#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DAGLB	221955	hgsc.bcm.edu	37	7	6470120	6470120	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr7:6470120C>T	ENST00000297056.6	-	6	1089	c.920G>A	c.(919-921)gGt>gAt	p.G307D	DAGLB_ENST00000436575.1_Missense_Mutation_p.G266D|DAGLB_ENST00000425398.2_Intron|DAGLB_ENST00000421761.2_Intron|DAGLB_ENST00000428902.2_Missense_Mutation_p.G180D	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta	307					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.G307D(1)		breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		CCAGTCACCACCAATCCTGCA	0.458																																					p.G307D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G920A	7						.						38.0	42.0	41.0					7																	6470120		2203	4300	6503	6436645	SO:0001583	missense	221955	exon6			AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.920G>A	7.37:g.6470120C>T	ENSP00000297056:p.Gly307Asp	Somatic		Capture	SOLID	Phase_I	6436645	NM_139179	A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Missense_Mutation	SNP	ENST00000297056.6	37	CCDS5350.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.868558	0.51588	.	.	ENSG00000164535	ENST00000297056;ENST00000436575;ENST00000428902	T;T	0.46819	0.86;0.87	4.85	3.96	0.45880	.	0.241686	0.42294	N	0.000737	T	0.45276	0.1334	L	0.58669	1.825	0.80722	D	1	D;P	0.53745	0.962;0.923	P;B	0.47299	0.543;0.36	T	0.36138	-0.9760	10	0.35671	T	0.21	-19.3043	6.7044	0.23242	0.1733:0.7085:0.0:0.1182	.	121;307	B4DQQ6;Q8NCG7	.;DGLB_HUMAN	D	307;266;180	ENSP00000297056:G307D;ENSP00000404785:G266D	ENSP00000297056:G307D	G	-	2	0	DAGLB	6436645	0.995000	0.38212	0.030000	0.17652	0.986000	0.74619	3.467000	0.53078	1.137000	0.42214	-0.169000	0.13324	GGT		DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246840.2	NM_139179	
CRHR2	1395	hgsc.bcm.edu	37	7	30693147	30693147	+	Silent	SNP	G	G	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr7:30693147G>T	ENST00000471646.1	-	12	1582	c.1165C>A	c.(1165-1167)Cgg>Agg	p.R389R	CRHR2_ENST00000506074.2_3'UTR|CRHR2_ENST00000348438.4_Silent_p.R416R|CRHR2_ENST00000341843.4_Silent_p.R375R	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	389					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)	p.R375R(1)|p.R389R(1)		breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GACATGGCCCGGGCCATGGGG	0.657																																					p.R389R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1165A	7						.						155.0	139.0	144.0					7																	30693147		2203	4300	6503	30659672	SO:0001819	synonymous_variant	1395	exon12				CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.1165C>A	7.37:g.30693147G>T		Somatic		Capture	SOLID	Phase_I	30659672	NM_001883	B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Silent	SNP	ENST00000471646.1	37	CCDS5429.1																																																																																				CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250448.3		
NME8	51314	hgsc.bcm.edu	37	7	37916483	37916483	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr7:37916483G>T	ENST00000199447.4	+	12	1240	c.868G>T	c.(868-870)Gaa>Taa	p.E290*	NME8_ENST00000440017.1_Nonsense_Mutation_p.E290*|EPDR1_ENST00000476620.1_Intron	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	290					cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)	p.E290*(1)									CTGTGACATTGAAGAGGATGC	0.313																																					p.E290X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G868T	7						.						69.0	72.0	71.0					7																	37916483		2203	4300	6503	37883008	SO:0001587	stop_gained	51314	exon12			AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.868G>T	7.37:g.37916483G>T	ENSP00000199447:p.Glu290*	Somatic		Capture	SOLID	Phase_I	37883008	NM_016616	Q9NZH1	Nonsense_Mutation	SNP	ENST00000199447.4	37	CCDS5452.1	.	.	.	.	.	.	.	.	.	.	G	17.45	3.393364	0.62066	.	.	ENSG00000086288	ENST00000199447;ENST00000440017	.	.	.	4.12	4.12	0.48240	.	0.543919	0.15829	N	0.242633	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-33.6553	12.161	0.54103	0.0:0.0:1.0:0.0	.	.	.	.	X	290	.	ENSP00000199447:E290X	E	+	1	0	TXNDC3	37883008	1.000000	0.71417	0.834000	0.33040	0.019000	0.09904	2.834000	0.48167	2.570000	0.86706	0.591000	0.81541	GAA		NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219946.1	NM_016616	
GCK	2645	hgsc.bcm.edu	37	7	44191894	44191894	+	Silent	SNP	G	G	A	rs149412035	byFrequency	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr7:44191894G>A	ENST00000403799.3	-	3	808	c.339C>T	c.(337-339)gaC>gaT	p.D113D	GCK_ENST00000437084.1_Silent_p.D113D|GCK_ENST00000476008.1_5'Flank|GCK_ENST00000345378.2_Silent_p.D114D|GCK_ENST00000395796.3_Silent_p.D112D	NM_000162.3	NP_000153.1	P35557	HXK4_HUMAN	glucokinase (hexokinase 4)	113	Hexokinase type-1.				calcium ion import (GO:0070509)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|cellular response to glucose starvation (GO:0042149)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|NADP metabolic process (GO:0006739)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gluconeogenesis (GO:0045721)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphorylation (GO:0042327)|regulation of glucose transport (GO:0010827)|regulation of glycolytic process (GO:0006110)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transport (GO:0043266)|second-messenger-mediated signaling (GO:0019932)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|secretory granule (GO:0030141)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|magnesium ion binding (GO:0000287)	p.D114D(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	37						CGGTCATGGCGTCCTCGGGGA	0.632													G|||	11	0.00219649	0.0076	0.0014	5008	,	,		19356	0.0		0.0	False		,,,				2504	0.0				p.D113D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C339T	7						.	G	,,	60,4346	58.1+/-94.6	1,58,2144	266.0	223.0	238.0		339,342,336	-2.3	1.0	7	dbSNP_134	238	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	GCK	NM_000162.3,NM_033507.1,NM_033508.1	,,	1,58,6444	AA,AG,GG		0.0,1.3618,0.4613	,,	113/466,114/467,112/465	44191894	60,12946	2203	4300	6503	44158419	SO:0001819	synonymous_variant	2645	exon3			AF041014	CCDS5479.1, CCDS5480.1, CCDS5481.1	7p15.3-p15.1	2008-02-07	2008-02-07		ENSG00000106633	ENSG00000106633	2.7.1.2, 2.7.1.1		4195	protein-coding gene	gene with protein product		138079	"""maturity onset diabetes of the young 2"""	MODY2		1740341, 1502186	Standard	NM_033507		Approved	HK4	uc003tkk.1	P35557	OTTHUMG00000022903	ENST00000403799.3:c.339C>T	7.37:g.44191894G>A		Somatic		Capture	SOLID	Phase_I	44158419	NM_000162	A4D2J2|A4D2J3|Q05810	Silent	SNP	ENST00000403799.3	37	CCDS5479.1																																																																																				GCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251069.2		
BAZ1B	9031	hgsc.bcm.edu	37	7	72892555	72892555	+	Silent	SNP	C	C	G			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr7:72892555C>G	ENST00000339594.4	-	7	1574	c.1236G>C	c.(1234-1236)ctG>ctC	p.L412L	BAZ1B_ENST00000404251.1_Silent_p.L412L	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	412	Lys-rich.				cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)	p.L412L(1)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				TCTGTCCATTCAGGATGCCTT	0.443																																					p.L412L	Esophageal Squamous(112;1167 1561 21085 43672 48228)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1236C	7						.						139.0	132.0	135.0					7																	72892555		2203	4300	6503	72530491	SO:0001819	synonymous_variant	9031	exon7			AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.1236G>C	7.37:g.72892555C>G		Somatic		Capture	SOLID	Phase_I	72530491	NM_032408	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Silent	SNP	ENST00000339594.4	37	CCDS5549.1																																																																																				BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252123.4	NM_032408	
SLC12A9	56996	hgsc.bcm.edu	37	7	100459099	100459099	+	Missense_Mutation	SNP	G	G	A	rs200686276		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr7:100459099G>A	ENST00000354161.3	+	11	1554	c.1429G>A	c.(1429-1431)Gcg>Acg	p.A477T	SLC12A9_ENST00000275729.3_Missense_Mutation_p.A388T|SLC12A9_ENST00000428758.1_Missense_Mutation_p.A477T|SLC12A9_ENST00000415287.1_Missense_Mutation_p.A388T|SLC12A9_ENST00000540482.1_Missense_Mutation_p.A477T	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	477					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)	p.A477T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					CAGTCCTGGCGCGGCTGGTGG	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		16662	0.001		0.0	False		,,,				2504	0.0				p.A477T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1429A	7						.						77.0	76.0	76.0					7																	100459099		2203	4300	6503	100297035	SO:0001583	missense	56996	exon11			AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.1429G>A	7.37:g.100459099G>A	ENSP00000275730:p.Ala477Thr	Somatic		Capture	SOLID	Phase_I	100297035	NM_020246	B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	Missense_Mutation	SNP	ENST00000354161.3	37	CCDS5707.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	10.78	1.445938	0.25987	.	.	ENSG00000146828	ENST00000540482;ENST00000428758;ENST00000275729;ENST00000415287;ENST00000354161;ENST00000539308	D;D;D;D;D	0.98958	-5.27;-5.27;-5.27;-5.27;-5.27	5.51	5.51	0.81932	Amino acid permease domain (1);	0.122524	0.56097	D	0.000027	D	0.94971	0.8373	N	0.16233	0.39	0.40558	D	0.981184	P;P	0.35628	0.457;0.513	B;B	0.30179	0.068;0.112	D	0.95203	0.8318	10	0.14656	T	0.56	.	16.8882	0.86081	0.0:0.0:1.0:0.0	.	388;477	Q9BXP2-2;Q9BXP2	.;S12A9_HUMAN	T	477;477;388;388;477;103	ENSP00000443702:A477T;ENSP00000408301:A477T;ENSP00000275729:A388T;ENSP00000413796:A388T;ENSP00000275730:A477T	ENSP00000275729:A388T	A	+	1	0	SLC12A9	100297035	1.000000	0.71417	0.276000	0.24689	0.002000	0.02628	4.759000	0.62227	2.590000	0.87494	0.491000	0.48974	GCG		SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342837.1	NM_020246	
BRAF	673	hgsc.bcm.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	A	T	rs121913377|rs113488022|rs121913227|rs397516897		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr7:140453136A>T	ENST00000288602.6	-	15	1859	c.1799T>A	c.(1798-1800)gTg>gAg	p.V600E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:12068308}.|V -> E (in CRC; also found in sarcoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis; loss of regulation by PMRT5). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:12198537, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:23263490, ECO:0000269|PubMed:24455489}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V600E(15453)|p.V600K(252)|p.V600R(44)|p.V600D(16)|p.V600A(12)|p.V600_K601>E(12)|p.V600G(11)|p.T599_R603>I(2)|p.V600Q(2)|p.V600_S605>EK(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insDFGLAT(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TCGAGATTTCACTGTAGCTAG	0.368	V600D(K029AX_SKIN)|V600D(WM115_SKIN)|V600D(WM2664_SKIN)|V600E(8505C_THYROID)|V600E(A101D_SKIN)|V600E(A2058_SKIN)|V600E(A375_SKIN)|V600E(A673_BONE)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(BCPAP_THYROID)|V600E(BHT101_THYROID)|V600E(BT474_BREAST)|V600E(C32_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(COLO205_LARGE_INTESTINE)|V600E(COLO679_SKIN)|V600E(COLO741_SKIN)|V600E(COLO783_SKIN)|V600E(COLO800_SKIN)|V600E(COLO818_SKIN)|V600E(COLO829_SKIN)|V600E(COLO849_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(DU4475_BREAST)|V600E(ES2_OVARY)|V600E(G361_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(HS294T_SKIN)|V600E(HS695T_SKIN)|V600E(HS939T_SKIN)|V600E(IGR1_SKIN)|V600E(IGR37_SKIN)|V600E(IGR39_SKIN)|V600E(K029AX_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(LOXIMVI_SKIN)|V600E(MALME3M_SKIN)|V600E(MELHO_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(RKO_LARGE_INTESTINE)|V600E(RPMI7951_SKIN)|V600E(RVH421_SKIN)|V600E(SH4_SKIN)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(SKHEP1_LIVER)|V600E(SKMEL24_SKIN)|V600E(SKMEL28_SKIN)|V600E(SKMEL5_SKIN)|V600E(SW1417_LARGE_INTESTINE)|V600E(UACC257_SKIN)|V600E(UACC62_SKIN)|V600E(WM793_SKIN)|V600E(WM88_SKIN)|V600E(WM983B_SKIN)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.V600E	Colon(40;35 892 2973 5743 27438)		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	BRAF,pituitary,NS,Substitution - Missense,0	.	15808	Substitution - Missense(15790)|Complex - deletion inframe(17)|Insertion - In frame(1)	thyroid(7476)|skin(3822)|large_intestine(3288)|NS(360)|haematopoietic_and_lymphoid_tissue(336)|ovary(211)|lung(58)|eye(57)|central_nervous_system(53)|soft_tissue(30)|biliary_tract(18)|liver(17)|prostate(13)|breast(10)|upper_aerodigestive_tract(9)|endometrium(8)|pancreas(8)|testis(7)|small_intestine(7)|genital_tract(4)|stomach(4)|bone(3)|autonomic_ganglia(2)|oesophagus(2)|urinary_tract(2)|adrenal_gland(2)|pituitary(1)	c.T1799A	7						.						112.0	104.0	107.0					7																	140453136		2203	4300	6503	140099605	SO:0001583	missense	673	exon15	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1799T>A	7.37:g.140453136A>T	ENSP00000288602:p.Val600Glu	Somatic		Capture	SOLID	Phase_I	140099605	NM_004333	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.0|24.0	4.486113|4.486113	0.84854|0.84854	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.81739|.	-1.53|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61565|.	0.2357|.	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D|.	0.55385|.	0.971|.	D|.	0.66351|.	0.943|.	T|.	0.58160|.	-0.7685|.	10|.	0.87932|.	D|.	0|.	.|.	15.9326|15.9326	0.79675|0.79675	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	600|.	P15056|.	BRAF_HUMAN|.	E|R	600|208	ENSP00000288602:V600E|.	ENSP00000288602:V600E|.	V|X	-|-	2|1	0|0	BRAF|BRAF	140099605|140099605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.197000|9.197000	0.94985|0.94985	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	GTG|TGA		BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	
RNASE11	122651	hgsc.bcm.edu	37	14	21052270	21052270	+	Missense_Mutation	SNP	G	G	T	rs144501463	byFrequency	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr14:21052270G>T	ENST00000610205.1	-	3	547	c.364C>A	c.(364-366)Cgc>Agc	p.R122S	RNASE11_ENST00000553849.1_Missense_Mutation_p.R122S|RNASE11_ENST00000432835.2_Missense_Mutation_p.R122S|RNASE11_ENST00000555841.1_Missense_Mutation_p.R122S|RNASE11_ENST00000398008.2_Missense_Mutation_p.R122S|RNASE11_ENST00000398009.2_Missense_Mutation_p.R122S	NM_145250.3	NP_660293.1	Q8TAA1	RNS11_HUMAN	ribonuclease, RNase A family, 11 (non-active)	122						extracellular region (GO:0005576)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)	p.R122S(1)		endometrium(1)|large_intestine(6)|lung(7)|ovary(3)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	21	all_cancers(95;0.00238)	all_lung(585;0.235)	Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.0139)		GTGGAGCTGCGGATGAAGTTA	0.488																																					p.R122S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C364A	14						.						96.0	82.0	87.0					14																	21052270		2203	4300	6503	20122110	SO:0001583	missense	122651	exon3			BC025410	CCDS9553.1	14q11.1	2013-08-05	2004-11-18	2004-11-18	ENSG00000173464	ENSG00000173464		"""Ribonucleases, RNase A"""	19269	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 6"""	C14orf6			Standard	NM_145250		Approved		uc001vxs.3	Q8TAA1	OTTHUMG00000170990	ENST00000610205.1:c.364C>A	14.37:g.21052270G>T	ENSP00000476537:p.Arg122Ser	Somatic		Capture	SOLID	Phase_I	20122110	NM_145250		Missense_Mutation	SNP	ENST00000610205.1	37	CCDS9553.1	.	.	.	.	.	.	.	.	.	.	G	9.777	1.174223	0.21704	.	.	ENSG00000173464	ENST00000335950;ENST00000553849;ENST00000555841;ENST00000398009;ENST00000398008;ENST00000432835;ENST00000443456;ENST00000557503;ENST00000557105;ENST00000413502;ENST00000554842	T;T;T;T;T;T;T;T;T;D;T	0.94576	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;-3.46;1.0	3.94	1.06	0.20224	Ribonuclease A, domain (3);	0.402361	0.24211	N	0.040526	D	0.84538	0.5494	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.75717	-0.3220	10	0.59425	D	0.04	-23.0798	6.345	0.21345	0.3254:0.0:0.6746:0.0	.	122	Q8TAA1	RNS11_HUMAN	S	122	ENSP00000338288:R122S;ENSP00000451318:R122S;ENSP00000451563:R122S;ENSP00000381093:R122S;ENSP00000381092:R122S;ENSP00000395210:R122S;ENSP00000401398:R122S;ENSP00000451839:R122S;ENSP00000452412:R122S;ENSP00000415954:R122S;ENSP00000451466:R122S	ENSP00000338288:R122S	R	-	1	0	RNASE11	20122110	0.006000	0.16342	0.000000	0.03702	0.047000	0.14425	1.343000	0.33930	0.231000	0.21079	0.511000	0.50034	CGC		RNASE11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073662.3	NM_145250	
LTBP2	4053	hgsc.bcm.edu	37	14	75019734	75019734	+	Silent	SNP	G	G	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr14:75019734G>T	ENST00000261978.4	-	5	1439	c.1053C>A	c.(1051-1053)atC>atA	p.I351I	CTD-2207P18.1_ENST00000554552.1_lincRNA|LTBP2_ENST00000556690.1_Silent_p.I351I|LTBP2_ENST00000557425.1_Intron	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	351	Heparin-binding.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.I351I(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		AGACGATCTTGATCTTCTTGA	0.592																																					p.I351I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1053A	14						.						94.0	77.0	83.0					14																	75019734		2203	4300	6503	74089487	SO:0001819	synonymous_variant	4053	exon5				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.1053C>A	14.37:g.75019734G>T		Somatic		Capture	SOLID	Phase_I	74089487	NM_000428	Q99907|Q9NS51	Silent	SNP	ENST00000261978.4	37	CCDS9831.1																																																																																				LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
TSPAN16	26526	hgsc.bcm.edu	37	19	11417341	11417341	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr19:11417341C>T	ENST00000316737.1	+	5	662	c.512C>T	c.(511-513)aCg>aTg	p.T171M	TSPAN16_ENST00000590327.1_Missense_Mutation_p.T171M|CTC-510F12.4_ENST00000586356.1_RNA|TSPAN16_ENST00000592955.1_Missense_Mutation_p.T146M	NM_012466.2	NP_036598.1	Q9UKR8	TSN16_HUMAN	tetraspanin 16	171						integral component of membrane (GO:0016021)		p.T171M(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	12						GAAATGACAACGGGCCACACC	0.483																																					p.T171M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C512T	19						.						114.0	98.0	103.0					19																	11417341		2203	4300	6503	11278341	SO:0001583	missense	26526	exon5			BC029908	CCDS12256.1, CCDS62549.1, CCDS62550.1	19p13.2	2013-02-14	2005-03-21	2005-03-21	ENSG00000130167	ENSG00000130167		"""Tetraspanins"""	30725	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 16"""	TM4SF16		10500248	Standard	NM_012466		Approved	TM4-B, TM-8	uc002mqv.1	Q9UKR8	OTTHUMG00000180833	ENST00000316737.1:c.512C>T	19.37:g.11417341C>T	ENSP00000319486:p.Thr171Met	Somatic		Capture	SOLID	Phase_I	11278341	NM_012466	K7EN22|K7EPD8|Q8N6J7	Missense_Mutation	SNP	ENST00000316737.1	37	CCDS12256.1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.585067	0.46110	.	.	ENSG00000130167	ENST00000316737	T	0.80393	-1.37	3.25	3.25	0.37280	Tetraspanin, EC2 domain (1);	0.498534	0.14978	N	0.287450	D	0.85120	0.5624	L	0.50333	1.59	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73579	-0.3938	10	0.52906	T	0.07	-6.473	10.2668	0.43460	0.0:1.0:0.0:0.0	.	171	Q9UKR8	TSN16_HUMAN	M	171	ENSP00000319486:T171M	ENSP00000319486:T171M	T	+	2	0	TSPAN16	11278341	0.004000	0.15560	0.019000	0.16419	0.104000	0.19210	1.990000	0.40717	2.110000	0.64415	0.561000	0.74099	ACG		TSPAN16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000453204.1	NM_012466	
SLC35E1	79939	hgsc.bcm.edu	37	19	16677411	16677411	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr19:16677411C>T	ENST00000595753.1	-	4	705	c.688G>A	c.(688-690)Gcc>Acc	p.A230T	CTD-3222D19.2_ENST00000409035.1_Silent_p.T423T|CTD-3222D19.10_ENST00000597851.1_RNA|SLC35E1_ENST00000431408.1_Missense_Mutation_p.A74T	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	230					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.A86T(1)		central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						AAGAAGACGGCGTGGCAGCCC	0.527																																					p.A230T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G688A	19						.						93.0	91.0	91.0					19																	16677411		2203	4300	6503	16538411	SO:0001583	missense	79939	exon4			AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.688G>A	19.37:g.16677411C>T	ENSP00000470652:p.Ala230Thr	Somatic		Capture	SOLID	Phase_I	16538411	NM_024881	Q8NBQ2|Q96JV7	Missense_Mutation	SNP	ENST00000595753.1	37	CCDS12346.2	.	.	.	.	.	.	.	.	.	.	C	34	5.304959	0.95601	.	.	ENSG00000127526	ENST00000409648;ENST00000436553;ENST00000431408	T;T	0.68765	-0.35;-0.35	5.4	5.4	0.78164	Domain of unknown function DUF250 (1);	0.000000	0.85682	D	0.000000	D	0.84088	0.5395	M	0.88906	2.99	0.80722	D	1	D;P	0.71674	0.998;0.945	D;B	0.65010	0.931;0.408	D	0.87077	0.2163	10	0.72032	D	0.01	-29.8871	18.1728	0.89752	0.0:1.0:0.0:0.0	.	230;86	Q96K37;Q9H7U6	S35E1_HUMAN;.	T	230;164;74	ENSP00000400435:A164T;ENSP00000397670:A74T	ENSP00000387152:A230T	A	-	1	0	SLC35E1	16538411	1.000000	0.71417	0.995000	0.50966	0.944000	0.59088	7.284000	0.78650	2.527000	0.85204	0.655000	0.94253	GCC		SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326809.2	NM_024881	
CYP2S1	29785	hgsc.bcm.edu	37	19	41700569	41700569	+	Missense_Mutation	SNP	G	G	A	rs199728850		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr19:41700569G>A	ENST00000310054.4	+	2	514	c.298G>A	c.(298-300)Ggc>Agc	p.G100S	CYP2S1_ENST00000542619.1_5'UTR	NM_030622.6	NP_085125.1	Q96SQ9	CP2S1_HUMAN	cytochrome P450, family 2, subfamily S, polypeptide 1	100					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.G100S(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(2)	14						GGAGTTCAGCGGCCGGGGAAC	0.637																																					p.G100S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G298A	19						.						130.0	107.0	115.0					19																	41700569		2203	4300	6503	46392409	SO:0001583	missense	29785	exon2			AA301039	CCDS12573.1	19q13.2	2013-11-11	2003-01-14		ENSG00000167600	ENSG00000167600		"""Cytochrome P450s"""	15654	protein-coding gene	gene with protein product		611529	"""cytochrome P450, subfamily IIS, polypeptide 1"""			11181079	Standard	NM_030622		Approved		uc002opw.3	Q96SQ9	OTTHUMG00000182721	ENST00000310054.4:c.298G>A	19.37:g.41700569G>A	ENSP00000308032:p.Gly100Ser	Somatic		Capture	SOLID	Phase_I	46392409	NM_030622	Q9BZ66	Missense_Mutation	SNP	ENST00000310054.4	37	CCDS12573.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.757791	0.69648	.	.	ENSG00000167600	ENST00000301173;ENST00000310054	T	0.01221	5.15	4.27	4.27	0.50696	.	0.213258	0.38272	N	0.001743	T	0.05731	0.0150	L	0.49455	1.56	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.35674	-0.9779	10	0.62326	D	0.03	.	14.3115	0.66419	0.0:0.0:1.0:0.0	.	100	Q96SQ9	CP2S1_HUMAN	S	100	ENSP00000308032:G100S	ENSP00000301173:G100S	G	+	1	0	CYP2S1	46392409	1.000000	0.71417	0.928000	0.36995	0.061000	0.15899	7.558000	0.82253	2.249000	0.74217	0.485000	0.47835	GGC		CYP2S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463287.1		
CCDC97	90324	hgsc.bcm.edu	37	19	41826358	41826358	+	Silent	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr19:41826358C>T	ENST00000269967.3	+	4	1016	c.894C>T	c.(892-894)gaC>gaT	p.D298D		NM_052848.1	NP_443080.1	Q96F63	CCD97_HUMAN	coiled-coil domain containing 97	298								p.D298D(1)		biliary_tract(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	17						ATGGCAAGGACGGGGACTTTG	0.622																																					p.D298D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C894T	19						.						105.0	91.0	95.0					19																	41826358		2203	4300	6503	46518198	SO:0001819	synonymous_variant	90324	exon4			BC011577	CCDS12578.1	19q13.2	2008-02-05							28289	protein-coding gene	gene with protein product						12477932	Standard	NM_052848		Approved	FLJ40267, MGC20255	uc002oqg.3	Q96F63		ENST00000269967.3:c.894C>T	19.37:g.41826358C>T		Somatic		Capture	SOLID	Phase_I	46518198	NM_052848	Q658N6|Q96IF3	Silent	SNP	ENST00000269967.3	37	CCDS12578.1																																																																																				CCDC97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463293.1	NM_052848	
PTPRH	5794	hgsc.bcm.edu	37	19	55708114	55708114	+	Missense_Mutation	SNP	G	G	A	rs145975365		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr19:55708114G>A	ENST00000376350.3	-	10	2055	c.2033C>T	c.(2032-2034)gCg>gTg	p.A678V	PTPRH_ENST00000588559.1_5'UTR|PTPRH_ENST00000263434.5_Missense_Mutation_p.A500V	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	678	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A678V(1)		breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		TCCATAGCCCGCTGAGGTGCT	0.597																																					p.A678V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2033T	19						.	G	VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	71.0	69.0	70.0		1499,2033	3.1	0.9	19	dbSNP_134	70	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	PTPRH	NM_001161440.1,NM_002842.3	64,64	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	benign,benign	500/938,678/1116	55708114	3,13003	2203	4300	6503	60399926	SO:0001583	missense	5794	exon10				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.2033C>T	19.37:g.55708114G>A	ENSP00000365528:p.Ala678Val	Somatic		Capture	SOLID	Phase_I	60399926	NM_002842	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	37	CCDS33110.1	.	.	.	.	.	.	.	.	.	.	G	11.37	1.619370	0.28801	2.27E-4	2.33E-4	ENSG00000080031	ENST00000376350;ENST00000263434	T;T	0.06371	3.31;4.31	5.33	3.08	0.35506	Fibronectin, type III (1);	0.679238	0.12123	N	0.497502	T	0.03564	0.0102	N	0.08118	0	0.22017	N	0.999413	P;P;P	0.48640	0.86;0.861;0.913	B;B;B	0.37731	0.131;0.257;0.166	T	0.46119	-0.9214	10	0.29301	T	0.29	.	12.8659	0.57939	0.0:0.6863:0.3137:0.0	.	500;500;678	C9JCH2;Q9HD43-2;Q9HD43	.;.;PTPRH_HUMAN	V	678;500	ENSP00000365528:A678V;ENSP00000263434:A500V	ENSP00000263434:A500V	A	-	2	0	PTPRH	60399926	0.451000	0.25705	0.858000	0.33744	0.112000	0.19704	0.710000	0.25748	1.403000	0.46800	-0.146000	0.13790	GCG		PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1		
ZNF582	147948	hgsc.bcm.edu	37	19	56896279	56896279	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr19:56896279T>G	ENST00000301310.4	-	5	665	c.507A>C	c.(505-507)aaA>aaC	p.K169N	ZNF582_ENST00000586929.1_Missense_Mutation_p.K169N|AC006116.12_ENST00000589671.1_RNA	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	169					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K169N(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		ACCCAAAAGGTTTTTCTCTAG	0.333																																					p.K169N	Ovarian(183;1887 2032 4349 30507 51343)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A507C	19						.						72.0	76.0	74.0					19																	56896279		2203	4300	6503	61588091	SO:0001583	missense	147948	exon5			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.507A>C	19.37:g.56896279T>G	ENSP00000301310:p.Lys169Asn	Somatic		Capture	SOLID	Phase_I	61588091	NM_144690	B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	ENST00000301310.4	37	CCDS33121.1	.	.	.	.	.	.	.	.	.	.	T	14.65	2.599169	0.46318	.	.	ENSG00000018869	ENST00000301310	T	0.21031	2.03	4.48	-0.00602	0.14015	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37761	N	0.001960	T	0.27524	0.0676	L	0.61218	1.895	0.09310	N	1	D;D	0.60160	0.987;0.987	P;P	0.51453	0.67;0.67	T	0.13548	-1.0505	10	0.62326	D	0.03	.	9.0044	0.36102	0.0:0.4308:0.0:0.5692	.	169;200	Q96NG8;B4DQZ9	ZN582_HUMAN;.	N	169	ENSP00000301310:K169N	ENSP00000301310:K169N	K	-	3	2	ZNF582	61588091	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.061000	0.11693	-0.190000	0.10465	0.260000	0.18958	AAA		ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458387.2	NM_144690	
TUSC3	7991	hgsc.bcm.edu	37	8	15508247	15508247	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr8:15508247G>A	ENST00000503731.1	+	3	498	c.350G>A	c.(349-351)cGc>cAc	p.R117H	TUSC3_ENST00000503191.1_Intron|TUSC3_ENST00000506802.1_Missense_Mutation_p.R117H|TUSC3_ENST00000382020.4_Missense_Mutation_p.R117H|TUSC3_ENST00000509380.1_Missense_Mutation_p.R117H	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	117	Thioredoxin.				cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)	p.R117H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		AACTCCTGGCGCTATTCATCT	0.398																																					p.R117H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G350A	8						.						236.0	229.0	231.0					8																	15508247		2203	4300	6503	15552618	SO:0001583	missense	7991	exon3			AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.350G>A	8.37:g.15508247G>A	ENSP00000424544:p.Arg117His	Somatic		Capture	SOLID	Phase_I	15552618	NM_178234	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Missense_Mutation	SNP	ENST00000503731.1	37	CCDS5994.1	.	.	.	.	.	.	.	.	.	.	G	35	5.430221	0.96131	.	.	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000509380;ENST00000503731	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.46	5.46	0.80206	Thioredoxin domain (1);Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.67915	0.2944	M	0.85373	2.75	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;1.0;1.0	D;D;D;D;D;D	0.83275	0.98;0.978;0.989;0.99;0.99;0.996	T	0.64609	-0.6367	10	0.20046	T	0.44	-12.7594	18.6795	0.91541	0.0:0.0:1.0:0.0	.	117;117;117;117;117;117	D6RDV0;D6RIY7;Q13454-2;Q13454;D6RA37;A8MSM0	.;.;.;TUSC3_HUMAN;.;.	H	117	ENSP00000371450:R117H;ENSP00000425777:R117H;ENSP00000423426:R117H;ENSP00000424544:R117H	ENSP00000221167:R117H	R	+	2	0	TUSC3	15552618	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.718000	0.92993	0.655000	0.94253	CGC		TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1	NM_006765	
POLB	5423	hgsc.bcm.edu	37	8	42226808	42226808	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr8:42226808G>T	ENST00000265421.4	+	12	898	c.728G>T	c.(727-729)aGt>aTt	p.S243I	POLB_ENST00000521492.1_5'UTR|POLB_ENST00000538005.1_Missense_Mutation_p.S89I	NM_002690.2	NP_002681.1	P06746	DPOLB_HUMAN	polymerase (DNA directed), beta	243					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neuron apoptotic process (GO:0051402)|pyrimidine dimer repair (GO:0006290)|response to ethanol (GO:0045471)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|enzyme binding (GO:0019899)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)|microtubule binding (GO:0008017)	p.S243I(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(1)	16	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)	CAGCTTCCCAGTAAAAATGAT	0.323								DNA polymerases (catalytic subunits)																													p.S243I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G728T	8						.						108.0	107.0	107.0					8																	42226808		2203	4300	6503	42345965	SO:0001583	missense	5423	exon12				CCDS6129.1	8p12-p11	2012-10-02			ENSG00000070501	ENSG00000070501	2.7.7.7	"""DNA polymerases"""	9174	protein-coding gene	gene with protein product		174760					Standard	NM_002690		Approved		uc003xoz.2	P06746	OTTHUMG00000164093	ENST00000265421.4:c.728G>T	8.37:g.42226808G>T	ENSP00000265421:p.Ser243Ile	Somatic		Capture	SOLID	Phase_I	42345965	NM_002690	B2RC78|Q3KP48|Q6FI34	Missense_Mutation	SNP	ENST00000265421.4	37	CCDS6129.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	12.78|12.78|12.78	2.039755|2.039755|2.039755	0.35989|0.35989|0.35989	.|.|.	.|.|.	ENSG00000070501|ENSG00000070501|ENSG00000070501	ENST00000521290|ENST00000265421;ENST00000518925;ENST00000538005|ENST00000518579	.|T;T;T|.	.|0.47177|.	.|0.85;0.85;1.48|.	5.71|5.71|5.71	1.81|1.81|1.81	0.25067|0.25067|0.25067	.|DNA-directed DNA polymerase X (1);|.	.|0.736785|.	.|0.14755|.	.|N|.	.|0.300337|.	T|T|T	0.48995|0.48995|0.48995	0.1531|0.1531|0.1531	L|L|L	0.52011|0.52011|0.52011	1.625|1.625|1.625	0.35792|0.35792|0.35792	D|D|D	0.822485|0.822485|0.822485	.|B;P|.	.|0.36125|.	.|0.351;0.538|.	.|B;B|.	.|0.21708|.	.|0.014;0.036|.	T|T|T	0.50224|0.50224|0.50224	-0.8853|-0.8853|-0.8853	5|10|5	.|0.44086|.	.|T|.	.|0.13|.	-15.6222|-15.6222|-15.6222	5.8441|5.8441|5.8441	0.18652|0.18652|0.18652	0.1491:0.0:0.5796:0.2713|0.1491:0.0:0.5796:0.2713|0.1491:0.0:0.5796:0.2713	.|.|.	.|243;243|.	.|Q53EV2;P06746|.	.|.;DPOLB_HUMAN|.	H|I|L	144|243;278;89|101	.|ENSP00000265421:S243I;ENSP00000430784:S278I;ENSP00000440497:S89I|.	.|ENSP00000265421:S243I|.	Q|S|V	+|+|+	3|2|1	2|0|0	POLB|POLB|POLB	42345965|42345965|42345965	0.145000|0.145000|0.145000	0.22656|0.22656|0.22656	0.897000|0.897000|0.897000	0.35233|0.35233|0.35233	0.672000|0.672000|0.672000	0.39443|0.39443|0.39443	0.464000|0.464000|0.464000	0.21988|0.21988|0.21988	0.050000|0.050000|0.050000	0.15949|0.15949|0.15949	0.491000|0.491000|0.491000	0.48974|0.48974|0.48974	CAG|AGT|GTA		POLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377242.1	NM_002690	
CNGB3	54714	hgsc.bcm.edu	37	8	87683311	87683311	+	Silent	SNP	C	C	T	rs75858066	byFrequency	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr8:87683311C>T	ENST00000320005.5	-	4	401	c.354G>A	c.(352-354)ccG>ccA	p.P118P		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	118					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.P118P(1)		NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						GAGCTGCAGGCGGTTTGTTTT	0.403																																					p.P118P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G354A	8						.						153.0	167.0	162.0					8																	87683311		2203	4300	6503	87752427	SO:0001819	synonymous_variant	54714	exon4			AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.354G>A	8.37:g.87683311C>T		Somatic		Capture	SOLID	Phase_I	87752427	NM_019098	C9JA51|Q9NRE9	Silent	SNP	ENST00000320005.5	37	CCDS6244.1																																																																																				CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375107.1	NM_019098	
SETDB1	9869	hgsc.bcm.edu	37	1	150923106	150923106	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr1:150923106C>T	ENST00000271640.5	+	13	1943	c.1753C>T	c.(1753-1755)Cga>Tga	p.R585*	SETDB1_ENST00000459773.1_Intron|SETDB1_ENST00000368969.4_Nonsense_Mutation_p.R585*	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	585					bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.R585*(2)		NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTGTCTGTCTCGAGTCAGACC	0.567																																					p.R585X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1753T	1						.						97.0	96.0	96.0					1																	150923106		2203	4300	6503	149189730	SO:0001587	stop_gained	9869	exon13			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.1753C>T	1.37:g.150923106C>T	ENSP00000271640:p.Arg585*	Somatic		Capture	SOLID	Phase_I	149189730	NM_001145415	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Nonsense_Mutation	SNP	ENST00000271640.5	37	CCDS44217.1	.	.	.	.	.	.	.	.	.	.	C	31	5.099698	0.94197	.	.	ENSG00000143379	ENST00000271640;ENST00000534805;ENST00000368969;ENST00000498193	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.7942	0.88565	0.0:1.0:0.0:0.0	.	.	.	.	X	585;586;585;585	.	ENSP00000271640:R585X	R	+	1	2	SETDB1	149189730	1.000000	0.71417	0.987000	0.45799	0.566000	0.35808	4.456000	0.60081	2.540000	0.85666	0.655000	0.94253	CGA		SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2		
LELP1	149018	hgsc.bcm.edu	37	1	153177315	153177315	+	Silent	SNP	C	C	T	rs267598048		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr1:153177315C>T	ENST00000368747.1	+	2	242	c.132C>T	c.(130-132)ttC>ttT	p.F44F		NM_001010857.1	NP_001010857.1	Q5T871	LELP1_HUMAN	late cornified envelope-like proline-rich 1	44	Cys/Pro-rich.							p.F44F(1)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|pancreas(1)|prostate(1)	19	all_lung(78;3.51e-31)|Lung NSC(65;1.34e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AACGCTGTTTCGAAAAGTGCC	0.567																																					p.F44F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C132T	1						.						174.0	149.0	158.0					1																	153177315		2203	4300	6503	151443939	SO:0001819	synonymous_variant	149018	exon2				CCDS30869.1	1q21.3	2008-02-05			ENSG00000203784	ENSG00000203784			32046	protein-coding gene	gene with protein product		611042					Standard	NM_001010857		Approved		uc001fbl.4	Q5T871	OTTHUMG00000013935	ENST00000368747.1:c.132C>T	1.37:g.153177315C>T		Somatic		Capture	SOLID	Phase_I	151443939	NM_001010857	A1L4E1	Silent	SNP	ENST00000368747.1	37	CCDS30869.1																																																																																				LELP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039104.1	NM_001010857	
TAS1R2	80834	hgsc.bcm.edu	37	1	19181156	19181156	+	Missense_Mutation	SNP	G	G	A	rs138972387		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr1:19181156G>A	ENST00000375371.3	-	3	829	c.808C>T	c.(808-810)Cgc>Tgc	p.R270C	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	270					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)	p.R270C(2)|p.R270G(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	ACCACGACGCGCGCTGTGCTC	0.627																																					p.R270C												.	.	3	Substitution - Missense(3)	large_intestine(2)|lung(1)	c.C808T	1						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	70.0	60.0	64.0		808	4.0	0.3	1	dbSNP_134	64	0,8600		0,0,4300	no	missense	TAS1R2	NM_152232.2	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	270/840	19181156	1,13005	2203	4300	6503	19053743	SO:0001583	missense	80834	exon3				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.808C>T	1.37:g.19181156G>A	ENSP00000364520:p.Arg270Cys	Somatic		Capture	SOLID	Phase_I	19053743	NM_152232	Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	CCDS187.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.725061	0.48833	2.27E-4	0.0	ENSG00000179002	ENST00000375371	D	0.87256	-2.23	4.99	4.01	0.46588	Extracellular ligand-binding receptor (1);	0.613341	0.14245	N	0.331801	D	0.92244	0.7540	M	0.78344	2.41	0.22851	N	0.998653	D	0.89917	1.0	D	0.72982	0.979	D	0.83619	0.0138	10	0.87932	D	0	.	9.9288	0.41510	0.0:0.0:0.7021:0.2979	.	270	Q8TE23	TS1R2_HUMAN	C	270	ENSP00000364520:R270C	ENSP00000364520:R270C	R	-	1	0	TAS1R2	19053743	0.850000	0.29656	0.335000	0.25508	0.266000	0.26442	4.417000	0.59822	2.607000	0.88179	0.561000	0.74099	CGC		TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
IPO13	9670	hgsc.bcm.edu	37	1	44422103	44422103	+	Silent	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr1:44422103C>T	ENST00000372343.3	+	3	1595	c.933C>T	c.(931-933)atC>atT	p.I311I	IPO13_ENST00000492152.1_3'UTR	NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	311					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I311I(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				TCTGTCGCATCGCTGTGGCCC	0.597																																					p.I311I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C933T	1						.						69.0	64.0	66.0					1																	44422103		2203	4300	6503	44194690	SO:0001819	synonymous_variant	9670	exon3			AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.933C>T	1.37:g.44422103C>T		Somatic		Capture	SOLID	Phase_I	44194690	NM_014652	D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Silent	SNP	ENST00000372343.3	37	CCDS503.1																																																																																				IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022846.1	NM_014652	
LRP8	7804	hgsc.bcm.edu	37	1	53729948	53729948	+	Silent	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr1:53729948C>T	ENST00000306052.6	-	10	1649	c.1548G>A	c.(1546-1548)tcG>tcA	p.S516S	LRP8_ENST00000460214.1_5'Flank|LRP8_ENST00000371454.2_Silent_p.S516S|LRP8_ENST00000354412.3_Silent_p.S387S|LRP8_ENST00000465675.1_Silent_p.S69S|LRP8_ENST00000347547.2_Silent_p.S346S	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	516					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.S516S(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						TCTTATTGCCCGAGTCAGTCC	0.597																																					p.S387S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1161A	1						.						94.0	86.0	89.0					1																	53729948		2203	4300	6503	53502536	SO:0001819	synonymous_variant	7804	exon9			D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.1548G>A	1.37:g.53729948C>T		Somatic		Capture	SOLID	Phase_I	53502536	NM_017522	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Silent	SNP	ENST00000306052.6	37	CCDS578.1	.	.	.	.	.	.	.	.	.	.	C	9.406	1.079195	0.20227	.	.	ENSG00000157193	ENST00000475501	.	.	.	5.16	-10.2	0.00374	.	.	.	.	.	T	0.34454	0.0898	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42103	-0.9471	4	.	.	.	.	3.2705	0.06880	0.2224:0.1084:0.1376:0.5316	.	.	.	.	Q	205	.	.	R	-	2	0	LRP8	53502536	0.000000	0.05858	0.517000	0.27799	0.976000	0.68499	-3.562000	0.00430	-1.795000	0.01255	-0.781000	0.03364	CGG		LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
ATF6	22926	hgsc.bcm.edu	37	1	161789582	161789582	+	Missense_Mutation	SNP	C	C	T	rs145066726		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr1:161789582C>T	ENST00000367942.3	+	8	1136	c.1069C>T	c.(1069-1071)Cgg>Tgg	p.R357W		NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6	357	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.R357W(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	AACACTGAAGCGGCAGCTGGA	0.418																																					p.R357W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1069T	1						.	C	TRP/ARG	0,4406		0,0,2203	58.0	57.0	58.0		1069	3.2	1.0	1	dbSNP_134	58	1,8599	1.2+/-3.3	0,1,4299	no	missense	ATF6	NM_007348.3	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	357/671	161789582	1,13005	2203	4300	6503	160056206	SO:0001583	missense	22926	exon8			AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.1069C>T	1.37:g.161789582C>T	ENSP00000356919:p.Arg357Trp	Somatic		Capture	SOLID	Phase_I	160056206	NM_007348	O15139|Q5VW62|Q6IPB5|Q9UEC9	Missense_Mutation	SNP	ENST00000367942.3	37	CCDS1235.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065960	0.55539	0.0	1.16E-4	ENSG00000118217	ENST00000367942	T	0.55234	0.53	5.19	3.25	0.37280	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.181511	0.48286	D	0.000193	T	0.62405	0.2425	M	0.80183	2.485	0.48511	D	0.999661	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.983	T	0.69684	-0.5079	9	0.87932	D	0	-11.0758	11.2981	0.49290	0.5095:0.4905:0.0:0.0	.	357;358	P18850;Q59H30	ATF6A_HUMAN;.	W	357	ENSP00000356919:R357W	ENSP00000356919:R357W	R	+	1	2	ATF6	160056206	1.000000	0.71417	0.997000	0.53966	0.534000	0.34807	1.279000	0.33191	0.509000	0.28195	0.650000	0.86243	CGG		ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060304.2	NM_007348	
LRRC4C	57689	hgsc.bcm.edu	37	11	40137536	40137536	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr11:40137536C>A	ENST00000278198.2	-	2	2270	c.307G>T	c.(307-309)Gaa>Taa	p.E103*	LRRC4C_ENST00000527150.1_Nonsense_Mutation_p.E103*|LRRC4C_ENST00000530763.1_Nonsense_Mutation_p.E103*|LRRC4C_ENST00000528697.1_Nonsense_Mutation_p.E103*			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	103					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.E103*(1)|p.E103K(1)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				TGTAGGATTTCCAAGTGTCTC	0.468																																					p.E103X												.	.	2	Substitution - Missense(1)|Substitution - Nonsense(1)	large_intestine(1)|skin(1)	c.G307T	11						.						91.0	86.0	87.0					11																	40137536		2203	4300	6503	40094112	SO:0001587	stop_gained	57689	exon2			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.307G>T	11.37:g.40137536C>A	ENSP00000278198:p.Glu103*	Somatic		Capture	SOLID	Phase_I	40094112	NM_020929	A8K0T1|Q7L0N3	Nonsense_Mutation	SNP	ENST00000278198.2	37	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	C	41	9.095378	0.99064	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	18.9442	0.92615	0.0:1.0:0.0:0.0	.	.	.	.	X	103	.	ENSP00000278198:E103X	E	-	1	0	LRRC4C	40094112	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.774000	0.85478	2.719000	0.93026	0.650000	0.86243	GAA		LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
SLC43A3	29015	hgsc.bcm.edu	37	11	57176741	57176741	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr11:57176741A>C	ENST00000395123.2	-	13	1582	c.1278T>G	c.(1276-1278)ttT>ttG	p.F426L	RP11-872D17.8_ENST00000529411.1_Missense_Mutation_p.F70L|SLC43A3_ENST00000533524.1_Missense_Mutation_p.F439L|SLC43A3_ENST00000529554.1_Missense_Mutation_p.F426L|SLC43A3_ENST00000395124.1_Missense_Mutation_p.F426L|SLC43A3_ENST00000352187.1_Missense_Mutation_p.F426L	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	426					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.F426L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						TCACCAGCCCAAAGAGCTTGC	0.552																																					p.F426L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1278G	11						.						108.0	113.0	111.0					11																	57176741		2201	4296	6497	56933317	SO:0001583	missense	29015	exon13			AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.1278T>G	11.37:g.57176741A>C	ENSP00000378555:p.Phe426Leu	Somatic		Capture	SOLID	Phase_I	56933317	NM_199329	B4DNR8|E7EQD2|Q9NSS4	Missense_Mutation	SNP	ENST00000395123.2	37	CCDS7956.1	.	.	.	.	.	.	.	.	.	.	A	13.69	2.311645	0.40895	.	.	ENSG00000254979;ENSG00000134802;ENSG00000134802;ENSG00000134802;ENSG00000134802;ENSG00000134802	ENST00000529411;ENST00000395123;ENST00000395124;ENST00000352187;ENST00000529554;ENST00000533524	T;T;T;T;T;T	0.80214	-1.35;0.47;0.47;0.47;0.47;0.47	5.03	-1.06	0.10002	Major facilitator superfamily domain, general substrate transporter (1);	0.189362	0.47852	D	0.000203	T	0.75671	0.3881	L	0.57536	1.79	0.37347	D	0.91063	B;B	0.34200	0.254;0.441	B;B	0.40329	0.326;0.326	T	0.70375	-0.4889	10	0.38643	T	0.18	-7.7929	9.1413	0.36906	0.5796:0.0:0.4204:0.0	.	439;426	E7EQD2;Q8NBI5	.;S43A3_HUMAN	L	70;426;426;426;426;439	ENSP00000431536:F70L;ENSP00000378555:F426L;ENSP00000378556:F426L;ENSP00000337561:F426L;ENSP00000436254:F426L;ENSP00000434515:F439L	ENSP00000431536:F70L	F	-	3	2	RP11-872D17.8;SLC43A3	56933317	0.883000	0.30277	0.981000	0.43875	0.751000	0.42716	-0.068000	0.11561	-0.009000	0.14296	-0.274000	0.10170	TTT		SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393057.1	NM_017611	
C11orf63	79864	hgsc.bcm.edu	37	11	122756683	122756683	+	Silent	SNP	C	C	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr11:122756683C>A	ENST00000531316.1	+	1	218	c.126C>A	c.(124-126)tcC>tcA	p.S42S	C11orf63_ENST00000307257.6_Silent_p.S42S|C11orf63_ENST00000227349.2_Silent_p.S42S			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	42					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)			p.S42S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		CAAAAGACTCCTTGGAATCTG	0.453																																					p.S42S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C126A	11						.						92.0	96.0	94.0					11																	122756683		2202	4299	6501	122261893	SO:0001819	synonymous_variant	79864	exon2			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.126C>A	11.37:g.122756683C>A		Somatic		Capture	SOLID	Phase_I	122261893	NM_024806	A8K6G0|Q96GB5|Q9H5D6	Silent	SNP	ENST00000531316.1	37	CCDS8438.1																																																																																				C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387511.1	NM_024806	
MYLK4	340156	hgsc.bcm.edu	37	6	2679591	2679591	+	Silent	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr6:2679591G>A	ENST00000274643.7	-	9	1152	c.810C>T	c.(808-810)ctC>ctT	p.L270L	MYLK4_ENST00000268446.5_Silent_p.L270L	NM_001012418.3	NP_001012418.2	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4	270	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.L270L(4)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				CTTCAGGGGCGAGAAATTCTG	0.453																																					p.L270L												.	.	4	Substitution - coding silent(4)	large_intestine(2)|lung(2)	c.C810T	6						.						205.0	208.0	207.0					6																	2679591		2203	4300	6503	2624590	SO:0001819	synonymous_variant	340156	exon9				CCDS34330.1	6p25.2	2008-01-23			ENSG00000145949	ENSG00000145949			27972	protein-coding gene	gene with protein product	"""caMLCK like"""						Standard	NM_001012418		Approved	SgK085	uc003mty.4	Q86YV6	OTTHUMG00000014121	ENST00000274643.7:c.810C>T	6.37:g.2679591G>A		Somatic		Capture	SOLID	Phase_I	2624590	NM_001012418	A2RUC0|Q5TAW2	Silent	SNP	ENST00000274643.7	37	CCDS34330.1																																																																																				MYLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039632.2	NM_001012418	
GCNT2	2651	hgsc.bcm.edu	37	6	10530033	10530033	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr6:10530033G>A	ENST00000379597.3	+	1	1445	c.889G>A	c.(889-891)Gac>Aac	p.D297N	GCNT2_ENST00000410107.1_Intron|GCNT2_ENST00000495262.1_Missense_Mutation_p.D297N|GCNT2_ENST00000397423.2_Intron			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)	297					maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)	p.D297N(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		CTACAGCCCCGACGAACATTT	0.468																																					p.D297N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G889A	6						.						120.0	114.0	116.0					6																	10530033		2203	4300	6503	10638019	SO:0001583	missense	2651	exon3			L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.889G>A	6.37:g.10530033G>A	ENSP00000368917:p.Asp297Asn	Somatic		Capture	SOLID	Phase_I	10638019	NM_145649		Missense_Mutation	SNP	ENST00000379597.3	37	CCDS34338.1	.	.	.	.	.	.	.	.	.	.	G	33	5.203329	0.95033	.	.	ENSG00000111846	ENST00000495262;ENST00000379597	T;T	0.21361	2.01;2.01	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.55657	0.1934	H	0.95004	3.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.68447	-0.5406	10	0.87932	D	0	-11.3582	19.5352	0.95251	0.0:0.0:1.0:0.0	.	297;296	Q8N0V5;Q08M29	GNT2A_HUMAN;.	N	297	ENSP00000419411:D297N;ENSP00000368917:D297N	ENSP00000368917:D297N	D	+	1	0	GCNT2	10638019	1.000000	0.71417	0.363000	0.25875	0.696000	0.40369	9.521000	0.98029	2.712000	0.92718	0.650000	0.86243	GAC		GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327912.3	NM_145649	
LRFN2	57497	hgsc.bcm.edu	37	6	40399583	40399583	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr6:40399583G>A	ENST00000338305.6	-	2	1812	c.1270C>T	c.(1270-1272)Cgg>Tgg	p.R424W		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	424	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.R424W(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGCACAGCCCGTTCCGGGGGG	0.632																																					p.R424W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1270T	6						.						47.0	51.0	50.0					6																	40399583		2203	4300	6503	40507561	SO:0001583	missense	57497	exon2			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1270C>T	6.37:g.40399583G>A	ENSP00000345985:p.Arg424Trp	Somatic		Capture	SOLID	Phase_I	40507561	NM_020737	A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925841	0.52759	.	.	ENSG00000156564	ENST00000338305	T	0.59083	0.29	5.38	2.13	0.27403	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.158439	0.56097	D	0.000023	T	0.55513	0.1925	L	0.47190	1.495	0.39484	D	0.967935	D	0.76494	0.999	D	0.70016	0.967	T	0.57499	-0.7801	10	0.46703	T	0.11	.	11.7103	0.51620	0.0:0.0:0.3459:0.6541	.	424	Q9ULH4	LRFN2_HUMAN	W	424	ENSP00000345985:R424W	ENSP00000345985:R424W	R	-	1	2	LRFN2	40507561	0.982000	0.34865	0.915000	0.36163	0.988000	0.76386	2.077000	0.41557	0.578000	0.29487	0.561000	0.74099	CGG		LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372	
NLRP1	22861	hgsc.bcm.edu	37	17	5442796	5442796	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr17:5442796C>T	ENST00000572272.1	-	7	2808	c.2809G>A	c.(2809-2811)Gtt>Att	p.V937I	NLRP1_ENST00000262467.5_Missense_Mutation_p.V937I|NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000345221.3_Missense_Mutation_p.V937I|NLRP1_ENST00000269280.4_Missense_Mutation_p.V937I|NLRP1_ENST00000354411.3_Missense_Mutation_p.V937I|NLRP1_ENST00000577119.1_Missense_Mutation_p.V937I			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	937					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.V937I(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				CGCACGCCAACGTCATCCAGG	0.622																																					p.V937I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2809A	17						.						78.0	61.0	67.0					17																	5442796		2203	4300	6503	5383520	SO:0001583	missense	22861	exon7			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.2809G>A	17.37:g.5442796C>T	ENSP00000460475:p.Val937Ile	Somatic		Capture	SOLID	Phase_I	5383520	NM_033007	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	37	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	C	7.909	0.735991	0.15574	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221;ENST00000537069	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	3.7	-7.39	0.01402	.	3.693960	0.00841	N	0.001747	T	0.27063	0.0663	L	0.35542	1.07	0.09310	N	1	B;B;B;B;B;B	0.26672	0.156;0.153;0.153;0.033;0.023;0.06	B;B;B;B;B;B	0.26202	0.065;0.05;0.05;0.036;0.049;0.067	T	0.09684	-1.0663	10	0.37606	T	0.19	.	3.5394	0.07806	0.1601:0.4768:0.1515:0.2116	.	203;937;937;937;937;937	F5H042;Q9C000-3;Q9C000-4;Q9C000;Q9C000-2;E9PE50	.;.;.;NALP1_HUMAN;.;.	I	937;937;937;937;937;203	ENSP00000442029:V937I;ENSP00000262467:V937I;ENSP00000269280:V937I;ENSP00000346390:V937I;ENSP00000324366:V937I	ENSP00000262467:V937I	V	-	1	0	NLRP1	5383520	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.660000	0.01974	-1.795000	0.01255	-1.354000	0.01226	GTT		NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	
TP53	7157	hgsc.bcm.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R196X	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,-2	.	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	c.C586T	17	GRCh37	CM941329	TP53	M		.						102.0	91.0	94.0					17																	7578263		2203	4300	6503	7518988	SO:0001587	stop_gained	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*	Somatic		Capture	SOLID	Phase_I	7518988	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
VAT1	10493	hgsc.bcm.edu	37	17	41169867	41169867	+	Missense_Mutation	SNP	C	C	T	rs145617143	byFrequency	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr17:41169867C>T	ENST00000420567.3	-	4	590	c.445G>A	c.(445-447)Gtc>Atc	p.V149I	VAT1_ENST00000355653.3_Missense_Mutation_p.V283I|VAT1_ENST00000587173.1_Missense_Mutation_p.V215I			P54219	VMAT1_HUMAN	vesicle amine transport 1	0					monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)	p.V283I(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	9		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	CCATAGGTGACGACTTTGCCC	0.547													C|||	3	0.000599042	0.0008	0.0	5008	,	,		17026	0.0		0.002	False		,,,				2504	0.0				p.V283I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G847A	17						.	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	103.0	86.0	92.0		847	-2.9	0.6	17	dbSNP_134	92	2,8598	2.2+/-6.3	0,2,4298	yes	missense	VAT1	NM_006373.3	29	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	benign	283/394	41169867	3,13003	2203	4300	6503	38423393	SO:0001583	missense	10493	exon4			U18009	CCDS11451.1	17q21	2013-08-23	2013-08-23			ENSG00000108828			16919	protein-coding gene	gene with protein product		604631	"""vesicle amine transport protein 1 homolog (T. californica)"""			7774926, 8938427	Standard	NM_006373		Approved	VATI, FLJ20230	uc002icm.1	Q99536		ENST00000420567.3:c.445G>A	17.37:g.41169867C>T	ENSP00000408553:p.Val149Ile	Somatic		Capture	SOLID	Phase_I	38423393	NM_006373	E9PDJ5|Q9BRE4	Missense_Mutation	SNP	ENST00000420567.3	37		2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	0	0.0	1	0.0013192612137203166	C	1.899	-0.453575	0.04540	2.27E-4	2.33E-4	ENSG00000108828	ENST00000355653;ENST00000542468;ENST00000420567	T;T	0.07444	3.19;3.19	5.28	-2.88	0.05682	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.354794	0.32258	N	0.006353	T	0.03871	0.0109	N	0.20807	0.61	0.20638	N	0.999877	B;B	0.18310	0.027;0.026	B;B	0.18871	0.016;0.023	T	0.44817	-0.9303	10	0.02654	T	1	-1.9544	11.9294	0.52837	0.0:0.3723:0.0:0.6277	.	215;283	B4DPX4;Q99536	.;VAT1_HUMAN	I	283;190;149	ENSP00000347872:V283I;ENSP00000408553:V149I	ENSP00000347872:V283I	V	-	1	0	VAT1	38423393	0.470000	0.25854	0.634000	0.29324	0.966000	0.64601	-0.143000	0.10296	-0.534000	0.06315	-0.379000	0.06801	GTC		VAT1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000453104.1	NM_006373	
RPTOR	57521	hgsc.bcm.edu	37	17	78519555	78519555	+	Silent	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr17:78519555C>T	ENST00000306801.3	+	1	488	c.126C>T	c.(124-126)tcC>tcT	p.S42S	RPTOR_ENST00000544334.2_Silent_p.S42S|RPTOR_ENST00000570891.1_Silent_p.S42S|RPTOR_ENST00000537330.1_5'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	42					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.S42S(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						TTGAAGGCTCCAAATCCTTAG	0.478																																					p.S42S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C126T	17						.						90.0	97.0	95.0					17																	78519555		2203	4300	6503	76134150	SO:0001819	synonymous_variant	57521	exon1				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.126C>T	17.37:g.78519555C>T		Somatic		Capture	SOLID	Phase_I	76134150	NM_020761	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Silent	SNP	ENST00000306801.3	37	CCDS11773.1																																																																																				RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	
UBASH3A	53347	hgsc.bcm.edu	37	21	43862591	43862591	+	Nonsense_Mutation	SNP	C	C	T	rs148203332		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr21:43862591C>T	ENST00000319294.6	+	12	1547	c.1516C>T	c.(1516-1518)Cga>Tga	p.R506*	UBASH3A_ENST00000291535.6_Nonsense_Mutation_p.R468*|UBASH3A_ENST00000398367.1_Nonsense_Mutation_p.R468*	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	506	Phosphatase-like.				negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.R506*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						AATCAAGATACGAGTGGAACC	0.413																																					p.R468X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1402T	21						.	C	stop/ARG,stop/ARG	0,4406		0,0,2203	111.0	111.0	111.0		1402,1516	3.7	1.0	21	dbSNP_134	111	3,8597	3.0+/-9.4	0,3,4297	no	stop-gained,stop-gained	UBASH3A	NM_001001895.2,NM_018961.3	,	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	,	468/624,506/662	43862591	3,13003	2203	4300	6503	42735660	SO:0001587	stop_gained	53347	exon11			AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.1516C>T	21.37:g.43862591C>T	ENSP00000317327:p.Arg506*	Somatic		Capture	SOLID	Phase_I	42735660	NM_001001895	G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Nonsense_Mutation	SNP	ENST00000319294.6	37	CCDS13687.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.078652	0.76528	0.0	3.49E-4	ENSG00000160185	ENST00000291535;ENST00000319294;ENST00000398367	.	.	.	4.9	3.73	0.42828	.	0.084250	0.51477	D	0.000094	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0442	5.613	0.17416	0.6315:0.2113:0.0:0.1572	.	.	.	.	X	468;506;468	.	ENSP00000291535:R468X	R	+	1	2	UBASH3A	42735660	0.999000	0.42202	0.995000	0.50966	0.196000	0.23810	1.109000	0.31135	0.702000	0.31825	-0.312000	0.09012	CGA		UBASH3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195382.1	NM_001001895	
MCM3AP	8888	hgsc.bcm.edu	37	21	47692736	47692736	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr21:47692736G>A	ENST00000397708.1	-	9	2458	c.2204C>T	c.(2203-2205)aCg>aTg	p.T735M	MCM3AP_ENST00000291688.1_Missense_Mutation_p.T735M			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	735	SAC3 homology.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)	p.T735M(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					GTGCTGCTGCGTGATATCCTG	0.552																																					p.T735M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2204T	21						.						72.0	58.0	63.0					21																	47692736		2203	4300	6503	46517164	SO:0001583	missense	8888	exon8			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.2204C>T	21.37:g.47692736G>A	ENSP00000380820:p.Thr735Met	Somatic		Capture	SOLID	Phase_I	46517164	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.005660	0.93287	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.36340	1.26;1.26	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.69975	0.3171	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.74904	-0.3505	10	0.87932	D	0	-19.6426	20.3539	0.98825	0.0:0.0:1.0:0.0	.	735	O60318	MCM3A_HUMAN	M	735	ENSP00000380820:T735M;ENSP00000291688:T735M	ENSP00000291688:T735M	T	-	2	0	MCM3AP	46517164	1.000000	0.71417	0.984000	0.44739	0.910000	0.53928	6.437000	0.73421	2.826000	0.97356	0.655000	0.94253	ACG		MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
NKD1	85407	hgsc.bcm.edu	37	16	50664815	50664815	+	Missense_Mutation	SNP	C	C	T	rs200257763		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr16:50664815C>T	ENST00000268459.3	+	8	913	c.689C>T	c.(688-690)cCg>cTg	p.P230L		NM_033119.4	NP_149110.1	Q969G9	NKD1_HUMAN	naked cuticle homolog 1 (Drosophila)	230					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of convergent extension involved in axis elongation (GO:1901233)|positive regulation of non-canonical Wnt signaling pathway via JNK cascade (GO:1901231)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P230L(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|prostate(1)|urinary_tract(2)	23		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		CAGCGAGCCCCGCTCAGGTAT	0.592																																					p.P230L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C689T	16						.	C	LEU/PRO	1,4351		0,1,2175	36.0	30.0	32.0		689	3.7	0.8	16		32	0,8582		0,0,4291	yes	missense	NKD1	NM_033119.4	98	0,1,6466	TT,TC,CC		0.0,0.023,0.0077	benign	230/471	50664815	1,12933	2176	4291	6467	49222316	SO:0001583	missense	85407	exon8			AF358135	CCDS10743.1	16q12.1	2013-01-10			ENSG00000140807	ENSG00000140807		"""EF-hand domain containing"""	17045	protein-coding gene	gene with protein product		607851				11356022	Standard	NM_033119		Approved		uc002egg.2	Q969G9	OTTHUMG00000133169	ENST00000268459.3:c.689C>T	16.37:g.50664815C>T	ENSP00000268459:p.Pro230Leu	Somatic		Capture	SOLID	Phase_I	49222316	NM_033119	B2RC39|Q8WZ08	Missense_Mutation	SNP	ENST00000268459.3	37	CCDS10743.1	.	.	.	.	.	.	.	.	.	.	C	7.412	0.634896	0.14322	2.3E-4	0.0	ENSG00000140807	ENST00000268459	T	0.61859	0.07	4.69	3.72	0.42706	.	0.320500	0.34531	N	0.003897	T	0.40297	0.1111	L	0.31294	0.92	0.44454	D	0.997382	B	0.06786	0.001	B	0.06405	0.002	T	0.14117	-1.0484	10	0.12430	T	0.62	-5.2668	9.9061	0.41377	0.0:0.9011:0.0:0.0989	.	230	Q969G9	NKD1_HUMAN	L	230	ENSP00000268459:P230L	ENSP00000268459:P230L	P	+	2	0	NKD1	49222316	0.996000	0.38824	0.765000	0.31456	0.761000	0.43186	3.404000	0.52623	0.917000	0.36895	0.467000	0.42956	CCG		NKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256873.1		
SETD1A	9739	hgsc.bcm.edu	37	16	30991857	30991857	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr16:30991857G>A	ENST00000262519.8	+	15	5146	c.4460G>A	c.(4459-4461)cGg>cAg	p.R1487Q		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1487	Interaction with ASH2L, RBBP5 and WDR5.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.R1487Q(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						GATGGGCCCCGGGAGCACCAG	0.642																																					p.R1487Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4460A	16						.						61.0	64.0	63.0					16																	30991857		2197	4300	6497	30899358	SO:0001583	missense	9739	exon15			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.4460G>A	16.37:g.30991857G>A	ENSP00000262519:p.Arg1487Gln	Somatic		Capture	SOLID	Phase_I	30899358	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	37	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.736242	0.69189	.	.	ENSG00000099381	ENST00000262519	D	0.94966	-3.57	4.99	4.99	0.66335	COMPASS complex Set1 subunit, N-SET domain (1);	0.000000	0.85682	D	0.000000	D	0.96188	0.8757	L	0.56280	1.765	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95453	0.8536	10	0.35671	T	0.21	.	17.0399	0.86486	0.0:0.0:1.0:0.0	.	1487	O15047	SET1A_HUMAN	Q	1487	ENSP00000262519:R1487Q	ENSP00000262519:R1487Q	R	+	2	0	SETD1A	30899358	1.000000	0.71417	0.991000	0.47740	0.971000	0.66376	9.767000	0.98960	2.303000	0.77524	0.551000	0.68910	CGG		SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
SLC38A7	55238	hgsc.bcm.edu	37	16	58713853	58713853	+	Missense_Mutation	SNP	C	C	T	rs373267275		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr16:58713853C>T	ENST00000570101.1	-	2	1061	c.178G>A	c.(178-180)Gtc>Atc	p.V60I	SLC38A7_ENST00000564100.1_Missense_Mutation_p.V60I|SLC38A7_ENST00000219320.4_Missense_Mutation_p.V60I|SLC38A7_ENST00000566953.1_Intron|SLC38A7_ENST00000564010.1_Intron|SLC38A7_ENST00000564391.1_Missense_Mutation_p.V60I			Q9NVC3	S38A7_HUMAN	solute carrier family 38, member 7	60					sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	L-alanine transmembrane transporter activity (GO:0015180)|L-amino acid transmembrane transporter activity (GO:0015179)|L-asparagine transmembrane transporter activity (GO:0015182)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|L-glutamine transmembrane transporter activity (GO:0015186)|L-histidine transmembrane transporter activity (GO:0005290)|L-leucine transmembrane transporter activity (GO:0015190)|L-methionine transmembrane transporter activity (GO:0015191)|L-serine transmembrane transporter activity (GO:0015194)	p.V60I(1)		endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	13						GCGTTGACGACGATGAAGATG	0.627																																					p.V60I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G178A	16						.	C	ILE/VAL	0,4396		0,0,2198	55.0	50.0	51.0		178	4.7	1.0	16		51	2,8598	2.2+/-6.3	0,2,4298	no	missense	SLC38A7	NM_018231.1	29	0,2,6496	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	60/463	58713853	2,12994	2198	4300	6498	57271354	SO:0001583	missense	55238	exon3			BC001961	CCDS10800.1	16q21	2013-05-22			ENSG00000103042	ENSG00000103042		"""Solute carriers"""	25582	protein-coding gene	gene with protein product		614236					Standard	XM_006721229		Approved	FLJ10815	uc002eod.1	Q9NVC3	OTTHUMG00000133491	ENST00000570101.1:c.178G>A	16.37:g.58713853C>T	ENSP00000454646:p.Val60Ile	Somatic		Capture	SOLID	Phase_I	57271354	NM_018231	Q53GJ9|Q9H9I5	Missense_Mutation	SNP	ENST00000570101.1	37	CCDS10800.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.897399	0.52121	0.0	2.33E-4	ENSG00000103042	ENST00000219320	T	0.02067	4.47	5.66	4.71	0.59529	.	0.000000	0.85682	D	0.000000	T	0.05960	0.0155	L	0.36672	1.1	0.58432	D	0.999999	B;D	0.61697	0.225;0.99	B;P	0.60012	0.047;0.867	T	0.52909	-0.8512	9	.	.	.	.	13.8729	0.63631	0.0:0.9265:0.0:0.0735	.	60;60	Q9NVC3;Q9NVC3-2	S38A7_HUMAN;.	I	60	ENSP00000219320:V60I	.	V	-	1	0	SLC38A7	57271354	1.000000	0.71417	0.978000	0.43139	0.118000	0.20060	5.704000	0.68347	1.398000	0.46701	-0.291000	0.09656	GTC		SLC38A7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422206.2	NM_018231	
RRAD	6236	hgsc.bcm.edu	37	16	66957614	66957614	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr16:66957614G>A	ENST00000299759.6	-	4	704	c.454C>T	c.(454-456)Cgc>Tgc	p.R152C	RRAD_ENST00000420652.1_Missense_Mutation_p.R152C			P55042	RAD_HUMAN	Ras-related associated with diabetes	152					small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R152C(1)		endometrium(2)|kidney(4)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		GGCAACCAGCGGCCCCCGTCC	0.607																																					p.R152C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C454T	16						.						91.0	95.0	94.0					16																	66957614		2200	4300	6500	65515115	SO:0001583	missense	6236	exon4			L24564	CCDS10824.1	16q22	2014-05-09			ENSG00000166592	ENSG00000166592			10446	protein-coding gene	gene with protein product		179503				7859947	Standard	NM_004165		Approved	REM3, RAD	uc002eqo.2	P55042	OTTHUMG00000137511	ENST00000299759.6:c.454C>T	16.37:g.66957614G>A	ENSP00000299759:p.Arg152Cys	Somatic		Capture	SOLID	Phase_I	65515115	NM_004165	Q96F39	Missense_Mutation	SNP	ENST00000299759.6	37	CCDS10824.1	.	.	.	.	.	.	.	.	.	.	G	12.95	2.091825	0.36952	.	.	ENSG00000166592	ENST00000420652;ENST00000299759	T;T	0.78364	-1.17;-1.17	4.81	0.539	0.17156	Small GTP-binding protein domain (1);	0.533159	0.22760	N	0.055977	T	0.81465	0.4828	M	0.69358	2.11	0.34541	D	0.710301	D	0.69078	0.997	P	0.59703	0.862	T	0.82510	-0.0421	10	0.45353	T	0.12	.	9.431	0.38610	0.2937:0.0:0.7063:0.0	.	152	P55042	RAD_HUMAN	C	152	ENSP00000388744:R152C;ENSP00000299759:R152C	ENSP00000299759:R152C	R	-	1	0	RRAD	65515115	1.000000	0.71417	0.008000	0.14137	0.039000	0.13416	4.093000	0.57714	-0.050000	0.13356	-0.258000	0.10820	CGC		RRAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268830.1	NM_004165	
CTCF	10664	hgsc.bcm.edu	37	16	67644779	67644779	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr16:67644779C>G	ENST00000264010.4	+	3	488	c.44C>G	c.(43-45)aCt>aGt	p.T15S	CTCF_ENST00000401394.1_Intron	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	15					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.T15S(1)		breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		GAGTCCGAAACTTTTATTAAA	0.483																																					p.T15S	Colon(175;1200 1966 6945 23069 27405)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C44G	16						.						58.0	64.0	62.0					16																	67644779		2198	4300	6498	66202280	SO:0001583	missense	10664	exon3			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.44C>G	16.37:g.67644779C>G	ENSP00000264010:p.Thr15Ser	Somatic		Capture	SOLID	Phase_I	66202280	NM_006565	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	ENST00000264010.4	37	CCDS10841.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.237712	0.39598	.	.	ENSG00000102974	ENST00000264010	T	0.08634	3.07	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000001	T	0.07458	0.0188	N	0.19112	0.55	0.80722	D	1	B	0.29037	0.231	B	0.19666	0.026	T	0.31364	-0.9946	10	0.52906	T	0.07	-3.0078	18.8924	0.92410	0.0:1.0:0.0:0.0	.	15	P49711	CTCF_HUMAN	S	15	ENSP00000264010:T15S	ENSP00000264010:T15S	T	+	2	0	CTCF	66202280	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.525000	0.53502	2.696000	0.92011	0.655000	0.94253	ACT		CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268870.2	NM_006565	
L3MBTL4	91133	hgsc.bcm.edu	37	18	6301951	6301951	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr18:6301951T>A	ENST00000284898.6	-	4	278	c.78A>T	c.(76-78)caA>caT	p.Q26H	L3MBTL4_ENST00000317931.7_Missense_Mutation_p.Q26H|L3MBTL4_ENST00000400104.3_Missense_Mutation_p.Q26H|L3MBTL4_ENST00000400105.2_Missense_Mutation_p.Q26H	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	26					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.Q26H(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				CCTCTTCAGCTTGCTCCTAGA	0.373																																					p.Q26H	Esophageal Squamous(41;748 902 17366 28959 43175)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A78T	18						.						268.0	254.0	259.0					18																	6301951		2203	4300	6503	6291951	SO:0001583	missense	91133	exon4			BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.78A>T	18.37:g.6301951T>A	ENSP00000284898:p.Gln26His	Somatic		Capture	SOLID	Phase_I	6291951	NM_173464	A8MTL8|Q8IXS3	Missense_Mutation	SNP	ENST00000284898.6	37	CCDS11839.2	.	.	.	.	.	.	.	.	.	.	.	3.224	-0.158868	0.06544	.	.	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000400104	T;T;T;T	0.14766	2.48;2.48;2.48;2.7	5.06	2.33	0.28932	.	2.077890	0.02677	N	0.109220	T	0.13415	0.0325	N	0.19112	0.55	0.33261	D	0.55973	B	0.30763	0.294	B	0.39738	0.308	T	0.26224	-1.0109	10	0.66056	D	0.02	.	3.2483	0.06804	0.1904:0.1416:0.0:0.668	.	26	Q8NA19	LMBL4_HUMAN	H	26	ENSP00000382976:Q26H;ENSP00000318543:Q26H;ENSP00000284898:Q26H;ENSP00000382975:Q26H	ENSP00000284898:Q26H	Q	-	3	2	L3MBTL4	6291951	0.354000	0.24912	0.356000	0.25785	0.141000	0.21300	0.562000	0.23531	0.227000	0.20999	0.477000	0.44152	CAA		L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254448.2	NM_173464	
DCC	1630	hgsc.bcm.edu	37	18	49867231	49867231	+	Missense_Mutation	SNP	C	C	T	rs548959522		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr18:49867231C>T	ENST00000442544.2	+	1	690	c.74C>T	c.(73-75)gCg>gTg	p.A25V	RP11-25O3.1_ENST00000582700.1_lincRNA	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	25					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)	p.A25V(2)		NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TTGTTCAGCGCGCATCTTCAA	0.498																																					p.A25V												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C74T	18						.						193.0	171.0	178.0					18																	49867231		2203	4300	6503	48121229	SO:0001583	missense	1630	exon1			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.74C>T	18.37:g.49867231C>T	ENSP00000389140:p.Ala25Val	Somatic		Capture	SOLID	Phase_I	48121229	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	C	13.63	2.294693	0.40594	.	.	ENSG00000187323	ENST00000442544	T	0.49432	0.78	5.73	4.76	0.60689	Immunoglobulin-like (1);	0.310949	0.25112	N	0.033059	T	0.24160	0.0585	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	T	0.13602	-1.0503	10	0.56958	D	0.05	.	4.5674	0.12193	0.0:0.7141:0.0:0.2859	.	25	P43146	DCC_HUMAN	V	25	ENSP00000389140:A25V	ENSP00000389140:A25V	A	+	2	0	DCC	48121229	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.309000	0.43699	2.709000	0.92574	0.561000	0.74099	GCG		DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
ATP9B	374868	hgsc.bcm.edu	37	18	76953211	76953211	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr18:76953211A>G	ENST00000426216.2	+	9	919	c.902A>G	c.(901-903)tAt>tGt	p.Y301C	ATP9B_ENST00000307671.7_Missense_Mutation_p.Y301C	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	301					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.Y301C(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		GCTTATGTTTATGCTCAGAAA	0.323																																					p.Y301C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A902G	18						.						134.0	131.0	132.0					18																	76953211		2203	4300	6503	75054199	SO:0001583	missense	374868	exon9			R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.902A>G	18.37:g.76953211A>G	ENSP00000398076:p.Tyr301Cys	Somatic		Capture	SOLID	Phase_I	75054199	NM_198531	O60872|Q08AD8|Q08AD9	Missense_Mutation	SNP	ENST00000426216.2	37	CCDS12014.1	.	.	.	.	.	.	.	.	.	.	A	16.85	3.237171	0.58886	.	.	ENSG00000166377	ENST00000426216;ENST00000307671	T;T	0.66280	-0.17;-0.2	5.01	3.81	0.43845	ATPase, P-type, ATPase-associated domain (1);	0.196217	0.45606	D	0.000357	T	0.75932	0.3917	M	0.73430	2.235	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.73380	0.98;0.967	T	0.76105	-0.3081	10	0.52906	T	0.07	.	11.2331	0.48925	0.8626:0.0:0.0:0.1374	.	301;301	O43861;O43861-2	ATP9B_HUMAN;.	C	301	ENSP00000398076:Y301C;ENSP00000304500:Y301C	ENSP00000304500:Y301C	Y	+	2	0	ATP9B	75054199	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	4.552000	0.60747	0.817000	0.34445	0.477000	0.44152	TAT		ATP9B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256402.3	NM_198531	
ECT2	1894	hgsc.bcm.edu	37	3	172520703	172520703	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr3:172520703C>T	ENST00000392692.3	+	20	2215	c.2039C>T	c.(2038-2040)tCt>tTt	p.S680F	ECT2_ENST00000427830.1_Missense_Mutation_p.S649F|ECT2_ENST00000540509.1_Missense_Mutation_p.S680F|ECT2_ENST00000417960.1_Missense_Mutation_p.S648F|ECT2_ENST00000232458.5_Missense_Mutation_p.S649F|ECT2_ENST00000441497.2_Missense_Mutation_p.S649F	NM_001258315.1	NP_001245244.1	Q9H8V3	ECT2_HUMAN	epithelial cell transforming 2	680	PH.				activation of protein kinase activity (GO:0032147)|activation of Rac GTPase activity (GO:0032863)|activation of Rho GTPase activity (GO:0032862)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular response to calcium ion (GO:0071277)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of Rho GTPase activity (GO:0032321)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|centralspindlin complex (GO:0097149)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.S649F(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			GAAACAATTTCTCTAGGTGAG	0.378																																					p.S649F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1946T	3						.						80.0	79.0	79.0					3																	172520703		2203	4300	6503	174003397	SO:0001583	missense	1894	exon18			AA206473	CCDS3220.1, CCDS58860.1	3q26.1-q26.2	2014-03-11	2014-03-11		ENSG00000114346	ENSG00000114346		"""Rho guanine nucleotide exchange factors"""	3155	protein-coding gene	gene with protein product		600586	"""epithelial cell transforming sequence 2 oncogene"""			8464478, 10579713	Standard	NM_018098		Approved	ARHGEF31	uc003fil.2	Q9H8V3	OTTHUMG00000156762	ENST00000392692.3:c.2039C>T	3.37:g.172520703C>T	ENSP00000376457:p.Ser680Phe	Somatic		Capture	SOLID	Phase_I	174003397	NM_018098	Q0MT80|Q2M269|Q6U836|Q9NSV8|Q9NVW9	Missense_Mutation	SNP	ENST00000392692.3	37	CCDS58860.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.949861	0.92660	.	.	ENSG00000114346	ENST00000232458;ENST00000392692;ENST00000427830;ENST00000417960;ENST00000441497;ENST00000540509	T;T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61;1.61	6.07	6.07	0.98685	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.045868	0.85682	D	0.000000	T	0.33352	0.0860	N	0.19112	0.55	0.58432	D	0.999994	P;P;P;P;B	0.51147	0.74;0.626;0.942;0.657;0.222	B;B;P;B;B	0.49085	0.401;0.308;0.6;0.333;0.253	T	0.04386	-1.0955	10	0.59425	D	0.04	-19.3722	20.6593	0.99626	0.0:1.0:0.0:0.0	.	680;125;680;649;648	Q9H8V3;Q96SJ9;Q9H8V3-3;G5E9L8;Q9H8V3-2	ECT2_HUMAN;.;.;.;.	F	649;680;649;648;649;680	ENSP00000232458:S649F;ENSP00000376457:S680F;ENSP00000401910:S649F;ENSP00000415876:S648F;ENSP00000412259:S649F;ENSP00000443160:S680F	ENSP00000232458:S649F	S	+	2	0	ECT2	174003397	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.541000	0.67212	2.885000	0.99019	0.655000	0.94253	TCT		ECT2-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345994.2	NM_018098	
CCR4	1233	hgsc.bcm.edu	37	3	32995415	32995415	+	Silent	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr3:32995415C>T	ENST00000330953.5	+	2	669	c.501C>T	c.(499-501)ttC>ttT	p.F167F		NM_005508.4	NP_005499.1	P51679	CCR4_HUMAN	chemokine (C-C motif) receptor 4	167					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuron migration (GO:0001764)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of positive chemotaxis (GO:0050927)|response to antibiotic (GO:0046677)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)|tolerance induction (GO:0002507)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)	p.F167F(2)		NS(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)|stomach(1)	16						TGGCTGTGTTCGCCTCCCTTC	0.502																																					p.F167F												.	.	2	Substitution - coding silent(2)	large_intestine(1)|stomach(1)	c.C501T	3						.						140.0	120.0	127.0					3																	32995415		2203	4300	6503	32970419	SO:0001819	synonymous_variant	1233	exon2			X85740	CCDS2656.1	3p24-p21.3	2012-08-08			ENSG00000183813	ENSG00000183813		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1605	protein-coding gene	gene with protein product		604836				7642634, 8884276	Standard	NM_005508		Approved	CC-CKR-4, CMKBR4, CKR4, k5-5, ChemR13, CD194	uc003cfg.1	P51679	OTTHUMG00000130752	ENST00000330953.5:c.501C>T	3.37:g.32995415C>T		Somatic		Capture	SOLID	Phase_I	32970419	NM_005508	Q9ULY6|Q9ULY7	Silent	SNP	ENST00000330953.5	37	CCDS2656.1																																																																																				CCR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253252.2		
FETUB	26998	hgsc.bcm.edu	37	3	186370361	186370361	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr3:186370361C>T	ENST00000265029.3	+	7	1191	c.1090C>T	c.(1090-1092)Cgc>Tgc	p.R364C	RP11-134F2.2_ENST00000455926.1_RNA|RP11-134F2.2_ENST00000428501.1_RNA|FETUB_ENST00000382136.3_Missense_Mutation_p.R327C|FETUB_ENST00000539949.1_Missense_Mutation_p.R216C|FETUB_ENST00000450521.1_Missense_Mutation_p.R364C|FETUB_ENST00000382134.3_Missense_Mutation_p.R299C	NM_014375.2	NP_055190.2	Q9UGM5	FETUB_HUMAN	fetuin B	364					binding of sperm to zona pellucida (GO:0007339)|negative regulation of endopeptidase activity (GO:0010951)|single fertilization (GO:0007338)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)	p.R364C(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)	20	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		AGAAAAAGCACGCACTGCTGA	0.562																																					p.R364C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1090T	3						.						51.0	55.0	54.0					3																	186370361		2203	4300	6503	187853055	SO:0001583	missense	26998	exon7			AJ242928	CCDS3279.1	3q27.3	2008-05-15			ENSG00000090512	ENSG00000090512			3658	protein-coding gene	gene with protein product		605954				10947975	Standard	XM_005247350		Approved		uc003fqn.3	Q9UGM5	OTTHUMG00000156586	ENST00000265029.3:c.1090C>T	3.37:g.186370361C>T	ENSP00000265029:p.Arg364Cys	Somatic		Capture	SOLID	Phase_I	187853055	NM_014375	B2RCW6|E9PG06|Q1RMZ0|Q5J876|Q6DK58|Q6GRB6|Q9Y6Z0	Missense_Mutation	SNP	ENST00000265029.3	37	CCDS3279.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.694262	0.48202	.	.	ENSG00000090512	ENST00000450521;ENST00000539949;ENST00000265029;ENST00000382134;ENST00000382136	T;T;T;T;T	0.62788	-0.0;-0.0;-0.0;-0.0;-0.0	4.27	2.33	0.28932	.	0.527286	0.17286	N	0.179826	T	0.70979	0.3286	M	0.69823	2.125	0.09310	N	0.999991	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.66602	0.92;0.945;0.91	T	0.58707	-0.7589	10	0.87932	D	0	-7.428	4.7449	0.13033	0.2128:0.6758:0.0:0.1115	.	327;299;364	E9PG06;E9PG08;Q9UGM5	.;.;FETUB_HUMAN	C	364;216;364;299;327	ENSP00000404288:R364C;ENSP00000443704:R216C;ENSP00000265029:R364C;ENSP00000371569:R299C;ENSP00000371571:R327C	ENSP00000265029:R364C	R	+	1	0	FETUB	187853055	0.000000	0.05858	0.170000	0.22879	0.001000	0.01503	0.050000	0.14120	1.169000	0.42739	-0.140000	0.14226	CGC		FETUB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344679.1	NM_014375	
CD27	939	hgsc.bcm.edu	37	12	6559346	6559346	+	Silent	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr12:6559346C>T	ENST00000266557.3	+	3	505	c.276C>T	c.(274-276)ctC>ctT	p.L92L	CD27_ENST00000541233.1_3'UTR|CD27-AS1_ENST00000545339.1_RNA|CD27-AS1_ENST00000399492.2_RNA|TAPBPL_ENST00000544021.1_5'Flank|TAPBPL_ENST00000266556.7_5'Flank	NM_001242.4	NP_001233	P26842	CD27_HUMAN	CD27 molecule	92					cell surface receptor signaling pathway (GO:0007166)|extrinsic apoptotic signaling pathway (GO:0097191)|immunoglobulin mediated immune response (GO:0016064)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of JNK cascade (GO:0046330)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|response to ethanol (GO:0045471)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|transmembrane signaling receptor activity (GO:0004888)	p.L92L(1)		kidney(1)|large_intestine(5)|lung(1)|urinary_tract(3)	10						CAGGTCTTCTCGTTCGCAACT	0.587																																					p.L92L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C276T	12						.						131.0	91.0	105.0					12																	6559346		2203	4300	6503	6429607	SO:0001819	synonymous_variant	939	exon3			M63928	CCDS8545.1	12p13	2014-09-17	2006-10-27	2006-10-27	ENSG00000139193	ENSG00000139193		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11922	protein-coding gene	gene with protein product		186711	"""tumor necrosis factor receptor superfamily, member 7"""	TNFRSF7		2442250, 8530100	Standard	NM_001242		Approved	S152, Tp55	uc001qod.3	P26842	OTTHUMG00000168316	ENST00000266557.3:c.276C>T	12.37:g.6559346C>T		Somatic		Capture	SOLID	Phase_I	6429607	NM_001242	B2RDZ0	Silent	SNP	ENST00000266557.3	37	CCDS8545.1																																																																																				CD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399258.1		
USP5	8078	hgsc.bcm.edu	37	12	6961371	6961371	+	Silent	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr12:6961371C>T	ENST00000229268.8	+	1	80	c.28C>T	c.(28-30)Ctg>Ttg	p.L10L	CDCA3_ENST00000535406.1_5'Flank|CDCA3_ENST00000422785.3_5'Flank|USP5_ENST00000389231.5_Silent_p.L10L|CDCA3_ENST00000540683.1_5'Flank|CDCA3_ENST00000538862.2_5'Flank|CDCA3_ENST00000229265.6_5'Flank	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	10					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)	p.L10L(1)		breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						GGAGGCGCTGCTGTCAGTATT	0.652													C|||	1	0.000199681	0.0	0.0	5008	,	,		-128	0.001		0.0	False		,,,				2504	0.0				p.L10L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C28T	12						.						105.0	87.0	93.0					12																	6961371		2203	4300	6503	6831632	SO:0001819	synonymous_variant	8078	exon1			U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.28C>T	12.37:g.6961371C>T		Somatic		Capture	SOLID	Phase_I	6831632	NM_003481	D3DUS7|D3DUS8|Q96J22	Silent	SNP	ENST00000229268.8	37	CCDS41743.1																																																																																				USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402982.1		
ENDOU	8909	hgsc.bcm.edu	37	12	48105514	48105514	+	Silent	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr12:48105514G>A	ENST00000422538.3	-	9	1139	c.1017C>T	c.(1015-1017)gaC>gaT	p.D339D	ENDOU_ENST00000545824.2_Silent_p.D276D|ENDOU_ENST00000542202.1_Intron|ENDOU_ENST00000229003.3_Silent_p.D298D|RP1-197B17.3_ENST00000547799.1_lincRNA	NM_001172439.1	NP_001165910.1	P21128	ENDOU_HUMAN	endonuclease, polyU-specific	339					female pregnancy (GO:0007565)|immune response (GO:0006955)|proteolysis (GO:0006508)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endoribonuclease activity (GO:0004521)|growth factor activity (GO:0008083)|manganese ion binding (GO:0030145)|polysaccharide binding (GO:0030247)|RNA binding (GO:0003723)|scavenger receptor activity (GO:0005044)|serine-type peptidase activity (GO:0008236)	p.D298D(1)		autonomic_ganglia(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(3)|pancreas(1)|stomach(1)	14						TATAGTAGCCGTCCCAGTTGA	0.547																																					p.D339D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1017T	12						.						76.0	64.0	68.0					12																	48105514		2203	4300	6503	46391781	SO:0001819	synonymous_variant	8909	exon9			M32402	CCDS8754.1, CCDS53784.1, CCDS53785.1	12q13.1	2011-08-31			ENSG00000111405	ENSG00000111405		"""Serine peptidases / Serine peptidases"""	14369	protein-coding gene	gene with protein product		606720				2350438, 1710108, 15755742, 18936097	Standard	NM_006025		Approved	PP11, P11, PRSS26	uc001rpu.2	P21128	OTTHUMG00000169670	ENST00000422538.3:c.1017C>T	12.37:g.48105514G>A		Somatic		Capture	SOLID	Phase_I	46391781	NM_001172439	B2RBJ3|B3KQS7|B7Z6E1|Q2NKJ4	Silent	SNP	ENST00000422538.3	37	CCDS53785.1																																																																																				ENDOU-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000405352.1	NM_006025.2	
CRADD	8738	hgsc.bcm.edu	37	12	94243853	94243853	+	Silent	SNP	C	C	T	rs56944668	byFrequency	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr12:94243853C>T	ENST00000542893.2	+	3	724	c.406C>T	c.(406-408)Ctg>Ttg	p.L136L	CRADD_ENST00000548330.1_3'UTR|CRADD_ENST00000541813.1_Intron|CRADD_ENST00000548483.1_Intron|CRADD_ENST00000332896.3_Silent_p.L136L			P78560	CRADD_HUMAN	CASP2 and RIPK1 domain containing adaptor with death domain	136	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|positive regulation of apoptotic signaling pathway (GO:2001235)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	death domain binding (GO:0070513)|protease binding (GO:0002020)|protein binding, bridging (GO:0030674)	p.L136L(1)		endometrium(1)|large_intestine(5)|lung(1)|ovary(1)	8						GCCCATGGTGCTGTCTCTGGG	0.617													C|||	1138	0.227236	0.1059	0.1686	5008	,	,		17245	0.4911		0.1551	False		,,,				2504	0.2352				p.L136L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C406T	12						.	C		537,3869	245.3+/-254.3	31,475,1697	57.0	53.0	54.0		406	5.9	1.0	12	dbSNP_129	54	1357,7243	265.0+/-285.9	105,1147,3048	yes	coding-synonymous	CRADD	NM_003805.3		136,1622,4745	TT,TC,CC		15.7791,12.1879,14.5625		136/200	94243853	1894,11112	2203	4300	6503	92767984	SO:0001819	synonymous_variant	8738	exon3			U84388	CCDS9048.1	12q21.33-q23.1	2008-08-04				ENSG00000169372			2340	protein-coding gene	gene with protein product	"""RIP-associated ICH1/CED3-homologous protein with death domain"""	603454				8985253, 9044836	Standard	NM_003805		Approved	RAIDD	uc001tda.3	P78560		ENST00000542893.2:c.406C>T	12.37:g.94243853C>T		Somatic		Capture	SOLID	Phase_I	92767984	NM_003805	B7Z2Q5	Silent	SNP	ENST00000542893.2	37	CCDS9048.1																																																																																				CRADD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408515.1	NM_003805	
ATP2A2	488	hgsc.bcm.edu	37	12	110778760	110778760	+	Silent	SNP	C	C	T	rs140766323	byFrequency	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr12:110778760C>T	ENST00000539276.2	+	14	2167	c.2058C>T	c.(2056-2058)atC>atT	p.I686I	ATP2A2_ENST00000395494.2_Silent_p.I659I|ATP2A2_ENST00000308664.6_Silent_p.I686I			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	686					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)	p.I686I(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						AGTCTAAAATCGTAGAATTTC	0.493													C|||	5	0.000998403	0.0	0.0	5008	,	,		20126	0.0		0.0	False		,,,				2504	0.0051				p.I686I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2058T	12						.	C	,	1,4405	2.1+/-5.4	0,1,2202	47.0	48.0	48.0		2058,2058	-3.7	0.7	12	dbSNP_134	48	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ATP2A2	NM_001681.3,NM_170665.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	686/998,686/1043	110778760	1,13005	2203	4300	6503	109263143	SO:0001819	synonymous_variant	488	exon14				CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.2058C>T	12.37:g.110778760C>T		Somatic		Capture	SOLID	Phase_I	109263143	NM_170665	A6NDN7|B4DF05|P16614|Q86VJ2	Silent	SNP	ENST00000539276.2	37	CCDS9144.1	.	.	.	.	.	.	.	.	.	.	C	8.948	0.967402	0.18659	2.27E-4	0.0	ENSG00000174437	ENST00000548169	.	.	.	5.81	-3.67	0.04476	.	.	.	.	.	T	0.65015	0.2651	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62435	-0.6855	4	.	.	.	.	15.1138	0.72384	0.0:0.3311:0.0:0.6689	.	.	.	.	C	577	.	.	R	+	1	0	ATP2A2	109263143	0.135000	0.22499	0.736000	0.30914	0.946000	0.59487	-0.493000	0.06459	-1.224000	0.02581	-1.731000	0.00696	CGT		ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681	
PLA2G4F	255189	hgsc.bcm.edu	37	15	42434341	42434341	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr15:42434341G>T	ENST00000382396.4	-	20	2477	c.2391C>A	c.(2389-2391)gaC>gaA	p.D797E	PLA2G4F_ENST00000397272.3_Missense_Mutation_p.D799E			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	797	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)	p.D797E(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		CATAGGGGGTGTCTGGCCTGT	0.562																																					p.D797E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2391A	15						.						90.0	79.0	83.0					15																	42434341		2203	4299	6502	40221633	SO:0001583	missense	255189	exon20				CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.2391C>A	15.37:g.42434341G>T	ENSP00000371833:p.Asp797Glu	Somatic		Capture	SOLID	Phase_I	40221633	NM_213600	Q6ZMC8	Missense_Mutation	SNP	ENST00000382396.4	37	CCDS32204.1	.	.	.	.	.	.	.	.	.	.	G	7.702	0.693286	0.15039	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000443825	T;T	0.04083	3.71;3.71	5.21	0.0172	0.14111	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (1);	0.161472	0.42172	D	0.000749	T	0.02012	0.0063	N	0.24115	0.695	0.29226	N	0.873632	B;B;B	0.33857	0.429;0.011;0.429	B;B;B	0.24006	0.05;0.015;0.05	T	0.45338	-0.9268	10	0.02654	T	1	-26.8745	5.8992	0.18957	0.4465:0.0:0.4326:0.1209	.	584;799;797	A2RRC4;C9J281;Q68DD2	.;.;PA24F_HUMAN	E	793;799;797;797	ENSP00000380442:D799E;ENSP00000371833:D797E	ENSP00000290497:D793E	D	-	3	2	PLA2G4F	40221633	0.906000	0.30813	0.980000	0.43619	0.539000	0.34962	0.088000	0.14979	-0.157000	0.11059	-0.786000	0.03341	GAC		PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600	
NEIL1	79661	hgsc.bcm.edu	37	15	75644493	75644493	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr15:75644493G>A	ENST00000564784.1	+	4	1105	c.476G>A	c.(475-477)cGg>cAg	p.R159Q	NEIL1_ENST00000567959.1_Intron|MIR631_ENST00000384904.1_RNA|NEIL1_ENST00000569035.1_Missense_Mutation_p.R159Q|NEIL1_ENST00000355059.4_Missense_Mutation_p.R159Q			Q96FI4	NEIL1_HUMAN	nei endonuclease VIII-like 1 (E. coli)	159			R -> Q. {ECO:0000269|PubMed:21697813}.		base-excision repair (GO:0006284)|negative regulation of nuclease activity (GO:0032074)|nucleotide-excision repair (GO:0006289)|response to oxidative stress (GO:0006979)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)	p.R159Q(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)	13						GCCTTTGACCGGCCCATCTGC	0.587								Base excision repair (BER), DNA glycosylases																													p.R159Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G476A	15						.						74.0	68.0	70.0					15																	75644493		2197	4294	6491	73431546	SO:0001583	missense	79661	exon3			AK026055	CCDS10278.1	15q33.33	2008-07-18			ENSG00000140398	ENSG00000140398			18448	protein-coding gene	gene with protein product		608844				11904416	Standard	NM_024608		Approved	FLJ22402, hFPG1, NEI1, FPG1	uc002bae.4	Q96FI4	OTTHUMG00000142821	ENST00000564784.1:c.476G>A	15.37:g.75644493G>A	ENSP00000457352:p.Arg159Gln	Somatic		Capture	SOLID	Phase_I	73431546	NM_024608	D3DW75|Q6ZRA7|Q86XW7|Q9H6C3	Missense_Mutation	SNP	ENST00000564784.1	37	CCDS10278.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.579490	0.46006	.	.	ENSG00000140398	ENST00000355059	T	0.20881	2.04	5.55	3.37	0.38596	DNA glycosylase/AP lyase, H2TH DNA-binding (1);Ribosomal protein S13-like, H2TH (1);	0.399671	0.28448	N	0.015319	T	0.13372	0.0324	L	0.38838	1.175	0.27028	N	0.964312	B	0.23490	0.086	B	0.15484	0.013	T	0.11867	-1.0570	10	0.36615	T	0.2	-24.2007	4.4732	0.11722	0.3849:0.0:0.6151:0.0	.	159	Q96FI4	NEIL1_HUMAN	Q	159	ENSP00000347170:R159Q	ENSP00000347170:R159Q	R	+	2	0	NEIL1	73431546	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.844000	0.39269	1.271000	0.44313	0.655000	0.94253	CGG		NEIL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419885.1	NM_024608	
SPRY1	10252	hgsc.bcm.edu	37	4	124323423	124323423	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr4:124323423A>G	ENST00000394339.2	+	2	1017	c.677A>G	c.(676-678)aAg>aGg	p.K226R	SPRY1_ENST00000339241.1_Missense_Mutation_p.K226R	NM_001258039.1|NM_005841.2	NP_001244968.1|NP_005832.1	O43609	SPY1_HUMAN	sprouty homolog 1, antagonist of FGF signaling (Drosophila)	226	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytosol (GO:0005829)|plasma membrane (GO:0005886)		p.K226R(1)		NS(1)|large_intestine(4)|lung(2)|ovary(1)|skin(3)	11						TGCTTAGTCAAGGGCATCTTC	0.507																																					p.K226R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A677G	4						.						264.0	220.0	235.0					4																	124323423		2203	4300	6503	124542873	SO:0001583	missense	10252	exon2			AF041037	CCDS3731.1	4q	2009-04-17	2001-11-28		ENSG00000164056	ENSG00000164056			11269	protein-coding gene	gene with protein product		602465	"""sprouty (Drosophila) homolog 1 (antagonist of FGF signaling)"""			9458049, 15962011	Standard	NM_001258038		Approved	hSPRY1	uc003ifa.4	O43609	OTTHUMG00000133071	ENST00000394339.2:c.677A>G	4.37:g.124323423A>G	ENSP00000377871:p.Lys226Arg	Somatic		Capture	SOLID	Phase_I	124542873	NM_005841	D3DNX6|Q6PNE0	Missense_Mutation	SNP	ENST00000394339.2	37	CCDS3731.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.220336	0.79464	.	.	ENSG00000164056	ENST00000339241;ENST00000394339	T;T	0.64991	-0.13;-0.13	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.73969	0.3655	L	0.53249	1.67	0.58432	D	0.999999	D	0.69078	0.997	D	0.80764	0.994	T	0.73569	-0.3941	9	.	.	.	-21.9899	14.6626	0.68882	1.0:0.0:0.0:0.0	.	226	O43609	SPY1_HUMAN	R	226	ENSP00000343785:K226R;ENSP00000377871:K226R	.	K	+	2	0	SPRY1	124542873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.420000	0.90256	2.120000	0.65058	0.459000	0.35465	AAG		SPRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256711.1		
KLB	152831	hgsc.bcm.edu	37	4	39436103	39436103	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr4:39436103G>T	ENST00000257408.4	+	2	1196	c.1099G>T	c.(1099-1101)Gct>Tct	p.A367S		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	367	Glycosyl hydrolase-1 1.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.A367S(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						GAGAGGCACAGCTGATTTCTT	0.438																																					p.A367S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1099T	4						.						131.0	131.0	131.0					4																	39436103		2203	4300	6503	39112498	SO:0001583	missense	152831	exon2			AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.1099G>T	4.37:g.39436103G>T	ENSP00000257408:p.Ala367Ser	Somatic		Capture	SOLID	Phase_I	39112498	NM_175737	Q2M3K8	Missense_Mutation	SNP	ENST00000257408.4	37	CCDS3451.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.313887	0.81358	.	.	ENSG00000134962	ENST00000257408	T	0.30448	1.53	6.17	5.31	0.75309	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.050490	0.85682	N	0.000000	T	0.39708	0.1088	L	0.35542	1.07	0.49687	D	0.999811	D;D	0.56746	0.977;0.977	P;P	0.55871	0.786;0.786	T	0.14868	-1.0457	10	0.42905	T	0.14	-11.5393	16.7418	0.85461	0.0:0.0:0.8698:0.1302	.	367;367	B7ZL50;Q86Z14	.;KLOTB_HUMAN	S	367	ENSP00000257408:A367S	ENSP00000257408:A367S	A	+	1	0	KLB	39112498	1.000000	0.71417	0.986000	0.45419	0.991000	0.79684	6.587000	0.74071	1.561000	0.49584	0.655000	0.94253	GCT		KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737	
DCAF4L1	285429	hgsc.bcm.edu	37	4	41984092	41984092	+	Missense_Mutation	SNP	G	G	A	rs368035048		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr4:41984092G>A	ENST00000333141.5	+	1	380	c.283G>A	c.(283-285)Gaa>Aaa	p.E95K		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	95								p.E95K(1)		breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						GGTCGAAGTCGAAGGCTCCAA	0.542																																					p.E95K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G283A	4						.	G	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	94.0	84.0	87.0		283	0.7	0.3	4		87	1,8599	1.2+/-3.3	0,1,4299	no	missense	DCAF4L1	NM_001029955.3	56	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	95/397	41984092	2,13004	2203	4300	6503	41678849	SO:0001583	missense	285429	exon1			BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.283G>A	4.37:g.41984092G>A	ENSP00000327796:p.Glu95Lys	Somatic		Capture	SOLID	Phase_I	41678849	NM_001029955	B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Missense_Mutation	SNP	ENST00000333141.5	37	CCDS33978.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805285	0.50315	2.27E-4	1.16E-4	ENSG00000182308	ENST00000333141	T	0.38077	1.16	0.688	0.688	0.18027	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.045119	0.85682	D	0.000000	T	0.12732	0.0309	N	0.08118	0	0.24240	N	0.995369	P	0.37466	0.596	B	0.19666	0.026	T	0.21552	-1.0242	9	0.72032	D	0.01	.	.	.	.	.	95	Q3SXM0	DC4L1_HUMAN	K	95	ENSP00000327796:E95K	ENSP00000327796:E95K	E	+	1	0	DCAF4L1	41678849	1.000000	0.71417	0.344000	0.25628	0.765000	0.43378	5.366000	0.66122	0.635000	0.30488	0.313000	0.20887	GAA		DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360958.1	NM_001029955	
MAPK10	5602	hgsc.bcm.edu	37	4	86989043	86989043	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr4:86989043A>T	ENST00000359221.3	-	10	1394	c.868T>A	c.(868-870)Ttg>Atg	p.L290M	MAPK10_ENST00000395157.3_Missense_Mutation_p.L145M|MAPK10_ENST00000395160.3_Missense_Mutation_p.L145M|MAPK10_ENST00000395166.1_Missense_Mutation_p.L252M|MAPK10_ENST00000395169.3_Missense_Mutation_p.L252M|MAPK10_ENST00000361569.2_Missense_Mutation_p.L290M|MAPK10_ENST00000395161.2_Missense_Mutation_p.L290M|MAPK10_ENST00000449047.2_Missense_Mutation_p.L145M			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	290	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)	p.L290M(1)|p.L145M(1)		breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		GTGGGTTGCAATTTCTTCATG	0.448																																					p.L145M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T433A	4						.						146.0	132.0	137.0					4																	86989043		2203	4300	6503	87208067	SO:0001583	missense	5602	exon5			U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.868T>A	4.37:g.86989043A>T	ENSP00000352157:p.Leu290Met	Somatic		Capture	SOLID	Phase_I	87208067	NM_138981	A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	ENST00000359221.3	37	CCDS34026.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.8|20.8	4.044150|4.044150	0.75732|0.75732	.|.	.|.	ENSG00000109339|ENSG00000109339	ENST00000515400|ENST00000395169;ENST00000359221;ENST00000395157;ENST00000361569;ENST00000395166;ENST00000395160;ENST00000449047;ENST00000395161	.|D;D;D;D;D;D;D;D	.|0.83506	.|-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73	5.28|5.28	1.55|1.55	0.23275|0.23275	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.84188|0.84188	0.5417|0.5417	L|L	0.37750|0.37750	1.13|1.13	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;0.999;0.999;1.0	.|D;D;D;D;D	.|0.87578	.|0.998;0.998;0.994;0.994;0.997	T|T	0.81284|0.81284	-0.1002|-0.1002	5|10	.|0.59425	.|D	.|0.04	-12.0218|-12.0218	8.5109|8.5109	0.33217|0.33217	0.5391:0.0:0.4609:0.0|0.5391:0.0:0.4609:0.0	.|.	.|176;145;252;290;290	.|B7Z1Z1;Q499Y8;P53779-3;P53779-2;P53779	.|.;.;.;.;MK10_HUMAN	N|M	202|252;290;145;290;252;145;145;290	.|ENSP00000378598:L252M;ENSP00000352157:L290M;ENSP00000378586:L145M;ENSP00000355297:L290M;ENSP00000378595:L252M;ENSP00000378589:L145M;ENSP00000414469:L145M;ENSP00000378590:L290M	.|ENSP00000352157:L290M	I|L	-|-	2|1	0|2	MAPK10|MAPK10	87208067|87208067	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.999000|0.999000	0.98932|0.98932	3.757000|3.757000	0.55212|0.55212	0.100000|0.100000	0.17581|0.17581	0.533000|0.533000	0.62120|0.62120	ATT|TTG		MAPK10-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000361363.2		
GALNT7	51809	hgsc.bcm.edu	37	4	174219443	174219443	+	Silent	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr4:174219443G>A	ENST00000265000.4	+	6	1226	c.1143G>A	c.(1141-1143)ccG>ccA	p.P381P	GALNT7_ENST00000512285.1_3'UTR	NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	381	Catalytic subdomain B.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.P381P(1)		central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		AAACTGAACCGTATCGGTAAT	0.423																																					p.P381P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1143A	4						.						60.0	60.0	60.0					4																	174219443		2203	4300	6503	174456018	SO:0001819	synonymous_variant	51809	exon6			AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.1143G>A	4.37:g.174219443G>A		Somatic		Capture	SOLID	Phase_I	174456018	NM_017423	B3KQU3|Q7Z5W7|Q9UJ28	Silent	SNP	ENST00000265000.4	37	CCDS3815.1																																																																																				GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362456.2	NM_017423	
ARHGAP36	158763	hgsc.bcm.edu	37	X	130217770	130217770	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chrX:130217770C>T	ENST00000276211.5	+	4	727	c.382C>T	c.(382-384)Cgc>Tgc	p.R128C	ARHGAP36_ENST00000370922.1_Missense_Mutation_p.R116C|ARHGAP36_ENST00000370921.1_5'UTR	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	128					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.R128C(2)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GTTTACCCGCCGCAAGCATCT	0.562																																					p.R128C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C382T	X						.						134.0	132.0	133.0					X																	130217770		2203	4300	6503	130045451	SO:0001583	missense	158763	exon4				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.382C>T	X.37:g.130217770C>T	ENSP00000276211:p.Arg128Cys	Somatic		Capture	SOLID	Phase_I	130045451	NM_144967	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.535966	0.27475	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432	T;T;T	0.13307	2.6;2.6;2.63	4.3	3.43	0.39272	.	0.137816	0.34156	N	0.004215	T	0.09992	0.0245	N	0.24115	0.695	0.80722	D	1	D;D;D	0.58620	0.957;0.983;0.971	B;B;B	0.43950	0.437;0.437;0.253	T	0.09530	-1.0670	10	0.51188	T	0.08	.	8.4459	0.32841	0.2315:0.7685:0.0:0.0	.	97;116;128	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	C	128;116;80;97	ENSP00000276211:R128C;ENSP00000359960:R116C;ENSP00000408515:R97C	ENSP00000276211:R128C	R	+	1	0	ARHGAP36	130045451	0.999000	0.42202	0.996000	0.52242	0.044000	0.14063	1.640000	0.37186	1.134000	0.42165	0.600000	0.82982	CGC		ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
LTBP1	4052	hgsc.bcm.edu	37	2	33246074	33246074	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr2:33246074G>T	ENST00000404816.2	+	3	1017	c.664G>T	c.(664-666)Gct>Tct	p.A222S	LTBP1_ENST00000354476.3_Missense_Mutation_p.A222S			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	222					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.A222S(1)		breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TGAAACAATAGCTGCCCAGGA	0.557																																					p.A222S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G664T	2						.						147.0	150.0	149.0					2																	33246074		2203	4300	6503	33099578	SO:0001583	missense	4052	exon3				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.664G>T	2.37:g.33246074G>T	ENSP00000386043:p.Ala222Ser	Somatic		Capture	SOLID	Phase_I	33099578	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	37	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	G	6.421	0.445839	0.12164	.	.	ENSG00000049323	ENST00000404816;ENST00000354476	D;D	0.91843	-2.92;-2.92	4.99	2.18	0.27775	.	.	.	.	.	T	0.80352	0.4607	N	0.04387	-0.21	0.09310	N	1	B	0.19200	0.034	B	0.18561	0.022	T	0.70146	-0.4952	9	0.72032	D	0.01	.	5.3907	0.16242	0.3022:0.1354:0.5624:0.0	.	222	Q14766-4	.	S	222	ENSP00000386043:A222S;ENSP00000346467:A222S	ENSP00000346467:A222S	A	+	1	0	LTBP1	33099578	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.001000	0.13038	0.225000	0.20959	0.637000	0.83480	GCT		LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
CNRIP1	25927	hgsc.bcm.edu	37	2	68544315	68544315	+	Missense_Mutation	SNP	G	G	A	rs139324099		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr2:68544315G>A	ENST00000263655.3	-	2	909	c.304C>T	c.(304-306)Cgg>Tgg	p.R102W	CNRIP1_ENST00000481714.1_5'UTR|CNRIP1_ENST00000409862.1_Missense_Mutation_p.R102W|CNRIP1_ENST00000409559.3_Missense_Mutation_p.R102W	NM_015463.2	NP_056278.1	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1	102								p.R102W(4)		kidney(1)|large_intestine(5)|liver(1)|lung(1)|skin(1)	9						ATGGGTTGCCGTTCTCCACTC	0.478																																					p.R102W												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.C304T	2						.	G	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	192.0	164.0	174.0		304,304	4.9	1.0	2	dbSNP_134	174	0,8600		0,0,4300	no	missense,missense	CNRIP1	NM_001111101.1,NM_015463.2	101,101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	102/129,102/165	68544315	1,13005	2203	4300	6503	68397819	SO:0001583	missense	25927	exon2			AL110235	CCDS1886.1, CCDS46311.1	2p13	2008-02-05	2007-11-29	2007-11-29	ENSG00000119865	ENSG00000119865			24546	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 32"""	C2orf32		12477932	Standard	NM_015463		Approved	DKFZP566K1924, CRIP1, CRIP1a, CRIP1b	uc002sek.4	Q96F85	OTTHUMG00000129565	ENST00000263655.3:c.304C>T	2.37:g.68544315G>A	ENSP00000263655:p.Arg102Trp	Somatic		Capture	SOLID	Phase_I	68397819	NM_015463	B2R4D0|Q49AN4|Q9UFZ0	Missense_Mutation	SNP	ENST00000263655.3	37	CCDS1886.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.204907	0.79127	2.27E-4	0.0	ENSG00000119865	ENST00000409559;ENST00000263655;ENST00000409862	.	.	.	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.70263	0.3204	L	0.60455	1.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.71978	-0.4429	9	0.87932	D	0	-7.7262	11.1633	0.48528	0.0:0.0:0.7675:0.2325	.	102;102;102	B8ZZB8;Q96F85;Q96F85-2	.;CNRP1_HUMAN;.	W	102	.	ENSP00000263655:R102W	R	-	1	2	CNRIP1	68397819	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.442000	0.52900	2.697000	0.92050	0.555000	0.69702	CGG		CNRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251758.1	NM_015463	
GKN1	56287	hgsc.bcm.edu	37	2	69207125	69207125	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr2:69207125C>A	ENST00000377938.2	+	5	501	c.438C>A	c.(436-438)agC>agA	p.S146R		NM_019617.3	NP_062563.3	Q9NS71	GKN1_HUMAN	gastrokine 1	146	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				digestion (GO:0007586)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)	extracellular region (GO:0005576)|secretory granule (GO:0030141)		p.S146S(1)|p.S146R(1)		breast(2)|large_intestine(4)|lung(5)	11						ATGACCTGAGCAAGTTCGGAA	0.502																																					p.S146R												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(2)	c.C438A	2						.						171.0	125.0	141.0					2																	69207125		2203	4300	6503	69060629	SO:0001583	missense	56287	exon5			AY139182	CCDS1891.2	2p13.3	2012-10-10			ENSG00000169605	ENSG00000169605		"""BRICHOS domain containing"""	23217	protein-coding gene	gene with protein product	"""BRICHOS domain containing 1"""	606402				12851218, 11562744	Standard	NM_019617		Approved	AMP18, CA11, BRICD1	uc002sfc.3	Q9NS71	OTTHUMG00000129574	ENST00000377938.2:c.438C>A	2.37:g.69207125C>A	ENSP00000367172:p.Ser146Arg	Somatic		Capture	SOLID	Phase_I	69060629	NM_019617	Q8IUA9	Missense_Mutation	SNP	ENST00000377938.2	37	CCDS1891.2	.	.	.	.	.	.	.	.	.	.	C	12.92	2.082850	0.36758	.	.	ENSG00000169605	ENST00000377938	T	0.80480	-1.38	5.35	1.48	0.22813	BRICHOS (2);	1.291150	0.04804	N	0.433921	T	0.72914	0.3520	N	0.25647	0.755	0.09310	N	1	P	0.38677	0.642	P	0.45829	0.494	T	0.58951	-0.7545	10	0.28530	T	0.3	-5.5649	2.0988	0.03675	0.1486:0.3968:0.289:0.1657	.	146	Q9NS71	GKN1_HUMAN	R	146	ENSP00000367172:S146R	ENSP00000367172:S146R	S	+	3	2	GKN1	69060629	0.000000	0.05858	0.000000	0.03702	0.422000	0.31414	0.050000	0.14120	0.093000	0.17368	0.650000	0.86243	AGC		GKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251769.2	NM_019617	
DYSF	8291	hgsc.bcm.edu	37	2	71886083	71886083	+	Missense_Mutation	SNP	G	G	A	rs143163327		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr2:71886083G>A	ENST00000258104.3	+	43	4991	c.4714G>A	c.(4714-4716)Gcc>Acc	p.A1572T	DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000409582.3_Missense_Mutation_p.A1610T|DYSF_ENST00000409762.1_Missense_Mutation_p.A1589T|DYSF_ENST00000409744.1_Missense_Mutation_p.A1580T|DYSF_ENST00000410020.3_Missense_Mutation_p.A1611T|DYSF_ENST00000429174.2_Missense_Mutation_p.A1593T|DYSF_ENST00000394120.2_Missense_Mutation_p.A1573T|DYSF_ENST00000409651.1_Missense_Mutation_p.A1604T|DYSF_ENST00000410041.1_Missense_Mutation_p.A1590T|DYSF_ENST00000409366.1_Missense_Mutation_p.A1594T|DYSF_ENST00000413539.2_Missense_Mutation_p.A1603T	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1572	C2 6. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.A1572T(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CCAGCTGGCCGCCCAGGGACC	0.547													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17582	0.0		0.0	False		,,,				2504	0.0				p.A1604T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4810A	2						.	G	THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	85.0	92.0	90.0		4717,4672,4735,4777,4807,4765,4828,4810,4780,4738,4768,4675,4831,4714	3.5	1.0	2	dbSNP_134	90	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	DYSF	NM_001130455.1,NM_001130976.1,NM_001130977.1,NM_001130978.1,NM_001130979.1,NM_001130980.1,NM_001130981.1,NM_001130982.1,NM_001130983.1,NM_001130984.1,NM_001130985.1,NM_001130986.1,NM_001130987.1,NM_003494.3	58,58,58,58,58,58,58,58,58,58,58,58,58,58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	1573/2082,1558/2067,1579/2088,1593/2102,1603/2112,1589/2098,1610/2119,1604/2113,1594/2103,1580/2089,1590/2099,1559/2068,1611/2120,1572/2081	71886083	1,13005	2203	4300	6503	71739591	SO:0001583	missense	8291	exon44			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.4714G>A	2.37:g.71886083G>A	ENSP00000258104:p.Ala1572Thr	Somatic		Capture	SOLID	Phase_I	71739591	NM_001130982	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.572700	0.28092	0.0	1.16E-4	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	T;T;T;T;T;T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08	5.36	3.49	0.39957	C2 membrane targeting protein (1);C2 calcium/lipid-binding domain, CaLB (1);	0.453698	0.25666	N	0.029118	T	0.26376	0.0644	L	0.34521	1.04	0.25640	N	0.98622	B;P;P;P;B;B;B;B;B;P;B;B;B;B;B	0.38473	0.175;0.633;0.633;0.633;0.322;0.131;0.04;0.131;0.002;0.633;0.007;0.005;0.203;0.322;0.216	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.32465	0.047;0.146;0.146;0.093;0.093;0.063;0.04;0.063;0.01;0.093;0.01;0.01;0.093;0.093;0.043	T	0.10291	-1.0636	10	0.14656	T	0.56	-7.5719	10.9452	0.47296	0.0:0.0:0.6369:0.3631	.	336;1604;1611;1594;1559;1590;1580;1589;1579;1603;1610;1593;1558;1573;1572	B7Z8G4;O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	T	1603;1589;1610;1593;1572;1604;1573;1580;1594;1611;1590	ENSP00000407046:A1603T;ENSP00000387137:A1589T;ENSP00000386547:A1610T;ENSP00000398305:A1593T;ENSP00000258104:A1572T;ENSP00000386683:A1604T;ENSP00000377678:A1573T;ENSP00000386285:A1580T;ENSP00000386512:A1594T;ENSP00000386881:A1611T;ENSP00000386617:A1590T	ENSP00000258104:A1572T	A	+	1	0	DYSF	71739591	0.920000	0.31207	0.958000	0.39756	0.659000	0.38960	2.316000	0.43761	0.573000	0.29400	0.650000	0.86243	GCC		DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
CFAP221	200373	hgsc.bcm.edu	37	2	120383254	120383254	+	Silent	SNP	G	G	A	rs371319201		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr2:120383254G>A	ENST00000413369.3	+	15	1593	c.1506G>A	c.(1504-1506)tcG>tcA	p.S502S	PCDP1_ENST00000597189.1_3'UTR|PCDP1_ENST00000602047.1_Silent_p.S216S	NM_001271049.1	NP_001257978												p.S216S(1)				Colorectal(110;0.196)					CAAAACAATCGATAGCACAAG	0.428																																					p.S216S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G648A	2						.	G		0,4406		0,0,2203	118.0	99.0	106.0		648	-8.3	0.0	2		106	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PCDP1	NM_001029996.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		216/555	120383254	1,13005	2203	4300	6503	120099724	SO:0001819	synonymous_variant	200373	exon16																														ENST00000413369.3:c.1506G>A	2.37:g.120383254G>A		Somatic		Capture	SOLID	Phase_I	120099724	NM_001029996		Silent	SNP	ENST00000413369.3	37	CCDS33282.2	.	.	.	.	.	.	.	.	.	.	G	1.982	-0.433989	0.04669	0.0	1.16E-4	ENSG00000163075	ENST00000443972;ENST00000413057	.	.	.	4.17	-8.34	0.00988	.	.	.	.	.	T	0.22975	0.0555	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.06972	-1.0797	4	.	.	.	1.104	5.0918	0.14711	0.1175:0.2647:0.4634:0.1544	.	.	.	.	Q	61;50	.	.	R	+	2	0	AC069154.2	120099724	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.822000	0.00357	-4.381000	0.00053	-1.114000	0.02060	CGA		PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464236.1		
PDCD1LG2	80380	hgsc.bcm.edu	37	9	5534898	5534898	+	Missense_Mutation	SNP	G	G	A	rs146192984		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr9:5534898G>A	ENST00000397747.3	+	3	457	c.209G>A	c.(208-210)cGt>cAt	p.R70H	PDCD1LG2_ENST00000397745.2_Missense_Mutation_p.R70H	NM_025239.3	NP_079515.2	Q9BQ51	PD1L2_HUMAN	programmed cell death 1 ligand 2	70	Ig-like V-type.				immune response (GO:0006955)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R70H(1)		large_intestine(2)|lung(4)|prostate(2)	8	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000767)|Lung(218;0.112)		TCCCCACACCGTGAAAGAGCC	0.498																																					p.R70H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G209A	9						.	G	HIS/ARG	0,4406		0,0,2203	101.0	88.0	93.0		209	3.8	0.0	9	dbSNP_134	93	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PDCD1LG2	NM_025239.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	70/274	5534898	1,13005	2203	4300	6503	5524898	SO:0001583	missense	80380	exon3			AF344424	CCDS6465.1	9p24.2	2014-01-30			ENSG00000197646	ENSG00000197646		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	18731	protein-coding gene	gene with protein product	"""B7 dendritic cell molecule"""	605723				11224527	Standard	NM_025239		Approved	PD-L2, Btdc, PDL2, bA574F11.2, CD273, B7-DC	uc003zjg.4	Q9BQ51	OTTHUMG00000019504	ENST00000397747.3:c.209G>A	9.37:g.5534898G>A	ENSP00000380855:p.Arg70His	Somatic		Capture	SOLID	Phase_I	5524898	NM_025239	Q14CN8|Q5T7Z6|Q6JXL8|Q6JXL9	Missense_Mutation	SNP	ENST00000397747.3	37	CCDS6465.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.339836	0.24339	0.0	1.16E-4	ENSG00000197646	ENST00000397745;ENST00000397747	T;T	0.12984	2.63;2.63	5.73	3.82	0.43975	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.318200	0.04769	N	0.427725	T	0.19366	0.0465	L	0.29908	0.895	0.09310	N	1	D;D;D;D;D	0.71674	0.977;0.992;0.998;0.957;0.992	P;P;P;P;P	0.53649	0.493;0.59;0.731;0.481;0.59	T	0.15178	-1.0446	10	0.49607	T	0.09	-12.4626	6.4576	0.21938	0.1061:0.2015:0.6924:0.0	.	59;70;70;70;70	Q2LC89;A4GW21;Q9BQ51-3;Q9BQ51-2;Q9BQ51	.;.;.;.;PD1L2_HUMAN	H	70	ENSP00000380853:R70H;ENSP00000380855:R70H	ENSP00000380853:R70H	R	+	2	0	PDCD1LG2	5524898	0.000000	0.05858	0.030000	0.17652	0.040000	0.13550	-0.156000	0.10100	0.684000	0.31448	-0.311000	0.09066	CGT		PDCD1LG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051634.1	NM_025239	
POMT1	10585	hgsc.bcm.edu	37	9	134385419	134385419	+	Silent	SNP	C	C	G			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr9:134385419C>G	ENST00000372228.3	+	8	914	c.735C>G	c.(733-735)gcC>gcG	p.A245A	POMT1_ENST00000404875.2_Intron|POMT1_ENST00000541219.1_Intron|POMT1_ENST00000354713.4_Intron|POMT1_ENST00000402686.3_Intron|POMT1_ENST00000423007.1_Intron|POMT1_ENST00000341012.7_Intron|POMT1_ENST00000419118.2_Intron	NM_007171.3	NP_009102	Q9Y6A1	POMT1_HUMAN	protein-O-mannosyltransferase 1	245					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|mannosylation (GO:0097502)|multicellular organismal development (GO:0007275)|protein O-linked glycosylation (GO:0006493)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|sarcoplasmic reticulum (GO:0016529)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannosyltransferase activity (GO:0000030)|metal ion binding (GO:0046872)	p.A245A(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	31		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.65e-05)|Epithelial(140;0.000259)		TGAGGCCGGCCTGTATGGGGC	0.567																																					p.A245A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C735G	9						.						84.0	71.0	75.0					9																	134385419		2203	4300	6503	133375240	SO:0001819	synonymous_variant	10585	exon8			AF095136	CCDS6943.1, CCDS43894.1, CCDS43895.1, CCDS48045.1	9q34.1	2014-09-17			ENSG00000130714	ENSG00000130714	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	9202	protein-coding gene	gene with protein product	"""dolichyl-phosphate-mannose-protein mannosyltransferase"""	607423				10366449	Standard	NM_001077366		Approved	LGMD2K	uc004cav.3	Q9Y6A1	OTTHUMG00000020826	ENST00000372228.3:c.735C>G	9.37:g.134385419C>G		Somatic		Capture	SOLID	Phase_I	133375240	NM_007171	B3KQG0|B4DIF0|Q5JT01|Q5JT06|Q5JT08|Q8NC91|Q8TCA9|Q9NX32|Q9NX82|Q9UNT2	Silent	SNP	ENST00000372228.3	37	CCDS6943.1																																																																																				POMT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054737.1	NM_007171	
SLITRK1	114798	hgsc.bcm.edu	37	13	84455253	84455253	+	Silent	SNP	G	G	A	rs370805552		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr13:84455253G>A	ENST00000377084.2	-	1	1275	c.390C>T	c.(388-390)gaC>gaT	p.D130D		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	130					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.D130D(2)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		ATTCCAGATCGTCCAGCCCCA	0.473																																					p.D130D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C390T	13						.	G		1,4405	2.1+/-5.4	0,1,2202	63.0	68.0	67.0		390	3.6	1.0	13		67	0,8600		0,0,4300	no	coding-synonymous	SLITRK1	NM_052910.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		130/697	84455253	1,13005	2203	4300	6503	83353254	SO:0001819	synonymous_variant	114798	exon1			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.390C>T	13.37:g.84455253G>A		Somatic		Capture	SOLID	Phase_I	83353254	NM_052910	Q5U5I6|Q96SF9	Silent	SNP	ENST00000377084.2	37	CCDS9464.1																																																																																				SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
C10orf90	118611	hgsc.bcm.edu	37	10	128118366	128118366	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr10:128118366G>A	ENST00000284694.7	-	7	2071	c.1951C>T	c.(1951-1953)Cga>Tga	p.R651*	C10orf90_ENST00000454341.1_Nonsense_Mutation_p.R554*|C10orf90_ENST00000544758.1_Nonsense_Mutation_p.R748*|C10orf90_ENST00000480379.1_Nonsense_Mutation_p.R55*|C10orf90_ENST00000356858.3_Nonsense_Mutation_p.R604*	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	651	ALMS motif. {ECO:0000250}.				mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.R651*(2)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		CTCTTAGATCGCATATGCATC	0.438																																					p.R651X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|lung(1)	c.C1951T	10						.						247.0	221.0	230.0					10																	128118366		2203	4300	6503	128108356	SO:0001587	stop_gained	118611	exon7			BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.1951C>T	10.37:g.128118366G>A	ENSP00000284694:p.Arg651*	Somatic		Capture	SOLID	Phase_I	128108356	NM_001004298	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Nonsense_Mutation	SNP	ENST00000284694.7	37	CCDS31310.1	.	.	.	.	.	.	.	.	.	.	G	38	7.077197	0.98048	.	.	ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642	.	.	.	4.78	0.18	0.15068	.	0.000000	0.38548	N	0.001652	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.4571	13.2486	0.60039	0.0:0.0:0.3798:0.6202	.	.	.	.	X	604;651;554;748;651	.	ENSP00000284694:R651X	R	-	1	2	C10orf90	128108356	0.994000	0.37717	0.997000	0.53966	0.988000	0.76386	0.130000	0.15850	0.124000	0.18369	0.655000	0.94253	CGA		C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
APC	324	hgsc.bcm.edu	37	5	112164616	112164616	+	Nonsense_Mutation	SNP	C	C	T	rs137854574		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr5:112164616C>T	ENST00000457016.1	+	14	2070	c.1690C>T	c.(1690-1692)Cga>Tga	p.R564*	APC_ENST00000257430.4_Nonsense_Mutation_p.R564*|APC_ENST00000508376.2_Nonsense_Mutation_p.R564*|CTC-554D6.1_ENST00000520401.1_Silent_p.C59C			P25054	APC_HUMAN	adenomatous polyposis coli	564	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R564*(14)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAAGACGTTGCGAGAAGTTGG	0.313		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R546X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0	.	15	Substitution - Nonsense(14)|Unknown(1)	large_intestine(14)|skin(1)	c.C1636T	5	GRCh37	CM920035	APC	M	rs137854574	.						126.0	137.0	134.0					5																	112164616		2202	4300	6502	112192515	SO:0001587	stop_gained	324	exon12	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1690C>T	5.37:g.112164616C>T	ENSP00000413133:p.Arg564*	Somatic		Capture	SOLID	Phase_I	112192515	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	40	7.921767	0.98563	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.62	4.73	0.59995	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.3959	14.5777	0.68262	0.2726:0.7274:0.0:0.0	.	.	.	.	X	564;546;564;564;564	.	ENSP00000257430:R564X	R	+	1	2	APC	112192515	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.526000	0.45607	1.313000	0.45069	0.655000	0.94253	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	hgsc.bcm.edu	37	5	112175639	112175639	+	Nonsense_Mutation	SNP	C	C	T	rs121913332		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr5:112175639C>T	ENST00000457016.1	+	16	4728	c.4348C>T	c.(4348-4350)Cga>Tga	p.R1450*	APC_ENST00000257430.4_Nonsense_Mutation_p.R1450*|APC_ENST00000508376.2_Nonsense_Mutation_p.R1450*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1450	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1450*(153)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.R1450fs*22(1)|p.S1436fs*22(1)|p.R1450fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAAACCAAGCGAGAAGTACC	0.478	R1450*(LS123_LARGE_INTESTINE)|R1450*(MKN74_STOMACH)|R1450*(SW1417_LARGE_INTESTINE)|R1450*(SW837_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1432X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,rectum,Substitution - Nonsense,0	.	159	Substitution - Nonsense(153)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(136)|stomach(13)|soft_tissue(4)|small_intestine(3)|endometrium(1)|skin(1)|pancreas(1)	c.C4294T	5	GRCh37	CM930030	APC	M	rs121913332	.						102.0	90.0	94.0					5																	112175639		2202	4300	6502	112203538	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4348C>T	5.37:g.112175639C>T	ENSP00000413133:p.Arg1450*	Somatic		Capture	SOLID	Phase_I	112203538	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.651223	0.98901	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	4.2	0.49525	.	0.600559	0.18052	N	0.153248	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.0649	14.037	0.64651	0.426:0.574:0.0:0.0	.	.	.	.	X	1450	.	.	R	+	1	2	APC	112203538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.171000	0.50824	1.564000	0.49628	0.655000	0.94253	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
GRAMD3	65983	hgsc.bcm.edu	37	5	125820113	125820113	+	Silent	SNP	C	C	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr5:125820113C>A	ENST00000285689.3	+	10	1328	c.867C>A	c.(865-867)tcC>tcA	p.S289S	GRAMD3_ENST00000543198.1_Silent_p.S267S|GRAMD3_ENST00000502348.1_Silent_p.S180S|RP11-517I3.1_ENST00000512500.1_RNA|GRAMD3_ENST00000511134.1_Silent_p.S273S|GRAMD3_ENST00000542322.1_Silent_p.S297S|GRAMD3_ENST00000515200.1_Silent_p.S267S|GRAMD3_ENST00000513040.1_Silent_p.S304S|GRAMD3_ENST00000544396.1_Silent_p.S185S|RP11-517I3.1_ENST00000515808.1_RNA	NM_023927.2	NP_076416.2	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3	289						cytoplasmic microtubule (GO:0005881)		p.S289S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		CGACAGAATCCCAAACAGTTC	0.443																																					p.S289S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C867A	5						.						114.0	106.0	109.0					5																	125820113		2203	4300	6503	125848012	SO:0001819	synonymous_variant	65983	exon10			BC008590	CCDS4136.1, CCDS54891.1, CCDS54892.1, CCDS54893.1, CCDS54894.1	5q23.2	2014-02-12	2005-11-03		ENSG00000155324	ENSG00000155324			24911	protein-coding gene	gene with protein product	"""HCV NS3 transactivated protein 2"""					12477932	Standard	NM_023927		Approved	NS3TP2, FLJ21313	uc011cwt.2	Q96HH9	OTTHUMG00000128943	ENST00000285689.3:c.867C>A	5.37:g.125820113C>A		Somatic		Capture	SOLID	Phase_I	125848012	NM_023927	B7Z1F2|B7Z3R1|B7Z6D8|B7Z8T2|D3DSZ3|Q9H753	Silent	SNP	ENST00000285689.3	37	CCDS4136.1																																																																																				GRAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250922.2	NM_023927	
DNAH5	1767	hgsc.bcm.edu	37	5	13901432	13901432	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr5:13901432G>A	ENST00000265104.4	-	14	2085	c.1981C>T	c.(1981-1983)Cgc>Tgc	p.R661C		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	661	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R661C(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTGTAACTGCGAATTATAGGT	0.532									Kartagener syndrome																												p.R661C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1981T	5						.						75.0	72.0	73.0					5																	13901432		2203	4300	6503	13954432	SO:0001583	missense	1767	exon14	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.1981C>T	5.37:g.13901432G>A	ENSP00000265104:p.Arg661Cys	Somatic		Capture	SOLID	Phase_I	13954432	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	19.59	3.855940	0.71834	.	.	ENSG00000039139	ENST00000265104	T	0.57107	0.42	5.55	5.55	0.83447	Dynein heavy chain, domain-1 (1);	0.126361	0.53938	D	0.000052	T	0.75474	0.3854	M	0.83384	2.64	0.58432	D	0.999998	D	0.76494	0.999	D	0.67725	0.953	T	0.78929	-0.2010	10	0.87932	D	0	.	19.4947	0.95067	0.0:0.0:1.0:0.0	.	661	Q8TE73	DYH5_HUMAN	C	661	ENSP00000265104:R661C	ENSP00000265104:R661C	R	-	1	0	DNAH5	13954432	1.000000	0.71417	0.998000	0.56505	0.626000	0.37791	5.914000	0.69964	2.622000	0.88805	0.491000	0.48974	CGC		DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
CHSY3	337876	hgsc.bcm.edu	37	5	129520782	129520782	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr5:129520782G>T	ENST00000305031.4	+	3	2305	c.1947G>T	c.(1945-1947)aaG>aaT	p.K649N		NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	649					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.K649N(1)		central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		TTATCCCAAAGCAGAATGTAA	0.398																																					p.K649N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1947T	5						.						78.0	80.0	80.0					5																	129520782		2203	4300	6503	129548681	SO:0001583	missense	337876	exon3			AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.1947G>T	5.37:g.129520782G>T	ENSP00000302629:p.Lys649Asn	Somatic		Capture	SOLID	Phase_I	129548681	NM_175856	B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	ENST00000305031.4	37	CCDS34223.1	.	.	.	.	.	.	.	.	.	.	G	1.470	-0.560151	0.03967	.	.	ENSG00000198108	ENST00000305031	T	0.34275	1.37	4.12	2.29	0.28610	.	0.320592	0.26387	N	0.024671	T	0.10423	0.0255	N	0.01168	-0.975	0.43947	D	0.996615	B	0.09022	0.002	B	0.14023	0.01	T	0.08391	-1.0724	9	.	.	.	-7.9195	5.4618	0.16622	0.086:0.1439:0.622:0.1481	.	649	Q70JA7	CHSS3_HUMAN	N	649	ENSP00000302629:K649N	.	K	+	3	2	CHSY3	129548681	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.599000	0.36751	0.646000	0.30693	0.650000	0.86243	AAG		CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	NM_175856	
CDH12	1010	hgsc.bcm.edu	37	5	22078626	22078626	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr5:22078626G>A	ENST00000382254.1	-	5	1246	c.160C>T	c.(160-162)Cgt>Tgt	p.R54C	CDH12_ENST00000522262.1_Missense_Mutation_p.R54C|CDH12_ENST00000504376.2_Missense_Mutation_p.R54C	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	54					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R54C(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						ACCCAGCCACGTTTAACACGT	0.468										HNSCC(59;0.17)																											p.R54C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C160T	5						.						165.0	162.0	163.0					5																	22078626		2203	4300	6503	22114383	SO:0001583	missense	1010	exon5			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.160C>T	5.37:g.22078626G>A	ENSP00000371689:p.Arg54Cys	Somatic		Capture	SOLID	Phase_I	22114383	NM_004061	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345761	0.82022	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.00587	6.38;6.38;6.38	5.5	5.5	0.81552	.	0.049688	0.85682	D	0.000000	T	0.03695	0.0105	M	0.84082	2.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.99	T	0.31916	-0.9926	10	0.87932	D	0	.	19.3983	0.94617	0.0:0.0:1.0:0.0	.	54;54	B7Z2U6;P55289	.;CAD12_HUMAN	C	54	ENSP00000423577:R54C;ENSP00000371689:R54C;ENSP00000428786:R54C	ENSP00000371689:R54C	R	-	1	0	CDH12	22114383	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.778000	0.75043	2.596000	0.87737	0.650000	0.86243	CGT		CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061	
SLC45A2	51151	hgsc.bcm.edu	37	5	33947428	33947428	+	Missense_Mutation	SNP	G	G	A	rs141286272		TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr5:33947428G>A	ENST00000296589.4	-	6	1354	c.1208C>T	c.(1207-1209)aCg>aTg	p.T403M	SLC45A2_ENST00000342059.3_Missense_Mutation_p.T344M|SLC45A2_ENST00000382102.3_Missense_Mutation_p.T403M	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	403					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.T403M(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						CAAATATCCCGTGAAGTAAAG	0.478																																					p.T403M	Ovarian(31;380 859 8490 22203 49048)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1208T	5						.	G	MET/THR,MET/THR	0,4406		0,0,2203	123.0	124.0	124.0		1208,1208	3.1	1.0	5	dbSNP_134	124	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SLC45A2	NM_001012509.2,NM_016180.3	81,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	403/461,403/531	33947428	1,13005	2203	4300	6503	33983185	SO:0001583	missense	51151	exon6			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.1208C>T	5.37:g.33947428G>A	ENSP00000296589:p.Thr403Met	Somatic		Capture	SOLID	Phase_I	33983185	NM_001012509	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000296589.4	37	CCDS3901.1	.	.	.	.	.	.	.	.	.	.	G	7.409	0.634336	0.14322	0.0	1.16E-4	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102;ENST00000510600	D;D;D;D	0.92595	-3.07;-3.07;-3.07;-3.07	5.62	3.1	0.35709	Major facilitator superfamily domain, general substrate transporter (1);	0.480130	0.26859	N	0.022138	T	0.72700	0.3493	N	0.00563	-1.375	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.15484	0.003;0.013	T	0.61058	-0.7139	10	0.23891	T	0.37	-3.2104	8.9213	0.35612	0.8317:0.0:0.1683:0.0	.	403;403	Q9UMX9-4;Q9UMX9	.;S45A2_HUMAN	M	403;344;403;228	ENSP00000296589:T403M;ENSP00000341014:T344M;ENSP00000371534:T403M;ENSP00000424010:T228M	ENSP00000296589:T403M	T	-	2	0	SLC45A2	33983185	0.985000	0.35326	0.984000	0.44739	0.966000	0.64601	2.443000	0.44881	0.352000	0.24053	-0.345000	0.07892	ACG		SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180	
NAIP	4671	hgsc.bcm.edu	37	5	70308414	70308414	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr5:70308414G>A	ENST00000517649.1	-	4	619	c.329C>T	c.(328-330)aCg>aTg	p.T110M	NAIP_ENST00000503719.2_Intron|NAIP_ENST00000194097.4_Missense_Mutation_p.T110M|NAIP_ENST00000508426.2_Missense_Mutation_p.T110M|NAIP_ENST00000523981.1_Intron	NM_004536.2	NP_004527.2	Q13075	BIRC1_HUMAN	NLR family, apoptosis inhibitory protein	110					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|metal ion binding (GO:0046872)	p.T110M(1)		central_nervous_system(1)	1		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		GGGGAGTCTCGTGAGGCCGGC	0.493																																					p.T110M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C329T	5						.						103.0	93.0	96.0					5																	70308414		2202	4296	6498	70344170	SO:0001583	missense	4671	exon4			U19251	CCDS4009.1, CCDS43327.1	5q13.2	2010-06-16	2006-12-08	2006-12-08	ENSG00000249437	ENSG00000249437		"""Baculoviral IAP repeat containing"", ""Nucleotide-binding domain and leucine rich repeat containing"""	7634	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and BIR domain containing 1"", ""NLR family, BIR domain containing 1"""	600355	"""baculoviral IAP repeat-containing 1"""	BIRC1		7813013	Standard	NM_022892		Approved	NLRB1	uc003jyj.1	Q13075	OTTHUMG00000163318	ENST00000517649.1:c.329C>T	5.37:g.70308414G>A	ENSP00000428657:p.Thr110Met	Somatic		Capture	SOLID	Phase_I	70344170	NM_004536	B9EG72|E9PHD1|O75857|Q13730|Q59GI6|Q8TDZ4|Q99796	Missense_Mutation	SNP	ENST00000517649.1	37	CCDS4009.1	.	.	.	.	.	.	.	.	.	.	g	5.394	0.257822	0.10239	.	.	ENSG00000249437	ENST00000517649;ENST00000194097;ENST00000508426	T;T;T	0.73047	-0.71;-0.71;-0.71	3.26	-3.59	0.04583	Baculoviral inhibition of apoptosis protein repeat (5);	1.536970	0.06402	U	0.719039	T	0.57902	0.2085	L	0.45352	1.415	0.09310	N	1	P;P	0.50710	0.876;0.938	B;B	0.41088	0.062;0.347	T	0.53947	-0.8366	10	0.36615	T	0.2	.	6.8408	0.23961	0.0:0.4019:0.1208:0.4773	.	110;110	E7EQW0;Q13075	.;BIRC1_HUMAN	M	110	ENSP00000428657:T110M;ENSP00000443944:T110M;ENSP00000429545:T110M	ENSP00000443944:T110M	T	-	2	0	NAIP	70344170	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-0.777000	0.04669	-0.898000	0.03906	-2.072000	0.00384	ACG		NAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372649.6	NM_004536	
RASGRF2	5924	hgsc.bcm.edu	37	5	80409417	80409417	+	Silent	SNP	C	C	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr5:80409417C>A	ENST00000265080.4	+	15	2215	c.2148C>A	c.(2146-2148)ggC>ggA	p.G716G	CTD-2193P3.2_ENST00000508993.1_RNA	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	716	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G716G(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TGGTGGATGGCAAATCCCCAC	0.478																																					p.G716G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2148A	5						.						102.0	104.0	103.0					5																	80409417		2203	4300	6503	80445173	SO:0001819	synonymous_variant	5924	exon15			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.2148C>A	5.37:g.80409417C>A		Somatic		Capture	SOLID	Phase_I	80445173	NM_006909	B9EG89|Q9UK56	Silent	SNP	ENST00000265080.4	37	CCDS4052.1																																																																																				RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909	
DOCK2	1794	hgsc.bcm.edu	37	5	169461458	169461458	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00D-01A-01W-A005-10	TCGA-AA-A00D-10A-01W-A005-10	g.chr5:169461458G>A	ENST00000256935.8	+	35	3603	c.3523G>A	c.(3523-3525)Gtg>Atg	p.V1175M	DOCK2_ENST00000540750.1_Missense_Mutation_p.V236M|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.V667M	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1175	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.V1175M(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGAGAACTTCGTGAACCTGGT	0.567																																					p.V1175M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3523A	5						.						110.0	105.0	106.0					5																	169461458		2203	4300	6503	169394036	SO:0001583	missense	1794	exon35			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3523G>A	5.37:g.169461458G>A	ENSP00000256935:p.Val1175Met	Somatic		Capture	SOLID	Phase_I	169394036	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	G	34	5.367267	0.95900	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.53640	0.61;0.61;0.61	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.54271	0.1848	M	0.72118	2.19	0.58432	D	0.999994	D;P	0.61697	0.99;0.844	B;B	0.44044	0.439;0.168	T	0.61426	-0.7065	10	0.59425	D	0.04	.	19.2876	0.94085	0.0:0.0:1.0:0.0	.	667;1175	E7ERW7;Q92608	.;DOCK2_HUMAN	M	1175;667;236	ENSP00000256935:V1175M;ENSP00000429283:V667M;ENSP00000438827:V236M	ENSP00000256935:V1175M	V	+	1	0	DOCK2	169394036	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.508000	0.98000	2.656000	0.90262	0.655000	0.94253	GTG		DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
