#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NDST2	8509	broad.mit.edu	37	10	75566514	75566515	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr10:75566514_75566515insA	ENST00000309979.6	-	5	1704_1705	c.1148_1149insT	c.(1147-1149)ttcfs	p.F383fs	RP11-574K11.31_ENST00000603027.1_Frame_Shift_Ins_p.F383fs|NDST2_ENST00000299641.4_Frame_Shift_Ins_p.F260fs			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	383	Heparan sulfate N-deacetylase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)	p.W384fs*23(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					GGAACCACCAGAACTCTTTGCG	0.579																																					p.F383fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1149_1150insT	10						.																																			75236521	SO:0001589	frameshift_variant	8509	exon5			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.1149dupT	10.37:g.75566516_75566516dupA	ENSP00000310657:p.Phe383fs	Somatic		Capture	Illumina HiSeq	Phase_I	75236520	NM_003635	Q2TB32|Q59H89	Frame_Shift_Ins	INS	ENST00000309979.6	37	CCDS7335.1																																																																																				NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048710.1	NM_003635	
OGDHL	55753	broad.mit.edu	37	10	50954894	50954894	+	Missense_Mutation	SNP	C	C	T	rs199864072		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr10:50954894C>T	ENST00000374103.4	-	10	1283	c.1198G>A	c.(1198-1200)Gcc>Acc	p.A400T	OGDHL_ENST00000419399.1_Missense_Mutation_p.A343T|OGDHL_ENST00000432695.1_Missense_Mutation_p.A191T	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	400					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.A400T(3)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CCAGCAAAGGCGGCGTCCCCA	0.632																																					p.A343T												.	.	3	Substitution - Missense(3)	large_intestine(2)|endometrium(1)	c.G1027A	10						.	C	THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	114.0	84.0	94.0		1027,571,1198	5.8	1.0	10		94	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	OGDHL	NM_001143996.1,NM_001143997.1,NM_018245.2	58,58,58	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	343/954,191/802,400/1011	50954894	2,13004	2203	4300	6503	50624900	SO:0001583	missense	55753	exon9			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.1198G>A	10.37:g.50954894C>T	ENSP00000363216:p.Ala400Thr	Somatic		Capture	Illumina HiSeq	Phase_I	50624900	NM_001143996	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	ENST00000374103.4	37	CCDS7234.1	.	.	.	.	.	.	.	.	.	.	C	35	5.554669	0.96501	0.0	2.33E-4	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	D;D;D	0.97831	-4.56;-4.56;-4.56	5.76	5.76	0.90799	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.99330	0.9765	H	0.97918	4.105	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.986;0.975;0.995	D	0.98581	1.0650	10	0.87932	D	0	.	19.9576	0.97228	0.0:1.0:0.0:0.0	.	343;191;400	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	T	400;343;191	ENSP00000363216:A400T;ENSP00000401356:A343T;ENSP00000390240:A191T	ENSP00000363216:A400T	A	-	1	0	OGDHL	50624900	1.000000	0.71417	0.969000	0.41365	0.734000	0.41952	7.776000	0.85560	2.736000	0.93811	0.655000	0.94253	GCC		OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245	
MYPN	84665	broad.mit.edu	37	10	69970067	69970067	+	Missense_Mutation	SNP	C	C	T	rs148942084	byFrequency	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr10:69970067C>T	ENST00000358913.5	+	20	4306	c.3818C>T	c.(3817-3819)cCg>cTg	p.P1273L	MYPN_ENST00000540630.1_Missense_Mutation_p.P1273L|MYPN_ENST00000354393.2_Missense_Mutation_p.P998L	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	1273	Interaction with ACTN.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)	p.P1273L(1)		breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						CAGATCCCACCGCCCATGTCT	0.502													C|||	3	0.000599042	0.0023	0.0	5008	,	,		21238	0.0		0.0	False		,,,				2504	0.0				p.P1273L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3818T	10						.	C	LEU/PRO	3,4403	6.2+/-15.9	0,3,2200	105.0	96.0	99.0		3818	1.2	0.1	10	dbSNP_134	99	0,8600		0,0,4300	yes	missense	MYPN	NM_032578.2	98	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign	1273/1321	69970067	3,13003	2203	4300	6503	69640073	SO:0001583	missense	84665	exon20			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.3818C>T	10.37:g.69970067C>T	ENSP00000351790:p.Pro1273Leu	Somatic		Capture	Illumina HiSeq	Phase_I	69640073	NM_032578	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.246878	0.22796	6.81E-4	0.0	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630	T;T;T	0.59502	0.26;0.35;0.32	5.86	1.22	0.21188	.	0.795361	0.11828	N	0.525557	T	0.42449	0.1203	L	0.29908	0.895	0.09310	N	1	B;B;B	0.31459	0.324;0.324;0.039	B;B;B	0.22152	0.038;0.038;0.014	T	0.11421	-1.0588	9	.	.	.	.	14.4619	0.67456	0.7034:0.2966:0.0:0.0	.	1273;998;1273	F5GWA6;Q86TC9-2;Q86TC9	.;.;MYPN_HUMAN	L	998;998;1273;1273	ENSP00000346369:P998L;ENSP00000351790:P1273L;ENSP00000441668:P1273L	.	P	+	2	0	MYPN	69640073	0.003000	0.15002	0.096000	0.21009	0.493000	0.33554	1.965000	0.40471	0.457000	0.26962	-0.188000	0.12872	CCG		MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
C10orf11	83938	broad.mit.edu	37	10	78084220	78084220	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr10:78084220C>G	ENST00000372499.1	+	5	709	c.494C>G	c.(493-495)tCc>tGc	p.S165C	C10orf11_ENST00000593699.1_3'UTR|C10orf11_ENST00000496424.2_Missense_Mutation_p.S22C	NM_032024.3	NP_114413.1	Q9H2I8	CJ011_HUMAN	chromosome 10 open reading frame 11	165					melanocyte differentiation (GO:0030318)			p.S165C(1)		endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	10	Prostate(51;0.0095)|all_epithelial(25;0.0221)					CCTTCTGCTTCCAGGGAACTC	0.537																																					p.S165C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C494G	10						.						212.0	181.0	192.0					10																	78084220		2203	4300	6503	77754226	SO:0001583	missense	83938	exon5			AF267860	CCDS7351.1	10q22.3	2013-08-22			ENSG00000148655	ENSG00000148655			23405	protein-coding gene	gene with protein product	"""oculocutaneous albinism 7, autosomal recessive"""	614537				23395477	Standard	NM_032024		Approved	CDA017, OCA7	uc001jxi.3	Q9H2I8	OTTHUMG00000018532	ENST00000372499.1:c.494C>G	10.37:g.78084220C>G	ENSP00000361577:p.Ser165Cys	Somatic		Capture	Illumina HiSeq	Phase_I	77754226	NM_032024	B1AVW6	Missense_Mutation	SNP	ENST00000372499.1	37	CCDS7351.1	.	.	.	.	.	.	.	.	.	.	C	18.62	3.663694	0.67700	.	.	ENSG00000148655	ENST00000354343;ENST00000372499	T	0.46819	0.86	5.63	5.63	0.86233	.	0.059375	0.64402	D	0.000002	T	0.67998	0.2953	M	0.69823	2.125	0.41880	D	0.990314	D	0.76494	0.999	D	0.66847	0.947	T	0.68792	-0.5315	10	0.56958	D	0.05	-27.85	18.2272	0.89921	0.0:1.0:0.0:0.0	.	165	Q9H2I8	CJ011_HUMAN	C	193;165	ENSP00000361577:S165C	ENSP00000346310:S193C	S	+	2	0	C10orf11	77754226	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.703000	0.61824	2.815000	0.96918	0.561000	0.74099	TCC		C10orf11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048839.1	NM_032024	
SLC18A2	6571	broad.mit.edu	37	10	119003573	119003573	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr10:119003573C>G	ENST00000298472.5	+	3	356	c.213C>G	c.(211-213)atC>atG	p.I71M	RP11-501J20.5_ENST00000425264.1_RNA|SLC18A2_ENST00000497497.1_3'UTR	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2	71					aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)	p.I71M(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	CTGCCTCCATCTCAGACAGCT	0.502																																					p.I71M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C213G	10						.						100.0	85.0	90.0					10																	119003573		2203	4300	6503	118993563	SO:0001583	missense	6571	exon3			L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	ENST00000298472.5:c.213C>G	10.37:g.119003573C>G	ENSP00000298472:p.Ile71Met	Somatic		Capture	Illumina HiSeq	Phase_I	118993563	NM_003054	B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	Missense_Mutation	SNP	ENST00000298472.5	37	CCDS7599.1	.	.	.	.	.	.	.	.	.	.	C	1.536	-0.542955	0.04053	.	.	ENSG00000165646	ENST00000298472	T	0.03607	3.87	5.1	4.18	0.49190	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.539310	0.19969	N	0.102034	T	0.02342	0.0072	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.17433	0.018	T	0.45116	-0.9283	10	0.33141	T	0.24	-7.157	9.6038	0.39622	0.1395:0.7852:0.0:0.0753	.	71	Q05940	VMAT2_HUMAN	M	71	ENSP00000298472:I71M	ENSP00000298472:I71M	I	+	3	3	SLC18A2	118993563	0.000000	0.05858	0.007000	0.13788	0.119000	0.20118	0.436000	0.21526	1.437000	0.47472	0.563000	0.77884	ATC		SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050563.1	NM_003054	
CTSD	1509	broad.mit.edu	37	11	1778725	1778725	+	Missense_Mutation	SNP	A	A	C	rs200471178		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr11:1778725A>C	ENST00000236671.2	-	5	665	c.533T>G	c.(532-534)gTc>gGc	p.V178G	RP11-295K3.1_ENST00000427721.1_Missense_Mutation_p.S49A|AC068580.6_ENST00000449248.1_RNA	NM_001909.4	NP_001900.1	P07339	CATD_HUMAN	cathepsin D	178					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic vacuole assembly (GO:0000045)|cell death (GO:0008219)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	aspartic-type endopeptidase activity (GO:0004190)	p.V178G(1)		endometrium(1)|large_intestine(4)|lung(8)	13		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CTCCCCAAAGACCTGCCTCTC	0.637											OREG0003774	type=REGULATORY REGION|Gene=CTSD|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.V178G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T533G	11						.						130.0	86.0	101.0					11																	1778725		2202	4299	6501	1735301	SO:0001583	missense	1509	exon5			M11233	CCDS7725.1	11p15.5	2009-06-26	2006-12-05		ENSG00000117984	ENSG00000117984	3.4.23.5	"""Cathepsins"""	2529	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 10"""	116840	"""cathepsin D (lysosomal aspartyl protease)"""	CPSD		3927292	Standard	NM_001909		Approved	CLN10	uc001luc.2	P07339	OTTHUMG00000044760	ENST00000236671.2:c.533T>G	11.37:g.1778725A>C	ENSP00000236671:p.Val178Gly	Somatic	598	Capture	Illumina HiSeq	Phase_I	1735301	NM_001909	Q6IB57	Missense_Mutation	SNP	ENST00000236671.2	37	CCDS7725.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	11.23|11.23	1.577281|1.577281	0.28092|0.28092	.|.	.|.	ENSG00000250644|ENSG00000117984	ENST00000427721|ENST00000236671;ENST00000438213;ENST00000367196	.|T;T;T	.|0.57436	.|0.4;0.4;0.4	4.11|4.11	-4.55|-4.55	0.03441|0.03441	.|Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	.|0.851711	.|0.10377	.|N	.|0.682076	T|T	0.41534|0.41534	0.1163|0.1163	L|L	0.43152|0.43152	1.355|1.355	0.36487|0.36487	D|D	0.868197|0.868197	.|B	.|0.17268	.|0.021	.|B	.|0.18263	.|0.021	T|T	0.20140|0.20140	-1.0284|-1.0284	5|10	.|0.40728	.|T	.|0.16	.|.	12.5754|12.5754	0.56362|0.56362	0.8228:0.0:0.1772:0.0|0.8228:0.0:0.1772:0.0	.|.	.|178	.|P07339	.|CATD_HUMAN	A|G	49|178;163;143	.|ENSP00000236671:V178G;ENSP00000415036:V163G;ENSP00000356164:V143G	.|ENSP00000236671:V178G	S|V	-|-	1|2	0|0	RP11-295K3.1|CTSD	1735301|1735301	0.000000|0.000000	0.05858|0.05858	0.629000|0.629000	0.29254|0.29254	0.436000|0.436000	0.31835|0.31835	0.336000|0.336000	0.19823|0.19823	-0.853000|-0.853000	0.04136|0.04136	0.387000|0.387000	0.25754|0.25754	TCT|GTC		CTSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104272.5	NM_001909	
MPPED2	744	broad.mit.edu	37	11	30516943	30516943	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr11:30516943G>T	ENST00000358117.5	-	3	558	c.436C>A	c.(436-438)Cca>Aca	p.P146T	MPPED2_ENST00000448418.2_Missense_Mutation_p.P146T	NM_001584.2	NP_001575.1	Q15777	MPPD2_HUMAN	metallophosphoesterase domain containing 2	146					nervous system development (GO:0007399)		hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.P146T(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(15)|skin(2)|upper_aerodigestive_tract(2)	33						AAGTCCTCTGGTTTCAATTTG	0.428																																					p.P146T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C436A	11						.						150.0	140.0	143.0					11																	30516943		2202	4299	6501	30473519	SO:0001583	missense	744	exon3			U57911	CCDS7870.1, CCDS44560.1	11p13	2008-07-18	2005-10-10	2005-10-10	ENSG00000066382	ENSG00000066382			1180	protein-coding gene	gene with protein product		600911	"""chromosome 11 open reading frame 8"""	C11orf8		8666403, 9266672	Standard	NM_001584		Approved	239FB, D11S302E, Hs.46638, FAM1B, dJ873F21.1, dJ1024C24.1	uc001msr.3	Q15777	OTTHUMG00000166159	ENST00000358117.5:c.436C>A	11.37:g.30516943G>T	ENSP00000350833:p.Pro146Thr	Somatic		Capture	Illumina HiSeq	Phase_I	30473519	NM_001584	D3DQZ5|E9PB10|Q59GE6	Missense_Mutation	SNP	ENST00000358117.5	37	CCDS7870.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148210	0.57151	.	.	ENSG00000066382	ENST00000448418;ENST00000358117	D;D	0.85411	-1.98;-1.98	5.7	5.7	0.88788	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.80071	0.4556	N	0.20574	0.59	0.80722	D	1	B;P	0.36222	0.034;0.544	B;B	0.42738	0.111;0.396	T	0.75028	-0.3462	10	0.09843	T	0.71	-6.3859	19.8478	0.96722	0.0:0.0:1.0:0.0	.	146;146	Q15777;E9PB10	MPPD2_HUMAN;.	T	146	ENSP00000388258:P146T;ENSP00000350833:P146T	ENSP00000350833:P146T	P	-	1	0	MPPED2	30473519	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.698000	0.92095	0.655000	0.94253	CCA		MPPED2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388155.2	NM_001584	
OR4C15	81309	broad.mit.edu	37	11	55321800	55321800	+	Silent	SNP	A	A	G			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr11:55321800A>G	ENST00000314644.2	+	1	18	c.18A>G	c.(16-18)acA>acG	p.T6T		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T6T(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						CAATGACAACAGAAGCACTCA	0.303										HNSCC(20;0.049)																											p.T6T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A18G	11						.						105.0	105.0	105.0					11																	55321800		2201	4296	6497	55078376	SO:0001819	synonymous_variant	81309	exon1			BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.18A>G	11.37:g.55321800A>G		Somatic		Capture	Illumina HiSeq	Phase_I	55078376	NM_001001920	Q6IFE2	Silent	SNP	ENST00000314644.2	37	CCDS31501.1																																																																																				OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920	
OR5AS1	219447	broad.mit.edu	37	11	55798627	55798627	+	Missense_Mutation	SNP	C	C	G	rs150801187		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr11:55798627C>G	ENST00000313555.1	+	1	733	c.733C>G	c.(733-735)Ctc>Gtc	p.L245V		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L245V(1)		endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					TGCTTCCCACCTCATAGCAGT	0.443																																					p.L245V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C733G	11						.						152.0	129.0	137.0					11																	55798627		2201	4296	6497	55555203	SO:0001583	missense	219447	exon1			AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.733C>G	11.37:g.55798627C>G	ENSP00000324111:p.Leu245Val	Somatic		Capture	Illumina HiSeq	Phase_I	55555203	NM_001001921	Q6IFB8	Missense_Mutation	SNP	ENST00000313555.1	37	CCDS31516.1	.	.	.	.	.	.	.	.	.	.	C	11.26	1.587619	0.28268	.	.	ENSG00000181785	ENST00000313555	T	0.43294	0.95	5.23	3.35	0.38373	GPCR, rhodopsin-like superfamily (1);	0.357378	0.14873	U	0.293457	T	0.52338	0.1728	M	0.84773	2.715	0.23304	N	0.997946	P	0.45715	0.865	P	0.49421	0.61	T	0.51803	-0.8659	10	0.72032	D	0.01	.	4.5439	0.12071	0.1553:0.595:0.0:0.2498	.	245	Q8N127	O5AS1_HUMAN	V	245	ENSP00000324111:L245V	ENSP00000324111:L245V	L	+	1	0	OR5AS1	55555203	0.065000	0.20965	0.679000	0.29978	0.149000	0.21700	0.509000	0.22707	1.206000	0.43276	0.643000	0.83706	CTC		OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921	
MTL5	9633	broad.mit.edu	37	11	68514765	68514765	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr11:68514765G>A	ENST00000255087.5	-	3	724	c.541C>T	c.(541-543)Ctt>Ttt	p.L181F	MTL5_ENST00000443940.2_Missense_Mutation_p.L181F|MTL5_ENST00000540869.1_5'UTR|MTL5_ENST00000544963.1_Missense_Mutation_p.L181F	NM_004923.3	NP_004914.2	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific (tesmin)	181					cell differentiation (GO:0030154)|cellular metal ion homeostasis (GO:0006875)|multicellular organismal development (GO:0007275)|response to metal ion (GO:0010038)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.L181F(1)		breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	15	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			TCCTGAGCAAGAAGATTCTGC	0.403																																					p.L181F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C541T	11						.						138.0	134.0	135.0					11																	68514765		2200	4294	6494	68271341	SO:0001583	missense	9633	exon3			U86074	CCDS8184.1, CCDS44661.1	11q13.2-q13.3	2007-01-03			ENSG00000132749	ENSG00000132749			7446	protein-coding gene	gene with protein product	"""CXC domain containing 2"""	604374				1091092	Standard	XR_428932		Approved	CXCDC2	uc001ooc.3	Q9Y4I5	OTTHUMG00000167891	ENST00000255087.5:c.541C>T	11.37:g.68514765G>A	ENSP00000255087:p.Leu181Phe	Somatic		Capture	Illumina HiSeq	Phase_I	68271341	NM_001039656	A8K8J3|Q4G182|Q6P2E2|Q8NCC8	Missense_Mutation	SNP	ENST00000255087.5	37	CCDS8184.1	.	.	.	.	.	.	.	.	.	.	G	10.71	1.427351	0.25726	.	.	ENSG00000132749	ENST00000255087;ENST00000443940;ENST00000544963	T;T;T	0.47528	1.45;0.84;1.43	5.1	4.18	0.49190	.	0.428985	0.19917	N	0.103161	T	0.44498	0.1296	L	0.29908	0.895	0.09310	N	1	D;D;P	0.58268	0.958;0.982;0.93	P;P;P	0.57911	0.563;0.829;0.564	T	0.22208	-1.0223	10	0.09590	T	0.72	-2.6596	8.8255	0.35052	0.0:0.3064:0.5353:0.1583	.	181;164;181	Q9Y4I5-3;Q6PHY4;Q9Y4I5	.;.;MTL5_HUMAN	F	181	ENSP00000255087:L181F;ENSP00000403086:L181F;ENSP00000440968:L181F	ENSP00000255087:L181F	L	-	1	0	MTL5	68271341	0.028000	0.19301	0.062000	0.19696	0.708000	0.40852	0.455000	0.21843	1.372000	0.46190	0.561000	0.74099	CTT		MTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396844.1	NM_004923	
GRIA4	2893	broad.mit.edu	37	11	105758246	105758246	+	Splice_Site	SNP	T	T	C			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr11:105758246T>C	ENST00000530497.1	+	5	674	c.674T>C	c.(673-675)aTt>aCt	p.I225T	GRIA4_ENST00000282499.5_Splice_Site_p.I225T|GRIA4_ENST00000393127.2_Splice_Site_p.I225T|GRIA4_ENST00000525187.1_Splice_Site_p.I225T|GRIA4_ENST00000428631.2_Splice_Site_p.I225T|GRIA4_ENST00000393125.2_Splice_Site_p.I225T			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	225					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.I225T(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		TCTTCACAGATTGTAAGTGTT	0.264																																					p.I225T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T674C	11						.						89.0	90.0	90.0					11																	105758246		2201	4282	6483	105263456	SO:0001630	splice_region_variant	2893	exon6			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.673-1T>C	11.37:g.105758246T>C		Somatic		Capture	Illumina HiSeq	Phase_I	105263456	NM_001077244	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	T	13.77	2.336428	0.41398	.	.	ENSG00000152578	ENST00000393125;ENST00000282499;ENST00000393127;ENST00000428631;ENST00000530497;ENST00000525187	D;D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74;-1.74	5.01	5.01	0.66863	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.78091	0.4229	L	0.36672	1.1	0.80722	D	1	B;B;P	0.39044	0.066;0.101;0.656	B;B;B	0.39339	0.063;0.138;0.297	T	0.81086	-0.1092	10	0.72032	D	0.01	.	14.6811	0.69017	0.0:0.0:0.0:1.0	.	225;225;225	P48058;G3V164;Q86XE8	GRIA4_HUMAN;.;.	T	225	ENSP00000376833:I225T;ENSP00000282499:I225T;ENSP00000376835:I225T;ENSP00000415551:I225T;ENSP00000435775:I225T;ENSP00000432180:I225T	ENSP00000282499:I225T	I	+	2	0	GRIA4	105263456	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	3.072000	0.50049	2.005000	0.58758	0.455000	0.32223	ATT		GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		Missense_Mutation
CHD4	1108	broad.mit.edu	37	12	6700659	6700659	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr12:6700659G>A	ENST00000357008.2	-	22	3476	c.3313C>T	c.(3313-3315)Cgg>Tgg	p.R1105W	CHD4_ENST00000544040.1_Missense_Mutation_p.R1098W|CHD4_ENST00000544484.1_Missense_Mutation_p.R1102W|CHD4_ENST00000309577.6_Missense_Mutation_p.R1105W	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1105	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.R1105W(1)		central_nervous_system(2)	2						GCCTCTTGCCGCATGTTCCCA	0.433																																					p.R1105W	Colon(32;586 792 4568 16848 45314)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3313T	12						.						179.0	150.0	160.0					12																	6700659		2203	4300	6503	6570920	SO:0001583	missense	1108	exon22			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.3313C>T	12.37:g.6700659G>A	ENSP00000349508:p.Arg1105Trp	Somatic		Capture	Illumina HiSeq	Phase_I	6570920	NM_001273	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.648870	0.87958	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63	5.15	5.15	0.70609	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.98108	0.9376	H	0.99951	5.03	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.992	D	0.99873	1.1099	10	0.87932	D	0	.	18.6317	0.91361	0.0:0.0:1.0:0.0	.	1105;1105;1098	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	W	1102;1098;1105;1105;1079	ENSP00000440392:R1102W;ENSP00000440542:R1098W;ENSP00000312419:R1105W;ENSP00000349508:R1105W	ENSP00000312419:R1105W	R	-	1	2	CHD4	6570920	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.720000	0.68470	2.409000	0.81822	0.655000	0.94253	CGG		CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
SLC6A15	55117	broad.mit.edu	37	12	85279295	85279295	+	Missense_Mutation	SNP	T	T	C	rs201563753		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr12:85279295T>C	ENST00000266682.5	-	4	1034	c.493A>G	c.(493-495)Agt>Ggt	p.S165G	SLC6A15_ENST00000552192.1_Missense_Mutation_p.S58G|SLC6A15_ENST00000551388.1_Intron|SLC6A15_ENST00000450363.3_Missense_Mutation_p.S165G	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	165					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)			kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						TAAAACAAACTCCAGCCAATG	0.368																																					p.S165G												.	.	0			c.A493G	12						.						100.0	97.0	98.0					12																	85279295		2203	4300	6503	83803426	SO:0001583	missense	55117	exon4			AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.493A>G	12.37:g.85279295T>C	ENSP00000266682:p.Ser165Gly	None		Capture	Illumina HiSeq	Phase_I	83803426	NM_018057	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Missense_Mutation	SNP	ENST00000266682.5	37	CCDS9026.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.824505	0.90955	.	.	ENSG00000072041	ENST00000266682;ENST00000552192;ENST00000450363	T;T;T	0.74842	-0.88;-0.88;-0.88	5.15	5.15	0.70609	.	0.133317	0.64402	D	0.000002	T	0.80849	0.4702	M	0.63208	1.945	0.52099	D	0.999947	P;P	0.39831	0.482;0.69	P;P	0.52189	0.497;0.692	T	0.79914	-0.1602	10	0.38643	T	0.18	.	15.3158	0.74078	0.0:0.0:0.0:1.0	.	165;165	Q9H9F5;Q9H2J7	.;S6A15_HUMAN	G	165;58;165	ENSP00000266682:S165G;ENSP00000450145:S58G;ENSP00000390706:S165G	ENSP00000266682:S165G	S	-	1	0	SLC6A15	83803426	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.606000	0.82863	2.079000	0.62486	0.472000	0.43445	AGT		SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
CCER1	196477	broad.mit.edu	37	12	91348243	91348243	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr12:91348243G>A	ENST00000358859.2	-	1	710	c.277C>T	c.(277-279)Cgc>Tgc	p.R93C	CCER1_ENST00000548187.1_Intron	NM_152638.2	NP_689851.1	Q8TC90	CCER1_HUMAN	coiled-coil glutamate-rich protein 1	93								p.R93C(1)									GGGGGTGGGCGCCAGGGCCCT	0.637																																					p.R93C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C277T	12						.						27.0	33.0	31.0					12																	91348243		2203	4300	6503	89872374	SO:0001583	missense	196477	exon1			BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651			28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12		17967063	Standard	NM_152638		Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000358859.2:c.277C>T	12.37:g.91348243G>A	ENSP00000351727:p.Arg93Cys	Somatic		Capture	Illumina HiSeq	Phase_I	89872374	NM_152638	Q8TC47	Missense_Mutation	SNP	ENST00000358859.2	37	CCDS9036.1	.	.	.	.	.	.	.	.	.	.	G	7.101	0.574089	0.13623	.	.	ENSG00000197651	ENST00000358859	T	0.32272	1.46	4.62	-0.187	0.13268	.	1.073890	0.07405	N	0.891409	T	0.18002	0.0432	N	0.14661	0.345	0.23577	N	0.997371	B	0.17465	0.022	B	0.09377	0.004	T	0.27971	-1.0058	10	0.44086	T	0.13	-0.3391	8.1359	0.31054	0.2969:0.0:0.7031:0.0	.	93	Q8TC90	CL012_HUMAN	C	93	ENSP00000351727:R93C	ENSP00000351727:R93C	R	-	1	0	C12orf12	89872374	0.050000	0.20438	0.042000	0.18584	0.387000	0.30353	-0.229000	0.09098	-0.239000	0.09710	0.462000	0.41574	CGC		CCER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407142.2	NM_152638	
GPR133	283383	broad.mit.edu	37	12	131569153	131569153	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr12:131569153G>A	ENST00000261654.5	+	15	2175	c.1616G>A	c.(1615-1617)tGc>tAc	p.C539Y	GPR133_ENST00000376682.4_Missense_Mutation_p.C225Y|GPR133_ENST00000535015.1_Missense_Mutation_p.C571Y|GPR133_ENST00000543617.1_Missense_Mutation_p.C58Y	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	539	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.C539Y(1)		NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TACTCCGTCTGCCGCTGCACT	0.622																																					p.C539Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1616A	12						.						144.0	98.0	113.0					12																	131569153		2203	4300	6503	130135106	SO:0001583	missense	283383	exon15			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1616G>A	12.37:g.131569153G>A	ENSP00000261654:p.Cys539Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	130135106	NM_198827	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	CCDS9272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.30|19.30	3.800914|3.800914	0.70567|0.70567	.|.	.|.	ENSG00000111452|ENSG00000111452	ENST00000335486|ENST00000261654;ENST00000535015;ENST00000376682;ENST00000543617	.|D;D;D;D	.|0.87029	.|-2.2;-2.2;-2.2;-2.2	4.99|4.99	4.99|4.99	0.66335|0.66335	.|GPS domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.96210|0.96210	0.8764|0.8764	H|H	0.98407|0.98407	4.225|4.225	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;0.999;1.0	D|D	0.97898|0.97898	1.0301|1.0301	5|10	.|0.87932	.|D	.|0	.|.	15.7511|15.7511	0.77986|0.77986	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|571;58;539	.|B7ZLF7;Q6QNK2-3;Q6QNK2	.|.;.;GP133_HUMAN	T|Y	61|539;571;225;58	.|ENSP00000261654:C539Y;ENSP00000444425:C571Y;ENSP00000365872:C225Y;ENSP00000438021:C58Y	.|ENSP00000261654:C539Y	A|C	+|+	1|2	0|0	GPR133|GPR133	130135106|130135106	1.000000|1.000000	0.71417|0.71417	0.971000|0.971000	0.41717|0.41717	0.573000|0.573000	0.36030|0.36030	7.999000|7.999000	0.88496|0.88496	2.309000|2.309000	0.77851|0.77851	0.585000|0.585000	0.79938|0.79938	GCC|TGC		GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
CENPJ	55835	broad.mit.edu	37	13	25478172	25478172	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr13:25478172delA	ENST00000381884.4	-	8	2902	c.2717delT	c.(2716-2718)ttgfs	p.L906fs	CENPJ_ENST00000545981.1_Frame_Shift_Del_p.L906fs	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	906					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)	p.L906fs*1(1)		endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TTTCTCTCTCAAAACCTGGGA	0.368																																					p.L906X												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2717delT	13						.						130.0	127.0	128.0					13																	25478172		2203	4300	6503	24376172	SO:0001589	frameshift_variant	55835	exon8			AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.2717delT	13.37:g.25478172delA	ENSP00000371308:p.Leu906fs	Somatic		Capture	Illumina HiSeq	Phase_I	24376172	NM_018451	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Frame_Shift_Del	DEL	ENST00000381884.4	37	CCDS9310.1																																																																																				CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451	
MDGA2	161357	broad.mit.edu	37	14	47389300	47389300	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr14:47389300C>T	ENST00000399232.2	-	10	2310	c.1946G>A	c.(1945-1947)cGt>cAt	p.R649H	MDGA2_ENST00000439988.3_Missense_Mutation_p.R718H|MDGA2_ENST00000357362.3_Missense_Mutation_p.R420H|MDGA2_ENST00000426342.1_Missense_Mutation_p.R420H	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	649	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.R420H(1)|p.R718H(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						AGAATAAACACGGTGTCTGTT	0.423																																					p.R420H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1259A	14						.						159.0	150.0	153.0					14																	47389300		1902	4134	6036	46459050	SO:0001583	missense	161357	exon10			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.1946G>A	14.37:g.47389300C>T	ENSP00000382178:p.Arg649His	Somatic		Capture	Illumina HiSeq	Phase_I	46459050	NM_182830	F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	37		.	.	.	.	.	.	.	.	.	.	C	24.0	4.478170	0.84747	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	5.39	5.39	0.77823	.	0.139331	0.33005	U	0.005385	T	0.55289	0.1911	L	0.44542	1.39	0.80722	D	1	D;D	0.54397	0.963;0.966	P;P	0.54100	0.742;0.72	T	0.55704	-0.8099	10	0.54805	T	0.06	.	10.4648	0.44600	0.0:0.9113:0.0:0.0887	.	420;649	F6W3S7;Q7Z553	.;MDGA2_HUMAN	H	649;420;718;420	ENSP00000400011:R649H;ENSP00000405456:R420H;ENSP00000382178:R718H;ENSP00000349925:R420H	ENSP00000349925:R420H	R	-	2	0	MDGA2	46459050	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.515000	0.60489	2.699000	0.92147	0.591000	0.81541	CGT		MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830	
FERMT2	10979	broad.mit.edu	37	14	53331529	53331529	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr14:53331529A>C	ENST00000395631.2	-	11	1532	c.1316T>G	c.(1315-1317)tTt>tGt	p.F439C	FERMT2_ENST00000341590.3_Missense_Mutation_p.F439C|FERMT2_ENST00000553373.1_Missense_Mutation_p.F439C|FERMT2_ENST00000557255.1_5'Flank|FERMT2_ENST00000399304.3_Missense_Mutation_p.F439C|FERMT2_ENST00000343279.4_Missense_Mutation_p.F439C			Q96AC1	FERM2_HUMAN	fermitin family member 2	439	FERM.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)	p.F439C(1)	ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					TTTAATGTTAAATTTTTGGCC	0.308																																					p.F439C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1316G	14						.						113.0	115.0	114.0					14																	53331529		2203	4300	6503	52401279	SO:0001583	missense	10979	exon11			Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.1316T>G	14.37:g.53331529A>C	ENSP00000378993:p.Phe439Cys	Somatic		Capture	Illumina HiSeq	Phase_I	52401279	NM_001134999	B5TJY2|Q14840|Q86TY7	De_novo_Start_OutOfFrame	SNP	ENST00000395631.2	37	CCDS9713.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.401765	0.83120	.	.	ENSG00000073712	ENST00000395631;ENST00000341590;ENST00000554152;ENST00000343279;ENST00000553373;ENST00000399304	D;D;D;D;D;D	0.96554	-4.05;-4.05;-4.05;-4.05;-4.05;-4.05	5.56	5.56	0.83823	Band 4.1 domain (1);FERM central domain (2);Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.048504	0.85682	D	0.000000	D	0.98115	0.9378	M	0.82716	2.605	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.992;0.998;0.988	D	0.99160	1.0861	10	0.87932	D	0	.	16.0103	0.80399	1.0:0.0:0.0:0.0	.	439;439;439	Q96AC1-2;Q96AC1;B5TJY2	.;FERM2_HUMAN;.	C	439;439;392;439;439;439	ENSP00000378993:F439C;ENSP00000340391:F439C;ENSP00000450741:F392C;ENSP00000342858:F439C;ENSP00000451084:F439C;ENSP00000382243:F439C	ENSP00000340391:F439C	F	-	2	0	FERMT2	52401279	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.245000	0.95431	2.234000	0.73211	0.519000	0.50382	TTT		FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276907.2	NM_006832	
RTN1	6252	broad.mit.edu	37	14	60194227	60194227	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr14:60194227G>A	ENST00000267484.5	-	3	1510	c.1175C>T	c.(1174-1176)cCg>cTg	p.P392L		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	392					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)		p.P392L(1)		central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		GATGGTTGGCGGTCCGGACCT	0.672																																					p.P392L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1175T	14						.						16.0	16.0	16.0					14																	60194227		2197	4292	6489	59263980	SO:0001583	missense	6252	exon3			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1175C>T	14.37:g.60194227G>A	ENSP00000267484:p.Pro392Leu	Somatic		Capture	Illumina HiSeq	Phase_I	59263980	NM_021136	Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	ENST00000267484.5	37	CCDS9740.1	.	.	.	.	.	.	.	.	.	.	G	5.132	0.209891	0.09757	.	.	ENSG00000139970	ENST00000267484;ENST00000433623	T	0.21543	2.0	5.49	-0.677	0.11357	.	1.223610	0.05794	N	0.610853	T	0.07098	0.0180	N	0.01048	-1.04	0.28392	N	0.919033	B	0.02656	0.0	B	0.01281	0.0	T	0.32981	-0.9886	10	0.33940	T	0.23	.	6.9424	0.24500	0.3684:0.4399:0.1917:0.0	.	392	Q16799	RTN1_HUMAN	L	392;318	ENSP00000267484:P392L	ENSP00000267484:P392L	P	-	2	0	RTN1	59263980	0.022000	0.18835	0.967000	0.41034	0.084000	0.17831	0.028000	0.13644	-0.016000	0.14127	-0.878000	0.02970	CCG		RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2		
NRXN3	9369	broad.mit.edu	37	14	79270092	79270092	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr14:79270092C>T	ENST00000554719.1	+	6	1546	c.1055C>T	c.(1054-1056)aCg>aTg	p.T352M	NRXN3_ENST00000335750.5_Missense_Mutation_p.T352M	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	129					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.T352M(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CTGGTGGCTACGACCTCCAGG	0.552																																					p.T352M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1055T	14						.						156.0	115.0	129.0					14																	79270092		2203	4300	6503	78339845	SO:0001583	missense	9369	exon6			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.1055C>T	14.37:g.79270092C>T	ENSP00000451648:p.Thr352Met	Somatic		Capture	Illumina HiSeq	Phase_I	78339845	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	37	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.765873	0.90020	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	T;T	0.78364	-1.17;-1.17	6.17	6.17	0.99709	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.110305	0.64402	D	0.000008	D	0.88869	0.6554	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.73708	0.974;0.981	D	0.87145	0.2205	8	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	725;352	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	M	725;723;352;352	ENSP00000451648:T352M;ENSP00000338349:T352M	.	T	+	2	0	NRXN3	78339845	1.000000	0.71417	0.142000	0.22268	0.979000	0.70002	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	ACG		NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250	
GOLGA5	9950	broad.mit.edu	37	14	93264125	93264125	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr14:93264125A>C	ENST00000163416.2	+	2	599	c.343A>C	c.(343-345)Aag>Cag	p.K115Q	GOLGA5_ENST00000355976.2_Missense_Mutation_p.K115Q	NM_005113.2	NP_005104	Q8TBA6	GOGA5_HUMAN	golgin A5	115					Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)	p.K114N(1)|p.K115Q(1)		large_intestine(6)|lung(1)|ovary(2)	9		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)		GCGAAGAAAAAAGTCAGAACC	0.448			T	RET	papillary thyroid																																p.K115Q			Dom	yes		14	14q	9950	"""golgi autoantigen, golgin subfamily a, 5  (PTC5)"""		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A343C	14						.						90.0	88.0	89.0					14																	93264125		2203	4300	6503	92333878	SO:0001583	missense	9950	exon2			AF085199	CCDS9905.1	14q32.12	2012-05-04	2010-02-12		ENSG00000066455	ENSG00000066455			4428	protein-coding gene	gene with protein product	"""golgi integral membrane protein 5"""	606918	"""golgi autoantigen, golgin subfamily a, 5"""			2734021, 9443391, 15004235	Standard	NM_005113		Approved	ret-II, golgin-84, rfg5, GOLIM5	uc001yaz.1	Q8TBA6	OTTHUMG00000171217	ENST00000163416.2:c.343A>C	14.37:g.93264125A>C	ENSP00000163416:p.Lys115Gln	Somatic		Capture	Illumina HiSeq	Phase_I	92333878	NM_005113	C9JRU1|O95287|Q03962|Q2TS49|Q9UQQ7	Missense_Mutation	SNP	ENST00000163416.2	37	CCDS9905.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.513620	0.85389	.	.	ENSG00000066455	ENST00000163416;ENST00000355976	T;T	0.41400	1.01;1.0	5.45	5.45	0.79879	.	0.000000	0.51477	D	0.000093	T	0.63331	0.2502	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.65207	-0.6224	10	0.54805	T	0.06	-31.3613	15.8164	0.78604	1.0:0.0:0.0:0.0	.	115	Q8TBA6	GOGA5_HUMAN	Q	115	ENSP00000163416:K115Q;ENSP00000348252:K115Q	ENSP00000163416:K115Q	K	+	1	0	GOLGA5	92333878	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.079000	0.89508	2.195000	0.70347	0.533000	0.62120	AAG		GOLGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412365.1		
ATP10A	57194	broad.mit.edu	37	15	25947098	25947098	+	Missense_Mutation	SNP	C	C	T	rs202137938		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr15:25947098C>T	ENST00000356865.6	-	13	2836	c.2725G>A	c.(2725-2727)Gac>Aac	p.D909N		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	909					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.D909N(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		ACCTCCTCGTCGTGGTCCAGC	0.542																																					p.D909N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2725A	15						.						176.0	152.0	160.0					15																	25947098		2203	4300	6503	23498191	SO:0001583	missense	57194	exon13			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.2725G>A	15.37:g.25947098C>T	ENSP00000349325:p.Asp909Asn	Somatic		Capture	Illumina HiSeq	Phase_I	23498191	NM_024490	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	C	10.53	1.374710	0.24857	.	.	ENSG00000206190	ENST00000356865	D	0.94576	-3.46	5.51	4.6	0.57074	HAD-like domain (2);	0.319446	0.39759	N	0.001272	D	0.91012	0.7173	L	0.40543	1.245	0.18873	N	0.999984	B	0.24483	0.104	B	0.20184	0.028	T	0.82849	-0.0254	10	0.44086	T	0.13	-9.3553	14.3824	0.66921	0.0:0.9289:0.0:0.0711	.	909	O60312	AT10A_HUMAN	N	909	ENSP00000349325:D909N	ENSP00000349325:D909N	D	-	1	0	ATP10A	23498191	0.997000	0.39634	0.003000	0.11579	0.267000	0.26476	4.712000	0.61888	1.335000	0.45486	0.655000	0.94253	GAC		ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
MAP1A	4130	broad.mit.edu	37	15	43814034	43814034	+	Silent	SNP	C	C	T	rs552869456		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr15:43814034C>T	ENST00000300231.5	+	4	813	c.363C>T	c.(361-363)agC>agT	p.S121S	MAP1A_ENST00000399453.1_Silent_p.S121S|MAP1A_ENST00000382031.1_Silent_p.S359S			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	121					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)	p.S121S(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GCAGTTACAGCGACTGGGTGA	0.552													C|||	1	0.000199681	0.0	0.0014	5008	,	,		22247	0.0		0.0	False		,,,				2504	0.0				p.S121S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C363T	15						.						127.0	133.0	131.0					15																	43814034		2069	4208	6277	41601326	SO:0001819	synonymous_variant	4130	exon4			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.363C>T	15.37:g.43814034C>T		Somatic		Capture	Illumina HiSeq	Phase_I	41601326	NM_002373	O95643|Q12973|Q15882|Q9UJT4	Silent	SNP	ENST00000300231.5	37	CCDS42031.1																																																																																				MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
STRC	161497	broad.mit.edu	37	15	43900093	43900093	+	Silent	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr15:43900093G>A	ENST00000450892.2	-	18	3839	c.3762C>T	c.(3760-3762)aaC>aaT	p.N1254N	STRC_ENST00000541030.1_Silent_p.N481N	NM_153700.2	NP_714544.1	Q7RTU9	STRC_HUMAN	stereocilin	1254					auditory receptor cell stereocilium organization (GO:0060088)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)	kinocilium (GO:0060091)|stereocilium bundle tip (GO:0032426)		p.N1254N(1)		skin(4)	4		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		TATCCAGCCCGTTCAGTTCTG	0.537																																					p.N1254N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3762T	15						.																																			41687385	SO:0001819	synonymous_variant	161497	exon18			BK000138	CCDS10098.1	15q15.3	2010-02-26			ENSG00000242866	ENSG00000242866			16035	protein-coding gene	gene with protein product		606440		DFNB16		11687802, 9429146	Standard	NM_153700		Approved		uc001zsf.3	Q7RTU9	OTTHUMG00000059899	ENST00000450892.2:c.3762C>T	15.37:g.43900093G>A		Somatic		Capture	Illumina HiSeq	Phase_I	41687385	NM_153700		De_novo_Start_OutOfFrame	SNP	ENST00000450892.2	37	CCDS10098.1																																																																																				STRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133140.1	NM_153700	
HCN4	10021	broad.mit.edu	37	15	73635795	73635795	+	Silent	SNP	C	C	T	rs370059727		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr15:73635795C>T	ENST00000261917.3	-	2	2133	c.1140G>A	c.(1138-1140)acG>acA	p.T380T	RP11-272D12.1_ENST00000558742.1_RNA|RP11-272D12.1_ENST00000557981.1_RNA	NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	380					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.T380T(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		TGAGGATCTTCGTGAAGCGGA	0.552																																					p.T380T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1140A	15						.	C		0,4396		0,0,2198	92.0	73.0	79.0		1140	1.3	1.0	15		79	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	HCN4	NM_005477.2		0,1,6494	TT,TC,CC		0.0116,0.0,0.0077		380/1204	73635795	1,12989	2198	4297	6495	71422848	SO:0001819	synonymous_variant	10021	exon2			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1140G>A	15.37:g.73635795C>T		Somatic		Capture	Illumina HiSeq	Phase_I	71422848	NM_005477	Q9UMQ7	Silent	SNP	ENST00000261917.3	37	CCDS10248.1																																																																																				HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
PALB2	79728	broad.mit.edu	37	16	23614975	23614975	+	Silent	SNP	G	G	A	rs373783514		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr16:23614975G>A	ENST00000261584.4	-	13	3518	c.3366C>T	c.(3364-3366)gaC>gaT	p.D1122D	CTD-2196E14.3_ENST00000561764.1_RNA	NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	1122	Interaction with RAD51, BRCA2 and POLH.|Required for interaction with POLH and POLH DNA synthesis stimulation.				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D1124D(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		GATCTTTCACGTCACCTTCCA	0.403			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																													p.D1122D		yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3366T	16						.	G		0,4394		0,0,2197	79.0	70.0	73.0		3366	-11.2	0.7	16		73	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PALB2	NM_024675.3		0,1,6496	AA,AG,GG		0.0116,0.0,0.0077		1122/1187	23614975	1,12993	2197	4300	6497	23522476	SO:0001819	synonymous_variant	79728	exon13				CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.3366C>T	16.37:g.23614975G>A		Somatic		Capture	Illumina HiSeq	Phase_I	23522476	NM_024675	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Silent	SNP	ENST00000261584.4	37	CCDS32406.1																																																																																				PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675	
ADAMTS18	170692	broad.mit.edu	37	16	77326975	77326975	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr16:77326975C>T	ENST00000282849.5	-	20	3605	c.3187G>A	c.(3187-3189)Gag>Aag	p.E1063K	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1063	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E1063K(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ATCCATACCTCGCTCCACGAA	0.527																																					p.E1063K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3187A	16						.						70.0	64.0	66.0					16																	77326975		2198	4300	6498	75884476	SO:0001583	missense	170692	exon20			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3187G>A	16.37:g.77326975C>T	ENSP00000282849:p.Glu1063Lys	Somatic		Capture	Illumina HiSeq	Phase_I	75884476	NM_199355	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.161752	0.78226	.	.	ENSG00000140873	ENST00000282849	T	0.54279	0.58	5.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.66954	0.2842	L	0.61218	1.895	0.58432	D	0.999994	D;D	0.60160	0.974;0.987	P;P	0.62491	0.674;0.903	T	0.68224	-0.5465	10	0.56958	D	0.05	.	15.4607	0.75353	0.0:0.8614:0.1386:0.0	.	1063;1063	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	K	1063	ENSP00000282849:E1063K	ENSP00000282849:E1063K	E	-	1	0	ADAMTS18	75884476	1.000000	0.71417	1.000000	0.80357	0.018000	0.09664	5.451000	0.66632	2.753000	0.94483	0.557000	0.71058	GAG		ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R175H	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,lung,NS,Substitution - Missense,0 	.	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	c.G524A	17	GRCh37	CM062017|CM951224	TP53	M	rs28934578	.						50.0	50.0	50.0					17																	7578406		2203	4300	6503	7519131	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	Somatic		Capture	Illumina HiSeq	Phase_I	7519131	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
EFNB3	1949	broad.mit.edu	37	17	7611833	7611833	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr17:7611833C>T	ENST00000226091.2	+	3	893	c.496C>T	c.(496-498)Cga>Tga	p.R166*		NM_001406.3	NP_001397.1	Q15768	EFNB3_HUMAN	ephrin-B3	166	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.		R -> Q.		adult walking behavior (GO:0007628)|axon choice point recognition (GO:0016198)|axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)	p.R166*(1)		large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	8		all_cancers(10;1.14e-06)|Prostate(122;0.081)				GGTGCTTCTCCGAGTGGGACA	0.622																																					p.R166X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C496T	17						.						72.0	62.0	66.0					17																	7611833		2203	4299	6502	7552558	SO:0001587	stop_gained	1949	exon3			U57001	CCDS11120.1	17p13.1	2011-03-09			ENSG00000108947	ENSG00000108947		"""Ephrins"""	3228	protein-coding gene	gene with protein product		602297		EPLG8		9126477	Standard	NM_001406		Approved	LERK-8	uc002gis.3	Q15768	OTTHUMG00000108161	ENST00000226091.2:c.496C>T	17.37:g.7611833C>T	ENSP00000226091:p.Arg166*	Somatic		Capture	Illumina HiSeq	Phase_I	7552558	NM_001406	B2RBW2|D3DTQ6|O00680|Q8TBH7|Q92875	Nonsense_Mutation	SNP	ENST00000226091.2	37	CCDS11120.1	.	.	.	.	.	.	.	.	.	.	c	29.3	4.998684	0.93227	.	.	ENSG00000108947	ENST00000226091	.	.	.	4.58	2.56	0.30785	.	0.081143	0.49916	D	0.000136	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-3.7129	5.9398	0.19186	0.4599:0.4489:0.0:0.0911	.	.	.	.	X	166	.	ENSP00000226091:R166X	R	+	1	2	EFNB3	7552558	0.961000	0.32948	0.979000	0.43373	0.046000	0.14306	2.022000	0.41030	0.529000	0.28599	-0.371000	0.07208	CGA		EFNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226965.1	NM_001406	
ZNF99	7652	broad.mit.edu	37	19	22940555	22940555	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr19:22940555G>T	ENST00000596209.1	-	4	2246	c.2156C>A	c.(2155-2157)aCt>aAt	p.T719N	CTC-451A6.4_ENST00000442497.2_lincRNA|ZNF99_ENST00000397104.3_Missense_Mutation_p.T628N	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	719					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T628N(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TTTTCTAAGAGTTGAGGACTG	0.358																																					p.T628N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1883A	19						.						41.0	44.0	43.0					19																	22940555		2080	4219	6299	22732395	SO:0001583	missense	7652	exon5			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.2156C>A	19.37:g.22940555G>T	ENSP00000472969:p.Thr719Asn	Somatic		Capture	Illumina HiSeq	Phase_I	22732395	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	g	0.005	-2.212798	0.00289	.	.	ENSG00000213973	ENST00000397104	T	0.07444	3.19	0.543	-1.09	0.09904	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02418	0.0074	N	0.03268	-0.37	0.09310	N	1	B	0.28998	0.23	B	0.29862	0.108	T	0.39643	-0.9604	9	0.02654	T	1	.	2.7923	0.05391	0.0:0.216:0.2751:0.5088	.	628	A8MXY4	ZNF99_HUMAN	N	628	ENSP00000380293:T628N	ENSP00000380293:T628N	T	-	2	0	ZNF99	22732395	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.137000	0.01304	-0.561000	0.06094	-0.755000	0.03482	ACT		ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
ZNF526	116115	broad.mit.edu	37	19	42729056	42729056	+	Silent	SNP	G	G	A	rs57984044	byFrequency	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr19:42729056G>A	ENST00000301215.3	+	3	726	c.501G>A	c.(499-501)acG>acA	p.T167T		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	167					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T167T(1)		autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				TTTCTGCTACGGTAGCTGAGC	0.602													G|||	38	0.00758786	0.0287	0.0	5008	,	,		19123	0.0		0.0	False		,,,				2504	0.0				p.T167T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G501A	19						.	G		95,4311	77.3+/-115.6	1,93,2109	96.0	88.0	90.0		501	-1.4	0.0	19	dbSNP_129	90	0,8600		0,0,4300	no	coding-synonymous	ZNF526	NM_133444.1		1,93,6409	AA,AG,GG		0.0,2.1562,0.7304		167/671	42729056	95,12911	2203	4300	6503	47420896	SO:0001819	synonymous_variant	116115	exon3			AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.501G>A	19.37:g.42729056G>A		Somatic		Capture	Illumina HiSeq	Phase_I	47420896	NM_133444	B3KV29|Q69YI2|Q96E24	Silent	SNP	ENST00000301215.3	37	CCDS12598.1																																																																																				ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463681.2	XM_057401	
KLK15	55554	broad.mit.edu	37	19	51330148	51330148	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr19:51330148C>A	ENST00000598239.1	-	3	497	c.467G>T	c.(466-468)aGc>aTc	p.S156I	KLK15_ENST00000416184.1_Intron|KLK15_ENST00000301421.2_Missense_Mutation_p.S156I|KLK15_ENST00000596931.1_Missense_Mutation_p.S155I|KLK15_ENST00000326856.4_Missense_Mutation_p.S155I	NM_017509.2	NP_059979.2	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15	156	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.			SHNEPGTAGSPRSQ -> PLSSP (in Ref. 2). {ECO:0000305}.		extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.S156I(1)		breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		TGACCGGGGGCTCCCAGCGGT	0.682																																					p.S156I	Pancreas(140;10 2513 7143 9246)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G467T	19						.						30.0	32.0	31.0					19																	51330148		2203	4300	6503	56021960	SO:0001583	missense	55554	exon3			AF242195	CCDS12805.1, CCDS12806.1, CCDS12806.2, CCDS62766.1	19q13.4	2008-02-05	2006-10-27			ENSG00000174562		"""Kallikreins"""	20453	protein-coding gene	gene with protein product		610601	"""kallikrein 15"""			11010966, 12439720, 16800724, 16800723	Standard	NM_017509		Approved	HSRNASPH, ACO, prostinogen	uc002ptl.3	Q9H2R5		ENST00000598239.1:c.467G>T	19.37:g.51330148C>A	ENSP00000469315:p.Ser156Ile	Somatic		Capture	Illumina HiSeq	Phase_I	56021960	NM_017509	A0AUY8|Q15358|Q6ISI0|Q9H2R3|Q9H2R4|Q9H2R6|Q9HBG9	Missense_Mutation	SNP	ENST00000598239.1	37	CCDS12805.1	.	.	.	.	.	.	.	.	.	.	c	10.26	1.300483	0.23650	.	.	ENSG00000174562	ENST00000326856;ENST00000301421;ENST00000544946	D	0.87809	-2.3	4.5	3.46	0.39613	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.750232	0.11955	N	0.513286	D	0.84347	0.5452	L	0.27053	0.805	0.09310	N	1	B;P;P	0.48998	0.001;0.918;0.918	B;P;P	0.52386	0.005;0.697;0.697	T	0.73525	-0.3955	10	0.45353	T	0.12	.	8.6939	0.34284	0.0:0.8947:0.0:0.1053	.	156;155;156	Q6UBM2;Q6ISI0;Q9H2R5	.;.;KLK15_HUMAN	I	156	ENSP00000301421:S156I	ENSP00000301421:S156I	S	-	2	0	KLK15	56021960	0.000000	0.05858	0.005000	0.12908	0.007000	0.05969	0.469000	0.22067	1.265000	0.44215	0.555000	0.69702	AGC		KLK15-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465160.1	NM_017509	
ZNF761	388561	broad.mit.edu	37	19	53959594	53959594	+	RNA	SNP	T	T	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr19:53959594T>A	ENST00000454407.1	+	0	2286							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C557*(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		GTAATGAGTGTGGCAAGACCT	0.393																																					p.W612R												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T1834A	19						.						134.0	137.0	136.0					19																	53959594		2203	4300	6503	58651406			388561	exon6			AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53959594T>A		Somatic		Capture	Illumina HiSeq	Phase_I	58651406	NM_001008401	Q6ZNB9	Nonsense_Mutation	SNP	ENST00000454407.1	37																																																																																					ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401	
NLRP5	126206	broad.mit.edu	37	19	56539106	56539106	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr19:56539106G>A	ENST00000390649.3	+	7	1507	c.1507G>A	c.(1507-1509)Gcc>Acc	p.A503T		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	503	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)	p.A503T(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		AGGCCTGCACGCCGCTTTTGT	0.632																																					p.A503T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1507A	19						.						33.0	35.0	34.0					19																	56539106		2122	4227	6349	61230918	SO:0001583	missense	126206	exon7			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1507G>A	19.37:g.56539106G>A	ENSP00000375063:p.Ala503Thr	Somatic		Capture	Illumina HiSeq	Phase_I	61230918	NM_153447	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	G	9.707	1.155978	0.21454	.	.	ENSG00000171487	ENST00000390649	T	0.69685	-0.42	2.98	1.93	0.25924	.	0.213980	0.23801	N	0.044428	T	0.43077	0.1231	L	0.31420	0.93	0.09310	N	1	P	0.43607	0.812	B	0.36845	0.234	T	0.31280	-0.9949	10	0.11485	T	0.65	.	6.1457	0.20285	0.142:0.0:0.858:0.0	.	503	P59047	NALP5_HUMAN	T	503	ENSP00000375063:A503T	ENSP00000375063:A503T	A	+	1	0	NLRP5	61230918	0.000000	0.05858	0.007000	0.13788	0.004000	0.04260	-0.056000	0.11787	0.817000	0.34445	0.561000	0.74099	GCC		NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
KHSRP	8570	broad.mit.edu	37	19	6416853	6416853	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr19:6416853G>A	ENST00000398148.3	-	13	1315	c.1223C>T	c.(1222-1224)cCg>cTg	p.P408L	MIR3940_ENST00000579148.1_RNA	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	408	Gly-rich.				gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.P408L(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						TCGGCCCCCCGGGGGCATGCC	0.652																																					p.P408L	Colon(55;593 1006 2067 9135 22980)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1223T	19						.						15.0	18.0	17.0					19																	6416853		1895	4104	5999	6367853	SO:0001583	missense	8570	exon13			U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.1223C>T	19.37:g.6416853G>A	ENSP00000381216:p.Pro408Leu	Somatic		Capture	Illumina HiSeq	Phase_I	6367853	NM_003685	O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Missense_Mutation	SNP	ENST00000398148.3	37	CCDS45936.1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.515347	0.44763	.	.	ENSG00000088247	ENST00000398148;ENST00000201886	T	0.37411	1.2	5.53	5.53	0.82687	.	0.159653	0.56097	D	0.000032	T	0.34745	0.0908	L	0.58101	1.795	0.58432	D	0.999996	B	0.34264	0.446	B	0.21360	0.034	T	0.16100	-1.0414	10	0.42905	T	0.14	.	18.2323	0.89937	0.0:0.0:1.0:0.0	.	408	Q92945	FUBP2_HUMAN	L	408	ENSP00000381216:P408L	ENSP00000201886:P408L	P	-	2	0	KHSRP	6367853	1.000000	0.71417	0.962000	0.40283	0.793000	0.44817	5.005000	0.63972	2.587000	0.87381	0.655000	0.94253	CCG		KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453305.1		
FBN3	84467	broad.mit.edu	37	19	8152977	8152977	+	Missense_Mutation	SNP	C	C	T	rs372550025		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr19:8152977C>T	ENST00000600128.1	-	52	6877	c.6463G>A	c.(6463-6465)Ggc>Agc	p.G2155S	FBN3_ENST00000270509.2_Missense_Mutation_p.G2155S|FBN3_ENST00000601739.1_Missense_Mutation_p.G2155S			Q75N90	FBN3_HUMAN	fibrillin 3	2155	EGF-like 34; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.G2155S(2)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GGCTCAAAGCCGTCAGCACAG	0.617																																					p.G2155S												.	.	2	Substitution - Missense(2)	large_intestine(1)|central_nervous_system(1)	c.G6463A	19						.	C	SER/GLY	0,4406		0,0,2203	115.0	93.0	101.0		6463	4.0	0.9	19		101	1,8599	1.2+/-3.3	0,1,4299	no	missense	FBN3	NM_032447.3	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	2155/2810	8152977	1,13005	2203	4300	6503	8058977	SO:0001583	missense	84467	exon51				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.6463G>A	19.37:g.8152977C>T	ENSP00000470498:p.Gly2155Ser	Somatic		Capture	Illumina HiSeq	Phase_I	8058977	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.249835	0.80024	0.0	1.16E-4	ENSG00000142449	ENST00000270509;ENST00000341066	D	0.92348	-3.02	4.03	4.03	0.46877	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.96012	0.8701	M	0.86864	2.845	0.80722	D	1	D	0.65815	0.995	P	0.62649	0.905	D	0.97056	0.9767	10	0.87932	D	0	.	16.5178	0.84305	0.0:1.0:0.0:0.0	.	2155	Q75N90	FBN3_HUMAN	S	2155;261	ENSP00000270509:G2155S	ENSP00000270509:G2155S	G	-	1	0	FBN3	8058977	1.000000	0.71417	0.905000	0.35620	0.442000	0.32017	5.511000	0.67024	1.951000	0.56629	0.313000	0.20887	GGC		FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
PSG8	440533	broad.mit.edu	37	19	43258581	43258581	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr19:43258581delG	ENST00000306511.4	-	5	1244	c.1147delC	c.(1147-1149)caafs	p.Q383fs	PSG8_ENST00000404209.4_Frame_Shift_Del_p.Q383fs|PSG8_ENST00000406636.3_Frame_Shift_Del_p.Q261fs|PSG8_ENST00000401467.2_Frame_Shift_Del_p.Q290fs|PSG8_ENST00000600709.1_5'UTR	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	383	Ig-like C2-type 3.					extracellular region (GO:0005576)		p.Q383fs*27(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GTAGTAATTTGGGGGATAAAG	0.458																																					p.Q261fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.781delC	19						.						207.0	223.0	217.0					19																	43258581		2203	4299	6502	47950421	SO:0001589	frameshift_variant	440533	exon4			M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.1147delC	19.37:g.43258581delG	ENSP00000305005:p.Gln383fs	Somatic		Capture	Illumina HiSeq	Phase_I	47950421	NM_001130168	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Frame_Shift_Del	DEL	ENST00000306511.4	37	CCDS33037.1																																																																																				PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1		
ZNF154	7710	broad.mit.edu	37	19	58213200	58213200	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr19:58213200G>A	ENST00000512439.2	-	3	1313	c.1117C>T	c.(1117-1119)Cga>Tga	p.R373*	AC003006.7_ENST00000599221.1_Intron|ZNF154_ENST00000426889.1_Nonsense_Mutation_p.R373*|AC003006.7_ENST00000594684.1_Intron|ZNF551_ENST00000596085.1_Intron			Q13106	ZN154_HUMAN	zinc finger protein 154	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R373*(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(3)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TGGTGTTTTCGGAGACTGGAG	0.498																																					p.R373X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1117T	19						.						84.0	88.0	86.0					19																	58213200		2199	4299	6498	62905012	SO:0001587	stop_gained	7710	exon3			U20648	CCDS42639.1	19q13.4	2013-01-08	2006-08-22		ENSG00000179909	ENSG00000179909		"""Zinc fingers, C2H2-type"", ""-"""	12939	protein-coding gene	gene with protein product		604085	"""zinc finger protein 154 (pHZ-92)"""			7557990	Standard	XR_243957		Approved	pHZ-92	uc010euf.3	Q13106	OTTHUMG00000140375	ENST00000512439.2:c.1117C>T	19.37:g.58213200G>A	ENSP00000421258:p.Arg373*	Somatic		Capture	Illumina HiSeq	Phase_I	62905012	NM_001085384	A7MCY3|Q8IVG7|Q8NAR0	Nonsense_Mutation	SNP	ENST00000512439.2	37	CCDS42639.1	.	.	.	.	.	.	.	.	.	.	G	17.14	3.313984	0.60414	.	.	ENSG00000179909	ENST00000512439;ENST00000426889	.	.	.	2.99	-5.97	0.02227	.	.	.	.	.	.	.	.	.	.	.	0.46478	D	0.999062	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	0.8925	0.01257	0.3241:0.1024:0.3016:0.2719	.	.	.	.	X	373	.	ENSP00000442370:R373X	R	-	1	2	ZNF154	62905012	0.000000	0.05858	0.000000	0.03702	0.165000	0.22458	-1.181000	0.03085	-1.876000	0.01131	0.561000	0.74099	CGA		ZNF154-002	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277102.2		
PRAMEF1	65121	broad.mit.edu	37	1	12853534	12853534	+	Missense_Mutation	SNP	C	C	T	rs267597970	byFrequency	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr1:12853534C>T	ENST00000332296.7	+	2	261	c.158C>T	c.(157-159)aCg>aTg	p.T53M	PRAMEF1_ENST00000400814.3_5'Flank	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	53					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.T53M(4)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CAGACTCTGACGGTGATGGTT	0.557													c|||	7	0.00139776	0.0	0.0	5008	,	,		22772	0.006		0.0	False		,,,				2504	0.001				p.T53M												.	.	4	Substitution - Missense(4)	large_intestine(2)|endometrium(2)	c.C158T	1						.						135.0	142.0	140.0					1																	12853534		2203	4297	6500	12776121	SO:0001583	missense	65121	exon2			AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.158C>T	1.37:g.12853534C>T	ENSP00000332134:p.Thr53Met	Somatic		Capture	Illumina HiSeq	Phase_I	12776121	NM_023013	Q9UQP2	Missense_Mutation	SNP	ENST00000332296.7	37	CCDS148.1	.	.	.	.	.	.	.	.	.	.	.	0.022	-1.406830	0.01155	.	.	ENSG00000116721	ENST00000332296	T	0.11604	2.76	1.82	-3.64	0.04515	.	0.280965	0.35525	N	0.003160	T	0.05410	0.0143	L	0.42744	1.35	0.09310	N	0.999999	P	0.34743	0.466	B	0.23716	0.048	T	0.26643	-1.0097	10	0.72032	D	0.01	.	0.2059	0.00150	0.3364:0.1464:0.2376:0.2797	.	53	O95521	PRAM1_HUMAN	M	53	ENSP00000332134:T53M	ENSP00000332134:T53M	T	+	2	0	PRAMEF1	12776121	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.668000	0.01959	-3.169000	0.00225	-4.255000	0.00008	ACG		PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013	
PROK1	84432	broad.mit.edu	37	1	110996698	110996698	+	Missense_Mutation	SNP	G	G	C	rs200271858		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr1:110996698G>C	ENST00000271331.3	+	2	205	c.188G>C	c.(187-189)gGc>gCc	p.G63A	RP11-470L19.5_ENST00000481350.2_RNA	NM_032414.2	NP_115790.1	P58294	PROK1_HUMAN	prokineticin 1	63					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|regulation of angiogenesis (GO:0045765)	extracellular region (GO:0005576)		p.G63A(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(4)|skin(1)|stomach(1)	9		all_cancers(81;6.23e-06)|all_epithelial(167;2.12e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0239)|all cancers(265;0.0699)|Epithelial(280;0.0753)|Colorectal(144;0.105)|LUSC - Lung squamous cell carcinoma(189;0.135)		TGCCACCCCGGCAGCCACAAG	0.652																																					p.G63A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G188C	1						.						28.0	26.0	27.0					1																	110996698		2203	4299	6502	110798221	SO:0001583	missense	84432	exon2			AF333024	CCDS825.1	1p21	2013-02-28			ENSG00000143125	ENSG00000143125		"""Endogenous ligands"""	18454	protein-coding gene	gene with protein product	"""black mamba toxin-related protein"", ""mambakine"""	606233				11259612	Standard	NM_032414		Approved	PK1, PRK1, EGVEGF	uc001dzs.3	P58294	OTTHUMG00000011569	ENST00000271331.3:c.188G>C	1.37:g.110996698G>C	ENSP00000271331:p.Gly63Ala	Somatic		Capture	Illumina HiSeq	Phase_I	110798221	NM_032414	Q5VWD4|Q8TC69	Missense_Mutation	SNP	ENST00000271331.3	37	CCDS825.1	.	.	.	.	.	.	.	.	.	.	G	2.317	-0.356534	0.05138	.	.	ENSG00000143125	ENST00000271331	D	0.83506	-1.73	5.28	1.76	0.24704	Prokineticin domain (2);	0.473496	0.23003	N	0.053060	T	0.44623	0.1302	N	0.17082	0.46	0.09310	N	0.999997	B	0.20164	0.042	B	0.21917	0.037	T	0.37709	-0.9694	10	0.15066	T	0.55	.	6.5283	0.22312	0.093:0.0:0.3739:0.5331	.	63	P58294	PROK1_HUMAN	A	63	ENSP00000271331:G63A	ENSP00000271331:G63A	G	+	2	0	PROK1	110798221	0.696000	0.27757	0.479000	0.27329	0.253000	0.25986	1.289000	0.33307	0.666000	0.31087	0.655000	0.94253	GGC		PROK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031969.1	NM_032414	
CACNA1E	777	broad.mit.edu	37	1	181701661	181701661	+	Silent	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr1:181701661G>A	ENST00000367573.2	+	20	2439	c.2439G>A	c.(2437-2439)ccG>ccA	p.P813P	CACNA1E_ENST00000367567.4_Silent_p.P420P|CACNA1E_ENST00000526775.1_Silent_p.P794P|CACNA1E_ENST00000367570.1_Silent_p.P813P|CACNA1E_ENST00000358338.5_Silent_p.P745P|CACNA1E_ENST00000357570.5_Silent_p.P764P|CACNA1E_ENST00000360108.3_Silent_p.P794P	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	813					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.P813P(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						ccctcaacccgctcagctccc	0.652																																					p.P813P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2439A	1						.						43.0	57.0	52.0					1																	181701661		1775	3451	5226	179968284	SO:0001819	synonymous_variant	777	exon20			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.2439G>A	1.37:g.181701661G>A		Somatic		Capture	Illumina HiSeq	Phase_I	179968284	NM_000721	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	CCDS55664.1																																																																																				CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
TMEM63A	9725	broad.mit.edu	37	1	226044697	226044697	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr1:226044697G>C	ENST00000366835.3	-	16	1668	c.1398C>G	c.(1396-1398)ttC>ttG	p.F466L	TMEM63A_ENST00000474478.1_5'Flank	NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	466					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)	p.F466L(1)		breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					GGGTGGGGAAGAACTGGCTGA	0.592																																					p.F466L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1398G	1						.						63.0	66.0	65.0					1																	226044697		2203	4300	6503	224111320	SO:0001583	missense	9725	exon16				CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.1398C>G	1.37:g.226044697G>C	ENSP00000355800:p.Phe466Leu	Somatic		Capture	Illumina HiSeq	Phase_I	224111320	NM_014698	Q53GI7|Q5TE96|Q8N2U2	Missense_Mutation	SNP	ENST00000366835.3	37	CCDS31042.1	.	.	.	.	.	.	.	.	.	.	G	31	5.069433	0.93950	.	.	ENSG00000196187	ENST00000366835	T	0.27557	1.66	5.12	4.2	0.49525	Domain of unknown function DUF221 (1);	0.000000	0.85682	D	0.000000	T	0.58090	0.2098	M	0.89601	3.045	0.80722	D	1	D	0.59767	0.986	D	0.64877	0.93	T	0.63743	-0.6568	10	0.44086	T	0.13	-38.7559	11.7985	0.52114	0.1477:0.0:0.8523:0.0	.	466	O94886	TM63A_HUMAN	L	466	ENSP00000355800:F466L	ENSP00000355800:F466L	F	-	3	2	TMEM63A	224111320	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.909000	0.56363	1.159000	0.42565	0.462000	0.41574	TTC		TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091154.2	NM_014698	
OR14C36	127066	broad.mit.edu	37	1	248512878	248512878	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr1:248512878C>A	ENST00000317861.1	+	1	802	c.802C>A	c.(802-804)Cag>Aag	p.Q268K		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q268K(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						TGCAGCCACCCAGGATCTGAT	0.468																																					p.Q268K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C802A	1						.						129.0	104.0	113.0					1																	248512878		2203	4300	6503	246579501	SO:0001583	missense	127066	exon1			BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.802C>A	1.37:g.248512878C>A	ENSP00000324534:p.Gln268Lys	Somatic		Capture	Illumina HiSeq	Phase_I	246579501	NM_001001918	Q6IEZ6	Missense_Mutation	SNP	ENST00000317861.1	37	CCDS31112.1	.	.	.	.	.	.	.	.	.	.	C	0.039	-1.293099	0.01375	.	.	ENSG00000177174	ENST00000317861	T	0.00137	8.68	3.81	0.503	0.16940	GPCR, rhodopsin-like superfamily (1);	0.459773	0.15920	U	0.238171	T	0.00073	0.0002	L	0.28556	0.865	0.09310	N	1	B	0.12013	0.005	B	0.16289	0.015	T	0.19614	-1.0300	10	0.17832	T	0.49	.	1.1601	0.01804	0.3946:0.2915:0.1327:0.1811	.	268	Q8NHC7	O14CZ_HUMAN	K	268	ENSP00000324534:Q268K	ENSP00000324534:Q268K	Q	+	1	0	OR14C36	246579501	0.000000	0.05858	0.003000	0.11579	0.270000	0.26580	-3.646000	0.00404	0.281000	0.22233	0.395000	0.25975	CAG		OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918	
BPIFA3	128861	broad.mit.edu	37	20	31811646	31811646	+	Missense_Mutation	SNP	G	G	A	rs532125562	byFrequency	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr20:31811646G>A	ENST00000375454.3	+	2	367	c.157G>A	c.(157-159)Gca>Aca	p.A53T	BPIFA3_ENST00000375452.3_Missense_Mutation_p.A53T|BPIFA3_ENST00000490499.1_3'UTR	NM_178466.3	NP_848561.2	Q9BQP9	BPIA3_HUMAN	BPI fold containing family A, member 3	53						extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.A53T(1)									AAAGCACAACGCAGAAAGCCG	0.547													G|||	2	0.000399361	0.0	0.0	5008	,	,		20332	0.0		0.0	False		,,,				2504	0.002				p.A53T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G157A	20						.						115.0	95.0	102.0					20																	31811646		2203	4300	6503	31275307	SO:0001583	missense	128861	exon2				CCDS13216.2, CCDS42865.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131059	ENSG00000131059		"""BPI fold containing"""	16204	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 71"""	C20orf71		11971875, 21787333	Standard	XR_244132		Approved	bA49G10.4, SPLUNC3	uc002wyr.3	Q9BQP9	OTTHUMG00000032245	ENST00000375454.3:c.157G>A	20.37:g.31811646G>A	ENSP00000364603:p.Ala53Thr	Somatic		Capture	Illumina HiSeq	Phase_I	31275307	NM_178466	Q5JWG8|Q6NZ38	Missense_Mutation	SNP	ENST00000375454.3	37	CCDS13216.2	.	.	.	.	.	.	.	.	.	.	G	3.431	-0.116061	0.06881	.	.	ENSG00000131059	ENST00000375454;ENST00000375452	T;T	0.30448	3.46;1.53	4.17	2.15	0.27550	.	0.328423	0.22238	N	0.062723	T	0.14098	0.0341	N	0.19112	0.55	0.09310	N	1	P;P	0.41420	0.454;0.749	B;B	0.36378	0.071;0.223	T	0.10177	-1.0641	10	0.25106	T	0.35	-2.4144	4.5899	0.12301	0.1166:0.0:0.6681:0.2153	.	53;53	Q9BQP9-2;Q9BQP9	.;BPIA3_HUMAN	T	53	ENSP00000364603:A53T;ENSP00000364601:A53T	ENSP00000364601:A53T	A	+	1	0	BPIFA3	31275307	0.094000	0.21725	0.003000	0.11579	0.001000	0.01503	0.971000	0.29396	0.667000	0.31107	-0.181000	0.13052	GCA		BPIFA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078672.1	NM_178466	
TPTE	7179	broad.mit.edu	37	21	10971325	10971325	+	Missense_Mutation	SNP	G	G	A	rs139096194	byFrequency	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr21:10971325G>A	ENST00000361285.4	-	5	361	c.32C>T	c.(31-33)gCg>gTg	p.A11V	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000342420.5_Missense_Mutation_p.A11V|TPTE_ENST00000298232.7_Missense_Mutation_p.A11V	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	11					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.A11V(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GATGACTCCCGCCAGGTCAGT	0.448													.|||	2	0.000399361	0.0008	0.0	5008	,	,		38898	0.0		0.001	False		,,,				2504	0.0				p.A11V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C32T	21						.	G	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	121.0	97.0	105.0		32,32,32	-1.5	0.0	21	dbSNP_134	105	5,8595	4.3+/-15.6	0,5,4295	yes	missense,missense,missense	TPTE	NM_199259.2,NM_199260.2,NM_199261.2	64,64,64	0,5,6498	AA,AG,GG		0.0581,0.0,0.0384	benign,benign,benign	11/534,11/514,11/552	10971325	5,13001	2203	4300	6503	9993196	SO:0001583	missense	7179	exon5			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.32C>T	21.37:g.10971325G>A	ENSP00000355208:p.Ala11Val	Somatic		Capture	Illumina HiSeq	Phase_I	9993196	NM_199259	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	g	0.001	-4.008248	0.00002	0.0	5.81E-4	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420;ENST00000328758	D;D;D	0.95307	-3.53;-3.57;-3.67	0.728	-1.46	0.08800	.	.	.	.	.	T	0.80243	0.4587	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.21688	0.006;0.059;0.003	B;B;B	0.16722	0.001;0.016;0.0	T	0.57516	-0.7798	9	0.40728	T	0.16	.	0.8066	0.01085	0.1897:0.1806:0.3753:0.2543	.	11;11;11	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	V	11	ENSP00000298232:A11V;ENSP00000355208:A11V;ENSP00000344441:A11V	ENSP00000298232:A11V	A	-	2	0	TPTE	9993196	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.248000	0.02890	-3.986000	0.00084	-2.931000	0.00088	GCG		TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
SSTR3	6753	broad.mit.edu	37	22	37603624	37603624	+	Silent	SNP	C	C	T	rs550210765	byFrequency	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr22:37603624C>T	ENST00000328544.3	-	2	752	c.219G>A	c.(217-219)acG>acA	p.T73T	SSTR3_ENST00000402501.1_Silent_p.T73T	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	73					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.T73T(1)		NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	AAGGGCTGGCCGTGTGCCGCA	0.642													C|||	2	0.000399361	0.0	0.0	5008	,	,		17941	0.0		0.0	False		,,,				2504	0.002				p.T73T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G219A	22						.						83.0	78.0	79.0					22																	37603624		2203	4300	6503	35933570	SO:0001819	synonymous_variant	6753	exon2				CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.219G>A	22.37:g.37603624C>T		Somatic		Capture	Illumina HiSeq	Phase_I	35933570	NM_001051	A8K550|Q53ZR7	Silent	SNP	ENST00000328544.3	37	CCDS13944.1																																																																																				SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318802.1		
WDR33	55339	broad.mit.edu	37	2	128467309	128467309	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr2:128467309G>A	ENST00000322313.4	-	19	3588	c.3430C>T	c.(3430-3432)Cga>Tga	p.R1144*		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	1144					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R1144*(2)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		TCTCGTCCTCGGGCCGCTTCC	0.562																																					p.R1144X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|prostate(1)	c.C3430T	2						.						86.0	95.0	92.0					2																	128467309		2203	4300	6503	128183779	SO:0001587	stop_gained	55339	exon19				CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.3430C>T	2.37:g.128467309G>A	ENSP00000325377:p.Arg1144*	Somatic		Capture	Illumina HiSeq	Phase_I	128183779	NM_018383	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Nonsense_Mutation	SNP	ENST00000322313.4	37	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	G	42	9.317726	0.99135	.	.	ENSG00000136709	ENST00000322313	.	.	.	5.32	3.3	0.37823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-9.7435	11.7017	0.51575	0.0:0.0:0.3977:0.6022	.	.	.	.	X	1144	.	ENSP00000325377:R1144X	R	-	1	2	WDR33	128183779	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.141000	0.42168	1.225000	0.43566	0.561000	0.74099	CGA		WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
MYO1B	4430	broad.mit.edu	37	2	192228894	192228894	+	Silent	SNP	A	A	G			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr2:192228894A>G	ENST00000392318.3	+	11	1171	c.924A>G	c.(922-924)gaA>gaG	p.E308E	MYO1B_ENST00000304164.4_Silent_p.E308E|MYO1B_ENST00000339514.4_Silent_p.E308E|MYO1B_ENST00000392316.1_Silent_p.E308E	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	308	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.E308E(1)		NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			AGTTAAAAGAAATTTGTGAAT	0.398																																					p.E308E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A924G	2						.						117.0	112.0	114.0					2																	192228894		2203	4300	6503	191937139	SO:0001819	synonymous_variant	4430	exon11			L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.924A>G	2.37:g.192228894A>G		Somatic		Capture	Illumina HiSeq	Phase_I	191937139	NM_012223	O43794|Q7Z6L5	Silent	SNP	ENST00000392318.3	37	CCDS46477.1																																																																																				MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	NM_012223	
CCDC150	284992	broad.mit.edu	37	2	197583289	197583289	+	Silent	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr2:197583289G>A	ENST00000389175.4	+	18	2064	c.1929G>A	c.(1927-1929)gcG>gcA	p.A643A	CCDC150_ENST00000409270.1_Silent_p.A130A|CCDC150_ENST00000272831.7_Silent_p.A290A	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	643								p.A643A(1)		breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GTCGTAATGCGGCCCTGAAAG	0.428																																					p.A643A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1929A	2						.						90.0	91.0	90.0					2																	197583289		1934	4134	6068	197291534	SO:0001819	synonymous_variant	284992	exon18				CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.1929G>A	2.37:g.197583289G>A		Somatic		Capture	Illumina HiSeq	Phase_I	197291534	NM_001080539	Q6P5U6|Q6P663|Q8N8V5	Silent	SNP	ENST00000389175.4	37	CCDS46478.1																																																																																				CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335377.2	NM_001080539	
ADI1	55256	broad.mit.edu	37	2	3502849	3502849	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr2:3502849T>C	ENST00000327435.6	-	4	673	c.425A>G	c.(424-426)tAc>tGc	p.Y142C	RP11-1293J14.1_ENST00000607415.1_lincRNA|ADI1_ENST00000382093.5_Missense_Mutation_p.Y136C	NM_018269.3	NP_060739.2			acireductone dioxygenase 1									p.Y142C(1)		breast(2)|large_intestine(2)|lung(4)|ovary(1)|stomach(1)	10	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0729)|Epithelial(75;0.173)|all cancers(51;0.228)		GGCCTTCGTGTAGTTCTGGAA	0.468																																					p.Y142C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A425G	2						.						43.0	42.0	43.0					2																	3502849		2203	4300	6503	3481856	SO:0001583	missense	55256	exon4				CCDS1653.1	2p25.2	2013-05-29			ENSG00000182551	ENSG00000182551	1.13.11.54		30576	protein-coding gene	gene with protein product	"""membrane-type 1 matrix metalloproteinase cytoplasmic tail binding protein-1"""	613400				14718544, 15938715	Standard	NM_018269		Approved	SIPL, MTCBP-1, ARD, APL1, FLJ10913, HMFT1638, mtnD	uc002qxp.4	Q9BV57	OTTHUMG00000112441	ENST00000327435.6:c.425A>G	2.37:g.3502849T>C	ENSP00000333666:p.Tyr142Cys	Somatic		Capture	Illumina HiSeq	Phase_I	3481856	NM_018269		Missense_Mutation	SNP	ENST00000327435.6	37	CCDS1653.1	.	.	.	.	.	.	.	.	.	.	T	16.93	3.258974	0.59321	.	.	ENSG00000182551	ENST00000327435;ENST00000382093	.	.	.	4.59	4.59	0.56863	Cupin, RmlC-type (1);RmlC-like jelly roll fold (1);	0.000000	0.85682	D	0.000000	T	0.80675	0.4668	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84080	0.0384	9	0.66056	D	0.02	-34.818	13.2379	0.59979	0.0:0.0:0.0:1.0	.	142	Q9BV57	MTND_HUMAN	C	142;136	.	ENSP00000333666:Y142C	Y	-	2	0	ADI1	3481856	1.000000	0.71417	0.987000	0.45799	0.130000	0.20726	5.310000	0.65780	2.052000	0.61016	0.533000	0.62120	TAC		ADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000231914.6	NM_018269	
ABCA12	26154	broad.mit.edu	37	2	215848424	215848424	+	Silent	SNP	A	A	G			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr2:215848424A>G	ENST00000272895.7	-	29	4548	c.4329T>C	c.(4327-4329)ggT>ggC	p.G1443G	ABCA12_ENST00000389661.4_Silent_p.G1125G	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1443	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.G1443G(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CTTTGATGGAACCATATAGGA	0.448																																					p.G1443G	Ovarian(66;664 1488 5121 34295)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T4329C	2						.						204.0	178.0	187.0					2																	215848424		2203	4300	6503	215556669	SO:0001819	synonymous_variant	26154	exon29			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.4329T>C	2.37:g.215848424A>G		Somatic		Capture	Illumina HiSeq	Phase_I	215556669	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	ENST00000272895.7	37	CCDS33372.1																																																																																				ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
DNAJB8	165721	broad.mit.edu	37	3	128181425	128181425	+	Missense_Mutation	SNP	C	C	T	rs529782278		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr3:128181425C>T	ENST00000469083.1	-	2	3221	c.664G>A	c.(664-666)Ggc>Agc	p.G222S	DNAJB8_ENST00000319153.3_Missense_Mutation_p.G222S|DNAJB8-AS1_ENST00000471626.1_RNA			Q8NHS0	DNJB8_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 8	222					chaperone-mediated protein folding (GO:0061077)|negative regulation of inclusion body assembly (GO:0090084)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|protein binding involved in protein folding (GO:0044183)|unfolded protein binding (GO:0051082)	p.G222S(1)		kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.177)		TGCTCCTTGCCGTTCACAGTC	0.632																																					p.G222S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G664A	3						.						167.0	133.0	145.0					3																	128181425		2203	4300	6503	129664115	SO:0001583	missense	165721	exon3				CCDS3048.1	3q21.3	2014-01-21			ENSG00000179407	ENSG00000179407		"""Heat shock proteins / DNAJ (HSP40)"""	23699	protein-coding gene	gene with protein product		611337					Standard	NM_153330		Approved	MGC33884, CT156	uc003ekk.2	Q8NHS0	OTTHUMG00000159690	ENST00000469083.1:c.664G>A	3.37:g.128181425C>T	ENSP00000417418:p.Gly222Ser	Somatic		Capture	Illumina HiSeq	Phase_I	129664115	NM_153330	B3KWV7	Missense_Mutation	SNP	ENST00000469083.1	37	CCDS3048.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964794	0.74131	.	.	ENSG00000179407	ENST00000469083;ENST00000319153	T;T	0.69806	-0.43;-0.43	4.58	4.58	0.56647	.	0.235195	0.33631	U	0.004715	T	0.81498	0.4835	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83134	-0.0112	10	0.49607	T	0.09	.	17.3637	0.87358	0.0:1.0:0.0:0.0	.	222	Q8NHS0	DNJB8_HUMAN	S	222	ENSP00000417418:G222S;ENSP00000316053:G222S	ENSP00000316053:G222S	G	-	1	0	DNAJB8	129664115	1.000000	0.71417	0.927000	0.36925	0.116000	0.19942	5.314000	0.65804	2.093000	0.63338	0.555000	0.69702	GGC		DNAJB8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356933.1	NM_153330	
PIK3R4	30849	broad.mit.edu	37	3	130427145	130427145	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr3:130427145A>C	ENST00000356763.3	-	10	3080	c.2523T>G	c.(2521-2523)gaT>gaG	p.D841E		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	841					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D841E(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						CCCGTTTGTCATCTGGTTCTT	0.348																																					p.D841E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2523G	3						.						172.0	156.0	162.0					3																	130427145		2203	4300	6503	131909835	SO:0001583	missense	30849	exon10			Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.2523T>G	3.37:g.130427145A>C	ENSP00000349205:p.Asp841Glu	Somatic		Capture	Illumina HiSeq	Phase_I	131909835	NM_014602	Q2TBF4	Missense_Mutation	SNP	ENST00000356763.3	37	CCDS3067.1	.	.	.	.	.	.	.	.	.	.	A	5.396	0.258279	0.10239	.	.	ENSG00000196455	ENST00000356763	T	0.40756	1.02	5.47	-0.0863	0.13682	.	0.148383	0.64402	N	0.000012	T	0.15739	0.0379	N	0.08118	0	0.41549	D	0.988567	B	0.02656	0.0	B	0.01281	0.0	T	0.32268	-0.9913	10	0.02654	T	1	-11.9653	8.4035	0.32601	0.5547:0.3779:0.0674:0.0	.	841	Q99570	PI3R4_HUMAN	E	841	ENSP00000349205:D841E	ENSP00000349205:D841E	D	-	3	2	PIK3R4	131909835	0.764000	0.28473	1.000000	0.80357	0.983000	0.72400	-0.004000	0.12878	0.330000	0.23485	0.460000	0.39030	GAT		PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602	
ACAD11	84129	broad.mit.edu	37	3	132322122	132322122	+	Silent	SNP	T	T	C			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr3:132322122T>C	ENST00000264990.6	-	13	2543	c.1572A>G	c.(1570-1572)caA>caG	p.Q524Q	ACAD11_ENST00000355458.3_Silent_p.Q524Q|ACAD11_ENST00000545291.1_Silent_p.Q49Q	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	524					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)	p.Q524Q(1)		breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						CTTCATCTCGTTGGATGCTGC	0.393																																					p.Q524Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1572G	3						.						220.0	189.0	199.0					3																	132322122		2203	4300	6503	133804812	SO:0001819	synonymous_variant	84129	exon13			BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.1572A>G	3.37:g.132322122T>C		Somatic		Capture	Illumina HiSeq	Phase_I	133804812	NM_032169	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Silent	SNP	ENST00000264990.6	37	CCDS3074.1																																																																																				ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357279.2	NM_032169	
PLS1	5357	broad.mit.edu	37	3	142405194	142405194	+	Silent	SNP	T	T	C			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr3:142405194T>C	ENST00000337777.3	+	9	1170	c.957T>C	c.(955-957)atT>atC	p.I319I	PLS1_ENST00000457734.2_Silent_p.I319I|PLS1_ENST00000497002.1_Silent_p.I319I	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	319	Actin-binding 1.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.I319I(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						GACCTGCCATTGCCATTGACC	0.338																																					p.I319I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T957C	3						.						139.0	136.0	137.0					3																	142405194		2203	4300	6503	143887884	SO:0001819	synonymous_variant	5357	exon9			L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.957T>C	3.37:g.142405194T>C		Somatic		Capture	Illumina HiSeq	Phase_I	143887884	NM_002670	A8K2Q1|D3DNG3|Q8NEG6	Silent	SNP	ENST00000337777.3	37	CCDS3125.1																																																																																				PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354435.1	NM_002670	
SETD2	29072	broad.mit.edu	37	3	47079232	47079232	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr3:47079232G>A	ENST00000409792.3	-	18	7316	c.7274C>T	c.(7273-7275)cCa>cTa	p.P2425L		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2425					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.P1922L(1)|p.P2425L(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATCATCTCCTGGGCTTTCCCA	0.478			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.P2425L			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C7274T	3						.						139.0	119.0	126.0					3																	47079232		2203	4300	6503	47054236	SO:0001583	missense	29072	exon18			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.7274C>T	3.37:g.47079232G>A	ENSP00000386759:p.Pro2425Leu	Somatic		Capture	Illumina HiSeq	Phase_I	47054236	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	19.51	3.841497	0.71488	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	D	0.88818	-2.43	5.93	5.93	0.95920	WW/Rsp5/WWP (1);	0.000000	0.56097	D	0.000034	D	0.88085	0.6342	N	0.19112	0.55	0.53688	D	0.999974	P;P	0.50943	0.746;0.94	B;P	0.51742	0.258;0.678	D	0.88839	0.3311	10	0.59425	D	0.04	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	2425;2425	F2Z317;Q9BYW2	.;SETD2_HUMAN	L	2425	ENSP00000386759:P2425L	ENSP00000386759:P2425L	P	-	2	0	SETD2	47054236	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.905000	0.48727	2.826000	0.97356	0.655000	0.94253	CCA		SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
ERICH6	131831	broad.mit.edu	37	3	150421443	150421443	+	Silent	SNP	G	G	C			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr3:150421443G>C	ENST00000295910.6	-	1	295	c.243C>G	c.(241-243)gtC>gtG	p.V81V	RP11-103G8.2_ENST00000471093.1_RNA|RP11-103G8.2_ENST00000475393.1_RNA|FAM194A_ENST00000491361.1_Intron	NM_152394.3	NP_689607.2												p.V81V(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						CGATGTCCGTGACCTTCCAGA	0.622																																					p.V81V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C243G	3						.						232.0	184.0	200.0					3																	150421443		2203	4300	6503	151904133	SO:0001819	synonymous_variant	131831	exon1																														ENST00000295910.6:c.243C>G	3.37:g.150421443G>C		Somatic		Capture	Illumina HiSeq	Phase_I	151904133	NM_152394		Silent	SNP	ENST00000295910.6	37	CCDS3151.2																																																																																				FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257666.1		
FAT4	79633	broad.mit.edu	37	4	126336792	126336792	+	Missense_Mutation	SNP	A	A	C	rs188934368		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr4:126336792A>C	ENST00000394329.3	+	5	6687	c.6674A>C	c.(6673-6675)tAc>tCc	p.Y2225S	FAT4_ENST00000335110.5_Missense_Mutation_p.Y523S	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2225	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y2225S(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ACCCCTACCTACCATTTAACT	0.443													A|||	1	0.000199681	0.0	0.0	5008	,	,		18097	0.0		0.001	False		,,,				2504	0.0				p.Y2225S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A6674C	4						.						124.0	122.0	123.0					4																	126336792		2203	4300	6503	126556242	SO:0001583	missense	79633	exon5			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.6674A>C	4.37:g.126336792A>C	ENSP00000377862:p.Tyr2225Ser	Somatic		Capture	Illumina HiSeq	Phase_I	126556242	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	17.50	3.405374	0.62288	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.70045	-0.45;-0.45	5.46	5.46	0.80206	Cadherin (4);Cadherin-like (1);	0.000000	0.31821	U	0.007001	D	0.88618	0.6485	H	0.98048	4.135	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	D	0.92840	0.6288	10	0.87932	D	0	.	15.5355	0.75998	1.0:0.0:0.0:0.0	.	523;2225	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	S	2225;523	ENSP00000377862:Y2225S;ENSP00000335169:Y523S	ENSP00000335169:Y523S	Y	+	2	0	FAT4	126556242	1.000000	0.71417	0.316000	0.25252	0.501000	0.33797	9.149000	0.94659	2.071000	0.62044	0.455000	0.32223	TAC		FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
FAT4	79633	broad.mit.edu	37	4	126372659	126372659	+	Silent	SNP	A	A	G			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr4:126372659A>G	ENST00000394329.3	+	9	10501	c.10488A>G	c.(10486-10488)ttA>ttG	p.L3496L	FAT4_ENST00000335110.5_Silent_p.L1794L	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3496	Cadherin 33. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L3496L(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GTGCCTCTTTATTAGTCACCC	0.473																																					p.L3496L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A10488G	4						.						104.0	106.0	105.0					4																	126372659		2203	4300	6503	126592109	SO:0001819	synonymous_variant	79633	exon9			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10488A>G	4.37:g.126372659A>G		Somatic		Capture	Illumina HiSeq	Phase_I	126592109	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																				FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
PRMT9	90826	broad.mit.edu	37	4	148579082	148579082	+	Silent	SNP	A	A	T			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr4:148579082A>T	ENST00000322396.6	-	8	1433	c.1191T>A	c.(1189-1191)atT>atA	p.I397I	TMEM184C_ENST00000508208.1_Intron|PRMT10_ENST00000541232.1_Silent_p.I284I	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		397	SAM-dependent MTase PRMT-type 1. {ECO:0000255|PROSITE-ProRule:PRU01015}.					cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)	p.I397I(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						TAATAACAGGAATACCAATCT	0.333																																					p.I397I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1191A	4						.						75.0	65.0	68.0					4																	148579082		2203	4299	6502	148798532	SO:0001819	synonymous_variant	90826	exon8																														ENST00000322396.6:c.1191T>A	4.37:g.148579082A>T		Somatic		Capture	Illumina HiSeq	Phase_I	148798532	NM_138364	A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Silent	SNP	ENST00000322396.6	37	CCDS3771.1																																																																																				PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364650.1		
GUCY1A3	2982	broad.mit.edu	37	4	156638387	156638387	+	Missense_Mutation	SNP	C	C	T	rs192008544		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr4:156638387C>T	ENST00000296518.7	+	8	1858	c.1649C>T	c.(1648-1650)gCg>gTg	p.A550V	GUCY1A3_ENST00000511108.1_Missense_Mutation_p.A550V|GUCY1A3_ENST00000393832.3_Missense_Mutation_p.A292V|GUCY1A3_ENST00000506455.1_Missense_Mutation_p.A550V|GUCY1A3_ENST00000455639.2_Missense_Mutation_p.A550V|GUCY1A3_ENST00000511507.1_Missense_Mutation_p.A550V|GUCY1A3_ENST00000513574.1_Missense_Mutation_p.A550V			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	550	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)	p.A550V(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GTTCAGATAGCGCTGATGGCC	0.438													C|||	1	0.000199681	0.0	0.0	5008	,	,		19657	0.0		0.001	False		,,,				2504	0.0				p.A550V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1649T	4						.						146.0	135.0	138.0					4																	156638387		2203	4300	6503	156857837	SO:0001583	missense	2982	exon8				CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.1649C>T	4.37:g.156638387C>T	ENSP00000296518:p.Ala550Val	Somatic		Capture	Illumina HiSeq	Phase_I	156857837	NM_001130682	D3DP19|D6RDW3|O43843|Q8TAH3	Missense_Mutation	SNP	ENST00000296518.7	37	CCDS34085.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	35	5.510706	0.96386	.	.	ENSG00000164116	ENST00000506455;ENST00000511108;ENST00000511507;ENST00000455639;ENST00000393832;ENST00000296518;ENST00000513574	D;D;D;D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66;-1.66;-1.66;-1.66	5.64	5.64	0.86602	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.64402	D	0.000007	D	0.89171	0.6639	L	0.58583	1.82	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.62885	0.908;0.908	D	0.88651	0.3182	10	0.51188	T	0.08	.	19.6996	0.96048	0.0:1.0:0.0:0.0	.	550;550	B3KU69;Q02108	.;GCYA3_HUMAN	V	550;550;550;550;292;550;550	ENSP00000424361:A550V;ENSP00000421493:A550V;ENSP00000426968:A550V;ENSP00000412201:A550V;ENSP00000377418:A292V;ENSP00000296518:A550V;ENSP00000426040:A550V	ENSP00000296518:A550V	A	+	2	0	GUCY1A3	156857837	1.000000	0.71417	0.972000	0.41901	0.993000	0.82548	7.792000	0.85828	2.646000	0.89796	0.655000	0.94253	GCG		GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2		
PPP2R2C	5522	broad.mit.edu	37	4	6331042	6331042	+	Silent	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr4:6331042G>A	ENST00000382599.4	-	8	1215	c.999C>T	c.(997-999)taC>taT	p.Y333Y	PPP2R2C_ENST00000506140.1_Silent_p.Y326Y|PPP2R2C_ENST00000515571.1_Silent_p.Y316Y|PPP2R2C_ENST00000507294.1_Silent_p.Y326Y|PPP2R2C_ENST00000335585.5_Silent_p.Y333Y			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	333					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.Y333Y(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						AGTCGTTCTCGTACAGGGAAC	0.582																																					p.Y333Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C999T	4						.						194.0	150.0	165.0					4																	6331042		2203	4300	6503	6381943	SO:0001819	synonymous_variant	5522	exon8			AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.999C>T	4.37:g.6331042G>A		Somatic		Capture	Illumina HiSeq	Phase_I	6381943	NM_020416	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Silent	SNP	ENST00000382599.4	37																																																																																					PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	NM_181876	
SLC9B1	150159	broad.mit.edu	37	4	103870465	103870465	+	Frame_Shift_Del	DEL	T	T	-	rs370465981		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr4:103870465delT	ENST00000296422.7	-	4	472	c.331delA	c.(331-333)attfs	p.I111fs	SLC9B1_ENST00000394789.3_Frame_Shift_Del_p.I111fs	NM_139173.3	NP_631912	Q4ZJI4	SL9B1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1	111					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)	p.I111fs*9(1)									AGTTGTAAAATTTTTCCCCCA	0.348																																					p.I111fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.331delA	4						.						48.0	52.0	51.0					4																	103870465		2190	4288	6478	104089914	SO:0001589	frameshift_variant	150159	exon4			AF447585	CCDS34041.1, CCDS47119.1	4q24	2013-05-22	2012-03-22	2011-07-26	ENSG00000164037	ENSG00000164037		"""Solute carriers"""	24244	protein-coding gene	gene with protein product		611527	"""Na+/H+ exchanger domain containing 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1"""	NHEDC1		16850186	Standard	NM_139173		Approved	NHA1	uc003hww.3	Q4ZJI4	OTTHUMG00000161114	ENST00000296422.7:c.331delA	4.37:g.103870465delT	ENSP00000296422:p.Ile111fs	Somatic		Capture	Illumina HiSeq	Phase_I	104089914	NM_139173	A1KXV1|B9EH04|C9JBP7|Q49A30|Q8NCV2|Q8WVZ0	Frame_Shift_Del	DEL	ENST00000296422.7	37	CCDS34041.1																																																																																				SLC9B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363841.1	NM_139173	
WDR17	116966	broad.mit.edu	37	4	177032838	177032838	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr4:177032838C>A	ENST00000280190.4	+	3	335	c.179C>A	c.(178-180)gCt>gAt	p.A60D	WDR17_ENST00000507824.2_Missense_Mutation_p.A60D|WDR17_ENST00000393643.2_Missense_Mutation_p.A36D|WDR17_ENST00000508596.1_Missense_Mutation_p.A36D			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	60								p.A60D(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		GCGACCCTGGCTATCTATATT	0.358																																					p.A36D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C107A	4						.						92.0	85.0	88.0					4																	177032838		2203	4300	6503	177269832	SO:0001583	missense	116966	exon2			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.179C>A	4.37:g.177032838C>A	ENSP00000280190:p.Ala60Asp	Somatic		Capture	Illumina HiSeq	Phase_I	177269832	NM_181265	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165716	0.78339	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000296524;ENST00000507824	T;T;T	0.60920	0.18;0.21;0.15	5.39	5.39	0.77823	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.67552	0.2905	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	T	0.63444	-0.6636	10	0.28530	T	0.3	-11.3149	19.1629	0.93541	0.0:1.0:0.0:0.0	.	36;60;60	E7EQX0;E7ESC9;Q8IZU2	.;.;WDR17_HUMAN	D	36;36;60;36;60	ENSP00000422763:A36D;ENSP00000377258:A36D;ENSP00000280190:A60D	ENSP00000280190:A60D	A	+	2	0	WDR17	177269832	1.000000	0.71417	0.997000	0.53966	0.493000	0.33554	7.212000	0.77941	2.513000	0.84729	0.467000	0.42956	GCT		WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		
APC	324	broad.mit.edu	37	5	112175398	112175398	+	Silent	SNP	C	C	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr5:112175398C>A	ENST00000457016.1	+	16	4487	c.4107C>A	c.(4105-4107)ccC>ccA	p.P1369P	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Silent_p.P1369P|APC_ENST00000508376.2_Silent_p.P1369P			P25054	APC_HUMAN	adenomatous polyposis coli	1369	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.P1369fs*5(1)|p.S1371fs*44(1)|p.K1192fs*3(1)|p.?(1)|p.P1369P(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CTCAGACACCCAAAAGTCCAC	0.453		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.P1351P	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Complex - frameshift,+2 	.	5	Deletion - Frameshift(2)|Unknown(1)|Complex - frameshift(1)|Substitution - coding silent(1)	large_intestine(3)|soft_tissue(1)|skin(1)	c.C4053A	5						.						79.0	76.0	77.0					5																	112175398		2202	4300	6502	112203297	SO:0001819	synonymous_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4107C>A	5.37:g.112175398C>A		Somatic		Capture	Illumina HiSeq	Phase_I	112203297	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Silent	SNP	ENST00000457016.1	37	CCDS4107.1																																																																																				APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175639	112175639	+	Nonsense_Mutation	SNP	C	C	T	rs121913332		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr5:112175639C>T	ENST00000457016.1	+	16	4728	c.4348C>T	c.(4348-4350)Cga>Tga	p.R1450*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.R1450*|APC_ENST00000508376.2_Nonsense_Mutation_p.R1450*			P25054	APC_HUMAN	adenomatous polyposis coli	1450	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1450*(153)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.R1450fs*22(1)|p.S1436fs*22(1)|p.R1450fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAAACCAAGCGAGAAGTACC	0.478	R1450*(LS123_LARGE_INTESTINE)|R1450*(MKN74_STOMACH)|R1450*(SW1417_LARGE_INTESTINE)|R1450*(SW837_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1432X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,rectum,Substitution - Nonsense,0 	.	159	Substitution - Nonsense(153)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(136)|stomach(13)|soft_tissue(4)|small_intestine(3)|endometrium(1)|skin(1)|pancreas(1)	c.C4294T	5	GRCh37	CM930030	APC	M	rs121913332	.						102.0	90.0	94.0					5																	112175639		2202	4300	6502	112203538	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4348C>T	5.37:g.112175639C>T	ENSP00000413133:p.Arg1450*	Somatic		Capture	Illumina HiSeq	Phase_I	112203538	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.651223	0.98901	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	4.2	0.49525	.	0.600559	0.18052	N	0.153248	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.0649	14.037	0.64651	0.426:0.574:0.0:0.0	.	.	.	.	X	1450	.	.	R	+	1	2	APC	112203538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.171000	0.50824	1.564000	0.49628	0.655000	0.94253	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
FAM105A	54491	broad.mit.edu	37	5	14610395	14610395	+	Missense_Mutation	SNP	A	A	C	rs373940963		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr5:14610395A>C	ENST00000274217.3	+	8	1163	c.1043A>C	c.(1042-1044)gAc>gCc	p.D348A		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	348	OTU.							p.D348A(1)		large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					ACCGAGAACGACCGCCACTAC	0.532																																					p.D348A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1043C	5						.						47.0	50.0	49.0					5																	14610395		2203	4300	6503	14663395	SO:0001583	missense	54491	exon8				CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.1043A>C	5.37:g.14610395A>C	ENSP00000274217:p.Asp348Ala	Somatic		Capture	Illumina HiSeq	Phase_I	14663395	NM_019018	Q53H50|Q9H037	Missense_Mutation	SNP	ENST00000274217.3	37	CCDS3884.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.223936	0.79576	.	.	ENSG00000145569	ENST00000274217	T	0.24723	1.84	5.13	3.93	0.45458	.	0.075470	0.53938	D	0.000048	T	0.39436	0.1078	M	0.79926	2.475	0.38264	D	0.941973	P	0.44521	0.837	P	0.47827	0.558	T	0.47509	-0.9112	10	0.87932	D	0	-19.478	11.0834	0.48072	0.926:0.0:0.074:0.0	.	348	Q9NUU6	F105A_HUMAN	A	348	ENSP00000274217:D348A	ENSP00000274217:D348A	D	+	2	0	FAM105A	14663395	1.000000	0.71417	0.989000	0.46669	0.994000	0.84299	6.100000	0.71473	0.746000	0.32786	0.528000	0.53228	GAC		FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253710.1	NM_019018	
PCDHGA5	56110	broad.mit.edu	37	5	140745458	140745458	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr5:140745458G>A	ENST00000518069.1	+	1	1561	c.1561G>A	c.(1561-1563)Gac>Aac	p.D521N	PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	521	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D521Y(1)|p.D521N(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGATCCTTCGACTATGAGCA	0.542																																					p.D521N												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1561A	5						.						181.0	199.0	193.0					5																	140745458		2190	4298	6488	140725642	SO:0001583	missense	56110	exon1			AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.1561G>A	5.37:g.140745458G>A	ENSP00000429834:p.Asp521Asn	Somatic		Capture	Illumina HiSeq	Phase_I	140725642	NM_032054	Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	37	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	17.22	3.334143	0.60853	.	.	ENSG00000253485	ENST00000518069	T	0.63417	-0.04	4.84	4.84	0.62591	Cadherin (5);Cadherin-like (1);	.	.	.	.	D	0.83686	0.5308	M	0.91717	3.235	0.41178	D	0.986217	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88123	0.2833	9	0.87932	D	0	.	17.9134	0.88942	0.0:0.0:1.0:0.0	.	521;521	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	N	521	ENSP00000429834:D521N	ENSP00000429834:D521N	D	+	1	0	PCDHGA5	140725642	1.000000	0.71417	0.972000	0.41901	0.268000	0.26511	6.735000	0.74806	2.397000	0.81536	0.563000	0.77884	GAC		PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
ENC1	8507	broad.mit.edu	37	5	73930863	73930863	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr5:73930863C>T	ENST00000302351.4	-	2	2578	c.1448G>A	c.(1447-1449)cGt>cAt	p.R483H	ENC1_ENST00000509284.1_5'Flank|ENC1_ENST00000510316.1_Missense_Mutation_p.R410H|ENC1_ENST00000537006.1_Missense_Mutation_p.R483H	NM_003633.3	NP_003624.1	O14682	ENC1_HUMAN	ectodermal-neural cortex 1 (with BTB domain)	483					multicellular organismal development (GO:0007275)|negative regulation of translation (GO:0017148)|nervous system development (GO:0007399)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.R483H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	20		all_lung(232;0.0154)|Lung NSC(167;0.0331)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.45e-59)		TGCTGTGTAACGCCAGGGCTG	0.502																																					p.R483H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1448A	5						.						53.0	61.0	58.0					5																	73930863		2203	4300	6503	73966619	SO:0001583	missense	8507	exon2			AF059611	CCDS4021.1, CCDS58958.1	5q13	2013-01-30	2013-01-30		ENSG00000171617	ENSG00000171617		"""Kelch-like"", ""BTB/POZ domain containing"""	3345	protein-coding gene	gene with protein product	"""kelch-like family member 37"""	605173	"""ectodermal-neural cortex 1 (with BTB-like domain)"""	NRPB		9305847, 9566959	Standard	NM_003633		Approved	PIG10, ENC-1, TP53I10, KLHL37	uc003kdc.5	O14682	OTTHUMG00000102059	ENST00000302351.4:c.1448G>A	5.37:g.73930863C>T	ENSP00000306356:p.Arg483His	Somatic		Capture	Illumina HiSeq	Phase_I	73966619	NM_003633	B4DHJ1|E9PFU0|O75464|Q9UPG9	Missense_Mutation	SNP	ENST00000302351.4	37	CCDS4021.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.514711	0.85389	.	.	ENSG00000171617	ENST00000302351;ENST00000510316;ENST00000537006	T;T;T	0.77358	-1.09;-1.09;-1.09	5.79	5.79	0.91817	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.79924	0.4530	L	0.44542	1.39	0.80722	D	1	D	0.53312	0.959	P	0.49597	0.616	T	0.81180	-0.1050	10	0.66056	D	0.02	.	20.0212	0.97504	0.0:1.0:0.0:0.0	.	483	O14682	ENC1_HUMAN	H	483;410;483	ENSP00000306356:R483H;ENSP00000423804:R410H;ENSP00000446289:R483H	ENSP00000306356:R483H	R	-	2	0	ENC1	73966619	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.735000	0.93741	0.561000	0.74099	CGT		ENC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219862.2	NM_003633	
CMYA5	202333	broad.mit.edu	37	5	79032887	79032887	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr5:79032887T>C	ENST00000446378.2	+	2	8330	c.8299T>C	c.(8299-8301)Tca>Cca	p.S2767P		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2767					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.S2767P(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GTTCAAAGAGTCAGAGCTATG	0.378																																					p.S2767P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T8299C	5						.						77.0	78.0	78.0					5																	79032887		1868	4102	5970	79068643	SO:0001583	missense	202333	exon2			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.8299T>C	5.37:g.79032887T>C	ENSP00000394770:p.Ser2767Pro	Somatic		Capture	Illumina HiSeq	Phase_I	79068643	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	T	7.571	0.666672	0.14710	.	.	ENSG00000164309	ENST00000446378	T	0.39406	1.08	4.06	-0.336	0.12658	.	0.615724	0.13631	N	0.373727	T	0.24392	0.0591	L	0.34521	1.04	0.09310	N	1	B	0.12013	0.005	B	0.11329	0.006	T	0.19289	-1.0310	10	0.18710	T	0.47	.	4.2268	0.10584	0.0:0.2157:0.3399:0.4445	.	2767	Q8N3K9	CMYA5_HUMAN	P	2767	ENSP00000394770:S2767P	ENSP00000394770:S2767P	S	+	1	0	CMYA5	79068643	0.206000	0.23470	0.005000	0.12908	0.017000	0.09413	0.696000	0.25541	0.121000	0.18284	0.391000	0.25812	TCA		CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
STC2	8614	broad.mit.edu	37	5	172744857	172744857	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr5:172744857C>T	ENST00000265087.4	-	4	2211	c.902G>A	c.(901-903)cGg>cAg	p.R301Q	STC2_ENST00000520593.1_5'Flank	NM_003714.2	NP_003705.1	O76061	STC2_HUMAN	stanniocalcin 2	301					cellular calcium ion homeostasis (GO:0006874)|cellular response to hypoxia (GO:0071456)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|regulation of hormone biosynthetic process (GO:0046885)|regulation of store-operated calcium entry (GO:2001256)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)	p.R301Q(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(3)	25	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ATTTCACCTCCGGATATCAGA	0.537																																					p.R301Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G902A	5						.						83.0	88.0	87.0					5																	172744857		2203	4300	6503	172677463	SO:0001583	missense	8614	exon4			AB012664	CCDS4388.1	5q35.2	2004-05-17			ENSG00000113739	ENSG00000113739			11374	protein-coding gene	gene with protein product		603665				9723890, 9753616	Standard	NM_003714		Approved	STC-2	uc003mco.1	O76061	OTTHUMG00000130542	ENST00000265087.4:c.902G>A	5.37:g.172744857C>T	ENSP00000265087:p.Arg301Gln	Somatic		Capture	Illumina HiSeq	Phase_I	172677463	NM_003714		Missense_Mutation	SNP	ENST00000265087.4	37	CCDS4388.1	.	.	.	.	.	.	.	.	.	.	C	36	5.846632	0.97016	.	.	ENSG00000113739	ENST00000265087	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.67021	0.2849	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.71377	-0.4611	9	0.87932	D	0	-28.0415	18.9971	0.92818	0.0:1.0:0.0:0.0	.	301	O76061	STC2_HUMAN	Q	301	.	ENSP00000265087:R301Q	R	-	2	0	STC2	172677463	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.545000	0.67237	2.480000	0.83734	0.650000	0.86243	CGG		STC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252965.1	NM_003714	
SOGA3	387104	broad.mit.edu	37	6	127796643	127796643	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr6:127796643G>A	ENST00000525778.1	-	6	3273	c.2528C>T	c.(2527-2529)gCg>gTg	p.A843V	SOGA3_ENST00000465909.2_Missense_Mutation_p.A843V|SOGA3_ENST00000474293.2_5'UTR|SOGA3_ENST00000481848.2_Missense_Mutation_p.A843V|SOGA3_ENST00000368268.2_Missense_Mutation_p.A843V|SOGA3_ENST00000556132.1_Missense_Mutation_p.A843V			Q5TF21	SOGA3_HUMAN	SOGA family member 3	843					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.A843V(1)									GTAGATGCGCGCCTCGGTGAT	0.652																																					p.A843V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2528T	6						.						89.0	102.0	97.0					6																	127796643		2186	4281	6467	127838336	SO:0001583	missense	387104	exon6			AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.2528C>T	6.37:g.127796643G>A	ENSP00000434570:p.Ala843Val	Somatic		Capture	Illumina HiSeq	Phase_I	127838336	NM_001012279		Missense_Mutation	SNP	ENST00000525778.1	37	CCDS43505.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686804	0.88639	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.33865	1.39;1.39;1.39;1.39	5.71	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.22085	0.0532	L	0.56769	1.78	0.80722	D	1	P	0.44006	0.824	B	0.38296	0.27	T	0.03706	-1.1011	10	0.42905	T	0.14	-14.9161	14.5446	0.68020	0.0701:0.0:0.9299:0.0	.	843	Q5TF21	CF174_HUMAN	V	843	ENSP00000451768:A843V;ENSP00000357251:A843V;ENSP00000434570:A843V;ENSP00000435559:A843V	ENSP00000435559:A843V	A	-	2	0	C6orf174	127838336	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.869000	0.99810	1.419000	0.47118	0.462000	0.41574	GCG		SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279	
PARK2	5071	broad.mit.edu	37	6	162475180	162475180	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr6:162475180T>G	ENST00000366898.1	-	5	663	c.561A>C	c.(559-561)ttA>ttC	p.L187F	PARK2_ENST00000366892.1_Missense_Mutation_p.L187F|PARK2_ENST00000366896.1_Intron|PARK2_ENST00000366894.1_5'UTR|PARK2_ENST00000366897.1_Intron|PARK2_ENST00000338468.3_5'UTR	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	187					adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)	p.L187F(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		GGTTTGGAATTAAAACATCAT	0.398																																					p.L187F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A561C	6						.						126.0	109.0	115.0					6																	162475180		2203	4300	6503	162395170	SO:0001583	missense	5071	exon5				CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.561A>C	6.37:g.162475180T>G	ENSP00000355865:p.Leu187Phe	Somatic		Capture	Illumina HiSeq	Phase_I	162395170	NM_004562	A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Missense_Mutation	SNP	ENST00000366898.1	37	CCDS5281.1	.	.	.	.	.	.	.	.	.	.	T	19.20	3.782169	0.70222	.	.	ENSG00000185345	ENST00000366898;ENST00000366892;ENST00000366895	D;D	0.95885	-3.62;-3.84	5.39	-3.31	0.04988	.	0.000000	0.64402	D	0.000015	D	0.95778	0.8626	M	0.86178	2.8	0.39019	D	0.959711	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.989	D	0.93396	0.6756	10	0.87932	D	0	.	6.7791	0.23636	0.0:0.4745:0.1547:0.3708	.	187;187	O60260-5;O60260	.;PRKN2_HUMAN	F	187;187;108	ENSP00000355865:L187F;ENSP00000355858:L187F	ENSP00000355858:L187F	L	-	3	2	PARK2	162395170	0.854000	0.29725	0.975000	0.42487	0.973000	0.67179	-0.598000	0.05706	-0.580000	0.05944	0.533000	0.62120	TTA		PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042995.1		
NAMPT	10135	broad.mit.edu	37	7	105915443	105915443	+	Silent	SNP	T	T	C			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr7:105915443T>C	ENST00000222553.3	-	3	574	c.267A>G	c.(265-267)gaA>gaG	p.E89E	NAMPT_ENST00000484527.1_5'UTR|NAMPT_ENST00000354289.4_Silent_p.E89E	NM_005746.2	NP_005737.1	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	89					cell-cell signaling (GO:0007267)|circadian regulation of gene expression (GO:0032922)|NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|nicotinamide metabolic process (GO:0006769)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|nicotinamide phosphoribosyltransferase activity (GO:0047280)|nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)	p.E89E(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						CTTGGAAATGTTCTTTGTAGA	0.338																																					p.E89E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A267G	7						.						187.0	173.0	177.0					7																	105915443		2202	4300	6502	105702679	SO:0001819	synonymous_variant	10135	exon3			U02020	CCDS5737.1	7q22.3	2012-10-02	2008-03-27	2008-03-27	ENSG00000105835	ENSG00000105835			30092	protein-coding gene	gene with protein product	"""visfatin"""	608764	"""pre-B-cell colony enhancing factor 1"""	PBEF1		8289818	Standard	NM_005746		Approved	PBEF	uc003vdq.3	P43490	OTTHUMG00000140388	ENST00000222553.3:c.267A>G	7.37:g.105915443T>C		Somatic		Capture	Illumina HiSeq	Phase_I	105702679	NM_005746	A4D0Q9|A4D0R0|Q3KQV0|Q8WW95	Silent	SNP	ENST00000222553.3	37	CCDS5737.1																																																																																				NAMPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277146.1	NM_182790	
IFRD1	3475	broad.mit.edu	37	7	112095830	112095830	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr7:112095830G>A	ENST00000403825.3	+	2	368	c.107G>A	c.(106-108)cGa>cAa	p.R36Q	IFRD1_ENST00000535603.1_5'UTR|IFRD1_ENST00000429071.1_Missense_Mutation_p.R36Q|IFRD1_ENST00000005558.4_Missense_Mutation_p.R36Q	NM_001550.3	NP_001541.2	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1	36					adult somatic muscle development (GO:0007527)|multicellular organismal development (GO:0007275)|myoblast fate determination (GO:0007518)	nucleus (GO:0005634)		p.R36Q(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|urinary_tract(1)	15						GGCCAGCATCGAAATGTTCAG	0.343																																					p.R36Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G107A	7						.						130.0	124.0	126.0					7																	112095830		2203	4300	6503	111883066	SO:0001583	missense	3475	exon2			Y10313	CCDS34736.1, CCDS56504.1	7q31.1	2005-10-17			ENSG00000006652	ENSG00000006652			5456	protein-coding gene	gene with protein product		603502				9722946	Standard	NM_001550		Approved	PC4, TIS7	uc003vgh.3	O00458	OTTHUMG00000155124	ENST00000403825.3:c.107G>A	7.37:g.112095830G>A	ENSP00000384477:p.Arg36Gln	Somatic		Capture	Illumina HiSeq	Phase_I	111883066	NM_001550	B7Z5G1|O75234|Q5U013|Q9BVE4	Missense_Mutation	SNP	ENST00000403825.3	37	CCDS34736.1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.331148	0.60853	.	.	ENSG00000006652	ENST00000005558;ENST00000445335;ENST00000403825;ENST00000429071	T;T	0.47528	0.84;0.84	5.06	4.18	0.49190	.	0.178624	0.48767	D	0.000179	T	0.24198	0.0586	N	0.08118	0	0.80722	D	1	B;B	0.27498	0.059;0.18	B;B	0.14578	0.003;0.011	T	0.06391	-1.0829	10	0.29301	T	0.29	-2.0168	9.8538	0.41073	0.158:0.0:0.842:0.0	.	36;36	C9JA65;O00458	.;IFRD1_HUMAN	Q	36	ENSP00000005558:R36Q;ENSP00000384477:R36Q	ENSP00000005558:R36Q	R	+	2	0	IFRD1	111883066	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	4.950000	0.63603	1.248000	0.43934	0.460000	0.39030	CGA		IFRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338700.1	NM_001550	
PLXNA4	91584	broad.mit.edu	37	7	131833328	131833328	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr7:131833328G>A	ENST00000359827.3	-	26	5700	c.4738C>T	c.(4738-4740)Cga>Tga	p.R1580*	PLXNA4_ENST00000321063.4_Nonsense_Mutation_p.R1580*			Q9HCM2	PLXA4_HUMAN	plexin A4	1580					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.R1580*(1)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GTGTTCAGTCGCTTCCAATCA	0.522																																					p.R1580X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C4738T	7						.						161.0	164.0	163.0					7																	131833328		2172	4295	6467	131483868	SO:0001587	stop_gained	91584	exon26			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4738C>T	7.37:g.131833328G>A	ENSP00000352882:p.Arg1580*	Somatic		Capture	Illumina HiSeq	Phase_I	131483868	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Nonsense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	G	46	12.572742	0.99679	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	.	.	.	5.0	3.88	0.44766	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.5909	0.50945	0.0:0.0:0.1692:0.8308	.	.	.	.	X	1580	.	ENSP00000323194:R1580X	R	-	1	2	PLXNA4	131483868	1.000000	0.71417	0.999000	0.59377	0.919000	0.55068	2.564000	0.45931	0.793000	0.33875	0.561000	0.74099	CGA		PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
CNTNAP2	26047	broad.mit.edu	37	7	146805385	146805385	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr7:146805385G>A	ENST00000361727.3	+	5	1213	c.697G>A	c.(697-699)Gga>Aga	p.G233R		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	233	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.G233R(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			AGGACAGCAAGGAGATTACAT	0.398										HNSCC(39;0.1)																											p.G233R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G697A	7						.						132.0	120.0	124.0					7																	146805385		2203	4300	6503	146436318	SO:0001583	missense	26047	exon5			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.697G>A	7.37:g.146805385G>A	ENSP00000354778:p.Gly233Arg	Somatic		Capture	Illumina HiSeq	Phase_I	146436318	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.977573	0.92982	.	.	ENSG00000174469	ENST00000361727	T	0.78481	-1.18	6.03	6.03	0.97812	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.083603	0.45867	D	0.000321	D	0.86163	0.5867	M	0.64567	1.98	0.80722	D	1	D	0.56035	0.974	P	0.62014	0.897	D	0.85560	0.1227	10	0.56958	D	0.05	.	19.1533	0.93499	0.0:0.0:1.0:0.0	.	233	Q9UHC6	CNTP2_HUMAN	R	233	ENSP00000354778:G233R	ENSP00000354778:G233R	G	+	1	0	CNTNAP2	146436318	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.326000	0.96389	2.868000	0.98415	0.557000	0.71058	GGA		CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
TNRC18	84629	broad.mit.edu	37	7	5391706	5391706	+	Silent	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr7:5391706G>A	ENST00000430969.1	-	17	5562	c.5214C>T	c.(5212-5214)gaC>gaT	p.D1738D	TNRC18_ENST00000399537.4_Silent_p.D1738D	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1738							chromatin binding (GO:0003682)	p.D1738D(2)|p.D793D(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGAATTCTTCGTCTTCCTCTG	0.502																																					p.D1738D												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C5214T	7						.						39.0	36.0	37.0					7																	5391706		1568	3582	5150	5358232	SO:0001819	synonymous_variant	84629	exon17			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5214C>T	7.37:g.5391706G>A		Somatic		Capture	Illumina HiSeq	Phase_I	5358232	NM_001080495	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1																																																																																				TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
RNF216	54476	broad.mit.edu	37	7	5662731	5662731	+	Silent	SNP	G	G	A	rs35337338	byFrequency	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr7:5662731G>A	ENST00000425013.2	-	17	2585	c.2361C>T	c.(2359-2361)ccC>ccT	p.P787P	RNF216_ENST00000389902.3_Silent_p.P844P|RNF216_ENST00000469375.1_5'UTR	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	787	Pro-rich.				apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.P844P(1)	FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		TCTGCGGAACGGGCCTCGGGA	0.622													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		15720	0.0		0.0	False		,,,				2504	0.0				p.P787P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2361T	7						.	G	,	4,4402	8.1+/-20.4	0,4,2199	49.0	55.0	53.0		2532,2361	-6.9	0.7	7	dbSNP_126	53	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	RNF216	NM_207111.3,NM_207116.2	,	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	,	844/924,787/867	5662731	4,13002	2203	4300	6503	5629257	SO:0001819	synonymous_variant	54476	exon17			AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.2361C>T	7.37:g.5662731G>A		Somatic		Capture	Illumina HiSeq	Phase_I	5629257	NM_207116	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Silent	SNP	ENST00000425013.2	37	CCDS34595.1																																																																																				RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111	
PMS2	5395	broad.mit.edu	37	7	6038763	6038763	+	Silent	SNP	G	G	A	rs188813057		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr7:6038763G>A	ENST00000265849.7	-	6	786	c.681C>T	c.(679-681)atC>atT	p.I227I	PMS2_ENST00000382321.4_Silent_p.I227I|PMS2_ENST00000469652.1_Intron|PMS2_ENST00000406569.3_Silent_p.I227I|PMS2_ENST00000441476.2_Silent_p.I121I	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	227					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)	p.I227I(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		ACACAGAGCCGATATTTTCCT	0.493			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome				a|||	1	0.000199681	0.0	0.0014	5008	,	,		17000	0.0		0.0	False		,,,				2504	0.0				p.I227I		yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C681T	7						.						170.0	154.0	160.0					7																	6038763		2203	4300	6503	6005289	SO:0001819	synonymous_variant	5395	exon6	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.681C>T	7.37:g.6038763G>A		Somatic		Capture	Illumina HiSeq	Phase_I	6005289	NM_000535	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Silent	SNP	ENST00000265849.7	37	CCDS5343.1																																																																																				PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535	
DNAH11	8701	broad.mit.edu	37	7	21901500	21901500	+	Silent	SNP	C	C	T	rs201120788		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr7:21901500C>T	ENST00000409508.3	+	69	11263	c.11232C>T	c.(11230-11232)atC>atT	p.I3744I	DNAH11_ENST00000328843.6_Silent_p.I3751I	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3751					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I3751I(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						ACAGAGCGATCGAGCAGGCTG	0.512									Kartagener syndrome																												p.R3752X												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C11254T	7						.						88.0	89.0	88.0					7																	21901500		2030	4184	6214	21868025	SO:0001819	synonymous_variant	8701	exon69	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.11232C>T	7.37:g.21901500C>T		Somatic		Capture	Illumina HiSeq	Phase_I	21868025	NM_003777	Q9UJ82	Silent	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	C	0.214	-1.033877	0.02029	.	.	ENSG00000105877	ENST00000421290	.	.	.	5.65	-11.3	0.00108	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.5477	0.04741	0.1589:0.1467:0.313:0.3815	.	.	.	.	X	139	.	.	R	+	1	2	DNAH11	21868025	0.000000	0.05858	0.000000	0.03702	0.105000	0.19272	-3.252000	0.00539	-4.103000	0.00073	-1.936000	0.00505	CGA		DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
SEPT7	989	broad.mit.edu	37	7	35872433	35872433	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr7:35872433T>G	ENST00000399034.2	+	3	288	c.95T>G	c.(94-96)gTg>gGg	p.V32G	SEPT7_ENST00000494488.2_Missense_Mutation_p.V17G|SEPT7_ENST00000475109.1_3'UTR|SEPT7_ENST00000399035.3_Missense_Mutation_p.V30G|SEPT7_ENST00000435235.1_5'UTR|SEPT7_ENST00000350320.6_Missense_Mutation_p.V30G|SEPT7_ENST00000469679.2_Missense_Mutation_p.V30G			Q16181	SEPT7_HUMAN	septin 7	31					cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein heterooligomerization (GO:0051291)|regulation of embryonic cell shape (GO:0016476)	actin cytoskeleton (GO:0015629)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|septin complex (GO:0031105)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.V32G(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)	14						GAAGGCTATGTGGGATTTGCC	0.368																																					p.V30G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T89G	7						.						153.0	147.0	149.0					7																	35872433		1835	4092	5927	35838958	SO:0001583	missense	989	exon2			S72008	CCDS75582.1	7p14.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000122545	ENSG00000122545		"""Septins"""	1717	protein-coding gene	gene with protein product		603151	"""CDC10 cell division cycle 10 homolog (S. cerevisiae)"""	CDC10		8037772	Standard	NM_001788		Approved	CDC3, SEPT7A	uc011kau.2	Q16181	OTTHUMG00000155063	ENST00000399034.2:c.95T>G	7.37:g.35872433T>G	ENSP00000381992:p.Val32Gly	Somatic		Capture	Illumina HiSeq	Phase_I	35838958	NM_001011553	Q52M76|Q6NX50	Missense_Mutation	SNP	ENST00000399034.2	37		.	.	.	.	.	.	.	.	.	.	T	26.5	4.745861	0.89663	.	.	ENSG00000122545	ENST00000399034;ENST00000350320;ENST00000469679;ENST00000399035;ENST00000494488	T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38	5.58	5.58	0.84498	.	0.000000	0.64402	U	0.000002	T	0.58566	0.2131	M	0.66439	2.03	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.987	T	0.62324	-0.6878	10	0.87932	D	0	.	14.7386	0.69437	0.0:0.0:0.0:1.0	.	30;31	E7EPK1;Q16181	.;SEPT7_HUMAN	G	32;30;30;30;17	ENSP00000381992:V32G;ENSP00000344868:V30G;ENSP00000444501:V30G;ENSP00000381993:V30G;ENSP00000438395:V17G	ENSP00000344868:V30G	V	+	2	0	SEPT7	35838958	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.857000	0.86963	2.131000	0.65755	0.533000	0.62120	GTG		SEPT7-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001788	
GCK	2645	broad.mit.edu	37	7	44189575	44189575	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr7:44189575C>T	ENST00000403799.3	-	5	1041	c.572G>A	c.(571-573)cGg>cAg	p.R191Q	GCK_ENST00000345378.2_Missense_Mutation_p.R192Q|GCK_ENST00000437084.1_Missense_Mutation_p.R174Q|GCK_ENST00000395796.3_Missense_Mutation_p.R190Q	NM_000162.3	NP_000153.1	P35557	HXK4_HUMAN	glucokinase (hexokinase 4)	191	Hexokinase type-1.				calcium ion import (GO:0070509)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|cellular response to glucose starvation (GO:0042149)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|NADP metabolic process (GO:0006739)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gluconeogenesis (GO:0045721)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphorylation (GO:0042327)|regulation of glucose transport (GO:0010827)|regulation of glycolytic process (GO:0006110)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transport (GO:0043266)|second-messenger-mediated signaling (GO:0019932)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|secretory granule (GO:0030141)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|magnesium ion binding (GO:0000287)	p.R192Q(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	37						CACCCCTCTCCGTTTGATAGC	0.632																																					p.R191Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G572A	7	GRCh37	CM012120	GCK	M		.						94.0	87.0	89.0					7																	44189575		2203	4300	6503	44156100	SO:0001583	missense	2645	exon5			AF041014	CCDS5479.1, CCDS5480.1, CCDS5481.1	7p15.3-p15.1	2008-02-07	2008-02-07		ENSG00000106633	ENSG00000106633	2.7.1.2, 2.7.1.1		4195	protein-coding gene	gene with protein product		138079	"""maturity onset diabetes of the young 2"""	MODY2		1740341, 1502186	Standard	NM_033507		Approved	HK4	uc003tkk.1	P35557	OTTHUMG00000022903	ENST00000403799.3:c.572G>A	7.37:g.44189575C>T	ENSP00000384247:p.Arg191Gln	Somatic		Capture	Illumina HiSeq	Phase_I	44156100	NM_000162	A4D2J2|A4D2J3|Q05810	Missense_Mutation	SNP	ENST00000403799.3	37	CCDS5479.1	.	.	.	.	.	.	.	.	.	.	C	36	5.852261	0.97023	.	.	ENSG00000106633	ENST00000403799;ENST00000395796;ENST00000345378;ENST00000437084	D;D;D;D	0.98649	-5.05;-5.05;-5.05;-5.05	5.83	5.83	0.93111	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98943	0.9641	M	0.81112	2.525	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	P;P;P	0.57620	0.824;0.822;0.73	D	0.99831	1.1054	10	0.87932	D	0	-42.6365	19.7478	0.96258	0.0:1.0:0.0:0.0	.	191;192;190	P35557;P35557-2;P35557-3	HXK4_HUMAN;.;.	Q	191;190;192;174	ENSP00000384247:R191Q;ENSP00000379142:R190Q;ENSP00000223366:R192Q;ENSP00000402840:R174Q	ENSP00000223366:R192Q	R	-	2	0	GCK	44156100	0.993000	0.37304	0.999000	0.59377	0.953000	0.61014	6.085000	0.71343	2.763000	0.94921	0.563000	0.77884	CGG		GCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251069.2		
PEX1	5189	broad.mit.edu	37	7	92122279	92122279	+	Silent	SNP	C	C	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr7:92122279C>A	ENST00000248633.4	-	20	3290	c.3195G>T	c.(3193-3195)tcG>tcT	p.S1065S	PEX1_ENST00000438045.1_Silent_p.S743S|AC007566.10_ENST00000441539.1_RNA|AC007566.10_ENST00000427458.1_RNA|PEX1_ENST00000428214.1_Silent_p.S1008S	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	1065					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)	p.S1065S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			GGAGTCCACTCGAGAGCAGCA	0.378																																					p.S1065S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3195T	7						.						121.0	121.0	121.0					7																	92122279		2203	4300	6503	91960215	SO:0001819	synonymous_variant	5189	exon20			AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.3195G>T	7.37:g.92122279C>A		Somatic		Capture	Illumina HiSeq	Phase_I	91960215	NM_000466	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Silent	SNP	ENST00000248633.4	37	CCDS5627.1																																																																																				PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	
EN2	2020	broad.mit.edu	37	7	155255126	155255126	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr7:155255126C>T	ENST00000297375.4	+	2	995	c.746C>T	c.(745-747)aCg>aTg	p.T249M		NM_001427.3	NP_001418.2	P19622	HME2_HUMAN	engrailed homeobox 2	249					hindbrain development (GO:0030902)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron development (GO:0048666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.T249M(1)		central_nervous_system(1)|large_intestine(1)|lung(2)	4	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGGCCGCGCACGGCCTTTACC	0.607																																					p.T249M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C746T	7						.						61.0	70.0	67.0					7																	155255126		2203	4300	6503	154947887	SO:0001583	missense	2020	exon2				CCDS5940.1	7q36.2	2011-06-20	2007-02-15		ENSG00000164778	ENSG00000164778		"""Homeoboxes / ANTP class : NKL subclass"""	3343	protein-coding gene	gene with protein product		131310					Standard	NM_001427		Approved		uc003wmb.3	P19622	OTTHUMG00000151354	ENST00000297375.4:c.746C>T	7.37:g.155255126C>T	ENSP00000297375:p.Thr249Met	Somatic		Capture	Illumina HiSeq	Phase_I	154947887	NM_001427	A4D252|Q549U3|Q9UD58	Missense_Mutation	SNP	ENST00000297375.4	37	CCDS5940.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.987474	0.93106	.	.	ENSG00000164778	ENST00000297375	D	0.97352	-4.35	5.2	5.2	0.72013	Homeodomain-related (1);Homeobox engrailed (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98745	0.9578	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99709	1.1006	10	0.87932	D	0	-19.6564	18.6977	0.91607	0.0:1.0:0.0:0.0	.	249	P19622	HME2_HUMAN	M	249	ENSP00000297375:T249M	ENSP00000297375:T249M	T	+	2	0	EN2	154947887	1.000000	0.71417	0.787000	0.31911	0.985000	0.73830	7.494000	0.81503	2.590000	0.87494	0.655000	0.94253	ACG		EN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322337.1	NM_001427	
TRPA1	8989	broad.mit.edu	37	8	72967687	72967688	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr8:72967687_72967688insT	ENST00000262209.4	-	12	1719_1720	c.1512_1513insA	c.(1510-1515)aaaggtfs	p.G505fs	RP11-383H13.1_ENST00000457356.4_3'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	505					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	AACAATGCACCTTTTTTCAGAA	0.347																																					p.G505fs												.	.	0			c.1513_1514insA	8						.																																			73130242	SO:0001589	frameshift_variant	8989	exon12			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1513dupA	8.37:g.72967693_72967693dupT	ENSP00000262209:p.Gly505fs	None		Capture	Illumina HiSeq	Phase_I	73130241	NM_007332	A6NIN6	Frame_Shift_Ins	INS	ENST00000262209.4	37	CCDS34908.1																																																																																				TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
PINX1	54984	broad.mit.edu	37	8	10623347	10623347	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr8:10623347T>G	ENST00000314787.3	-	7	670	c.551A>C	c.(550-552)aAg>aCg	p.K184T	PINX1_ENST00000519088.1_Missense_Mutation_p.Q158H|CTD-2135J3.3_ENST00000506149.2_RNA|SOX7_ENST00000554914.1_Intron|SOX7_ENST00000553390.1_Intron|PINX1_ENST00000426190.2_Missense_Mutation_p.Q156H|CTD-2135J3.3_ENST00000519568.1_RNA	NM_017884.4	NP_060354.4	Q96BK5	PINX1_HUMAN	PIN2/TERF1 interacting, telomerase inhibitor 1	184					mitotic metaphase plate congression (GO:0007080)|negative regulation of cell proliferation (GO:0008285)|negative regulation of telomerase activity (GO:0051974)|regulation of telomerase activity (GO:0051972)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)|nucleolus (GO:0005730)|spindle (GO:0005819)	telomerase inhibitor activity (GO:0010521)|telomeric RNA binding (GO:0070034)	p.K184T(1)		kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	17				Kidney(29;0.0595)|COAD - Colon adenocarcinoma(149;0.105)|KIRC - Kidney renal clear cell carcinoma(542;0.201)		TGCCATCCGCTTGGCAAAGTA	0.527																																					p.K184T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A551C	8						.						159.0	164.0	163.0					8																	10623347		1994	4179	6173	10660757	SO:0001583	missense	54984	exon7			AF418553	CCDS47801.1, CCDS64825.1	8p23	2013-01-28				ENSG00000254093		"""G patch domain containing"""	30046	protein-coding gene	gene with protein product	"""PIN2 interacting protein 1"", ""liver-related putative tumor suppressor"""	606505				11003615, 11701125	Standard	NM_001284356		Approved	PinX1, LPTL, LPTS, FLJ20565, MGC8850		Q96BK5		ENST00000314787.3:c.551A>C	8.37:g.10623347T>G	ENSP00000318966:p.Lys184Thr	Somatic		Capture	Illumina HiSeq	Phase_I	10660757	NM_017884	B2R9B1|Q548A5|Q6QWG9|Q7Z7J8|Q96QD7|Q9HBU7|Q9NWW2	Missense_Mutation	SNP	ENST00000314787.3	37	CCDS47801.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.71|11.71	1.718782|1.718782	0.30503|0.30503	.|.	.|.	ENSG00000254093|ENSG00000254093	ENST00000314787;ENST00000524114|ENST00000426190;ENST00000519088	T|.	0.16597|.	2.33|.	5.8|5.8	1.98|1.98	0.26296|0.26296	.|.	0.534254|.	0.21979|.	N|.	0.066333|.	T|T	0.34832|0.34832	0.0911|0.0911	M|M	0.62016|0.62016	1.91|1.91	0.18873|0.18873	N|N	0.999981|0.999981	P|P	0.44776|0.44195	0.843|0.828	B|P	0.43658|0.45138	0.426|0.471	T|T	0.16988|0.16988	-1.0384|-1.0384	10|8	0.54805|0.35671	T|T	0.06|0.21	.|.	3.433|3.433	0.07436|0.07436	0.1637:0.1995:0.0:0.6368|0.1637:0.1995:0.0:0.6368	.|.	184|158	Q96BK5|Q96BK5-2	PINX1_HUMAN|.	T|H	184;194|156;158	ENSP00000318966:K184T|.	ENSP00000318966:K184T|ENSP00000411396:Q156H	K|Q	-|-	2|3	0|2	PINX1|PINX1	10660757|10660757	0.977000|0.977000	0.34250|0.34250	0.338000|0.338000	0.25549|0.25549	0.683000|0.683000	0.39861|0.39861	1.057000|1.057000	0.30492|0.30492	0.089000|0.089000	0.17243|0.17243	-0.408000|-0.408000	0.06270|0.06270	AAG|CAA		PINX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375683.1	NM_017884	
LONRF1	91694	broad.mit.edu	37	8	12586699	12586699	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr8:12586699T>C	ENST00000398246.3	-	9	1900	c.1831A>G	c.(1831-1833)Agt>Ggt	p.S611G	LONRF1_ENST00000533751.1_Missense_Mutation_p.S254G|MIR3926-2_ENST00000578598.1_RNA|LONRF1_ENST00000525024.1_Missense_Mutation_p.S37G	NM_152271.3	NP_689484.3	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger 1	611	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)	p.S611G(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19				READ - Rectum adenocarcinoma(644;0.236)		TGTGTATCACTGACACACATG	0.378																																					p.S611G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1831G	8						.						86.0	81.0	82.0					8																	12586699		1891	4132	6023	12631070	SO:0001583	missense	91694	exon9			AK074329	CCDS5987.2	8p23.1	2013-01-09			ENSG00000154359	ENSG00000154359		"""RING-type (C3HC4) zinc fingers"""	26302	protein-coding gene	gene with protein product						18253036	Standard	XM_005273685		Approved	FLJ23749, RNF191	uc003wwd.1	Q17RB8	OTTHUMG00000165475	ENST00000398246.3:c.1831A>G	8.37:g.12586699T>C	ENSP00000381298:p.Ser611Gly	Somatic		Capture	Illumina HiSeq	Phase_I	12631070	NM_152271	B4DM29|B4DU84|Q8TEA0|Q9BSV1	Missense_Mutation	SNP	ENST00000398246.3	37	CCDS5987.2	.	.	.	.	.	.	.	.	.	.	T	16.11	3.030197	0.54790	.	.	ENSG00000154359	ENST00000398246;ENST00000525024;ENST00000533751;ENST00000524526	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.04	5.04	0.67666	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.083511	0.85682	D	0.000000	T	0.32102	0.0818	N	0.20357	0.565	0.58432	D	0.999992	B;B	0.20261	0.034;0.043	B;B	0.29440	0.062;0.102	T	0.09250	-1.0683	10	0.27082	T	0.32	-16.1422	15.4855	0.75564	0.0:0.0:0.0:1.0	.	600;611	Q17RB8-2;Q17RB8	.;LONF1_HUMAN	G	611;37;254;214	ENSP00000381298:S611G;ENSP00000436770:S37G;ENSP00000432130:S254G;ENSP00000433327:S214G	ENSP00000381298:S611G	S	-	1	0	LONRF1	12631070	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.699000	0.61796	2.206000	0.71126	0.455000	0.32223	AGT		LONRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251693.2	NM_152271	
CSMD1	64478	broad.mit.edu	37	8	3245147	3245147	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr8:3245147C>T	ENST00000520002.1	-	19	3209	c.2654G>A	c.(2653-2655)cGc>cAc	p.R885H	CSMD1_ENST00000602557.1_Missense_Mutation_p.R885H|CSMD1_ENST00000537824.1_Missense_Mutation_p.R884H|CSMD1_ENST00000400186.3_Missense_Mutation_p.R885H|CSMD1_ENST00000539096.1_Missense_Mutation_p.R884H|CSMD1_ENST00000542608.1_Missense_Mutation_p.R884H|CSMD1_ENST00000602723.1_Missense_Mutation_p.R885H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	885	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.R613H(1)|p.R884H(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCCACCGTGGCGATGGCCGTT	0.577																																					p.S884S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2652A	8						.						38.0	46.0	43.0					8																	3245147		2118	4225	6343	3232554	SO:0001583	missense	64478	exon18					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.2654G>A	8.37:g.3245147C>T	ENSP00000430733:p.Arg885His	Somatic		Capture	Illumina HiSeq	Phase_I	3232554	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	C	20.5	4.004733	0.74932	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17	5.11	4.21	0.49690	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.73923	0.3649	L	0.53249	1.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.993	T	0.72818	-0.4178	10	0.37606	T	0.19	.	14.783	0.69781	0.1455:0.8545:0.0:0.0	.	885;885;885	E5RIG2;Q96PZ7;Q96PZ7-4	.;CSMD1_HUMAN;.	H	885;885;747;884;884;884	ENSP00000383047:R885H;ENSP00000430733:R885H;ENSP00000441462:R884H;ENSP00000446243:R884H;ENSP00000441675:R884H	ENSP00000320445:R747H	R	-	2	0	CSMD1	3232554	1.000000	0.71417	0.103000	0.21229	0.553000	0.35397	7.630000	0.83225	1.103000	0.41568	0.650000	0.86243	CGC		CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
EBF2	64641	broad.mit.edu	37	8	25897562	25897562	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr8:25897562G>A	ENST00000520164.1	-	5	1001	c.464C>T	c.(463-465)aCg>aTg	p.T155M	EBF2_ENST00000408929.3_Missense_Mutation_p.T7M	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	155					adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T155M(3)		endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		CACTTCGTGCGTCAGGAGAAC	0.602																																					p.T155M	Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)											.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.C464T	8						.						155.0	153.0	154.0					8																	25897562		1921	4135	6056	25953479	SO:0001583	missense	64641	exon5			AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.464C>T	8.37:g.25897562G>A	ENSP00000430241:p.Thr155Met	Somatic		Capture	Illumina HiSeq	Phase_I	25953479	NM_022659	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Missense_Mutation	SNP	ENST00000520164.1	37	CCDS43726.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.746561	0.89663	.	.	ENSG00000221818	ENST00000520164;ENST00000408929	T;T	0.65178	0.02;-0.14	5.5	5.5	0.81552	.	0.000000	0.85682	U	0.000000	D	0.82898	0.5137	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85641	0.1276	10	0.87932	D	0	-0.2061	19.4023	0.94635	0.0:0.0:1.0:0.0	.	155	Q9HAK2	COE2_HUMAN	M	155;7	ENSP00000430241:T155M;ENSP00000386178:T7M	ENSP00000386178:T7M	T	-	2	0	EBF2	25953479	1.000000	0.71417	0.966000	0.40874	0.959000	0.62525	9.747000	0.98863	2.573000	0.86826	0.655000	0.94253	ACG		EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375886.2	NM_022659	
ANK1	286	broad.mit.edu	37	8	41575199	41575199	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr8:41575199C>T	ENST00000347528.4	-	12	1311	c.1228G>A	c.(1228-1230)Gtg>Atg	p.V410M	ANK1_ENST00000352337.4_Missense_Mutation_p.V410M|ANK1_ENST00000265709.8_Missense_Mutation_p.V443M|ANK1_ENST00000396942.1_Missense_Mutation_p.V410M|ANK1_ENST00000396945.1_Missense_Mutation_p.V410M|ANK1_ENST00000289734.7_Missense_Mutation_p.V410M|ANK1_ENST00000379758.2_Missense_Mutation_p.V410M	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	410	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.V410M(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			AAGGAGGCCACGTGGAGAGGT	0.587																																					p.V410M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1228A	8						.						24.0	18.0	20.0					8																	41575199		2014	3785	5799	41694356	SO:0001583	missense	286	exon12			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1228G>A	8.37:g.41575199C>T	ENSP00000339620:p.Val410Met	Somatic		Capture	Illumina HiSeq	Phase_I	41694356	NM_020475	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785878	0.90282	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	5.5	5.5	0.81552	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.73001	0.3531	N	0.17872	0.535	0.80722	D	1	D;D;P;D;D	0.89917	1.0;0.999;0.479;1.0;1.0	D;D;B;D;D	0.91635	0.999;0.998;0.08;0.997;0.999	T	0.76812	-0.2821	10	0.66056	D	0.02	.	19.389	0.94573	0.0:1.0:0.0:0.0	.	443;410;410;410;410	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	M	410;410;410;410;410;410;443;410	ENSP00000339620:V410M;ENSP00000289734:V410M;ENSP00000369082:V410M;ENSP00000380149:V410M;ENSP00000380147:V410M;ENSP00000309131:V410M;ENSP00000265709:V443M	ENSP00000265709:V443M	V	-	1	0	ANK1	41694356	1.000000	0.71417	1.000000	0.80357	0.641000	0.38312	7.797000	0.85911	2.584000	0.87258	0.491000	0.48974	GTG		ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
XKR4	114786	broad.mit.edu	37	8	56436530	56436530	+	Missense_Mutation	SNP	G	G	A	rs377335343		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr8:56436530G>A	ENST00000327381.6	+	3	1797	c.1697G>A	c.(1696-1698)cGg>cAg	p.R566Q	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	566						integral component of membrane (GO:0016021)		p.R566Q(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			TTCGCAGAGCGGGATGGGTGT	0.552																																					p.R566Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1697A	8						.	G	GLN/ARG	0,4406		0,0,2203	73.0	76.0	75.0		1697	5.9	1.0	8		75	1,8599	1.2+/-3.3	0,1,4299	no	missense	XKR4	NM_052898.1	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	566/651	56436530	1,13005	2203	4300	6503	56599084	SO:0001583	missense	114786	exon3			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1697G>A	8.37:g.56436530G>A	ENSP00000328326:p.Arg566Gln	Somatic		Capture	Illumina HiSeq	Phase_I	56599084	NM_052898	Q96PZ8	Missense_Mutation	SNP	ENST00000327381.6	37	CCDS34893.1	.	.	.	.	.	.	.	.	.	.	G	19.55	3.849069	0.71603	0.0	1.16E-4	ENSG00000206579	ENST00000327381;ENST00000543752	D	0.84070	-1.8	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.89986	0.6874	L	0.59436	1.845	0.58432	D	0.999998	D	0.89917	1.0	D	0.79108	0.992	D	0.87919	0.2702	10	0.40728	T	0.16	-3.1323	20.3931	0.98965	0.0:0.0:1.0:0.0	.	566	Q5GH76	XKR4_HUMAN	Q	566	ENSP00000328326:R566Q	ENSP00000328326:R566Q	R	+	2	0	XKR4	56599084	1.000000	0.71417	0.998000	0.56505	0.133000	0.20885	9.869000	0.99810	2.824000	0.97209	0.655000	0.94253	CGG		XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	NM_052898	
ZFHX4	79776	broad.mit.edu	37	8	77767760	77767760	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr8:77767760T>C	ENST00000521891.2	+	10	9051	c.8603T>C	c.(8602-8604)cTc>cCc	p.L2868P	ZFHX4_ENST00000518282.1_Missense_Mutation_p.L2842P|ZFHX4_ENST00000455469.2_Missense_Mutation_p.L2823P|ZFHX4_ENST00000050961.6_Missense_Mutation_p.L2823P	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2823					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.L2852P(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CTCTTTTCTCTCACAAGCCCA	0.502										HNSCC(33;0.089)																											p.L2868P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T8603C	8						.						97.0	99.0	98.0					8																	77767760		1977	4148	6125	77930315	SO:0001583	missense	79776	exon10				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8603T>C	8.37:g.77767760T>C	ENSP00000430497:p.Leu2868Pro	Somatic		Capture	Illumina HiSeq	Phase_I	77930315	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	T	13.99	2.400988	0.42613	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.59502	0.26;0.32;0.29;0.29	5.25	5.25	0.73442	.	0.000000	0.40064	U	0.001181	T	0.70281	0.3206	L	0.48642	1.525	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.83275	0.99;0.996;0.996	T	0.73094	-0.4091	10	0.72032	D	0.01	.	15.317	0.74089	0.0:0.0:0.0:1.0	.	2823;2823;2868	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	P	2868;2852;2823;2823;2842	ENSP00000430497:L2868P;ENSP00000399605:L2823P;ENSP00000050961:L2823P;ENSP00000430848:L2842P	ENSP00000050961:L2823P	L	+	2	0	ZFHX4	77930315	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	7.868000	0.87116	2.207000	0.71202	0.459000	0.35465	CTC		ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
PTGR1	22949	broad.mit.edu	37	9	114341160	114341160	+	Silent	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr9:114341160G>A	ENST00000407693.2	-	7	829	c.567C>T	c.(565-567)gtC>gtT	p.V189V	PTGR1_ENST00000238248.3_Silent_p.V66V|PTGR1_ENST00000309195.5_Silent_p.V189V|PTGR1_ENST00000538962.1_Silent_p.V189V	NM_001146108.1	NP_001139580.1	Q14914	PTGR1_HUMAN	prostaglandin reductase 1	189					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|leukotriene metabolic process (GO:0006691)|lipoxin metabolic process (GO:2001300)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)|2-alkenal reductase [NAD(P)] activity (GO:0032440)|zinc ion binding (GO:0008270)	p.V189V(1)		endometrium(2)|large_intestine(5)|lung(3)|ovary(1)	11						AGTTAAAGACGACATCAAATC	0.373																																					p.V189V	Ovarian(200;132 2151 7551 19220 46064)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C567T	9						.						95.0	82.0	86.0					9																	114341160		2203	4300	6503	113380981	SO:0001819	synonymous_variant	22949	exon7			D49387	CCDS6779.1, CCDS55331.1	9q32	2008-06-04	2008-06-02	2008-06-02	ENSG00000106853	ENSG00000106853	1.3.1.74, 1.3.1.48		18429	protein-coding gene	gene with protein product	"""zinc binding alcohol dehydrogenase domain containing 3"""	601274	"""leukotriene B4 12-hydroxydehydrogenase"""	LTB4DH		8576264, 17449869	Standard	NM_001146109		Approved	ZADH3	uc004bfh.2	Q14914	OTTHUMG00000020493	ENST00000407693.2:c.567C>T	9.37:g.114341160G>A		Somatic		Capture	Illumina HiSeq	Phase_I	113380981	NM_001146109	A8K0N2|B4DPK3|F5GY50|Q8IYQ0|Q9H1X6	Silent	SNP	ENST00000407693.2	37	CCDS6779.1																																																																																				PTGR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053647.2		
WDR31	114987	broad.mit.edu	37	9	116082775	116082775	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr9:116082775T>G	ENST00000374193.4	-	9	888	c.642A>C	c.(640-642)ttA>ttC	p.L214F	WDR31_ENST00000341761.4_Missense_Mutation_p.L213F|WDR31_ENST00000374195.3_Missense_Mutation_p.L89F|WDR31_ENST00000461942.1_5'UTR	NM_001012361.2|NM_145241.3	NP_001012361.1|NP_660284.1	Q8NA23	WDR31_HUMAN	WD repeat domain 31	214								p.L214F(1)		NS(1)|large_intestine(1)|lung(2)|prostate(2)	6						GACTGTCCCATAATCTGAAAG	0.458																																					p.L214F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A642C	9						.						69.0	64.0	65.0					9																	116082775		2203	4300	6503	115122596	SO:0001583	missense	114987	exon9			BC012352	CCDS6792.1, CCDS35110.1	9q33.1	2013-01-09			ENSG00000148225	ENSG00000148225		"""WD repeat domain containing"""	21421	protein-coding gene	gene with protein product	"""similar to spermatid WD-repeat protein"""						Standard	NM_145241		Approved	FLJ35921	uc004bhb.3	Q8NA23	OTTHUMG00000020525	ENST00000374193.4:c.642A>C	9.37:g.116082775T>G	ENSP00000363308:p.Leu214Phe	Somatic		Capture	Illumina HiSeq	Phase_I	115122596	NM_001012361	Q5W0T9|Q96EG8	Missense_Mutation	SNP	ENST00000374193.4	37	CCDS35110.1	.	.	.	.	.	.	.	.	.	.	T	19.94	3.920123	0.73098	.	.	ENSG00000148225	ENST00000374193;ENST00000374195;ENST00000341761	T;T;T	0.66460	-0.21;-0.21;-0.21	5.86	-1.01	0.10169	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.297696	0.30193	N	0.010187	T	0.69575	0.3126	M	0.69523	2.12	0.43896	D	0.996522	D;D	0.54772	0.968;0.96	P;P	0.55303	0.773;0.663	T	0.68334	-0.5436	10	0.87932	D	0	-9.0578	6.7353	0.23405	0.1729:0.498:0.0:0.3291	.	214;213	Q8NA23;Q8NA23-2	WDR31_HUMAN;.	F	214;89;213	ENSP00000363308:L214F;ENSP00000363310:L89F;ENSP00000345027:L213F	ENSP00000345027:L213F	L	-	3	2	WDR31	115122596	0.880000	0.30214	0.997000	0.53966	0.991000	0.79684	-0.111000	0.10807	-0.066000	0.12998	0.460000	0.39030	TTA		WDR31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053734.2	NM_145241	
SPTAN1	6709	broad.mit.edu	37	9	131383493	131383493	+	Silent	SNP	C	C	T	rs144435438	byFrequency	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr9:131383493C>T	ENST00000372731.4	+	44	5885	c.5775C>T	c.(5773-5775)cgC>cgT	p.R1925R	SPTAN1_ENST00000372739.3_Silent_p.R1930R|SPTAN1_ENST00000358161.5_Silent_p.R1930R	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1925					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R1925R(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						ACAAGGATCGCGTGAATGATG	0.507													C|||	6	0.00119808	0.0045	0.0	5008	,	,		21441	0.0		0.0	False		,,,				2504	0.0				p.R1905R	NSCLC(120;833 1744 2558 35612 37579)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5715T	9						.	C	,,	7,4399	12.9+/-30.5	0,7,2196	114.0	90.0	98.0		5790,5715,5775	-10.4	0.0	9	dbSNP_134	98	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	SPTAN1	NM_001130438.2,NM_001195532.1,NM_003127.3	,,	0,7,6496	TT,TC,CC		0.0,0.1589,0.0538	,,	1930/2478,1905/2453,1925/2473	131383493	7,12999	2203	4300	6503	130423314	SO:0001819	synonymous_variant	6709	exon43			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.5775C>T	9.37:g.131383493C>T		Somatic		Capture	Illumina HiSeq	Phase_I	130423314	NM_001195532	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Silent	SNP	ENST00000372731.4	37	CCDS6905.1																																																																																				SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
ANKRD20A1	84210	broad.mit.edu	37	9	67968285	67968285	+	Missense_Mutation	SNP	C	C	G	rs201264629		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr9:67968285C>G	ENST00000377477.2	+	15	1956	c.1844C>G	c.(1843-1845)gCt>gGt	p.A615G	RP11-195B21.3_ENST00000417488.1_5'Flank	NM_032250.3	NP_115626.2	Q5TYW2	A20A1_HUMAN	ankyrin repeat domain 20 family, member A1	615						plasma membrane (GO:0005886)		p.A615G(1)		kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	11						AGACTGGCTGCTGCTATAAGC	0.388																																					p.A615G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1844G	9						.																																			67558105	SO:0001583	missense	441425	exon15			AL136793	CCDS6620.1	9p12	2014-04-16	2005-08-23	2005-08-23	ENSG00000196774	ENSG00000260691		"""Ankyrin repeat domain containing"""	23665	protein-coding gene	gene with protein product			"""ankyrin repeat domain 20A"""	ANKRD20A			Standard	NM_032250		Approved	DKFZp434A171		Q5TYW2	OTTHUMG00000188594	ENST00000377477.2:c.1844C>G	9.37:g.67968285C>G	ENSP00000366697:p.Ala615Gly	Somatic		Capture	Illumina HiSeq	Phase_I	67558105	NM_001012419	Q9H0H6	Missense_Mutation	SNP	ENST00000377477.2	37	CCDS6620.1	.	.	.	.	.	.	.	.	.	.	.	8.954	0.968897	0.18659	.	.	ENSG00000196774	ENST00000377477	T	0.19105	2.17	1.88	1.88	0.25563	.	.	.	.	.	T	0.23370	0.0565	M	0.78456	2.415	0.09310	N	1	B	0.32409	0.37	B	0.23716	0.048	T	0.16719	-1.0393	9	0.62326	D	0.03	.	9.5031	0.39031	0.0:1.0:0.0:0.0	.	615	Q5TYW2	A20A1_HUMAN	G	615	ENSP00000366697:A615G	ENSP00000366697:A615G	A	+	2	0	ANKRD20A1	67558105	0.388000	0.25197	0.022000	0.16811	0.005000	0.04900	2.728000	0.47319	1.071000	0.40834	0.109000	0.15622	GCT		ANKRD20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083800.1		
APBA1	320	broad.mit.edu	37	9	72132061	72132061	+	Silent	SNP	G	G	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr9:72132061G>A	ENST00000265381.4	-	2	288	c.66C>T	c.(64-66)aaC>aaT	p.N22N		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	22					axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.N22N(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						CCACCGACTCGTTCACCTCCC	0.682																																					p.N22N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C66T	9						.						16.0	13.0	14.0					9																	72132061		2195	4286	6481	71321881	SO:0001819	synonymous_variant	320	exon2			AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.66C>T	9.37:g.72132061G>A		Somatic		Capture	Illumina HiSeq	Phase_I	71321881	NM_001163	O14914|O60570|Q5VYR8	Silent	SNP	ENST00000265381.4	37	CCDS6630.1																																																																																				APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052589.2	NM_001163	
LCN1	3933	broad.mit.edu	37	9	138415760	138415760	+	Silent	SNP	G	G	A	rs373587388	byFrequency	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chr9:138415760G>A	ENST00000263598.2	+	4	387	c.327G>A	c.(325-327)tcG>tcA	p.S109S	LCN1_ENST00000371781.3_Silent_p.S109S	NM_001252617.1|NM_001252618.1|NM_001252619.1|NM_002297.3	NP_001239546.1|NP_001239547.1|NP_001239548.1|NP_002288.1	P31025	LCN1_HUMAN	lipocalin 1	109					negative regulation of endopeptidase activity (GO:0010951)|proteolysis (GO:0006508)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|sensory perception of taste (GO:0050909)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.S109S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)	13		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.54e-08)|Epithelial(140;5.25e-08)|all cancers(34;9.27e-07)|READ - Rectum adenocarcinoma(205;0.155)		TCATCAGGTCGCACGTGAAGG	0.602													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		17671	0.0		0.0	False		,,,				2504	0.0				p.S109S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G327A	9						.	G		0,4406		0,0,2203	109.0	88.0	95.0		327	-6.2	0.0	9		95	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	LCN1	NM_002297.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		109/177	138415760	2,13004	2203	4300	6503	137555581	SO:0001819	synonymous_variant	3933	exon4				CCDS6991.1	9q34	2011-11-14	2011-11-01		ENSG00000160349	ENSG00000160349		"""Lipocalins"""	6525	protein-coding gene	gene with protein product	"""Von Ebner gland protein"", ""tear lipocalin"", ""lipocalin 1-like 2"", ""tear prealbumin"""	151675	"""lipocalin 1 (protein migrating faster than albumin, tear prealbumin)"", ""lipocalin 1 (tear prealbumin)"""			8276406	Standard	NM_002297		Approved	VEGP, TP, PMFA, MGC71975, TLC	uc022bpk.1	P31025	OTTHUMG00000020908	ENST00000263598.2:c.327G>A	9.37:g.138415760G>A		Somatic		Capture	Illumina HiSeq	Phase_I	137555581	NM_002297	Q5T8A1	Silent	SNP	ENST00000263598.2	37	CCDS6991.1																																																																																				LCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054992.1	NM_002297	
NLGN3	54413	broad.mit.edu	37	X	70389790	70389790	+	Missense_Mutation	SNP	G	G	A	rs139671086		TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chrX:70389790G>A	ENST00000358741.3	+	8	2693	c.2390G>A	c.(2389-2391)cGg>cAg	p.R797Q	NLGN3_ENST00000374051.3_Missense_Mutation_p.R777Q|NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_Missense_Mutation_p.R757Q	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	797					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.R777Q(1)		biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					CTGACCCTGCGGCGCTCCCCG	0.612																																					p.R757Q	Esophageal Squamous(103;760 1488 16849 22250 40351)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2270A	X						.	G	GLN/ARG,GLN/ARG,GLN/ARG	1,3833		0,1,1631,570	102.0	70.0	81.0		2270,2330,2390	4.1	1.0	X	dbSNP_134	81	0,6725		0,0,2428,1869	no	missense,missense,missense	NLGN3	NM_001166660.1,NM_018977.3,NM_181303.1	43,43,43	0,1,4059,2439	AA,AG,GG,G		0.0,0.0261,0.0095	probably-damaging,probably-damaging,probably-damaging	757/809,777/829,797/849	70389790	1,10558	2202	4297	6499	70306515	SO:0001583	missense	54413	exon6			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.2390G>A	X.37:g.70389790G>A	ENSP00000351591:p.Arg797Gln	Somatic		Capture	Illumina HiSeq	Phase_I	70306515	NM_001166660	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Missense_Mutation	SNP	ENST00000358741.3	37	CCDS55441.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.026242	0.75390	2.61E-4	0.0	ENSG00000196338	ENST00000536169;ENST00000374051;ENST00000358741	T;T;T	0.70986	-0.51;-0.53;-0.53	4.92	4.06	0.47325	.	0.000000	0.85682	D	0.000000	D	0.83510	0.5270	M	0.81497	2.545	0.48632	D	0.999687	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.85462	0.1167	10	0.87932	D	0	.	12.7797	0.57471	0.0809:0.0:0.9191:0.0	.	757;797;777	D3DVV1;Q9NZ94;Q9NZ94-2	.;NLGN3_HUMAN;.	Q	757;777;797	ENSP00000445298:R757Q;ENSP00000363163:R777Q;ENSP00000351591:R797Q	ENSP00000351591:R797Q	R	+	2	0	NLGN3	70306515	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.657000	0.98554	1.096000	0.41439	0.525000	0.51046	CGG		NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057121.1	NM_018977	
AFF2	2334	broad.mit.edu	37	X	148037870	148037870	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3851-01A-01W-0995-10	TCGA-AA-3851-10A-01W-0995-10	g.chrX:148037870C>A	ENST00000370460.2	+	11	2774	c.2295C>A	c.(2293-2295)agC>agA	p.S765R	AFF2_ENST00000286437.5_Missense_Mutation_p.S406R|AFF2_ENST00000342251.3_Missense_Mutation_p.S732R|AFF2_ENST00000370457.5_Missense_Mutation_p.S732R	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	765					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.S765R(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GCAGTGGCAGCAACAACAACT	0.468																																					p.S765R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2295A	X						.						97.0	86.0	90.0					X																	148037870		2203	4300	6503	147845570	SO:0001583	missense	2334	exon11			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2295C>A	X.37:g.148037870C>A	ENSP00000359489:p.Ser765Arg	Somatic		Capture	Illumina HiSeq	Phase_I	147845570	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	C	4.894	0.166109	0.09339	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	3.98	3.98	0.46160	.	1.263210	0.05121	N	0.490640	T	0.55625	0.1932	L	0.36672	1.1	0.20307	N	0.999914	B;B;B;B;B;B	0.33044	0.395;0.343;0.062;0.062;0.343;0.395	B;B;B;B;B;B	0.31614	0.133;0.082;0.075;0.075;0.082;0.133	T	0.41088	-0.9528	10	0.15499	T	0.54	.	15.5208	0.75866	0.0:1.0:0.0:0.0	.	406;730;732;726;755;765	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	R	765;732;732;406	ENSP00000359489:S765R;ENSP00000359486:S732R;ENSP00000345459:S732R;ENSP00000286437:S406R	ENSP00000286437:S406R	S	+	3	2	AFF2	147845570	0.999000	0.42202	0.007000	0.13788	0.101000	0.19017	5.288000	0.65651	1.553000	0.49476	0.544000	0.68410	AGC		AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
