;B7Z264;Q6ZSU2;Q15700-2;Q15700;Q15700-3	.;.;.;.;.;.;DLG2_HUMAN;.	I	191;296;140;296;230;130;191;191;296;158;230;108	ENSP00000381355:V191I;ENSP00000365272:V296I;ENSP00000402275:V140I;ENSP00000441994:V296I;ENSP00000280241:V230I;ENSP00000381353:V130I;ENSP00000432894:V191I;ENSP00000435849:V191I;ENSP00000433848:V158I;ENSP00000381346:V230I;ENSP00000381344:V108I	.	V	-	1	0	DLG2	83448039	1.000000	0.71417	0.997000	0.53966	0.944000	0.59088	4.604000	0.61112	2.368000	0.80403	0.313000	0.20887	GTT		DLG2-009	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000259253.2	NM_001364	
FAT3	120114	broad.mit.edu	37	11	92565032	92565032	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr11:92565032G>A	ENST00000298047.6	+	13	9743	c.9726G>A	c.(9724-9726)ctG>ctA	p.L3242L	FAT3_ENST00000409404.2_Silent_p.L3242L|FAT3_ENST00000525166.1_Silent_p.L3092L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3242	Cadherin 30. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L3242L(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGGACTACCTGGTGACGGTGC	0.527										TCGA Ovarian(4;0.039)																											p.L3242L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G9726A	11						.						73.0	75.0	74.0					11																	92565032		1985	4181	6166	92204680	SO:0001819	synonymous_variant	120114	exon13			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.9726G>A	11.37:g.92565032G>A		Somatic		Capture	Illumina HiSeq	Phase_I	92204680	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																					FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
AMOTL1	154810	broad.mit.edu	37	11	94602456	94602456	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr11:94602456C>T	ENST00000433060.2	+	12	2723	c.2582C>T	c.(2581-2583)aCg>aTg	p.T861M	AMOTL1_ENST00000317837.9_Missense_Mutation_p.T448M|AMOTL1_ENST00000317829.8_Missense_Mutation_p.T811M	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	861					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)	p.T862M(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				GCCTCCACTACGGCAGCCAGC	0.637																																					p.T861M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2582T	11						.						25.0	33.0	30.0					11																	94602456		2161	4275	6436	94242104	SO:0001583	missense	154810	exon12			AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.2582C>T	11.37:g.94602456C>T	ENSP00000387739:p.Thr861Met	Somatic		Capture	Illumina HiSeq	Phase_I	94242104	NM_130847	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	ENST00000433060.2	37	CCDS44712.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.028938	0.75504	.	.	ENSG00000166025	ENST00000317829;ENST00000317837;ENST00000433060	T;T;T	0.48201	2.16;0.82;2.16	5.15	-3.52	0.04682	.	1.174800	0.06027	N	0.652344	T	0.29321	0.0730	L	0.39898	1.24	0.09310	N	1	P;P	0.44659	0.84;0.757	B;B	0.34873	0.191;0.186	T	0.34378	-0.9831	10	0.72032	D	0.01	-0.5058	2.3491	0.04279	0.1015:0.3181:0.2008:0.3796	.	811;861	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	M	811;448;861	ENSP00000320968:T811M;ENSP00000323474:T448M;ENSP00000387739:T861M	ENSP00000320968:T811M	T	+	2	0	AMOTL1	94242104	0.000000	0.05858	0.000000	0.03702	0.436000	0.31835	-0.366000	0.07563	-0.278000	0.09180	0.561000	0.74099	ACG		AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847	
GLB1L3	112937	broad.mit.edu	37	11	134182305	134182305	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr11:134182305G>T	ENST00000431683.2	+	14	1350	c.1350G>T	c.(1348-1350)caG>caT	p.Q450H		NM_001080407.2	NP_001073876.2	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1-like 3	450					carbohydrate metabolic process (GO:0005975)		beta-galactosidase activity (GO:0004565)	p.Q111H(1)|p.Q450H(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)	13	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		GGAGCGGCCAGTCCTACGGGC	0.592																																					p.Q450H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1350T	11						.						57.0	62.0	60.0					11																	134182305		2063	4205	6268	133687515	SO:0001583	missense	112937	exon14				CCDS44780.1	11q25	2008-11-06	2008-01-29		ENSG00000166105	ENSG00000166105			25147	protein-coding gene	gene with protein product						12477932	Standard	NM_001080407		Approved	FLJ90231	uc009zdf.3	Q8NCI6	OTTHUMG00000133524	ENST00000431683.2:c.1350G>T	11.37:g.134182305G>T	ENSP00000396615:p.Gln450His	Somatic		Capture	Illumina HiSeq	Phase_I	133687515	NM_001080407	A6NEM0|A6NN15|Q6P3S3|Q96FF8	Missense_Mutation	SNP	ENST00000431683.2	37	CCDS44780.1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.337653	0.41398	.	.	ENSG00000166105	ENST00000431683	D	0.94897	-3.55	4.69	0.605	0.17553	.	0.000000	0.85682	D	0.000000	D	0.96405	0.8827	H	0.94734	3.575	0.40206	D	0.977576	D	0.56968	0.978	P	0.54100	0.742	D	0.94900	0.8055	10	0.87932	D	0	.	8.1543	0.31160	0.3355:0.0:0.6645:0.0	.	450	Q8NCI6	GLBL3_HUMAN	H	450	ENSP00000396615:Q450H	ENSP00000396615:Q450H	Q	+	3	2	GLB1L3	133687515	1.000000	0.71417	0.837000	0.33122	0.219000	0.24729	2.525000	0.45598	0.031000	0.15407	0.655000	0.94253	CAG		GLB1L3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393625.1	NM_138416	
APPL2	55198	broad.mit.edu	37	12	105593207	105593207	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr12:105593207G>A	ENST00000258530.3	-	10	1032	c.807C>T	c.(805-807)gcC>gcT	p.A269A	APPL2_ENST00000551662.1_Silent_p.A275A|APPL2_ENST00000549573.1_5'UTR|APPL2_ENST00000539978.2_Silent_p.A226A	NM_001251904.1|NM_018171.3	NP_001238833.1|NP_060641.2	Q06481	APLP2_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2	0	Asp/Glu-rich (highly acidic).				cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)	p.A269A(1)		breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TCTGTGGTGCGGCCACATCAG	0.478																																					p.A269A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C807T	12						.						143.0	133.0	136.0					12																	105593207		2203	4300	6503	104117337	SO:0001819	synonymous_variant	55198	exon10			AY113704	CCDS9101.1, CCDS58275.1, CCDS58276.1	12q23.3	2014-08-12			ENSG00000136044	ENSG00000136044		"""Pleckstrin homology (PH) domain containing"""	18242	protein-coding gene	gene with protein product		606231				11431708, 17030088	Standard	NM_001251904		Approved	FLJ10659, DIP13B	uc010swu.1	Q8NEU8	OTTHUMG00000169853	ENST00000258530.3:c.807C>T	12.37:g.105593207G>A		Somatic		Capture	Illumina HiSeq	Phase_I	104117337	NM_018171	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Silent	SNP	ENST00000258530.3	37	CCDS9101.1																																																																																				APPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406238.3	NM_018171	
KDM2B	84678	broad.mit.edu	37	12	122016782	122016782	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr12:122016782G>A	ENST00000377071.4	-	2	268	c.196C>T	c.(196-198)Cgc>Tgc	p.R66C	RP13-941N14.1_ENST00000541574.1_lincRNA|KDM2B_ENST00000377069.4_Missense_Mutation_p.R35C|KDM2B_ENST00000538046.2_Missense_Mutation_p.R66C|KDM2B_ENST00000536437.1_5'UTR	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	66					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)	p.R66C(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						CTGAAGCCGCGGACGCTGACG	0.672																																					p.R66C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C196T	12						.						54.0	63.0	60.0					12																	122016782		2096	4221	6317	120501165	SO:0001583	missense	84678	exon2			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.196C>T	12.37:g.122016782G>A	ENSP00000366271:p.Arg66Cys	Somatic		Capture	Illumina HiSeq	Phase_I	120501165	NM_032590	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	37	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.069472	0.55539	.	.	ENSG00000089094	ENST00000397480;ENST00000377069;ENST00000377071;ENST00000397478;ENST00000261824;ENST00000446152;ENST00000539371	T;T;T	0.55234	2.07;1.43;0.53	4.06	3.08	0.35506	.	0.127499	0.29444	N	0.012121	T	0.60418	0.2267	M	0.85542	2.76	0.80722	D	1	P;P;D	0.60575	0.899;0.913;0.988	B;P;B	0.47206	0.287;0.541;0.386	T	0.70648	-0.4814	10	0.87932	D	0	-20.0301	11.3142	0.49381	0.0:0.0:0.7028:0.2972	.	66;66;35	E7EML5;Q8NHM5;A8MRS1	.;KDM2B_HUMAN;.	C	66;35;66;66;66;29;35	ENSP00000366269:R35C;ENSP00000366271:R66C;ENSP00000398279:R29C	ENSP00000261824:R66C	R	-	1	0	KDM2B	120501165	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.548000	0.45794	2.105000	0.64084	0.456000	0.33151	CGC		KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
SLC2A14	144195	broad.mit.edu	37	12	7973853	7973853	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr12:7973853G>A	ENST00000543909.1	-	13	1761	c.1002C>T	c.(1000-1002)agC>agT	p.S334S	SLC2A14_ENST00000340749.5_Silent_p.S311S|SLC2A14_ENST00000535295.1_Silent_p.S225S|SLC2A14_ENST00000431042.2_Silent_p.S311S|SLC2A14_ENST00000396589.2_Silent_p.S334S|SLC2A14_ENST00000539924.1_Silent_p.S349S|SLC2A14_ENST00000542505.1_5'UTR|SLC2A14_ENST00000542546.1_Silent_p.S225S			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	334					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)	p.S334S(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		CCACACCCGCGCTGATGGTGG	0.403																																					p.S334S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1002T	12						.						151.0	141.0	145.0					12																	7973853		2203	4300	6503	7865120	SO:0001819	synonymous_variant	144195	exon9			AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.1002C>T	12.37:g.7973853G>A		Somatic		Capture	Illumina HiSeq	Phase_I	7865120	NM_153449	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Silent	SNP	ENST00000543909.1	37	CCDS8585.1																																																																																				SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
VDR	7421	broad.mit.edu	37	12	48238691	48238691	+	Silent	SNP	C	C	T	rs368961482		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr12:48238691C>T	ENST00000395324.2	-	10	1390	c.1122G>A	c.(1120-1122)ccG>ccA	p.P374P	VDR_ENST00000550325.1_Silent_p.P424P|VDR_ENST00000535672.1_Silent_p.P342P|VDR_ENST00000229022.3_Silent_p.P374P|VDR_ENST00000549336.1_Silent_p.P374P			P11473	VDR_HUMAN	vitamin D (1,25- dihydroxyvitamin D3) receptor	374	Ligand-binding.				bile acid signaling pathway (GO:0038183)|calcium ion transport (GO:0006816)|cell morphogenesis (GO:0000902)|cellular calcium ion homeostasis (GO:0006874)|decidualization (GO:0046697)|gene expression (GO:0010467)|intestinal absorption (GO:0050892)|lactation (GO:0007595)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of calcidiol 1-monooxygenase activity (GO:0060558)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin D receptor signaling pathway (GO:0070561)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcitriol binding (GO:1902098)|calcitriol receptor activity (GO:0008434)|DNA binding (GO:0003677)|lithocholic acid binding (GO:1902121)|lithocholic acid receptor activity (GO:0038186)|retinoid X receptor binding (GO:0046965)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.P374P(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(3)|skin(2)	22		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Alfacalcidol(DB01436)|Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Cholecalciferol(DB00169)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	GGTGGCTGCCCGGGGGCGGGT	0.642																																					p.P374P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1122A	12						.						97.0	105.0	102.0					12																	48238691		2203	4300	6503	46524958	SO:0001819	synonymous_variant	7421	exon10			J03258	CCDS8757.1, CCDS55820.1	12q12-q14	2014-06-13				ENSG00000111424		"""Nuclear hormone receptors"""	12679	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 163"""	601769				1662663	Standard	NM_001017536		Approved	NR1I1, PPP1R163	uc001rql.3	P11473		ENST00000395324.2:c.1122G>A	12.37:g.48238691C>T		Somatic		Capture	Illumina HiSeq	Phase_I	46524958	NM_000376	B2R5Q1|G3V1V9|Q5PSV3	Silent	SNP	ENST00000395324.2	37	CCDS8757.1																																																																																				VDR-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406433.1		
NEUROD4	58158	broad.mit.edu	37	12	55420485	55420485	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr12:55420485C>T	ENST00000242994.3	+	2	640	c.262C>T	c.(262-264)Cga>Tga	p.R88*		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	88	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R88*(2)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						ATTCAGGGCTCGAAGAGTCAA	0.507																																					p.R88X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.C262T	12						.						67.0	67.0	67.0					12																	55420485		2203	4300	6503	53706752	SO:0001587	stop_gained	58158	exon2			AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.262C>T	12.37:g.55420485C>T	ENSP00000242994:p.Arg88*	Somatic		Capture	Illumina HiSeq	Phase_I	53706752	NM_021191	B2RAC9	Nonsense_Mutation	SNP	ENST00000242994.3	37	CCDS8886.1	.	.	.	.	.	.	.	.	.	.	C	38	7.232720	0.98154	.	.	ENSG00000123307	ENST00000242994	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.4191	11.7335	0.51752	0.1762:0.8238:0.0:0.0	.	.	.	.	X	88	.	ENSP00000242994:R88X	R	+	1	2	NEUROD4	53706752	0.853000	0.29707	1.000000	0.80357	0.996000	0.88848	2.612000	0.46343	2.603000	0.88011	0.655000	0.94253	CGA		NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406104.1		
RNF41	10193	broad.mit.edu	37	12	56604226	56604226	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr12:56604226G>A	ENST00000345093.4	-	4	586	c.217C>T	c.(217-219)Cgg>Tgg	p.R73W	RNF41_ENST00000552244.1_Missense_Mutation_p.R73W|RNF41_ENST00000552656.1_Missense_Mutation_p.R73W|RNF41_ENST00000394013.2_Missense_Mutation_p.R2W	NM_005785.3|NM_194359.2	NP_005776.1|NP_919340.1	Q9H4P4	RNF41_HUMAN	ring finger protein 41, E3 ubiquitin protein ligase	73					extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|proteasomal protein catabolic process (GO:0010498)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|regulation of establishment of cell polarity (GO:2000114)|regulation of lymphocyte differentiation (GO:0045619)|regulation of MAPK cascade (GO:0043408)|regulation of myeloid cell differentiation (GO:0045637)|regulation of protein kinase B signaling (GO:0051896)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytosol (GO:0005829)	acid-amino acid ligase activity (GO:0016881)|protein tag (GO:0031386)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R73W(1)		breast(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	11						AACATGTTCCGCATGATCCGA	0.562																																					p.R73W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C217T	12						.						135.0	109.0	118.0					12																	56604226		2203	4300	6503	54890493	SO:0001583	missense	10193	exon4			AF077599	CCDS8909.1, CCDS8910.1	12q13.13	2014-03-24	2014-03-24		ENSG00000181852	ENSG00000181852		"""RING-type (C3HC4) zinc fingers"""	18401	protein-coding gene	gene with protein product			"""ring finger protein 41"""				Standard	NM_005785		Approved	SBBI03, NRDP1	uc001skg.2	Q9H4P4	OTTHUMG00000170328	ENST00000345093.4:c.217C>T	12.37:g.56604226G>A	ENSP00000342755:p.Arg73Trp	Somatic		Capture	Illumina HiSeq	Phase_I	54890493	NM_005785	A6NFW0|B2RBT8|O75598	Missense_Mutation	SNP	ENST00000345093.4	37	CCDS8909.1	.	.	.	.	.	.	.	.	.	.	G	34	5.337976	0.95758	.	.	ENSG00000181852	ENST00000345093;ENST00000394013;ENST00000448057;ENST00000552656;ENST00000551711;ENST00000552244;ENST00000549038	T;T;T;T	0.11063	2.81;2.81;2.85;2.83	5.22	5.22	0.72569	Zinc finger, RING/FYVE/PHD-type (1);	0.082235	0.64402	D	0.000001	T	0.39627	0.1085	M	0.86178	2.8	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.83275	0.947;0.996;0.964	T	0.29119	-1.0022	10	0.87932	D	0	.	18.0941	0.89483	0.0:0.0:1.0:0.0	.	60;73;73	B4E353;F8VSB6;Q9H4P4	.;.;RNF41_HUMAN	W	73;2;60;73;2;73;73	ENSP00000342755:R73W;ENSP00000447303:R73W;ENSP00000448187:R73W;ENSP00000446595:R73W	ENSP00000342755:R73W	R	-	1	2	RNF41	54890493	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.544000	0.98092	2.885000	0.99019	0.655000	0.94253	CGG		RNF41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408525.1	NM_005785	
NAV3	89795	broad.mit.edu	37	12	78401199	78401199	+	Silent	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr12:78401199C>T	ENST00000397909.2	+	8	2054	c.1881C>T	c.(1879-1881)acC>acT	p.T627T	NAV3_ENST00000266692.7_Silent_p.T627T|NAV3_ENST00000228327.6_Silent_p.T627T|NAV3_ENST00000536525.2_Silent_p.T627T			Q8IVL0	NAV3_HUMAN	neuron navigator 3	627						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.T627T(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						ACCCGAATACCGCGACAGTGG	0.488										HNSCC(70;0.22)																											p.T627T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1881T	12						.						117.0	115.0	116.0					12																	78401199		2056	4198	6254	76925330	SO:0001819	synonymous_variant	89795	exon8			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.1881C>T	12.37:g.78401199C>T		Somatic		Capture	Illumina HiSeq	Phase_I	76925330	NM_014903	Q8NFW7|Q9Y2E7	Silent	SNP	ENST00000397909.2	37																																																																																					NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
NAV3	89795	broad.mit.edu	37	12	78516052	78516052	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr12:78516052C>T	ENST00000397909.2	+	16	4255	c.4082C>T	c.(4081-4083)cCg>cTg	p.P1361L	NAV3_ENST00000266692.7_Intron|NAV3_ENST00000228327.6_Missense_Mutation_p.P1361L|NAV3_ENST00000536525.2_Missense_Mutation_p.P1361L			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1361	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.P1361L(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						AAGGATACTCCGAGCTACCAG	0.572										HNSCC(70;0.22)																											p.P1361L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4082T	12						.						110.0	105.0	107.0					12																	78516052		2017	4184	6201	77040183	SO:0001583	missense	89795	exon16			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.4082C>T	12.37:g.78516052C>T	ENSP00000381007:p.Pro1361Leu	Somatic		Capture	Illumina HiSeq	Phase_I	77040183	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.	.	.	.	.	.	.	.	.	.	C	5.608	0.296949	0.10622	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000550788	T;T;T;T	0.22945	1.94;1.93;1.94;2.76	5.96	5.96	0.96718	.	0.000000	0.39985	U	0.001214	T	0.11452	0.0279	N	0.02315	-0.6	0.80722	D	1	B;B;B	0.22080	0.009;0.048;0.064	B;B;B	0.12837	0.004;0.005;0.008	T	0.20207	-1.0282	10	0.02654	T	1	-15.2498	20.4082	0.99013	0.0:1.0:0.0:0.0	.	1361;1361;1361	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	L	1361;1361;1361;4	ENSP00000446132:P1361L;ENSP00000381007:P1361L;ENSP00000228327:P1361L;ENSP00000448303:P4L	ENSP00000228327:P1361L	P	+	2	0	NAV3	77040183	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	5.522000	0.67092	2.814000	0.96858	0.655000	0.94253	CCG		NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
C12orf50	160419	broad.mit.edu	37	12	88380174	88380174	+	Silent	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr12:88380174C>T	ENST00000298699.2	-	10	1017	c.837G>A	c.(835-837)gtG>gtA	p.V279V	C12orf50_ENST00000550553.1_Silent_p.V240V	NM_152589.1	NP_689802.1	Q8NA57	CL050_HUMAN	chromosome 12 open reading frame 50	279								p.V279V(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|urinary_tract(2)	34						GAGGCTTCTTCACTGGCTGGA	0.333																																					p.V279V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G837A	12						.						100.0	101.0	101.0					12																	88380174		2202	4300	6502	86904305	SO:0001819	synonymous_variant	160419	exon10			AK093140	CCDS9031.1	12q21.32	2006-02-03				ENSG00000165805			26665	protein-coding gene	gene with protein product						12477932	Standard	NM_152589		Approved	FLJ35821	uc001tam.1	Q8NA57	OTTHUMG00000169869	ENST00000298699.2:c.837G>A	12.37:g.88380174C>T		Somatic		Capture	Illumina HiSeq	Phase_I	86904305	NM_152589	Q6P674	Silent	SNP	ENST00000298699.2	37	CCDS9031.1																																																																																				C12orf50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406328.1	NM_152589	
TMEM132B	114795	broad.mit.edu	37	12	126135250	126135250	+	Missense_Mutation	SNP	C	C	A	rs372079668		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr12:126135250C>A	ENST00000299308.3	+	7	1658	c.1650C>A	c.(1648-1650)gaC>gaA	p.D550E	TMEM132B_ENST00000535886.1_Missense_Mutation_p.D62E	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	550						integral component of membrane (GO:0016021)		p.D550E(1)		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AAAGCGATGACGAGGACGATG	0.527																																					p.D550E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1650A	12						.						73.0	81.0	79.0					12																	126135250		2173	4291	6464	124701203	SO:0001583	missense	114795	exon7			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1650C>A	12.37:g.126135250C>A	ENSP00000299308:p.Asp550Glu	Somatic		Capture	Illumina HiSeq	Phase_I	124701203	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	T	5.125	0.208593	0.09757	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.15139	2.45;2.45	5.15	-1.62	0.08372	.	0.000000	0.64402	D	0.000003	T	0.08447	0.0210	L	0.28115	0.83	0.51012	D	0.999908	B	0.32781	0.384	B	0.30029	0.11	T	0.37641	-0.9697	10	0.12766	T	0.61	.	9.0047	0.36104	0.0975:0.333:0.0:0.5695	.	550	Q14DG7	T132B_HUMAN	E	550;62	ENSP00000299308:D550E;ENSP00000440436:D62E	ENSP00000299308:D550E	D	+	3	2	TMEM132B	124701203	0.005000	0.15991	0.329000	0.25429	0.010000	0.07245	-1.273000	0.02823	-0.688000	0.05155	-1.581000	0.00855	GAC		TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
SACS	26278	broad.mit.edu	37	13	23908265	23908265	+	Silent	SNP	A	A	G			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr13:23908265A>G	ENST00000382292.3	-	9	10023	c.9750T>C	c.(9748-9750)ttT>ttC	p.F3250F	SACS_ENST00000402364.1_Silent_p.F2500F|SACS_ENST00000382298.3_Silent_p.F3250F			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3250					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.F3103F(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		ATTCACTAATAAAATGCCATG	0.373																																					p.F3250F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T9750C	13						.						105.0	103.0	104.0					13																	23908265		2202	4299	6501	22806265	SO:0001819	synonymous_variant	26278	exon10			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.9750T>C	13.37:g.23908265A>G		Somatic		Capture	Illumina HiSeq	Phase_I	22806265	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	ENST00000382292.3	37	CCDS9300.2																																																																																				SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
MTUS2	23281	broad.mit.edu	37	13	29600347	29600347	+	Silent	SNP	A	A	T	rs201003310		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr13:29600347A>T	ENST00000431530.3	+	1	1600	c.1542A>T	c.(1540-1542)acA>acT	p.T514T		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	504						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.T514T(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						AGGTCACCACATCTGTTGCTG	0.502																																					p.T514T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1542T	13						.						87.0	91.0	90.0					13																	29600347		1970	4155	6125	28498347	SO:0001819	synonymous_variant	23281	exon1			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.1542A>T	13.37:g.29600347A>T		Somatic		Capture	Illumina HiSeq	Phase_I	28498347	NM_001033602	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	ENST00000431530.3	37	CCDS45022.1																																																																																				MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270	
SUCLA2	8803	broad.mit.edu	37	13	48562731	48562731	+	Missense_Mutation	SNP	C	C	T	rs370898100		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr13:48562731C>T	ENST00000378654.3	-	4	535	c.479G>A	c.(478-480)cGa>cAa	p.R160Q	SUCLA2_ENST00000534875.1_Missense_Mutation_p.R102Q|SUCLA2_ENST00000543413.1_Missense_Mutation_p.R102Q|SUCLA2_ENST00000497202.1_5'UTR|SUCLA2_ENST00000544100.1_Missense_Mutation_p.R26Q	NM_003850.2	NP_003841.1	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit	160	ATP-grasp.				cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|succinyl-CoA pathway (GO:0006781)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)	p.R160Q(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(3)|skin(4)	15		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	GGGATATTTTCGCTCACAGAC	0.358																																					p.R160Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G479A	13						.						157.0	143.0	148.0					13																	48562731		2201	4298	6499	47460732	SO:0001583	missense	8803	exon4			AF058953	CCDS9406.1	13q12.2-q13.3	2010-04-16			ENSG00000136143	ENSG00000136143	6.2.1.5		11448	protein-coding gene	gene with protein product		603921				9765291	Standard	NM_003850		Approved		uc001vbs.3	Q9P2R7	OTTHUMG00000016889	ENST00000378654.3:c.479G>A	13.37:g.48562731C>T	ENSP00000367923:p.Arg160Gln	Somatic		Capture	Illumina HiSeq	Phase_I	47460732	NM_003850	B2RDE7|O95194|Q5T9Q4|Q5T9Q6|Q9NV21|Q9NVP7	Missense_Mutation	SNP	ENST00000378654.3	37	CCDS9406.1	.	.	.	.	.	.	.	.	.	.	c	34	5.378964	0.95945	.	.	ENSG00000136143	ENST00000378654;ENST00000378645;ENST00000378642;ENST00000544100;ENST00000534875;ENST00000543413;ENST00000434484	T;T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46;-0.46	5.4	5.4	0.78164	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);ATP-grasp fold, succinyl-CoA synthetase-type (1);	0.000000	0.85682	D	0.000000	T	0.79718	0.4494	L	0.61036	1.89	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.67900	0.954;0.954	T	0.80690	-0.1270	10	0.59425	D	0.04	-11.0398	18.1696	0.89740	0.0:1.0:0.0:0.0	.	160;160	E5KS55;Q9P2R7	.;SUCB1_HUMAN	Q	160;138;90;26;102;102;90	ENSP00000367923:R160Q;ENSP00000443412:R26Q;ENSP00000438182:R102Q;ENSP00000441056:R102Q;ENSP00000392771:R90Q	ENSP00000367909:R90Q	R	-	2	0	SUCLA2	47460732	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.391000	0.79828	2.538000	0.85594	0.563000	0.77884	CGA		SUCLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044852.1		
TRIM13	10206	broad.mit.edu	37	13	50586536	50586536	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr13:50586536C>T	ENST00000378182.3	+	2	1198	c.460C>T	c.(460-462)Cgg>Tgg	p.R154W	TRIM13_ENST00000356017.4_Missense_Mutation_p.R157W|TRIM13_ENST00000457662.2_Missense_Mutation_p.R154W|TRIM13_ENST00000298772.5_Missense_Mutation_p.R157W|TRIM13_ENST00000420995.2_Missense_Mutation_p.R154W|KCNRG_ENST00000312942.1_5'Flank|KCNRG_ENST00000360473.4_5'Flank|TRIM13_ENST00000478111.1_Intron	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13	154					anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R154W(1)		large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		GACCTGGCGTCGGGGAGATGC	0.448																																					p.R154W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C460T	13						.						62.0	62.0	62.0					13																	50586536		2203	4300	6503	49484537	SO:0001583	missense	10206	exon3			AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.460C>T	13.37:g.50586536C>T	ENSP00000367424:p.Arg154Trp	Somatic		Capture	Illumina HiSeq	Phase_I	49484537	NM_005798	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	Missense_Mutation	SNP	ENST00000378182.3	37	CCDS9423.1	.	.	.	.	.	.	.	.	.	.	C	4.725	0.134812	0.09032	.	.	ENSG00000204977	ENST00000378183;ENST00000420995;ENST00000378182;ENST00000356017;ENST00000457662;ENST00000298772	T;T;T;T;T;T	0.28666	2.1;1.6;1.6;2.14;1.6;2.14	5.46	4.53	0.55603	.	0.160062	0.52532	D	0.000070	T	0.27663	0.0680	N	0.19112	0.55	0.32449	N	0.54568	D;D	0.71674	0.997;0.998	P;P	0.56700	0.642;0.804	T	0.19745	-1.0296	9	.	.	.	-5.7187	5.9545	0.19265	0.3205:0.5634:0.0:0.1161	.	154;157	O60858;O60858-3	TRI13_HUMAN;.	W	154;154;154;157;154;157	ENSP00000367425:R154W;ENSP00000412943:R154W;ENSP00000367424:R154W;ENSP00000348299:R157W;ENSP00000399206:R154W;ENSP00000298772:R157W	.	R	+	1	2	TRIM13	49484537	0.885000	0.30320	1.000000	0.80357	0.998000	0.95712	1.271000	0.33098	2.554000	0.86153	0.655000	0.94253	CGG		TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354875.1	NM_001007278	
OR4K1	79544	broad.mit.edu	37	14	20404578	20404578	+	Silent	SNP	C	C	T	rs142429554	byFrequency	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr14:20404578C>T	ENST00000285600.4	+	1	812	c.753C>T	c.(751-753)ttC>ttT	p.F251F		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	251						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F251F(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		TTCTTTTCTTCGGGCCTTGCA	0.438													C|||	29	0.00579073	0.0189	0.0043	5008	,	,		27554	0.0		0.001	False		,,,				2504	0.0				p.F251F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C753T	14						.	C		56,4350		0,56,2147	130.0	128.0	129.0		753	-3.5	0.9	14	dbSNP_134	129	1,8599		0,1,4299	no	coding-synonymous	OR4K1	NM_001004063.2		0,57,6446	TT,TC,CC		0.0116,1.271,0.4383		251/312	20404578	57,12949	2203	4300	6503	19474418	SO:0001819	synonymous_variant	79544	exon1				CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.753C>T	14.37:g.20404578C>T		Somatic		Capture	Illumina HiSeq	Phase_I	19474418	NM_001004063	B9EKV9|Q8NGD6|Q96R73	Silent	SNP	ENST00000285600.4	37	CCDS32025.1																																																																																				OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409881.1		
FANCM	57697	broad.mit.edu	37	14	45645337	45645337	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr14:45645337C>G	ENST00000267430.5	+	14	3465	c.3380C>G	c.(3379-3381)tCc>tGc	p.S1127C	FANCM_ENST00000542564.2_Missense_Mutation_p.S1101C	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1127					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)	p.S1127C(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						CCAGTATTGTCCACTGATCAA	0.383								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.S1127C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3380G	14						.						80.0	79.0	80.0					14																	45645337		2203	4299	6502	44715087	SO:0001583	missense	57697	exon14	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.3380C>G	14.37:g.45645337C>G	ENSP00000267430:p.Ser1127Cys	Somatic		Capture	Illumina HiSeq	Phase_I	44715087	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	C	7.609	0.674302	0.14841	.	.	ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250	T;T;T	0.18657	2.79;2.79;2.2	5.41	-8.05	0.01106	.	2.537280	0.00775	N	0.001232	T	0.10551	0.0258	N	0.22421	0.69	0.09310	N	1	P;P	0.45078	0.85;0.85	B;B	0.40101	0.319;0.319	T	0.36089	-0.9762	10	0.37606	T	0.19	.	1.5026	0.02480	0.3092:0.3273:0.099:0.2645	.	1101;1127	B2RTQ9;Q8IYD8	.;FANCM_HUMAN	C	1127;1101;643	ENSP00000267430:S1127C;ENSP00000442493:S1101C;ENSP00000452033:S643C	ENSP00000267430:S1127C	S	+	2	0	FANCM	44715087	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.158000	0.03153	-0.870000	0.04047	-0.469000	0.05056	TCC		FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
DYNC1H1	1778	broad.mit.edu	37	14	102516209	102516209	+	Silent	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr14:102516209C>T	ENST00000360184.4	+	76	13838	c.13674C>T	c.(13672-13674)ttC>ttT	p.F4558F	RP11-1017G21.4_ENST00000557242.1_RNA|RP11-1017G21.4_ENST00000553701.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	4558					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.F4558F(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CTTGCAGCTTCGGAGTCACGG	0.582																																					p.F4558F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C13674T	14						.						46.0	43.0	44.0					14																	102516209		2203	4300	6503	101585962	SO:0001819	synonymous_variant	1778	exon76			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.13674C>T	14.37:g.102516209C>T		Somatic		Capture	Illumina HiSeq	Phase_I	101585962	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	37	CCDS9966.1																																																																																				DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
DUOX2	50506	broad.mit.edu	37	15	45394036	45394036	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr15:45394036G>A	ENST00000603300.1	-	21	3008	c.2806C>T	c.(2806-2808)Cgc>Tgc	p.R936C	DUOX2_ENST00000389039.6_Missense_Mutation_p.R936C	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	936					adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)	p.R936C(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		TGCGTGAAGCGGAGCTCGCTG	0.572																																					p.R936C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2806T	15						.						140.0	114.0	123.0					15																	45394036		2198	4298	6496	43181328	SO:0001583	missense	50506	exon21			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.2806C>T	15.37:g.45394036G>A	ENSP00000475084:p.Arg936Cys	Somatic		Capture	Illumina HiSeq	Phase_I	43181328	NM_014080	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	37	CCDS10117.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.517953	0.85495	.	.	ENSG00000140279	ENST00000389039	.	.	.	6.08	5.15	0.70609	EF-hand-like domain (1);	0.329573	0.33938	N	0.004406	T	0.75895	0.3912	M	0.74258	2.255	0.45108	D	0.998123	D;D	0.89917	0.999;1.0	P;D	0.66351	0.856;0.943	T	0.78465	-0.2193	9	0.66056	D	0.02	-7.8844	11.4069	0.49902	0.0:0.1366:0.7214:0.142	.	936;498	Q9NRD8;Q59GU9	DUOX2_HUMAN;.	C	936	.	ENSP00000373691:R936C	R	-	1	0	DUOX2	43181328	1.000000	0.71417	0.980000	0.43619	0.940000	0.58332	5.087000	0.64480	1.562000	0.49601	0.655000	0.94253	CGC		DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
FAM214A	56204	broad.mit.edu	37	15	52901193	52901193	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr15:52901193G>T	ENST00000261844.7	-	6	2070	c.1918C>A	c.(1918-1920)Cag>Aag	p.Q640K	FAM214A_ENST00000546305.2_Missense_Mutation_p.Q647K	NM_019600.2	NP_062546.2	Q32MH5	F214A_HUMAN	family with sequence similarity 214, member A	640								p.Q640K(1)									TTTGAATACTGTTTATCAATT	0.294																																					p.Q640K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1918A	15						.						117.0	116.0	116.0					15																	52901193		1814	4070	5884	50688485	SO:0001583	missense	56204	exon6			AB037791	CCDS45263.1, CCDS66773.1	15q21.2-q21.3	2011-12-01	2011-12-01	2011-12-01	ENSG00000047346	ENSG00000047346			25609	protein-coding gene	gene with protein product			"""KIAA1370"""	KIAA1370		10718198	Standard	XM_005254547		Approved	FLJ10980	uc002acg.4	Q32MH5		ENST00000261844.7:c.1918C>A	15.37:g.52901193G>T	ENSP00000261844:p.Gln640Lys	Somatic		Capture	Illumina HiSeq	Phase_I	50688485	NM_019600	A8KA52|B4DEP5|B4DF40|F5H8G0|Q32MH6|Q4G0R7|Q5XJ16|Q6PDA3|Q9NV24|Q9P2H7	Missense_Mutation	SNP	ENST00000261844.7	37	CCDS45263.1	.	.	.	.	.	.	.	.	.	.	G	7.983	0.751626	0.15778	.	.	ENSG00000047346	ENST00000261844;ENST00000399202;ENST00000534964;ENST00000546305	T;T	0.32023	1.47;1.47	6.17	4.28	0.50868	.	0.173259	0.41500	D	0.000863	T	0.29389	0.0732	L	0.54323	1.7	0.36131	D	0.846136	P;B	0.36789	0.57;0.434	B;B	0.32677	0.15;0.072	T	0.38243	-0.9670	10	0.66056	D	0.02	-2.253	13.8113	0.63266	0.0:0.1185:0.7579:0.1236	.	647;640	F5H8G0;Q32MH5	.;K1370_HUMAN	K	640;640;639;647	ENSP00000261844:Q640K;ENSP00000443598:Q647K	ENSP00000261844:Q640K	Q	-	1	0	KIAA1370	50688485	1.000000	0.71417	0.992000	0.48379	0.040000	0.13550	2.506000	0.45433	0.917000	0.36895	0.655000	0.94253	CAG		FAM214A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419914.1	NM_019600	
ADAMTS7	11173	broad.mit.edu	37	15	79080692	79080692	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr15:79080692G>A	ENST00000388820.4	-	8	1413	c.1203C>T	c.(1201-1203)agC>agT	p.S401S	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	401	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.S401S(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						AGTCATTGCCGCTTCCGTCAT	0.647																																					p.S401S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1203T	15						.						135.0	114.0	121.0					15																	79080692		2196	4293	6489	76867747	SO:0001819	synonymous_variant	11173	exon8			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1203C>T	15.37:g.79080692G>A		Somatic		Capture	Illumina HiSeq	Phase_I	76867747	NM_014272	Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	CCDS32303.1																																																																																				ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
NTRK3	4916	broad.mit.edu	37	15	88679815	88679815	+	Silent	SNP	G	G	A	rs201894375		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr15:88679815G>A	ENST00000360948.2	-	7	809	c.648C>T	c.(646-648)caC>caT	p.H216H	NTRK3_ENST00000357724.2_Silent_p.H216H|NTRK3_ENST00000394480.2_Silent_p.H216H|NTRK3_ENST00000540489.2_Silent_p.H216H|NTRK3_ENST00000558676.1_Silent_p.H216H|NTRK3_ENST00000542733.2_Silent_p.H118H|NTRK3_ENST00000557856.1_Silent_p.H216H|NTRK3_ENST00000355254.2_Silent_p.H216H|NTRK3_ENST00000317501.3_Silent_p.H216H	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	216	Ig-like C2-type 1.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.H216H(3)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			TCAGGTTGACGTGGCTCACGC	0.537			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)			G|||	1	0.000199681	0.0	0.0	5008	,	,		21918	0.0		0.001	False		,,,				2504	0.0				p.H216H			Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C648T	15						.	G	,,	0,4402		0,0,2201	128.0	75.0	93.0		648,648,648	-8.0	0.6	15		93	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	NTRK3	NM_001007156.2,NM_001012338.2,NM_002530.3	,,	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	,,	216/613,216/840,216/826	88679815	1,12999	2201	4299	6500	86480819	SO:0001819	synonymous_variant	4916	exon7			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.648C>T	15.37:g.88679815G>A		Somatic		Capture	Illumina HiSeq	Phase_I	86480819	NM_001007156	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	ENST00000360948.2	37	CCDS32322.1																																																																																				NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
CNOT1	23019	broad.mit.edu	37	16	58608967	58608967	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr16:58608967G>A	ENST00000317147.5	-	15	2103	c.1771C>T	c.(1771-1773)Cgt>Tgt	p.R591C	CNOT1_ENST00000441024.2_Missense_Mutation_p.R591C|CNOT1_ENST00000569240.1_Missense_Mutation_p.R591C	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	591					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)	p.R591C(2)		breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TATTCACGACGTGAAGCAAGT	0.393																																					p.R591C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1771T	16						.						134.0	119.0	124.0					16																	58608967		2198	4300	6498	57166468	SO:0001583	missense	23019	exon15			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.1771C>T	16.37:g.58608967G>A	ENSP00000320949:p.Arg591Cys	Somatic		Capture	Illumina HiSeq	Phase_I	57166468	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	G	33	5.211509	0.95069	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000394200;ENST00000441024	T;T	0.19250	2.16;2.16	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.56485	0.1988	M	0.89785	3.06	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.992;0.997;1.0	T	0.65253	-0.6213	9	.	.	.	.	18.9339	0.92577	0.0:0.0:1.0:0.0	.	591;591;591	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	C	591;20;591;591	ENSP00000320949:R591C;ENSP00000413113:R591C	.	R	-	1	0	CNOT1	57166468	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.837000	0.99465	2.473000	0.83533	0.563000	0.77884	CGT		CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
TP53	7157	broad.mit.edu	37	17	7578265	7578266	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr17:7578265_7578266insT	ENST00000269305.4	-	6	772_773	c.583_584insA	c.(583-585)atcfs	p.I195fs	TP53_ENST00000420246.2_Frame_Shift_Ins_p.I195fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.I195fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.I195fs|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Frame_Shift_Ins_p.I195fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.I195fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.I195F(20)|p.I195N(12)|p.I195S(10)|p.0?(8)|p.I195fs*14(6)|p.?(6)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102S(2)|p.I102T(2)|p.I63T(2)|p.I63S(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.I195L(1)|p.I195fs*50(1)|p.I102F(1)|p.I63F(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*52(1)|p.I63fs*14(1)|p.L194fs*52(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCACTCGGATAAGATGCTGA	0.554		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.I63fs	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,0 	.	161	Substitution - Missense(122)|Insertion - Frameshift(8)|Whole gene deletion(8)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(6)|Deletion - Frameshift(4)|Complex - frameshift(1)	ovary(39)|breast(24)|large_intestine(18)|lung(15)|upper_aerodigestive_tract(10)|central_nervous_system(8)|oesophagus(8)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(6)|skin(5)|stomach(4)|liver(4)|urinary_tract(4)|bone(4)|endometrium(3)|pancreas(2)|soft_tissue(1)	c.188_189insA	17						.																																			7518991	SO:0001589	frameshift_variant	7157	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.584dupA	17.37:g.7578266_7578266dupT	ENSP00000269305:p.Ile195fs	Somatic		Capture	Illumina HiSeq	Phase_I	7518990	NM_001126116	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	37	CCDS11118.1																																																																																				TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TAOK1	57551	broad.mit.edu	37	17	27794176	27794176	+	Missense_Mutation	SNP	G	G	A	rs370461672		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr17:27794176G>A	ENST00000261716.3	+	3	665	c.146G>A	c.(145-147)cGt>cAt	p.R49H	TAOK1_ENST00000536202.1_Missense_Mutation_p.R49H	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	49	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)	p.R49H(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			CGAGATGTGCGTACCAATGAA	0.333													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14639	0.0		0.0	False		,,,				2504	0.0				p.R49H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G146A	17						.						108.0	107.0	107.0					17																	27794176		2203	4300	6503	24818302	SO:0001583	missense	57551	exon3			AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.146G>A	17.37:g.27794176G>A	ENSP00000261716:p.Arg49His	Somatic		Capture	Illumina HiSeq	Phase_I	24818302	NM_020791	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	ENST00000261716.3	37	CCDS32601.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996698	0.54147	.	.	ENSG00000160551	ENST00000261716;ENST00000536202	T;T	0.65732	-0.17;-0.17	5.17	5.17	0.71159	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.43344	0.1243	N	0.10916	0.065	0.80722	D	1	B;P	0.43477	0.162;0.808	B;B	0.38683	0.021;0.279	T	0.39663	-0.9603	10	0.13853	T	0.58	.	19.0359	0.92978	0.0:0.0:1.0:0.0	.	49;49	B7ZLV6;Q7L7X3	.;TAOK1_HUMAN	H	49	ENSP00000261716:R49H;ENSP00000438819:R49H	ENSP00000261716:R49H	R	+	2	0	TAOK1	24818302	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.994000	0.88315	2.561000	0.86390	0.591000	0.81541	CGT		TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447790.1	NM_020791	
LYZL6	57151	broad.mit.edu	37	17	34264774	34264774	+	Missense_Mutation	SNP	C	C	T	rs114022698	byFrequency	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr17:34264774C>T	ENST00000585556.1	-	3	620	c.286G>A	c.(286-288)Gta>Ata	p.V96I	LYZL6_ENST00000293274.4_Missense_Mutation_p.V96I|LYZL6_ENST00000492340.2_5'UTR|LYZL6_ENST00000394523.3_Missense_Mutation_p.V96I			O75951	LYZL6_HUMAN	lysozyme-like 6	96					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)	p.V96I(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(8)|stomach(1)	12				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TGACAGTCTACGTGGCAAAGG	0.512													C|||	3	0.000599042	0.0	0.0	5008	,	,		20650	0.002		0.0	False		,,,				2504	0.001				p.V96I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G286A	17						.	C	ILE/VAL,ILE/VAL	0,4406		0,0,2203	99.0	91.0	94.0		286,286	-1.0	0.0	17	dbSNP_132	94	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	LYZL6	NM_001199951.1,NM_020426.2	29,29	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	benign,benign	96/149,96/149	34264774	3,13003	2203	4300	6503	31288887	SO:0001583	missense	57151	exon2			AF088219, AY742214	CCDS11302.1	17q11.2	2014-04-10			ENSG00000161572	ENSG00000275722			29614	protein-coding gene	gene with protein product		612751				10213461	Standard	NM_020426		Approved	LYC1, PRO1485, TKAL754	uc002hkj.2	O75951	OTTHUMG00000188400	ENST00000585556.1:c.286G>A	17.37:g.34264774C>T	ENSP00000468094:p.Val96Ile	Somatic		Capture	Illumina HiSeq	Phase_I	31288887	NM_020426	Q6UW30	Missense_Mutation	SNP	ENST00000585556.1	37	CCDS11302.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	0.005	-2.136238	0.00335	0.0	3.49E-4	ENSG00000161572	ENST00000293274;ENST00000394523	T;T	0.65364	-0.15;-0.15	4.96	-0.996	0.10218	Lysozyme-like domain (1);Glycoside hydrolase, family 22, conserved site (1);	0.514876	0.17489	N	0.172424	T	0.31575	0.0801	N	0.13299	0.325	0.09310	N	1	B	0.29612	0.251	B	0.28784	0.094	T	0.33929	-0.9849	10	0.02654	T	1	-1.4209	5.2494	0.15514	0.0:0.4826:0.1448:0.3726	.	96	O75951	LYZL6_HUMAN	I	96	ENSP00000293274:V96I;ENSP00000378031:V96I	ENSP00000293274:V96I	V	-	1	0	LYZL6	31288887	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.044000	0.03532	-0.048000	0.13401	-0.140000	0.14226	GTA		LYZL6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256578.2	NM_020426	
CNP	1267	broad.mit.edu	37	17	40125570	40125570	+	Silent	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr17:40125570C>T	ENST00000393892.3	+	4	1038	c.894C>T	c.(892-894)gcC>gcT	p.A298A	CNP_ENST00000393888.1_Silent_p.A278A|CNP_ENST00000472031.1_3'UTR|CNP_ENST00000591072.1_Silent_p.A63A	NM_033133.4	NP_149124.3	P09543	CN37_HUMAN	2',3'-cyclic nucleotide 3' phosphodiesterase	298					adult locomotory behavior (GO:0008344)|aging (GO:0007568)|axonogenesis (GO:0007409)|cyclic nucleotide catabolic process (GO:0009214)|microtubule cytoskeleton organization (GO:0000226)|oligodendrocyte differentiation (GO:0048709)|regulation of mitochondrial membrane permeability (GO:0046902)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule (GO:0005874)|microvillus (GO:0005902)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|myelin sheath abaxonal region (GO:0035748)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	2',3'-cyclic-nucleotide 3'-phosphodiesterase activity (GO:0004113)|cyclic nucleotide binding (GO:0030551)|RNA binding (GO:0003723)	p.A278A(1)		breast(1)|kidney(2)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	9		all_cancers(22;2.38e-06)|all_epithelial(22;6.79e-05)|Breast(137;0.000143)		UCEC - Uterine corpus endometrioid carcinoma (308;0.171)		CGACTGGGGCCCGGGTGGAGT	0.587																																					p.A298A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C894T	17						.						101.0	113.0	109.0					17																	40125570		2010	4183	6193	37379096	SO:0001819	synonymous_variant	1267	exon4				CCDS11414.2	17q21	2008-02-05			ENSG00000173786	ENSG00000173786	3.1.4.37		2158	protein-coding gene	gene with protein product		123830				1322358	Standard	XM_006721701		Approved		uc002hyl.1	P09543	OTTHUMG00000133502	ENST00000393892.3:c.894C>T	17.37:g.40125570C>T		Somatic		Capture	Illumina HiSeq	Phase_I	37379096	NM_033133		Silent	SNP	ENST00000393892.3	37	CCDS11414.2																																																																																				CNP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257443.2		
KIF1C	10749	broad.mit.edu	37	17	4927021	4927021	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr17:4927021C>T	ENST00000320785.5	+	23	3244	c.2887C>T	c.(2887-2889)Cgc>Tgc	p.R963C		NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	963					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)	p.R963C(1)		NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						CGGGGGGCTGCGCAGGCCCCC	0.697																																					p.R963C	Melanoma(96;1023 1447 10250 19259 33730)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2887T	17						.						11.0	14.0	13.0					17																	4927021		2114	4142	6256	4867745	SO:0001583	missense	10749	exon23			U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.2887C>T	17.37:g.4927021C>T	ENSP00000320821:p.Arg963Cys	Somatic		Capture	Illumina HiSeq	Phase_I	4867745	NM_006612	D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	ENST00000320785.5	37	CCDS11065.1	.	.	.	.	.	.	.	.	.	.	C	16.44	3.123791	0.56613	.	.	ENSG00000129250	ENST00000320785	T	0.74106	-0.81	4.93	4.93	0.64822	.	.	.	.	.	T	0.71517	0.3349	L	0.29908	0.895	0.46437	D	0.999045	D	0.76494	0.999	P	0.50082	0.63	T	0.75918	-0.3148	9	0.72032	D	0.01	.	15.6642	0.77213	0.0:1.0:0.0:0.0	.	963	O43896	KIF1C_HUMAN	C	963	ENSP00000320821:R963C	ENSP00000320821:R963C	R	+	1	0	KIF1C	4867745	0.947000	0.32204	1.000000	0.80357	0.969000	0.65631	1.993000	0.40747	2.558000	0.86282	0.655000	0.94253	CGC		KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216916.1		
BECN1	8678	broad.mit.edu	37	17	40975858	40975858	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr17:40975858T>C	ENST00000361523.4	-	2	170	c.38A>G	c.(37-39)cAg>cGg	p.Q13R	BECN1_ENST00000438274.3_Missense_Mutation_p.Q13R|BECN1_ENST00000590099.1_Missense_Mutation_p.Q13R|PSME3_ENST00000545225.1_5'Flank	NM_003766.3	NP_003757.1	Q14457	BECN1_HUMAN	beclin 1, autophagy related	13					autophagic vacuole assembly (GO:0000045)|beta-amyloid metabolic process (GO:0050435)|cellular defense response (GO:0006968)|cellular response to aluminum ion (GO:0071275)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokinesis (GO:0000910)|defense response to virus (GO:0051607)|lysosome organization (GO:0007040)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|neuron development (GO:0048666)|positive regulation of macroautophagy (GO:0016239)|regulation of catalytic activity (GO:0050790)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to vitamin E (GO:0033197)|viral process (GO:0016032)	dendrite (GO:0030425)|membrane (GO:0016020)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)		p.Q13R(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		GAAGCTCACCTGCATGGTGCT	0.592																																					p.Q13R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A38G	17						.						130.0	99.0	110.0					17																	40975858		2203	4300	6503	38229384	SO:0001583	missense	8678	exon2			AF077301	CCDS11441.1	17q21	2014-02-12	2008-01-14		ENSG00000126581	ENSG00000126581			1034	protein-coding gene	gene with protein product	"""ATG6 autophagy related 6 homolog (S. cerevisiae)"""	604378	"""beclin 1 (coiled-coil, moesin-like BCL2 interacting protein)"""			9765397	Standard	NM_003766		Approved	ATG6, VPS30	uc002ibn.2	Q14457		ENST00000361523.4:c.38A>G	17.37:g.40975858T>C	ENSP00000355231:p.Gln13Arg	Somatic		Capture	Illumina HiSeq	Phase_I	38229384	NM_003766	B2R6N7|O75595|Q9UNA8	Missense_Mutation	SNP	ENST00000361523.4	37	CCDS11441.1	.	.	.	.	.	.	.	.	.	.	T	11.87	1.768941	0.31320	.	.	ENSG00000126581	ENST00000361523;ENST00000438274	T	0.29917	1.55	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.40743	0.1129	L	0.34521	1.04	0.53688	D	0.999972	D;B	0.54601	0.967;0.008	P;B	0.62382	0.901;0.003	T	0.08086	-1.0739	10	0.23891	T	0.37	.	15.3997	0.74830	0.0:0.0:0.0:1.0	.	13;13	E7EV84;Q14457	.;BECN1_HUMAN	R	13	ENSP00000355231:Q13R	ENSP00000355231:Q13R	Q	-	2	0	BECN1	38229384	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.245000	0.78237	2.222000	0.72286	0.528000	0.53228	CAG		BECN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452405.1	NM_003766	
BPTF	2186	broad.mit.edu	37	17	65955870	65955870	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr17:65955870G>A	ENST00000321892.4	+	26	8579	c.8518G>A	c.(8518-8520)Gaa>Aaa	p.E2840K	BPTF_ENST00000306378.6_Missense_Mutation_p.E2714K|BPTF_ENST00000335221.5_Missense_Mutation_p.E2697K|BPTF_ENST00000424123.3_Missense_Mutation_p.E2558K			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2840					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E2714K(1)|p.E2697K(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			GAGGAAGCGGGAAGAGGAAAA	0.498																																					p.E2714K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G8140A	17						.						60.0	55.0	57.0					17																	65955870		2203	4300	6503	63386332	SO:0001583	missense	2186	exon24			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.8518G>A	17.37:g.65955870G>A	ENSP00000315454:p.Glu2840Lys	Somatic		Capture	Illumina HiSeq	Phase_I	63386332	NM_182641	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	37		.	.	.	.	.	.	.	.	.	.	G	24.3	4.520907	0.85495	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892;ENST00000424123	T;T;T	0.62498	0.03;0.08;0.02	5.22	5.22	0.72569	.	.	.	.	.	T	0.63651	0.2529	L	0.48642	1.525	0.80722	D	1	P;P;P	0.49559	0.682;0.925;0.925	B;P;P	0.47162	0.156;0.54;0.54	T	0.62656	-0.6808	9	0.34782	T	0.22	-13.1799	18.8003	0.92013	0.0:0.0:1.0:0.0	.	518;2714;2697	B4DJV8;Q12830-2;Q12830-4	.;.;.	K	2714;2697;2840;368	ENSP00000307208:E2714K;ENSP00000334351:E2697K;ENSP00000315454:E2840K	ENSP00000307208:E2714K	E	+	1	0	BPTF	63386332	1.000000	0.71417	0.947000	0.38551	0.968000	0.65278	9.561000	0.98142	2.433000	0.82419	0.491000	0.48974	GAA		BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
TGIF1	7050	broad.mit.edu	37	18	3456512	3456512	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr18:3456512C>A	ENST00000330513.5	+	2	867	c.564C>A	c.(562-564)taC>taA	p.Y188*	TGIF1_ENST00000343820.5_Nonsense_Mutation_p.Y59*|TGIF1_ENST00000407501.2_Nonsense_Mutation_p.Y59*|TGIF1_ENST00000577543.1_Nonsense_Mutation_p.Y59*|TGIF1_ENST00000548489.2_Nonsense_Mutation_p.Y73*|TGIF1_ENST00000551402.1_Nonsense_Mutation_p.Y59*|TGIF1_ENST00000345133.5_Nonsense_Mutation_p.Y39*|TGIF1_ENST00000405385.3_Nonsense_Mutation_p.Y39*|TGIF1_ENST00000400167.2_Nonsense_Mutation_p.Y39*|TGIF1_ENST00000401449.1_Nonsense_Mutation_p.Y39*|TGIF1_ENST00000472042.1_Nonsense_Mutation_p.Y39*|TGIF1_ENST00000551541.1_Nonsense_Mutation_p.Y39*	NM_170695.2	NP_733796.2	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	188					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.Y188*(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				AGCACCGTTACAATGCCTATC	0.498																																					p.Y59X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C177A	18	GRCh37	CM030282	TGIF1	M		.						170.0	147.0	155.0					18																	3456512		2203	4300	6503	3446512	SO:0001587	stop_gained	7050	exon2			X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000330513.5:c.564C>A	18.37:g.3456512C>A	ENSP00000327959:p.Tyr188*	Somatic		Capture	Illumina HiSeq	Phase_I	3446512	NM_003244	A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Nonsense_Mutation	SNP	ENST00000330513.5	37	CCDS11834.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.849369	0.91277	.	.	ENSG00000177426	ENST00000552383;ENST00000401449;ENST00000550958;ENST00000548489;ENST00000549780;ENST00000549253;ENST00000405385;ENST00000343820;ENST00000407501;ENST00000546979;ENST00000551402;ENST00000551541;ENST00000345133;ENST00000330513;ENST00000549546;ENST00000549468;ENST00000400167;ENST00000551333;ENST00000472042	.	.	.	5.97	3.25	0.37280	.	0.055528	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.7846	9.1926	0.37209	0.0:0.727:0.0:0.273	.	.	.	.	X	39;39;39;73;39;62;39;59;59;59;59;39;39;188;39;39;39;39;39	.	ENSP00000327959:Y188X	Y	+	3	2	TGIF1	3446512	1.000000	0.71417	0.998000	0.56505	0.900000	0.52787	2.540000	0.45727	0.424000	0.26061	0.655000	0.94253	TAC		TGIF1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254368.4	NM_170695	
BRSK1	84446	broad.mit.edu	37	19	55816179	55816180	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr19:55816179_55816180insC	ENST00000309383.1	+	14	1885_1886	c.1608_1609insC	c.(1609-1611)cccfs	p.P537fs	BRSK1_ENST00000590333.1_Frame_Shift_Ins_p.P553fs|BRSK1_ENST00000588584.1_3'UTR|BRSK1_ENST00000326848.7_Frame_Shift_Ins_p.P232fs	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	537	Pro-rich.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.S539fs*39(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		GGACAACACCACCCCCCAGCCC	0.743																																					p.P536fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.1608_1609insC	19						.																																			60507992	SO:0001589	frameshift_variant	84446	exon14			AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.1614dupC	19.37:g.55816185_55816185dupC	ENSP00000310649:p.Pro537fs	Somatic		Capture	Illumina HiSeq	Phase_I	60507991	NM_032430	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Frame_Shift_Ins	INS	ENST00000309383.1	37	CCDS12921.1																																																																																				BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430	
CNN2	1265	broad.mit.edu	37	19	1036169	1036169	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr19:1036169T>C	ENST00000263097.4	+	5	794	c.431T>C	c.(430-432)gTc>gCc	p.V144A	CNN2_ENST00000565096.2_Missense_Mutation_p.V133A|CNN2_ENST00000348419.3_Intron|CNN2_ENST00000606983.1_Intron|CNN2_ENST00000562958.2_Missense_Mutation_p.V165A|AC011558.5_ENST00000585757.1_RNA	NM_004368.2	NP_004359.1	Q99439	CNN2_HUMAN	calponin 2	144					actomyosin structure organization (GO:0031032)|cellular response to mechanical stimulus (GO:0071260)|cytoskeleton organization (GO:0007010)|hemopoiesis (GO:0030097)|negative regulation of cell migration (GO:0030336)|negative regulation of phagocytosis (GO:0050765)|positive regulation of gene expression (GO:0010628)|regulation of actin filament-based process (GO:0032970)|regulation of cell proliferation (GO:0042127)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|stress fiber (GO:0001725)	actin binding (GO:0003779)			endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACATTGGCGTCAAGTACTCG	0.642																																					p.V144A												.	.	0			c.T431C	19						.						44.0	40.0	41.0					19																	1036169		2203	4300	6503	987169	SO:0001583	missense	1265	exon5			D83735	CCDS12053.1, CCDS12054.1	19p13.3	2011-02-18			ENSG00000064666	ENSG00000064666			2156	protein-coding gene	gene with protein product		602373				8889829	Standard	NM_004368		Approved		uc002lqu.3	Q99439		ENST00000263097.4:c.431T>C	19.37:g.1036169T>C	ENSP00000263097:p.Val144Ala	None		Capture	Illumina HiSeq	Phase_I	987169	NM_004368	A5D8U8|A6NFI4|D6W5X9|Q92578	Missense_Mutation	SNP	ENST00000263097.4	37	CCDS12053.1	.	.	.	.	.	.	.	.	.	.	T	19.17	3.775751	0.70107	.	.	ENSG00000064666	ENST00000263097;ENST00000442531	T	0.63913	-0.07	4.67	4.67	0.58626	Calponin homology domain (2);	0.071555	0.56097	U	0.000039	T	0.65903	0.2736	M	0.80982	2.52	0.43719	D	0.996191	P;B;B	0.39665	0.682;0.16;0.041	B;B;B	0.42555	0.114;0.391;0.066	T	0.65990	-0.6034	10	0.29301	T	0.29	.	12.018	0.53326	0.0:0.0:0.0:1.0	.	165;133;144	B4DUT8;B4DDF4;Q99439	.;.;CNN2_HUMAN	A	144;123	ENSP00000263097:V144A	ENSP00000263097:V144A	V	+	2	0	CNN2	987169	1.000000	0.71417	0.849000	0.33467	0.811000	0.45836	7.418000	0.80167	1.730000	0.51580	0.459000	0.35465	GTC		CNN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420293.3	NM_004368	
CD70	970	broad.mit.edu	37	19	6590982	6590982	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr19:6590982C>T	ENST00000245903.3	-	1	181	c.32G>A	c.(31-33)cGg>cAg	p.R11Q	CD70_ENST00000423145.3_Missense_Mutation_p.R11Q	NM_001252.3	NP_001243.1	P32970	CD70_HUMAN	CD70 molecule	11					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protease binding (GO:0002020)|receptor binding (GO:0005102)	p.R11Q(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|skin(1)	11						GGGCCTGCGCCGCACCGAGCA	0.701																																					p.R11Q	Pancreas(183;2617 2876 10173 34193)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G32A	19						.						42.0	44.0	43.0					19																	6590982		2203	4299	6502	6541982	SO:0001583	missense	970	exon1			L08096	CCDS12170.1	19p13	2013-05-22	2006-10-27	2006-10-27		ENSG00000125726		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11937	protein-coding gene	gene with protein product		602840	"""tumor necrosis factor (ligand) superfamily, member 7"""	CD27LG, TNFSF7		8387892, 8120384	Standard	NM_001252		Approved	CD27L	uc002mfi.3	P32970		ENST00000245903.3:c.32G>A	19.37:g.6590982C>T	ENSP00000245903:p.Arg11Gln	Somatic		Capture	Illumina HiSeq	Phase_I	6541982	NM_001252	B4DPR8|Q53XX4|Q96J57	Missense_Mutation	SNP	ENST00000245903.3	37	CCDS12170.1	.	.	.	.	.	.	.	.	.	.	C	10.10	1.256677	0.22965	.	.	ENSG00000125726	ENST00000423145;ENST00000245903	.	.	.	2.46	-4.91	0.03085	.	2.434170	0.02195	N	0.061714	T	0.20292	0.0488	N	0.19112	0.55	0.09310	N	1	D;D	0.63880	0.993;0.962	B;B	0.44108	0.441;0.194	T	0.27971	-1.0058	9	0.22109	T	0.4	-4.7227	9.0312	0.36260	0.1219:0.6763:0.2017:0.0	.	11;11	B4DPR8;P32970	.;CD70_HUMAN	Q	11	.	ENSP00000245903:R11Q	R	-	2	0	CD70	6541982	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.188000	0.03064	-1.135000	0.02895	-0.479000	0.04858	CGG		CD70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457860.1		
INSR	3643	broad.mit.edu	37	19	7122700	7122700	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr19:7122700C>T	ENST00000302850.5	-	19	3596	c.3454G>A	c.(3454-3456)Gcc>Acc	p.A1152T	INSR_ENST00000341500.5_Missense_Mutation_p.A1140T	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	1152	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.A1152T(2)		breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	AACTTCTTGGCGTTCAGGTAG	0.507																																					p.A1152T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3454A	19						.						86.0	79.0	81.0					19																	7122700		2203	4300	6503	7073700	SO:0001583	missense	3643	exon19			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.3454G>A	19.37:g.7122700C>T	ENSP00000303830:p.Ala1152Thr	Somatic		Capture	Illumina HiSeq	Phase_I	7073700	NM_000208	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	ENST00000302850.5	37	CCDS12176.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756245	0.89843	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	D;D	0.89050	-2.46;-2.46	5.33	5.33	0.75918	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.44483	U	0.000452	T	0.79137	0.4395	N	0.10707	0.03	0.80722	D	1	P;P	0.50443	0.92;0.935	B;B	0.39738	0.282;0.308	D	0.84236	0.0469	10	0.66056	D	0.02	.	16.5108	0.84284	0.0:1.0:0.0:0.0	.	1140;1152	P06213-2;P06213	.;INSR_HUMAN	T	1152;1140	ENSP00000303830:A1152T;ENSP00000342838:A1140T	ENSP00000303830:A1152T	A	-	1	0	INSR	7073700	1.000000	0.71417	0.966000	0.40874	0.622000	0.37654	7.392000	0.79840	2.491000	0.84063	0.491000	0.48974	GCC		INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1		
MUC16	94025	broad.mit.edu	37	19	9058785	9058785	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr19:9058785G>A	ENST00000397910.4	-	3	28864	c.28661C>T	c.(28660-28662)tCt>tTt	p.S9554F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9556	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S5187F(1)|p.S9554F(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTCTCTTATAGAGGAAGAGGT	0.488																																					p.S9554F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C28661T	19						.						93.0	87.0	89.0					19																	9058785		1914	4131	6045	8919785	SO:0001583	missense	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28661C>T	19.37:g.9058785G>A	ENSP00000381008:p.Ser9554Phe	Somatic		Capture	Illumina HiSeq	Phase_I	8919785	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.618	-0.289209	0.05605	.	.	ENSG00000181143	ENST00000397910	T	0.24538	1.85	1.57	-3.13	0.05266	.	.	.	.	.	T	0.09905	0.0243	N	0.14661	0.345	.	.	.	P	0.39809	0.689	B	0.31442	0.13	T	0.14868	-1.0457	8	0.87932	D	0	.	2.8508	0.05556	0.3915:0.2436:0.365:0.0	.	9554	B5ME49	.	F	9554	ENSP00000381008:S9554F	ENSP00000381008:S9554F	S	-	2	0	MUC16	8919785	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-2.186000	0.01251	-0.756000	0.04703	0.305000	0.20034	TCT		MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
KLK12	43849	broad.mit.edu	37	19	51535184	51535184	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr19:51535184G>A	ENST00000525263.1	-	3	524	c.405C>T	c.(403-405)acC>acT	p.T135T	KLK12_ENST00000529888.1_Intron|KLK12_ENST00000250352.11_Intron|CTC-518B2.9_ENST00000594910.1_RNA|KLK12_ENST00000250351.4_Silent_p.T135T|KLK12_ENST00000319590.4_Silent_p.T135T			Q9UKR0	KLK12_HUMAN	kallikrein-related peptidase 12	135	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.T135T(1)		endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	12		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00399)		CGGTGCCAGCGGTTGCACAGT	0.677																																					p.T135T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C405T	19						.						62.0	66.0	65.0					19																	51535184		2203	4299	6502	56226996	SO:0001819	synonymous_variant	43849	exon4				CCDS12820.1, CCDS12821.1, CCDS54298.1	19q13.33	2008-02-05	2006-10-27		ENSG00000186474	ENSG00000186474		"""Kallikreins"""	6360	protein-coding gene	gene with protein product		605539	"""kallikrein 12"""			16800724, 16800723	Standard	NM_019598		Approved	KLK-L5	uc002pvh.1	Q9UKR0	OTTHUMG00000165806	ENST00000525263.1:c.405C>T	19.37:g.51535184G>A		Somatic		Capture	Illumina HiSeq	Phase_I	56226996	NM_145894	Q9UKR1|Q9UKR2	Silent	SNP	ENST00000525263.1	37	CCDS12821.1																																																																																				KLK12-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000386288.1	NM_019598	
C1orf189	388701	broad.mit.edu	37	1	154178782	154178782	+	Start_Codon_SNP	SNP	A	A	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr1:154178782A>T	ENST00000368525.3	-	1	27	c.2T>A	c.(1-3)aTg>aAg	p.M1K	C1orf43_ENST00000483282.1_5'Flank	NM_001010979.1	NP_001010979.1	Q5VU69	CA189_HUMAN	chromosome 1 open reading frame 189	1								p.M1K(1)		kidney(1)|large_intestine(3)|lung(1)|skin(2)	7	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					TTCCACAGACATGTCTATAGA	0.408																																					p.M1K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2A	1						.						205.0	205.0	205.0					1																	154178782		2203	4300	6503	152445406	SO:0001582	initiator_codon_variant	388701	exon1				CCDS30876.1	1q21.3	2012-07-27			ENSG00000163263	ENSG00000163263			32305	protein-coding gene	gene with protein product							Standard	NM_001010979		Approved		uc001fee.2	Q5VU69	OTTHUMG00000035982	ENST00000368525.3:c.2T>A	1.37:g.154178782A>T	ENSP00000357511:p.Met1Lys	Somatic		Capture	Illumina HiSeq	Phase_I	152445406	NM_001010979	A1L4E3	Missense_Mutation	SNP	ENST00000368525.3	37	CCDS30876.1	.	.	.	.	.	.	.	.	.	.	A	15.20	2.764160	0.49574	.	.	ENSG00000163263	ENST00000368525	.	.	.	5.2	4.08	0.47627	.	0.068434	0.85682	D	0.000000	T	0.16854	0.0405	.	.	.	0.22571	N	0.998972	P	0.40476	0.718	B	0.41036	0.346	T	0.05599	-1.0875	8	0.87932	D	0	.	7.8068	0.29206	0.9073:0.0:0.0927:0.0	.	1	Q5VU69	CA189_HUMAN	K	1	.	ENSP00000357511:M1K	M	-	2	0	C1orf189	152445406	1.000000	0.71417	0.953000	0.39169	0.550000	0.35303	1.135000	0.31454	1.002000	0.39104	-0.332000	0.08345	ATG		C1orf189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087672.1	NM_001010979	Missense_Mutation
KCNN3	3782	broad.mit.edu	37	1	154842123	154842123	+	Silent	SNP	G	G	A	rs201079149		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr1:154842123G>A	ENST00000271915.4	-	1	633	c.318C>T	c.(316-318)acC>acT	p.T106T	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	111					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.T106T(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	CCCTGAAAGCGGTGGGAGAGG	0.647																																					p.T106T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C318T	1						.						41.0	32.0	35.0					1																	154842123		2203	4300	6503	153108747	SO:0001819	synonymous_variant	3782	exon1			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.318C>T	1.37:g.154842123G>A		Somatic		Capture	Illumina HiSeq	Phase_I	153108747	NM_002249	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																				KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
GMEB1	10691	broad.mit.edu	37	1	29030747	29030747	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr1:29030747G>A	ENST00000294409.2	+	8	894	c.804G>A	c.(802-804)ctG>ctA	p.L268L	GMEB1_ENST00000373816.1_Silent_p.L258L|GMEB1_ENST00000480454.1_3'UTR|GMEB1_ENST00000361872.4_Silent_p.L258L	NM_006582.3	NP_006573.2	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding protein 1	268					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.L258L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)	11		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		ATGTAGGGCTGATGGAAGAGG	0.468																																					p.L268L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G804A	1						.						141.0	140.0	140.0					1																	29030747		2203	4300	6503	28903334	SO:0001819	synonymous_variant	10691	exon8			AF099013	CCDS327.1, CCDS328.1	1p35	2008-02-05			ENSG00000162419	ENSG00000162419			4370	protein-coding gene	gene with protein product		604409				10386584, 10523663	Standard	NM_006582		Approved	P96PIF, PIF96	uc001bra.3	Q9Y692	OTTHUMG00000003647	ENST00000294409.2:c.804G>A	1.37:g.29030747G>A		Somatic		Capture	Illumina HiSeq	Phase_I	28903334	NM_006582	B1AT48|Q9NWH1|Q9UKD0	Silent	SNP	ENST00000294409.2	37	CCDS327.1																																																																																				GMEB1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000010333.1	NM_006582	
ZSCAN20	7579	broad.mit.edu	37	1	33945040	33945040	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr1:33945040C>T	ENST00000361328.3	+	2	304	c.151C>T	c.(151-153)Cgc>Tgc	p.R51C	ZSCAN20_ENST00000373413.2_Missense_Mutation_p.R51C|ZSCAN20_ENST00000480917.1_3'UTR	NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	51	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R51C(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AGAGGCCTCCCGCCAGCGCTT	0.582																																					p.R51C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C151T	1						.						36.0	40.0	39.0					1																	33945040		1997	4178	6175	33717627	SO:0001583	missense	7579	exon2			X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.151C>T	1.37:g.33945040C>T	ENSP00000355053:p.Arg51Cys	Somatic		Capture	Illumina HiSeq	Phase_I	33717627	NM_145238	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	SNP	ENST00000361328.3	37	CCDS41300.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.691034	0.48097	.	.	ENSG00000121903	ENST00000373411;ENST00000326544;ENST00000373413	T	0.08282	3.11	5.11	5.11	0.69529	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.51477	D	0.000096	T	0.26666	0.0652	M	0.75615	2.305	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	T	0.00220	-1.1906	10	0.54805	T	0.06	-20.2261	11.0263	0.47746	0.1853:0.8147:0.0:0.0	.	51;51;51	P17040-3;P17040-4;P17040	.;.;ZSC20_HUMAN	C	51	ENSP00000362512:R51C	ENSP00000324450:R51C	R	+	1	0	ZSCAN20	33717627	1.000000	0.71417	1.000000	0.80357	0.391000	0.30476	2.410000	0.44592	2.663000	0.90544	0.650000	0.86243	CGC		ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238	
EIF2B3	8891	broad.mit.edu	37	1	45316638	45316638	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr1:45316638C>A	ENST00000360403.2	-	12	1470	c.1344G>T	c.(1342-1344)caG>caT	p.Q448H		NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa	448					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)	p.Q448H(1)		endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					TCTCCATGAGCTGGTCATTCC	0.448																																					p.Q448H	Colon(26;357 658 2581 11857 12657)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1344T	1						.						112.0	109.0	110.0					1																	45316638		2203	4300	6503	45089225	SO:0001583	missense	8891	exon12			AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585	ENST00000360403.2:c.1344G>T	1.37:g.45316638C>A	ENSP00000353575:p.Gln448His	Somatic		Capture	Illumina HiSeq	Phase_I	45089225	NM_020365	B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Missense_Mutation	SNP	ENST00000360403.2	37	CCDS517.1	.	.	.	.	.	.	.	.	.	.	C	15.44	2.833731	0.50951	.	.	ENSG00000070785	ENST00000360403	D	0.92495	-3.05	5.36	4.43	0.53597	.	0.000000	0.85682	D	0.000000	D	0.90208	0.6939	M	0.72118	2.19	0.80722	D	1	B	0.10296	0.003	B	0.10450	0.005	D	0.86754	0.1962	10	0.49607	T	0.09	-10.8538	10.3125	0.43716	0.0:0.9079:0.0:0.0921	.	448	Q9NR50	EI2BG_HUMAN	H	448	ENSP00000353575:Q448H	ENSP00000353575:Q448H	Q	-	3	2	EIF2B3	45089225	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.927000	0.28818	1.224000	0.43551	0.650000	0.86243	CAG		EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023724.1	NM_020365	
ABCD3	5825	broad.mit.edu	37	1	94972162	94972162	+	Silent	SNP	C	C	T	rs139094095		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr1:94972162C>T	ENST00000370214.4	+	21	1833	c.1809C>T	c.(1807-1809)gtC>gtT	p.V603V	ABCD3_ENST00000484213.1_3'UTR|ABCD3_ENST00000536817.1_Silent_p.V530V|ABCD3_ENST00000454898.2_Silent_p.V627V|ABCD3_ENST00000394233.2_Silent_p.V493V	NM_002858.3	NP_002849.1	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D (ALD), member 3	603	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|fatty acid beta-oxidation (GO:0006635)|peroxisome organization (GO:0007031)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)	p.V603V(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(2)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		CAGTTAGTGTCGACGTGGAAG	0.393																																					p.V603V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1809T	1						.	C		1,4405	2.1+/-5.4	0,1,2202	171.0	156.0	161.0		1809	2.2	1.0	1	dbSNP_134	161	0,8600		0,0,4300	no	coding-synonymous	ABCD3	NM_002858.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		603/660	94972162	1,13005	2203	4300	6503	94744750	SO:0001819	synonymous_variant	5825	exon21			M81182	CCDS749.1, CCDS44175.1	1p21.3	2012-05-16			ENSG00000117528	ENSG00000117528		"""ATP binding cassette transporters / subfamily D"""	67	protein-coding gene	gene with protein product		170995		PXMP1		1301993, 8449508	Standard	NM_002858		Approved	PMP70, ZWS2	uc001dqn.4	P28288	OTTHUMG00000010717	ENST00000370214.4:c.1809C>T	1.37:g.94972162C>T		Somatic		Capture	Illumina HiSeq	Phase_I	94744750	NM_002858	D3DT46|Q15271|Q6NUN5|Q96DA3|Q9H529	Silent	SNP	ENST00000370214.4	37	CCDS749.1																																																																																				ABCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029597.1	NM_002858	
NLRP3	114548	broad.mit.edu	37	1	247588382	247588382	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr1:247588382T>C	ENST00000336119.3	+	3	2383	c.1637T>C	c.(1636-1638)gTt>gCt	p.V546A	NLRP3_ENST00000366497.2_Missense_Mutation_p.V546A|NLRP3_ENST00000391828.3_Missense_Mutation_p.V546A|NLRP3_ENST00000366496.2_Missense_Mutation_p.V546A|NLRP3_ENST00000391827.2_Missense_Mutation_p.V546A|NLRP3_ENST00000348069.2_Missense_Mutation_p.V546A|NLRP3_ENST00000474792.1_3'UTR	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	546					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.V546A(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGGACGAACGTTCCAGGGAGT	0.473																																					p.V546A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1637C	1						.						56.0	50.0	52.0					1																	247588382		2203	4300	6503	245655005	SO:0001583	missense	114548	exon3			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1637T>C	1.37:g.247588382T>C	ENSP00000337383:p.Val546Ala	Somatic		Capture	Illumina HiSeq	Phase_I	245655005	NM_004895	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.527238	0.00147	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.89552	-2.53;-2.53;-2.53;-2.53;-2.53;-2.53	3.33	-6.66	0.01789	.	1.876510	0.02388	N	0.079429	T	0.75110	0.3805	N	0.20483	0.58	0.09310	N	1	B;B;B;B;B	0.12013	0.0;0.005;0.001;0.001;0.003	B;B;B;B;B	0.08055	0.002;0.003;0.002;0.001;0.001	T	0.65660	-0.6114	10	0.16896	T	0.51	.	2.1319	0.03752	0.2665:0.4164:0.1349:0.1822	.	546;546;546;546;546	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	A	546	ENSP00000375704:V546A;ENSP00000355453:V546A;ENSP00000337383:V546A;ENSP00000294752:V546A;ENSP00000355452:V546A;ENSP00000375703:V546A	ENSP00000337383:V546A	V	+	2	0	NLRP3	245655005	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.155000	0.03163	-2.026000	0.00934	-0.912000	0.02778	GTT		NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
UBOX5	22888	broad.mit.edu	37	20	3102687	3102687	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr20:3102687T>C	ENST00000217173.2	-	3	1069	c.598A>G	c.(598-600)Acc>Gcc	p.T200A	UBOX5-AS1_ENST00000446537.1_RNA|UBOX5_ENST00000348031.2_Missense_Mutation_p.T200A	NM_001267584.1|NM_014948.3	NP_001254513.1|NP_055763.1			U-box domain containing 5									p.T200A(1)		endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	20						TGGGAGCAGGTCTTGGCCGGC	0.577																																					p.T200A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A598G	20						.						58.0	51.0	53.0					20																	3102687		2203	4300	6503	3050687	SO:0001583	missense	22888	exon3			AB020667	CCDS13046.1, CCDS13047.1	20p13	2013-01-28			ENSG00000185019	ENSG00000185019		"""RING-type (C3HC4) zinc fingers"", ""U-box domain containing"""	17777	protein-coding gene	gene with protein product						11274149	Standard	NM_014948		Approved	UIP5, KIAA0860, Ubce7ip5, RNF37	uc002whw.4	O94941	OTTHUMG00000031731	ENST00000217173.2:c.598A>G	20.37:g.3102687T>C	ENSP00000217173:p.Thr200Ala	Somatic		Capture	Illumina HiSeq	Phase_I	3050687	NM_014948		Missense_Mutation	SNP	ENST00000217173.2	37	CCDS13046.1	.	.	.	.	.	.	.	.	.	.	T	14.50	2.552754	0.45487	.	.	ENSG00000185019	ENST00000217173;ENST00000348031	T;T	0.26067	1.76;1.76	5.42	4.25	0.50352	.	0.274143	0.35739	U	0.003015	T	0.23171	0.0560	L	0.51422	1.61	0.28092	N	0.931743	P;P;P	0.45827	0.867;0.75;0.867	B;B;B	0.40228	0.323;0.236;0.323	T	0.19811	-1.0294	10	0.59425	D	0.04	-19.2101	9.999	0.41918	0.2284:0.0:0.0:0.7716	.	200;200;200	Q53GQ5;Q86X87;O94941	.;.;RNF37_HUMAN	A	200	ENSP00000217173:T200A;ENSP00000311726:T200A	ENSP00000217173:T200A	T	-	1	0	UBOX5	3050687	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.478000	0.53158	2.050000	0.60909	0.460000	0.39030	ACC		UBOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077706.2	NM_014948	
DHX35	60625	broad.mit.edu	37	20	37650575	37650575	+	Silent	SNP	C	C	T	rs141540547	byFrequency	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr20:37650575C>T	ENST00000252011.3	+	16	1623	c.1590C>T	c.(1588-1590)caC>caT	p.H530H	DHX35_ENST00000373325.2_Silent_p.H530H|DHX35_ENST00000373323.4_Silent_p.H499H	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	530					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)	p.H530H(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				AGAAGTCTCACGCAGTAAGTC	0.478													G|||	2	0.000399361	0.0	0.0014	5008	,	,		16677	0.0		0.001	False		,,,				2504	0.0				p.H499H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1497T	20						.	G	,	7,4399		0,7,2196	117.0	110.0	112.0		1497,1590	3.0	1.0	20	dbSNP_134	112	12,8588		0,12,4288	no	coding-synonymous,coding-synonymous	DHX35	NM_001190809.1,NM_021931.3	,	0,19,6484	TT,TC,CC		0.1395,0.1589,0.1461	,	499/673,530/704	37650575	19,12987	2203	4300	6503	37083989	SO:0001819	synonymous_variant	60625	exon15			AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.1590C>T	20.37:g.37650575C>T		Somatic		Capture	Illumina HiSeq	Phase_I	37083989	NM_001190809	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Silent	SNP	ENST00000252011.3	37	CCDS13310.1																																																																																				DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	NM_021931	
NELFCD	51497	broad.mit.edu	37	20	57567046	57567046	+	Silent	SNP	A	A	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr20:57567046A>C	ENST00000344018.3	+	10	1254	c.1227A>C	c.(1225-1227)gcA>gcC	p.A409A	NELFCD_ENST00000602795.1_Silent_p.A418A|NELFCD_ENST00000479207.1_3'UTR			Q8IXH7	NELFD_HUMAN	negative elongation factor complex member C/D	409					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	membrane (GO:0016020)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)		p.A409A(1)									AACTAGTGGCAGAATTGAGCA	0.408																																					p.A409A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1227C	20						.						147.0	138.0	141.0					20																	57567046		2203	4300	6503	57000441	SO:0001819	synonymous_variant	51497	exon10			AF161479	CCDS13473.1, CCDS13473.2	20q13	2013-01-31	2013-01-31	2013-01-31	ENSG00000101158	ENSG00000101158			15934	protein-coding gene	gene with protein product	"""trihydrophobin 1"""	605297	"""TH1-like (Drosophila homolog)"", ""TH1-like (Drosophila)"""	TH1L		11030415, 11042152	Standard	NM_198976		Approved	HSPC130, TH1, NELF-C, NELF-D	uc002yag.4	Q8IXH7	OTTHUMG00000032861	ENST00000344018.3:c.1227A>C	20.37:g.57567046A>C		Somatic		Capture	Illumina HiSeq	Phase_I	57000441	NM_198976	B4DE06|Q9BYL2|Q9H405|Q9H888|Q9H8T3|Q9NVX5|Q9P029|Q9UGN1|Q9UGN2|Q9UGN3	Silent	SNP	ENST00000344018.3	37																																																																																					NELFCD-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_198976	
KRTAP22-1	337979	broad.mit.edu	37	21	31973481	31973481	+	Silent	SNP	C	C	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr21:31973481C>A	ENST00000334680.2	+	1	68	c.42C>A	c.(40-42)gcC>gcA	p.A14A	KRTAP6-2_ENST00000334897.3_5'Flank	NM_181620.1	NP_853651.1	Q3MIV0	KR221_HUMAN	keratin associated protein 22-1	14						intermediate filament (GO:0005882)		p.A14A(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)|urinary_tract(1)	8						AGGGCTATGCCAAAGGAGGCC	0.478																																					p.A14A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C42A	21						.						176.0	161.0	166.0					21																	31973481		2203	4300	6503	30895352	SO:0001819	synonymous_variant	337979	exon1			AP001708	CCDS13601.1	21q22.1	2011-02-10			ENSG00000186924	ENSG00000186924		"""Keratin associated proteins"""	18947	protein-coding gene	gene with protein product						12359730	Standard	NM_181620		Approved	KAP22.1	uc011add.2	Q3MIV0	OTTHUMG00000057778	ENST00000334680.2:c.42C>A	21.37:g.31973481C>A		Somatic		Capture	Illumina HiSeq	Phase_I	30895352	NM_181620		Silent	SNP	ENST00000334680.2	37	CCDS13601.1																																																																																				KRTAP22-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128230.2		
PCNT	5116	broad.mit.edu	37	21	47847577	47847577	+	Silent	SNP	G	G	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr21:47847577G>T	ENST00000359568.5	+	34	7469	c.7362G>T	c.(7360-7362)ctG>ctT	p.L2454L	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2454					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.L2454L(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GGGACCTTCTGCAGGTTGTGC	0.587																																					p.L2454L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G7362T	21						.						78.0	80.0	80.0					21																	47847577		2203	4300	6503	46672005	SO:0001819	synonymous_variant	5116	exon34			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.7362G>T	21.37:g.47847577G>T		Somatic		Capture	Illumina HiSeq	Phase_I	46672005	NM_006031	O43152|Q7Z7C9	Silent	SNP	ENST00000359568.5	37	CCDS33592.1																																																																																				PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
CRYBB1	1414	broad.mit.edu	37	22	27008060	27008060	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr22:27008060C>T	ENST00000215939.2	-	3	405	c.275G>A	c.(274-276)cGc>cAc	p.R92H		NM_001887.3	NP_001878.1	P53674	CRBB1_HUMAN	crystallin, beta B1	92	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)	p.R92H(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(3)|skin(2)|urinary_tract(4)	31						AATGATGCTGCGCACACGGTC	0.582																																					p.R92H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G275A	22						.						95.0	85.0	88.0					22																	27008060		2203	4300	6503	25338060	SO:0001583	missense	1414	exon3				CCDS13840.1	22q12.1	2008-06-10			ENSG00000100122	ENSG00000100122			2397	protein-coding gene	gene with protein product		600929				8575764, 12360425	Standard	NM_001887		Approved		uc003acy.1	P53674	OTTHUMG00000150980	ENST00000215939.2:c.275G>A	22.37:g.27008060C>T	ENSP00000215939:p.Arg92His	Somatic		Capture	Illumina HiSeq	Phase_I	25338060	NM_001887		Missense_Mutation	SNP	ENST00000215939.2	37	CCDS13840.1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.474608	0.63737	.	.	ENSG00000100122	ENST00000215939	T	0.76578	-1.03	3.7	3.7	0.42460	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.057781	0.64402	D	0.000001	T	0.70789	0.3264	L	0.43757	1.38	0.80722	D	1	B	0.27765	0.188	B	0.25987	0.065	T	0.72693	-0.4216	10	0.54805	T	0.06	.	14.6006	0.68438	0.0:1.0:0.0:0.0	.	92	P53674	CRBB1_HUMAN	H	92	ENSP00000215939:R92H	ENSP00000215939:R92H	R	-	2	0	CRYBB1	25338060	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	4.019000	0.57181	1.878000	0.54408	0.491000	0.48974	CGC		CRYBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320767.1	NM_001887	
KDELR3	11015	broad.mit.edu	37	22	38870607	38870607	+	Silent	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr22:38870607C>T	ENST00000216014.4	+	2	343	c.171C>T	c.(169-171)tcC>tcT	p.S57S	KDELR3_ENST00000471268.1_3'UTR|KDELR3_ENST00000409006.3_Silent_p.S57S	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3	57					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)	p.S57S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					ACTTCATCTCCATCTACAACA	0.537																																					p.S57S	Ovarian(11;103 529 24120 28493 32980)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C171T	22						.						170.0	132.0	145.0					22																	38870607		2203	4300	6503	37200553	SO:0001819	synonymous_variant	11015	exon2			AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520	ENST00000216014.4:c.171C>T	22.37:g.38870607C>T		Somatic		Capture	Illumina HiSeq	Phase_I	37200553	NM_016657	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Silent	SNP	ENST00000216014.4	37	CCDS13972.1																																																																																				KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331474.1		
PHF5A	84844	broad.mit.edu	37	22	41856441	41856441	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr22:41856441G>A	ENST00000216252.3	-	4	365	c.294C>T	c.(292-294)ctC>ctT	p.L98L	PHF5A_ENST00000491254.1_5'UTR	NM_032758.3	NP_116147.1	Q7RTV0	PHF5A_HUMAN	PHD finger protein 5A	98					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|U12-type spliceosomal complex (GO:0005689)|U2 snRNP (GO:0005686)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L98L(1)		central_nervous_system(1)|large_intestine(2)|lung(1)	4						GTTCATAGAAGAGGTCTGTCT	0.493																																					p.L98L	Ovarian(15;130 571 1826 2981 46141)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C294T	22						.						87.0	81.0	83.0					22																	41856441		2203	4300	6503	40186387	SO:0001819	synonymous_variant	84844	exon4			BC007321	CCDS14016.1	22q13.2	2014-02-14			ENSG00000100410	ENSG00000100410		"""Zinc fingers, PHD-type"""	18000	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 7"""					12054543, 12234937, 18076038	Standard	NM_032758		Approved	MGC1346, SF3b14b, INI, bK223H9.2, Rds3, SAP14b, SF3B7	uc003bab.3	Q7RTV0	OTTHUMG00000150966	ENST00000216252.3:c.294C>T	22.37:g.41856441G>A		Somatic		Capture	Illumina HiSeq	Phase_I	40186387	NM_032758	Q9UH06	Silent	SNP	ENST00000216252.3	37	CCDS14016.1																																																																																				PHF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320686.1	NM_032758	
SELO	83642	broad.mit.edu	37	22	50649214	50649214	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr22:50649214G>A	ENST00000380903.2	+	5	1283	c.1225G>A	c.(1225-1227)Gag>Aag	p.E409K	SELO_ENST00000492092.1_3'UTR|RP3-402G11.28_ENST00000608016.1_RNA	NM_031454.1	NP_113642.1	Q9BVL4	SELO_HUMAN		409								p.E409K(1)					all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		CCTGGCCGAGGAGTTTGACGC	0.662											OREG0026676	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E409K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1225A	22						.						55.0	69.0	64.0					22																	50649214		2067	4192	6259	48991341	SO:0001583	missense	83642	exon5																														ENST00000380903.2:c.1225G>A	22.37:g.50649214G>A	ENSP00000370288:p.Glu409Lys	Somatic	971	Capture	Illumina HiSeq	Phase_I	48991341	NM_031454	Q2TAL2|Q5JZ81|Q8WUI0	Missense_Mutation	SNP	ENST00000380903.2	37	CCDS43034.1	.	.	.	.	.	.	.	.	.	.	G	14.04	2.417570	0.42918	.	.	ENSG00000073169	ENST00000380903	T	0.39406	1.08	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.46347	0.1388	L	0.46157	1.445	0.80722	D	1	B;B	0.30146	0.27;0.178	B;B	0.39027	0.179;0.288	T	0.21655	-1.0239	10	0.23891	T	0.37	.	20.0969	0.97855	0.0:0.0:1.0:0.0	.	409;252	Q9BVL4;Q6ICA4	SELO_HUMAN;.	K	409	ENSP00000370288:E409K	ENSP00000370288:E409K	E	+	1	0	RP3-402G11.5	48991341	1.000000	0.71417	0.821000	0.32701	0.223000	0.24884	7.158000	0.77470	2.761000	0.94854	0.561000	0.74099	GAG		SELO-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000075003.2		
DPP10	57628	broad.mit.edu	37	2	116497420	116497420	+	Missense_Mutation	SNP	G	G	A	rs148038008		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:116497420G>A	ENST00000410059.1	+	9	1283	c.803G>A	c.(802-804)cGg>cAg	p.R268Q	DPP10_ENST00000393147.2_Missense_Mutation_p.R272Q|DPP10_ENST00000310323.8_Missense_Mutation_p.R261Q|DPP10_ENST00000409163.1_Missense_Mutation_p.R218Q	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	268						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.R261Q(1)|p.R268Q(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GTTATCCCTCGGTTTACTGGA	0.463													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20138	0.0		0.0	False		,,,				2504	0.0				p.R218Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G653A	2						.						235.0	205.0	215.0					2																	116497420		2203	4300	6503	116213890	SO:0001583	missense	57628	exon10			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.803G>A	2.37:g.116497420G>A	ENSP00000386565:p.Arg268Gln	Somatic		Capture	Illumina HiSeq	Phase_I	116213890	NM_001178036	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	13.11	2.138687	0.37728	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	4.95	4.07	0.47477	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.198830	0.44902	N	0.000414	T	0.15132	0.0365	N	0.08118	0	0.44595	D	0.997561	B;B;B;B	0.10296	0.003;0.001;0.003;0.003	B;B;B;B	0.11329	0.003;0.002;0.006;0.006	T	0.06625	-1.0816	10	0.29301	T	0.29	-9.5722	9.412	0.38498	0.1635:0.0:0.8365:0.0	.	261;272;264;268	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	Q	268;218;272;261;218	ENSP00000386565:R268Q;ENSP00000387038:R218Q;ENSP00000376855:R272Q;ENSP00000309066:R261Q	ENSP00000309066:R261Q	R	+	2	0	DPP10	116213890	0.971000	0.33674	0.999000	0.59377	0.922000	0.55478	1.674000	0.37544	1.442000	0.47568	0.563000	0.77884	CGG		DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
TMEM163	81615	broad.mit.edu	37	2	135308176	135308176	+	Silent	SNP	G	G	A	rs146033998		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:135308176G>A	ENST00000281924.6	-	4	487	c.423C>T	c.(421-423)aaC>aaT	p.N141N		NM_030923.4	NP_112185.1	Q8TC26	TM163_HUMAN	transmembrane protein 163	141						cell junction (GO:0030054)|early endosome membrane (GO:0031901)|integral component of synaptic vesicle membrane (GO:0030285)	zinc ion binding (GO:0008270)	p.N141N(1)		endometrium(1)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.154)		CAGCGGCCGCGTTGCTGTAAC	0.522													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21189	0.0		0.0	False		,,,				2504	0.0				p.N141N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C423T	2						.	G		7,4399	12.9+/-30.5	0,7,2196	120.0	114.0	116.0		423	-11.2	0.1	2	dbSNP_134	116	0,8600		0,0,4300	no	coding-synonymous	TMEM163	NM_030923.4		0,7,6496	AA,AG,GG		0.0,0.1589,0.0538		141/290	135308176	7,12999	2203	4300	6503	135024646	SO:0001819	synonymous_variant	81615	exon4				CCDS2172.1	2q21.3	2008-02-05			ENSG00000152128	ENSG00000152128			25380	protein-coding gene	gene with protein product						17623043	Standard	NM_030923		Approved	DKFZP566N034, SV31	uc002ttx.3	Q8TC26	OTTHUMG00000131713	ENST00000281924.6:c.423C>T	2.37:g.135308176G>A		Somatic		Capture	Illumina HiSeq	Phase_I	135024646	NM_030923	Q53QM3|Q53SV7|Q69YH3|Q9UFG3	Silent	SNP	ENST00000281924.6	37	CCDS2172.1																																																																																				TMEM163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254631.2	NM_030923	
MMADHC	27249	broad.mit.edu	37	2	150426563	150426563	+	Silent	SNP	G	G	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:150426563G>C	ENST00000428879.1	-	7	1320	c.816C>G	c.(814-816)acC>acG	p.T272T	MMADHC_ENST00000303319.5_Silent_p.T272T|MMADHC_ENST00000422782.2_Silent_p.T306T			Q9H3L0	MMAD_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria	272					cobalamin metabolic process (GO:0009235)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)		p.T272T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(2)	11						CAACTACATGGGTACCCCAGA	0.388																																					p.T272T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C816G	2						.						130.0	117.0	121.0					2																	150426563		2203	4300	6503	150134809	SO:0001819	synonymous_variant	27249	exon8			BC023995	CCDS2189.1	2q23	2011-05-12	2009-01-08	2009-01-08	ENSG00000168288	ENSG00000168288			25221	protein-coding gene	gene with protein product		611935	"""chromosome 2 open reading frame 25"""	C2orf25		18385497	Standard	NM_015702		Approved	CL25022, cblD	uc002txc.3	Q9H3L0	OTTHUMG00000155558	ENST00000428879.1:c.816C>G	2.37:g.150426563G>C		Somatic		Capture	Illumina HiSeq	Phase_I	150134809	NM_015702	B2R895|D3DP91|O95891	Silent	SNP	ENST00000428879.1	37	CCDS2189.1																																																																																				MMADHC-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332312.1	NM_015702	
NEB	4703	broad.mit.edu	37	2	152421647	152421647	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:152421647T>A	ENST00000172853.10	-	89	13426	c.13279A>T	c.(13279-13281)Aca>Tca	p.T4427S	NEB_ENST00000604864.1_Missense_Mutation_p.T6128S|NEB_ENST00000427231.2_Missense_Mutation_p.T6128S|NEB_ENST00000397345.3_Missense_Mutation_p.T6128S|NEB_ENST00000603639.1_Missense_Mutation_p.T6128S|NEB_ENST00000409198.1_Missense_Mutation_p.T4427S			P20929	NEBU_HUMAN	nebulin	4427					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.T6128S(1)|p.T4427S(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTATTAAATGTTTCTTTATAT	0.303																																					p.T6128S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A18382T	2						.						111.0	98.0	102.0					2																	152421647		1797	4073	5870	152129893	SO:0001583	missense	4703	exon117			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.13279A>T	2.37:g.152421647T>A	ENSP00000172853:p.Thr4427Ser	Somatic		Capture	Illumina HiSeq	Phase_I	152129893	NM_001164507	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	T	20.4	3.983196	0.74474	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	6.07	6.07	0.98685	.	0.094194	0.64402	D	0.000001	T	0.53367	0.1792	L	0.39020	1.185	0.80722	D	1	B;D	0.62365	0.313;0.991	P;D	0.69654	0.679;0.965	T	0.45659	-0.9246	10	0.29301	T	0.29	.	15.8088	0.78538	0.0:0.0:0.0:1.0	.	4427;858	P20929;Q14215	NEBU_HUMAN;.	S	4427;6128;6128;476;858;4427	ENSP00000386259:T4427S;ENSP00000380505:T6128S;ENSP00000416578:T6128S;ENSP00000410961:T858S;ENSP00000172853:T4427S	ENSP00000172853:T4427S	T	-	1	0	NEB	152129893	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.156000	0.50708	2.330000	0.79161	0.528000	0.53228	ACA		NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
NEB	4703	broad.mit.edu	37	2	152432753	152432753	+	Missense_Mutation	SNP	C	C	T	rs374740079		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:152432753C>T	ENST00000172853.10	-	78	11864	c.11717G>A	c.(11716-11718)cGg>cAg	p.R3906Q	NEB_ENST00000604864.1_Missense_Mutation_p.R5607Q|NEB_ENST00000427231.2_Missense_Mutation_p.R5607Q|NEB_ENST00000397345.3_Missense_Mutation_p.R5607Q|NEB_ENST00000603639.1_Missense_Mutation_p.R5607Q|NEB_ENST00000409198.1_Missense_Mutation_p.R3906Q			P20929	NEBU_HUMAN	nebulin	3906					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.R3906Q(1)|p.R5607Q(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CACAGGCGTCCGATAGACACT	0.448																																					p.R5607Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G16820A	2						.	C	GLN/ARG,GLN/ARG,GLN/ARG	1,3789		0,1,1894	73.0	76.0	75.0		16820,16820,11717	5.0	1.0	2		75	0,8244		0,0,4122	no	missense,missense,missense	NEB	NM_001164507.1,NM_001164508.1,NM_004543.4	43,43,43	0,1,6016	TT,TC,CC		0.0,0.0264,0.0083	probably-damaging,probably-damaging,probably-damaging	5607/8526,5607/8526,3906/6670	152432753	1,12033	1895	4122	6017	152140999	SO:0001583	missense	4703	exon106			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.11717G>A	2.37:g.152432753C>T	ENSP00000172853:p.Arg3906Gln	Somatic		Capture	Illumina HiSeq	Phase_I	152140999	NM_001164507	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	C	33	5.217741	0.95104	2.64E-4	0.0	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000413693;ENST00000172853	T;T;T;T;T	0.18810	2.54;2.72;2.72;2.19;2.53	5.9	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.49355	0.1552	M	0.81112	2.525	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.85130	0.997;0.98	T	0.55541	-0.8125	10	0.66056	D	0.02	.	15.049	0.71850	0.0:0.9321:0.0:0.0679	.	3906;337	P20929;Q14215	NEBU_HUMAN;.	Q	3906;5607;5607;337;3906	ENSP00000386259:R3906Q;ENSP00000380505:R5607Q;ENSP00000416578:R5607Q;ENSP00000410961:R337Q;ENSP00000172853:R3906Q	ENSP00000172853:R3906Q	R	-	2	0	NEB	152140999	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	4.695000	0.61767	1.499000	0.48617	0.563000	0.77884	CGG		NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
PXDN	7837	broad.mit.edu	37	2	1647230	1647230	+	Missense_Mutation	SNP	C	C	T	rs183629867		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:1647230C>T	ENST00000252804.4	-	19	3912	c.3862G>A	c.(3862-3864)Gtg>Atg	p.V1288M		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	1288					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.V1288M(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		ACCCTGAACACGTCGCTCTGC	0.637													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17678	0.0		0.0	False		,,,				2504	0.0				p.V1288M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3862A	2						.						82.0	93.0	89.0					2																	1647230		2130	4225	6355	1626237	SO:0001583	missense	7837	exon19			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.3862G>A	2.37:g.1647230C>T	ENSP00000252804:p.Val1288Met	Somatic		Capture	Illumina HiSeq	Phase_I	1626237	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	37	CCDS46221.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	18.15	3.560800	0.65538	.	.	ENSG00000130508	ENST00000252804	T	0.70986	-0.53	5.27	4.39	0.52855	.	0.169946	0.38897	N	0.001538	D	0.84442	0.5473	M	0.85099	2.735	0.37488	D	0.916274	D	0.89917	1.0	D	0.68353	0.957	D	0.88823	0.3300	10	0.72032	D	0.01	-39.5692	14.3929	0.66991	0.0:0.7187:0.2813:0.0	.	1288	Q92626	PXDN_HUMAN	M	1288	ENSP00000252804:V1288M	ENSP00000252804:V1288M	V	-	1	0	PXDN	1626237	1.000000	0.71417	0.996000	0.52242	0.465000	0.32709	4.770000	0.62309	1.213000	0.43380	0.563000	0.77884	GTG		PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
ITGB6	3694	broad.mit.edu	37	2	161055750	161055750	+	Silent	SNP	A	A	G			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:161055750A>G	ENST00000283249.2	-	2	318	c.81T>C	c.(79-81)ggT>ggC	p.G27G	ITGB6_ENST00000428609.2_Intron|ITGB6_ENST00000409872.1_Silent_p.G27G|ITGB6_ENST00000485635.1_Intron|ITGB6_ENST00000409967.2_Silent_p.G27G	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	27					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)	p.G27G(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						AGGTTTCTGCACCTCCCAGGG	0.458																																					p.G27G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T81C	2						.						84.0	81.0	82.0					2																	161055750		2203	4300	6503	160763996	SO:0001819	synonymous_variant	3694	exon2				CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.81T>C	2.37:g.161055750A>G		Somatic		Capture	Illumina HiSeq	Phase_I	160763996	NM_000888	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Silent	SNP	ENST00000283249.2	37	CCDS2212.1																																																																																				ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888	
TLK1	9874	broad.mit.edu	37	2	171863364	171863364	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:171863364A>T	ENST00000431350.2	-	16	1948	c.1544T>A	c.(1543-1545)cTg>cAg	p.L515Q	TLK1_ENST00000442919.2_Missense_Mutation_p.L467Q|TLK1_ENST00000434911.2_Missense_Mutation_p.L419Q|TLK1_ENST00000360843.3_Missense_Mutation_p.L536Q|TLK1_ENST00000521943.1_Missense_Mutation_p.L467Q			Q9UKI8	TLK1_HUMAN	tousled-like kinase 1	515	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.L515Q(1)|p.L467Q(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|liver(3)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						GGGGTGATCCAGTTCTTTGTG	0.313																																					p.L515Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1544A	2						.						121.0	129.0	127.0					2																	171863364		2203	4298	6501	171571610	SO:0001583	missense	9874	exon16			AB004885	CCDS2241.1, CCDS46447.1, CCDS46448.1	2q31.1	2010-04-19			ENSG00000198586	ENSG00000198586			11841	protein-coding gene	gene with protein product		608438				9427565, 12660173	Standard	NM_012290		Approved	KIAA0137, PKU-BETA	uc002ugp.2	Q9UKI8	OTTHUMG00000132243	ENST00000431350.2:c.1544T>A	2.37:g.171863364A>T	ENSP00000411099:p.Leu515Gln	Somatic		Capture	Illumina HiSeq	Phase_I	171571610	NM_012290	B3KR15|B4DX87|Q14150|Q8N591|Q9NYH2|Q9Y4F6	Missense_Mutation	SNP	ENST00000431350.2	37	CCDS2241.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.377973	0.82682	.	.	ENSG00000198586	ENST00000442919;ENST00000431350;ENST00000360843;ENST00000521943;ENST00000434911	T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29	4.95	4.95	0.65309	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.58250	0.2109	M	0.69248	2.105	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.81914	0.995;0.995;0.993	T	0.62992	-0.6736	10	0.87932	D	0	.	14.9642	0.71179	1.0:0.0:0.0:0.0	.	419;536;515	B4DX87;Q9UKI8-2;Q9UKI8	.;.;TLK1_HUMAN	Q	467;515;536;467;419	ENSP00000402165:L467Q;ENSP00000411099:L515Q;ENSP00000354089:L536Q;ENSP00000428113:L467Q;ENSP00000409222:L419Q	ENSP00000354089:L536Q	L	-	2	0	TLK1	171571610	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.336000	0.96533	2.007000	0.58848	0.373000	0.22412	CTG		TLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255314.1	NM_012290	
NAB1	4664	broad.mit.edu	37	2	191537876	191537876	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:191537876G>A	ENST00000337386.5	+	6	1464	c.1003G>A	c.(1003-1005)Gag>Aag	p.E335K	NAB1_ENST00000409581.1_Missense_Mutation_p.E335K|NAB1_ENST00000545490.1_Missense_Mutation_p.E105K|NAB1_ENST00000484774.1_Intron|NAB1_ENST00000357215.5_Missense_Mutation_p.E335K|NAB1_ENST00000409641.1_Missense_Mutation_p.E335K	NM_005966.3	NP_005957.2	Q13506	NAB1_HUMAN	NGFI-A binding protein 1 (EGR1 binding protein 1)	335	Necessary for nuclear localization. {ECO:0000250}.				endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of epidermis development (GO:0045682)|regulation of transcription, DNA-templated (GO:0006355)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.E335K(1)		kidney(2)|large_intestine(2)|lung(1)|prostate(1)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0405)|all cancers(119;0.109)			AATTAAAGTGGAGGTATGGTC	0.323																																					p.E335K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1003A	2						.						201.0	215.0	210.0					2																	191537876		2203	4300	6503	191246121	SO:0001583	missense	4664	exon6				CCDS2307.1	2q32.3-q33	2008-05-23			ENSG00000138386	ENSG00000138386			7626	protein-coding gene	gene with protein product	"""EGR1 binding protein 1"""	600800				7624335, 8668170, 9418898	Standard	XM_005246579		Approved		uc002usb.3	Q13506	OTTHUMG00000132689	ENST00000337386.5:c.1003G>A	2.37:g.191537876G>A	ENSP00000336894:p.Glu335Lys	Somatic		Capture	Illumina HiSeq	Phase_I	191246121	NM_005966	O75383|O75384|Q6GTU1|Q9UEV1	Missense_Mutation	SNP	ENST00000337386.5	37	CCDS2307.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.130752|5.130752	0.94473|0.94473	.|.	.|.	ENSG00000138386|ENSG00000138386	ENST00000409581;ENST00000337386;ENST00000357215;ENST00000409641;ENST00000545490|ENST00000434473	.|.	.|.	.|.	5.0|5.0	5.0|5.0	0.66597|0.66597	Nab1, C-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.48187|0.48187	0.1486|0.1486	L|L	0.32530|0.32530	0.975|0.975	0.28706|0.28706	N|N	0.90382|0.90382	D;D;D|.	0.76494|.	0.996;0.999;0.997|.	D;D;D|.	0.81914|.	0.987;0.995;0.948|.	T|T	0.41233|0.41233	-0.9520|-0.9520	9|5	0.72032|.	D|.	0.01|.	-18.3581|-18.3581	17.8248|17.8248	0.88661|0.88661	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	335;335;335|.	F8W8J7;B8ZZS2;Q13506|.	.;.;NAB1_HUMAN|.	K|E	335;335;335;335;105|117	.|.	ENSP00000336894:E335K|.	E|G	+|+	1|2	0|0	NAB1|NAB1	191246121|191246121	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.969000|0.969000	0.65631|0.65631	8.310000|8.310000	0.89971|0.89971	2.761000|2.761000	0.94854|0.94854	0.650000|0.650000	0.86243|0.86243	GAG|GGA		NAB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255986.1	NM_005966	
ADAM23	8745	broad.mit.edu	37	2	207437919	207437919	+	Splice_Site	SNP	G	G	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:207437919G>T	ENST00000264377.3	+	18	2065	c.1737G>T	c.(1735-1737)caG>caT	p.Q579H	ADAM23_ENST00000374415.3_Splice_Site_p.Q579H|ADAM23_ENST00000374416.1_Splice_Site_p.Q579H	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	579	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.Q579H(2)		NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		ACTCTGGTCAGGTATGGCGCA	0.408																																					p.Q579H	Melanoma(194;1127 2130 19620 24042 27855)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1737T	2						.						230.0	202.0	212.0					2																	207437919		2203	4300	6503	207146164	SO:0001630	splice_region_variant	8745	exon18			AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1737+1G>T	2.37:g.207437919G>T		Somatic		Capture	Illumina HiSeq	Phase_I	207146164	NM_003812	A2RU59	Missense_Mutation	SNP	ENST00000264377.3	37	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315562	0.81469	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.11821	2.74;2.74;2.74	5.81	5.81	0.92471	Blood coagulation inhibitor, Disintegrin (5);	0.000000	0.64402	D	0.000020	T	0.31979	0.0814	L	0.49513	1.565	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.00726	-1.1592	10	0.19590	T	0.45	.	18.9069	0.92466	0.0:0.0:1.0:0.0	.	579	O75077	ADA23_HUMAN	H	579;579;473;579	ENSP00000264377:Q579H;ENSP00000363537:Q579H;ENSP00000363536:Q579H	ENSP00000264377:Q579H	Q	+	3	2	ADAM23	207146164	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	8.216000	0.89764	2.755000	0.94549	0.650000	0.86243	CAG		ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812	Missense_Mutation
CCDC108	255101	broad.mit.edu	37	2	219888962	219888962	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:219888962G>A	ENST00000341552.5	-	15	2453	c.2370C>T	c.(2368-2370)tcC>tcT	p.S790S	CCDC108_ENST00000453220.1_Silent_p.S790S|CCDC108_ENST00000441968.1_Silent_p.S790S	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	790						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.S790S(2)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGCTCACCGGAGGACACTG	0.642																																					p.S790S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C2370T	2						.						40.0	45.0	43.0					2																	219888962		2203	4300	6503	219597206	SO:0001819	synonymous_variant	255101	exon15			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.2370C>T	2.37:g.219888962G>A		Somatic		Capture	Illumina HiSeq	Phase_I	219597206	NM_194302	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Silent	SNP	ENST00000341552.5	37	CCDS2430.2																																																																																				CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
NYAP2	57624	broad.mit.edu	37	2	226447014	226447014	+	Missense_Mutation	SNP	C	C	T	rs368778863		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:226447014C>T	ENST00000272907.6	+	4	1294	c.881C>T	c.(880-882)tCg>tTg	p.S294L	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	294					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)			p.S294L(1)									AGCTGTTCTTCGCAGTGTGCT	0.587																																					p.S294L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C881T	2						.						87.0	91.0	90.0					2																	226447014		2109	4219	6328	226155258	SO:0001583	missense	57624	exon4			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.881C>T	2.37:g.226447014C>T	ENSP00000272907:p.Ser294Leu	Somatic		Capture	Illumina HiSeq	Phase_I	226155258	NM_020864	A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	C	14.55	2.569072	0.45798	.	.	ENSG00000144460	ENST00000272907	T	0.52754	0.65	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.66479	0.2793	L	0.56769	1.78	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.58880	-0.7558	10	0.29301	T	0.29	-16.8579	20.1381	0.98040	0.0:1.0:0.0:0.0	.	294	Q9P242	K1486_HUMAN	L	294	ENSP00000272907:S294L	ENSP00000272907:S294L	S	+	2	0	KIAA1486	226155258	1.000000	0.71417	0.999000	0.59377	0.192000	0.23643	4.529000	0.60588	2.763000	0.94921	0.650000	0.86243	TCG		NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864	
GPR113	165082	broad.mit.edu	37	2	26535970	26535970	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:26535970G>A	ENST00000311519.1	-	10	1493	c.1494C>T	c.(1492-1494)ggC>ggT	p.G498G	GPR113_ENST00000421160.2_Silent_p.G429G|GPR113_ENST00000333478.6_Silent_p.G299G|GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000541401.1_Silent_p.G101G	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	498					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G299G(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGCAGGACTGCCCTGGCCTG	0.587																																					p.G429G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1287T	2						.						85.0	76.0	79.0					2																	26535970		2203	4300	6503	26389474	SO:0001819	synonymous_variant	165082	exon9			AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.1494C>T	2.37:g.26535970G>A		Somatic		Capture	Illumina HiSeq	Phase_I	26389474	NM_001145169	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Silent	SNP	ENST00000311519.1	37	CCDS46239.1																																																																																				GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	NM_153835	
C2orf16	84226	broad.mit.edu	37	2	27802553	27802553	+	Silent	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:27802553C>T	ENST00000408964.2	+	1	3165	c.3114C>T	c.(3112-3114)taC>taT	p.Y1038Y	AC074091.1_ENST00000408604.1_RNA	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1038						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.Y1038Y(1)		breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					GCATATTTTACGATAGAGAAG	0.453																																					p.Y1038Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3114T	2						.						102.0	105.0	104.0					2																	27802553		2065	4227	6292	27656057	SO:0001819	synonymous_variant	84226	exon1			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.3114C>T	2.37:g.27802553C>T		Somatic		Capture	Illumina HiSeq	Phase_I	27656057	NM_032266	B9EIQ4|Q53S01|Q8ND64|Q9H088	Silent	SNP	ENST00000408964.2	37	CCDS42666.1																																																																																				C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266	
DHX57	90957	broad.mit.edu	37	2	39050248	39050248	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:39050248C>T	ENST00000295373.6	-	17	3304	c.3178G>A	c.(3178-3180)Gcc>Acc	p.A1060T		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	1060							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.A1060T(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				GGCAGAGAGGCCAAATGATAC	0.468																																					p.A1060T	Melanoma(191;1090 2095 4375 23729 47341)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3178A	2						.						119.0	107.0	111.0					2																	39050248		2203	4300	6503	38903752	SO:0001583	missense	90957	exon17			AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.3178G>A	2.37:g.39050248C>T	ENSP00000295373:p.Ala1060Thr	Somatic		Capture	Illumina HiSeq	Phase_I	38903752	NM_198963	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	ENST00000295373.6	37	CCDS1800.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.477445|5.477445	0.96291|0.96291	.|.	.|.	ENSG00000163214|ENSG00000163214	ENST00000295373|ENST00000452978	T|.	0.36157|.	1.27|.	5.51|5.51	5.51|5.51	0.81932|0.81932	Helicase-associated domain (2);|.	0.000000|.	0.52532|.	D|.	0.000078|.	D|D	0.83234|0.83234	0.5210|0.5210	M|M	0.85373|0.85373	2.75|2.75	0.80722|0.80722	D|D	1|1	D;D|.	0.65815|.	0.977;0.995|.	D;D|.	0.70016|.	0.954;0.967|.	D|D	0.84449|0.84449	0.0587|0.0587	10|5	0.72032|.	D|.	0.01|.	.|.	19.4309|19.4309	0.94765|0.94765	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1060;452|.	Q6P158;Q59G60|.	DHX57_HUMAN;.|.	T|D	1060|383	ENSP00000295373:A1060T|.	ENSP00000295373:A1060T|.	A|G	-|-	1|2	0|0	DHX57|DHX57	38903752|38903752	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	7.711000|7.711000	0.84669|0.84669	2.592000|2.592000	0.87571|0.87571	0.650000|0.650000	0.86243|0.86243	GCC|GGC		DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646	
LRRTM4	80059	broad.mit.edu	37	2	76975877	76975877	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:76975877C>T	ENST00000409093.1	-	4	2053	c.1717G>A	c.(1717-1719)Gcc>Acc	p.A573T	LRRTM4_ENST00000409884.1_Missense_Mutation_p.A573T|LRRTM4_ENST00000409911.1_Missense_Mutation_p.A574T			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	573					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.A573P(1)|p.A573T(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		GCGATGGTGGCGATGAAGCTG	0.622																																					p.A573T												.	.	2	Substitution - Missense(2)	large_intestine(1)|central_nervous_system(1)	c.G1717A	2						.						149.0	138.0	141.0					2																	76975877		1568	3582	5150	76829385	SO:0001583	missense	80059	exon4			AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1717G>A	2.37:g.76975877C>T	ENSP00000386357:p.Ala573Thr	Somatic		Capture	Illumina HiSeq	Phase_I	76829385	NM_001134745	Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	C	5.502	0.277573	0.10403	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093	T;T;T	0.55052	0.54;0.57;0.57	5.91	5.03	0.67393	.	.	.	.	.	T	0.25644	0.0624	N	0.08118	0	0.80722	D	1	B	0.11235	0.004	B	0.04013	0.001	T	0.14980	-1.0453	9	0.02654	T	1	.	8.1989	0.31413	0.1545:0.7661:0.0:0.0793	.	573	Q86VH4	LRRT4_HUMAN	T	574;573;573	ENSP00000387228:A574T;ENSP00000387297:A573T;ENSP00000386357:A573T	ENSP00000386357:A573T	A	-	1	0	LRRTM4	76829385	0.987000	0.35691	0.998000	0.56505	0.893000	0.52053	2.252000	0.43196	1.496000	0.48567	0.650000	0.86243	GCC		LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993	
SFTPB	6439	broad.mit.edu	37	2	85893830	85893830	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:85893830G>A	ENST00000519937.2	-	4	322	c.303C>T	c.(301-303)aaC>aaT	p.N101N	SFTPB_ENST00000409383.1_Silent_p.N113N|SFTPB_ENST00000393822.3_Silent_p.N113N|SFTPB_ENST00000342375.3_Silent_p.N101N			P07988	PSPB_HUMAN	surfactant protein B	101	Saposin B-type 1. {ECO:0000255|PROSITE- ProRule:PRU00415}.				organ morphogenesis (GO:0009887)|respiratory gaseous exchange (GO:0007585)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)		p.N101N(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)	16						AGGGGAGGACGTTGCACTCCT	0.612																																					p.N113N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C339T	2						.						183.0	157.0	166.0					2																	85893830		2203	4300	6503	85747341	SO:0001819	synonymous_variant	6439	exon5			J02761	CCDS1983.1, CCDS1983.2	2p12-p11.2	2008-08-26	2008-08-26		ENSG00000168878	ENSG00000168878			10801	protein-coding gene	gene with protein product		178640	"""surfactant, pulmonary-associated protein B"""	SFTP3		2924687, 1346779	Standard	NM_198843		Approved	SP-B	uc002sqh.3	P07988	OTTHUMG00000130181	ENST00000519937.2:c.303C>T	2.37:g.85893830G>A		Somatic		Capture	Illumina HiSeq	Phase_I	85747341	NM_198843	Q96R04	Silent	SNP	ENST00000519937.2	37		.	.	.	.	.	.	.	.	.	.	G	0.026	-1.373686	0.01214	.	.	ENSG00000168878	ENST00000428225	.	.	.	4.47	-3.42	0.04825	.	.	.	.	.	T	0.27027	0.0662	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30119	-0.9989	4	.	.	.	-8.3047	5.9281	0.19124	0.5907:0.1544:0.2549:0.0	.	.	.	.	C	98	.	.	R	-	1	0	SFTPB	85747341	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-2.325000	0.01115	-0.808000	0.04387	-0.258000	0.10820	CGT		SFTPB-001	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252499.3	NM_198843	
POLR1A	25885	broad.mit.edu	37	2	86271425	86271425	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:86271425C>A	ENST00000263857.6	-	22	3350	c.2972G>T	c.(2971-2973)tGc>tTc	p.C991F	POLR1A_ENST00000409681.1_Missense_Mutation_p.C991F			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	991					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)	p.C991F(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						CTTGATGATGCACCTGTAAGG	0.632																																					p.C991F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2972T	2						.						88.0	94.0	92.0					2																	86271425		2106	4220	6326	86124936	SO:0001583	missense	25885	exon22			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.2972G>T	2.37:g.86271425C>A	ENSP00000263857:p.Cys991Phe	Somatic		Capture	Illumina HiSeq	Phase_I	86124936	NM_015425	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	37	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	C	19.32	3.804640	0.70682	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.68903	-0.36;-0.36	5.69	5.69	0.88448	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	D	0.88112	0.6349	H	0.95187	3.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91001	0.4842	10	0.87932	D	0	-21.1397	19.8154	0.96566	0.0:1.0:0.0:0.0	.	357;991	B7Z8X7;O95602	.;RPA1_HUMAN	F	991	ENSP00000263857:C991F;ENSP00000386300:C991F	ENSP00000263857:C991F	C	-	2	0	POLR1A	86124936	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.487000	0.81328	2.699000	0.92147	0.655000	0.94253	TGC		POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425	
PSMD1	5707	broad.mit.edu	37	2	231947669	231947669	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr2:231947669T>G	ENST00000308696.6	+	13	1648	c.1486T>G	c.(1486-1488)Ttg>Gtg	p.L496V	PSMD1_ENST00000409643.1_Missense_Mutation_p.L496V|PSMD1_ENST00000373635.4_Missense_Mutation_p.L496V	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	496					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)	p.L496V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	TGTTTATGATTTGCTAAAAAC	0.363																																					p.L496V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1486G	2						.						119.0	116.0	117.0					2																	231947669		2203	4300	6503	231655913	SO:0001583	missense	5707	exon13			D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.1486T>G	2.37:g.231947669T>G	ENSP00000309474:p.Leu496Val	Somatic		Capture	Illumina HiSeq	Phase_I	231655913	NM_002807	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	ENST00000308696.6	37	CCDS2482.1	.	.	.	.	.	.	.	.	.	.	T	15.82	2.946358	0.53079	.	.	ENSG00000173692	ENST00000308696;ENST00000373635;ENST00000409643	T;T;T	0.32988	1.43;1.43;1.43	6.06	4.72	0.59763	Armadillo-like helical (1);Armadillo-type fold (1);	0.129298	0.51477	D	0.000092	T	0.21761	0.0524	L	0.36672	1.1	0.58432	D	0.999995	B;B	0.18610	0.01;0.029	B;B	0.16289	0.01;0.015	T	0.06250	-1.0837	10	0.30854	T	0.27	-8.8026	7.8137	0.29247	0.0:0.2131:0.0:0.7869	.	496;496	Q99460;Q99460-2	PSMD1_HUMAN;.	V	496	ENSP00000309474:L496V;ENSP00000362738:L496V;ENSP00000386932:L496V	ENSP00000309474:L496V	L	+	1	2	PSMD1	231655913	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	0.621000	0.24418	2.324000	0.78689	0.533000	0.62120	TTG		PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2		
SIDT1	54847	broad.mit.edu	37	3	113344950	113344950	+	Splice_Site	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr3:113344950G>A	ENST00000264852.4	+	24	3035	c.2309G>A	c.(2308-2310)gGa>gAa	p.G770E	SIDT1_ENST00000463226.1_3'UTR|SIDT1_ENST00000393830.3_Splice_Site_p.G775E	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	770					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)	p.G770E(1)		breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						TTCCTCCAGGGAACTCCGGCC	0.512																																					p.G770E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2309A	3						.						168.0	164.0	165.0					3																	113344950		2203	4300	6503	114827640	SO:0001630	splice_region_variant	54847	exon24			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.2308-1G>A	3.37:g.113344950G>A		Somatic		Capture	Illumina HiSeq	Phase_I	114827640	NM_017699	Q17RR4	Missense_Mutation	SNP	ENST00000264852.4	37	CCDS2974.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.853469	0.32791	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.20332	2.08;2.08	5.47	4.48	0.54585	.	0.201588	0.33732	N	0.004620	T	0.03959	0.0111	N	0.00483	-1.445	0.29613	N	0.846758	B;B	0.02656	0.0;0.0	B;B	0.09377	0.002;0.004	T	0.41215	-0.9521	10	0.02654	T	1	-3.2009	4.2818	0.10836	0.3042:0.0:0.6958:0.0	.	775;770	Q9NXL6-2;Q9NXL6	.;SIDT1_HUMAN	E	770;775	ENSP00000264852:G770E;ENSP00000377416:G775E	ENSP00000264852:G770E	G	+	2	0	SIDT1	114827640	1.000000	0.71417	0.999000	0.59377	0.357000	0.29423	6.035000	0.70940	2.565000	0.86533	0.655000	0.94253	GGA		SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317564.1	NM_017699	Missense_Mutation
TMEM108	66000	broad.mit.edu	37	3	133099131	133099131	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr3:133099131G>A	ENST00000321871.6	+	4	786	c.576G>A	c.(574-576)agG>agA	p.R192R	TMEM108_ENST00000515826.1_Silent_p.R192R|TMEM108_ENST00000508711.1_Intron|TMEM108_ENST00000393130.3_Silent_p.R192R	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	192						integral component of membrane (GO:0016021)		p.R192R(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						GCCACTCCAGGAGTAAAGAAG	0.602																																					p.R192R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G576A	3						.						32.0	34.0	33.0					3																	133099131		2203	4300	6503	134581821	SO:0001819	synonymous_variant	66000	exon4			AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.576G>A	3.37:g.133099131G>A		Somatic		Capture	Illumina HiSeq	Phase_I	134581821	NM_001136469	D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Silent	SNP	ENST00000321871.6	37	CCDS33858.1																																																																																				TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356907.2	NM_023943	
HACL1	26061	broad.mit.edu	37	3	15616515	15616515	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr3:15616515G>A	ENST00000321169.5	-	10	1245	c.878C>T	c.(877-879)cCa>cTa	p.P293L	HACL1_ENST00000435217.2_Intron|HACL1_ENST00000456194.2_Missense_Mutation_p.P266L|HACL1_ENST00000451445.2_Missense_Mutation_p.P211L|HACL1_ENST00000457447.2_Missense_Mutation_p.P267L	NM_012260.2	NP_036392.2	Q9UJ83	HACL1_HUMAN	2-hydroxyacyl-CoA lyase 1	293					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carbon-carbon lyase activity (GO:0016830)|cofactor binding (GO:0048037)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|receptor binding (GO:0005102)|thiamine pyrophosphate binding (GO:0030976)	p.P293L(1)		NS(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	16						CTGATATCTTGGAGGCAGTCC	0.348																																					p.P293L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C878T	3						.						78.0	78.0	78.0					3																	15616515		2203	4300	6503	15591519	SO:0001583	missense	26061	exon10			AJ131753	CCDS2627.1, CCDS68360.1, CCDS68361.1, CCDS68362.1	3p24.3	2009-01-14	2006-05-16	2006-05-16	ENSG00000131373	ENSG00000131373	4.1.-.-		17856	protein-coding gene	gene with protein product		604300	"""2-hydroxyphytanoyl-CoA lyase"""	HPCL		10468558, 15644336	Standard	NM_001284416		Approved	2-HPCL, PHYH2	uc003caf.3	Q9UJ83	OTTHUMG00000129862	ENST00000321169.5:c.878C>T	3.37:g.15616515G>A	ENSP00000323811:p.Pro293Leu	Somatic		Capture	Illumina HiSeq	Phase_I	15591519	NM_012260	B4DWI1|B4DXI5|E9PEN4|Q9BV42|Q9P0A2	Missense_Mutation	SNP	ENST00000321169.5	37	CCDS2627.1	.	.	.	.	.	.	.	.	.	.	G	32	5.160929	0.94727	.	.	ENSG00000131373	ENST00000321169;ENST00000451445;ENST00000456194;ENST00000457447	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.47	5.47	0.80525	Thiamine pyrophosphate enzyme, central domain (1);	0.000000	0.85682	D	0.000000	T	0.75191	0.3816	M	0.93594	3.435	0.80722	D	1	D;D;D;D	0.89917	0.976;1.0;1.0;1.0	P;D;D;D	0.97110	0.881;1.0;1.0;1.0	T	0.81720	-0.0804	10	0.87932	D	0	.	19.6916	0.96005	0.0:0.0:1.0:0.0	.	211;267;266;293	B4DXI5;E9PEN4;B4DWI1;Q9UJ83	.;.;.;HACL1_HUMAN	L	293;211;266;267	ENSP00000323811:P293L;ENSP00000403656:P211L;ENSP00000390699:P266L;ENSP00000404883:P267L	ENSP00000323811:P293L	P	-	2	0	HACL1	15591519	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	9.731000	0.98807	2.717000	0.92951	0.650000	0.86243	CCA		HACL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252104.3	NM_012260	
TRIM42	287015	broad.mit.edu	37	3	140401469	140401470	+	Nonsense_Mutation	DNP	CC	CC	AA	rs138358928	byFrequency	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	CC	CC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr3:140401469_140401470CC>AA	ENST00000286349.3	+	2	698_699	c.507_508CC>AA	c.(505-510)tgCCtg>tgAAtg	p.169_170CL>*M		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	169						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.C169>?(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GCGAGAAGTGCCTGCGGCAGCT	0.599																																					.												.	.	1	Complex(1)	large_intestine(1)	c.507_508AA	3						.																																			141884160	SO:0001587	stop_gained	287015	exon2			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	Exception_encountered	3.37:g.140401469_140401470delinsAA	ENSP00000286349:p.C169_L170delins*M	Somatic		Capture	Illumina HiSeq	Phase_I	141884159	NM_152616	A1L4B4|Q8N832|Q8NDL3	Nonsense_Mutation	DNP	ENST00000286349.3	37	CCDS3113.1																																																																																				TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	
PIK3CA	5290	broad.mit.edu	37	3	178916876	178916876	+	Missense_Mutation	SNP	G	G	A	rs121913287		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr3:178916876G>A	ENST00000263967.3	+	2	420	c.263G>A	c.(262-264)cGa>cAa	p.R88Q		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	88	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.		R -> Q (in MCAP; also found in a glioblastoma multiforme sample; may disrupt the interaction between the PI3K- ABD domain and the N-terminal lobe of PI3K/PI4K kinase domain possibly affecting the conformation of the kinase domain). {ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.R88Q(53)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAAACAAGACGACTTTGTGAC	0.363	R88Q(JHUEM1_ENDOMETRIUM)|R88Q(SKUT1_SOFT_TISSUE)|R88Q(SNGM_ENDOMETRIUM)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.R88Q	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,central_nervous_system,brain,Substitution - Missense,0 	.	53	Substitution - Missense(53)	endometrium(27)|large_intestine(13)|central_nervous_system(8)|cervix(3)|soft_tissue(1)|breast(1)	c.G263A	3						.						107.0	102.0	104.0					3																	178916876		1821	4078	5899	180399570	SO:0001583	missense	5290	exon2				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.263G>A	3.37:g.178916876G>A	ENSP00000263967:p.Arg88Gln	Somatic		Capture	Illumina HiSeq	Phase_I	180399570	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971870	0.92919	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.80033	-1.33;-1.33	5.44	5.44	0.79542	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	D	0.89079	0.6613	M	0.72353	2.195	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	D	0.88404	0.3017	9	.	.	.	-14.8194	19.2635	0.93977	0.0:0.0:1.0:0.0	.	88	P42336	PK3CA_HUMAN	Q	88	ENSP00000263967:R88Q;ENSP00000417479:R88Q	.	R	+	2	0	PIK3CA	180399570	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.571000	0.82399	2.547000	0.85894	0.555000	0.69702	CGA		PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
PIK3CA	5290	broad.mit.edu	37	3	178921567	178921567	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr3:178921567A>G	ENST00000263967.3	+	5	1206	c.1049A>G	c.(1048-1050)gAc>gGc	p.D350G		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	350	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.D350G(2)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATATTCGAGACATTGATAAG	0.299		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.D350G	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,central_nervous_system,brain,Substitution - Missense,+1 	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1049G	3						.						58.0	58.0	58.0					3																	178921567		1805	4073	5878	180404261	SO:0001583	missense	5290	exon5				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1049A>G	3.37:g.178921567A>G	ENSP00000263967:p.Asp350Gly	Somatic		Capture	Illumina HiSeq	Phase_I	180404261	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.180265	0.78677	.	.	ENSG00000121879	ENST00000263967	T	0.70164	-0.46	5.41	5.41	0.78517	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.73001	0.3531	M	0.65498	2.005	0.80722	D	1	P	0.42010	0.768	P	0.48952	0.596	T	0.71859	-0.4465	10	0.33141	T	0.24	-23.1794	15.721	0.77710	1.0:0.0:0.0:0.0	.	350	P42336	PK3CA_HUMAN	G	350	ENSP00000263967:D350G	ENSP00000263967:D350G	D	+	2	0	PIK3CA	180404261	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.851000	0.92205	2.166000	0.68216	0.402000	0.26972	GAC		PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
CHL1	10752	broad.mit.edu	37	3	402006	402006	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr3:402006T>A	ENST00000256509.2	+	12	1847	c.1205T>A	c.(1204-1206)aTc>aAc	p.I402N	CHL1_ENST00000397491.2_Missense_Mutation_p.I386N	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.I402N(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CCCAGGGAAATCAGTTTTACC	0.388																																					p.I402N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1205A	3						.						184.0	174.0	177.0					3																	402006		2203	4300	6503	377006	SO:0001583	missense	10752	exon12			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.1205T>A	3.37:g.402006T>A	ENSP00000256509:p.Ile402Asn	Somatic		Capture	Illumina HiSeq	Phase_I	377006	NM_006614	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	T	15.77	2.930196	0.52866	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	D;D	0.82619	-1.63;-1.63	5.16	5.16	0.70880	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.177149	0.47093	D	0.000246	D	0.91573	0.7338	M	0.87097	2.86	0.52099	D	0.999943	D;D;D	0.89917	1.0;1.0;0.992	D;D;D	0.77557	0.99;0.99;0.921	D	0.92939	0.6370	10	0.87932	D	0	.	13.5121	0.61519	0.0:0.0:0.0:1.0	.	386;386;402	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	N	402;386	ENSP00000256509:I402N;ENSP00000380628:I386N	ENSP00000256509:I402N	I	+	2	0	CHL1	377006	1.000000	0.71417	0.993000	0.49108	0.272000	0.26649	4.475000	0.60210	2.062000	0.61559	0.533000	0.62120	ATC		CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
CDCP1	64866	broad.mit.edu	37	3	45160026	45160026	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr3:45160026T>C	ENST00000296129.1	-	2	304	c.170A>G	c.(169-171)tAc>tGc	p.Y57C	CDCP1_ENST00000490471.1_5'UTR|CDCP1_ENST00000425231.2_Missense_Mutation_p.Y57C	NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	57						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Y57C(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		AATGACGATGTAACAGGGTTT	0.433																																					p.Y57C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A170G	3						.						113.0	114.0	114.0					3																	45160026		2203	4300	6503	45135030	SO:0001583	missense	64866	exon2			AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.170A>G	3.37:g.45160026T>C	ENSP00000296129:p.Tyr57Cys	Somatic		Capture	Illumina HiSeq	Phase_I	45135030	NM_022842	Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Missense_Mutation	SNP	ENST00000296129.1	37	CCDS2727.1	.	.	.	.	.	.	.	.	.	.	T	6.978	0.550392	0.13374	.	.	ENSG00000163814	ENST00000296129;ENST00000425231	T;T	0.44083	1.93;0.93	5.33	4.15	0.48705	.	0.802333	0.11979	N	0.510931	T	0.37865	0.1019	L	0.46157	1.445	0.09310	N	1	P;P	0.42908	0.793;0.793	B;P	0.45610	0.386;0.487	T	0.30031	-0.9992	10	0.39692	T	0.17	.	2.5785	0.04812	0.2521:0.0715:0.1311:0.5453	.	57;57	Q9H5V8-3;Q9H5V8	.;CDCP1_HUMAN	C	57	ENSP00000296129:Y57C;ENSP00000399342:Y57C	ENSP00000296129:Y57C	Y	-	2	0	CDCP1	45135030	0.352000	0.24895	0.257000	0.24404	0.010000	0.07245	0.816000	0.27267	1.016000	0.39470	0.459000	0.35465	TAC		CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256748.3	NM_022842	
FGF12	2257	broad.mit.edu	37	3	192125854	192125854	+	Silent	SNP	G	G	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr3:192125854G>T	ENST00000454309.2	-	1	984	c.159C>A	c.(157-159)cgC>cgA	p.R53R	FGF12_ENST00000430714.1_Intron|FGF12_ENST00000445105.2_Intron|FGF12_ENST00000450716.1_Intron|FGF12_ENST00000264730.3_Intron	NM_021032.4	NP_066360.1	P61328	FGF12_HUMAN	fibroblast growth factor 12	53					adult locomotory behavior (GO:0008344)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell-cell signaling (GO:0007267)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|JNK cascade (GO:0007254)|negative regulation of cation channel activity (GO:2001258)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|regulation of membrane depolarization (GO:0003254)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)	p.R53R(1)		endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		CGCTGCAGAAGCGCACTTTGC	0.672																																					p.R53R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C159A	3						.						76.0	88.0	84.0					3																	192125854		2196	4266	6462	193608548	SO:0001819	synonymous_variant	2257	exon1			U66197	CCDS3301.1, CCDS46983.1	3q28	2008-07-18			ENSG00000114279	ENSG00000114279			3668	protein-coding gene	gene with protein product	"""fibroblast growth factor 12B"", ""fibroblast growth factor homologous factor 1"", ""myocyte-activating factor"", ""fibroblast growth factor FGF-12b"""	601513		FGF12B		8790420, 9345906	Standard	NM_021032		Approved	FHF1	uc003fsx.3	P61328	OTTHUMG00000156132	ENST00000454309.2:c.159C>A	3.37:g.192125854G>T		Somatic		Capture	Illumina HiSeq	Phase_I	193608548	NM_021032	B2R6B7|B2R976|O35339|P70376|Q8TBG5|Q92912|Q93001	Silent	SNP	ENST00000454309.2	37	CCDS3301.1																																																																																				FGF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343160.1	NM_021032	
PCDH10	57575	broad.mit.edu	37	4	134073878	134073878	+	Silent	SNP	C	C	T	rs111442577		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr4:134073878C>T	ENST00000264360.5	+	1	3409	c.2583C>T	c.(2581-2583)acC>acT	p.T861T		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	861					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T861T(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CCGGTTACACCGACCAGCAGC	0.562																																					p.T861T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2583T	4						.						84.0	81.0	82.0					4																	134073878		2203	4300	6503	134293328	SO:0001819	synonymous_variant	57575	exon1			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2583C>T	4.37:g.134073878C>T		Somatic		Capture	Illumina HiSeq	Phase_I	134293328	NM_032961	Q4W5F6|Q96SF0	Silent	SNP	ENST00000264360.5	37	CCDS34063.1																																																																																				PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
PCDH18	54510	broad.mit.edu	37	4	138449652	138449652	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr4:138449652G>A	ENST00000344876.4	-	3	3106	c.2720C>T	c.(2719-2721)aCa>aTa	p.T907I	PCDH18_ENST00000507846.1_Missense_Mutation_p.T686I|PCDH18_ENST00000412923.2_Missense_Mutation_p.T906I|PCDH18_ENST00000510305.1_Missense_Mutation_p.T118I|PCDH18_ENST00000511115.1_Missense_Mutation_p.T87I	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	907	Interaction with DAB1. {ECO:0000250}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T907I(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					TCTTCCATCTGTGAGAAACAG	0.438																																					p.T907I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2720T	4						.						154.0	170.0	164.0					4																	138449652		2203	4300	6503	138669102	SO:0001583	missense	54510	exon3			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.2720C>T	4.37:g.138449652G>A	ENSP00000355082:p.Thr907Ile	Somatic		Capture	Illumina HiSeq	Phase_I	138669102	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	37	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	G	16.60	3.167887	0.57476	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846;ENST00000510305;ENST00000511115	T;T;T;T;T	0.55760	0.59;0.6;0.5;1.45;1.45	5.56	5.56	0.83823	.	0.000000	0.44483	D	0.000441	T	0.44932	0.1317	L	0.40543	1.245	0.39474	D	0.967771	B;B;B;B	0.28291	0.206;0.035;0.148;0.164	B;B;B;B	0.27715	0.076;0.018;0.037;0.082	T	0.47623	-0.9103	10	0.59425	D	0.04	.	12.8198	0.57685	0.0744:0.0:0.9256:0.0	.	87;686;906;907	B4DLR6;D6RIG4;Q9HCL0-2;Q9HCL0	.;.;.;PCD18_HUMAN	I	907;906;686;118;87	ENSP00000355082:T907I;ENSP00000390688:T906I;ENSP00000425903:T686I;ENSP00000424269:T118I;ENSP00000425647:T87I	ENSP00000355082:T907I	T	-	2	0	PCDH18	138669102	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	4.376000	0.59556	2.607000	0.88179	0.655000	0.94253	ACA		PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
NR3C2	4306	broad.mit.edu	37	4	149357973	149357973	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr4:149357973C>T	ENST00000358102.3	-	2	402	c.40G>A	c.(40-42)Gat>Aat	p.D14N	NR3C2_ENST00000512865.1_Missense_Mutation_p.D14N|NR3C2_ENST00000344721.4_Missense_Mutation_p.D14N|NR3C2_ENST00000511528.1_Missense_Mutation_p.D14N|NR3C2_ENST00000355292.3_Missense_Mutation_p.D14N	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	14	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.D14N(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	CTTTCCATATCTAGACCTTCA	0.418																																					p.D14N	Melanoma(27;428 957 40335 51025 51111)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G40A	4						.						68.0	60.0	62.0					4																	149357973		2203	4300	6503	149577423	SO:0001583	missense	4306	exon2			M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.40G>A	4.37:g.149357973C>T	ENSP00000350815:p.Asp14Asn	Somatic		Capture	Illumina HiSeq	Phase_I	149577423	NM_001166104	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	ENST00000358102.3	37	CCDS3772.1	.	.	.	.	.	.	.	.	.	.	C	13.23	2.175245	0.38413	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000544252;ENST00000342437;ENST00000511528	D;D;D;D;D;D	0.90563	-2.69;-2.69;-2.69;-2.33;-2.32;-2.69	6.02	6.02	0.97574	.	0.098065	0.64402	D	0.000002	D	0.83866	0.5347	L	0.27053	0.805	0.46241	D	0.99894	B;B	0.10296	0.003;0.001	B;B	0.08055	0.003;0.001	T	0.77225	-0.2666	9	.	.	.	.	13.7	0.62602	0.0:0.93:0.0:0.07	.	14;14	B0ZBF5;B0ZBF6	.;.	N	14	ENSP00000341390:D14N;ENSP00000347441:D14N;ENSP00000350815:D14N;ENSP00000423510:D14N;ENSP00000343907:D14N;ENSP00000421481:D14N	.	D	-	1	0	NR3C2	149577423	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.061000	0.49963	2.865000	0.98341	0.655000	0.94253	GAT		NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
FBXW7	55294	broad.mit.edu	37	4	153249385	153249385	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr4:153249385G>A	ENST00000281708.4	-	9	2622	c.1393C>T	c.(1393-1395)Cgt>Tgt	p.R465C	FBXW7_ENST00000603841.1_Missense_Mutation_p.R465C|FBXW7_ENST00000603548.1_Missense_Mutation_p.R465C|FBXW7_ENST00000393956.3_Missense_Mutation_p.R289C|FBXW7_ENST00000296555.5_Missense_Mutation_p.R347C|FBXW7_ENST00000263981.5_Missense_Mutation_p.R385C	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	465			R -> C (in a acute lymphoblastic leukemia cell line). {ECO:0000269|PubMed:11565033}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R465C(71)|p.R226C(11)|p.R385C(11)|p.R347C(3)|p.R465Y(2)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGCATACAACGCACAGTGGAA	0.413			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R385C			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,large_intestine,NS,Substitution - Missense,+1 	.	99	Substitution - Missense(98)|Unknown(1)	haematopoietic_and_lymphoid_tissue(41)|large_intestine(27)|endometrium(20)|stomach(6)|biliary_tract(4)|pancreas(1)	c.C1153T	4						.						260.0	223.0	235.0					4																	153249385		2203	4300	6503	153468835	SO:0001583	missense	55294	exon8			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1393C>T	4.37:g.153249385G>A	ENSP00000281708:p.Arg465Cys	Somatic		Capture	Illumina HiSeq	Phase_I	153468835	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909959	0.92107	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	6.05	6.05	0.98169	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.67287	0.2877	M	0.71206	2.165	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.67130	-0.5748	10	0.87932	D	0	-17.2313	20.6013	0.99457	0.0:0.0:1.0:0.0	.	289;465;347;385	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	C	465;347;385;289	ENSP00000281708:R465C;ENSP00000296555:R347C;ENSP00000263981:R385C;ENSP00000377528:R289C	ENSP00000263981:R385C	R	-	1	0	FBXW7	153468835	1.000000	0.71417	0.959000	0.39883	0.996000	0.88848	9.869000	0.99810	2.878000	0.98634	0.650000	0.86243	CGT		FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
GRIA2	2891	broad.mit.edu	37	4	158254083	158254083	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr4:158254083C>A	ENST00000264426.9	+	7	1274	c.995C>A	c.(994-996)gCa>gAa	p.A332E	GRIA2_ENST00000507898.1_Missense_Mutation_p.A285E|GRIA2_ENST00000393815.2_Missense_Mutation_p.A285E|GRIA2_ENST00000449365.1_Missense_Mutation_p.A285E|GRIA2_ENST00000296526.7_Missense_Mutation_p.A332E	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	332					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.A332E(2)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GACTGTCTGGCAAACCCAGCA	0.473																																					p.A285E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C854A	4						.						59.0	66.0	64.0					4																	158254083		2203	4299	6502	158473533	SO:0001583	missense	2891	exon7				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.995C>A	4.37:g.158254083C>A	ENSP00000264426:p.Ala332Glu	Somatic		Capture	Illumina HiSeq	Phase_I	158473533	NM_001083620	A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	37	CCDS43274.1	.	.	.	.	.	.	.	.	.	.	C	31	5.068796	0.93950	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	T;T;T;T;T	0.12879	2.64;2.64;2.69;2.69;2.64	5.09	5.09	0.68999	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.39036	0.1063	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.81914	0.973;0.99;0.995	T	0.24657	-1.0154	10	0.72032	D	0.01	.	18.4737	0.90783	0.0:1.0:0.0:0.0	.	332;332;285	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	E	285;285;332;332;285	ENSP00000426845:A285E;ENSP00000377403:A285E;ENSP00000296526:A332E;ENSP00000264426:A332E;ENSP00000389837:A285E	ENSP00000264426:A332E	A	+	2	0	GRIA2	158473533	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	7.818000	0.86416	2.341000	0.79615	0.557000	0.71058	GCA		GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
PCDH7	5099	broad.mit.edu	37	4	30725307	30725307	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr4:30725307C>T	ENST00000361762.2	+	1	3271	c.2263C>T	c.(2263-2265)Cct>Tct	p.P755S	PCDH7_ENST00000543491.1_Missense_Mutation_p.P755S	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	755	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P708S(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						TTTACTGCCACCTTCGAGTAA	0.458																																					p.P755S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2263T	4						.						79.0	73.0	75.0					4																	30725307		2203	4300	6503	30334405	SO:0001583	missense	5099	exon1			AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2263C>T	4.37:g.30725307C>T	ENSP00000355243:p.Pro755Ser	Somatic		Capture	Illumina HiSeq	Phase_I	30334405	NM_032456	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.52|17.52	3.409851|3.409851	0.62399|0.62399	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135|ENST00000511884	T;T|.	0.38722|.	1.12;1.12|.	5.04|5.04	5.04|5.04	0.67666|0.67666	Cadherin (2);Cadherin-like (1);|.	.|.	.|.	.|.	.|.	T|T	0.74481|0.74481	0.3722|0.3722	M|M	0.67397|0.67397	2.05|2.05	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.81914|.	0.991;0.991;0.995|.	T|T	0.73347|0.73347	-0.4011|-0.4011	9|5	0.56958|.	D|.	0.05|.	.|.	18.588|18.588	0.91197|0.91197	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	755;708;755|.	F5GWJ1;O60245-3;O60245|.	.;.;PCDH7_HUMAN|.	S|I	755;755;708|444	ENSP00000355243:P755S;ENSP00000441802:P755S|.	ENSP00000330302:P708S|.	P|T	+|+	1|2	0|0	PCDH7|PCDH7	30334405|30334405	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.647000|7.647000	0.83462|0.83462	2.612000|2.612000	0.88384|0.88384	0.655000|0.655000	0.94253|0.94253	CCT|ACC		PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
DCAF4L1	285429	broad.mit.edu	37	4	41984905	41984905	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr4:41984905G>A	ENST00000333141.5	+	1	1193	c.1096G>A	c.(1096-1098)Gtg>Atg	p.V366M		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	366								p.V366M(1)		breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						CATTCCCAGCGTGGCCTTCGC	0.612																																					p.V366M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1096A	4						.						65.0	60.0	61.0					4																	41984905		2203	4300	6503	41679662	SO:0001583	missense	285429	exon1			BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.1096G>A	4.37:g.41984905G>A	ENSP00000327796:p.Val366Met	Somatic		Capture	Illumina HiSeq	Phase_I	41679662	NM_001029955	B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Missense_Mutation	SNP	ENST00000333141.5	37	CCDS33978.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.398454	0.62177	.	.	ENSG00000182308	ENST00000333141	T	0.57273	0.41	0.97	0.97	0.19692	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.062767	0.64402	D	0.000006	T	0.55561	0.1928	M	0.76838	2.35	0.37568	D	0.919315	D	0.71674	0.998	P	0.49226	0.603	T	0.63954	-0.6520	10	0.66056	D	0.02	.	7.7469	0.28875	1.0E-4:0.0:0.9999:0.0	.	366	Q3SXM0	DC4L1_HUMAN	M	366	ENSP00000327796:V366M	ENSP00000327796:V366M	V	+	1	0	DCAF4L1	41679662	1.000000	0.71417	0.501000	0.27601	0.647000	0.38526	4.527000	0.60573	0.821000	0.34540	0.313000	0.20887	GTG		DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360958.1	NM_001029955	
KIAA1211	57482	broad.mit.edu	37	4	57181615	57181615	+	Silent	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr4:57181615C>T	ENST00000504228.1	+	6	2052	c.1947C>T	c.(1945-1947)agC>agT	p.S649S	KIAA1211_ENST00000541073.1_Silent_p.S642S|KIAA1211_ENST00000264229.6_Silent_p.S649S			Q6ZU35	K1211_HUMAN	KIAA1211	649								p.S649S(1)		endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					GGGCGGGCAGCGGGAAGGCTA	0.677																																					p.S649S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1947T	4						.						15.0	19.0	18.0					4																	57181615		1906	4085	5991	56876372	SO:0001819	synonymous_variant	57482	exon8			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1947C>T	4.37:g.57181615C>T		Somatic		Capture	Illumina HiSeq	Phase_I	56876372	NM_020722	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	ENST00000504228.1	37	CCDS43230.1																																																																																				KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
UGT2B28	54490	broad.mit.edu	37	4	70155427	70155427	+	Silent	SNP	C	C	G			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr4:70155427C>G	ENST00000335568.5	+	4	1049	c.1047C>G	c.(1045-1047)ctC>ctG	p.L349L	UGT2B28_ENST00000511240.1_Intron	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	349					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.L349L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						CCTTAGGTCTCAATACTCGGC	0.363																																					p.L349L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1047G	4						.						105.0	137.0	126.0					4																	70155427		1490	2705	4195	70190016	SO:0001819	synonymous_variant	54490	exon4			AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.1047C>G	4.37:g.70155427C>G		Somatic		Capture	Illumina HiSeq	Phase_I	70190016	NM_053039	B5BUM0|Q9BY62|Q9BY63	Silent	SNP	ENST00000335568.5	37	CCDS3528.1																																																																																				UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039	
RASGEF1B	153020	broad.mit.edu	37	4	82355822	82355822	+	Missense_Mutation	SNP	G	G	A	rs373675008		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr4:82355822G>A	ENST00000264400.2	-	11	1322	c.1171C>T	c.(1171-1173)Cgc>Tgc	p.R391C	RASGEF1B_ENST00000509081.1_Missense_Mutation_p.R390C|RASGEF1B_ENST00000335927.7_Missense_Mutation_p.R349C	NM_152545.1	NP_689758.1	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B	391	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	endosome (GO:0005768)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.R391C(1)		endometrium(2)|kidney(5)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	26						TTGGGAAGGCGGTTGGCACAA	0.443																																					p.R391C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1171T	4						.	G	CYS/ARG	0,4406		0,0,2203	77.0	71.0	73.0		1171	4.5	1.0	4		73	1,8599	1.2+/-3.3	0,1,4299	no	missense	RASGEF1B	NM_152545.1	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	391/474	82355822	1,13005	2203	4300	6503	82574846	SO:0001583	missense	153020	exon11			AK056257	CCDS34022.1, CCDS75151.1, CCDS75152.1	4q21.21	2013-09-24				ENSG00000138670			24881	protein-coding gene	gene with protein product		614532				12488504	Standard	XM_005262776		Approved	GPIG4, FLJ31695	uc003hmi.1	Q0VAM2		ENST00000264400.2:c.1171C>T	4.37:g.82355822G>A	ENSP00000264400:p.Arg391Cys	Somatic		Capture	Illumina HiSeq	Phase_I	82574846	NM_152545	Q0VAM1|Q4W5L7|Q4W5M3|Q96MY8	Missense_Mutation	SNP	ENST00000264400.2	37	CCDS34022.1	.	.	.	.	.	.	.	.	.	.	G	18.68	3.675155	0.67928	0.0	1.16E-4	ENSG00000138670	ENST00000509081;ENST00000264400;ENST00000335927	T;T;T	0.30981	1.51;1.51;1.51	4.46	4.46	0.54185	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine-nucleotide exchange factor, conserved site (1);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.50205	0.1602	L	0.60455	1.87	0.80722	D	1	D;P;D	0.76494	0.999;0.874;0.999	D;B;D	0.67725	0.947;0.272;0.953	T	0.46569	-0.9182	10	0.39692	T	0.17	.	16.8923	0.86090	0.0:0.0:1.0:0.0	.	349;390;391	Q0VAM2-2;Q0VAM2-3;Q0VAM2	.;.;RGF1B_HUMAN	C	390;391;349	ENSP00000425393:R390C;ENSP00000264400:R391C;ENSP00000338437:R349C	ENSP00000264400:R391C	R	-	1	0	RASGEF1B	82574846	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.830000	0.55768	2.327000	0.79052	0.460000	0.39030	CGC		RASGEF1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362830.1	NM_152545	
THAP9	79725	broad.mit.edu	37	4	83839779	83839779	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr4:83839779G>A	ENST00000302236.5	+	5	2465	c.2414G>A	c.(2413-2415)tGt>tAt	p.C805Y	LIN54_ENST00000505905.1_Intron	NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	805					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)	p.C805Y(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				AAAATATTATGTGAGCTTTCT	0.333																																					p.C805Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2414A	4						.						66.0	68.0	68.0					4																	83839779		2203	4299	6502	84058803	SO:0001583	missense	79725	exon5			AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.2414G>A	4.37:g.83839779G>A	ENSP00000305533:p.Cys805Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	84058803	NM_024672	B3KRE2|Q59AC9	Missense_Mutation	SNP	ENST00000302236.5	37	CCDS3598.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.148131	0.00029	.	.	ENSG00000168152	ENST00000302236;ENST00000536314	D	0.90197	-2.63	4.11	-6.3	0.02007	.	3.343260	0.00725	N	0.000911	D	0.82356	0.5019	N	0.22421	0.69	0.09310	N	0.999994	B	0.02656	0.0	B	0.01281	0.0	T	0.74237	-0.3730	10	0.02654	T	1	4.5649	16.0995	0.81163	0.8394:0.0:0.1606:0.0	.	805	Q9H5L6	THAP9_HUMAN	Y	805	ENSP00000305533:C805Y	ENSP00000305533:C805Y	C	+	2	0	THAP9	84058803	0.001000	0.12720	0.000000	0.03702	0.463000	0.32649	-0.306000	0.08178	-1.573000	0.01659	-0.783000	0.03347	TGT		THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252633.1	NM_024672	
HERC5	51191	broad.mit.edu	37	4	89408247	89408247	+	Missense_Mutation	SNP	G	G	A	rs148569726		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr4:89408247G>A	ENST00000264350.3	+	15	2032	c.1879G>A	c.(1879-1881)Gtc>Atc	p.V627I	HERC5_ENST00000508159.1_Missense_Mutation_p.V265I	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	627					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.V627I(1)		NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		ACAATGCTGCGTCATATTCAG	0.318																																					p.V627I	Esophageal Squamous(39;887 1012 34045 50514)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1879A	4						.	G	ILE/VAL	0,4406		0,0,2203	95.0	94.0	95.0		1879	2.3	0.0	4	dbSNP_134	95	1,8595	1.2+/-3.3	0,1,4297	yes	missense	HERC5	NM_016323.2	29	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	benign	627/1025	89408247	1,13001	2203	4298	6501	89627270	SO:0001583	missense	51191	exon15			AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.1879G>A	4.37:g.89408247G>A	ENSP00000264350:p.Val627Ile	Somatic		Capture	Illumina HiSeq	Phase_I	89627270	NM_016323	B2RTQ1|Q69G20	Missense_Mutation	SNP	ENST00000264350.3	37	CCDS3630.1	.	.	.	.	.	.	.	.	.	.	G	4.111	0.018804	0.07959	0.0	1.16E-4	ENSG00000138646	ENST00000264350;ENST00000508159	T;T	0.76186	-1.0;-1.0	4.09	2.27	0.28462	.	0.367489	0.22051	N	0.065309	T	0.62221	0.2410	L	0.49126	1.545	0.09310	N	1	P	0.43431	0.807	B	0.38156	0.266	T	0.51212	-0.8734	10	0.20046	T	0.44	.	8.6252	0.33886	0.0:0.1667:0.6608:0.1724	.	627	Q9UII4	HERC5_HUMAN	I	627;265	ENSP00000264350:V627I;ENSP00000424129:V265I	ENSP00000264350:V627I	V	+	1	0	HERC5	89627270	0.973000	0.33851	0.034000	0.17996	0.001000	0.01503	1.982000	0.40638	0.634000	0.30469	-0.293000	0.09583	GTC		HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	NM_016323	
ASB5	140458	broad.mit.edu	37	4	177190238	177190238	+	Missense_Mutation	SNP	G	G	A	rs200442347	byFrequency	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr4:177190238G>A	ENST00000296525.3	-	1	135	c.22C>T	c.(22-24)Cgg>Tgg	p.R8W		NM_080874.3	NP_543150.1	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box containing 5	8					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.R8W(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(18)|prostate(2)|skin(2)	34		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		GCAAACGGCCGATTTTCTTCT	0.443																																					p.R8W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C22T	4						.						80.0	76.0	78.0					4																	177190238		2203	4300	6503	177427232	SO:0001583	missense	140458	exon1			AY057053	CCDS3827.1	4q34.1	2013-01-10	2011-01-25		ENSG00000164122	ENSG00000164122		"""Ankyrin repeat domain containing"""	17180	protein-coding gene	gene with protein product		615050	"""ankyrin repeat and SOCS box-containing 5"""				Standard	NM_080874		Approved		uc003iuq.2	Q8WWX0	OTTHUMG00000160793	ENST00000296525.3:c.22C>T	4.37:g.177190238G>A	ENSP00000296525:p.Arg8Trp	Somatic		Capture	Illumina HiSeq	Phase_I	177427232	NM_080874	Q8N7B5	Missense_Mutation	SNP	ENST00000296525.3	37	CCDS3827.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.726655	0.69074	.	.	ENSG00000164122	ENST00000296525;ENST00000505299	T	0.44881	0.91	5.57	5.57	0.84162	.	0.252420	0.37809	N	0.001921	T	0.52386	0.1731	L	0.36672	1.1	0.54753	D	0.999981	D	0.76494	0.999	P	0.58970	0.849	T	0.53947	-0.8366	10	0.87932	D	0	-26.3287	17.7463	0.88422	0.0:0.0:1.0:0.0	.	8	Q8WWX0	ASB5_HUMAN	W	8	ENSP00000296525:R8W	ENSP00000296525:R8W	R	-	1	2	ASB5	177427232	1.000000	0.71417	0.637000	0.29366	0.312000	0.27988	4.628000	0.61282	2.630000	0.89119	0.591000	0.81541	CGG		ASB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362344.1		
PCDHGA6	56109	broad.mit.edu	37	5	140753720	140753721	+	Frame_Shift_Ins	INS	-	-	G	rs376984494		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr5:140753720_140753721insG	ENST00000517434.1	+	1	70_71	c.70_71insG	c.(70-72)tggfs	p.W24fs	PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	24					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGGACGCTGTGGGGGGCCGCG	0.619																																					p.W24fs												.	.	0			c.70_71insG	5						.		,,,,,,,,,	5,3839		0,5,1917					,,,,,,,,,	-0.2	0.2			17	1,8013		0,1,4006	no	frameshift,intron,intron,intron,frameshift,intron,intron,intron,intron,intron	PCDHGB3,PCDHGB2,PCDHGB1,PCDHGA6,PCDHGA5,PCDHGA4,PCDHGA3,PCDHGA2,PCDHGA1	NM_032086.1,NM_018924.2,NM_018923.2,NM_018922.2,NM_018919.2,NM_018918.2,NM_018917.2,NM_018916.3,NM_018915.2,NM_018912.2	,,,,,,,,,	0,6,5923	A1A1,A1R,RR		0.0125,0.1301,0.0506	,,,,,,,,,	,,,,,,,,,		6,11852				140733905	SO:0001589	frameshift_variant	56109	exon1			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.76dupG	5.37:g.140753726_140753726dupG	ENSP00000429601:p.Trp24fs	None		Capture	Illumina HiSeq	Phase_I	140733904	NM_032086	A6H8K7|B2RN55|Q9Y5D1	Frame_Shift_Ins	INS	ENST00000517434.1	37	CCDS54926.1																																																																																				PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919	
SLCO6A1	133482	broad.mit.edu	37	5	101834417	101834417	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr5:101834417G>A	ENST00000506729.1	-	1	303	c.132C>T	c.(130-132)ccC>ccT	p.P44P	SLCO6A1_ENST00000379810.1_Silent_p.P44P|SLCO6A1_ENST00000379807.3_Silent_p.P44P|SLCO6A1_ENST00000514551.1_5'Flank|RP11-58B2.1_ENST00000502494.1_RNA|SLCO6A1_ENST00000389019.3_Silent_p.P44P|SLCO6A1_ENST00000513675.1_Silent_p.P44P			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.P44P(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		GTTTTTTCCCGGGCTTCGAGG	0.572																																					p.P44P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C132T	5						.						133.0	150.0	144.0					5																	101834417		2203	4300	6503	101862316	SO:0001819	synonymous_variant	133482	exon1			AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.132C>T	5.37:g.101834417G>A		Somatic		Capture	Illumina HiSeq	Phase_I	101862316	NM_173488	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Silent	SNP	ENST00000506729.1	37	CCDS34206.1																																																																																				SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
APC	324	broad.mit.edu	37	5	112128143	112128143	+	Splice_Site	SNP	C	C	T	rs62619935		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr5:112128143C>T	ENST00000457016.1	+	7	1026	c.646C>T	c.(646-648)Cga>Tga	p.R216*	APC_ENST00000257430.4_Splice_Site_p.R216*|APC_ENST00000508376.2_Splice_Site_p.R216*			P25054	APC_HUMAN	adenomatous polyposis coli	216	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R216*(12)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTTATTTTAGCGAAGAATAGC	0.323		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R216X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	12	Substitution - Nonsense(12)	large_intestine(12)	c.C646T	5	GRCh37	CM992133	APC	M	rs62619935	.						52.0	51.0	51.0					5																	112128143		2202	4300	6502	112156042	SO:0001630	splice_region_variant	324	exon8	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.646-1C>T	5.37:g.112128143C>T		Somatic		Capture	Illumina HiSeq	Phase_I	112156042	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	39	7.466758	0.98302	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.19	2.99	0.34606	.	0.630262	0.16042	N	0.232387	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.2274	1.7088	0.02888	0.2899:0.3634:0.2259:0.1208	rs62619935	.	.	.	X	216	.	.	R	+	1	2	APC	112156042	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	0.662000	0.25038	1.304000	0.44892	-0.158000	0.13435	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	Nonsense_Mutation
RAPGEF6	51735	broad.mit.edu	37	5	130834287	130834287	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr5:130834287C>T	ENST00000509018.1	-	12	1473	c.1268G>A	c.(1267-1269)cGt>cAt	p.R423H	RAPGEF6_ENST00000308008.6_Missense_Mutation_p.R423H|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.R473H|RAPGEF6_ENST00000296859.6_Missense_Mutation_p.R423H|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.R423H|RAPGEF6_ENST00000510071.1_Missense_Mutation_p.R423H|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.R423H|RAPGEF6_ENST00000512052.1_Missense_Mutation_p.R138H	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	423	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)	p.R423H(2)|p.R473H(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		CATTATGAGACGCTCAGGTGT	0.348																																					p.R423H	Melanoma(168;435 1955 13113 13877 23213)											.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G1268A	5						.						70.0	74.0	73.0					5																	130834287		2203	4300	6503	130862186	SO:0001583	missense	51735	exon12			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.1268G>A	5.37:g.130834287C>T	ENSP00000421684:p.Arg423His	Somatic		Capture	Illumina HiSeq	Phase_I	130862186	NM_001164387	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	37	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	C	31	5.096264	0.94197	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000512052;ENST00000308008;ENST00000510071;ENST00000514667	T;T;T;T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41;1.41;1.41;1.41	5.46	5.46	0.80206	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.59985	0.2234	M	0.77103	2.36	0.80722	D	1	D;D;D;P;D;D;D	0.89917	1.0;1.0;1.0;0.933;1.0;0.987;1.0	D;D;D;P;D;P;D	0.97110	1.0;0.996;0.999;0.642;1.0;0.68;0.998	T	0.64076	-0.6492	10	0.87932	D	0	.	19.3031	0.94150	0.0:1.0:0.0:0.0	.	423;423;423;138;473;423;423	A3KN82;B7ZML2;Q8TEU7-2;D6RE77;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;.;RPGF6_HUMAN	H	423;423;423;423;423;138;423;423;473	ENSP00000421684:R423H;ENSP00000309298:R423H;ENSP00000426081:R423H;ENSP00000296859:R423H;ENSP00000426910:R138H;ENSP00000311419:R423H;ENSP00000425389:R423H;ENSP00000426948:R473H	ENSP00000426948:R473H	R	-	2	0	RAPGEF6;FNIP1	130862186	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.754000	0.68743	2.524000	0.85096	0.655000	0.94253	CGT		RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340	
SLC4A9	83697	broad.mit.edu	37	5	139745739	139745739	+	Missense_Mutation	SNP	C	C	T	rs200288269		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr5:139745739C>T	ENST00000230993.6	+	14	2010	c.1975C>T	c.(1975-1977)Cgc>Tgc	p.R659C	SLC4A9_ENST00000507527.1_Missense_Mutation_p.R659C|SLC4A9_ENST00000506757.2_Missense_Mutation_p.R635C|SLC4A9_ENST00000506545.1_Missense_Mutation_p.R572C|SLC4A9_ENST00000432095.2_Missense_Mutation_p.R621C	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	659	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)	p.R659C(1)|p.R633C(1)		endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCCAGGTGCGCAAAGGGCT	0.572																																					p.R635C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1903T	5						.	C	CYS/ARG	1,4249		0,1,2124	64.0	70.0	68.0		1903	3.5	0.9	5		68	1,8453		0,1,4226	yes	missense	SLC4A9	NM_031467.2	180	0,2,6350	TT,TC,CC		0.0118,0.0235,0.0157	probably-damaging	635/960	139745739	2,12702	2125	4227	6352	139725923	SO:0001583	missense	83697	exon14			AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	ENST00000230993.6:c.1975C>T	5.37:g.139745739C>T	ENSP00000230993:p.Arg659Cys	Somatic		Capture	Illumina HiSeq	Phase_I	139725923	NM_031467	B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Missense_Mutation	SNP	ENST00000230993.6	37	CCDS58973.1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.418373	0.42918	2.35E-4	1.18E-4	ENSG00000113073	ENST00000230993;ENST00000506757;ENST00000432095;ENST00000506545;ENST00000507527	D;D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16;-2.16	4.4	3.53	0.40419	Bicarbonate transporter, C-terminal (1);	0.000000	0.64402	D	0.000002	D	0.94165	0.8128	H	0.94423	3.535	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.999;0.999	D	0.93867	0.7159	10	0.87932	D	0	.	7.9961	0.30269	0.1571:0.7594:0.0:0.0835	.	572;659;621;635	E9PDK1;Q96Q91;Q96Q91-2;Q96Q91-3	.;B3A4_HUMAN;.;.	C	659;635;621;572;659	ENSP00000230993:R659C;ENSP00000424424:R635C;ENSP00000410056:R621C;ENSP00000422855:R572C;ENSP00000427661:R659C	ENSP00000230993:R659C	R	+	1	0	SLC4A9	139725923	0.684000	0.27642	0.933000	0.37362	0.207000	0.24258	1.240000	0.32731	1.442000	0.47568	0.561000	0.74099	CGC		SLC4A9-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372823.1	NM_031467	
PCDHA5	56143	broad.mit.edu	37	5	140203048	140203048	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr5:140203048C>T	ENST00000529859.1	+	1	1688	c.1688C>T	c.(1687-1689)gCg>gTg	p.A563V	PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.A563V|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.A563V|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	563	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A563V(2)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACGCGCCGGCGCTGCTGGTG	0.716																																					p.A563V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1688T	5						.						49.0	55.0	53.0					5																	140203048		2202	4297	6499	140183232	SO:0001583	missense	56143	exon1			AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1688C>T	5.37:g.140203048C>T	ENSP00000436557:p.Ala563Val	Somatic		Capture	Illumina HiSeq	Phase_I	140183232	NM_018908	O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	C	0.453	-0.892821	0.02491	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.34667	1.35;1.35;1.35	4.0	0.435	0.16544	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.09774	0.0240	N	0.01086	-1.025	0.09310	N	1	B;B;B	0.17038	0.008;0.02;0.016	B;B;B	0.15484	0.005;0.013;0.013	T	0.35051	-0.9804	9	0.12103	T	0.63	.	4.1093	0.10052	0.0:0.3937:0.1791:0.4272	.	563;563;563	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	V	563	ENSP00000433416:A563V;ENSP00000436557:A563V;ENSP00000367366:A563V	ENSP00000367366:A563V	A	+	2	0	PCDHA5	140183232	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-1.911000	0.01583	0.268000	0.21939	0.461000	0.40582	GCG		PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908	
PCDHB4	56131	broad.mit.edu	37	5	140503269	140503269	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr5:140503269G>A	ENST00000194152.1	+	1	1689	c.1689G>A	c.(1687-1689)ccG>ccA	p.P563P	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	563					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P563P(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCTGTACCCGCTGCAGAATG	0.711																																					p.P563P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1689A	5						.						21.0	24.0	23.0					5																	140503269		2192	4272	6464	140483453	SO:0001819	synonymous_variant	56131	exon1			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1689G>A	5.37:g.140503269G>A		Somatic		Capture	Illumina HiSeq	Phase_I	140483453	NM_018938	Q4V761	Silent	SNP	ENST00000194152.1	37	CCDS4246.1																																																																																				PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938	
PCDHB15	56121	broad.mit.edu	37	5	140625151	140625151	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr5:140625151A>T	ENST00000231173.3	+	1	5	c.5A>T	c.(4-6)gAg>gTg	p.E2V		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	2					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.E2V(1)		NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTAAAGATGGAGCCTGCAGGG	0.537																																					p.E2V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5T	5						.						43.0	48.0	46.0					5																	140625151		2203	4300	6503	140605335	SO:0001583	missense	56121	exon1			AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.5A>T	5.37:g.140625151A>T	ENSP00000231173:p.Glu2Val	Somatic		Capture	Illumina HiSeq	Phase_I	140605335	NM_018935	Q8IUX5	Missense_Mutation	SNP	ENST00000231173.3	37	CCDS4257.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.590524	0.86851	.	.	ENSG00000113248	ENST00000231173	T	0.51071	0.72	5.03	3.87	0.44632	.	.	.	.	.	T	0.46386	0.1390	L	0.52126	1.63	0.24024	N	0.996133	P	0.38420	0.63	B	0.43867	0.434	T	0.39563	-0.9608	9	0.59425	D	0.04	.	7.1806	0.25770	0.7739:0.1469:0.0791:0.0	.	2	Q9Y5E8	PCDBF_HUMAN	V	2	ENSP00000231173:E2V	ENSP00000231173:E2V	E	+	2	0	PCDHB15	140605335	0.028000	0.19301	0.928000	0.36995	0.586000	0.36452	0.235000	0.17948	0.884000	0.36064	0.402000	0.26972	GAG		PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
PCDHGB1	56104	broad.mit.edu	37	5	140731619	140731619	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr5:140731619G>A	ENST00000523390.1	+	1	1792	c.1792G>A	c.(1792-1794)Gct>Act	p.A598T	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	598	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A598T(2)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGACACAACGCTTGGCTGTC	0.682																																					p.A598T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1792A	5						.						9.0	11.0	10.0					5																	140731619		1760	3855	5615	140711803	SO:0001583	missense	56104	exon1			AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.1792G>A	5.37:g.140731619G>A	ENSP00000429273:p.Ala598Thr	Somatic		Capture	Illumina HiSeq	Phase_I	140711803	NM_018922	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	ENST00000523390.1	37	CCDS54923.1	.	.	.	.	.	.	.	.	.	.	.	21.7	4.188754	0.78789	.	.	ENSG00000254221	ENST00000523390	T	0.60797	0.16	5.53	5.53	0.82687	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.79112	0.4391	M	0.88450	2.955	0.32716	N	0.51091	D;D	0.89917	1.0;1.0	D;D	0.85130	0.991;0.997	D	0.85123	0.0970	9	0.87932	D	0	.	13.0746	0.59079	0.0:0.0:0.7253:0.2747	.	598;598	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	T	598	ENSP00000429273:A598T	ENSP00000429273:A598T	A	+	1	0	PCDHGB1	140711803	1.000000	0.71417	0.991000	0.47740	0.994000	0.84299	5.514000	0.67043	2.762000	0.94881	0.655000	0.94253	GCT		PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	NM_018922	
RXFP3	51289	broad.mit.edu	37	5	33937909	33937909	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr5:33937909A>G	ENST00000330120.3	+	1	1419	c.1064A>G	c.(1063-1065)aAc>aGc	p.N355S		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	355					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)	p.N355S(1)		endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						ATCAAGTTCAACGCGGTGCCC	0.577																																					p.N355S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1064G	5						.						91.0	90.0	90.0					5																	33937909		2203	4300	6503	33973666	SO:0001583	missense	51289	exon1			D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.1064A>G	5.37:g.33937909A>G	ENSP00000328708:p.Asn355Ser	Somatic		Capture	Illumina HiSeq	Phase_I	33973666	NM_016568	Q14DA5	Missense_Mutation	SNP	ENST00000330120.3	37	CCDS3900.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.134268	0.77662	.	.	ENSG00000182631	ENST00000330120	T	0.71579	-0.58	5.79	5.79	0.91817	GPCR, rhodopsin-like superfamily (1);	0.049708	0.85682	D	0.000000	T	0.79458	0.4449	M	0.67397	2.05	0.47476	D	0.99943	D	0.53619	0.961	P	0.56648	0.803	T	0.78505	-0.2178	10	0.36615	T	0.2	-26.7713	16.1193	0.81336	1.0:0.0:0.0:0.0	.	355	Q9NSD7	RL3R1_HUMAN	S	355	ENSP00000328708:N355S	ENSP00000328708:N355S	N	+	2	0	RXFP3	33973666	1.000000	0.71417	0.961000	0.40146	0.926000	0.56050	5.139000	0.64801	2.201000	0.70794	0.533000	0.62120	AAC		RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568	
NIM1K	167359	broad.mit.edu	37	5	43245939	43245939	+	Missense_Mutation	SNP	G	G	A	rs144641529		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr5:43245939G>A	ENST00000512796.1	+	2	1561	c.62G>A	c.(61-63)cGg>cAg	p.R21Q	NIM1_ENST00000326035.2_Missense_Mutation_p.R21Q			Q8IY84	NIM1_HUMAN		21			R -> W. {ECO:0000269|PubMed:17344846}.		protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.R21Q(1)									CGGTGGGATCGGCGCGACAGT	0.607																																					p.R21Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G62A	5						.	G	GLN/ARG	0,4406		0,0,2203	120.0	113.0	115.0		62	2.6	1.0	5	dbSNP_134	115	3,8597	3.0+/-9.4	0,3,4297	yes	missense	NIM1	NM_153361.2	43	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	possibly-damaging	21/437	43245939	3,13003	2203	4300	6503	43281696	SO:0001583	missense	167359	exon2																														ENST00000512796.1:c.62G>A	5.37:g.43245939G>A	ENSP00000420849:p.Arg21Gln	Somatic		Capture	Illumina HiSeq	Phase_I	43281696	NM_153361	B3KVM1	Missense_Mutation	SNP	ENST00000512796.1	37	CCDS3943.1	.	.	.	.	.	.	.	.	.	.	G	18.22	3.575403	0.65878	0.0	3.49E-4	ENSG00000177453	ENST00000326035;ENST00000512796	T;T	0.72282	-0.64;-0.64	5.38	2.59	0.31030	.	0.233241	0.35585	N	0.003110	T	0.61664	0.2365	L	0.54323	1.7	0.50813	D	0.999893	B	0.09022	0.002	B	0.04013	0.001	T	0.57353	-0.7826	9	.	.	.	.	10.7733	0.46336	0.2564:0.0:0.7436:0.0	.	21	Q8IY84	NIM1_HUMAN	Q	21	ENSP00000313572:R21Q;ENSP00000420849:R21Q	.	R	+	2	0	AC114947.1	43281696	1.000000	0.71417	0.985000	0.45067	0.984000	0.73092	2.380000	0.44327	1.266000	0.44231	0.650000	0.86243	CGG		NIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368017.1		
FAT2	2196	broad.mit.edu	37	5	150911165	150911165	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr5:150911165C>T	ENST00000261800.5	-	13	9806	c.9794G>A	c.(9793-9795)cGc>cAc	p.R3265H		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3265	Cadherin 29. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R3265H(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGCATCCAGGCGGAACCTGCC	0.652																																					p.R3265H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G9794A	5						.						35.0	31.0	32.0					5																	150911165		2203	4300	6503	150891358	SO:0001583	missense	2196	exon13			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.9794G>A	5.37:g.150911165C>T	ENSP00000261800:p.Arg3265His	Somatic		Capture	Illumina HiSeq	Phase_I	150891358	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	C	16.30	3.084118	0.55861	.	.	ENSG00000086570	ENST00000261800	T	0.55413	0.52	5.21	4.34	0.51931	Cadherin (4);Cadherin-like (1);	0.106371	0.41712	D	0.000835	T	0.56108	0.1963	L	0.47716	1.5	0.29757	N	0.835869	D	0.76494	0.999	D	0.66979	0.948	T	0.51236	-0.8731	10	0.11794	T	0.64	.	6.5501	0.22429	0.0:0.6801:0.1499:0.17	.	3265	Q9NYQ8	FAT2_HUMAN	H	3265	ENSP00000261800:R3265H	ENSP00000261800:R3265H	R	-	2	0	FAT2	150891358	0.546000	0.26457	1.000000	0.80357	0.749000	0.42624	0.594000	0.24014	1.199000	0.43173	0.555000	0.69702	CGC		FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
AIM1	202	broad.mit.edu	37	6	107008788	107008788	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr6:107008788G>A	ENST00000369066.3	+	17	5229	c.4742G>A	c.(4741-4743)cGa>cAa	p.R1581Q	AIM1_ENST00000535438.1_Missense_Mutation_p.R400Q	NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.R1581Q(1)		breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GGTTCTCTACGACCTTTTGTT	0.378																																					p.R1581Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4742A	6						.						151.0	153.0	153.0					6																	107008788		2203	4300	6503	107115481	SO:0001583	missense	202	exon17			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.4742G>A	6.37:g.107008788G>A	ENSP00000358062:p.Arg1581Gln	Somatic		Capture	Illumina HiSeq	Phase_I	107115481	NM_001624	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	G	35	5.424585	0.96111	.	.	ENSG00000112297	ENST00000369066;ENST00000535438	D;D	0.81739	-1.53;-1.53	6.06	6.06	0.98353	Ricin B-related lectin (1);Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.000000	0.56097	D	0.000026	D	0.92795	0.7709	H	0.94886	3.595	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	D	0.93515	0.6856	10	0.87932	D	0	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	400;1581	B4DU04;Q9Y4K1	.;AIM1_HUMAN	Q	1581;400	ENSP00000358062:R1581Q;ENSP00000439183:R400Q	ENSP00000358062:R1581Q	R	+	2	0	AIM1	107115481	1.000000	0.71417	0.902000	0.35471	0.991000	0.79684	6.339000	0.72969	2.882000	0.98803	0.655000	0.94253	CGA		AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
SERINC1	57515	broad.mit.edu	37	6	122773142	122773142	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr6:122773142A>C	ENST00000339697.4	-	6	734	c.650T>G	c.(649-651)tTt>tGt	p.F217C		NM_020755.2	NP_065806.1	Q9NRX5	SERC1_HUMAN	serine incorporator 1	217					L-serine transport (GO:0015825)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)	p.F217C(1)		endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(1)	13				GBM - Glioblastoma multiforme(226;0.126)		GTAGTAGACAAAGAACAGGAC	0.403																																					p.F217C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T650G	6						.						86.0	80.0	82.0					6																	122773142		2203	4300	6503	122814841	SO:0001583	missense	57515	exon6			AF087902	CCDS5125.1	6q22.32	2006-02-09	2005-10-14	2005-10-14	ENSG00000111897	ENSG00000111897			13464	protein-coding gene	gene with protein product		614548	"""tumor differentially expressed 2"""	TDE2		10637174	Standard	NM_020755		Approved	TMS-2, TDE1L, KIAA1253	uc003pyy.1	Q9NRX5	OTTHUMG00000015487	ENST00000339697.4:c.650T>G	6.37:g.122773142A>C	ENSP00000342962:p.Phe217Cys	Somatic		Capture	Illumina HiSeq	Phase_I	122814841	NM_020755	B3KY69|E1P565|O75655|Q7Z2F5|Q8TAG1|Q9NTH8|Q9ULG7	Missense_Mutation	SNP	ENST00000339697.4	37	CCDS5125.1	.	.	.	.	.	.	.	.	.	.	A	15.49	2.849888	0.51270	.	.	ENSG00000111897	ENST00000339697;ENST00000368454	T;T	0.19250	2.16;2.16	5.71	5.71	0.89125	.	0.049789	0.85682	D	0.000000	T	0.28665	0.0710	M	0.83953	2.67	0.46521	D	0.999088	B	0.31640	0.333	P	0.46452	0.517	T	0.24297	-1.0164	10	0.87932	D	0	-24.9435	9.5521	0.39317	0.7362:0.0:0.0:0.2638	.	217	Q9NRX5	SERC1_HUMAN	C	217	ENSP00000342962:F217C;ENSP00000357439:F217C	ENSP00000342962:F217C	F	-	2	0	SERINC1	122814841	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.567000	0.67378	2.166000	0.68216	0.528000	0.53228	TTT		SERINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042031.2	NM_020755	
OR2W1	26692	broad.mit.edu	37	6	29012589	29012589	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr6:29012589G>C	ENST00000377175.1	-	1	428	c.364C>G	c.(364-366)Cgt>Ggt	p.R122G		NM_030903.3	NP_112165.1	Q9Y3N9	OR2W1_HUMAN	olfactory receptor, family 2, subfamily W, member 1	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R122G(1)|p.R122S(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|skin(1)	23						GCTGTAAAACGATCATAGGAC	0.398																																					p.R122G												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.C364G	6						.						101.0	82.0	89.0					6																	29012589		1511	2709	4220	29120568	SO:0001583	missense	26692	exon1			AL035402	CCDS4656.1	6p22.1	2012-08-09			ENSG00000204704	ENSG00000204704		"""GPCR / Class A : Olfactory receptors"""	8281	protein-coding gene	gene with protein product							Standard	NM_030903		Approved	hs6M1-15	uc003nlw.2	Q9Y3N9	OTTHUMG00000031048	ENST00000377175.1:c.364C>G	6.37:g.29012589G>C	ENSP00000366380:p.Arg122Gly	Somatic		Capture	Illumina HiSeq	Phase_I	29120568	NM_030903	B0S7Y5|Q5JNZ1|Q6IEU0|Q96R17|Q9GZL0|Q9GZL1	Missense_Mutation	SNP	ENST00000377175.1	37	CCDS4656.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148640	0.57151	.	.	ENSG00000204704	ENST00000377175	T	0.77620	-1.11	4.79	4.79	0.61399	GPCR, rhodopsin-like superfamily (1);	0.131262	0.35407	N	0.003240	D	0.85146	0.5630	H	0.98646	4.29	0.42739	D	0.993735	P	0.44139	0.827	B	0.42386	0.386	D	0.90935	0.4793	10	0.87932	D	0	.	16.3937	0.83548	0.0:0.0:1.0:0.0	.	122	Q9Y3N9	OR2W1_HUMAN	G	122	ENSP00000366380:R122G	ENSP00000366380:R122G	R	-	1	0	OR2W1	29120568	1.000000	0.71417	0.978000	0.43139	0.849000	0.48306	4.000000	0.57039	2.175000	0.68902	0.591000	0.81541	CGT		OR2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076053.2		
SCUBE3	222663	broad.mit.edu	37	6	35205787	35205787	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr6:35205787C>T	ENST00000274938.7	+	7	821	c.821C>T	c.(820-822)aCg>aTg	p.T274M	SCUBE3_ENST00000394681.1_Missense_Mutation_p.T290M	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3									p.T274M(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						GACAGGAAGACGTGCAAAGGT	0.557																																					p.T274M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C821T	6						.						90.0	78.0	82.0					6																	35205787		2203	4300	6503	35313765	SO:0001583	missense	222663	exon7			AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.821C>T	6.37:g.35205787C>T	ENSP00000274938:p.Thr274Met	Somatic		Capture	Illumina HiSeq	Phase_I	35313765	NM_152753		Missense_Mutation	SNP	ENST00000274938.7	37	CCDS4800.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.242417	0.79912	.	.	ENSG00000146197	ENST00000394681;ENST00000274938	D;D	0.97455	-4.39;-4.39	5.08	5.08	0.68730	Epidermal growth factor-like (1);EGF-like region, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98454	0.9485	M	0.85373	2.75	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.69479	0.944;0.964	D	0.99449	1.0940	10	0.87932	D	0	.	18.8377	0.92169	0.0:1.0:0.0:0.0	.	290;274	Q8IX30-2;Q8IX30	.;SCUB3_HUMAN	M	290;274	ENSP00000378174:T290M;ENSP00000274938:T274M	ENSP00000274938:T274M	T	+	2	0	SCUBE3	35313765	1.000000	0.71417	0.999000	0.59377	0.659000	0.38960	6.023000	0.70848	2.523000	0.85059	0.491000	0.48974	ACG		SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753	
MED20	9477	broad.mit.edu	37	6	41884656	41884656	+	Silent	SNP	G	G	A	rs150677099		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr6:41884656G>A	ENST00000265350.4	-	2	116	c.36C>T	c.(34-36)gcC>gcT	p.A12A	MED20_ENST00000409312.1_Silent_p.A12A|MED20_ENST00000467535.1_5'UTR|MED20_ENST00000409060.1_Silent_p.A12A|Y_RNA_ENST00000384641.1_RNA	NM_004275.3	NP_004266.2	Q9H944	MED20_HUMAN	mediator complex subunit 20	12					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	DNA-directed RNA polymerase activity (GO:0003899)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.A12A(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(1)|pancreas(1)	5	Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000367)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TCTTGCCCTCGGCCACAGGCA	0.527																																					p.A12A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C36T	6						.	G		0,4406		0,0,2203	104.0	83.0	90.0		36	-7.8	0.8	6	dbSNP_134	90	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MED20	NM_004275.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		12/213	41884656	1,13005	2203	4300	6503	41992634	SO:0001819	synonymous_variant	9477	exon2			AF097725	CCDS4862.1	6p21.1	2008-02-05	2007-07-30	2007-07-30	ENSG00000124641	ENSG00000124641			16840	protein-coding gene	gene with protein product		612915	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"""	TRFP		9933582, 15175163	Standard	NM_004275		Approved	DKFZp586D2223, PRO0213	uc011dui.3	Q9H944	OTTHUMG00000014689	ENST00000265350.4:c.36C>T	6.37:g.41884656G>A		Somatic		Capture	Illumina HiSeq	Phase_I	41992634	NM_004275	B4DE08|O95821|Q5T8J4|Q9Y429	Silent	SNP	ENST00000265350.4	37	CCDS4862.1																																																																																				MED20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040539.1	NM_004275	
CRISP1	167	broad.mit.edu	37	6	49803156	49803156	+	Splice_Site	SNP	G	G	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr6:49803156G>C	ENST00000335847.4	-	8	724	c.623C>G	c.(622-624)aCt>aGt	p.T208S	CRISP1_ENST00000536021.1_Splice_Site_p.D178E|CRISP1_ENST00000329411.5_Splice_Site_p.D178E|CRISP1_ENST00000505118.1_Splice_Site_p.T208S|CRISP1_ENST00000507853.1_Splice_Site_p.D178E|CRISP1_ENST00000355791.2_Splice_Site_p.T208S	NM_001131.2	NP_001122.2	P54107	CRIS1_HUMAN	cysteine-rich secretory protein 1	208					binding of sperm to zona pellucida (GO:0007339)|fusion of sperm to egg plasma membrane (GO:0007342)|regulation of acrosome reaction (GO:0060046)	extracellular space (GO:0005615)|nucleus (GO:0005634)	calcium channel regulator activity (GO:0005246)	p.T208S(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0358)					GCAGGGGTTAGCTGAAAGAAA	0.348																																					p.T208S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C623G	6						.						138.0	127.0	131.0					6																	49803156		2203	4300	6503	49911115	SO:0001630	splice_region_variant	167	exon8			D38451	CCDS4931.1, CCDS4932.1	6p21.2-p21.1	2008-02-05	2003-09-03	2003-09-05	ENSG00000124812	ENSG00000124812			304	protein-coding gene	gene with protein product		601193	"""acidic epididymal glycoprotein-like 1"""	AEGL1		8838800	Standard	NM_001131		Approved	CRISP-1, ARP, HUMARP, HSCRISP1D, HSCRISP1G	uc003ozw.2	P54107	OTTHUMG00000014827	ENST00000335847.4:c.623-1C>G	6.37:g.49803156G>C		Somatic		Capture	Illumina HiSeq	Phase_I	49911115	NM_001131	B5BU98|O00698|Q13248|Q14082|Q96SF6	Missense_Mutation	SNP	ENST00000335847.4	37	CCDS4931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.315|0.315	-0.965302|-0.965302	0.02249|0.02249	.|.	.|.	ENSG00000124812|ENSG00000124812	ENST00000507853;ENST00000329411;ENST00000536021|ENST00000335847;ENST00000355791;ENST00000505118	T;T;T|T;T;T	0.08807|0.08896	3.05;3.05;3.05|3.04;3.04;3.04	4.92|4.92	2.16|2.16	0.27623|0.27623	.|Cysteine-rich secretory protein (1);	.|0.054374	.|0.64402	.|D	.|0.000001	T|T	0.10680|0.10680	0.0261|0.0261	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	D|D	0.64830|0.89917	0.994|1.0	D|D	0.63488|0.76071	0.915|0.987	T|T	0.07868|0.07868	-1.0750|-1.0750	7|8	.|.	.|.	.|.	.|.	7.2921|7.2921	0.26372|0.26372	0.2834:0.0:0.7166:0.0|0.2834:0.0:0.7166:0.0	.|.	178|208	P54107-2|P54107	.|CRIS1_HUMAN	E|S	178|208	ENSP00000425020:D178E;ENSP00000331317:D178E;ENSP00000441798:D178E|ENSP00000338276:T208S;ENSP00000348044:T208S;ENSP00000427589:T208S	.|.	D|T	-|-	3|2	2|0	CRISP1|CRISP1	49911115|49911115	1.000000|1.000000	0.71417|0.71417	0.714000|0.714000	0.30535|0.30535	0.496000|0.496000	0.33645|0.33645	4.203000|4.203000	0.58453|0.58453	0.223000|0.223000	0.20920|0.20920	0.655000|0.655000	0.94253|0.94253	GAC|ACT		CRISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040875.2	NM_001131	Missense_Mutation
TFAP2D	83741	broad.mit.edu	37	6	50696707	50696707	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr6:50696707C>T	ENST00000008391.3	+	4	965	c.737C>T	c.(736-738)gCt>gTt	p.A246V	TFAP2D_ENST00000492804.1_3'UTR	NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)									p.A246V(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					TGCCTCAATGCTTCACTCTTG	0.468																																					p.A246V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C737T	6						.						94.0	94.0	94.0					6																	50696707		2203	4300	6503	50804666	SO:0001583	missense	83741	exon4			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.737C>T	6.37:g.50696707C>T	ENSP00000008391:p.Ala246Val	Somatic		Capture	Illumina HiSeq	Phase_I	50804666	NM_172238		Missense_Mutation	SNP	ENST00000008391.3	37	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	C	35	5.525853	0.96431	.	.	ENSG00000008197	ENST00000008391	D	0.97430	-4.38	5.97	5.97	0.96955	Transcription factor AP-2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98776	0.9588	M	0.92412	3.305	0.80722	D	1	D	0.54397	0.966	P	0.61397	0.888	D	0.99184	1.0868	10	0.87932	D	0	-9.0241	20.4388	0.99107	0.0:1.0:0.0:0.0	.	246	Q7Z6R9	AP2D_HUMAN	V	246	ENSP00000008391:A246V	ENSP00000008391:A246V	A	+	2	0	TFAP2D	50804666	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.836000	0.97738	0.655000	0.94253	GCT		TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238	
COL12A1	1303	broad.mit.edu	37	6	75884972	75884972	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr6:75884972T>G	ENST00000322507.8	-	13	2801	c.2492A>C	c.(2491-2493)aAa>aCa	p.K831T	COL12A1_ENST00000483888.2_Missense_Mutation_p.K831T|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Missense_Mutation_p.K831T	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	831	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.K831T(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CCAAGATAATTTCATAGTAGA	0.413																																					p.K831T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2492C	6						.						125.0	119.0	121.0					6																	75884972		1862	4085	5947	75941692	SO:0001583	missense	1303	exon13			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.2492A>C	6.37:g.75884972T>G	ENSP00000325146:p.Lys831Thr	Somatic		Capture	Illumina HiSeq	Phase_I	75941692	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	T	14.68	2.607405	0.46527	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.54279	0.58;0.58;0.58	5.79	4.63	0.57726	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.152212	0.44483	D	0.000441	T	0.32071	0.0817	N	0.25094	0.71	0.41164	D	0.986118	P	0.44521	0.837	P	0.47603	0.551	T	0.26087	-1.0113	10	0.56958	D	0.05	.	11.7579	0.51886	0.0:0.0687:0.0:0.9313	.	831	Q99715	COCA1_HUMAN	T	831	ENSP00000325146:K831T;ENSP00000412864:K831T;ENSP00000421216:K831T	ENSP00000325146:K831T	K	-	2	0	COL12A1	75941692	1.000000	0.71417	0.898000	0.35279	0.821000	0.46438	3.205000	0.51090	1.022000	0.39626	0.455000	0.32223	AAA		COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
BACH2	60468	broad.mit.edu	37	6	90661315	90661315	+	Silent	SNP	C	C	T	rs374825480		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr6:90661315C>T	ENST00000257749.4	-	7	1217	c.510G>A	c.(508-510)acG>acA	p.T170T	BACH2_ENST00000537989.1_Silent_p.T170T|RP3-512E2.2_ENST00000445838.1_RNA|RP3-512E2.2_ENST00000413986.1_RNA|BACH2_ENST00000343122.3_Silent_p.T170T	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	170						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.T170T(2)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		CTGAATCCATCGTCTCCTCCT	0.607																																					p.T170T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G510A	6						.						116.0	113.0	114.0					6																	90661315		2203	4300	6503	90718036	SO:0001819	synonymous_variant	60468	exon7			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.510G>A	6.37:g.90661315C>T		Somatic		Capture	Illumina HiSeq	Phase_I	90718036	NM_021813	E1P518|Q59H70|Q5T793|Q9NTS5	Silent	SNP	ENST00000257749.4	37	CCDS5026.1																																																																																				BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813	
ENPP1	5167	broad.mit.edu	37	6	132182748	132182748	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr6:132182748C>T	ENST00000360971.2	+	9	949	c.929C>T	c.(928-930)gCt>gTt	p.A310V		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	310	Phosphodiesterase.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)	p.A258V(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	TGGGTCACAGCTAAGTATCAA	0.373																																					p.A310V	Colon(104;336 1535 5856 11019 33782)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C929T	6						.						89.0	89.0	89.0					6																	132182748		2203	4300	6503	132224441	SO:0001583	missense	5167	exon9			M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.929C>T	6.37:g.132182748C>T	ENSP00000354238:p.Ala310Val	Somatic		Capture	Illumina HiSeq	Phase_I	132224441	NM_006208	Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	ENST00000360971.2	37	CCDS5150.2	.	.	.	.	.	.	.	.	.	.	C	34	5.388881	0.95988	.	.	ENSG00000197594	ENST00000360971	T	0.76839	-1.05	5.77	5.77	0.91146	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.119358	0.56097	D	0.000027	D	0.84835	0.5560	M	0.64260	1.97	0.80722	D	1	D	0.55800	0.973	D	0.68765	0.96	D	0.83556	0.0104	10	0.49607	T	0.09	-12.5738	19.9941	0.97377	0.0:1.0:0.0:0.0	.	310	P22413	ENPP1_HUMAN	V	310	ENSP00000354238:A310V	ENSP00000354238:A310V	A	+	2	0	ENPP1	132224441	1.000000	0.71417	0.993000	0.49108	0.910000	0.53928	5.540000	0.67205	2.729000	0.93468	0.557000	0.71058	GCT		ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042238.2		
PPP1R3A	5506	broad.mit.edu	37	7	113558361	113558361	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr7:113558361A>C	ENST00000284601.3	-	1	759	c.691T>G	c.(691-693)Tgt>Ggt	p.C231G		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	231			C -> Y (in dbSNP:rs7801819).		glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.C231G(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TTCTTTTGACAAATGAATGTA	0.333																																					p.C231G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T691G	7						.						107.0	109.0	108.0					7																	113558361		2201	4298	6499	113345597	SO:0001583	missense	5506	exon1			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.691T>G	7.37:g.113558361A>C	ENSP00000284601:p.Cys231Gly	Somatic		Capture	Illumina HiSeq	Phase_I	113345597	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	A	17.72	3.458988	0.63401	.	.	ENSG00000154415	ENST00000284601	T	0.19938	2.11	5.81	5.81	0.92471	.	0.106321	0.64402	D	0.000003	T	0.46927	0.1418	M	0.78285	2.405	0.80722	D	1	D	0.64830	0.994	D	0.63113	0.911	T	0.49597	-0.8923	10	0.72032	D	0.01	-0.5146	16.1773	0.81862	1.0:0.0:0.0:0.0	.	231	Q16821	PPR3A_HUMAN	G	231	ENSP00000284601:C231G	ENSP00000284601:C231G	C	-	1	0	PPP1R3A	113345597	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	8.730000	0.91510	2.217000	0.71921	0.482000	0.46254	TGT		PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
PRSS1	5644	broad.mit.edu	37	7	142459790	142459790	+	Silent	SNP	C	C	T	rs267606982|rs201487096		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr7:142459790C>T	ENST00000311737.7	+	3	372	c.366C>T	c.(364-366)cgC>cgT	p.R122R	PRSS1_ENST00000486171.1_Silent_p.R136R	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	122	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		R -> C (in PCTT; suppresses an autocleavage site). {ECO:0000269|PubMed:11788572}.|R -> H (in PCTT; suppresses an autocleavage site which is probably part of a fail-safe mechanism by which trypsin, which is activated within the pancreas, may be inactivated; loss of this cleavage site would permit autodigestion resulting in pancreatitis). {ECO:0000269|PubMed:10381903, ECO:0000269|PubMed:11073545, ECO:0000269|PubMed:11866271, ECO:0000269|PubMed:8841182, ECO:0000269|PubMed:9322498}.		cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.R122R(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	TCAACGCCCGCGTGTCCACCA	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		16737	0.001		0.0	False		,,,				2504	0.0				p.R122R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C366T	7						.						147.0	138.0	141.0					7																	142459790		2203	4300	6503	142139364	SO:0001819	synonymous_variant	5644	exon3			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.366C>T	7.37:g.142459790C>T		Somatic		Capture	Illumina HiSeq	Phase_I	142139364	NM_002769	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	ENST00000311737.7	37	CCDS5872.1																																																																																				PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2		
SDK1	221935	broad.mit.edu	37	7	4014070	4014070	+	Silent	SNP	C	C	T	rs367934053		TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr7:4014070C>T	ENST00000404826.2	+	13	2026	c.1887C>T	c.(1885-1887)gaC>gaT	p.D629D	SDK1_ENST00000389531.3_Silent_p.D629D	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	629	Ig-like C2-type 6.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.D629D(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TGGAGAAGGACGGGTCCCTTC	0.567																																					p.D629D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1887T	7						.	C		2,4404	4.2+/-10.8	0,2,2201	148.0	114.0	126.0		1887	-2.7	1.0	7		126	0,8600		0,0,4300	no	coding-synonymous	SDK1	NM_152744.3		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		629/2214	4014070	2,13004	2203	4300	6503	3980596	SO:0001819	synonymous_variant	221935	exon13			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.1887C>T	7.37:g.4014070C>T		Somatic		Capture	Illumina HiSeq	Phase_I	3980596	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	37	CCDS34590.1																																																																																				SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
ADAM22	53616	broad.mit.edu	37	7	87607657	87607657	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr7:87607657C>G	ENST00000265727.7	+	3	332	c.253C>G	c.(253-255)Cat>Gat	p.H85D	ADAM22_ENST00000398201.4_Missense_Mutation_p.H85D|ADAM22_ENST00000315984.7_Missense_Mutation_p.H85D|ADAM22_ENST00000439864.1_Missense_Mutation_p.H85D|ADAM22_ENST00000398209.3_Missense_Mutation_p.H85D|ADAM22_ENST00000398204.4_Missense_Mutation_p.H85D			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	85					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.H85D(2)		endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			GTAGTTGACTCATGTTGACCA	0.343																																					p.H85D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C253G	7						.						189.0	166.0	173.0					7																	87607657		1877	4104	5981	87445593	SO:0001583	missense	53616	exon3			AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.253C>G	7.37:g.87607657C>G	ENSP00000265727:p.His85Asp	Somatic		Capture	Illumina HiSeq	Phase_I	87445593	NM_021722	O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Missense_Mutation	SNP	ENST00000265727.7	37	CCDS47637.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.578074	0.45902	.	.	ENSG00000008277	ENST00000398204;ENST00000439864;ENST00000412441;ENST00000398201;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000398203	T;T;T;T;T;T;T;T	0.05786	3.39;3.39;3.39;3.39;3.39;3.39;3.39;3.39	5.29	5.29	0.74685	Peptidase M12B, propeptide (1);	0.000000	0.64402	D	0.000007	T	0.29524	0.0736	M	0.85630	2.765	0.53005	D	0.999966	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.998;0.999;1.0	T	0.04153	-1.0973	10	0.87932	D	0	.	15.8628	0.79038	0.0:1.0:0.0:0.0	.	137;85;85;85;85;85	E9PBH5;Q9P0K1-5;Q9P0K1;Q9P0K1-2;E7EPF1;D6W5P7	.;.;ADA22_HUMAN;.;.;.	D	85;85;102;85;85;85;85;52	ENSP00000381262:H85D;ENSP00000391334:H85D;ENSP00000413899:H102D;ENSP00000381260:H85D;ENSP00000265727:H85D;ENSP00000315900:H85D;ENSP00000381267:H85D;ENSP00000381261:H52D	ENSP00000265727:H85D	H	+	1	0	ADAM22	87445593	1.000000	0.71417	0.992000	0.48379	0.040000	0.13550	5.708000	0.68377	2.471000	0.83476	0.305000	0.20034	CAT		ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723	
GALNTL5	168391	broad.mit.edu	37	7	151699836	151699836	+	Silent	SNP	G	G	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr7:151699836G>T	ENST00000392800.2	+	6	950	c.696G>T	c.(694-696)gtG>gtT	p.V232V	GALNTL5_ENST00000483959.1_3'UTR|GALNTL5_ENST00000431418.2_Silent_p.V232V	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	232	Catalytic subdomain A.				spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.V232V(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		ACTGTGAGGTGAACAGAGTAT	0.512																																					p.V232V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G696T	7						.						87.0	82.0	84.0					7																	151699836		2203	4300	6503	151330769	SO:0001819	synonymous_variant	168391	exon6			AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.696G>T	7.37:g.151699836G>T		Somatic		Capture	Illumina HiSeq	Phase_I	151330769	NM_145292	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Silent	SNP	ENST00000392800.2	37	CCDS5929.1																																																																																				GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348395.1	NM_145292	
DLGAP2	9228	broad.mit.edu	37	8	1497608	1497608	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr8:1497608C>T	ENST00000421627.2	+	2	883	c.749C>T	c.(748-750)gCg>gTg	p.A250V		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	329					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.A272V(1)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		TACCCCGACGCGCTGCAGAGC	0.677																																					p.A250V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C749T	8						.						56.0	65.0	62.0					8																	1497608		2094	4234	6328	1485015	SO:0001583	missense	9228	exon2			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.749C>T	8.37:g.1497608C>T	ENSP00000400258:p.Ala250Val	Somatic		Capture	Illumina HiSeq	Phase_I	1485015	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	CCDS47760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.076|9.076	0.998044|0.998044	0.19043|0.19043	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	T|.	0.18502|.	2.21|.	5.3|5.3	4.4|4.4	0.53042|0.53042	.|.	0.775970|.	0.12861|.	N|.	0.433112|.	T|T	0.36441|0.36441	0.0967|0.0967	L|L	0.38953|0.38953	1.18|1.18	0.09310|0.09310	N|N	1|1	B;B|.	0.17268|.	0.021;0.012|.	B;B|.	0.09377|.	0.004;0.002|.	T|T	0.21518|0.21518	-1.0243|-1.0243	10|5	0.48119|.	T|.	0.1|.	-3.4101|-3.4101	8.2044|8.2044	0.31443|0.31443	0.1534:0.7641:0.0:0.0825|0.1534:0.7641:0.0:0.0825	.|.	329;329|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	V|C	295;250|267	ENSP00000400258:A250V|.	ENSP00000348366:A295V|.	A|R	+|+	2|1	0|0	DLGAP2|DLGAP2	1485015|1485015	0.061000|0.061000	0.20836|0.20836	0.001000|0.001000	0.08648|0.08648	0.399000|0.399000	0.30720|0.30720	3.326000|3.326000	0.52037|0.52037	1.154000|1.154000	0.42482|0.42482	0.655000|0.655000	0.94253|0.94253	GCG|CGC		DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
FDFT1	2222	broad.mit.edu	37	8	11683543	11683543	+	Missense_Mutation	SNP	A	A	G	rs139230476	byFrequency	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr8:11683543A>G	ENST00000220584.4	+	5	743	c.521A>G	c.(520-522)tAt>tGt	p.Y174C	FDFT1_ENST00000446331.2_Intron|FDFT1_ENST00000525900.1_Missense_Mutation_p.Y167C|FDFT1_ENST00000528812.1_Missense_Mutation_p.Y110C|FDFT1_ENST00000538689.1_Missense_Mutation_p.Y63C|FDFT1_ENST00000528643.1_Missense_Mutation_p.Y89C|FDFT1_ENST00000443614.2_Missense_Mutation_p.Y131C|FDFT1_ENST00000525777.1_Missense_Mutation_p.Y89C|FDFT1_ENST00000530664.1_Missense_Mutation_p.Y110C	NM_004462.3	NP_004453.3	P37268	FDFT_HUMAN	farnesyl-diphosphate farnesyltransferase 1	174					cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	farnesyl-diphosphate farnesyltransferase activity (GO:0004310)|oxidoreductase activity (GO:0016491)|squalene synthase activity (GO:0051996)	p.Y174C(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)	12	all_epithelial(15;0.234)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.18)		TACTGCCACTATGTTGCTGGG	0.418													A|||	2	0.000399361	0.0	0.0	5008	,	,		18337	0.002		0.0	False		,,,				2504	0.0				p.Y174C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A521G	8						.	A	CYS/TYR	0,4406		0,0,2203	95.0	91.0	92.0		521	5.2	1.0	8	dbSNP_134	92	1,8599	1.2+/-3.3	0,1,4299	no	missense	FDFT1	NM_004462.3	194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging	174/418	11683543	1,13005	2203	4300	6503	11720952	SO:0001583	missense	2222	exon5			X69141	CCDS5985.1, CCDS75696.1, CCDS75697.1	8p23.1-p22	2005-03-07			ENSG00000079459	ENSG00000079459	2.5.1.21		3629	protein-coding gene	gene with protein product	"""squalene synthase"""	184420					Standard	NM_001287742		Approved		uc003wui.3	P37268	OTTHUMG00000090801	ENST00000220584.4:c.521A>G	8.37:g.11683543A>G	ENSP00000220584:p.Tyr174Cys	Somatic		Capture	Illumina HiSeq	Phase_I	11720952	NM_004462	B3KQ95|B4DJE5|B4DT56|B7Z1J3|Q96GT0	Missense_Mutation	SNP	ENST00000220584.4	37	CCDS5985.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	A	15.58	2.875327	0.51695	0.0	1.16E-4	ENSG00000079459	ENST00000538689;ENST00000220584;ENST00000443614;ENST00000525900;ENST00000528812;ENST00000530664;ENST00000528643;ENST00000525777	T;T;T;T;T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74	5.21	5.21	0.72293	Terpenoid synthase (2);Squalene/phytoene synthase, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.88662	0.6497	M	0.90870	3.155	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.91099	0.4913	10	0.87932	D	0	-24.1696	14.7121	0.69241	1.0:0.0:0.0:0.0	.	131;231;167;174	B4DJE5;B4DND3;E9PNM1;P37268	.;.;.;FDFT_HUMAN	C	63;174;131;167;110;110;89;89	ENSP00000444248:Y63C;ENSP00000220584:Y174C;ENSP00000390367:Y131C;ENSP00000434714:Y167C;ENSP00000431749:Y110C;ENSP00000432331:Y110C;ENSP00000431649:Y89C;ENSP00000436069:Y89C	ENSP00000220584:Y174C	Y	+	2	0	FDFT1	11720952	1.000000	0.71417	0.995000	0.50966	0.296000	0.27459	8.483000	0.90442	2.317000	0.78254	0.459000	0.35465	TAT		FDFT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207588.2		
MTFR1	9650	broad.mit.edu	37	8	66620246	66620246	+	Splice_Site	SNP	G	G	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr8:66620246G>T	ENST00000262146.4	+	7	1059	c.933G>T	c.(931-933)ttG>ttT	p.L311F	MTFR1_ENST00000458689.2_Splice_Site_p.L278F	NM_014637.3	NP_055452.3	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1	311					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)		p.L311F(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|pancreas(1)|urinary_tract(1)	11			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			AGAGAGTGTTGGTGAGTTATT	0.398																																					p.L278F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G834T	8						.						110.0	113.0	112.0					8																	66620246		2203	4300	6503	66782800	SO:0001630	splice_region_variant	9650	exon5				CCDS6182.1, CCDS55240.1	8q13.1	2012-11-30							29510	protein-coding gene	gene with protein product	"""likely ortholog of chicken chondrocyte protein with a poly proline region"""					7584026, 7584028, 15389597	Standard	NM_014637		Approved	CHPPR, KIAA0009, FAM54A2	uc003xvn.2	Q15390		ENST00000262146.4:c.933+1G>T	8.37:g.66620246G>T		Somatic		Capture	Illumina HiSeq	Phase_I	66782800	NM_001145838	E7EP84|Q6IB94|Q7Z669|Q86XH5|Q8IVD7	Missense_Mutation	SNP	ENST00000262146.4	37	CCDS6182.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	16.28|16.28|16.28	3.077819|3.077819|3.077819	0.55753|0.55753|0.55753	.|.|.	.|.|.	ENSG00000066855|ENSG00000066855|ENSG00000066855	ENST00000518800|ENST00000527155|ENST00000518609;ENST00000262146;ENST00000458689;ENST00000521247	.|.|T	.|.|0.47528	.|.|0.84	5.51|5.51|5.51	4.63|4.63|4.63	0.57726|0.57726|0.57726	.|.|.	.|.|0.376602	.|.|0.27027	.|.|N	.|.|0.021291	T|.|T	0.52273|.|0.52273	0.1724|.|0.1724	M|M|M	0.83852|0.83852|0.83852	2.665|2.665|2.665	0.58432|0.58432|0.58432	D|D|D	0.999991|0.999991|0.999991	.|.|P;B;P;B	.|.|0.44659	.|.|0.84;0.122;0.484;0.3	.|.|B;B;B;B	.|.|0.40534	.|.|0.332;0.06;0.142;0.096	T|.|T	0.58923|.|0.58923	-0.7550|.|-0.7550	5|.|10	.|.|0.44086	.|.|T	.|.|0.13	-15.5654|-15.5654|-15.5654	13.385|13.385|13.385	0.60791|0.60791|0.60791	0.0756:0.0:0.9244:0.0|0.0756:0.0:0.9244:0.0|0.0756:0.0:0.9244:0.0	.|.|.	.|.|311;295;278;311	.|.|B4E3G8;E5RJS5;E7EP84;Q15390	.|.|.;.;.;MTFR1_HUMAN	F|X|F	269|125|295;311;278;127	.|.|ENSP00000262146:L311F	.|.|ENSP00000262146:L311F	C|E|L	+|+|+	2|1|3	0|0|2	MTFR1|MTFR1|MTFR1	66782800|66782800|66782800	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.915000|0.915000|0.915000	0.36163|0.36163|0.36163	0.512000|0.512000|0.512000	0.34134|0.34134|0.34134	7.363000|7.363000|7.363000	0.79516|0.79516|0.79516	1.326000|1.326000|1.326000	0.45319|0.45319|0.45319	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	TGT|GAA|TTG		MTFR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378894.1	NM_014637	Missense_Mutation
ZFHX4	79776	broad.mit.edu	37	8	77767846	77767846	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr8:77767846G>A	ENST00000521891.2	+	10	9137	c.8689G>A	c.(8689-8691)Gac>Aac	p.D2897N	ZFHX4_ENST00000455469.2_Missense_Mutation_p.D2852N|ZFHX4_ENST00000050961.6_Missense_Mutation_p.D2852N|ZFHX4_ENST00000518282.1_Missense_Mutation_p.D2871N	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2852					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.D2881N(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGACAACGCCGACCGCAGCGA	0.498										HNSCC(33;0.089)																											p.D2897N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8689A	8						.						74.0	73.0	73.0					8																	77767846		1974	4161	6135	77930401	SO:0001583	missense	79776	exon10				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8689G>A	8.37:g.77767846G>A	ENSP00000430497:p.Asp2897Asn	Somatic		Capture	Illumina HiSeq	Phase_I	77930401	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632418	0.67015	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.53857	0.6;0.65;0.62;0.61	5.25	5.25	0.73442	.	0.000000	0.47093	U	0.000256	T	0.68787	0.3039	L	0.52573	1.65	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.81914	0.989;0.995;0.995	T	0.69247	-0.5195	10	0.59425	D	0.04	.	19.0329	0.92965	0.0:0.0:1.0:0.0	.	2852;2852;2897	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	N	2897;2881;2852;2852;2871	ENSP00000430497:D2897N;ENSP00000399605:D2852N;ENSP00000050961:D2852N;ENSP00000430848:D2871N	ENSP00000050961:D2852N	D	+	1	0	ZFHX4	77930401	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	9.657000	0.98554	2.733000	0.93635	0.561000	0.74099	GAC		ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
OXR1	55074	broad.mit.edu	37	8	107752649	107752649	+	Silent	SNP	T	T	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr8:107752649T>C	ENST00000442977.2	+	13	2344	c.2245T>C	c.(2245-2247)Ttg>Ctg	p.L749L	OXR1_ENST00000445937.1_Silent_p.L721L|OXR1_ENST00000312046.6_Silent_p.L714L|OXR1_ENST00000521592.1_5'UTR|OXR1_ENST00000531443.1_Silent_p.L721L|OXR1_ENST00000449762.2_Silent_p.L91L|OXR1_ENST00000517566.2_Silent_p.L748L|OXR1_ENST00000452423.2_Silent_p.L169L|OXR1_ENST00000297447.6_Silent_p.L118L	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	749	TLD.				adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)	p.L749L(1)|p.L633L(1)|p.L118L(1)		NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			TGGCACAAGCTTGAAAACTCT	0.403																																					p.L91L												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.T271C	8						.						148.0	132.0	137.0					8																	107752649		2203	4300	6503	107821825	SO:0001819	synonymous_variant	55074	exon3			AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.2245T>C	8.37:g.107752649T>C		Somatic		Capture	Illumina HiSeq	Phase_I	107821825	NM_001198535	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Silent	SNP	ENST00000442977.2	37	CCDS56548.1																																																																																				OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354	
OR13C8	138802	broad.mit.edu	37	9	107331828	107331828	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr9:107331828G>T	ENST00000335040.1	+	1	380	c.380G>T	c.(379-381)tGc>tTc	p.C127F		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C127F(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						GTGGCCATCTGCTACCCACTG	0.542																																					p.C127F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G380T	9						.						105.0	90.0	95.0					9																	107331828		2203	4300	6503	106371649	SO:0001583	missense	138802	exon1				CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.380G>T	9.37:g.107331828G>T	ENSP00000334068:p.Cys127Phe	Somatic		Capture	Illumina HiSeq	Phase_I	106371649	NM_001004483	Q5VVG0|Q96R44	Missense_Mutation	SNP	ENST00000335040.1	37	CCDS35090.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.179176	0.78564	.	.	ENSG00000186943	ENST00000335040	T	0.07216	3.21	5.18	5.18	0.71444	GPCR, rhodopsin-like superfamily (1);	0.095542	0.47093	D	0.000243	T	0.42245	0.1194	H	0.97103	3.94	0.54753	D	0.999988	D	0.64830	0.994	D	0.65010	0.931	T	0.59679	-0.7409	10	0.87932	D	0	.	16.576	0.84648	0.0:0.0:1.0:0.0	.	127	Q8NGS7	O13C8_HUMAN	F	127	ENSP00000334068:C127F	ENSP00000334068:C127F	C	+	2	0	OR13C8	106371649	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.087000	0.71362	2.850000	0.98022	0.655000	0.94253	TGC		OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053480.1		
ZDHHC21	340481	broad.mit.edu	37	9	14658877	14658877	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr9:14658877T>C	ENST00000380916.4	-	7	840	c.374A>G	c.(373-375)aAt>aGt	p.N125S		NM_178566.4	NP_848661.1	Q8IVQ6	ZDH21_HUMAN	zinc finger, DHHC-type containing 21	125					hair follicle development (GO:0001942)|nitric oxide metabolic process (GO:0046209)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)|regulation of nitric-oxide synthase activity (GO:0050999)|sebaceous gland development (GO:0048733)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.N125S(1)		endometrium(2)|large_intestine(4)|lung(2)|skin(1)	9				GBM - Glioblastoma multiforme(50;4.31e-06)		ACCAACACAATTGTTAATCCT	0.299																																					p.N125S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A374G	9						.						65.0	71.0	69.0					9																	14658877		2203	4300	6503	14648877	SO:0001583	missense	340481	exon7			AF161360	CCDS6475.1	9p22.3	2010-02-09			ENSG00000175893	ENSG00000175893		"""Zinc fingers, DHHC-type"""	20750	protein-coding gene	gene with protein product		614605				19956733	Standard	NM_178566		Approved	HSPC097, DNZ1	uc003zlg.2	Q8IVQ6	OTTHUMG00000019573	ENST00000380916.4:c.374A>G	9.37:g.14658877T>C	ENSP00000370303:p.Asn125Ser	Somatic		Capture	Illumina HiSeq	Phase_I	14648877	NM_178566	A8KA95|D3DRI7|Q5VWG1	Missense_Mutation	SNP	ENST00000380916.4	37	CCDS6475.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.071227	0.76301	.	.	ENSG00000175893	ENST00000380916	T	0.28255	1.62	5.97	4.83	0.62350	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.36552	0.0971	M	0.79258	2.445	0.58432	D	0.999991	B	0.02656	0.0	B	0.06405	0.002	T	0.21690	-1.0238	10	0.87932	D	0	-14.8428	11.8889	0.52618	0.0:0.0686:0.0:0.9314	.	125	Q8IVQ6	ZDH21_HUMAN	S	125	ENSP00000370303:N125S	ENSP00000370303:N125S	N	-	2	0	ZDHHC21	14648877	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.038000	0.76537	1.075000	0.40932	0.533000	0.62120	AAT		ZDHHC21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051748.2	NM_178566	
CA9	768	broad.mit.edu	37	9	35679995	35679995	+	Splice_Site	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr9:35679995G>A	ENST00000378357.4	+	8	1314	c.1210G>A	c.(1210-1212)Gtc>Atc	p.V404I	CA9_ENST00000493245.1_3'UTR	NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	404	Catalytic.				bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.V404I(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	TGCTGAGCCAGGTACAGCTTT	0.587																																					p.V404I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1210A	9						.						111.0	102.0	105.0					9																	35679995		2203	4300	6503	35669995	SO:0001630	splice_region_variant	768	exon8			X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.1210+1G>A	9.37:g.35679995G>A		Somatic		Capture	Illumina HiSeq	Phase_I	35669995	NM_001216	Q5T4R1	Missense_Mutation	SNP	ENST00000378357.4	37	CCDS6585.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580181	0.86645	.	.	ENSG00000107159	ENST00000378357	T	0.65364	-0.15	5.41	3.56	0.40772	.	2.559410	0.01815	N	0.033664	T	0.65688	0.2715	L	0.46157	1.445	0.30868	N	0.732819	D	0.59357	0.985	P	0.50537	0.643	T	0.54091	-0.8345	10	0.37606	T	0.19	.	7.6096	0.28122	0.1894:0.0:0.8106:0.0	.	404	Q16790	CAH9_HUMAN	I	404	ENSP00000367608:V404I	ENSP00000367608:V404I	V	+	1	0	CA9	35669995	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	1.986000	0.40677	1.431000	0.47355	0.467000	0.42956	GTC		CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055479.1	NM_001216	Missense_Mutation
PGM5	5239	broad.mit.edu	37	9	71094429	71094429	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr9:71094429C>T	ENST00000396396.1	+	8	1484	c.1255C>T	c.(1255-1257)Cga>Tga	p.R419*		NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	419					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)	p.R419*(1)		endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						GGAAATTGTCCGAGATCACTG	0.532																																					p.R419X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1255T	9						.						86.0	90.0	89.0					9																	71094429		2203	4300	6503	70284249	SO:0001587	stop_gained	5239	exon8			L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.1255C>T	9.37:g.71094429C>T	ENSP00000379678:p.Arg419*	Somatic		Capture	Illumina HiSeq	Phase_I	70284249	NM_021965	B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Nonsense_Mutation	SNP	ENST00000396396.1	37	CCDS6622.2	.	.	.	.	.	.	.	.	.	.	C	39	7.885731	0.98542	.	.	ENSG00000154330	ENST00000396396	.	.	.	5.3	0.2	0.15181	.	0.053072	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	.	14.0611	0.64800	0.6061:0.3939:0.0:0.0	.	.	.	.	X	419	.	ENSP00000379678:R419X	R	+	1	2	PGM5	70284249	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	2.935000	0.48963	0.239000	0.21243	0.563000	0.77884	CGA		PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052548.2	NM_021965	
SETX	23064	broad.mit.edu	37	9	135172326	135172326	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chr9:135172326C>T	ENST00000224140.5	-	14	6079	c.5897G>A	c.(5896-5898)gGa>gAa	p.G1966E	SETX_ENST00000393220.1_Missense_Mutation_p.G1966E|SETX_ENST00000372169.2_Missense_Mutation_p.G1966E	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1966					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.G1966E(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TTTTCCTGTTCCAGGTGGTCC	0.408																																					p.G1966E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5897A	9						.						180.0	142.0	155.0					9																	135172326		2203	4300	6503	134162147	SO:0001583	missense	23064	exon14			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.5897G>A	9.37:g.135172326C>T	ENSP00000224140:p.Gly1966Glu	Somatic		Capture	Illumina HiSeq	Phase_I	134162147	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.572391	0.86542	.	.	ENSG00000107290	ENST00000224140;ENST00000436441;ENST00000372169;ENST00000393220	D;D;D;D	0.99711	-6.49;-6.49;-6.49;-6.49	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.99849	0.9930	H	0.97587	4.035	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96718	0.9530	10	0.87932	D	0	.	18.0171	0.89245	0.0:1.0:0.0:0.0	.	1966;1966;1966	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	E	1966;208;1966;1966	ENSP00000224140:G1966E;ENSP00000409143:G208E;ENSP00000361242:G1966E;ENSP00000376913:G1966E	ENSP00000224140:G1966E	G	-	2	0	SETX	134162147	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.672000	0.68102	2.601000	0.87937	0.563000	0.77884	GGA		SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
ARMCX1	51309	broad.mit.edu	37	X	100807940	100807940	+	Silent	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chrX:100807940C>T	ENST00000372829.3	+	4	398	c.27C>T	c.(25-27)tgC>tgT	p.C9C		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	9						integral component of membrane (GO:0016021)		p.C9C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						AAGCTGGCTGCGTGGCCGCTG	0.587																																					p.C9C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C27T	X						.						62.0	57.0	59.0					X																	100807940		2203	4300	6503	100694596	SO:0001819	synonymous_variant	51309	exon4			AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.27C>T	X.37:g.100807940C>T		Somatic		Capture	Illumina HiSeq	Phase_I	100694596	NM_016608	Q53HK2|Q9H2Q0	Silent	SNP	ENST00000372829.3	37	CCDS14487.1																																																																																				ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057561.1	NM_016608	
OFD1	8481	broad.mit.edu	37	X	13778791	13778791	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chrX:13778791C>A	ENST00000340096.6	+	16	2539	c.2212C>A	c.(2212-2214)Ccc>Acc	p.P738T	OFD1_ENST00000380567.1_Missense_Mutation_p.P598T|OFD1_ENST00000490265.1_3'UTR|OFD1_ENST00000380550.3_Missense_Mutation_p.P698T	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	738	Mediates the interaction with SDCCAG8.				axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)	p.P738T(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						CTCTTCCACACCCCTTCCAAA	0.572																																					p.P738T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2212A	X						.						31.0	35.0	34.0					X																	13778791		2202	4296	6498	13688712	SO:0001583	missense	8481	exon16			Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.2212C>A	X.37:g.13778791C>A	ENSP00000344314:p.Pro738Thr	Somatic		Capture	Illumina HiSeq	Phase_I	13688712	NM_003611	B9ZVU5|O75666|Q4VAK4	Missense_Mutation	SNP	ENST00000340096.6	37	CCDS14157.1	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721746	0.68959	.	.	ENSG00000046651	ENST00000380550;ENST00000340096;ENST00000380567	D;D;D	0.98178	-4.77;-4.69;-2.46	5.13	5.13	0.70059	.	0.057426	0.64402	D	0.000001	D	0.98760	0.9583	M	0.76002	2.32	0.80722	D	1	D;D;D;D;D	0.89917	0.994;0.983;1.0;1.0;0.983	P;P;D;D;P	0.91635	0.881;0.808;0.999;0.999;0.808	D	0.99866	1.1090	10	0.72032	D	0.01	-7.6988	15.9922	0.80214	0.0:1.0:0.0:0.0	.	738;698;406;598;738	A8K2T9;O75665-3;B4DLQ3;A6NF31;O75665	.;.;.;.;OFD1_HUMAN	T	698;738;598	ENSP00000369923:P698T;ENSP00000344314:P738T;ENSP00000369941:P598T	ENSP00000344314:P738T	P	+	1	0	OFD1	13688712	0.990000	0.36364	0.047000	0.18901	0.683000	0.39861	3.652000	0.54439	2.139000	0.66308	0.529000	0.55759	CCC		OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055808.1	NM_003611	
COL4A5	1287	broad.mit.edu	37	X	107816825	107816825	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chrX:107816825A>G	ENST00000361603.2	+	9	731	c.487A>G	c.(487-489)Atg>Gtg	p.M163V	COL4A5_ENST00000328300.6_Missense_Mutation_p.M163V	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	163	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.M163V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						TAGTATAATTATGTCATCACT	0.363									Alport syndrome with Diffuse Leiomyomatosis																												p.M163V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A487G	X						.						132.0	123.0	126.0					X																	107816825		2203	4300	6503	107703481	SO:0001583	missense	1287	exon9	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.487A>G	X.37:g.107816825A>G	ENSP00000354505:p.Met163Val	Somatic		Capture	Illumina HiSeq	Phase_I	107703481	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	A	10.14	1.269171	0.23221	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.93076	-3.16;-3.16	5.25	2.7	0.31948	.	0.591138	0.19101	N	0.122688	D	0.85779	0.5776	L	0.41824	1.3	0.23568	N	0.997391	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.68116	-0.5494	10	0.13853	T	0.58	.	3.2248	0.06728	0.6453:0.139:0.0789:0.1368	.	163;163	E7EVY4;P29400	.;CO4A5_HUMAN	V	163	ENSP00000331902:M163V;ENSP00000354505:M163V	ENSP00000331902:M163V	M	+	1	0	COL4A5	107703481	0.984000	0.35163	1.000000	0.80357	0.940000	0.58332	0.245000	0.18142	0.746000	0.32786	0.441000	0.28932	ATG		COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
TBL1X	6907	broad.mit.edu	37	X	9683034	9683034	+	Silent	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chrX:9683034C>T	ENST00000217964.7	+	17	2338	c.1698C>T	c.(1696-1698)tcC>tcT	p.S566S	TBL1X_ENST00000536365.1_Silent_p.S515S|TBL1X_ENST00000424279.1_Silent_p.S515S|TBL1X_ENST00000407597.2_Silent_p.S566S|TBL1X_ENST00000380961.1_Silent_p.S515S	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	566					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S566S(2)		breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				CCAGCGCGTCCGACGGCTCTG	0.602																																					p.S515S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1545T	X						.						65.0	49.0	54.0					X																	9683034		2203	4300	6503	9643034	SO:0001819	synonymous_variant	6907	exon17			Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.1698C>T	X.37:g.9683034C>T		Somatic		Capture	Illumina HiSeq	Phase_I	9643034	NM_001139468	A8K044|A8K4J7|Q86UY2	Silent	SNP	ENST00000217964.7	37	CCDS14133.1																																																																																				TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647	
GPR143	4935	broad.mit.edu	37	X	9707585	9707585	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chrX:9707585C>T	ENST00000467482.1	-	8	1206	c.1060G>A	c.(1060-1062)Ggg>Agg	p.G354R	GPR143_ENST00000487206.1_5'UTR|GPR143_ENST00000380929.2_Missense_Mutation_p.G374R			P51810	GP143_HUMAN	G protein-coupled receptor 143	354					calcium-mediated signaling using intracellular calcium source (GO:0035584)|eye pigment biosynthetic process (GO:0006726)|G-protein coupled receptor signaling pathway (GO:0007186)|melanosome localization (GO:0032400)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|neuropeptide signaling pathway (GO:0007218)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of calcium-mediated signaling (GO:0050848)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|G-protein coupled receptor activity (GO:0004930)|L-DOPA binding (GO:0072544)|L-DOPA receptor activity (GO:0035643)|tyrosine binding (GO:0072545)	p.G374R(1)		endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Hepatocellular(5;0.000888)				GACACCTTCCCGGAAGCAGGG	0.592																																					p.G354R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1060A	X						.						52.0	42.0	45.0					X																	9707585		2203	4299	6502	9667585	SO:0001583	missense	4935	exon8			Z48804	CCDS14134.1, CCDS14134.2	Xp22.3	2013-09-27	2003-12-01		ENSG00000101850	ENSG00000101850		"""GPCR / Unclassified : 7TM orphan receptors"""	20145	protein-coding gene	gene with protein product	"""ocular albinism 1"""	300808	"""ocular albinism 1 (Nettleship-Falls)"""	OA1		7647783, 10471510	Standard	NM_000273		Approved		uc004cst.2	P51810	OTTHUMG00000021118	ENST00000467482.1:c.1060G>A	X.37:g.9707585C>T	ENSP00000417161:p.Gly354Arg	Somatic		Capture	Illumina HiSeq	Phase_I	9667585	NM_000273	Q6NTI7	Missense_Mutation	SNP	ENST00000467482.1	37	CCDS14134.2	.	.	.	.	.	.	.	.	.	.	c	5.872	0.344971	0.11126	.	.	ENSG00000101850	ENST00000467482;ENST00000380929	D;D	0.99014	-5.31;-5.33	5.01	-7.09	0.01553	.	0.600012	0.18719	N	0.133069	D	0.92632	0.7659	N	0.04203	-0.255	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	D	0.87069	0.2158	10	0.15952	T	0.53	-3.3989	10.0179	0.42024	0.0:0.5054:0.1095:0.3851	.	354	P51810	GP143_HUMAN	R	354;374	ENSP00000417161:G354R;ENSP00000370316:G374R	ENSP00000370316:G374R	G	-	1	0	GPR143	9667585	0.027000	0.19231	0.000000	0.03702	0.002000	0.02628	0.116000	0.15561	-1.719000	0.01382	-0.376000	0.06991	GGG		GPR143-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055714.2	NM_000273	
SHROOM2	357	broad.mit.edu	37	X	9900521	9900521	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chrX:9900521G>A	ENST00000380913.3	+	6	3288	c.3198G>A	c.(3196-3198)ccG>ccA	p.P1066P	SHROOM2_ENST00000418909.2_5'UTR|SHROOM2_ENST00000493668.1_3'UTR	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	1066	Poly-Pro.				apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)	p.P1066P(1)		breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				AGAGGCCACCGCCACCCAAGC	0.697																																					p.P1066P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3198A	X						.						19.0	18.0	19.0					X																	9900521		2193	4296	6489	9860521	SO:0001819	synonymous_variant	357	exon6			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.3198G>A	X.37:g.9900521G>A		Somatic		Capture	Illumina HiSeq	Phase_I	9860521	NM_001649	B9EIQ7	Silent	SNP	ENST00000380913.3	37	CCDS14135.1																																																																																				SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055721.1	NM_001649	
CDKL5	6792	broad.mit.edu	37	X	18646535	18646535	+	Silent	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chrX:18646535G>A	ENST00000379989.3	+	19	2826	c.2541G>A	c.(2539-2541)tcG>tcA	p.S847S	CDKL5_ENST00000379996.3_Silent_p.S847S	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	847					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)	p.S847S(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					ATCTCTCTTCGGCCTCAAATC	0.483																																					p.S847S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2541A	X						.						249.0	258.0	255.0					X																	18646535		2203	4300	6503	18556456	SO:0001819	synonymous_variant	6792	exon18			Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.2541G>A	X.37:g.18646535G>A		Somatic		Capture	Illumina HiSeq	Phase_I	18556456	NM_003159	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Silent	SNP	ENST00000379989.3	37	CCDS14186.1																																																																																				CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
POLA1	5422	broad.mit.edu	37	X	24759517	24759517	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chrX:24759517T>G	ENST00000379059.3	+	21	2239	c.2224T>G	c.(2224-2226)Ttg>Gtg	p.L742V	POLA1_ENST00000379068.3_Missense_Mutation_p.L748V	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	742					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)	p.L742V(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	GTTATACCTGTTGGAACACAC	0.358																																					p.L742V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2224G	X						.						130.0	111.0	118.0					X																	24759517		2203	4300	6503	24669438	SO:0001583	missense	5422	exon21				CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.2224T>G	X.37:g.24759517T>G	ENSP00000368349:p.Leu742Val	Somatic		Capture	Illumina HiSeq	Phase_I	24669438	NM_016937	Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	37	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	T	3.866	-0.028906	0.07589	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.42900	0.96;0.96	5.24	4.08	0.47627	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.20414	0.0491	N	0.13371	0.34	0.58432	D	0.999996	B	0.21688	0.059	B	0.22152	0.038	T	0.06607	-1.0817	10	0.16420	T	0.52	-6.5522	3.5114	0.07709	0.0:0.2796:0.1932:0.5272	.	742	P09884	DPOLA_HUMAN	V	748;742	ENSP00000368358:L748V;ENSP00000368349:L742V	ENSP00000368349:L742V	L	+	1	2	POLA1	24669438	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.709000	0.47160	0.812000	0.34326	0.486000	0.48141	TTG		POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	
PHKA1	5255	broad.mit.edu	37	X	71822975	71822975	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chrX:71822975G>A	ENST00000373542.4	-	26	3070	c.2911C>T	c.(2911-2913)Cga>Tga	p.R971*	PHKA1_ENST00000373539.3_Nonsense_Mutation_p.R971*|PHKA1_ENST00000373545.3_Nonsense_Mutation_p.R912*|PHKA1_ENST00000339490.3_Nonsense_Mutation_p.R971*|PHKA1_ENST00000541944.1_Nonsense_Mutation_p.R912*	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	971					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.R971*(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					TCACCGCTTCGTTCCACTCCA	0.423																																					p.R912X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C2734T	X						.						127.0	98.0	107.0					X																	71822975		2203	4300	6503	71739700	SO:0001587	stop_gained	5255	exon25				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.2911C>T	X.37:g.71822975G>A	ENSP00000362643:p.Arg971*	Somatic		Capture	Illumina HiSeq	Phase_I	71739700	NM_001172436	B7ZL05|B7ZL07|Q2M3D7	Nonsense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	G	43	10.468460	0.99411	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	.	.	.	5.64	2.62	0.31277	.	0.053778	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.0938	11.4523	0.50160	0.0:0.0:0.4858:0.5142	.	.	.	.	X	912;971;912;971;971	.	ENSP00000342469:R971X	R	-	1	2	PHKA1	71739700	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	1.545000	0.36169	1.138000	0.42230	-0.222000	0.12452	CGA		PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
BRWD3	254065	broad.mit.edu	37	X	79965043	79965043	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chrX:79965043G>A	ENST00000373275.4	-	21	2575	c.2359C>T	c.(2359-2361)Cgc>Tgc	p.R787C	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	787					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)			p.R787C(2)		breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TGTGTCCTGCGTAAAGAACGC	0.388																																					p.R787C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2359T	X						.						148.0	103.0	119.0					X																	79965043		2203	4300	6503	79851699	SO:0001583	missense	254065	exon21				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.2359C>T	X.37:g.79965043G>A	ENSP00000362372:p.Arg787Cys	Somatic		Capture	Illumina HiSeq	Phase_I	79851699	NM_153252	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.747300	0.69418	.	.	ENSG00000165288	ENST00000373275	T	0.30714	1.52	5.47	3.64	0.41730	.	0.000000	0.85682	D	0.000000	T	0.48259	0.1490	M	0.79258	2.445	0.54753	D	0.999988	D	0.71674	0.998	P	0.55260	0.772	T	0.49263	-0.8958	9	.	.	.	-8.7575	13.5268	0.61599	0.0:0.0:0.4681:0.5319	.	787	Q6RI45	BRWD3_HUMAN	C	787	ENSP00000362372:R787C	.	R	-	1	0	BRWD3	79851699	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	1.281000	0.33214	0.439000	0.26476	0.600000	0.82982	CGC		BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
MTMR1	8776	broad.mit.edu	37	X	149901188	149901188	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3848-01A-01W-0900-09	TCGA-AA-3848-10A-01W-0900-09	g.chrX:149901188G>A	ENST00000370390.3	+	9	1199	c.1042G>A	c.(1042-1044)Gct>Act	p.A348T	MTMR1_ENST00000538506.1_Missense_Mutation_p.A235T|MTMR1_ENST00000445323.2_Missense_Mutation_p.A356T|MTMR1_ENST00000544228.1_Missense_Mutation_p.A348T|MTMR1_ENST00000451863.2_Missense_Mutation_p.A348T|MTMR1_ENST00000542156.1_Missense_Mutation_p.A348T|MTMR1_ENST00000541925.1_Missense_Mutation_p.A254T	NM_003828.2	NP_003819.1	Q13613	MTMR1_HUMAN	myotubularin related protein 1	348	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)	p.A348T(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					AAACAGTGTCGCTGATACCAA	0.373																																					p.A348T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1042A	X						.						97.0	78.0	85.0					X																	149901188		2203	4300	6503	149651846	SO:0001583	missense	8776	exon9			U58032	CCDS14695.1	Xq28	2011-06-09			ENSG00000063601	ENSG00000063601		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7449	protein-coding gene	gene with protein product		300171				9828128	Standard	XM_005274765		Approved		uc004fei.3	Q13613	OTTHUMG00000024159	ENST00000370390.3:c.1042G>A	X.37:g.149901188G>A	ENSP00000359417:p.Ala348Thr	Somatic		Capture	Illumina HiSeq	Phase_I	149651846	NM_003828	A0A024RC07|Q9UBX6|Q9UEM0|Q9UQD5	Missense_Mutation	SNP	ENST00000370390.3	37	CCDS14695.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.810896	0.90707	.	.	ENSG00000063601	ENST00000541925;ENST00000542156;ENST00000370390;ENST00000445323;ENST00000544228;ENST00000451863;ENST00000538506	D;D;D;D;D;D;D	0.94862	-3.54;-3.54;-3.54;-3.54;-3.54;-3.54;-2.58	5.93	5.93	0.95920	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.000000	0.85682	D	0.000000	D	0.98188	0.9401	H	0.94385	3.53	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.993;0.965	D	0.98994	1.0809	10	0.87932	D	0	.	19.2892	0.94092	0.0:0.0:1.0:0.0	.	348;356;348	Q13613;F8WA39;Q8NEC6	MTMR1_HUMAN;.;.	T	254;348;348;356;348;348;235	ENSP00000441879:A254T;ENSP00000445281:A348T;ENSP00000359417:A348T;ENSP00000414178:A356T;ENSP00000440534:A348T;ENSP00000387446:A348T;ENSP00000443444:A235T	ENSP00000359417:A348T	A	+	1	0	MTMR1	149651846	1.000000	0.71417	0.418000	0.26571	0.798000	0.45092	9.869000	0.99810	2.508000	0.84585	0.523000	0.50628	GCT		MTMR1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060863.2	NM_003828, NM_176789	
