#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ASXL1	171023	hgsc.bcm.edu	37	20	31024448	31024449	+	Frame_Shift_Ins	INS	-	-	G	rs143779557	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:31024448_31024449insG	ENST00000375687.4	+	13	4357_4358	c.3933_3934insG	c.(3934-3936)gcafs	p.A1312fs	ASXL1_ENST00000306058.5_Frame_Shift_Ins_p.A1307fs	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1312					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.A1312fs*17(1)|p.A1312S(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						GGAATGTGGCTGCAACCCTTCA	0.564			"""F, N, Mis"""		"""MDS, CMML"""																																p.A1311fs			Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	.	2	Substitution - Missense(1)|Insertion - Frameshift(1)	large_intestine(1)|lung(1)	c.3933_3934insG	20						.																																			30488110	SO:0001589	frameshift_variant	171023	exon12			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.3934dupG	20.37:g.31024449_31024449dupG	ENSP00000364839:p.Ala1312fs	Somatic		Capture	SOLID	Phase_I	30488109	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Frame_Shift_Ins	INS	ENST00000375687.4	37	CCDS13201.1																																																																																				ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
SNAP29	9342	hgsc.bcm.edu	37	22	21224735	21224736	+	Frame_Shift_Ins	INS	-	-	G	rs113637255		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr22:21224735_21224736insG	ENST00000215730.7	+	2	476_477	c.348_349insG	c.(349-351)gggfs	p.G117fs		NM_004782.3	NP_004773.1	O95721	SNP29_HUMAN	synaptosomal-associated protein, 29kDa	117					autophagic vacuole fusion (GO:0000046)|exocytosis (GO:0006887)|membrane fusion (GO:0061025)|protein transport (GO:0015031)|vesicle targeting (GO:0006903)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|synapse (GO:0045202)	SNAP receptor activity (GO:0005484)	p.L119fs*15(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(1)|upper_aerodigestive_tract(1)	9	all_cancers(11;2.77e-25)|all_epithelial(7;8.92e-24)|Lung NSC(8;1.49e-15)|all_lung(8;2.54e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000592)|Lung(15;0.0117)			AGAGCGTGTTTGGGGGGCTGGT	0.505																																					p.F116fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.348_349insG	22						.			1,4263		0,1,2131						1.0	1.0			99	0,8254		0,0,4127	no	frameshift	SNAP29	NM_004782.3		0,1,6258	A1A1,A1R,RR		0.0,0.0235,0.0080				1,12517				19554736	SO:0001589	frameshift_variant	9342	exon2			AF115436	CCDS13784.1	22q11.21	2008-06-10	2002-08-29		ENSG00000099940	ENSG00000099940			11133	protein-coding gene	gene with protein product	"""soluble 29 kDa NSF attachment protein"""	604202	"""synaptosomal-associated protein, 29kD"""			9852078, 10591208	Standard	NM_004782		Approved	SNAP-29, CEDNIK	uc011ahw.2	O95721	OTTHUMG00000150765	ENST00000215730.7:c.354dupG	22.37:g.21224741_21224741dupG	ENSP00000215730:p.Gly117fs	Somatic		Capture	SOLID	Phase_I	19554735	NM_004782		Frame_Shift_Ins	INS	ENST00000215730.7	37	CCDS13784.1																																																																																				SNAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320000.4	NM_004782	
BTBD7	55727	hgsc.bcm.edu	37	14	93762344	93762345	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr14:93762344_93762345insC	ENST00000334746.5	-	2	360_361	c.53_54insG	c.(52-54)ggafs	p.G18fs	BTBD7_ENST00000554565.1_Intron|BTBD7_ENST00000298896.3_Frame_Shift_Ins_p.G18fs|BTBD7_ENST00000393170.2_5'Flank|BTBD7_ENST00000555525.1_Frame_Shift_Ins_p.G18fs	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	18					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)		p.N19fs*27(2)		breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		CCTGTGAATTTCCCCCTACCCT	0.396																																					p.G18fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.54_55insG	14						.																																			92832098	SO:0001589	frameshift_variant	55727	exon2			AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.54dupG	14.37:g.93762349_93762349dupC	ENSP00000335615:p.Gly18fs	Somatic		Capture	SOLID	Phase_I	92832097	NM_001002860	A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Frame_Shift_Ins	INS	ENST00000334746.5	37	CCDS32146.1																																																																																				BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	NM_001002860	
NCAPD3	23310	hgsc.bcm.edu	37	11	134048585	134048586	+	Frame_Shift_Ins	INS	-	-	G	rs138442478		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:134048585_134048586insG	ENST00000534548.2	-	22	2789_2790	c.2725_2726insC	c.(2725-2727)cagfs	p.Q909fs	RP11-700F16.3_ENST00000531710.1_RNA	NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	909					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)	p.Q909fs*12(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		ACCTCTGACCTGGGGGGGTGGC	0.525																																					p.Q909fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2726_2727insC	11						.																																			133553796	SO:0001589	frameshift_variant	23310	exon22			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.2726dupC	11.37:g.134048592_134048592dupG	ENSP00000433681:p.Gln909fs	Somatic		Capture	SOLID	Phase_I	133553795	NM_015261	A6NFS2|Q4KMQ9	Frame_Shift_Ins	INS	ENST00000534548.2	37	CCDS31723.1																																																																																				NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
XYLT2	64132	hgsc.bcm.edu	37	17	48433966	48433967	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:48433966_48433967insC	ENST00000017003.2	+	8	1626_1627	c.1577_1578insC	c.(1576-1581)taccccfs	p.YP526fs	XYLT2_ENST00000507602.1_Frame_Shift_Ins_p.YP526fs	NM_022167.2	NP_071450.2	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	526					chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.G529fs*17(1)		endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(2)|urinary_tract(1)	12	Breast(11;7.18e-19)					TATGGCAGCTACCCCCCCGGCA	0.604																																					p.Y526fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1577_1578insC	17						.																																			45788966	SO:0001589	frameshift_variant	64132	exon8			AJ277442	CCDS11563.1	17q21.33	2013-02-25			ENSG00000015532	ENSG00000015532	2.4.2.26		15517	protein-coding gene	gene with protein product	"""protein xylosyltransferase 2"""	608125				11099377	Standard	NM_022167		Approved	XT-II, PXYLT2	uc002iqo.3	Q9H1B5	OTTHUMG00000162057	ENST00000017003.2:c.1584dupC	17.37:g.48433973_48433973dupC	ENSP00000017003:p.Tyr526fs	Somatic		Capture	SOLID	Phase_I	45788965	NM_022167	Q6UY41|Q86V00	Frame_Shift_Ins	INS	ENST00000017003.2	37	CCDS11563.1																																																																																				XYLT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367046.1	NM_022167	
MAPKBP1	23005	hgsc.bcm.edu	37	15	42107495	42107496	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:42107495_42107496insC	ENST00000456763.2	+	12	1423_1424	c.1227_1228insC	c.(1228-1230)cccfs	p.P410fs	MAPKBP1_ENST00000514566.1_Frame_Shift_Ins_p.P404fs|MAPKBP1_ENST00000260357.7_Intron|MAPKBP1_ENST00000457542.2_Frame_Shift_Ins_p.P404fs|MAPKBP1_ENST00000221214.6_Frame_Shift_Ins_p.P287fs	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	410								p.S406fs*35(1)		breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		AGGCCTGCCTGCCCCCCAGTTC	0.584																																					p.L409fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1227_1228insC	15						.																																			39894788	SO:0001589	frameshift_variant	23005	exon12			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.1233dupC	15.37:g.42107501_42107501dupC	ENSP00000393099:p.Pro410fs	Somatic		Capture	SOLID	Phase_I	39894787	NM_001128608	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Frame_Shift_Ins	INS	ENST00000456763.2	37	CCDS45239.1																																																																																				MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
CNKSR2	22866	hgsc.bcm.edu	37	X	21545086	21545087	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:21545086_21545087insC	ENST00000379510.3	+	10	1095_1096	c.1059_1060insC	c.(1060-1062)cccfs	p.P354fs	CNKSR2_ENST00000279451.4_Frame_Shift_Ins_p.P354fs|CNKSR2_ENST00000425654.2_Frame_Shift_Ins_p.P354fs|CNKSR2_ENST00000543067.1_Frame_Shift_Ins_p.P305fs	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	354	DUF1170.|Poly-Pro.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.P356fs*11(1)		breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						ATCTCTACATTCCCCCTCCTCC	0.475																																					p.I304fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.912_913insC	X						.																																			21455008	SO:0001589	frameshift_variant	22866	exon9			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.1064dupC	X.37:g.21545091_21545091dupC	ENSP00000368824:p.Pro354fs	Somatic		Capture	SOLID	Phase_I	21455007	NM_001168649	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Frame_Shift_Ins	INS	ENST00000379510.3	37	CCDS14198.1																																																																																				CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
CEP135	9662	hgsc.bcm.edu	37	4	56885563	56885564	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:56885563_56885564insA	ENST00000257287.4	+	23	3181_3182	c.3057_3058insA	c.(3058-3060)aaafs	p.K1020fs		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	1020					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)	p.Q1022fs*5(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					CAGACCTACTGAAAAAACAACT	0.332																																					p.L1019fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.3057_3058insA	4						.																																			56580321	SO:0001589	frameshift_variant	9662	exon23			AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.3063dupA	4.37:g.56885569_56885569dupA	ENSP00000257287:p.Lys1020fs	Somatic		Capture	SOLID	Phase_I	56580320	NM_025009	B2RMY0|O75130|Q58F25|Q9H8H7	Frame_Shift_Ins	INS	ENST00000257287.4	37	CCDS33986.1																																																																																				CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	
COL5A1	1289	hgsc.bcm.edu	37	9	137693828	137693829	+	Frame_Shift_Ins	INS	-	-	C	rs377265020		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:137693828_137693829insC	ENST00000371817.3	+	38	3395_3396	c.2981_2982insC	c.(2980-2985)ggccccfs	p.GP994fs		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	994	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.G997fs*17(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GGCCCTCCAGGCCCCCCCGGCG	0.658																																					p.G994fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2981_2982insC	9						.																																			136833650	SO:0001589	frameshift_variant	1289	exon38			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.2988dupC	9.37:g.137693835_137693835dupC	ENSP00000360882:p.Gly994fs	Somatic		Capture	SOLID	Phase_I	136833649	NM_000093	Q15094|Q5SUX4	Frame_Shift_Ins	INS	ENST00000371817.3	37	CCDS6982.1																																																																																				COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
VPS13A	23230	hgsc.bcm.edu	37	9	79946936	79946937	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:79946936_79946937insT	ENST00000360280.3	+	46	6262_6263	c.6002_6003insT	c.(6001-6006)cattttfs	p.HF2001fs	VPS13A_ENST00000376636.3_Frame_Shift_Ins_p.HF1962fs|VPS13A_ENST00000376634.4_Frame_Shift_Ins_p.HF2001fs|VPS13A_ENST00000357409.5_Frame_Shift_Ins_p.HF2001fs	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	2001					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)		p.S2003fs*19(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ATAAGAAATCATTTTTCAGTCC	0.317																																					p.H2001fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.6002_6003insT	9						.																																			79136757	SO:0001589	frameshift_variant	23230	exon46			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.6007dupT	9.37:g.79946941_79946941dupT	ENSP00000353422:p.His2001fs	Somatic		Capture	SOLID	Phase_I	79136756	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Frame_Shift_Ins	INS	ENST00000360280.3	37	CCDS6655.1																																																																																				VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
ENOX1	55068	hgsc.bcm.edu	37	13	43935419	43935420	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:43935419_43935420insT	ENST00000261488.6	-	6	954_955	c.377_378insA	c.(376-378)aatfs	p.N126fs	ENOX1_ENST00000412891.1_Frame_Shift_Ins_p.N126fs|ENOX1_ENST00000540032.1_5'Flank|ENOX1_ENST00000482207.1_5'UTR	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	126	Pro-rich.				rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)	p.N126fs*17(2)		breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		ACTTACTTGGATTTTGAGGAAA	0.376																																					p.N126fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.378_379insA	13						.																																			42833420	SO:0001589	frameshift_variant	55068	exon6			EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.378dupA	13.37:g.43935423_43935423dupT	ENSP00000261488:p.Asn126fs	Somatic		Capture	SOLID	Phase_I	42833419	NM_001127615	A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Frame_Shift_Ins	INS	ENST00000261488.6	37	CCDS9389.1																																																																																				ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044717.2	NM_017993	
HPS1	3257	hgsc.bcm.edu	37	10	100186986	100186987	+	Frame_Shift_Ins	INS	-	-	G	rs281865082|rs281865083		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:100186986_100186987insG	ENST00000325103.6	-	11	1205_1206	c.972_973insC	c.(970-975)cccatgfs	p.M325fs	HPS1_ENST00000467246.1_5'UTR|HPS1_ENST00000361490.4_Frame_Shift_Ins_p.M325fs	NM_000195.3	NP_000186.2	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1	325					blood coagulation (GO:0007596)|eye pigmentation (GO:0048069)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of natural killer cell activation (GO:0032816)|retina development in camera-type eye (GO:0060041)|secretion of lysosomal enzymes (GO:0033299)|visual perception (GO:0007601)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	protein dimerization activity (GO:0046983)	p.M325fs*128(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		AGGGCATCCATGGGGGGGGTGC	0.574									Hermansky-Pudlak syndrome																												p.M325fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.973_974insC	10	GRCh37	CD982691|CI962292	HPS1	D|I		.			33,3769		3,27,1871						1.7	0.2			27	89,7175		13,63,3556	no	frameshift	HPS1	NM_000195.3		16,90,5427	A1A1,A1R,RR		1.2252,0.868,1.1025				122,10944				100176977	SO:0001589	frameshift_variant	3257	exon11	Familial Cancer Database	HPS, HPS1-8	U79136	CCDS7475.1, CCDS7476.1	10q23.1-q23.3	2014-06-18		2002-05-01	ENSG00000107521	ENSG00000107521			5163	protein-coding gene	gene with protein product		604982	"""Hermansky-Pudlak syndrome"""	HPS		8541858, 7573033	Standard	NM_182639		Approved		uc021pwv.1	Q92902	OTTHUMG00000018876	ENST00000325103.6:c.973dupC	10.37:g.100186994_100186994dupG	ENSP00000326649:p.Met325fs	Somatic		Capture	SOLID	Phase_I	100176976	NM_000195	A8MRT2|O15402|O15502|Q5TAA3|Q8WXE5	Frame_Shift_Ins	INS	ENST00000325103.6	37	CCDS7475.1																																																																																				HPS1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049776.1	NM_000195, NM_182637, NM_182638, NM_182639	
LRRC20	55222	hgsc.bcm.edu	37	10	72061117	72061118	+	Frame_Shift_Ins	INS	-	-	G	rs149973737		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:72061117_72061118insG	ENST00000355790.4	-	5	1024_1025	c.547_548insC	c.(547-549)ctafs	p.L183fs	LRRC20_ENST00000358141.2_Frame_Shift_Ins_p.L133fs|LRRC20_ENST00000395011.1_Frame_Shift_Ins_p.L133fs|LRRC20_ENST00000395010.1_Frame_Shift_Ins_p.L127fs|LRRC20_ENST00000373224.1_Frame_Shift_Ins_p.L183fs	NM_001278212.1|NM_001278214.1|NM_207119.1	NP_001265141.1|NP_001265143.1|NP_997002.1	Q8TCA0	LRC20_HUMAN	leucine rich repeat containing 20	183								p.L183fs*>3(1)		endometrium(2)|large_intestine(4)|lung(2)|urinary_tract(1)	9						GGCCTAAGGTAGGGGGGCTCTT	0.658																																					p.L133fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.398_399insC	10						.		,,	1,4263		0,1,2131					,,	1.2	0.2			8	0,8254		0,0,4127	no	frameshift,frameshift,frameshift	LRRC20	NM_207119.1,NM_018239.2,NM_018205.2	,,	0,1,6258	A1A1,A1R,RR		0.0,0.0235,0.0080	,,	,,		1,12517				71731124	SO:0001589	frameshift_variant	55222	exon4			BC024001	CCDS7300.1, CCDS7301.1, CCDS7302.1, CCDS73145.1	10q22.2	2004-04-15			ENSG00000172731	ENSG00000172731			23421	protein-coding gene	gene with protein product							Standard	NM_207119		Approved	FLJ10751, FLJ10844	uc031pvr.1	Q8TCA0	OTTHUMG00000018407	ENST00000355790.4:c.548dupC	10.37:g.72061123_72061123dupG	ENSP00000348043:p.Leu183fs	Somatic		Capture	SOLID	Phase_I	71731123	NM_018239	Q5T6D4|Q5T6D6|Q9NVA6|Q9NVG3	Frame_Shift_Ins	INS	ENST00000355790.4	37	CCDS7302.1																																																																																				LRRC20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048510.1	NM_018239	
PCDHB2	56133	hgsc.bcm.edu	37	5	140475633	140475634	+	In_Frame_Ins	INS	-	-	CATCAC	rs372005802		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:140475633_140475634insCATCAC	ENST00000194155.4	+	1	1407_1408	c.1259_1260insCATCAC	c.(1258-1263)aacatc>aaCATCACcatc	p.423_424insTI		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	423	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCGAATACAACATCACCATCA	0.515																																					p.N420delinsNIT												.	.	0			c.1259_1260insCATCAC	5						.			24,4240		0,24,2108						2.5	0.9			132	264,7990		2,260,3865	no	coding	PCDHB2	NM_018936.2		2,284,5973	A1A1,A1R,RR		3.1984,0.5629,2.3007				288,12230				140455818	SO:0001652	inframe_insertion	56133	exon1			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1266_1271dupCATCAC	5.37:g.140475634_140475639dupCATCAC	ENSP00000194155:p.Thr422_Ile423dup	Somatic		Capture	SOLID	Phase_I	140455817	NM_018936	Q4KMU1	In_Frame_Ins	INS	ENST00000194155.4	37	CCDS4244.1																																																																																				PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
FBXO24	26261	hgsc.bcm.edu	37	7	100197681	100197681	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:100197681C>A	ENST00000241071.6	+	9	1556	c.1234C>A	c.(1234-1236)Ctg>Atg	p.L412M	PCOLCE-AS1_ENST00000446022.1_RNA|PCOLCE-AS1_ENST00000544873.1_RNA|FBXO24_ENST00000360609.2_3'UTR|FBXO24_ENST00000427939.2_Missense_Mutation_p.L450M|PCOLCE_ENST00000223061.5_5'Flank|FBXO24_ENST00000468962.1_Missense_Mutation_p.L400M|PCOLCE-AS1_ENST00000442166.2_RNA	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24	412					protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.L412M(1)		NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					GCCCATCACCCTGTGGTGCGG	0.677																																					p.L400M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1198A	7						.						27.0	30.0	29.0					7																	100197681		2203	4300	6503	100035617	SO:0001583	missense	26261	exon9			AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.1234C>A	7.37:g.100197681C>A	ENSP00000241071:p.Leu412Met	Somatic		Capture	SOLID	Phase_I	100035617	NM_001163499	A4D2D4|B4DX91|B4DY42|Q9H0G1	Missense_Mutation	SNP	ENST00000241071.6	37	CCDS5698.1	.	.	.	.	.	.	.	.	.	.	C	8.665	0.901466	0.17760	.	.	ENSG00000106336	ENST00000241071;ENST00000468962;ENST00000427939	T;T;T	0.81330	-1.48;-1.48;-1.48	4.76	3.85	0.44370	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.354167	0.19902	N	0.103495	T	0.76842	0.4044	L	0.56199	1.76	0.80722	D	1	B;B;B	0.23990	0.095;0.079;0.095	B;B;B	0.30029	0.071;0.11;0.071	T	0.74106	-0.3772	10	0.72032	D	0.01	-6.3374	9.9597	0.41688	0.4027:0.5973:0.0:0.0	.	400;450;412	B4DY42;B4DX91;O75426	.;.;FBX24_HUMAN	M	412;400;450	ENSP00000241071:L412M;ENSP00000420239:L400M;ENSP00000416558:L450M	ENSP00000241071:L412M	L	+	1	2	FBXO24	100035617	0.995000	0.38212	1.000000	0.80357	0.332000	0.28634	0.195000	0.17155	0.931000	0.37242	0.442000	0.29010	CTG		FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356104.1		
EPHB4	2050	hgsc.bcm.edu	37	7	100405112	100405112	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:100405112C>T	ENST00000358173.3	-	13	2677	c.2209G>A	c.(2209-2211)Gtc>Atc	p.V737I	EPHB4_ENST00000360620.3_Missense_Mutation_p.V737I	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	737	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V737I(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					TCTCGGTGGACGTAGCTCATC	0.577																																					p.V737I	GBM(200;2113 3072 25865 52728)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2209A	7						.						175.0	133.0	147.0					7																	100405112		2203	4300	6503	100243048	SO:0001583	missense	2050	exon13			AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.2209G>A	7.37:g.100405112C>T	ENSP00000350896:p.Val737Ile	Somatic		Capture	SOLID	Phase_I	100243048	NM_004444	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Missense_Mutation	SNP	ENST00000358173.3	37	CCDS5706.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491986	0.84962	.	.	ENSG00000196411	ENST00000360620;ENST00000358173	D;D	0.83163	-1.69;-1.69	4.65	4.65	0.58169	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43579	D	0.000554	D	0.82774	0.5110	N	0.12853	0.265	0.50813	D	0.999892	D;D	0.76494	0.999;0.978	D;P	0.75484	0.986;0.595	D	0.85246	0.1041	10	0.49607	T	0.09	.	15.0272	0.71680	0.0:1.0:0.0:0.0	.	737;737	Q96L35;P54760	.;EPHB4_HUMAN	I	737	ENSP00000353833:V737I;ENSP00000350896:V737I	ENSP00000350896:V737I	V	-	1	0	EPHB4	100243048	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	6.079000	0.71291	2.124000	0.65301	0.313000	0.20887	GTC		EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444	
SERPINE1	5054	hgsc.bcm.edu	37	7	100777090	100777090	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:100777090C>T	ENST00000223095.4	+	5	972	c.815C>T	c.(814-816)gCc>gTc	p.A272V	SERPINE1_ENST00000445463.2_Missense_Mutation_p.A257V	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	272					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.A272V(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	CCTCTCTCTGCCCTCACCAAC	0.577																																					p.A272V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C815T	7						.						162.0	135.0	144.0					7																	100777090		2203	4300	6503	100563810	SO:0001583	missense	5054	exon5			M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.815C>T	7.37:g.100777090C>T	ENSP00000223095:p.Ala272Val	Somatic		Capture	SOLID	Phase_I	100563810	NM_000602	B7Z4S0|F8WD53	Missense_Mutation	SNP	ENST00000223095.4	37	CCDS5711.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647802	0.87958	.	.	ENSG00000106366	ENST00000223095;ENST00000445463;ENST00000536888	D;D	0.84873	-1.91;-1.91	5.77	5.77	0.91146	Serpin domain (3);	0.275516	0.35838	N	0.002946	D	0.87541	0.6203	L	0.46670	1.46	0.49483	D	0.999796	D;D	0.76494	0.993;0.999	P;P	0.55303	0.485;0.773	D	0.86572	0.1848	10	0.41790	T	0.15	.	17.4922	0.87707	0.0:1.0:0.0:0.0	.	257;272	F8WD53;P05121	.;PAI1_HUMAN	V	272;257;49	ENSP00000223095:A272V;ENSP00000396766:A257V	ENSP00000223095:A272V	A	+	2	0	SERPINE1	100563810	0.995000	0.38212	1.000000	0.80357	0.787000	0.44495	2.486000	0.45259	2.724000	0.93272	0.561000	0.74099	GCC		SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347458.1	NM_000602	
SLC26A5	375611	hgsc.bcm.edu	37	7	103050840	103050840	+	Missense_Mutation	SNP	C	C	T	rs368643773		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:103050840C>T	ENST00000306312.3	-	7	988	c.727G>A	c.(727-729)Gtg>Atg	p.V243M	SLC26A5_ENST00000339444.6_Missense_Mutation_p.V243M|SLC26A5_ENST00000393735.2_Missense_Mutation_p.V243M|SLC26A5_ENST00000393727.1_Missense_Mutation_p.V243M|SLC26A5_ENST00000356767.4_Missense_Mutation_p.V243M|SLC26A5_ENST00000432958.2_Missense_Mutation_p.V243M|SLC26A5_ENST00000354356.4_De_novo_Start_InFrame|SLC26A5_ENST00000393723.1_Missense_Mutation_p.V243M|SLC26A5_ENST00000393730.1_Missense_Mutation_p.V243M|SLC26A5_ENST00000393729.1_Missense_Mutation_p.V206M	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	243					regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)	p.V243M(1)		endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						ACATACACCACGGAAAAGATT	0.418																																					p.V243M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G727A	7						.	C	MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	64.0	63.0	63.0		727,727,727,727,727	5.7	1.0	7		63	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	SLC26A5	NM_001167962.1,NM_198999.2,NM_206883.2,NM_206884.2,NM_206885.2	21,21,21,21,21	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	243/713,243/745,243/686,243/517,243/336	103050840	2,13004	2203	4300	6503	102838076	SO:0001583	missense	375611	exon7			AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.727G>A	7.37:g.103050840C>T	ENSP00000304783:p.Val243Met	Somatic		Capture	SOLID	Phase_I	102838076	NM_206884	Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Missense_Mutation	SNP	ENST00000306312.3	37	CCDS5733.1	.	.	.	.	.	.	.	.	.	.	C	19.28	3.797530	0.70567	2.27E-4	1.16E-4	ENSG00000170615	ENST00000339444;ENST00000356767;ENST00000393735;ENST00000306312;ENST00000393730;ENST00000432958;ENST00000393729;ENST00000393727;ENST00000393723	D;D;D;D;D;D;D;D;D	0.94280	-3.39;-3.39;-3.39;-3.39;-3.39;-3.39;-3.39;-3.39;-3.39	5.72	5.72	0.89469	Sulphate transporter (1);	0.113050	0.64402	D	0.000012	D	0.95506	0.8540	L	0.56340	1.77	0.80722	D	1	P;D;P;D;D	0.89917	0.82;1.0;0.785;1.0;1.0	P;D;B;D;D	0.72338	0.557;0.977;0.422;0.943;0.961	D	0.95540	0.8611	10	0.72032	D	0.01	.	15.4865	0.75571	0.1391:0.8609:0.0:0.0	.	243;243;243;243;243	P58743;Q496J2;P58743-4;P58743-3;P58743-2	S26A5_HUMAN;.;.;.;.	M	243;243;243;243;243;243;206;243;243	ENSP00000342396:V243M;ENSP00000349210:V243M;ENSP00000377336:V243M;ENSP00000304783:V243M;ENSP00000377331:V243M;ENSP00000389733:V243M;ENSP00000377330:V206M;ENSP00000377328:V243M;ENSP00000377324:V243M	ENSP00000304783:V243M	V	-	1	0	SLC26A5	102838076	0.989000	0.36119	0.990000	0.47175	0.983000	0.72400	3.615000	0.54167	2.708000	0.92522	0.591000	0.81541	GTG		SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313860.1	NM_198999	
RELN	5649	hgsc.bcm.edu	37	7	103162529	103162529	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:103162529T>C	ENST00000428762.1	-	48	7767	c.7608A>G	c.(7606-7608)ggA>ggG	p.G2536G	RELN_ENST00000424685.2_Silent_p.G2536G|RELN_ENST00000343529.5_Silent_p.G2536G	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2536					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.G2536G(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCAATTTCCCTCCGTTCACAG	0.522																																					p.G2536G	NSCLC(146;835 1944 15585 22231 52158)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A7608G	7						.						145.0	126.0	133.0					7																	103162529		2203	4300	6503	102949765	SO:0001819	synonymous_variant	5649	exon48				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7608A>G	7.37:g.103162529T>C		Somatic		Capture	SOLID	Phase_I	102949765	NM_005045	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																				RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
PUS7	54517	hgsc.bcm.edu	37	7	105148649	105148649	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:105148649A>G	ENST00000356362.2	-	2	525	c.311T>C	c.(310-312)aTg>aCg	p.M104T	PUS7_ENST00000469408.1_Missense_Mutation_p.M104T	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	104					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)	p.M104T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						ATGCTTCATCATGTCTGCAAA	0.453																																					p.M104T	Colon(138;2387 3051 17860)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T311C	7						.						170.0	140.0	150.0					7																	105148649		2203	4300	6503	104935885	SO:0001583	missense	54517	exon2			AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.311T>C	7.37:g.105148649A>G	ENSP00000348722:p.Met104Thr	Somatic		Capture	SOLID	Phase_I	104935885	NM_019042	Q75MG4|Q9NX19	Missense_Mutation	SNP	ENST00000356362.2	37	CCDS34725.1	.	.	.	.	.	.	.	.	.	.	A	19.01	3.743315	0.69418	.	.	ENSG00000091127	ENST00000356362;ENST00000544995;ENST00000469408	T;T	0.43294	0.95;0.95	5.58	4.42	0.53409	.	0.037823	0.85682	D	0.000000	T	0.53690	0.1812	L	0.55990	1.75	0.58432	D	0.999996	D;D	0.56968	0.978;0.978	D;D	0.64042	0.921;0.921	T	0.47923	-0.9079	10	0.32370	T	0.25	-14.3095	10.8534	0.46784	0.9259:0.0:0.0741:0.0	.	104;104	B3KY42;Q96PZ0	.;PUS7_HUMAN	T	104	ENSP00000348722:M104T;ENSP00000417402:M104T	ENSP00000348722:M104T	M	-	2	0	PUS7	104935885	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	8.648000	0.91062	0.937000	0.37394	0.379000	0.24179	ATG		PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348681.1	NM_019042	
LRRN3	54674	hgsc.bcm.edu	37	7	110764217	110764217	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:110764217A>C	ENST00000422987.3	+	2	2220	c.1389A>C	c.(1387-1389)aaA>aaC	p.K463N	IMMP2L_ENST00000452895.1_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.K463N|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000331762.3_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.K463N|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000450877.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	463	Ig-like C2-type.				positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.K463N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		CTGGTCAAAAACTCTTGCCTA	0.413																																					p.K463N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1389C	7						.						100.0	106.0	104.0					7																	110764217		2203	4300	6503	110551453	SO:0001583	missense	54674	exon2			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.1389A>C	7.37:g.110764217A>C	ENSP00000412417:p.Lys463Asn	Somatic		Capture	SOLID	Phase_I	110551453	NM_018334	O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	ENST00000422987.3	37	CCDS5754.1	.	.	.	.	.	.	.	.	.	.	A	14.49	2.549565	0.45383	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987	T;T;T	0.68331	-0.32;-0.32;-0.32	6.17	-1.96	0.07525	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.179640	0.38492	N	0.001672	T	0.58004	0.2092	L	0.42632	1.34	0.37096	D	0.899672	P	0.40578	0.722	B	0.43990	0.438	T	0.58509	-0.7624	10	0.28530	T	0.3	.	12.8868	0.58049	0.5242:0.0:0.4758:0.0	.	463	Q9H3W5	LRRN3_HUMAN	N	463	ENSP00000312001:K463N;ENSP00000397312:K463N;ENSP00000412417:K463N	ENSP00000312001:K463N	K	+	3	2	LRRN3	110551453	1.000000	0.71417	0.992000	0.48379	0.974000	0.67602	1.081000	0.30791	-0.259000	0.09432	0.533000	0.62120	AAA		LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
CPED1	79974	hgsc.bcm.edu	37	7	120655886	120655886	+	Silent	SNP	G	G	A	rs144047302	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:120655886G>A	ENST00000310396.5	+	3	884	c.417G>A	c.(415-417)ccG>ccA	p.P139P	CPED1_ENST00000450913.2_Silent_p.P139P|CPED1_ENST00000495036.1_3'UTR|CPED1_ENST00000340646.5_Silent_p.P139P	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	139						endoplasmic reticulum (GO:0005783)		p.P139P(1)									GCCTAGGGCCGGGGCTACTAG	0.443													G|||	2	0.000399361	0.0	0.0014	5008	,	,		16941	0.0		0.001	False		,,,				2504	0.0				p.P139P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G417A	7						.	G	,	2,4404	4.2+/-10.8	0,2,2201	53.0	43.0	47.0		417,417	2.7	0.0	7	dbSNP_134	47	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	C7orf58	NM_001105533.1,NM_024913.4	,	0,4,6499	AA,AG,GG		0.0233,0.0454,0.0308	,	139/784,139/1027	120655886	4,13002	2203	4300	6503	120443122	SO:0001819	synonymous_variant	79974	exon3				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.417G>A	7.37:g.120655886G>A		Somatic		Capture	SOLID	Phase_I	120443122	NM_024913	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Silent	SNP	ENST00000310396.5	37	CCDS34739.1																																																																																				CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913	
SND1	27044	hgsc.bcm.edu	37	7	127732058	127732058	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:127732058G>A	ENST00000354725.3	+	24	2875	c.2681G>A	c.(2680-2682)cGc>cAc	p.R894H		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	894					gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)	p.R894H(1)		central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						AACCTGTGGCGCTATGGAGAC	0.567																																					p.R894H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2681A	7						.						195.0	196.0	196.0					7																	127732058		2203	4300	6503	127519294	SO:0001583	missense	27044	exon24				CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.2681G>A	7.37:g.127732058G>A	ENSP00000346762:p.Arg894His	Somatic		Capture	SOLID	Phase_I	127519294	NM_014390	Q13122|Q96AG0	Missense_Mutation	SNP	ENST00000354725.3	37	CCDS34747.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297116	0.81025	.	.	ENSG00000197157	ENST00000354725;ENST00000438400	T	0.30714	1.52	4.61	4.61	0.57282	Staphylococcal nuclease (SNase-like) (2);Staphylococcal nuclease (SNase-like), OB-fold (1);	0.000000	0.85682	D	0.000000	T	0.50051	0.1593	M	0.76328	2.33	0.58432	D	0.999995	D	0.69078	0.997	P	0.58970	0.849	T	0.55477	-0.8135	10	0.72032	D	0.01	-12.4765	13.3142	0.60397	0.0:0.0:1.0:0.0	.	894	Q7KZF4	SND1_HUMAN	H	894;884	ENSP00000346762:R894H	ENSP00000346762:R894H	R	+	2	0	SND1	127519294	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	7.422000	0.80217	2.276000	0.75962	0.455000	0.32223	CGC		SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390	
WDR91	29062	hgsc.bcm.edu	37	7	134894467	134894467	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:134894467A>G	ENST00000354475.4	-	2	195	c.164T>C	c.(163-165)gTg>gCg	p.V55A	WDR91_ENST00000423565.1_Missense_Mutation_p.V20A|WDR91_ENST00000344400.5_Missense_Mutation_p.V55A|WDR91_ENST00000485942.1_5'Flank	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	55								p.V55A(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						CAAGTCATACACCTGCATTAA	0.512																																					p.V55A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T164C	7						.						105.0	105.0	105.0					7																	134894467		2203	4300	6503	134545007	SO:0001583	missense	29062	exon2			AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.164T>C	7.37:g.134894467A>G	ENSP00000346466:p.Val55Ala	Somatic		Capture	SOLID	Phase_I	134545007	NM_014149	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	ENST00000354475.4	37	CCDS34758.1	.	.	.	.	.	.	.	.	.	.	A	13.25	2.179670	0.38511	.	.	ENSG00000105875	ENST00000344400;ENST00000354475;ENST00000423565	T;T;T	0.61859	1.63;0.07;0.63	6.04	4.9	0.64082	.	0.152256	0.53938	D	0.000043	T	0.27524	0.0676	N	0.02916	-0.46	0.31866	N	0.620307	B	0.06786	0.001	B	0.04013	0.001	T	0.26430	-1.0103	10	0.15952	T	0.53	-9.5133	7.064	0.25141	0.6428:0.2777:0.0794:0.0	.	55	A4D1P6	WDR91_HUMAN	A	55;55;20	ENSP00000340877:V55A;ENSP00000346466:V55A;ENSP00000392555:V20A	ENSP00000340877:V55A	V	-	2	0	WDR91	134545007	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.764000	0.38471	2.317000	0.78254	0.459000	0.35465	GTG		WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149	
PTN	5764	hgsc.bcm.edu	37	7	136938369	136938369	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:136938369T>A	ENST00000348225.2	-	3	558	c.131A>T	c.(130-132)aAg>aTg	p.K44M	PTN_ENST00000393083.2_Missense_Mutation_p.K44M	NM_002825.5	NP_002816.1	P21246	PTN_HUMAN	pleiotrophin	44					bone mineralization (GO:0030282)|learning (GO:0007612)|negative regulation of catalytic activity (GO:0043086)|nervous system development (GO:0007399)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	heparin binding (GO:0008201)|protein phosphatase inhibitor activity (GO:0004864)	p.K44M(1)|p.K44T(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23						ACAGTCAGACTTCTTCACTTT	0.478																																					p.K44M												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.A131T	7						.						55.0	53.0	54.0					7																	136938369		2203	4300	6503	136588909	SO:0001583	missense	5764	exon3			M57399	CCDS5844.1	7q33	2014-01-30	2008-07-31		ENSG00000105894	ENSG00000105894		"""Endogenous ligands"""	9630	protein-coding gene	gene with protein product	"""heparin binding growth factor 8"""	162095	"""neurite growth-promoting factor 1"""	NEGF1		1457401, 1768439	Standard	NM_002825		Approved	HBNF, HBGF8	uc003vtq.2	P21246	OTTHUMG00000155709	ENST00000348225.2:c.131A>T	7.37:g.136938369T>A	ENSP00000341170:p.Lys44Met	Somatic		Capture	SOLID	Phase_I	136588909	NM_002825	Q5U0B0|Q6ICQ5|Q9UCC6	Missense_Mutation	SNP	ENST00000348225.2	37	CCDS5844.1	.	.	.	.	.	.	.	.	.	.	T	17.58	3.426080	0.62733	.	.	ENSG00000105894	ENST00000348225;ENST00000393083	.	.	.	5.66	5.66	0.87406	Midkine heparin-binding growth factor, N-terminal (3);Midkine heparin-binding growth factor, disulphide-rich domain (1);	0.437392	0.26485	N	0.024117	T	0.66819	0.2828	L	0.32530	0.975	0.44492	D	0.997431	D;D	0.71674	0.998;0.995	D;D	0.70935	0.971;0.937	T	0.69487	-0.5132	9	0.62326	D	0.03	-15.5865	15.8997	0.79362	0.0:0.0:0.0:1.0	.	44;44	C9JR52;P21246	.;PTN_HUMAN	M	44	.	ENSP00000341170:K44M	K	-	2	0	PTN	136588909	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	3.309000	0.51903	2.157000	0.67596	0.482000	0.46254	AAG		PTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341339.1	NM_002825	
TBXAS1	6916	hgsc.bcm.edu	37	7	139706927	139706927	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:139706927C>T	ENST00000336425.5	+	14	1560	c.1171C>T	c.(1171-1173)Ccc>Tcc	p.P391S	TBXAS1_ENST00000425687.1_Missense_Mutation_p.P324S|TBXAS1_ENST00000411653.1_Missense_Mutation_p.P391S|TBXAS1_ENST00000263552.6_Missense_Mutation_p.P392S|TBXAS1_ENST00000416849.2_Missense_Mutation_p.P438S|TBXAS1_ENST00000462275.1_3'UTR|TBXAS1_ENST00000436047.2_Missense_Mutation_p.P392S|TBXAS1_ENST00000458722.1_Missense_Mutation_p.P437S|TBXAS1_ENST00000448866.1_Missense_Mutation_p.P391S|TBXAS1_ENST00000414508.2_Missense_Mutation_p.P392S			P24557	THAS_HUMAN	thromboxane A synthase 1 (platelet)	391					arachidonic acid metabolic process (GO:0019369)|cellular chloride ion homeostasis (GO:0030644)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|positive regulation of vasoconstriction (GO:0045907)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|thromboxane-A synthase activity (GO:0004796)	p.P392S(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	28	Melanoma(164;0.0142)				Ridogrel(DB01207)|Sulfasalazine(DB00795)	GGAAGGCCTGCCCTATCTGGA	0.582																																					p.P392S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1174T	7						.						164.0	155.0	158.0					7																	139706927		2203	4300	6503	139353396	SO:0001583	missense	6916	exon10			L36085	CCDS5855.1, CCDS5856.1, CCDS55174.1, CCDS55175.1	7q34-q35	2014-09-17	2008-07-31		ENSG00000059377	ENSG00000059377	5.3.99.5	"""Cytochrome P450s"""	11609	protein-coding gene	gene with protein product	"""cytochrome P450, family 5, subfamily A, polypeptide 1"""	274180	"""thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)"""			1714723, 8964509	Standard	NM_001061		Approved	CYP5, CYP5A1, THAS, TXS, TXAS, TS	uc011kqv.2	P24557	OTTHUMG00000157302	ENST00000336425.5:c.1171C>T	7.37:g.139706927C>T	ENSP00000338087:p.Pro391Ser	Somatic		Capture	SOLID	Phase_I	139353396	NM_001061	B4DJG6|E7EMU9|E7EP08|E7ESB5|O14987|Q16843|Q16844|Q8IUN1|Q96CN2|Q9GZW4|Q9HD77|Q9HD78|Q9HD79|Q9HD80|Q9HD81|Q9HD82|Q9HD83|Q9HD84	Missense_Mutation	SNP	ENST00000336425.5	37		.	.	.	.	.	.	.	.	.	.	C	20.7	4.027416	0.75390	.	.	ENSG00000059377	ENST00000425687;ENST00000263552;ENST00000336425;ENST00000416849;ENST00000436047;ENST00000414508;ENST00000448866;ENST00000458722;ENST00000411653	T;T;T;T;T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88	4.27	4.27	0.50696	.	0.201209	0.44285	D	0.000477	T	0.81389	0.4812	L	0.53729	1.69	0.80722	D	1	D;D;P;D;P;P;P	0.89917	0.976;1.0;0.885;1.0;0.637;0.943;0.943	D;D;P;D;P;P;P	0.80764	0.936;0.986;0.771;0.994;0.827;0.823;0.823	T	0.78602	-0.2140	10	0.25751	T	0.34	.	13.9919	0.64372	0.0:1.0:0.0:0.0	.	372;438;343;324;392;392;391	B4DVP1;E7EP08;B4E0M5;E7ESB5;E7EMU9;Q53F23;P24557	.;.;.;.;.;.;THAS_HUMAN	S	324;392;391;438;392;392;391;437;391	ENSP00000388736:P324S;ENSP00000263552:P392S;ENSP00000338087:P391S;ENSP00000389414:P438S;ENSP00000392361:P392S;ENSP00000392702:P392S;ENSP00000402536:P391S;ENSP00000411274:P437S;ENSP00000411326:P391S	ENSP00000263552:P392S	P	+	1	0	TBXAS1	139353396	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.007000	0.40883	2.079000	0.62486	0.650000	0.86243	CCC		TBXAS1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000348373.1		
AGK	55750	hgsc.bcm.edu	37	7	141333767	141333767	+	Missense_Mutation	SNP	G	G	A	rs201584377	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:141333767G>A	ENST00000355413.4	+	10	915	c.655G>A	c.(655-657)Gtc>Atc	p.V219I	AGK_ENST00000535825.1_Missense_Mutation_p.V216I|AGK_ENST00000473247.1_Missense_Mutation_p.V191I	NM_018238.3	NP_060708.1	Q53H12	AGK_HUMAN	acylglycerol kinase	219					ceramide biosynthetic process (GO:0046513)|glycerolipid metabolic process (GO:0046486)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acylglycerol kinase activity (GO:0047620)|ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.V219I(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(3)	17	Melanoma(164;0.0171)					AGATGCTGGCGTCAAAGTTAG	0.363													G|||	2	0.000399361	0.0	0.0	5008	,	,		19129	0.0		0.001	False		,,,				2504	0.001				p.V219I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G655A	7						.	G	ILE/VAL	0,4406		0,0,2203	114.0	115.0	114.0		655	4.7	1.0	7		114	3,8597	3.0+/-9.4	0,3,4297	yes	missense	AGK	NM_018238.3	29	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	possibly-damaging	219/423	141333767	3,13003	2203	4300	6503	140980236	SO:0001583	missense	55750	exon10			BC022777	CCDS5865.1	7q34	2010-05-04	2007-01-11	2007-01-11	ENSG00000006530	ENSG00000006530	2.7.1.94		21869	protein-coding gene	gene with protein product		610345	"""multiple substrate lipid kinase"""	MULK		15252046, 15939762, 17135245	Standard	NM_018238		Approved	FLJ10842	uc003vwi.2	Q53H12	OTTHUMG00000157499	ENST00000355413.4:c.655G>A	7.37:g.141333767G>A	ENSP00000347581:p.Val219Ile	Somatic		Capture	SOLID	Phase_I	140980236	NM_018238	Q75KN1|Q96GC3|Q9NP48	Missense_Mutation	SNP	ENST00000355413.4	37	CCDS5865.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	15.71	2.912914	0.52439	0.0	3.49E-4	ENSG00000006530	ENST00000355413;ENST00000473247;ENST00000535825	T;T;T	0.40756	2.61;2.61;1.02	5.62	4.71	0.59529	.	0.355037	0.32593	N	0.005893	T	0.29524	0.0736	L	0.54323	1.7	0.36955	D	0.893058	P	0.35745	0.518	B	0.18561	0.022	T	0.25117	-1.0141	10	0.10902	T	0.67	.	11.1341	0.48365	0.0909:0.0:0.9091:0.0	.	219	Q53H12	AGK_HUMAN	I	219;191;216	ENSP00000347581:V219I;ENSP00000420776:V191I;ENSP00000444349:V216I	ENSP00000347581:V219I	V	+	1	0	AGK	140980236	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	2.141000	0.42168	1.351000	0.45789	0.655000	0.94253	GTC		AGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348969.1	NM_018238	
CASP2	835	hgsc.bcm.edu	37	7	142988660	142988660	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:142988660T>C	ENST00000310447.5	+	2	343	c.102T>C	c.(100-102)ccT>ccC	p.P34P	CASP2_ENST00000392925.2_Silent_p.P34P|RN7SL535P_ENST00000479087.2_RNA|CASP2_ENST00000493642.1_3'UTR	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	P42575	CASP2_HUMAN	caspase 2, apoptosis-related cysteine peptidase	34	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|ectopic germ cell programmed cell death (GO:0035234)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|luteolysis (GO:0001554)|neural retina development (GO:0003407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron apoptotic process (GO:0043525)|protein processing (GO:0016485)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.P34P(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(164;0.059)					GCATGCATCCTCATCATCAGG	0.448																																					p.P34P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T102C	7						.						150.0	151.0	151.0					7																	142988660		2203	4300	6503	142698782	SO:0001819	synonymous_variant	835	exon2			AK096245, BC002427, BM998653, BX537669, CB988674, U13021	CCDS5879.1, CCDS47733.1	7q34-q35	2014-01-20	2008-08-01		ENSG00000106144	ENSG00000106144		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1503	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 57"""	600639	"""neural precursor cell expressed, developmentally down-regulated 2"""	NEDD2		7789948, 8780721	Standard	NM_032982		Approved	ICH1, PPP1R57, MGC2181	uc003wco.3	P42575	OTTHUMG00000023641	ENST00000310447.5:c.102T>C	7.37:g.142988660T>C		Somatic		Capture	SOLID	Phase_I	142698782	NM_032982	A8K5F9|D3DXD6|E9PDN0|P42576|Q59F21|Q7KZL6|Q86UJ3|Q9BUP7|Q9BZK9|Q9BZL0	Silent	SNP	ENST00000310447.5	37	CCDS5879.1																																																																																				CASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059962.3	NM_032982	
CLCN1	1180	hgsc.bcm.edu	37	7	143036695	143036695	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:143036695T>C	ENST00000343257.2	+	14	1650	c.1563T>C	c.(1561-1563)ccT>ccC	p.P521P		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	521					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.P521P(1)		breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					AGATCCTACCTGGGGGCTATG	0.443																																					p.P521P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1563C	7						.						139.0	126.0	130.0					7																	143036695		2203	4300	6503	142746817	SO:0001819	synonymous_variant	1180	exon14			Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.1563T>C	7.37:g.143036695T>C		Somatic		Capture	SOLID	Phase_I	142746817	NM_000083	A4D2H5|Q2M202	Silent	SNP	ENST00000343257.2	37	CCDS5881.1																																																																																				CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	
NUPL2	11097	hgsc.bcm.edu	37	7	23224764	23224764	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:23224764C>T	ENST00000258742.5	+	2	456	c.197C>T	c.(196-198)tCc>tTc	p.S66F	NUPL2_ENST00000410002.3_Missense_Mutation_p.S66F|NUPL2_ENST00000487595.1_3'UTR|AC005082.1_ENST00000366347.4_Intron	NM_007342.2	NP_031368.1	O15504	NUPL2_HUMAN	nucleoporin like 2	66					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nuclear export signal receptor activity (GO:0005049)|poly(A) RNA binding (GO:0044822)	p.S66F(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TTCTCCAAATCCACACCATGG	0.398																																					p.S66F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C197T	7						.						81.0	83.0	82.0					7																	23224764		2203	4300	6503	23191289	SO:0001583	missense	11097	exon2			U97198	CCDS5379.1	7p15	2003-08-07			ENSG00000136243	ENSG00000136243			17010	protein-coding gene	gene with protein product	"""nucleoporin-like protein 1"""					10358091, 9450185	Standard	NM_007342		Approved	NLP_1, CG1, hCG1, H_RG271G13.9	uc003svu.3	O15504	OTTHUMG00000096955	ENST00000258742.5:c.197C>T	7.37:g.23224764C>T	ENSP00000258742:p.Ser66Phe	Somatic		Capture	SOLID	Phase_I	23191289	NM_007342	A4D143|B4DP42|Q49AE7|Q9BS49	Missense_Mutation	SNP	ENST00000258742.5	37	CCDS5379.1	.	.	.	.	.	.	.	.	.	.	C	18.92	3.725022	0.68959	.	.	ENSG00000136243	ENST00000258742;ENST00000410002;ENST00000413919	T;T;T	0.43294	0.95;0.95;0.95	6.07	4.24	0.50183	.	0.423693	0.27986	N	0.017047	T	0.54240	0.1846	M	0.63843	1.955	0.40821	D	0.983502	D	0.61080	0.989	P	0.61201	0.885	T	0.58797	-0.7573	10	0.87932	D	0	-4.6268	8.2234	0.31554	0.1185:0.7017:0.1147:0.0652	.	66	O15504	NUPL2_HUMAN	F	66	ENSP00000258742:S66F;ENSP00000387330:S66F;ENSP00000401475:S66F	ENSP00000258742:S66F	S	+	2	0	NUPL2	23191289	0.648000	0.27313	0.673000	0.29887	0.985000	0.73830	1.622000	0.36997	1.557000	0.49525	0.585000	0.79938	TCC		NUPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214017.2	NM_007342	
ELMO1	9844	hgsc.bcm.edu	37	7	37311484	37311484	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:37311484G>A	ENST00000310758.4	-	5	843	c.196C>T	c.(196-198)Cgc>Tgc	p.R66C	ELMO1_ENST00000448602.1_Missense_Mutation_p.R66C|ELMO1_ENST00000442504.1_Missense_Mutation_p.R66C	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	66					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)	p.R66C(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						ATCTCATTGCGGTTCTGGAAA	0.363																																					p.R66C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C196T	7						.						114.0	118.0	117.0					7																	37311484		2203	4300	6503	37278009	SO:0001583	missense	9844	exon5			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.196C>T	7.37:g.37311484G>A	ENSP00000312185:p.Arg66Cys	Somatic		Capture	SOLID	Phase_I	37278009	NM_014800	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	ENST00000310758.4	37	CCDS5449.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.871571	0.72065	.	.	ENSG00000155849	ENST00000310758;ENST00000442504;ENST00000448602;ENST00000455119;ENST00000455879;ENST00000453399	T;T;T;T;T;T	0.56275	2.24;2.24;2.24;1.01;0.97;0.47	4.79	3.9	0.45041	.	0.000000	0.85682	D	0.000000	T	0.71467	0.3343	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74393	-0.3680	10	0.54805	T	0.06	.	10.5944	0.45329	0.0:0.0:0.8084:0.1916	.	66	Q92556	ELMO1_HUMAN	C	66	ENSP00000312185:R66C;ENSP00000406952:R66C;ENSP00000394458:R66C;ENSP00000406610:R66C;ENSP00000416090:R66C;ENSP00000391734:R66C	ENSP00000312185:R66C	R	-	1	0	ELMO1	37278009	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.424000	0.52764	1.611000	0.50210	0.655000	0.94253	CGC		ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442	
DBNL	28988	hgsc.bcm.edu	37	7	44096436	44096436	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:44096436A>G	ENST00000448521.1	+	5	506	c.408A>G	c.(406-408)tcA>tcG	p.S136S	DBNL_ENST00000456905.1_Intron|DBNL_ENST00000490734.2_Silent_p.S41S|DBNL_ENST00000497184.1_3'UTR|DBNL_ENST00000468694.1_Silent_p.S136S|DBNL_ENST00000452943.1_Silent_p.S111S|DBNL_ENST00000440166.1_Silent_p.S33S|DBNL_ENST00000494774.1_Silent_p.S136S	NM_001014436.2	NP_001014436.1	Q9UJU6	DBNL_HUMAN	drebrin-like	136					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|endocytosis (GO:0006897)|immune system process (GO:0002376)|neuron projection morphogenesis (GO:0048812)|podosome assembly (GO:0071800)|Rac protein signal transduction (GO:0016601)|synapse assembly (GO:0007416)	cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|podosome (GO:0002102)|postsynaptic density (GO:0014069)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|enzyme activator activity (GO:0008047)	p.S136S(1)		breast(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|stomach(1)	12						CCAAGGCTTCAGGTGCCAACT	0.617																																					p.S136S	NSCLC(68;573 1327 18604 34760 37992)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A408G	7						.						120.0	103.0	109.0					7																	44096436		2203	4300	6503	44062961	SO:0001819	synonymous_variant	28988	exon5			AF151364	CCDS34622.1, CCDS34623.1, CCDS47579.1, CCDS64633.1, CCDS64634.1	7p13	2004-07-22			ENSG00000136279	ENSG00000136279			2696	protein-coding gene	gene with protein product		610106				10087302	Standard	NM_014063		Approved	SH3P7, HIP-55	uc003tjq.4	Q9UJU6	OTTHUMG00000155350	ENST00000448521.1:c.408A>G	7.37:g.44096436A>G		Somatic		Capture	SOLID	Phase_I	44062961	NM_014063	A4D2I9|B4DEM2|C9J7P1|P84070|Q6IAI8|Q96F30|Q96K74|Q9HBN8|Q9NR72	Silent	SNP	ENST00000448521.1	37	CCDS34623.1	.	.	.	.	.	.	.	.	.	.	A	9.509	1.105156	0.20632	.	.	ENSG00000136279	ENST00000432854	.	.	.	4.88	-9.77	0.00500	.	.	.	.	.	T	0.42607	0.1210	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54132	-0.8339	4	.	.	.	-16.7148	4.8419	0.13494	0.1387:0.0728:0.2285:0.56	.	.	.	.	G	65	.	.	R	+	1	2	DBNL	44062961	0.000000	0.05858	0.084000	0.20598	0.972000	0.66771	-6.824000	0.00052	-3.816000	0.00103	-0.502000	0.04539	AGG		DBNL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339572.2	NM_014063	
PKD1L1	168507	hgsc.bcm.edu	37	7	47882627	47882627	+	Missense_Mutation	SNP	G	G	A	rs202181563		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:47882627G>A	ENST00000289672.2	-	34	5428	c.5378C>T	c.(5377-5379)cCg>cTg	p.P1793L		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1793					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.P1793L(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CTGATGGCCCGGCAGGGAAGC	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		17849	0.0		0.001	False		,,,				2504	0.0				p.P1793L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5378T	7						.	G	LEU/PRO	0,4406		0,0,2203	60.0	61.0	61.0		5378	3.4	0.0	7		61	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PKD1L1	NM_138295.3	98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	1793/2850	47882627	1,13005	2203	4300	6503	47849152	SO:0001583	missense	168507	exon34			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.5378C>T	7.37:g.47882627G>A	ENSP00000289672:p.Pro1793Leu	Somatic		Capture	SOLID	Phase_I	47849152	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	11.33	1.607618	0.28623	0.0	1.16E-4	ENSG00000158683	ENST00000289672	T	0.20332	2.08	5.27	3.38	0.38709	Lipase/lipooxygenase, PLAT/LH2 (1);	0.792750	0.11307	N	0.577508	T	0.10252	0.0251	N	0.14661	0.345	0.09310	N	1	B	0.26935	0.164	B	0.16722	0.016	T	0.34354	-0.9832	10	0.23891	T	0.37	-9.2564	4.2869	0.10858	0.0863:0.1554:0.5979:0.1603	.	1793	Q8TDX9	PK1L1_HUMAN	L	1793	ENSP00000289672:P1793L	ENSP00000289672:P1793L	P	-	2	0	PKD1L1	47849152	0.006000	0.16342	0.000000	0.03702	0.001000	0.01503	1.527000	0.35975	0.547000	0.28938	0.563000	0.77884	CCG		PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
EGFR	1956	hgsc.bcm.edu	37	7	55225430	55225430	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:55225430G>A	ENST00000275493.2	+	11	1459	c.1282G>A	c.(1282-1284)Ggc>Agc	p.G428S	EGFR_ENST00000342916.3_Missense_Mutation_p.G428S|EGFR_ENST00000344576.2_Missense_Mutation_p.G428S|EGFR_ENST00000454757.2_Missense_Mutation_p.G375S|EGFR_ENST00000442591.1_Missense_Mutation_p.G428S|EGFR_ENST00000455089.1_Missense_Mutation_p.G383S	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	428					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.G428S(2)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	AATCATACGCGGCAGGACCAA	0.448		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.G428S		yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1282A	7						.						95.0	84.0	88.0					7																	55225430		2203	4300	6503	55192924	SO:0001583	missense	1956	exon11	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.1282G>A	7.37:g.55225430G>A	ENSP00000275493:p.Gly428Ser	Somatic		Capture	SOLID	Phase_I	55192924	NM_201282	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	G	34	5.400103	0.96030	.	.	ENSG00000146648	ENST00000455089;ENST00000342916;ENST00000395504;ENST00000344576;ENST00000275493;ENST00000442591;ENST00000454757;ENST00000533450	T;T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55;0.55	5.93	5.93	0.95920	EGF receptor, L domain (1);	0.000000	0.85682	D	0.000000	T	0.80924	0.4717	M	0.93638	3.44	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.85007	0.0903	10	0.87932	D	0	.	18.9075	0.92469	0.0:0.0:1.0:0.0	.	383;428;428;428	Q504U8;P00533;P00533-3;P00533-4	.;EGFR_HUMAN;.;.	S	383;428;298;428;428;428;375;222	ENSP00000415559:G383S;ENSP00000342376:G428S;ENSP00000345973:G428S;ENSP00000275493:G428S;ENSP00000410031:G428S;ENSP00000395243:G375S	ENSP00000275493:G428S	G	+	1	0	EGFR	55192924	1.000000	0.71417	0.983000	0.44433	0.862000	0.49288	9.440000	0.97547	2.815000	0.96918	0.561000	0.74099	GGC		EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
ZNF713	349075	hgsc.bcm.edu	37	7	55990945	55990945	+	Missense_Mutation	SNP	G	G	A	rs373401601		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:55990945G>A	ENST00000429591.2	+	2	177	c.139G>A	c.(139-141)Gtg>Atg	p.V47M	ZNF713_ENST00000482436.1_3'UTR|MRPS17_ENST00000426595.1_Missense_Mutation_p.V47M	NM_182633.1	NP_872439.1	Q8N859	ZN713_HUMAN	zinc finger protein 713	47	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V47M(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CTATCGAGACGTGATGCTGGA	0.512																																					p.V47M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G139A	7						.	G	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	145.0	125.0	132.0		139	2.9	1.0	7		132	0,8600		0,0,4300	no	missense	ZNF713	NM_182633.1	21	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	47/431	55990945	1,13005	2203	4300	6503	55958439	SO:0001583	missense	349075	exon2			AK097282	CCDS34639.1	7p11.2	2013-01-08			ENSG00000178665	ENSG00000178665		"""Zinc fingers, C2H2-type"", ""-"""	22043	protein-coding gene	gene with protein product							Standard	NM_182633		Approved	FLJ39963	uc003trc.1	Q8N859	OTTHUMG00000156175	ENST00000429591.2:c.139G>A	7.37:g.55990945G>A	ENSP00000416662:p.Val47Met	Somatic		Capture	SOLID	Phase_I	55958439	NM_182633		Missense_Mutation	SNP	ENST00000429591.2	37	CCDS34639.1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.652997	0.67472	2.27E-4	0.0	ENSG00000249773;ENSG00000178665	ENST00000426595;ENST00000429591	T;T	0.04015	3.73;3.73	2.93	2.93	0.34026	Krueppel-associated box (4);	.	.	.	.	T	0.29321	0.0730	H	0.95004	3.61	0.26382	N	0.976728	D	0.89917	1.0	D	0.87578	0.998	T	0.10109	-1.0644	9	0.87932	D	0	.	12.0912	0.53728	0.0:0.0:1.0:0.0	.	47	Q8N859	ZN713_HUMAN	M	47	ENSP00000390331:V47M;ENSP00000416662:V47M	ENSP00000390331:V47M	V	+	1	0	RP11-15K19.2;ZNF713	55958439	0.998000	0.40836	0.997000	0.53966	0.934000	0.57294	3.420000	0.52735	1.935000	0.56089	0.561000	0.74099	GTG		ZNF713-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343297.1	NM_182633	
CLIP2	7461	hgsc.bcm.edu	37	7	73815838	73815838	+	Missense_Mutation	SNP	A	A	G	rs144384765		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:73815838A>G	ENST00000395060.1	+	15	3070	c.3070A>G	c.(3070-3072)Atc>Gtc	p.I1024V	CLIP2_ENST00000223398.6_Missense_Mutation_p.I1024V|CLIP2_ENST00000361545.5_Missense_Mutation_p.I989V			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	1024						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)		p.I989V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						CTTCCAGACCATCGGCAATTC	0.607											OREG0018117	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I1024V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3070G	7						.	A	VAL/ILE,VAL/ILE	0,4406		0,0,2203	86.0	63.0	71.0		3070,2965	-7.9	0.0	7	dbSNP_134	71	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CLIP2	NM_003388.4,NM_032421.2	29,29	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign,benign	1024/1047,989/1012	73815838	1,13005	2203	4300	6503	73453774	SO:0001583	missense	7461	exon16			AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.3070A>G	7.37:g.73815838A>G	ENSP00000378500:p.Ile1024Val	Somatic	1148	Capture	SOLID	Phase_I	73453774	NM_003388	O14527|O43611	Missense_Mutation	SNP	ENST00000395060.1	37	CCDS5569.1	.	.	.	.	.	.	.	.	.	.	A	0.013	-1.624661	0.00820	0.0	1.16E-4	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	T;T;T	0.57907	0.37;0.37;0.37	3.94	-7.87	0.01183	.	1.254530	0.05480	N	0.554580	T	0.27241	0.0668	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.13202	-1.0518	10	0.27082	T	0.32	-1.163	4.2042	0.10481	0.265:0.2084:0.4244:0.1022	.	989;1024	Q9UDT6-2;Q9UDT6	.;CLIP2_HUMAN	V	1024;1024;989;1024	ENSP00000223398:I1024V;ENSP00000355151:I989V;ENSP00000378500:I1024V	ENSP00000223398:I1024V	I	+	1	0	CLIP2	73453774	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.390000	0.07332	-2.952000	0.00293	-0.535000	0.04281	ATC		CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388	
KIAA1324L	222223	hgsc.bcm.edu	37	7	86522352	86522352	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:86522352T>G	ENST00000450689.2	-	20	2935	c.2750A>C	c.(2749-2751)aAg>aCg	p.K917T	KIAA1324L_ENST00000297222.6_Missense_Mutation_p.K677T|KIAA1324L_ENST00000444627.1_Missense_Mutation_p.K846T|KIAA1324L_ENST00000416314.1_Missense_Mutation_p.K750T	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	917						integral component of membrane (GO:0016021)		p.K677T(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					GGTTGCCAACTTTTTCTCAGG	0.428																																					p.K750T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2249C	7						.						110.0	120.0	117.0					7																	86522352		2203	4300	6503	86360288	SO:0001583	missense	222223	exon19			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.2750A>C	7.37:g.86522352T>G	ENSP00000413445:p.Lys917Thr	Somatic		Capture	SOLID	Phase_I	86360288	NM_152748	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	ENST00000450689.2	37	CCDS47632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.19|14.19	2.462130|2.462130	0.43736|0.43736	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000423294|ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	T|T;T;T;T	0.15256|0.19806	2.44|2.38;2.13;2.12;2.13	6.02|6.02	4.68|4.68	0.58851|0.58851	.|.	0.232106|0.232106	0.52532|0.52532	D|D	0.000077|0.000077	T|T	0.15652|0.15652	0.0377|0.0377	L|L	0.35341|0.35341	1.055|1.055	0.45733|0.45733	D|D	0.998637|0.998637	.|B;B;B	.|0.26845	.|0.026;0.161;0.161	.|B;B;B	.|0.30495	.|0.015;0.116;0.116	T|T	0.07065|0.07065	-1.0792|-1.0792	8|10	0.44086|0.46703	T|T	0.13|0.11	.|.	6.1255|6.1255	0.20177|0.20177	0.0:0.2024:0.0:0.7976|0.0:0.2024:0.0:0.7976	.|.	.|917;677;750	.|A8MWY0;A8MWY0-2;B4DJV3	.|K132L_HUMAN;.;.	N|T	877|917;677;846;750	ENSP00000406961:K877N|ENSP00000413445:K917T;ENSP00000297222:K677T;ENSP00000397377:K846T;ENSP00000402390:K750T	ENSP00000406961:K877N|ENSP00000297222:K677T	K|K	-|-	3|2	2|0	KIAA1324L|KIAA1324L	86360288|86360288	0.980000|0.980000	0.34600|0.34600	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	0.966000|0.966000	0.29331|0.29331	2.311000|2.311000	0.77944|0.77944	0.533000|0.533000	0.62120|0.62120	AAA|AAG		KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748	
DMTF1	9988	hgsc.bcm.edu	37	7	86811622	86811622	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:86811622G>A	ENST00000394703.5	+	12	1352	c.789G>A	c.(787-789)cgG>cgA	p.R263R	DMTF1_ENST00000411766.2_3'UTR|DMTF1_ENST00000414194.2_5'UTR|DMTF1_ENST00000413276.2_Silent_p.R263R|DMTF1_ENST00000331242.7_Silent_p.R263R|DMTF1_ENST00000432937.2_Silent_p.R175R	NM_021145.3	NP_066968.3	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	263	Interaction with CCND1, CCND2 and CCND3. {ECO:0000250}.|Myb-like 1. {ECO:0000255|PROSITE- ProRule:PRU00133}.|Required for DNA-binding. {ECO:0000250}.				cell cycle (GO:0007049)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R263R(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)	16	Esophageal squamous(14;0.0058)					TCAAAGATCGGTGCCGACTGA	0.498																																					p.R263R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G789A	7						.						160.0	143.0	149.0					7																	86811622		2203	4300	6503	86649558	SO:0001819	synonymous_variant	9988	exon10			AF084530	CCDS5601.1, CCDS47633.1	7q21	2014-06-25			ENSG00000135164	ENSG00000135164			14603	protein-coding gene	gene with protein product	"""cyclin D-binding Myb-like protein"""	608491				10095122, 24958102	Standard	NR_024549		Approved	DMP1, DMTF, hDMP1, MRUL	uc003uih.3	Q9Y222	OTTHUMG00000154135	ENST00000394703.5:c.789G>A	7.37:g.86811622G>A		Somatic		Capture	SOLID	Phase_I	86649558	NM_001142327	B2RBE1|B4DJS5|Q05C48|Q59G79|Q6IS13|Q969T2|Q9H2Z2|Q9H2Z3	Silent	SNP	ENST00000394703.5	37	CCDS5601.1																																																																																				DMTF1-002	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334025.5	NM_021145	
AKAP9	10142	hgsc.bcm.edu	37	7	91726992	91726992	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:91726992A>G	ENST00000359028.2	+	42	10728	c.10503A>G	c.(10501-10503)aaA>aaG	p.K3501K	AKAP9_ENST00000356239.3_Silent_p.K3497K|AKAP9_ENST00000358100.2_Silent_p.K3447K			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	3501					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.K3497K(1)|p.K3501K(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ACTACGCTAAATTGATTGAAA	0.388			T	BRAF	papillary thyroid																																p.K3489K			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A10467G	7						.						113.0	114.0	113.0					7																	91726992		2203	4300	6503	91564928	SO:0001819	synonymous_variant	10142	exon42			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.10503A>G	7.37:g.91726992A>G		Somatic		Capture	SOLID	Phase_I	91564928	NM_147185	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Silent	SNP	ENST00000359028.2	37																																																																																					AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751	
COL1A2	1278	hgsc.bcm.edu	37	7	94049728	94049728	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:94049728C>G	ENST00000297268.6	+	36	2630	c.2159C>G	c.(2158-2160)gCt>gGt	p.A720G		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	720			Missing (in OI2). {ECO:0000269|PubMed:1339453}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.A720G(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GTCGGTCCTGCTGGCCCCAAT	0.453										HNSCC(75;0.22)																											p.A720G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2159G	7						.						89.0	86.0	87.0					7																	94049728		2203	4300	6503	93887664	SO:0001583	missense	1278	exon36			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2159C>G	7.37:g.94049728C>G	ENSP00000297268:p.Ala720Gly	Somatic		Capture	SOLID	Phase_I	93887664	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.782283	0.70222	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.93426	-3.22	5.65	5.65	0.86999	.	0.179595	0.47455	D	0.000225	D	0.91613	0.7350	L	0.50847	1.595	0.46011	D	0.998817	B	0.30104	0.268	B	0.34931	0.192	D	0.90202	0.4258	10	0.72032	D	0.01	.	13.7968	0.63175	0.0:0.9209:0.0:0.0791	.	720	P08123	CO1A2_HUMAN	G	720;721	ENSP00000297268:A720G	ENSP00000297268:A720G	A	+	2	0	COL1A2	93887664	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.985000	0.63845	2.835000	0.97688	0.650000	0.86243	GCT		COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
DLX5	1749	hgsc.bcm.edu	37	7	96650099	96650099	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:96650099C>T	ENST00000222598.4	-	3	1292	c.819G>A	c.(817-819)ccG>ccA	p.P273P	DLX5_ENST00000493764.1_5'UTR	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	273					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)	p.P273P(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					AGGAGCCCGGCGGCGGCAGGT	0.582																																					p.P273P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G819A	7						.						47.0	54.0	52.0					7																	96650099		2203	4300	6503	96488035	SO:0001819	synonymous_variant	1749	exon3				CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.819G>A	7.37:g.96650099C>T		Somatic		Capture	SOLID	Phase_I	96488035	NM_005221	B7Z4P3|Q9UPL1	Silent	SNP	ENST00000222598.4	37	CCDS5647.1																																																																																				DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334371.2		
TAC1	6863	hgsc.bcm.edu	37	7	97369205	97369205	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:97369205A>G	ENST00000319273.5	+	7	660	c.363A>G	c.(361-363)gcA>gcG	p.A121A	TAC1_ENST00000346867.4_Silent_p.A106A|TAC1_ENST00000350485.4_Silent_p.A103A	NM_003182.2	NP_003173.1	P20366	TKN1_HUMAN	tachykinin, precursor 1	121					associative learning (GO:0008306)|cell-cell signaling (GO:0007267)|detection of abiotic stimulus (GO:0009582)|inflammatory response (GO:0006954)|insemination (GO:0007320)|long-term memory (GO:0007616)|negative regulation of heart rate (GO:0010459)|neuropeptide signaling pathway (GO:0007218)|positive regulation of action potential (GO:0045760)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of ossification (GO:0045778)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of saliva secretion (GO:0046878)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of blood pressure (GO:0008217)|response to hormone (GO:0009725)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)|tachykinin receptor signaling pathway (GO:0007217)	axon (GO:0030424)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.A121A(1)		large_intestine(4)|lung(6)|urinary_tract(1)	11	all_cancers(62;3.95e-09)|all_epithelial(64;1.1e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0358)|all_lung(186;0.0384)					AAAGGAGTGCAATGCAGAATT	0.338																																					p.A106A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A318G	7						.						98.0	96.0	97.0					7																	97369205		2203	4298	6501	97207141	SO:0001819	synonymous_variant	6863	exon6			M68907	CCDS5649.1, CCDS5650.1, CCDS5651.1	7q21-q22	2013-02-26	2008-01-17		ENSG00000006128	ENSG00000006128		"""Endogenous ligands"""	11517	protein-coding gene	gene with protein product	"""substance K"", ""substance P"", ""neurokinin 1"", ""neurokinin 2"", ""neuromedin L"", ""neurokinin alpha"", ""neuropeptide K"", ""neuropeptide gamma"", ""preprotachykinin"""	162320	"""tachykinin, precursor 1 (substance K, substance P, neurokinin 1, neurokinin 2, neuromedin L, neurokinin alpha, neuropeptide K, neuropeptide gamma)"""	TAC2, NKNA		1708336	Standard	NM_003182		Approved	NPK	uc003uop.4	P20366	OTTHUMG00000154069	ENST00000319273.5:c.363A>G	7.37:g.97369205A>G		Somatic		Capture	SOLID	Phase_I	97207141	NM_013997	O60600|O60601|Q00072|Q53GH4|Q549V0|Q549V1|Q549V2|Q6FHM1	Silent	SNP	ENST00000319273.5	37	CCDS5649.1																																																																																				TAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333696.1	NM_003182	
ARPC1B	10095	hgsc.bcm.edu	37	7	98983396	98983396	+	Missense_Mutation	SNP	G	G	A	rs141634815		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:98983396G>A	ENST00000451682.1	+	4	368	c.59G>A	c.(58-60)cGc>cAc	p.R20H	ARPC1B_ENST00000474880.1_3'UTR|ARPC1A_ENST00000432884.2_Silent_p.P335P|ARPC1B_ENST00000252725.5_Missense_Mutation_p.R20H			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	20					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)	p.R20H(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			AACAAGGACCGCACCCGTGAG	0.657													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15924	0.0		0.0	False		,,,				2504	0.0				p.R20H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G59A	7						.	G	HIS/ARG	2,4402	4.2+/-10.8	0,2,2200	36.0	30.0	32.0		59	3.6	0.9	7	dbSNP_134	32	0,8600		0,0,4300	no	missense	ARPC1B	NM_005720.3	29	0,2,6500	AA,AG,GG		0.0,0.0454,0.0154	benign	20/373	98983396	2,13002	2202	4300	6502	98821332	SO:0001583	missense	10095	exon2			AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.59G>A	7.37:g.98983396G>A	ENSP00000389631:p.Arg20His	Somatic		Capture	SOLID	Phase_I	98821332	NM_005720	Q9BU00	Missense_Mutation	SNP	ENST00000451682.1	37	CCDS5661.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	17.50	3.404259	0.62288	4.54E-4	0.0	ENSG00000130429	ENST00000443222;ENST00000414376;ENST00000252725;ENST00000455009;ENST00000418347;ENST00000429246;ENST00000417330;ENST00000431816;ENST00000427217;ENST00000458033;ENST00000451682	T;T;T;T;T;T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2	4.52	3.63	0.41609	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.200571	0.41823	N	0.000807	T	0.60741	0.2292	M	0.79614	2.46	0.54753	D	0.999989	B;B	0.22800	0.075;0.075	B;B	0.13407	0.009;0.009	T	0.59899	-0.7367	10	0.41790	T	0.15	-39.2908	11.3447	0.49554	0.0905:0.0:0.9095:0.0	.	20;20	A4D275;O15143	.;ARC1B_HUMAN	H	20	ENSP00000413173:R20H;ENSP00000398620:R20H;ENSP00000252725:R20H;ENSP00000410238:R20H;ENSP00000413067:R20H;ENSP00000403324:R20H;ENSP00000398110:R20H;ENSP00000403211:R20H;ENSP00000388802:R20H;ENSP00000389631:R20H	ENSP00000252725:R20H	R	+	2	0	ARPC1B	98821332	1.000000	0.71417	0.862000	0.33874	0.958000	0.62258	6.422000	0.73357	1.035000	0.39972	0.555000	0.69702	CGC		ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335894.1	NM_005720	
AZGP1	563	hgsc.bcm.edu	37	7	99569607	99569607	+	Silent	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:99569607G>T	ENST00000292401.4	-	2	235	c.99C>A	c.(97-99)atC>atA	p.I33I	AZGP1_ENST00000411734.1_Silent_p.I30I	NM_001185.3	NP_001176.1	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc-binding	33				I -> V (in Ref. 7; AAH05306). {ECO:0000305}.	antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell adhesion (GO:0007155)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein transmembrane transport (GO:0071806)|retina homeostasis (GO:0001895)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|MHC class I protein complex (GO:0042612)|nucleus (GO:0005634)	glycoprotein binding (GO:0001948)|peptide antigen binding (GO:0042605)|protein transmembrane transporter activity (GO:0008320)|ribonuclease activity (GO:0004540)	p.I33I(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|stomach(1)	16	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GCCCAGTGTAGATATAGGTCA	0.507																																					p.I33I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C99A	7						.						71.0	69.0	69.0					7																	99569607		2203	4300	6503	99407543	SO:0001819	synonymous_variant	563	exon2			BC005306	CCDS5680.1	7q22.1	2013-01-11	2006-11-07		ENSG00000160862	ENSG00000160862		"""Immunoglobulin superfamily / C1-set domain containing"""	910	protein-coding gene	gene with protein product		194460	"""alpha-2-glycoprotein 1, zinc"""			2049092	Standard	NM_001185		Approved	ZA2G, ZAG	uc003ush.3	P25311	OTTHUMG00000023066	ENST00000292401.4:c.99C>A	7.37:g.99569607G>T		Somatic		Capture	SOLID	Phase_I	99407543	NM_001185	D6W5T8|O60386|Q5XKQ4|Q8N4N0	Silent	SNP	ENST00000292401.4	37	CCDS5680.1	.	.	.	.	.	.	.	.	.	.	G	6.978	0.550382	0.13374	.	.	ENSG00000160862	ENST00000419575	.	.	.	1.51	1.51	0.23008	.	.	.	.	.	T	0.52964	0.1767	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47471	-0.9115	4	.	.	.	.	6.4356	0.21821	0.0:0.0:1.0:0.0	.	.	.	.	Y	4	.	.	S	-	2	0	AZGP1	99407543	0.142000	0.22610	0.870000	0.34147	0.150000	0.21749	0.683000	0.25349	1.130000	0.42092	0.313000	0.20887	TCT		AZGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059387.4	NM_001185	
GPC2	221914	hgsc.bcm.edu	37	7	99773337	99773337	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:99773337T>C	ENST00000292377.2	-	3	673	c.506A>G	c.(505-507)cAg>cGg	p.Q169R	STAG3_ENST00000394018.2_5'Flank|STAG3_ENST00000426455.1_5'Flank|GPC2_ENST00000471050.1_5'Flank|STAG3_ENST00000317296.5_5'Flank	NM_152742.1	NP_689955.1	Q8N158	GPC2_HUMAN	glypican 2	169					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuron differentiation (GO:0030182)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	anchored component of membrane (GO:0031225)|endoplasmic reticulum (GO:0005783)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.Q169R(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(3)	18	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTCCAGGAGCTGTGCCCAGAA	0.587																																					p.Q169R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A506G	7						.						71.0	65.0	67.0					7																	99773337		2203	4300	6503	99611273	SO:0001583	missense	221914	exon3			BX375153	CCDS5689.1	7q22.1	2007-02-16	2007-02-15		ENSG00000213420	ENSG00000213420		"""Proteoglycans / Cell Surface : Glypicans"""	4450	protein-coding gene	gene with protein product	"""glypican proteoglycan 2, cerebroglycan proteoglycan"""		"""glypican 2 (cerebroglycan)"""			8294498	Standard	NM_152742		Approved	cerebroglycan, FLJ38962, DKFZp547M109	uc003utv.3	Q8N158	OTTHUMG00000154894	ENST00000292377.2:c.506A>G	7.37:g.99773337T>C	ENSP00000292377:p.Gln169Arg	Somatic		Capture	SOLID	Phase_I	99611273	NM_152742	A4D2A7	Missense_Mutation	SNP	ENST00000292377.2	37	CCDS5689.1	.	.	.	.	.	.	.	.	.	.	T	3.842	-0.033572	0.07543	.	.	ENSG00000213420	ENST00000292377	T	0.45276	0.9	5.06	5.06	0.68205	.	0.068416	0.64402	D	0.000012	T	0.21468	0.0517	N	0.10972	0.075	0.26769	N	0.969842	B	0.25272	0.122	B	0.29267	0.1	T	0.20605	-1.0270	10	0.02654	T	1	-14.2704	11.1947	0.48707	0.0:0.0:0.0:1.0	.	169	Q8N158	GPC2_HUMAN	R	169	ENSP00000292377:Q169R	ENSP00000292377:Q169R	Q	-	2	0	GPC2	99611273	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.948000	0.56660	1.913000	0.55393	0.255000	0.18592	CAG		GPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337556.1	NM_152742	
GIMAP8	155038	hgsc.bcm.edu	37	7	150164345	150164345	+	Missense_Mutation	SNP	C	C	T	rs540607407		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr7:150164345C>T	ENST00000307271.3	+	2	1133	c.559C>T	c.(559-561)Cgc>Tgc	p.R187C		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	187	AIG1-type G 1.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.R187C(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GGAGCTCCTTCGCAAGGTTGA	0.433													C|||	1	0.000199681	0.0	0.0	5008	,	,		19577	0.001		0.0	False		,,,				2504	0.0				p.R187C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C559T	7						.						117.0	108.0	111.0					7																	150164345		2203	4300	6503	149795278	SO:0001583	missense	155038	exon2			AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.559C>T	7.37:g.150164345C>T	ENSP00000305107:p.Arg187Cys	Somatic		Capture	SOLID	Phase_I	149795278	NM_175571		Missense_Mutation	SNP	ENST00000307271.3	37	CCDS34777.1	.	.	.	.	.	.	.	.	.	.	C	3.887	-0.024806	0.07589	.	.	ENSG00000171115	ENST00000307271	T	0.62788	-0.0	4.16	-8.31	0.01001	AIG1 (1);	2.904720	0.01179	N	0.007058	T	0.37999	0.1024	N	0.11131	0.1	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.39522	-0.9610	10	0.49607	T	0.09	.	5.0177	0.14345	0.1655:0.3011:0.4288:0.1046	.	187	Q8ND71	GIMA8_HUMAN	C	187	ENSP00000305107:R187C	ENSP00000305107:R187C	R	+	1	0	GIMAP8	149795278	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.937000	0.00049	-4.029000	0.00080	-1.974000	0.00461	CGC		GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571	
SNAP25	6616	hgsc.bcm.edu	37	20	10265390	10265390	+	Silent	SNP	A	A	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:10265390A>C	ENST00000254976.2	+	4	344	c.133A>C	c.(133-135)Agg>Cgg	p.R45R	SNAP25_ENST00000304886.2_Silent_p.R45R|SNAP25-AS1_ENST00000421143.2_RNA|SNAP25-AS1_ENST00000453544.1_RNA	NM_130811.2	NP_570824.1	P60880	SNP25_HUMAN	synaptosomal-associated protein, 25kDa	45	Interaction with CENPF. {ECO:0000250}.|t-SNARE coiled-coil homology 1. {ECO:0000255|PROSITE-ProRule:PRU00202}.				energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long-term synaptic potentiation (GO:0060291)|neurotransmitter secretion (GO:0007269)|neurotransmitter uptake (GO:0001504)|regulation of establishment of protein localization (GO:0070201)|regulation of insulin secretion (GO:0050796)|regulation of neuron projection development (GO:0010975)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|SNARE complex (GO:0031201)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin I complex (GO:0070032)|trans-Golgi network (GO:0005802)	calcium-dependent protein binding (GO:0048306)	p.R45R(1)		endometrium(1)|large_intestine(2)|lung(8)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	18					Botulinum Toxin Type A(DB00083)	TGCTGGTATCAGGACTTTGGT	0.343																																					p.R45R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A133C	20						.						182.0	184.0	183.0					20																	10265390		2203	4300	6503	10213390	SO:0001819	synonymous_variant	6616	exon4				CCDS13109.1, CCDS13110.1	20p12-p11.2	2008-08-01	2002-08-29		ENSG00000132639	ENSG00000132639			11132	protein-coding gene	gene with protein product	"""resistance to inhibitors of cholinesterase 4 homolog"""	600322	"""synaptosomal-associated protein, 25kD"""	SNAP		8661740, 10692432	Standard	NM_003081		Approved	SNAP-25, RIC-4, RIC4, SEC9, bA416N4.2, dJ1068F16.2	uc002wnr.2	P60880	OTTHUMG00000031863	ENST00000254976.2:c.133A>C	20.37:g.10265390A>C		Somatic		Capture	SOLID	Phase_I	10213390	NM_130811	B2RAU4|D3DW16|D3DW17|P13795|P36974|P70557|P70558|Q53EM2|Q5U0B5|Q8IXK3|Q96FM2|Q9BR45	Silent	SNP	ENST00000254976.2	37	CCDS13110.1																																																																																				SNAP25-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077976.3	NM_130811	
JAG1	182	hgsc.bcm.edu	37	20	10622537	10622537	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:10622537G>T	ENST00000254958.5	-	22	3091	c.2576C>A	c.(2575-2577)tCa>tAa	p.S859*	JAG1_ENST00000423891.2_Nonsense_Mutation_p.S700*	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	859					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)	p.S859*(2)		biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						AGGTCTCCCTGAAACTGACAG	0.512									Alagille Syndrome																												p.S859X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C2576A	20						.						152.0	136.0	142.0					20																	10622537		2203	4300	6503	10570537	SO:0001587	stop_gained	182	exon22	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.2576C>A	20.37:g.10622537G>T	ENSP00000254958:p.Ser859*	Somatic		Capture	SOLID	Phase_I	10570537	NM_000214	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Nonsense_Mutation	SNP	ENST00000254958.5	37	CCDS13112.1	.	.	.	.	.	.	.	.	.	.	G	42	9.783937	0.99263	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	.	.	.	5.84	5.84	0.93424	.	0.231830	0.44285	D	0.000471	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	20.1381	0.98040	0.0:0.0:1.0:0.0	.	.	.	.	X	859;700	.	ENSP00000254958:S859X	S	-	2	0	JAG1	10570537	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.923000	0.63412	2.763000	0.94921	0.650000	0.86243	TCA		JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
TGM3	7053	hgsc.bcm.edu	37	20	2315876	2315876	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:2315876T>A	ENST00000381458.5	+	11	1820	c.1757T>A	c.(1756-1758)gTg>gAg	p.V586E		NM_003245.3	NP_003236.3	Q08188	TGM3_HUMAN	transglutaminase 3	586					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|hair follicle morphogenesis (GO:0031069)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	calcium ion binding (GO:0005509)|catalytic activity (GO:0003824)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|transferase activity, transferring acyl groups (GO:0016746)	p.V586E(1)		breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(11)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	39					L-Glutamine(DB00130)	GAGGTGGTGGTGGAGCGGGAC	0.577																																					p.V586E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1757A	20						.						165.0	131.0	143.0					20																	2315876		2203	4300	6503	2263876	SO:0001583	missense	7053	exon11			L10386	CCDS33435.1	20q11.2	2013-05-02	2013-05-02		ENSG00000125780	ENSG00000125780	2.3.2.13	"""Transglutaminases"""	11779	protein-coding gene	gene with protein product	"""E polypeptide, protein-glutamine-gamma-glutamyltransferase"""	600238	"""transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7851911, 9452468	Standard	NM_003245		Approved	TGE	uc002wfx.4	Q08188	OTTHUMG00000031690	ENST00000381458.5:c.1757T>A	20.37:g.2315876T>A	ENSP00000370867:p.Val586Glu	Somatic		Capture	SOLID	Phase_I	2263876	NM_003245	A8K5N6|B2RCR6|D3DVX1|O95933|Q32ML9|Q32MM0	Missense_Mutation	SNP	ENST00000381458.5	37	CCDS33435.1	.	.	.	.	.	.	.	.	.	.	T	18.11	3.550700	0.65311	.	.	ENSG00000125780	ENST00000381458	T	0.72835	-0.69	5.13	5.13	0.70059	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.122249	0.56097	D	0.000036	D	0.82323	0.5012	M	0.81942	2.565	0.51767	D	0.999934	D	0.67145	0.996	P	0.62435	0.902	D	0.85132	0.0975	10	0.87932	D	0	-13.6601	12.8871	0.58051	0.0:0.0:0.0:1.0	.	586	Q08188	TGM3_HUMAN	E	586	ENSP00000370867:V586E	ENSP00000370867:V586E	V	+	2	0	TGM3	2263876	1.000000	0.71417	0.995000	0.50966	0.810000	0.45777	3.784000	0.55416	1.914000	0.55421	0.459000	0.35465	GTG		TGM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077579.2	NM_003245	
KIF16B	55614	hgsc.bcm.edu	37	20	16387053	16387053	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:16387053G>A	ENST00000354981.2	-	16	1818	c.1661C>T	c.(1660-1662)cCa>cTa	p.P554L	KIF16B_ENST00000355755.3_Missense_Mutation_p.P554L|KIF16B_ENST00000408042.1_Missense_Mutation_p.P554L|KIF16B_ENST00000378003.2_5'UTR	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	554					ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)	p.P554L(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						GGCTTCCTTTGGATGGTTAAA	0.478																																					p.P554L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1661T	20						.						232.0	210.0	217.0					20																	16387053		2203	4300	6503	16335053	SO:0001583	missense	55614	exon16			AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.1661C>T	20.37:g.16387053G>A	ENSP00000347076:p.Pro554Leu	Somatic		Capture	SOLID	Phase_I	16335053	NM_024704	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	ENST00000354981.2	37	CCDS13122.1	.	.	.	.	.	.	.	.	.	.	G	34	5.314254	0.95655	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997;ENST00000408042	D;D;D	0.86694	-2.16;-2.07;-2.03	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.92384	0.7583	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.92418	0.5943	10	0.87932	D	0	.	19.1462	0.93469	0.0:0.0:1.0:0.0	.	554;554;554;554	Q96L93-4;Q96L93-2;Q96L93-6;Q96L93	.;.;.;KI16B_HUMAN	L	554	ENSP00000347076:P554L;ENSP00000347995:P554L;ENSP00000384164:P554L	ENSP00000347076:P554L	P	-	2	0	KIF16B	16335053	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	8.940000	0.92958	2.817000	0.96982	0.563000	0.77884	CCA		KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683	
UBOX5	22888	hgsc.bcm.edu	37	20	3102778	3102778	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:3102778G>A	ENST00000217173.2	-	3	978	c.507C>T	c.(505-507)caC>caT	p.H169H	UBOX5-AS1_ENST00000446537.1_RNA|UBOX5_ENST00000348031.2_Silent_p.H169H	NM_001267584.1|NM_014948.3	NP_001254513.1|NP_055763.1			U-box domain containing 5									p.H169H(1)		endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	20						AGTGGGCCACGTGGCTAAGGG	0.602																																					p.H169H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C507T	20						.						66.0	61.0	63.0					20																	3102778		2203	4300	6503	3050778	SO:0001819	synonymous_variant	22888	exon3			AB020667	CCDS13046.1, CCDS13047.1	20p13	2013-01-28			ENSG00000185019	ENSG00000185019		"""RING-type (C3HC4) zinc fingers"", ""U-box domain containing"""	17777	protein-coding gene	gene with protein product						11274149	Standard	NM_014948		Approved	UIP5, KIAA0860, Ubce7ip5, RNF37	uc002whw.4	O94941	OTTHUMG00000031731	ENST00000217173.2:c.507C>T	20.37:g.3102778G>A		Somatic		Capture	SOLID	Phase_I	3050778	NM_014948		Silent	SNP	ENST00000217173.2	37	CCDS13046.1																																																																																				UBOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077706.2	NM_014948	
COX4I2	84701	hgsc.bcm.edu	37	20	30227794	30227794	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:30227794C>T	ENST00000376075.3	+	3	216	c.141C>T	c.(139-141)ccC>ccT	p.P47P	COX4I2_ENST00000490030.1_3'UTR	NM_032609.2	NP_115998.2	Q96KJ9	COX42_HUMAN	cytochrome c oxidase subunit IV isoform 2 (lung)	47					cellular respiration (GO:0045333)|generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)	mitochondrial respiratory chain complex IV (GO:0005751)	cytochrome-c oxidase activity (GO:0004129)	p.P47P(1)		breast(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	11	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.01e-05)|all cancers(5;9.46e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00121)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			GCTACTACCCCATGCCAGAAG	0.612																																					p.P47P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C141T	20						.						77.0	66.0	70.0					20																	30227794		2203	4300	6503	29691455	SO:0001819	synonymous_variant	84701	exon3			AF257180	CCDS13187.1	20q11.21	2011-07-04	2004-08-11		ENSG00000131055	ENSG00000131055		"""Mitochondrial respiratory chain complex / Complex IV"""	16232	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit IV-like 2"""	607976	"""cytochrome c oxidase subunit IV isoform 2"""	COX4L2		11311561, 17937768	Standard	NM_032609		Approved	COXIV-2, COX4B, dJ857M17.2, COX4-2	uc002wwj.1	Q96KJ9	OTTHUMG00000032180	ENST00000376075.3:c.141C>T	20.37:g.30227794C>T		Somatic		Capture	SOLID	Phase_I	29691455	NM_032609	Q6GTF4|Q9H0Z4	Silent	SNP	ENST00000376075.3	37	CCDS13187.1																																																																																				COX4I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078548.1	NM_032609	
FAM83C	128876	hgsc.bcm.edu	37	20	33875111	33875111	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:33875111T>C	ENST00000374408.3	-	4	1567	c.1471A>G	c.(1471-1473)Aca>Gca	p.T491A	EIF6_ENST00000374436.3_5'Flank|EIF6_ENST00000374450.3_5'Flank|EIF6_ENST00000462894.1_5'Flank|EIF6_ENST00000374443.3_5'Flank|FAM83C-AS1_ENST00000429167.1_RNA	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	491								p.T491A(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			TCCTCCACTGTCTCCAGGGTT	0.637																																					p.T491A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1471G	20						.						46.0	44.0	45.0					20																	33875111		2166	4262	6428	33338525	SO:0001583	missense	128876	exon4			AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.1471A>G	20.37:g.33875111T>C	ENSP00000363529:p.Thr491Ala	Somatic		Capture	SOLID	Phase_I	33338525	NM_178468	Q14D67|Q5JWN6|Q8N276	Missense_Mutation	SNP	ENST00000374408.3	37	CCDS13251.1	.	.	.	.	.	.	.	.	.	.	T	5.802	0.332240	0.10956	.	.	ENSG00000125998	ENST00000374408	T	0.06142	3.34	4.29	0.675	0.17952	.	0.870245	0.10121	N	0.713354	T	0.07818	0.0196	M	0.72353	2.195	0.33312	D	0.566188	B	0.12013	0.005	B	0.09377	0.004	T	0.14172	-1.0482	10	0.27785	T	0.31	-17.3291	4.7048	0.12844	0.0:0.1876:0.1648:0.6477	.	491	Q9BQN1	FA83C_HUMAN	A	491	ENSP00000363529:T491A	ENSP00000363529:T491A	T	-	1	0	FAM83C	33338525	0.307000	0.24500	0.996000	0.52242	0.199000	0.23934	0.033000	0.13754	0.265000	0.21872	-0.488000	0.04728	ACA		FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078854.3		
EPB41L1	2036	hgsc.bcm.edu	37	20	34773199	34773199	+	Missense_Mutation	SNP	G	G	A	rs199985301		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:34773199G>A	ENST00000338074.2	+	7	888	c.727G>A	c.(727-729)Gcc>Acc	p.A243T	EPB41L1_ENST00000202028.5_Missense_Mutation_p.A181T|EPB41L1_ENST00000373950.2_Missense_Mutation_p.A146T|EPB41L1_ENST00000373941.1_Missense_Mutation_p.A243T|EPB41L1_ENST00000373946.3_Missense_Mutation_p.A212T|EPB41L1_ENST00000441639.1_Missense_Mutation_p.A181T	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	243	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.A243T(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					GCTCCGCTTCGCCCCTAACCA	0.592																																					p.A243T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G727A	20						.						56.0	51.0	53.0					20																	34773199		2203	4300	6503	34236613	SO:0001583	missense	2036	exon7			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.727G>A	20.37:g.34773199G>A	ENSP00000337168:p.Ala243Thr	Somatic		Capture	SOLID	Phase_I	34236613	NM_012156	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	ENST00000338074.2	37	CCDS13271.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.918626	0.92249	.	.	ENSG00000088367	ENST00000202028;ENST00000430276;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000397307;ENST00000441639;ENST00000373946;ENST00000373945;ENST00000338074;ENST00000373941	T;T;T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13	5.33	5.33	0.75918	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	.	.	.	.	D	0.89008	0.6593	M	0.90759	3.145	0.58432	D	0.999996	D;D;D;D;D;D	0.89917	0.999;1.0;0.999;0.998;0.986;0.999	D;D;P;P;P;P	0.68192	0.956;0.909;0.886;0.908;0.746;0.893	D	0.90804	0.4696	9	0.87932	D	0	.	12.6697	0.56860	0.0:0.0:0.8348:0.1652	.	243;243;212;146;146;181	B7Z653;Q9H4G0;Q9H4G0-4;Q9H4G0-3;B3KUB6;Q9H4G0-2	.;E41L1_HUMAN;.;.;.;.	T	181;181;146;243;146;181;181;212;181;243;243	ENSP00000202028:A181T;ENSP00000404341:A181T;ENSP00000363061:A146T;ENSP00000399214:A181T;ENSP00000363057:A212T;ENSP00000363056:A181T;ENSP00000337168:A243T;ENSP00000363052:A243T	ENSP00000202028:A181T	A	+	1	0	EPB41L1	34236613	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	7.871000	0.87180	2.488000	0.83962	0.655000	0.94253	GCC		EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
SMOX	54498	hgsc.bcm.edu	37	20	4155822	4155822	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:4155822C>T	ENST00000305958.4	+	2	345	c.120C>T	c.(118-120)gcC>gcT	p.A40A	SMOX_ENST00000379460.2_Silent_p.A40A|SMOX_ENST00000346595.2_Silent_p.A40A|SMOX_ENST00000484515.1_3'UTR|SMOX_ENST00000339123.6_Silent_p.A40A|SMOX_ENST00000278795.3_Silent_p.A40A	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase	40					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)	p.A40A(2)		breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	TGGCTGCAGCCAAAGCACTTC	0.612																																					p.A40A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C120T	20						.						117.0	105.0	109.0					20																	4155822		2203	4300	6503	4103822	SO:0001819	synonymous_variant	54498	exon2			AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.120C>T	20.37:g.4155822C>T		Somatic		Capture	SOLID	Phase_I	4103822	NM_175841	A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Silent	SNP	ENST00000305958.4	37	CCDS13075.1																																																																																				SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077806.1	NM_175842	
EPB41L1	2036	hgsc.bcm.edu	37	20	34775666	34775666	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:34775666T>C	ENST00000338074.2	+	8	1015	c.854T>C	c.(853-855)gTa>gCa	p.V285A	EPB41L1_ENST00000202028.5_Missense_Mutation_p.V223A|EPB41L1_ENST00000373950.2_Missense_Mutation_p.V188A|EPB41L1_ENST00000373941.1_Missense_Mutation_p.V285A|EPB41L1_ENST00000373946.3_Missense_Mutation_p.V254A|EPB41L1_ENST00000441639.1_Missense_Mutation_p.V223A	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	285	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.V285A(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					ATGTACGGAGTAGACCTGCAC	0.542																																					p.V285A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T854C	20						.						76.0	64.0	68.0					20																	34775666		2203	4300	6503	34239080	SO:0001583	missense	2036	exon8			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.854T>C	20.37:g.34775666T>C	ENSP00000337168:p.Val285Ala	Somatic		Capture	SOLID	Phase_I	34239080	NM_012156	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	ENST00000338074.2	37	CCDS13271.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.985081	0.93044	.	.	ENSG00000088367	ENST00000202028;ENST00000430276;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000441639;ENST00000373946;ENST00000338074;ENST00000373941	T;T;T;T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.3	5.65	5.65	0.86999	Band 4.1 domain (1);FERM central domain (1);FERM domain (1);Pleckstrin homology-type (1);FERM conserved site (1);	.	.	.	.	D	0.93314	0.7869	H	0.97214	3.96	0.80722	D	1	D;D;D;D;D;D	0.89917	0.994;1.0;0.996;0.998;0.992;1.0	D;D;D;D;D;D	0.91635	0.982;0.999;0.969;0.99;0.989;0.989	D	0.95350	0.8446	9	0.87932	D	0	.	14.8428	0.70237	0.0:0.0:0.0:1.0	.	285;285;254;188;188;223	B7Z653;Q9H4G0;Q9H4G0-4;Q9H4G0-3;B3KUB6;Q9H4G0-2	.;E41L1_HUMAN;.;.;.;.	A	223;223;188;285;188;223;254;285;285	ENSP00000202028:V223A;ENSP00000404341:V223A;ENSP00000363061:V188A;ENSP00000399214:V223A;ENSP00000363057:V254A;ENSP00000337168:V285A;ENSP00000363052:V285A	ENSP00000202028:V223A	V	+	2	0	EPB41L1	34239080	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.868000	0.87116	2.371000	0.80710	0.533000	0.62120	GTA		EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
RIMS4	140730	hgsc.bcm.edu	37	20	43400030	43400030	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:43400030G>A	ENST00000372851.3	-	2	188	c.122C>T	c.(121-123)gCc>gTc	p.A41V	RIMS4_ENST00000541604.2_Missense_Mutation_p.A42V	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4	41					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)		p.A41V(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				CCTCTGGATGGCCCCCTTCAG	0.622																																					p.A41V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C122T	20						.						68.0	64.0	66.0					20																	43400030		2203	4300	6503	42833444	SO:0001583	missense	140730	exon2				CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546	ENST00000372851.3:c.122C>T	20.37:g.43400030G>A	ENSP00000361942:p.Ala41Val	Somatic		Capture	SOLID	Phase_I	42833444	NM_182970	A4FU94|E1P613|Q3MI44|Q5JWT7	Missense_Mutation	SNP	ENST00000372851.3	37	CCDS13338.1	.	.	.	.	.	.	.	.	.	.	G	18.89	3.718569	0.68844	.	.	ENSG00000101098	ENST00000372851;ENST00000541604	T;T	0.21932	2.03;1.98	4.37	4.37	0.52481	.	0.114561	0.64402	D	0.000017	T	0.20047	0.0482	L	0.38531	1.155	0.53688	D	0.999975	B;B	0.20780	0.048;0.048	B;B	0.17098	0.017;0.017	T	0.04203	-1.0969	10	0.49607	T	0.09	.	17.2658	0.87086	0.0:0.0:1.0:0.0	.	42;41	E1P613;Q9H426	.;RIMS4_HUMAN	V	41;42	ENSP00000361942:A41V;ENSP00000439287:A42V	ENSP00000361942:A41V	A	-	2	0	RIMS4	42833444	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.476000	0.66793	2.148000	0.66965	0.551000	0.68910	GCC		RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101027.2	NM_182970	
PCIF1	63935	hgsc.bcm.edu	37	20	44575769	44575769	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:44575769C>T	ENST00000372409.3	+	15	2035	c.1671C>T	c.(1669-1671)tgC>tgT	p.C557C	PCIF1_ENST00000479348.1_3'UTR	NM_022104.3	NP_071387.1	Q9H4Z3	PCIF1_HUMAN	PDX1 C-terminal inhibiting factor 1	557					negative regulation of phosphatase activity (GO:0010923)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)		p.C557C(1)		central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	20						CTCCCTTCTGCGAGGAGCTCA	0.582																																					p.C557C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1671T	20						.						165.0	139.0	148.0					20																	44575769		2203	4300	6503	44009176	SO:0001819	synonymous_variant	63935	exon15			AB050014	CCDS13388.1	20q13.12	2014-06-13	2008-04-29	2008-04-29	ENSG00000100982	ENSG00000100982			16200	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 121"""		"""chromosome 20 open reading frame 67"""	C20orf67		12565871, 15121856	Standard	NM_022104		Approved	bA465L10.1, PPP1R121	uc002xqs.3	Q9H4Z3	OTTHUMG00000032635	ENST00000372409.3:c.1671C>T	20.37:g.44575769C>T		Somatic		Capture	SOLID	Phase_I	44009176	NM_022104	E1P5P1|Q54AB9|Q9NT85	Silent	SNP	ENST00000372409.3	37	CCDS13388.1																																																																																				PCIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079550.1	NM_022104	
ELMO2	63916	hgsc.bcm.edu	37	20	44996094	44996094	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:44996094G>A	ENST00000290246.6	-	22	2262	c.2068C>T	c.(2068-2070)Cgg>Tgg	p.R690W	ELMO2_ENST00000352077.2_Missense_Mutation_p.R688W|ELMO2_ENST00000372176.1_Missense_Mutation_p.R602W|ELMO2_ENST00000445496.2_Missense_Mutation_p.R507W|ELMO2_ENST00000439931.2_Missense_Mutation_p.R702W|ELMO2_ENST00000396391.1_Missense_Mutation_p.R690W|ELMO2_ENST00000454865.2_Missense_Mutation_p.R422W	NM_133171.3	NP_573403.1	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	690					apoptotic process (GO:0006915)|cell chemotaxis (GO:0060326)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	receptor tyrosine kinase binding (GO:0030971)	p.R690W(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)				TCCAGGAGCCGCAGCTTCATC	0.577																																					p.R690W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2068T	20						.						74.0	64.0	67.0					20																	44996094		2203	4300	6503	44429501	SO:0001583	missense	63916	exon21			AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598		"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_133171		Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.2068C>T	20.37:g.44996094G>A	ENSP00000290246:p.Arg690Trp	Somatic		Capture	SOLID	Phase_I	44429501	NM_182764	E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	Missense_Mutation	SNP	ENST00000290246.6	37	CCDS13398.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116432	0.77323	.	.	ENSG00000062598	ENST00000290246;ENST00000372176;ENST00000452857;ENST00000396391;ENST00000439931;ENST00000445496;ENST00000454865;ENST00000352077	T;T;T;T;T;T;T;T	0.57752	2.03;1.77;0.38;2.03;2.02;1.47;1.55;2.02	5.08	5.08	0.68730	.	0.110776	0.64402	D	0.000006	T	0.73125	0.3547	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.76745	-0.2846	10	0.87932	D	0	-17.2637	14.2227	0.65839	0.0:0.0:0.8505:0.1494	.	702;422;690	B4DRL5;B4DZ20;Q96JJ3	.;.;ELMO2_HUMAN	W	690;602;253;690;702;507;422;688	ENSP00000290246:R690W;ENSP00000361249:R602W;ENSP00000414329:R253W;ENSP00000379673:R690W;ENSP00000396519:R702W;ENSP00000409920:R507W;ENSP00000415641:R422W;ENSP00000326172:R688W	ENSP00000290246:R690W	R	-	1	2	ELMO2	44429501	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.505000	0.60421	2.632000	0.89209	0.591000	0.81541	CGG		ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080466.1	NM_022086	
SULF2	55959	hgsc.bcm.edu	37	20	46313276	46313276	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:46313276G>A	ENST00000359930.4	-	6	1638	c.787C>T	c.(787-789)Cgc>Tgc	p.R263C	CTD-2653D5.1_ENST00000526566.2_RNA|SULF2_ENST00000361612.4_Missense_Mutation_p.R263C|SULF2_ENST00000484875.1_Missense_Mutation_p.R263C|SULF2_ENST00000467815.1_Missense_Mutation_p.R263C	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	263					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.R263C(2)		breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						CCCGTGTAGCGCATGATCCAG	0.597																																					p.R263C												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C787T	20						.						166.0	112.0	131.0					20																	46313276		2203	4300	6503	45746683	SO:0001583	missense	55959	exon6			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.787C>T	20.37:g.46313276G>A	ENSP00000353007:p.Arg263Cys	Somatic		Capture	SOLID	Phase_I	45746683	NM_198596	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	ENST00000359930.4	37	CCDS13408.1	.	.	.	.	.	.	.	.	.	.	g	24.6	4.554787	0.86231	.	.	ENSG00000196562	ENST00000359930;ENST00000484875;ENST00000361612;ENST00000467815	D;D;D;D	0.99259	-5.64;-5.64;-5.63;-5.63	4.62	3.62	0.41486	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.049944	0.85682	D	0.000000	D	0.99447	0.9804	M	0.91090	3.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.949;1.0	D	0.98012	1.0366	10	0.87932	D	0	-24.0617	13.2873	0.60251	0.0:0.0:0.7507:0.2493	.	263;263	Q8IWU5-2;Q8IWU5	.;SULF2_HUMAN	C	263	ENSP00000353007:R263C;ENSP00000418290:R263C;ENSP00000354662:R263C;ENSP00000418442:R263C	ENSP00000353007:R263C	R	-	1	0	SULF2	45746683	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.838000	0.39211	2.401000	0.81631	0.537000	0.68136	CGC		SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837	
PREX1	57580	hgsc.bcm.edu	37	20	47292800	47292800	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:47292800A>G	ENST00000371941.3	-	14	1618	c.1596T>C	c.(1594-1596)cgT>cgC	p.R532R	PREX1_ENST00000396220.1_Silent_p.R532R	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	532	DEP 2. {ECO:0000255|PROSITE- ProRule:PRU00066}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R532R(2)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GGTGGTAATCACGGTCTCTGT	0.632																																					p.R532R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1596C	20						.						144.0	112.0	123.0					20																	47292800		2203	4300	6503	46726207	SO:0001819	synonymous_variant	57580	exon14			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.1596T>C	20.37:g.47292800A>G		Somatic		Capture	SOLID	Phase_I	46726207	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	37	CCDS13410.1																																																																																				PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
SLC9A8	23315	hgsc.bcm.edu	37	20	48497477	48497477	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:48497477G>A	ENST00000361573.2	+	13	1217	c.1175G>A	c.(1174-1176)gGc>gAc	p.G392D	SLC9A8_ENST00000541138.1_Missense_Mutation_p.G92D|SLC9A8_ENST00000539601.1_Missense_Mutation_p.G173D|SLC9A8_ENST00000417961.1_Missense_Mutation_p.G408D			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	392					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)	p.G392D(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			GTACTATTTGGCAGAGCGGTA	0.418																																					p.G392D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1175A	20						.						201.0	171.0	181.0					20																	48497477		2203	4300	6503	47930884	SO:0001583	missense	23315	exon13			AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.1175G>A	20.37:g.48497477G>A	ENSP00000354966:p.Gly392Asp	Somatic		Capture	SOLID	Phase_I	47930884	NM_015266	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Missense_Mutation	SNP	ENST00000361573.2	37	CCDS13421.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661560	0.88154	.	.	ENSG00000197818	ENST00000417961;ENST00000361573;ENST00000541138;ENST00000539601	T;T;T;T	0.18657	2.2;2.2;2.2;2.2	5.62	4.67	0.58626	Cation/H+ exchanger (1);	0.045508	0.85682	D	0.000000	T	0.60064	0.2240	H	0.95328	3.655	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.995	T	0.74754	-0.3558	10	0.62326	D	0.03	.	16.6562	0.85229	0.0:0.1298:0.8702:0.0	.	92;173;392	B4DIV9;B4DIX7;Q9Y2E8	.;.;SL9A8_HUMAN	D	408;392;92;173	ENSP00000416418:G408D;ENSP00000354966:G392D;ENSP00000441615:G92D;ENSP00000441716:G173D	ENSP00000354966:G392D	G	+	2	0	SLC9A8	47930884	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.838000	0.86804	1.358000	0.45922	0.561000	0.74099	GGC		SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106483.3	XM_030524	
PTPN1	5770	hgsc.bcm.edu	37	20	49195807	49195807	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:49195807T>G	ENST00000371621.3	+	7	979	c.805T>G	c.(805-807)Ttc>Gtc	p.F269V	RP4-530I15.9_ENST00000431019.1_RNA|PTPN1_ENST00000541713.1_Missense_Mutation_p.F196V	NM_001278618.1|NM_002827.2	NP_001265547.1|NP_002818.1	P18031	PTN1_HUMAN	protein tyrosine phosphatase, non-receptor type 1	269	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine dephosphorylation involved in inactivation of protein kinase activity (GO:1990264)|platelet activation (GO:0030168)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|regulation of endocytosis (GO:0030100)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of signal transduction (GO:0009966)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|sorting endosome (GO:0097443)	enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|zinc ion binding (GO:0008270)	p.F269V(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(2)	16		Lung NSC(126;0.163)			Tiludronate(DB01133)	CCAGCTGCGCTTCTCCTACCT	0.498																																					p.F269V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T805G	20						.						138.0	141.0	140.0					20																	49195807		2203	4300	6503	48629214	SO:0001583	missense	5770	exon7				CCDS13430.1, CCDS63309.1	20q13.1-q13.2	2011-06-09			ENSG00000196396	ENSG00000196396		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9642	protein-coding gene	gene with protein product		176885		PTP1B		2164224	Standard	NM_002827		Approved		uc002xvl.3	P18031	OTTHUMG00000032729	ENST00000371621.3:c.805T>G	20.37:g.49195807T>G	ENSP00000360683:p.Phe269Val	Somatic		Capture	SOLID	Phase_I	48629214	NM_002827	Q5TGD8|Q9BQV9|Q9NQQ4	Missense_Mutation	SNP	ENST00000371621.3	37	CCDS13430.1	.	.	.	.	.	.	.	.	.	.	T	32	5.113121	0.94339	.	.	ENSG00000196396	ENST00000371621;ENST00000541713	D;D	0.86366	-2.11;-2.11	5.64	5.64	0.86602	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.000000	0.64402	D	0.000002	D	0.96565	0.8879	H	0.99225	4.475	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98419	1.0576	10	0.87932	D	0	.	15.8548	0.78968	0.0:0.0:0.0:1.0	.	269	P18031	PTN1_HUMAN	V	269;196	ENSP00000360683:F269V;ENSP00000437732:F196V	ENSP00000360683:F269V	F	+	1	0	PTPN1	48629214	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	8.040000	0.89188	2.138000	0.66242	0.460000	0.39030	TTC		PTPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079694.2		
ATP9A	10079	hgsc.bcm.edu	37	20	50234050	50234050	+	Nonsense_Mutation	SNP	G	G	T	rs570532955	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr20:50234050G>T	ENST00000338821.5	-	22	2658	c.2394C>A	c.(2392-2394)tgC>tgA	p.C798*	ATP9A_ENST00000402822.1_Nonsense_Mutation_p.C677*|ATP9A_ENST00000311637.5_Nonsense_Mutation_p.C662*	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	798					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.C798*(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CTCCCACGCCGCAGTCAGATT	0.493																																					p.C798X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2394A	20						.						132.0	83.0	100.0					20																	50234050		2203	4300	6503	49667457	SO:0001587	stop_gained	10079	exon22			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.2394C>A	20.37:g.50234050G>T	ENSP00000342481:p.Cys798*	Somatic		Capture	SOLID	Phase_I	49667457	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Nonsense_Mutation	SNP	ENST00000338821.5	37	CCDS33489.1	.	.	.	.	.	.	.	.	.	.	G	40	8.071656	0.98640	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	.	.	.	5.15	1.89	0.25635	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-29.2721	9.492	0.38965	0.4542:0.0:0.5458:0.0	.	.	.	.	X	662;798;677	.	ENSP00000309086:C662X	C	-	3	2	ATP9A	49667457	0.979000	0.34478	0.999000	0.59377	0.474000	0.32979	0.335000	0.19806	0.133000	0.18654	0.511000	0.50034	TGC		ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
NDRG2	57447	hgsc.bcm.edu	37	14	21490632	21490632	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr14:21490632C>T	ENST00000556147.1	-	4	1082	c.142G>A	c.(142-144)Ggc>Agc	p.G48S	NDRG2_ENST00000350792.3_Missense_Mutation_p.G34S|NDRG2_ENST00000555158.1_Missense_Mutation_p.G34S|AL161668.5_ENST00000533984.1_lincRNA|NDRG2_ENST00000397844.2_Missense_Mutation_p.G34S|NDRG2_ENST00000554143.1_Missense_Mutation_p.G34S|NDRG2_ENST00000397855.3_Missense_Mutation_p.G34S|NDRG2_ENST00000397853.3_Missense_Mutation_p.G48S|NDRG2_ENST00000554277.1_5'Flank|NDRG2_ENST00000397858.1_Missense_Mutation_p.G48S|NDRG2_ENST00000397851.2_Missense_Mutation_p.G48S|NDRG2_ENST00000397847.2_Missense_Mutation_p.G48S|NDRG2_ENST00000298684.5_Missense_Mutation_p.G34S|NDRG2_ENST00000397856.3_Missense_Mutation_p.G34S|NDRG2_ENST00000554104.1_5'UTR|NDRG2_ENST00000553503.1_Missense_Mutation_p.G34S|NDRG2_ENST00000403829.3_Missense_Mutation_p.G44S|NDRG2_ENST00000298687.5_Missense_Mutation_p.G48S|NDRG2_ENST00000360463.3_Missense_Mutation_p.G34S			Q9UN36	NDRG2_HUMAN	NDRG family member 2	48			G -> V (in dbSNP:rs11552412). {ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|negative regulation of cytokine production (GO:0001818)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of platelet-derived growth factor production (GO:0090361)|regulation of vascular endothelial growth factor production (GO:0010574)|substantia nigra development (GO:0021762)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)		p.G48S(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	23	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		GTGACAGAGCCGTATGGTGTC	0.537																																					p.G34S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G100A	14						.						123.0	111.0	115.0					14																	21490632		2203	4300	6503	20560472	SO:0001583	missense	57447	exon4			AB033074	CCDS9564.1, CCDS9565.1, CCDS61384.1, CCDS61386.1, CCDS73613.1	14q11.2	2008-07-09			ENSG00000165795	ENSG00000165795			14460	protein-coding gene	gene with protein product		605272				10831399	Standard	NM_201535		Approved	KIAA1248, SYLD	uc001vyx.3	Q9UN36	OTTHUMG00000029619	ENST00000556147.1:c.142G>A	14.37:g.21490632C>T	ENSP00000451712:p.Gly48Ser	Somatic		Capture	SOLID	Phase_I	20560472	NM_016250	B3KUE3|B4DE86|B7WP11|B7WPD5|D3DS07|D3DS10|Q567T1|Q68DW2|Q86U08|Q86U46|Q96FD3|Q96FT0|Q96JU0|Q96PN0|Q9BQH5|Q9ULH2	Missense_Mutation	SNP	ENST00000556147.1	37	CCDS9565.1	.	.	.	.	.	.	.	.	.	.	C	33	5.290238	0.95546	.	.	ENSG00000165795	ENST00000298687;ENST00000350792;ENST00000554770;ENST00000397858;ENST00000555158;ENST00000553503;ENST00000397853;ENST00000360463;ENST00000556147;ENST00000554143;ENST00000397851;ENST00000397847;ENST00000397856;ENST00000397855;ENST00000298684;ENST00000397844;ENST00000403829;ENST00000556008;ENST00000556974;ENST00000555026;ENST00000553867;ENST00000449431;ENST00000557169;ENST00000555869;ENST00000555733;ENST00000555384;ENST00000554094;ENST00000553442;ENST00000556420;ENST00000553784;ENST00000557149;ENST00000555142;ENST00000554531;ENST00000557264;ENST00000557676;ENST00000556924;ENST00000556329;ENST00000554398;ENST00000554472;ENST00000554483;ENST00000555657;ENST00000557274;ENST00000556457;ENST00000556688;ENST00000554561;ENST00000554419;ENST00000553563;ENST00000554489;ENST00000556561;ENST00000554893;ENST00000554833;ENST00000554415	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.79034	0.4378	M	0.91038	3.17	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;1.0	D	0.83543	0.0097	10	0.87932	D	0	-13.0626	17.1844	0.86863	0.0:1.0:0.0:0.0	.	44;48;34;48;34	B4DE86;Q9UN36-3;Q9UN36-5;Q9UN36;Q9UN36-4	.;.;.;NDRG2_HUMAN;.	S	48;34;29;48;34;34;48;34;48;34;48;48;34;34;34;34;44;34;34;34;48;9;34;34;48;48;34;34;34;48;34;34;37;34;34;34;34;48;48;34;34;34;48;48;34;48;34;34;48;34;48;48	ENSP00000298687:G48S;ENSP00000344620:G34S;ENSP00000380956:G48S;ENSP00000452038:G34S;ENSP00000452306:G34S;ENSP00000380951:G48S;ENSP00000353649:G34S;ENSP00000451712:G48S;ENSP00000452006:G34S;ENSP00000380949:G48S;ENSP00000380945:G48S;ENSP00000380954:G34S;ENSP00000380953:G34S;ENSP00000298684:G34S;ENSP00000380943:G34S;ENSP00000385889:G44S;ENSP00000451966:G34S;ENSP00000452362:G34S;ENSP00000451274:G34S;ENSP00000450691:G48S;ENSP00000397250:G9S;ENSP00000452334:G34S;ENSP00000451105:G34S;ENSP00000452482:G48S;ENSP00000451094:G48S;ENSP00000452278:G34S;ENSP00000450493:G34S;ENSP00000451951:G34S;ENSP00000451059:G48S;ENSP00000452592:G34S;ENSP00000450513:G34S;ENSP00000451302:G37S;ENSP00000451471:G34S;ENSP00000452548:G34S;ENSP00000450504:G34S;ENSP00000452262:G34S;ENSP00000451185:G48S;ENSP00000451348:G48S;ENSP00000451472:G34S;ENSP00000452247:G34S;ENSP00000452344:G34S;ENSP00000450852:G48S;ENSP00000451981:G48S;ENSP00000451163:G34S;ENSP00000452179:G48S;ENSP00000451541:G34S;ENSP00000452302:G34S;ENSP00000450825:G48S;ENSP00000450450:G34S;ENSP00000452458:G48S;ENSP00000452274:G48S	ENSP00000298684:G34S	G	-	1	0	NDRG2	20560472	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	7.033000	0.76504	2.649000	0.89929	0.655000	0.94253	GGC		NDRG2-013	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411717.1		
OR5AU1	390445	hgsc.bcm.edu	37	14	21623250	21623250	+	Missense_Mutation	SNP	C	C	T	rs372596322		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr14:21623250C>T	ENST00000304418.3	-	1	972	c.935G>A	c.(934-936)cGc>cAc	p.R312H		NM_001004731.1	NP_001004731.1	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU, member 1	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R312H(2)|p.R312P(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(12)|pancreas(1)	21	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		GGACCTGGGGCGCAGGTACAT	0.537																																					p.R312H												.	.	3	Substitution - Missense(3)	large_intestine(2)|lung(1)	c.G935A	14						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	120.0	109.0	113.0		935	1.6	1.0	14		113	0,8600		0,0,4300	no	missense	OR5AU1	NM_001004731.1	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	312/363	21623250	1,13005	2203	4300	6503	20693090	SO:0001583	missense	390445	exon1			AL157687	CCDS32042.1	14q11.2	2013-09-23			ENSG00000169327	ENSG00000169327		"""GPCR / Class A : Olfactory receptors"""	15362	protein-coding gene	gene with protein product							Standard	NM_001004731		Approved		uc010tlp.2	Q8NGC0	OTTHUMG00000170753	ENST00000304418.3:c.935G>A	14.37:g.21623250C>T	ENSP00000302057:p.Arg312His	Somatic		Capture	SOLID	Phase_I	20693090	NM_001004731	B2RP78|Q6IEU2|Q96R10	Missense_Mutation	SNP	ENST00000304418.3	37	CCDS32042.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.371774	0.42003	2.27E-4	0.0	ENSG00000169327	ENST00000304418	T	0.37752	1.18	4.48	1.6	0.23607	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.41213	0.1149	M	0.80847	2.515	0.33620	D	0.604636	B	0.33103	0.397	B	0.37387	0.248	T	0.53528	-0.8426	9	0.49607	T	0.09	.	8.3665	0.32389	0.0:0.7229:0.0:0.2771	.	312	Q8NGC0	O5AU1_HUMAN	H	312	ENSP00000302057:R312H	ENSP00000302057:R312H	R	-	2	0	OR5AU1	20693090	0.000000	0.05858	1.000000	0.80357	0.969000	0.65631	0.205000	0.17356	0.522000	0.28464	-0.424000	0.05967	CGC		OR5AU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410213.1		
SALL2	6297	hgsc.bcm.edu	37	14	22004984	22004984	+	Splice_Site	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr14:22004984G>A	ENST00000327430.3	-	1	366	c.72C>T	c.(70-72)aaC>aaT	p.N24N	SALL2_ENST00000317492.5_Splice_Site_p.N24N	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	24					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N24N(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		GGCACCCACCGTTCTCAGACG	0.657																																					p.N24N												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C72T	14						.						63.0	62.0	62.0					14																	22004984		2203	4300	6503	21074824	SO:0001630	splice_region_variant	6297	exon1			AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.73+1C>T	14.37:g.22004984G>A		Somatic		Capture	SOLID	Phase_I	21074824	NM_005407	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Silent	SNP	ENST00000327430.3	37	CCDS32045.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.583624	0.46006	.	.	ENSG00000165821	ENST00000546363	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	T	0.71710	0.3372	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70753	-0.4786	4	.	.	.	-33.2249	15.6582	0.77158	0.0:0.0:1.0:0.0	.	.	.	.	M	18	.	.	T	-	2	0	SALL2	21074824	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.427000	0.52785	2.421000	0.82119	0.655000	0.94253	ACG		SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407	Silent
NEMF	9147	hgsc.bcm.edu	37	14	50280756	50280756	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr14:50280756A>G	ENST00000298310.5	-	18	2143	c.1694T>C	c.(1693-1695)gTa>gCa	p.V565A	NEMF_ENST00000546046.1_Intron|NEMF_ENST00000545773.1_Missense_Mutation_p.V523A|NEMF_ENST00000556925.1_5'UTR			O60524	NEMF_HUMAN	nuclear export mediator factor	565					nuclear export (GO:0051168)	nucleus (GO:0005634)		p.V565A(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						ATCAGCATGTACATAAATGTC	0.299																																					p.V565A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1694C	14						.						63.0	63.0	63.0					14																	50280756		2203	4299	6502	49350506	SO:0001583	missense	9147	exon18			AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.1694T>C	14.37:g.50280756A>G	ENSP00000298310:p.Val565Ala	Somatic		Capture	SOLID	Phase_I	49350506	NM_004713	A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Missense_Mutation	SNP	ENST00000298310.5	37	CCDS9694.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.546696	0.86022	.	.	ENSG00000165525	ENST00000298310;ENST00000545773;ENST00000534912;ENST00000555970	T;T;T	0.58940	0.36;0.3;0.3	5.37	5.37	0.77165	Domain of unknown function DUF814 (1);	0.000000	0.85682	D	0.000000	D	0.82481	0.5046	H	0.96111	3.77	0.80722	D	1	D;D;D	0.61080	0.964;0.964;0.989	P;P;D	0.68039	0.841;0.841;0.955	D	0.88109	0.2824	10	0.87932	D	0	-18.2722	14.489	0.67637	1.0:0.0:0.0:0.0	.	540;523;565	O60524-5;O60524-4;O60524	.;.;NEMF_HUMAN	A	565;523;337;523	ENSP00000298310:V565A;ENSP00000438309:V523A;ENSP00000452540:V523A	ENSP00000298310:V565A	V	-	2	0	NEMF	49350506	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.839000	0.86812	2.166000	0.68216	0.397000	0.26171	GTA		NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410798.1	NM_004713	
KTN1	3895	hgsc.bcm.edu	37	14	56079169	56079169	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr14:56079169G>A	ENST00000395314.3	+	2	471	c.403G>A	c.(403-405)Gca>Aca	p.A135T	KTN1_ENST00000395308.1_Missense_Mutation_p.A135T|KTN1_ENST00000395309.3_Missense_Mutation_p.A135T|KTN1_ENST00000413890.2_Missense_Mutation_p.A135T|KTN1_ENST00000438792.2_Missense_Mutation_p.A135T|KTN1_ENST00000416613.1_Missense_Mutation_p.A135T|KTN1_ENST00000395311.1_Missense_Mutation_p.A135T	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	135					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.A135T(1)		breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						AGAAAGTGACGCATCAAAGAT	0.438			T	RET	papillary thryoid																																p.A135T			Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G403A	14						.						89.0	94.0	92.0					14																	56079169		2203	4300	6503	55148922	SO:0001583	missense	3895	exon2				CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.403G>A	14.37:g.56079169G>A	ENSP00000378725:p.Ala135Thr	Somatic		Capture	SOLID	Phase_I	55148922	NM_004986	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	ENST00000395314.3	37	CCDS41957.1	.	.	.	.	.	.	.	.	.	.	G	6.635	0.485649	0.12641	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613	D;D;D;D;D;D;D	0.98777	-5.13;-5.13;-5.13;-5.13;-5.13;-5.13;-5.13	5.9	2.03	0.26663	.	1.194940	0.06186	N	0.680486	D	0.95268	0.8465	N	0.22421	0.69	0.19300	N	0.999973	B;B;B;B	0.31290	0.079;0.132;0.079;0.318	B;B;B;B	0.29663	0.049;0.072;0.049;0.105	D	0.90153	0.4222	10	0.15952	T	0.53	0.0309	7.7204	0.28729	0.1919:0.118:0.6901:0.0	.	135;135;135;135	B4DZ88;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;KTN1_HUMAN	T	135	ENSP00000394992:A135T;ENSP00000378720:A135T;ENSP00000391964:A135T;ENSP00000378725:A135T;ENSP00000378719:A135T;ENSP00000378722:A135T;ENSP00000388807:A135T	ENSP00000378719:A135T	A	+	1	0	KTN1	55148922	0.998000	0.40836	0.161000	0.22692	0.006000	0.05464	0.928000	0.28831	0.103000	0.17682	-0.948000	0.02665	GCA		KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2		
HIF1A	3091	hgsc.bcm.edu	37	14	62203609	62203609	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr14:62203609G>A	ENST00000337138.4	+	9	1296	c.1031G>A	c.(1030-1032)gGt>gAt	p.G344D	RP11-618G20.1_ENST00000555937.1_RNA|HIF1A-AS2_ENST00000554254.1_lincRNA|HIF1A_ENST00000539097.1_Missense_Mutation_p.G368D|HIF1A_ENST00000557538.1_Missense_Mutation_p.G285D|HIF1A_ENST00000394997.1_Missense_Mutation_p.G345D|HIF1A_ENST00000323441.6_Missense_Mutation_p.G344D	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	344	Interaction with TSGA10. {ECO:0000250}.|PAC.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)	p.G344D(1)		breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	TTTGACAGTGGTATTATTCAG	0.368																																					p.G344D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1031A	14						.						76.0	68.0	71.0					14																	62203609		2203	4300	6503	61273362	SO:0001583	missense	3091	exon9			U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.1031G>A	14.37:g.62203609G>A	ENSP00000338018:p.Gly344Asp	Somatic		Capture	SOLID	Phase_I	61273362	NM_181054	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Missense_Mutation	SNP	ENST00000337138.4	37	CCDS9753.1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.198441	0.38806	.	.	ENSG00000100644	ENST00000539494;ENST00000394988;ENST00000337138;ENST00000394997;ENST00000323441;ENST00000557538;ENST00000539097	T;T;T;T;T	0.55413	0.63;0.63;0.52;0.63;0.62	5.88	5.88	0.94601	.	0.260319	0.43747	D	0.000535	T	0.36799	0.0980	N	0.11064	0.09	0.80722	D	1	B;B;B	0.33022	0.394;0.185;0.185	B;B;B	0.36567	0.228;0.144;0.144	T	0.28618	-1.0038	10	0.36615	T	0.2	.	13.4349	0.61077	0.0713:0.0:0.9287:0.0	.	345;344;344	A8MYV6;D0VY79;Q16665	.;.;HIF1A_HUMAN	D	95;285;344;345;344;285;368	ENSP00000338018:G344D;ENSP00000378446:G345D;ENSP00000323326:G344D;ENSP00000451696:G285D;ENSP00000437955:G368D	ENSP00000323326:G344D	G	+	2	0	HIF1A	61273362	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.366000	0.59492	2.788000	0.95919	0.555000	0.69702	GGT		HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276977.2	NM_001530	
SIPA1L1	26037	hgsc.bcm.edu	37	14	72055498	72055498	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr14:72055498A>G	ENST00000555818.1	+	2	1257	c.909A>G	c.(907-909)aaA>aaG	p.K303K	SIPA1L1_ENST00000381232.3_Silent_p.K303K|SIPA1L1_ENST00000358550.2_Silent_p.K303K	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	303					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)	p.K303K(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		GCAATGCCAAAGGTGAAGAAC	0.438																																					p.K303K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A909G	14						.						66.0	70.0	69.0					14																	72055498		2203	4300	6503	71125251	SO:0001819	synonymous_variant	26037	exon2			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.909A>G	14.37:g.72055498A>G		Somatic		Capture	SOLID	Phase_I	71125251	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Silent	SNP	ENST00000555818.1	37	CCDS9807.1																																																																																				SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
DCAF4	26094	hgsc.bcm.edu	37	14	73406561	73406561	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr14:73406561C>T	ENST00000358377.2	+	3	364	c.144C>T	c.(142-144)gaC>gaT	p.D48D	DCAF4_ENST00000553457.1_5'UTR|DCAF4_ENST00000510612.1_3'UTR|DCAF4_ENST00000394234.2_5'UTR|DCAF4_ENST00000509153.1_Silent_p.D48D|DCAF4_ENST00000555042.1_Silent_p.D48D|DCAF4_ENST00000353777.3_Silent_p.D48D	NM_001163509.1|NM_015604.3	NP_001156981.1|NP_056419.2	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4	48					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)		p.D48D(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|skin(1)	22						ACGGTGATGACGAGTCTCCGT	0.612																																					p.T37M												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C110T	14						.						40.0	33.0	35.0					14																	73406561		2203	4300	6503	72476314	SO:0001819	synonymous_variant	26094	exon3			BC018979	CCDS9809.1, CCDS9810.1, CCDS41968.1, CCDS41968.2, CCDS55926.1	14q24.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000119599		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20229	protein-coding gene	gene with protein product			"""WD repeat domain 21"", ""WD repeat domain 21A"""	WDR21, WDR21A			Standard	NM_015604		Approved	DKFZp434K114	uc010ttr.2	Q8WV16		ENST00000358377.2:c.144C>T	14.37:g.73406561C>T		Somatic		Capture	SOLID	Phase_I	72476314	NM_001163509	B4DUT6|G3V522|Q86U31|Q8IV10|Q96K22|Q9Y4P5	Silent	SNP	ENST00000358377.2	37	CCDS9809.1																																																																																				DCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361058.1	NM_015604	
COQ6	51004	hgsc.bcm.edu	37	14	74428209	74428209	+	Silent	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr14:74428209C>A	ENST00000334571.2	+	10	1186	c.1146C>A	c.(1144-1146)ggC>ggA	p.G382G	COQ6_ENST00000554920.1_Intron|ENTPD5_ENST00000557325.1_Intron|COQ6_ENST00000394026.4_Silent_p.G357G|COQ6_ENST00000238709.4_Silent_p.G307G	NM_182476.2	NP_872282.1	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 monooxygenase	382					small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)	p.G382G(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(234;0.00337)		TCAACATGGGCTTTGGGGATA	0.517																																					p.G382G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1146A	14						.						105.0	89.0	95.0					14																	74428209		2203	4300	6503	73497962	SO:0001819	synonymous_variant	51004	exon10			AF132944	CCDS9823.1, CCDS9824.1, CCDS9824.2	14q24.1	2013-05-01	2013-05-01		ENSG00000119723	ENSG00000119723			20233	protein-coding gene	gene with protein product		614647	"""coenzyme Q6 homolog (yeast)"", ""coenzyme Q6 homolog, monooxygenase (yeast)"", ""coenzyme Q6 homolog, monooxygenase (S. cerevisiae)"""			21540551	Standard	NM_182476		Approved	CGI-10	uc001xph.3	Q9Y2Z9	OTTHUMG00000171260	ENST00000334571.2:c.1146C>A	14.37:g.74428209C>A		Somatic		Capture	SOLID	Phase_I	73497962	NM_182476	B7Z3K8|Q53GG6|Q86U30|Q96CA1|Q96CK2	Silent	SNP	ENST00000334571.2	37	CCDS9823.1																																																																																				COQ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412616.1		
ABCD4	5826	hgsc.bcm.edu	37	14	74761872	74761872	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr14:74761872G>A	ENST00000356924.4	-	7	841	c.698C>T	c.(697-699)gCg>gTg	p.A233V	ABCD4_ENST00000557588.1_Missense_Mutation_p.A191V|AC005519.4_ENST00000554532.2_RNA|ABCD4_ENST00000557554.1_Intron|ABCD4_ENST00000298816.7_Intron	NM_005050.3	NP_005041.1	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D (ALD), member 4	233	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cobalamin metabolic process (GO:0009235)|transmembrane transport (GO:0055085)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.R2W(1)|p.A233V(1)		cervix(2)|endometrium(3)|kidney(3)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00153)		AGCAGGCTCCGCATTCACCCG	0.542																																					p.A233V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C698T	14						.						154.0	119.0	131.0					14																	74761872		2203	4300	6503	73831625	SO:0001583	missense	5826	exon7			AF009746	CCDS9828.1	14q24	2012-03-14			ENSG00000119688	ENSG00000119688		"""ATP binding cassette transporters / subfamily D"""	68	protein-coding gene	gene with protein product		603214		PXMP1L		9266848, 9302272	Standard	NR_003256		Approved	PMP69, P70R, EST352188	uc001xpr.2	O14678	OTTHUMG00000171207	ENST00000356924.4:c.698C>T	14.37:g.74761872G>A	ENSP00000349396:p.Ala233Val	Somatic		Capture	SOLID	Phase_I	73831625	NM_005050	A8K5L7|Q6IAQ0|Q96E75	Missense_Mutation	SNP	ENST00000356924.4	37	CCDS9828.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.3|24.3	4.519748|4.519748	0.85495|0.85495	.|.	.|.	ENSG00000119688|ENSG00000119688	ENST00000356924;ENST00000557588|ENST00000537629;ENST00000556971	D;D|.	0.99773|.	-6.72;-6.02|.	4.88|4.88	4.88|4.88	0.63580|0.63580	ABC transporter, N-terminal (1);ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78991|0.78991	0.4371|0.4371	M|M	0.81341|0.81341	2.54|2.54	0.80722|0.80722	D|D	1|1	D;D|.	0.71674|.	0.998;0.998|.	P;P|.	0.62184|.	0.899;0.899|.	T|T	0.82059|0.82059	-0.0645|-0.0645	10|6	0.31617|0.66056	T|D	0.26|0.02	.|.	18.2279|18.2279	0.89924|0.89924	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	233;233|.	A8K5L7;O14678|.	.;ABCD4_HUMAN|.	V|W	233;191|2;193	ENSP00000349396:A233V;ENSP00000451993:A191V|.	ENSP00000349396:A233V|ENSP00000443843:R2W	A|R	-|-	2|1	0|2	ABCD4|ABCD4	73831625|73831625	1.000000|1.000000	0.71417|0.71417	0.937000|0.937000	0.37676|0.37676	0.596000|0.596000	0.36781|0.36781	9.657000|9.657000	0.98554|0.98554	2.530000|2.530000	0.85305|0.85305	0.591000|0.591000	0.81541|0.81541	GCG|CGG		ABCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314382.1	NM_005050	
ISM2	145501	hgsc.bcm.edu	37	14	77950699	77950699	+	Silent	SNP	G	G	A	rs141373850		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr14:77950699G>A	ENST00000342219.4	-	3	650	c.594C>T	c.(592-594)caC>caT	p.H198H	ISM2_ENST00000429906.1_Silent_p.H117H|ISM2_ENST00000493585.1_Silent_p.H198H|ISM2_ENST00000393684.3_Silent_p.H110H|ISM2_ENST00000412904.1_Intron	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	198						extracellular region (GO:0005576)		p.H198H(1)		endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						TCAAGGTTGCGTGGACCAATT	0.627													G|||	1	0.000199681	0.0	0.0014	5008	,	,		21110	0.0		0.0	False		,,,				2504	0.0				p.H198H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C594T	14						.	G	,	0,4406		0,0,2203	99.0	93.0	95.0		594,594	1.0	0.9	14	dbSNP_134	95	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	ISM2	NM_182509.3,NM_199296.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	198/293,198/572	77950699	1,13005	2203	4300	6503	77020452	SO:0001819	synonymous_variant	145501	exon3			AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.594C>T	14.37:g.77950699G>A		Somatic		Capture	SOLID	Phase_I	77020452	NM_182509	A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Silent	SNP	ENST00000342219.4	37	CCDS9864.1																																																																																				ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351309.1	NM_182509	
ADCK1	57143	hgsc.bcm.edu	37	14	78392248	78392248	+	Nonsense_Mutation	SNP	C	C	T	rs142956948	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr14:78392248C>T	ENST00000238561.5	+	9	1249	c.1150C>T	c.(1150-1152)Cga>Tga	p.R384*	ADCK1_ENST00000556560.1_3'UTR|ADCK1_ENST00000341211.5_Nonsense_Mutation_p.R316*	NM_020421.3	NP_065154.2	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1	391	Protein kinase.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R316*(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(2)	25			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		GCTGACGGCGCGATCGTGGGA	0.602													C|||	2	0.000399361	0.0	0.0	5008	,	,		17780	0.0		0.002	False		,,,				2504	0.0				p.R316X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C946T	14						.						150.0	153.0	152.0					14																	78392248		2203	4300	6503	77462001	SO:0001587	stop_gained	57143	exon8			AK096919	CCDS9869.1, CCDS45144.1	14q24	2005-10-30							19038	protein-coding gene	gene with protein product						12471243	Standard	NM_020421		Approved	FLJ39600	uc001xui.3	Q86TW2		ENST00000238561.5:c.1150C>T	14.37:g.78392248C>T	ENSP00000238561:p.Arg384*	Somatic		Capture	SOLID	Phase_I	77462001	NM_001142545	B3KUD5|Q6PD65|Q9UIE6	Nonsense_Mutation	SNP	ENST00000238561.5	37	CCDS9869.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	21.1	4.096859	0.76870	.	.	ENSG00000063761	ENST00000238561;ENST00000341211	.	.	.	5.26	4.38	0.52667	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-41.0779	13.4374	0.61092	0.3432:0.6568:0.0:0.0	.	.	.	.	X	384;316	.	ENSP00000238561:R384X	R	+	1	2	ADCK1	77462001	1.000000	0.71417	0.911000	0.35937	0.100000	0.18952	4.008000	0.57103	1.215000	0.43411	-0.165000	0.13383	CGA		ADCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413864.1	NM_020421	
STON2	85439	hgsc.bcm.edu	37	14	81743310	81743310	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr14:81743310G>A	ENST00000267540.2	-	4	2545	c.2345C>T	c.(2344-2346)gCc>gTc	p.A782V	STON2_ENST00000555447.1_Missense_Mutation_p.A782V|STON2_ENST00000556280.1_5'Flank	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	782	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)		p.A782V(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		CTCGTACTTGGCAGTTCCCAG	0.498																																					p.A782V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2345T	14						.						122.0	122.0	122.0					14																	81743310		2203	4300	6503	80813063	SO:0001583	missense	85439	exon4			AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.2345C>T	14.37:g.81743310G>A	ENSP00000267540:p.Ala782Val	Somatic		Capture	SOLID	Phase_I	80813063	NM_033104	G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	37	CCDS9875.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.479742	0.63849	.	.	ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540	T;T	0.21361	2.01;2.01	5.92	5.92	0.95590	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.46852	0.1414	L	0.58669	1.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.24048	-1.0171	10	0.62326	D	0.03	-27.0979	20.3214	0.98679	0.0:0.0:1.0:0.0	.	782;782	Q8WXE9;G3V2T7	STON2_HUMAN;.	V	782;794;782	ENSP00000450857:A782V;ENSP00000267540:A782V	ENSP00000267540:A782V	A	-	2	0	STON2	80813063	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	7.655000	0.83696	2.804000	0.96469	0.655000	0.94253	GCC		STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104	
GGT5	2687	hgsc.bcm.edu	37	22	24615979	24615979	+	Missense_Mutation	SNP	C	C	T	rs532229060		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr22:24615979C>T	ENST00000327365.4	-	12	2136	c.1720G>A	c.(1720-1722)Gtc>Atc	p.V574I	GGT5_ENST00000418439.2_Missense_Mutation_p.V498I|GGT5_ENST00000398292.3_Missense_Mutation_p.V575I|GGT5_ENST00000263112.7_Missense_Mutation_p.V542I	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	574					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.V574I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						AGGTCCGAGACGGCGTACACA	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		17275	0.001		0.0	False		,,,				2504	0.0				p.V574I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1720A	22						.						74.0	60.0	64.0					22																	24615979		2203	4300	6503	22945979	SO:0001583	missense	2687	exon12			M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.1720G>A	22.37:g.24615979C>T	ENSP00000330080:p.Val574Ile	Somatic		Capture	SOLID	Phase_I	22945979	NM_004121	Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Missense_Mutation	SNP	ENST00000327365.4	37	CCDS13825.1	.	.	.	.	.	.	.	.	.	.	C	6.813	0.519123	0.13005	.	.	ENSG00000099998	ENST00000327365;ENST00000263112;ENST00000438024;ENST00000398292;ENST00000418439	T;T;T;T	0.07688	3.17;3.17;3.17;3.17	4.47	2.36	0.29203	.	0.774752	0.11737	N	0.534350	T	0.08313	0.0207	L	0.48935	1.535	0.09310	N	1	B;B;B;B	0.16396	0.017;0.001;0.004;0.001	B;B;B;B	0.15052	0.012;0.005;0.009;0.008	T	0.33163	-0.9879	10	0.31617	T	0.26	-5.7107	7.6928	0.28577	0.0:0.7946:0.0:0.2054	.	498;542;575;574	E7EUG3;P36269-2;Q6GMP0;P36269	.;.;.;GGT5_HUMAN	I	574;542;489;575;498	ENSP00000330080:V574I;ENSP00000263112:V542I;ENSP00000381340:V575I;ENSP00000392146:V498I	ENSP00000263112:V542I	V	-	1	0	GGT5	22945979	0.002000	0.14202	0.001000	0.08648	0.003000	0.03518	1.575000	0.36493	0.588000	0.29660	-0.143000	0.13931	GTC		GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320119.1	NM_004121	
CRYBB1	1414	hgsc.bcm.edu	37	22	27008121	27008121	+	Missense_Mutation	SNP	G	G	A	rs188680347		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr22:27008121G>A	ENST00000215939.2	-	3	344	c.214C>T	c.(214-216)Cgt>Tgt	p.R72C		NM_001887.3	NP_001878.1	P53674	CRBB1_HUMAN	crystallin, beta B1	72	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)	p.R72C(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(3)|skin(2)|urinary_tract(4)	31						TCTGCTCGACGGCCCTGGAAG	0.572													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16554	0.0		0.0	False		,,,				2504	0.0				p.R72C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C214T	22						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	71.0	64.0	66.0		214	3.0	0.9	22		66	0,8600		0,0,4300	no	missense	CRYBB1	NM_001887.3	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	72/253	27008121	1,13005	2203	4300	6503	25338121	SO:0001583	missense	1414	exon3				CCDS13840.1	22q12.1	2008-06-10			ENSG00000100122	ENSG00000100122			2397	protein-coding gene	gene with protein product		600929				8575764, 12360425	Standard	NM_001887		Approved		uc003acy.1	P53674	OTTHUMG00000150980	ENST00000215939.2:c.214C>T	22.37:g.27008121G>A	ENSP00000215939:p.Arg72Cys	Somatic		Capture	SOLID	Phase_I	25338121	NM_001887		Missense_Mutation	SNP	ENST00000215939.2	37	CCDS13840.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	12.96	2.094093	0.36952	2.27E-4	0.0	ENSG00000100122	ENST00000215939	T	0.78481	-1.18	4.02	3.0	0.34707	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.056916	0.64402	D	0.000017	T	0.77585	0.4152	M	0.89534	3.04	0.80722	D	1	P	0.34587	0.458	B	0.34038	0.174	T	0.76713	-0.2858	10	0.66056	D	0.02	.	5.053	0.14518	0.1072:0.0:0.5649:0.328	.	72	P53674	CRBB1_HUMAN	C	72	ENSP00000215939:R72C	ENSP00000215939:R72C	R	-	1	0	CRYBB1	25338121	0.996000	0.38824	0.933000	0.37362	0.745000	0.42441	1.840000	0.39230	0.891000	0.36235	0.491000	0.48974	CGT		CRYBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320767.1	NM_001887	
EIF4ENIF1	56478	hgsc.bcm.edu	37	22	31851179	31851179	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr22:31851179C>G	ENST00000397525.1	-	9	1445	c.1222G>C	c.(1222-1224)Gat>Cat	p.D408H	RP11-247I13.11_ENST00000464523.1_RNA|EIF4ENIF1_ENST00000344710.5_Missense_Mutation_p.D245H|EIF4ENIF1_ENST00000330125.5_Missense_Mutation_p.D408H|EIF4ENIF1_ENST00000397523.1_Missense_Mutation_p.D408H|EIF4ENIF1_ENST00000382180.2_Missense_Mutation_p.D87H	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	408						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)	p.D408H(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GGTTTCAAATCCACTTTGGCT	0.353																																					p.D408H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1222C	22						.						79.0	77.0	78.0					22																	31851179		2203	4300	6503	30181179	SO:0001583	missense	56478	exon9			AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.1222G>C	22.37:g.31851179C>G	ENSP00000380659:p.Asp408His	Somatic		Capture	SOLID	Phase_I	30181179	NM_019843	B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Missense_Mutation	SNP	ENST00000397525.1	37	CCDS13898.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.295568	0.81025	.	.	ENSG00000184708	ENST00000344710;ENST00000397525;ENST00000330125;ENST00000397523;ENST00000382180;ENST00000418321;ENST00000420671	.	.	.	5.93	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.75155	0.3811	L	0.61218	1.895	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.983;0.999;0.992;0.999	T	0.75827	-0.3180	9	0.48119	T	0.1	-15.51	12.7085	0.57076	0.0:0.9242:0.0:0.0758	.	245;408;245;408	B1AKL3;Q9NRA8;Q9NRA8-2;B1AKL4	.;4ET_HUMAN;.;.	H	245;408;408;408;87;6;408	.	ENSP00000328103:D408H	D	-	1	0	EIF4ENIF1	30181179	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.298000	0.78815	1.503000	0.48686	0.655000	0.94253	GAT		EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127926.1	NM_019843	
MYH9	4627	hgsc.bcm.edu	37	22	36684921	36684921	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr22:36684921A>G	ENST00000216181.5	-	33	4852	c.4622T>C	c.(4621-4623)cTg>cCg	p.L1541P	MYH9_ENST00000475726.1_5'Flank	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1541					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.L1541P(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CAGCTCTTCCAGCTGCGTCTT	0.627			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												p.L1541P			Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4622C	22						.						100.0	92.0	95.0					22																	36684921		2203	4300	6503	35014867	SO:0001583	missense	4627	exon33	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.4622T>C	22.37:g.36684921A>G	ENSP00000216181:p.Leu1541Pro	Somatic		Capture	SOLID	Phase_I	35014867	NM_002473	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	ENST00000216181.5	37	CCDS13927.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.555094	0.86231	.	.	ENSG00000100345	ENST00000337818;ENST00000397231;ENST00000216181	D	0.82167	-1.58	5.25	5.25	0.73442	Myosin tail (1);	0.000000	0.64402	D	0.000001	D	0.93115	0.7808	M	0.93328	3.405	0.80722	D	1	D	0.63046	0.992	D	0.72075	0.976	D	0.94847	0.8010	10	0.87932	D	0	.	15.4563	0.75318	1.0:0.0:0.0:0.0	.	1541	P35579	MYH9_HUMAN	P	963;143;1541	ENSP00000216181:L1541P	ENSP00000216181:L1541P	L	-	2	0	MYH9	35014867	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.277000	0.95755	2.098000	0.63641	0.459000	0.35465	CTG		MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	
TMEM184B	25829	hgsc.bcm.edu	37	22	38627314	38627314	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr22:38627314G>T	ENST00000361906.3	-	4	593	c.385C>A	c.(385-387)Ctg>Atg	p.L129M	TMEM184B_ENST00000361684.4_Missense_Mutation_p.L129M|RN7SL704P_ENST00000478699.2_RNA|RP1-5O6.5_ENST00000420172.1_RNA	NM_001195072.1|NM_012264.4	NP_001182001.1|NP_036396.2	Q9Y519	T184B_HUMAN	transmembrane protein 184B	129						integral component of membrane (GO:0016021)		p.L129M(1)		endometrium(1)|large_intestine(2)|lung(2)|skin(2)|upper_aerodigestive_tract(1)	8	Melanoma(58;0.045)					TCATAGCACAGGCTCAGGAAA	0.493																																					p.L129M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C385A	22						.						128.0	123.0	125.0					22																	38627314		2203	4300	6503	36957260	SO:0001583	missense	25829	exon4			AL096879	CCDS13969.2	22q12	2008-02-04	2007-07-11	2007-07-11	ENSG00000198792	ENSG00000198792			1310	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 5"""	C22orf5		10591208	Standard	NM_012264		Approved	HS5O6A, DKFZP586A1024, FM08	uc003avf.1	Q9Y519	OTTHUMG00000030557	ENST00000361906.3:c.385C>A	22.37:g.38627314G>T	ENSP00000355210:p.Leu129Met	Somatic		Capture	SOLID	Phase_I	36957260	NM_012264	A8K9D7|Q63HM8|Q7Z421|Q8NBM5|Q9UGT8|Q9UGT9|Q9UGV5	Missense_Mutation	SNP	ENST00000361906.3	37	CCDS13969.2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.346535	0.82022	.	.	ENSG00000198792	ENST00000361906;ENST00000361684;ENST00000403210	T;T;T	0.60797	0.16;0.16;0.16	5.15	4.11	0.48088	.	0.000000	0.85682	D	0.000000	D	0.83718	0.5315	H	0.97291	3.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.89149	0.3522	10	0.87932	D	0	.	14.0638	0.64815	0.074:0.0:0.926:0.0	.	129	Q9Y519	T184B_HUMAN	M	129;129;63	ENSP00000355210:L129M;ENSP00000354441:L129M;ENSP00000385608:L63M	ENSP00000354441:L129M	L	-	1	2	TMEM184B	36957260	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.764000	0.74960	1.138000	0.42230	0.563000	0.77884	CTG		TMEM184B-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075445.4	NM_012264	
KDELR3	11015	hgsc.bcm.edu	37	22	38877290	38877290	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr22:38877290G>A	ENST00000216014.4	+	4	597	c.425G>A	c.(424-426)gGa>gAa	p.G142E	KDELR3_ENST00000471268.1_3'UTR|KDELR3_ENST00000409006.3_Missense_Mutation_p.G142E	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3	142					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)	p.G142E(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					AGCAAGACTGGAGAGGCTGAG	0.498																																					p.G142E	Ovarian(11;103 529 24120 28493 32980)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G425A	22						.						150.0	147.0	148.0					22																	38877290		2203	4300	6503	37207236	SO:0001583	missense	11015	exon4			AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520	ENST00000216014.4:c.425G>A	22.37:g.38877290G>A	ENSP00000216014:p.Gly142Glu	Somatic		Capture	SOLID	Phase_I	37207236	NM_016657	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Missense_Mutation	SNP	ENST00000216014.4	37	CCDS13972.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914562	0.92178	.	.	ENSG00000100196	ENST00000216014;ENST00000409006	T;T	0.46451	0.88;0.87	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.66086	0.2754	M	0.86864	2.845	0.80722	D	1	P;B	0.36171	0.541;0.318	P;B	0.51742	0.678;0.305	T	0.66818	-0.5827	10	0.40728	T	0.16	.	18.4255	0.90607	0.0:0.0:1.0:0.0	.	142;142	O43731;O43731-2	ERD23_HUMAN;.	E	142	ENSP00000216014:G142E;ENSP00000386918:G142E	ENSP00000216014:G142E	G	+	2	0	KDELR3	37207236	1.000000	0.71417	0.596000	0.28811	0.938000	0.57974	9.657000	0.98554	2.595000	0.87683	0.650000	0.86243	GGA		KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331474.1		
KEAP1	9817	hgsc.bcm.edu	37	19	10599969	10599969	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:10599969C>T	ENST00000171111.5	-	5	2154	c.1607G>A	c.(1606-1608)cGc>cAc	p.R536H	KEAP1_ENST00000393623.2_Missense_Mutation_p.R536H|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	536					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.R536H(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CACATCGTAGCGCTCCACGCT	0.572																																					p.R536H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1607A	19						.						85.0	64.0	72.0					19																	10599969		2203	4300	6503	10460969	SO:0001583	missense	9817	exon5			AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1607G>A	19.37:g.10599969C>T	ENSP00000171111:p.Arg536His	Somatic		Capture	SOLID	Phase_I	10460969	NM_203500	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606046	0.66445	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.81247	-1.47;-1.47	5.73	5.73	0.89815	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.92270	0.7548	M	0.93507	3.425	0.58432	D	0.999997	D	0.89917	1.0	D	0.73380	0.98	D	0.93395	0.6755	10	0.59425	D	0.04	.	17.444	0.87573	0.0:1.0:0.0:0.0	.	536	Q14145	KEAP1_HUMAN	H	536	ENSP00000171111:R536H;ENSP00000377245:R536H	ENSP00000171111:R536H	R	-	2	0	KEAP1	10460969	1.000000	0.71417	1.000000	0.80357	0.090000	0.18270	4.444000	0.60001	2.726000	0.93360	0.585000	0.79938	CGC		KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
USHBP1	83878	hgsc.bcm.edu	37	19	17367281	17367281	+	Splice_Site	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:17367281C>A	ENST00000252597.3	-	9	1642	c.1469G>T	c.(1468-1470)aGg>aTg	p.R490M	AC010646.3_ENST00000594059.1_5'Flank|USHBP1_ENST00000431146.2_Splice_Site_p.R426M	NM_031941.3	NP_114147.2			Usher syndrome 1C binding protein 1									p.R490M(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(10)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44						CATTTGTACCCTTGCGGCCAC	0.577																																					p.R490M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1469T	19						.						80.0	84.0	83.0					19																	17367281		2203	4300	6503	17228281	SO:0001630	splice_region_variant	83878	exon9			AK096028	CCDS12353.1	19p13.11	2013-06-10			ENSG00000130307	ENSG00000130307			24058	protein-coding gene	gene with protein product		611810				11311560	Standard	XM_005260093		Approved	MCC2, AIEBP, FLJ38709	uc002nfs.1	Q8N6Y0	OTTHUMG00000182730	ENST00000252597.3:c.1470+1G>T	19.37:g.17367281C>A		Somatic		Capture	SOLID	Phase_I	17228281	NM_031941		Missense_Mutation	SNP	ENST00000252597.3	37	CCDS12353.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613149	0.46631	.	.	ENSG00000130307	ENST00000252597;ENST00000431146	T;T	0.34859	1.36;1.34	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000001	T	0.57710	0.2072	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.991	T	0.60989	-0.7153	10	0.72032	D	0.01	-35.0085	13.8345	0.63402	0.0:1.0:0.0:0.0	.	426;490	B4DUE8;Q8N6Y0	.;USBP1_HUMAN	M	490;426	ENSP00000252597:R490M;ENSP00000407902:R426M	ENSP00000252597:R490M	R	-	2	0	USHBP1	17228281	1.000000	0.71417	0.973000	0.42090	0.082000	0.17680	2.061000	0.41403	2.340000	0.79590	0.655000	0.94253	AGG		USHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463328.1	NM_031941	Missense_Mutation
DDA1	79016	hgsc.bcm.edu	37	19	17425159	17425159	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:17425159T>C	ENST00000359866.4	+	3	221	c.97T>C	c.(97-99)Tca>Cca	p.S33P		NM_024050.5	NP_076955.1	Q9BW61	DDA1_HUMAN	DET1 and DDB1 associated 1	33								p.S33P(1)		kidney(1)|large_intestine(1)|lung(1)|ovary(1)	4						CCGACGGCCCTCAGTCTACCT	0.622																																					p.S33P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T97C	19						.						109.0	83.0	92.0					19																	17425159		2203	4300	6503	17286159	SO:0001583	missense	79016	exon3			BC000615	CCDS12357.1	19p13.11	2008-02-05	2007-10-25	2007-10-25		ENSG00000130311			28360	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 58"""	C19orf58		17452440	Standard	NM_024050		Approved	PCIA1, MGC2594	uc002ngd.3	Q9BW61		ENST00000359866.4:c.97T>C	19.37:g.17425159T>C	ENSP00000352928:p.Ser33Pro	Somatic		Capture	SOLID	Phase_I	17286159	NM_024050		Missense_Mutation	SNP	ENST00000359866.4	37	CCDS12357.1	.	.	.	.	.	.	.	.	.	.	T	15.19	2.760434	0.49468	.	.	ENSG00000130311	ENST00000359866	.	.	.	4.69	4.69	0.59074	Ubiquitin ligase, Det1/DDB1-complexing (1);	0.075208	0.56097	N	0.000034	T	0.53481	0.1799	L	0.42245	1.32	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	T	0.51965	-0.8638	9	0.42905	T	0.14	-2.3913	12.1374	0.53979	0.0:0.0:0.0:1.0	.	33	Q9BW61	DDA1_HUMAN	P	33	.	ENSP00000352928:S33P	S	+	1	0	DDA1	17286159	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.957000	0.70323	1.753000	0.51906	0.459000	0.35465	TCA		DDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463519.1	NM_024050	
FCHO1	23149	hgsc.bcm.edu	37	19	17893828	17893828	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:17893828G>A	ENST00000596536.1	+	24	2223	c.1940G>A	c.(1939-1941)tGc>tAc	p.C647Y	FCHO1_ENST00000539407.1_Missense_Mutation_p.C647Y|FCHO1_ENST00000597512.1_Missense_Mutation_p.C654Y|FCHO1_ENST00000389133.4_Missense_Mutation_p.C647Y|FCHO1_ENST00000600676.1_Missense_Mutation_p.C647Y|FCHO1_ENST00000252771.7_Missense_Mutation_p.C647Y|FCHO1_ENST00000595033.1_Missense_Mutation_p.C597Y|FCHO1_ENST00000596951.1_Missense_Mutation_p.C647Y|FCHO1_ENST00000594202.1_Missense_Mutation_p.C647Y	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	647	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.|Mediates interaction with AGFG1, CALM, DAB2, EPS15, EPS15R, ITSN1 and clathrin.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)	p.C647Y(1)		NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						CTCCCTAGCTGCCTGGCTCGA	0.617																																					p.C597Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1790A	19						.						110.0	88.0	96.0					19																	17893828		2203	4300	6503	17754828	SO:0001583	missense	23149	exon22			AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.1940G>A	19.37:g.17893828G>A	ENSP00000470731:p.Cys647Tyr	Somatic		Capture	SOLID	Phase_I	17754828	NM_001161359	A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Missense_Mutation	SNP	ENST00000596536.1	37	CCDS32955.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.550953	0.65311	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	T;T;T	0.41400	1.0;1.0;1.0	4.01	4.01	0.46588	Muniscin C-terminal mu homology domain (1);	0.135144	0.49916	D	0.000126	T	0.57227	0.2039	M	0.72894	2.215	0.58432	D	0.999998	P;P	0.49783	0.928;0.912	P;P	0.60886	0.88;0.81	T	0.56117	-0.8032	10	0.33940	T	0.23	-15.9728	11.9814	0.53121	0.0:0.0:1.0:0.0	.	647;647	O14526;O14526-2	FCHO1_HUMAN;.	Y	647	ENSP00000252771:C647Y;ENSP00000373785:C647Y;ENSP00000437978:C647Y	ENSP00000252771:C647Y	C	+	2	0	FCHO1	17754828	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	8.320000	0.89995	1.965000	0.57142	0.484000	0.47621	TGC		FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466946.2	NM_015122	
JAK3	3718	hgsc.bcm.edu	37	19	17951106	17951106	+	Missense_Mutation	SNP	G	G	T	rs149047410	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:17951106G>T	ENST00000527670.1	-	8	1216	c.1187C>A	c.(1186-1188)cCt>cAt	p.P396H	JAK3_ENST00000534444.1_Missense_Mutation_p.P396H|JAK3_ENST00000458235.1_Missense_Mutation_p.P396H|JAK3_ENST00000526008.1_5'UTR			P52333	JAK3_HUMAN	Janus kinase 3	396	SH2; atypical.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.P396H(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	ATAGGAGCCAGGACGTGAGCC	0.577		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																p.P396H			Dom	yes		19	19p13.1	3718	Janus kinase 3		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1187A	19						.						55.0	48.0	50.0					19																	17951106		2203	4300	6503	17812106	SO:0001583	missense	3718	exon9			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.1187C>A	19.37:g.17951106G>T	ENSP00000432511:p.Pro396His	Somatic		Capture	SOLID	Phase_I	17812106	NM_000215	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	37	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.681522	0.29872	.	.	ENSG00000105639	ENST00000458235;ENST00000428406;ENST00000527670;ENST00000534444	T;T;T	0.74315	-0.83;-0.83;-0.83	4.8	4.8	0.61643	SH2 motif (2);	0.405962	0.26979	N	0.021524	T	0.80691	0.4671	L	0.54323	1.7	0.09310	N	1	D;D;P	0.89917	1.0;0.993;0.775	D;P;B	0.73380	0.98;0.896;0.304	T	0.71300	-0.4634	10	0.54805	T	0.06	-14.5583	9.0707	0.36491	0.1013:0.0:0.8987:0.0	.	396;396;396	B4DK43;P52333-2;P52333	.;.;JAK3_HUMAN	H	396	ENSP00000391676:P396H;ENSP00000432511:P396H;ENSP00000436421:P396H	ENSP00000413248:P396H	P	-	2	0	JAK3	17812106	0.006000	0.16342	0.311000	0.25182	0.220000	0.24768	1.459000	0.35234	2.226000	0.72624	0.557000	0.71058	CCT		JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215	
NMRK2	27231	hgsc.bcm.edu	37	19	3941100	3941100	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:3941100G>A	ENST00000168977.2	+	7	717	c.427G>A	c.(427-429)Ggc>Agc	p.G143S	NMRK2_ENST00000593949.1_Missense_Mutation_p.G148S|NMRK2_ENST00000599576.1_Intron	NM_170678.2	NP_733778.1	Q9NPI5	NRK2_HUMAN	nicotinamide riboside kinase 2	143					NAD biosynthetic process (GO:0009435)|negative regulation of myoblast differentiation (GO:0045662)	intracellular (GO:0005622)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|ribosylnicotinamide kinase activity (GO:0050262)	p.G143S(1)									TGATCCCCCCGGCCTCTTCGA	0.587																																					p.G143S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G427A	19						.						142.0	124.0	130.0					19																	3941100		2203	4300	6503	3892100	SO:0001583	missense	27231	exon7			AF190819	CCDS12115.1, CCDS74259.1	19p13.3	2013-10-28	2012-05-31	2012-05-31	ENSG00000077009	ENSG00000077009			17871	protein-coding gene	gene with protein product	"""muscle-specific beta 1 integrin binding protein"", ""nicotinamide riboside kinase 2"""	608705	"""integrin beta 1 binding protein 3"""	ITGB1BP3		10613898, 15137942	Standard	NM_170678		Approved	MIBP, NRK2	uc002lyz.4	Q9NPI5	OTTHUMG00000181758	ENST00000168977.2:c.427G>A	19.37:g.3941100G>A	ENSP00000168977:p.Gly143Ser	Somatic		Capture	SOLID	Phase_I	3892100	NM_170678	B7ZKR3|Q52M81|Q9NZK3	Missense_Mutation	SNP	ENST00000168977.2	37	CCDS12115.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623892	0.46840	.	.	ENSG00000077009	ENST00000168977	T	0.37411	1.2	4.03	2.99	0.34606	.	0.065315	0.64402	N	0.000011	T	0.60766	0.2294	M	0.87180	2.865	0.48762	D	0.999706	D;D	0.89917	0.99;1.0	D;D	0.83275	0.924;0.996	T	0.62793	-0.6779	10	0.59425	D	0.04	-23.6544	9.3442	0.38098	0.1093:0.0:0.8907:0.0	.	148;143	B7ZKR3;Q9NPI5	.;NRK2_HUMAN	S	143	ENSP00000168977:G143S	ENSP00000168977:G143S	G	+	1	0	ITGB1BP3	3892100	1.000000	0.71417	0.156000	0.22583	0.003000	0.03518	6.568000	0.73987	0.691000	0.31592	-0.218000	0.12543	GGC		NMRK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457492.1	NM_014446, NM_170678	
ZNF536	9745	hgsc.bcm.edu	37	19	30936106	30936106	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:30936106G>A	ENST00000355537.3	+	2	1784	c.1637G>A	c.(1636-1638)cGc>cAc	p.R546H		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	546					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.R546H(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CCGCTGCAGCGCAACCACGAA	0.562																																					p.R546H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1637A	19						.						76.0	82.0	80.0					19																	30936106		2203	4300	6503	35627946	SO:0001583	missense	9745	exon2				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1637G>A	19.37:g.30936106G>A	ENSP00000347730:p.Arg546His	Somatic		Capture	SOLID	Phase_I	35627946	NM_014717	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	G	0.020	-1.439079	0.01098	.	.	ENSG00000198597	ENST00000355537	T	0.46451	0.87	5.53	4.5	0.54988	.	0.296137	0.38837	N	0.001546	T	0.28200	0.0696	N	0.16478	0.41	0.37900	D	0.931026	B;B	0.12630	0.006;0.006	B;B	0.06405	0.002;0.002	T	0.09271	-1.0682	10	0.32370	T	0.25	-34.643	14.2026	0.65714	0.072:0.0:0.928:0.0	.	546;546	A7E228;O15090	.;ZN536_HUMAN	H	546	ENSP00000347730:R546H	ENSP00000347730:R546H	R	+	2	0	ZNF536	35627946	1.000000	0.71417	0.998000	0.56505	0.194000	0.23727	5.974000	0.70465	1.321000	0.45227	0.655000	0.94253	CGC		ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
ZNF790	388536	hgsc.bcm.edu	37	19	37309704	37309704	+	Silent	SNP	G	G	T	rs267605445		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:37309704G>T	ENST00000356725.4	-	5	1662	c.1542C>A	c.(1540-1542)gcC>gcA	p.A514A	CTD-2162K18.5_ENST00000587278.1_RNA|CTD-2162K18.5_ENST00000588906.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790	514					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A514A(1)		biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CCCAGAGAAAGGCTTTTCCAC	0.408																																					p.A514A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1542A	19						.						120.0	113.0	115.0					19																	37309704		2203	4300	6503	42001544	SO:0001819	synonymous_variant	388536	exon5			BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.1542C>A	19.37:g.37309704G>T		Somatic		Capture	SOLID	Phase_I	42001544	NM_206894		Silent	SNP	ENST00000356725.4	37	CCDS12496.1																																																																																				ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385341.2	NM_206894	
ZNF573	126231	hgsc.bcm.edu	37	19	38230342	38230342	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:38230342C>A	ENST00000590414.2	-	4	1070	c.1049G>T	c.(1048-1050)aGa>aTa	p.R350I	ZNF573_ENST00000357309.3_Missense_Mutation_p.R262I|ZNF573_ENST00000339503.4_Missense_Mutation_p.R292I|ZNF573_ENST00000536220.1_Missense_Mutation_p.R262I|ZNF573_ENST00000392138.1_Missense_Mutation_p.R263I			Q86YE8	ZN573_HUMAN	zinc finger protein 573	350					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R292I(2)		NS(1)|cervix(3)|endometrium(2)|large_intestine(8)|liver(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			TTTATGAATTCTCTGATGTAG	0.378																																					p.R348I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1043T	19						.						73.0	73.0	73.0					19																	38230342		2203	4300	6503	42922182	SO:0001583	missense	126231	exon5			AK074539	CCDS12508.1, CCDS54260.1, CCDS59381.1	19q13.12	2013-09-20			ENSG00000189144	ENSG00000189144		"""Zinc fingers, C2H2-type"", ""-"""	26420	protein-coding gene	gene with protein product						12477932	Standard	NM_152360		Approved	FLJ30921	uc002ohe.3	Q86YE8	OTTHUMG00000048183	ENST00000590414.2:c.1049G>T	19.37:g.38230342C>A	ENSP00000465020:p.Arg350Ile	Somatic		Capture	SOLID	Phase_I	42922182	NM_001172691	B7WPE1|K7EJ45|Q6P1P1|Q7Z7Q3|Q8N2Q1|Q96BM3|Q96NH0	Missense_Mutation	SNP	ENST00000590414.2	37	CCDS59381.1	.	.	.	.	.	.	.	.	.	.	C	9.571	1.121017	0.20877	.	.	ENSG00000189144	ENST00000392138;ENST00000536220;ENST00000357309;ENST00000339503;ENST00000427026	T;T;T;T	0.24908	1.83;1.83;1.83;1.83	2.02	-3.18	0.05186	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26557	0.0649	M	0.71920	2.185	0.09310	N	1	P;P;P;P	0.44044	0.65;0.79;0.825;0.79	B;B;B;B	0.44108	0.313;0.313;0.441;0.313	T	0.22730	-1.0208	9	0.62326	D	0.03	.	4.4117	0.11436	0.0:0.5649:0.1818:0.2533	.	263;292;330;262	Q86YE8-4;Q86YE8-3;Q86YE8;Q86YE8-2	.;.;ZN573_HUMAN;.	I	263;262;262;292;262	ENSP00000375983:R263I;ENSP00000440464:R262I;ENSP00000349861:R262I;ENSP00000340171:R292I	ENSP00000340171:R292I	R	-	2	0	ZNF573	42922182	0.000000	0.05858	0.063000	0.19743	0.199000	0.23934	-0.566000	0.05922	-0.346000	0.08312	0.460000	0.39030	AGA		ZNF573-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459773.2	NM_152360	
FBXO27	126433	hgsc.bcm.edu	37	19	39516110	39516110	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:39516110C>T	ENST00000292853.4	-	6	912	c.793G>A	c.(793-795)Ggc>Agc	p.G265S	FBXO27_ENST00000509137.2_Missense_Mutation_p.G265S|FBXO27_ENST00000600828.1_Missense_Mutation_p.G264S	NM_178820.3	NP_849142.1	Q8NI29	FBX27_HUMAN	F-box protein 27	265	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)	p.G265S(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|urinary_tract(2)	17	all_cancers(60;3.79e-07)|all_lung(34;1.26e-07)|Lung NSC(34;1.46e-07)|all_epithelial(25;4.69e-07)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CCATAGTGGCCAGCCCAGAAC	0.577																																					p.G265S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G793A	19						.						91.0	77.0	82.0					19																	39516110		2203	4300	6503	44207950	SO:0001583	missense	126433	exon6			AF436061	CCDS12527.1	19q13.2	2008-02-05	2004-06-15			ENSG00000161243		"""F-boxes /  ""other"""""	18753	protein-coding gene	gene with protein product		609099	"""F-box only protein 27"""			126433	Standard	NM_178820		Approved	Fbg5, Fbx27	uc002okh.3	Q8NI29		ENST00000292853.4:c.793G>A	19.37:g.39516110C>T	ENSP00000292853:p.Gly265Ser	Somatic		Capture	SOLID	Phase_I	44207950	NM_178820	Q96C87	Missense_Mutation	SNP	ENST00000292853.4	37	CCDS12527.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.694000	0.68386	.	.	ENSG00000161243	ENST00000292853;ENST00000509137	T;T	0.37584	1.19;1.19	4.06	3.03	0.35002	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	0.116735	0.36854	N	0.002377	T	0.52125	0.1715	M	0.87328	2.875	0.23735	N	0.996985	P	0.52316	0.952	P	0.53593	0.73	T	0.49113	-0.8973	10	0.72032	D	0.01	-34.1642	7.7356	0.28812	0.0:0.8841:0.0:0.1159	.	265	Q8NI29	FBX27_HUMAN	S	265	ENSP00000292853:G265S;ENSP00000437662:G265S	ENSP00000292853:G265S	G	-	1	0	FBXO27	44207950	0.070000	0.21116	0.123000	0.21794	0.897000	0.52465	1.587000	0.36622	1.055000	0.40461	0.491000	0.48974	GGC		FBXO27-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463281.1		
FBXO27	126433	hgsc.bcm.edu	37	19	39521863	39521863	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:39521863G>A	ENST00000292853.4	-	3	581	c.462C>T	c.(460-462)ttC>ttT	p.F154F	FBXO27_ENST00000509137.2_Silent_p.F154F|CTB-189B5.3_ENST00000597303.1_RNA|FBXO27_ENST00000600828.1_Silent_p.F153F	NM_178820.3	NP_849142.1	Q8NI29	FBX27_HUMAN	F-box protein 27	154	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)	p.F154F(2)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|urinary_tract(2)	17	all_cancers(60;3.79e-07)|all_lung(34;1.26e-07)|Lung NSC(34;1.46e-07)|all_epithelial(25;4.69e-07)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			ATGAAGTCACGAAGCACGTCT	0.582																																					p.F154F												.	.	2	Substitution - coding silent(2)	urinary_tract(1)|large_intestine(1)	c.C462T	19						.						122.0	121.0	121.0					19																	39521863		2203	4300	6503	44213703	SO:0001819	synonymous_variant	126433	exon3			AF436061	CCDS12527.1	19q13.2	2008-02-05	2004-06-15			ENSG00000161243		"""F-boxes /  ""other"""""	18753	protein-coding gene	gene with protein product		609099	"""F-box only protein 27"""			126433	Standard	NM_178820		Approved	Fbg5, Fbx27	uc002okh.3	Q8NI29		ENST00000292853.4:c.462C>T	19.37:g.39521863G>A		Somatic		Capture	SOLID	Phase_I	44213703	NM_178820	Q96C87	Silent	SNP	ENST00000292853.4	37	CCDS12527.1																																																																																				FBXO27-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463281.1		
SUPT5H	6829	hgsc.bcm.edu	37	19	39955515	39955515	+	Missense_Mutation	SNP	C	C	A	rs2304216	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:39955515C>A	ENST00000599117.1	+	12	1069	c.702C>A	c.(700-702)caC>caA	p.H234Q	SUPT5H_ENST00000598725.1_Missense_Mutation_p.H234Q|SUPT5H_ENST00000359191.6_Missense_Mutation_p.H230Q|SUPT5H_ENST00000402194.2_Missense_Mutation_p.H230Q|SUPT5H_ENST00000432763.2_Missense_Mutation_p.H234Q			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	234	Interaction with SUPT4H1.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			AGCAGACCCACGTGAAGCAGG	0.587																																					p.H234Q												.	.	0			c.C702A	19						.						103.0	88.0	93.0					19																	39955515		2203	4300	6503	44647355	SO:0001583	missense	6829	exon10			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.702C>A	19.37:g.39955515C>A	ENSP00000470252:p.His234Gln	Somatic		Capture	SOLID	Phase_I	44647355	NM_003169	O43279|Q59G52|Q99639	Missense_Mutation	SNP	ENST00000599117.1	37	CCDS12536.1	.	.	.	.	.	.	.	.	.	.	c	17.37	3.372543	0.61624	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.62	-9.1	0.00714	Transcription antitermination protein, NusG, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.68146	0.2969	M	0.78637	2.42	0.09310	P	0.999999886546	D;D	0.67145	0.995;0.996	D;D	0.76575	0.979;0.988	T	0.79325	-0.1850	7	.	.	.	-25.1679	15.2837	0.73810	0.0:0.3844:0.0:0.6156	.	230;234	O00267-2;O00267	.;SPT5H_HUMAN	Q	234;230;212;234	.	.	H	+	3	2	SUPT5H	44647355	0.007000	0.16637	0.496000	0.27539	0.864000	0.49448	-0.961000	0.03845	-1.680000	0.01450	-2.740000	0.00127	CAC		SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169	
SERTAD3	29946	hgsc.bcm.edu	37	19	40947861	40947861	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:40947861G>A	ENST00000322354.3	-	2	623	c.127C>T	c.(127-129)Cgc>Tgc	p.R43C	SERTAD3_ENST00000601217.1_5'Flank|CTC-492K19.4_ENST00000599050.1_RNA|SERTAD3_ENST00000392028.4_Missense_Mutation_p.R43C	NM_203344.2	NP_976219.1	Q9UJW9	SRTD3_HUMAN	SERTA domain containing 3	43	SERTA. {ECO:0000255|PROSITE- ProRule:PRU00396}.				negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.R43C(1)		kidney(1)|large_intestine(4)|lung(2)	7			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCCAGGCTGCGCTGGACTTTG	0.637																																					p.R43C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C127T	19						.						31.0	27.0	28.0					19																	40947861		2203	4300	6503	45639701	SO:0001583	missense	29946	exon2			AF192529	CCDS12558.1	19q13.2	2008-02-05				ENSG00000167565			17931	protein-coding gene	gene with protein product	"""RPA-binding trans-activator"""	612125				10982866, 11331592	Standard	NM_013368		Approved	RBT1	uc002onv.4	Q9UJW9		ENST00000322354.3:c.127C>T	19.37:g.40947861G>A	ENSP00000325414:p.Arg43Cys	Somatic		Capture	SOLID	Phase_I	45639701	NM_203344	B3KQB3|Q96CQ2	Missense_Mutation	SNP	ENST00000322354.3	37	CCDS12558.1	.	.	.	.	.	.	.	.	.	.	G	10.80	1.451727	0.26074	.	.	ENSG00000167565	ENST00000322354;ENST00000392028	.	.	.	4.88	3.84	0.44239	.	0.197941	0.30949	N	0.008542	T	0.35068	0.0919	N	0.08118	0	0.54753	D	0.99998	D	0.60575	0.988	P	0.50537	0.643	T	0.34850	-0.9812	9	0.66056	D	0.02	-16.0624	10.4785	0.44678	0.0:0.0:0.8066:0.1934	.	43	Q9UJW9	SRTD3_HUMAN	C	43	.	ENSP00000325414:R43C	R	-	1	0	SERTAD3	45639701	0.998000	0.40836	0.966000	0.40874	0.952000	0.60782	1.544000	0.36158	1.264000	0.44198	0.655000	0.94253	CGC		SERTAD3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462573.1	NM_013368	
ZNF180	7733	hgsc.bcm.edu	37	19	44981549	44981549	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:44981549A>G	ENST00000221327.4	-	5	1430	c.1149T>C	c.(1147-1149)tgT>tgC	p.C383C	ZNF180_ENST00000592529.1_Silent_p.C356C|ZNF180_ENST00000391956.4_Silent_p.C358C|ZNF180_ENST00000585514.1_5'Flank|AC069278.4_ENST00000591684.1_lincRNA	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	383					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C383C(1)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				CACATTCACTACATTCATAAG	0.443																																					p.C383C	Esophageal Squamous(180;1353 2003 32862 46574 49854)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1149C	19						.						72.0	72.0	72.0					19																	44981549		2203	4299	6502	49673389	SO:0001819	synonymous_variant	7733	exon5			AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.1149T>C	19.37:g.44981549A>G		Somatic		Capture	SOLID	Phase_I	49673389	NM_013256	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Silent	SNP	ENST00000221327.4	37	CCDS12639.1																																																																																				ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1	NM_013256	
CEACAM19	56971	hgsc.bcm.edu	37	19	45183598	45183598	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:45183598A>G	ENST00000403660.3	+	5	908	c.698A>G	c.(697-699)cAt>cGt	p.H233R	CEACAM19_ENST00000480278.1_3'UTR|CEACAM19_ENST00000358777.4_Missense_Mutation_p.H233R|CTB-171A8.1_ENST00000590796.1_RNA			Q7Z692	CEA19_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 19	233						integral component of membrane (GO:0016021)		p.H233R(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)	11	Lung NSC(12;0.00308)|all_lung(12;0.00806)	Prostate(69;0.0376)				GGCCCTGCTCATGATGCTGGT	0.557																																					p.H233R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A698G	19						.						128.0	122.0	124.0					19																	45183598		2203	4300	6503	49875438	SO:0001583	missense	56971	exon5			AF406955	CCDS12641.1, CCDS46108.1	19q13.31	2013-01-11			ENSG00000186567	ENSG00000186567		"""Immunoglobulin superfamily / V-set domain containing"""	31951	protein-coding gene	gene with protein product		606691					Standard	NM_020219		Approved	CEAL1	uc002ozo.4	Q7Z692	OTTHUMG00000151528	ENST00000403660.3:c.698A>G	19.37:g.45183598A>G	ENSP00000384887:p.His233Arg	Somatic		Capture	SOLID	Phase_I	49875438	NM_001127893	Q5XJ15|Q7Z693	Missense_Mutation	SNP	ENST00000403660.3	37	CCDS12641.1	.	.	.	.	.	.	.	.	.	.	A	0.609	-0.825762	0.02734	.	.	ENSG00000186567	ENST00000358777;ENST00000403660	T;T	0.02177	4.41;4.41	2.51	-5.02	0.02982	.	1.727770	0.04058	N	0.305940	T	0.01421	0.0046	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.44997	-0.9291	10	0.35671	T	0.21	-0.163	1.132	0.01747	0.1687:0.2158:0.3516:0.2639	.	233;233	Q5XJ15;Q7Z692	.;CEA19_HUMAN	R	233	ENSP00000351627:H233R;ENSP00000384887:H233R	ENSP00000351627:H233R	H	+	2	0	CEACAM19	49875438	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.160000	0.03147	-2.587000	0.00458	0.374000	0.22700	CAT		CEACAM19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323022.1	NM_020219	
PRKD2	25865	hgsc.bcm.edu	37	19	47181777	47181777	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:47181777G>A	ENST00000291281.4	-	16	2439	c.2214C>T	c.(2212-2214)ggC>ggT	p.G738G	PRKD2_ENST00000600194.1_Silent_p.G581G|PRKD2_ENST00000601806.1_Silent_p.G581G|PRKD2_ENST00000433867.1_Silent_p.G738G|PRKD2_ENST00000593492.1_5'Flank|PRKD2_ENST00000595515.1_Silent_p.G738G|DACT3-AS1_ENST00000525008.1_RNA			Q9BZL6	KPCD2_HUMAN	protein kinase D2	738	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.G738G(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		ACATGATCACGCCCACTGACC	0.622																																					p.G738G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2214T	19						.						169.0	122.0	138.0					19																	47181777		2203	4300	6503	51873617	SO:0001819	synonymous_variant	25865	exon17			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.2214C>T	19.37:g.47181777G>A		Somatic		Capture	SOLID	Phase_I	51873617	NM_001079881	Q8TB08|Q9P0T6|Q9Y3X8	Silent	SNP	ENST00000291281.4	37	CCDS12689.1																																																																																				PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
GLTSCR2	29997	hgsc.bcm.edu	37	19	48250287	48250287	+	Splice_Site	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:48250287A>G	ENST00000246802.5	+	2	326	c.288A>G	c.(286-288)aaA>aaG	p.K96K	GLTSCR2_ENST00000598681.1_3'UTR	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	96						intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.K96K(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		CCAAGGAAAAAGGTGAGGAGA	0.483																																					p.K96K	Colon(58;613 1041 9473 10089 15241)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A288G	19						.						97.0	96.0	97.0					19																	48250287		2203	4300	6503	52942099	SO:0001630	splice_region_variant	29997	exon2			AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.289+1A>G	19.37:g.48250287A>G		Somatic		Capture	SOLID	Phase_I	52942099	NM_015710	Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Silent	SNP	ENST00000246802.5	37	CCDS12705.1																																																																																				GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1	NM_015710	Silent
ELSPBP1	64100	hgsc.bcm.edu	37	19	48517547	48517547	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:48517547A>G	ENST00000339841.2	+	3	368	c.190A>G	c.(190-192)Aag>Gag	p.K64E	ELSPBP1_ENST00000597519.1_Intron	NM_022142.4	NP_071425.3	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1	64	Fibronectin type-II 1. {ECO:0000255|PROSITE-ProRule:PRU00479}.				single fertilization (GO:0007338)	extracellular region (GO:0005576)		p.K64E(1)		NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(6)	10		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		CGGCCAGTGGAAGTACTGCCA	0.483																																					p.K64E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A190G	19						.						152.0	131.0	138.0					19																	48517547		2203	4300	6503	53209359	SO:0001583	missense	64100	exon3			AJ278478	CCDS12708.1	19q13.33	2009-09-17							14417	protein-coding gene	gene with protein product	"""epididymal protein 12"""	607443					Standard	NM_022142		Approved	HE12, E12, EDDM12	uc002pht.3	Q96BH3		ENST00000339841.2:c.190A>G	19.37:g.48517547A>G	ENSP00000340660:p.Lys64Glu	Somatic		Capture	SOLID	Phase_I	53209359	NM_022142	Q96RT0|Q9H4C8	Missense_Mutation	SNP	ENST00000339841.2	37	CCDS12708.1	.	.	.	.	.	.	.	.	.	.	A	15.77	2.932258	0.52866	.	.	ENSG00000169393	ENST00000339841	T	0.52057	0.68	2.98	2.98	0.34508	Fibronectin, type II, collagen-binding (4);Kringle-like fold (2);	0.000000	0.37219	N	0.002189	T	0.65954	0.2741	M	0.87381	2.88	0.23758	N	0.996924	D	0.69078	0.997	D	0.75484	0.986	T	0.54931	-0.8219	10	0.28530	T	0.3	.	7.7835	0.29078	1.0:0.0:0.0:0.0	.	64	Q96BH3	ESPB1_HUMAN	E	64	ENSP00000340660:K64E	ENSP00000340660:K64E	K	+	1	0	ELSPBP1	53209359	0.642000	0.27260	0.874000	0.34290	0.017000	0.09413	2.469000	0.45110	1.598000	0.50083	0.445000	0.29226	AAG		ELSPBP1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465207.1		
RASIP1	54922	hgsc.bcm.edu	37	19	49228041	49228041	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:49228041C>T	ENST00000222145.4	-	9	2508	c.2304G>A	c.(2302-2304)gtG>gtA	p.V768V		NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	768	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)		p.V768V(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		AAGTCTGAGACACGAGGTCAG	0.592																																					p.V768V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2304A	19						.						114.0	114.0	114.0					19																	49228041		2203	4300	6503	53919853	SO:0001819	synonymous_variant	54922	exon9			BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.2304G>A	19.37:g.49228041C>T		Somatic		Capture	SOLID	Phase_I	53919853	NM_017805	Q6U676	Silent	SNP	ENST00000222145.4	37	CCDS12731.1																																																																																				RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	NM_017805	
SLC17A7	57030	hgsc.bcm.edu	37	19	49939939	49939939	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:49939939C>T	ENST00000221485.3	-	2	353	c.182G>A	c.(181-183)cGc>cAc	p.R61H	SLC17A7_ENST00000543531.1_Missense_Mutation_p.R49H|SLC17A7_ENST00000600601.1_5'UTR	NM_020309.3	NP_064705.1	Q9P2U7	VGLU1_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 7	61					glutamate secretion (GO:0014047)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|long-term memory (GO:0007616)|neurotransmitter secretion (GO:0007269)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sequestering of neurotransmitter (GO:0042137)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|synaptic vesicle membrane (GO:0030672)	inorganic phosphate transmembrane transporter activity (GO:0005315)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:inorganic phosphate symporter activity (GO:0015319)	p.R61H(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	26		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		AATGTAGCGGCGAGGGAGGCC	0.647																																					p.R61H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G182A	19						.						104.0	89.0	94.0					19																	49939939		2203	4300	6503	54631751	SO:0001583	missense	57030	exon2			AB032436	CCDS12764.1	19q13.33	2013-07-18	2013-07-18		ENSG00000104888	ENSG00000104888		"""Solute carriers"""	16704	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 1"""	605208	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7"""			8632143, 10820226	Standard	NM_020309		Approved	BNPI, VGLUT1	uc002pnp.3	Q9P2U7		ENST00000221485.3:c.182G>A	19.37:g.49939939C>T	ENSP00000221485:p.Arg61His	Somatic		Capture	SOLID	Phase_I	54631751	NM_020309	B4DFR9|B4DG46|Q6PCD0	Missense_Mutation	SNP	ENST00000221485.3	37	CCDS12764.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.933973	0.92458	.	.	ENSG00000104888	ENST00000221485;ENST00000543531	T;T	0.60299	0.2;0.2	4.05	4.05	0.47172	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.47455	D	0.000232	T	0.63331	0.2502	M	0.66939	2.045	0.46586	D	0.99911	D	0.56968	0.978	P	0.49361	0.608	T	0.69591	-0.5104	10	0.66056	D	0.02	.	14.5234	0.67870	0.0:1.0:0.0:0.0	.	61	Q9P2U7	VGLU1_HUMAN	H	61;49	ENSP00000221485:R61H;ENSP00000441767:R49H	ENSP00000221485:R61H	R	-	2	0	SLC17A7	54631751	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.170000	0.50816	2.572000	0.86782	0.561000	0.74099	CGC		SLC17A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465367.2		
SIGLEC7	27036	hgsc.bcm.edu	37	19	51645956	51645956	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:51645956C>T	ENST00000317643.6	+	1	399	c.330C>T	c.(328-330)atC>atT	p.I110I	SIGLEC7_ENST00000305628.7_Silent_p.I110I|SIGLEC7_ENST00000600577.1_Silent_p.I110I	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	110	Ig-like V-type.				cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.I110I(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		CCCTGAGCATCAGAGATGCCA	0.483																																					p.I110I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C330T	19						.						108.0	106.0	107.0					19																	51645956		2203	4300	6503	56337768	SO:0001819	synonymous_variant	27036	exon1			AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.330C>T	19.37:g.51645956C>T		Somatic		Capture	SOLID	Phase_I	56337768	NM_014385	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Silent	SNP	ENST00000317643.6	37	CCDS12826.1																																																																																				SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464226.2	NM_016543	
SIGLEC12	89858	hgsc.bcm.edu	37	19	52004636	52004636	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:52004636T>C	ENST00000291707.3	-	1	407	c.352A>G	c.(352-354)Aca>Gca	p.T118A	SIGLEC12_ENST00000598614.1_5'Flank	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	118	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.T118A(1)		NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		AAGACGTATGTCCCTGCATCA	0.498																																					p.T118A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A352G	19						.						150.0	135.0	140.0					19																	52004636		2203	4300	6503	56696448	SO:0001583	missense	89858	exon1			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.352A>G	19.37:g.52004636T>C	ENSP00000291707:p.Thr118Ala	Somatic		Capture	SOLID	Phase_I	56696448	NM_053003	Q8IYH7	Missense_Mutation	SNP	ENST00000291707.3	37	CCDS12833.1	.	.	.	.	.	.	.	.	.	.	.	0.142	-1.100811	0.01843	.	.	ENSG00000254521	ENST00000291707	T	0.70631	-0.5	2.09	-4.19	0.03835	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.58452	0.2123	M	0.64170	1.965	0.09310	N	1	B	0.12630	0.006	B	0.11329	0.006	T	0.40997	-0.9533	9	0.34782	T	0.22	.	2.7807	0.05360	0.4945:0.0:0.2056:0.2998	.	118	Q96PQ1	SIG12_HUMAN	A	118	ENSP00000291707:T118A	ENSP00000291707:T118A	T	-	1	0	SIGLEC12	56696448	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.837000	0.04377	-1.769000	0.01297	-0.934000	0.02701	ACA		SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003	
NLRP11	204801	hgsc.bcm.edu	37	19	56321560	56321560	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:56321560G>A	ENST00000589093.1	-	3	509	c.416C>T	c.(415-417)aCc>aTc	p.T139I	NLRP11_ENST00000443188.1_Missense_Mutation_p.T139I|NLRP11_ENST00000360133.3_Missense_Mutation_p.T139I|NLRP11_ENST00000592953.1_Missense_Mutation_p.T40I|NLRP11_ENST00000589824.2_Missense_Mutation_p.T139I			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	139							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)	p.T139I(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		ATAATAGCTGGTAGAATCATA	0.368																																					p.T139I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C416T	19						.						64.0	61.0	62.0					19																	56321560		2203	4300	6503	61013372	SO:0001583	missense	204801	exon5			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.416C>T	19.37:g.56321560G>A	ENSP00000466285:p.Thr139Ile	Somatic		Capture	SOLID	Phase_I	61013372	NM_145007	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	ENST00000589093.1	37	CCDS12935.1	.	.	.	.	.	.	.	.	.	.	G	1.786	-0.480655	0.04383	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.74947	-0.89;-0.83	1.86	-3.72	0.04411	.	.	.	.	.	T	0.47078	0.1426	N	0.08118	0	0.09310	N	1	P;B	0.36282	0.546;0.423	B;B	0.38842	0.186;0.283	T	0.39231	-0.9624	9	0.39692	T	0.17	.	0.2034	0.00147	0.276:0.1622:0.2831:0.2787	.	139;139	P59045;P59045-2	NAL11_HUMAN;.	I	139	ENSP00000409898:T139I;ENSP00000353251:T139I	ENSP00000353251:T139I	T	-	2	0	NLRP11	61013372	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.493000	0.00972	-2.162000	0.00784	-1.108000	0.02087	ACC		NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007	
CLPP	8192	hgsc.bcm.edu	37	19	6366341	6366341	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:6366341G>A	ENST00000245816.4	+	5	751	c.628G>A	c.(628-630)Gcc>Acc	p.A210T	CLPP_ENST00000596149.1_Missense_Mutation_p.A123T|CLPP_ENST00000596605.1_3'UTR	NM_006012.2	NP_006003.1	Q16740	CLPP_HUMAN	caseinolytic mitochondrial matrix peptidase proteolytic subunit	210					protein homooligomerization (GO:0051260)|proteolysis involved in cellular protein catabolic process (GO:0051603)	endopeptidase Clp complex (GO:0009368)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.A210T(1)		endometrium(2)|large_intestine(2)|ovary(2)	6						TAACATCTACGCCAAGCACAC	0.562																																					p.A210T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G628A	19						.						182.0	136.0	151.0					19																	6366341		2202	4300	6502	6317341	SO:0001583	missense	8192	exon5			Z50853	CCDS12162.1	19p13.3	2013-09-12	2013-09-12		ENSG00000125656	ENSG00000125656		"""ATPases / AAA-type"""	2084	protein-coding gene	gene with protein product	"""ATP-dependent protease ClpAP (E. coli), proteolytic subunit, human"""	601119	"""ClpP (caseinolytic protease, ATP-dependent, proteolytic subunit, E. coli) homolog"", ""ClpP caseinolytic protease, ATP-dependent, proteolytic subunit homolog (E. coli)"", ""ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)"""			8543061, 23360988	Standard	NM_006012		Approved		uc002mem.1	Q16740	OTTHUMG00000180779	ENST00000245816.4:c.628G>A	19.37:g.6366341G>A	ENSP00000245816:p.Ala210Thr	Somatic		Capture	SOLID	Phase_I	6317341	NM_006012	B2R4W5	Missense_Mutation	SNP	ENST00000245816.4	37	CCDS12162.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.122395	0.77436	.	.	ENSG00000125656	ENST00000245816	.	.	.	5.61	3.41	0.39046	.	0.305617	0.34700	N	0.003760	T	0.73745	0.3626	M	0.91196	3.185	0.48185	D	0.9996	D	0.55605	0.972	P	0.48795	0.59	T	0.79519	-0.1770	9	0.72032	D	0.01	-12.6561	12.006	0.53259	0.0:0.1318:0.7312:0.1371	.	210	Q16740	CLPP_HUMAN	T	210	.	ENSP00000245816:A210T	A	+	1	0	CLPP	6317341	1.000000	0.71417	0.757000	0.31301	0.797000	0.45037	3.812000	0.55628	0.819000	0.34492	0.650000	0.86243	GCC		CLPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452984.1	NM_006012	
SBSN	374897	hgsc.bcm.edu	37	19	36019046	36019047	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	CT	CT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:36019046_36019047delCT	ENST00000452271.2	-	1	165_166	c.137_138delAG	c.(136-138)gagfs	p.E46fs	SBSN_ENST00000518157.1_Frame_Shift_Del_p.E46fs	NM_001166034.1	NP_001159506.1	Q6UWP8	SBSN_HUMAN	suprabasin	46						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.E46fs*27(1)		large_intestine(5)|lung(6)|ovary(1)|prostate(2)	14	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CCTTGCCCACCTCTCTCTCTGC	0.579																																					p.46_46del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.137_138del	19						.																																			40710887	SO:0001589	frameshift_variant	374897	exon1			AY358701	CCDS12464.1, CCDS54253.1	19q13.13	2008-02-05							24950	protein-coding gene	gene with protein product		609969				12228223	Standard	NM_198538		Approved	UNQ698, HLAR698	uc002oad.2	Q6UWP8		ENST00000452271.2:c.137_138delAG	19.37:g.36019054_36019055delCT	ENSP00000430242:p.Glu46fs	Somatic		Capture	SOLID	Phase_I	40710886	NM_001166034	A8K5J0|E9PBV3	Frame_Shift_Del	DEL	ENST00000452271.2	37	CCDS54253.1																																																																																				SBSN-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109463.3	NM_198538	
ZIK1	284307	hgsc.bcm.edu	37	19	58101486	58101486	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr19:58101486G>A	ENST00000597850.1	+	4	522	c.307G>A	c.(307-309)Gag>Aag	p.E103K	ZIK1_ENST00000536878.2_Missense_Mutation_p.E90K|ZIK1_ENST00000599456.1_Missense_Mutation_p.E48K|ZIK1_ENST00000307468.4_3'UTR	NM_001010879.2	NP_001010879.2	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein 1	103	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E103K(1)		NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	34		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TCAATCCTGTGAGATGTGTGT	0.468																																					p.E103K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G307A	19						.						117.0	99.0	105.0					19																	58101486		2203	4300	6503	62793298	SO:0001583	missense	284307	exon4			AK092538	CCDS33135.1	19q13.43	2013-01-08	2012-12-07		ENSG00000171649	ENSG00000171649		"""Zinc fingers, C2H2-type"", ""-"""	33104	protein-coding gene	gene with protein product			"""zinc finger protein interacting with K protein 1 homolog (mouse)"""				Standard	XM_005258769		Approved	ZNF762	uc002qpg.3	Q3SY52		ENST00000597850.1:c.307G>A	19.37:g.58101486G>A	ENSP00000472867:p.Glu103Lys	Somatic		Capture	SOLID	Phase_I	62793298	NM_001010879	O43339|Q3SY51|Q3SY53	Missense_Mutation	SNP	ENST00000597850.1	37	CCDS33135.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.670145	0.67814	.	.	ENSG00000171649	ENST00000536878;ENST00000356724;ENST00000307468	T	0.06218	3.33	2.97	0.834	0.18880	Krueppel-associated box (1);	.	.	.	.	T	0.03695	0.0105	N	0.10837	0.055	0.25173	N	0.990261	B;P	0.46395	0.27;0.877	B;B	0.43194	0.103;0.411	T	0.40831	-0.9542	9	0.44086	T	0.13	.	4.8713	0.13635	0.2927:0.0:0.7073:0.0	.	90;103	F5H435;Q3SY52	.;ZIK1_HUMAN	K	90;84;103	ENSP00000438487:E90K	ENSP00000303820:E103K	E	+	1	0	ZIK1	62793298	0.846000	0.29590	0.312000	0.25196	0.525000	0.34531	3.467000	0.53078	0.300000	0.22699	0.555000	0.69702	GAG		ZIK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466791.1	NM_001010879	
CSMD3	114788	hgsc.bcm.edu	37	8	113353838	113353838	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:113353838T>C	ENST00000297405.5	-	42	6764	c.6520A>G	c.(6520-6522)Act>Gct	p.T2174A	CSMD3_ENST00000352409.3_Missense_Mutation_p.T2104A|CSMD3_ENST00000343508.3_Missense_Mutation_p.T2134A|CSMD3_ENST00000455883.2_Missense_Mutation_p.T2070A	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2174	CUB 12. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T2174A(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACAGTACTAGTTTCTGAGGAT	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.T2174A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A6520G	8						.						121.0	115.0	117.0					8																	113353838		2203	4300	6503	113423014	SO:0001583	missense	114788	exon42			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6520A>G	8.37:g.113353838T>C	ENSP00000297405:p.Thr2174Ala	Somatic		Capture	SOLID	Phase_I	113423014	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	14.22	2.469427	0.43839	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.17370	2.28;2.28;2.28;2.28;2.28	4.56	3.37	0.38596	CUB (5);	0.300125	0.30076	N	0.010471	T	0.16599	0.0399	L	0.58583	1.82	0.24075	N	0.995967	B;B;B	0.33212	0.001;0.0;0.402	B;B;B	0.37550	0.007;0.005;0.253	T	0.15578	-1.0432	10	0.19147	T	0.46	.	6.5358	0.22352	0.0:0.0798:0.1573:0.7629	.	2070;2174;2134	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	A	2134;2174;1444;2070;2104	ENSP00000345799:T2134A;ENSP00000297405:T2174A;ENSP00000341558:T1444A;ENSP00000412263:T2070A;ENSP00000343124:T2104A	ENSP00000297405:T2174A	T	-	1	0	CSMD3	113423014	1.000000	0.71417	0.988000	0.46212	0.991000	0.79684	2.590000	0.46154	0.843000	0.35070	0.533000	0.62120	ACT		CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
FBXO32	114907	hgsc.bcm.edu	37	8	124525568	124525568	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:124525568T>C	ENST00000517956.1	-	6	712	c.521A>G	c.(520-522)tAc>tGc	p.Y174C	FBXO32_ENST00000443022.2_Intron	NM_058229.3|NM_148177.2	NP_478136.1|NP_680482.1	Q969P5	FBX32_HUMAN	F-box protein 32	174					cellular response to dexamethasone stimulus (GO:0071549)|protein ubiquitination (GO:0016567)|response to denervation involved in regulation of muscle adaptation (GO:0014894)	nucleolus (GO:0005730)|Z disc (GO:0030018)		p.Y174C(1)		autonomic_ganglia(1)|breast(3)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)|stomach(1)	21	Lung NSC(37;1.13e-13)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TAAGGATGTGTAGAGGGTCTG	0.433																																					p.Y174C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A521G	8						.						177.0	149.0	159.0					8																	124525568		2203	4300	6503	124594749	SO:0001583	missense	114907	exon6			AJ420108	CCDS6345.1, CCDS56553.1	8q24.13	2008-01-28	2004-06-15		ENSG00000156804	ENSG00000156804		"""F-boxes /  ""other"""""	16731	protein-coding gene	gene with protein product		606604	"""F-box only protein 32"""			11679633, 11717410	Standard	NM_058229		Approved	MAFbx, ATROGIN1, Fbx32	uc003yqr.3	Q969P5	OTTHUMG00000164981	ENST00000517956.1:c.521A>G	8.37:g.124525568T>C	ENSP00000428205:p.Tyr174Cys	Somatic		Capture	SOLID	Phase_I	124594749	NM_058229	A4KYM0	Missense_Mutation	SNP	ENST00000517956.1	37	CCDS6345.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.384704	0.82792	.	.	ENSG00000156804	ENST00000517956	T	0.17854	2.25	5.63	5.63	0.86233	.	0.052630	0.85682	D	0.000000	T	0.33265	0.0857	L	0.57536	1.79	0.80722	D	1	D	0.54601	0.967	P	0.57324	0.818	T	0.01545	-1.1328	10	0.36615	T	0.2	-15.1048	15.8269	0.78718	0.0:0.0:0.0:1.0	.	174	Q969P5	FBX32_HUMAN	C	174	ENSP00000428205:Y174C	ENSP00000428205:Y174C	Y	-	2	0	FBXO32	124594749	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.276000	0.72601	2.147000	0.66899	0.454000	0.30748	TAC		FBXO32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381281.1		
ADCY8	114	hgsc.bcm.edu	37	8	131916177	131916177	+	Silent	SNP	A	A	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:131916177A>C	ENST00000286355.5	-	7	3844	c.1752T>G	c.(1750-1752)acT>acG	p.T584T	ADCY8_ENST00000377928.3_Silent_p.T584T	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	584					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.T584T(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TAATTAAGTAAGTTTCGATAT	0.483										HNSCC(32;0.087)																											p.T584T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1752G	8						.						151.0	138.0	142.0					8																	131916177		2203	4300	6503	131985359	SO:0001819	synonymous_variant	114	exon7			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1752T>G	8.37:g.131916177A>C		Somatic		Capture	SOLID	Phase_I	131985359	NM_001115		Silent	SNP	ENST00000286355.5	37	CCDS6363.1																																																																																				ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
NDRG1	10397	hgsc.bcm.edu	37	8	134271432	134271432	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:134271432G>T	ENST00000414097.2	-	6	1235	c.368C>A	c.(367-369)cCt>cAt	p.P123H	NDRG1_ENST00000354944.5_Intron|NDRG1_ENST00000323851.7_Missense_Mutation_p.P123H|NDRG1_ENST00000518066.1_Intron|NDRG1_ENST00000522476.1_Missense_Mutation_p.P57H|NDRG1_ENST00000537882.1_Missense_Mutation_p.P42H|NDRG1_ENST00000518176.1_Intron	NM_001135242.1	NP_001128714.1	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	123					cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|mast cell activation (GO:0045576)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of spindle checkpoint (GO:0090232)|response to metal ion (GO:0010038)	cell-cell adherens junction (GO:0005913)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	cadherin binding (GO:0045296)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|Rab GTPase binding (GO:0017137)	p.P123H(1)	NDRG1/ERG(5)	endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(4)|prostate(1)|skin(1)	17	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			AAGGACTCCAGGAAGCATTTC	0.522			T	ERG	prostate																																p.P123H			Dom	yes		8	8q24.3	10397	N-myc downstream regulated 1		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C368A	8						.						138.0	128.0	132.0					8																	134271432		2203	4300	6503	134340614	SO:0001583	missense	10397	exon6			X92845	CCDS34945.1, CCDS59112.1, CCDS59113.1	8q24	2014-09-17	2008-09-12		ENSG00000104419	ENSG00000104419			7679	protein-coding gene	gene with protein product		605262		CAP43		9251681, 8939898, 18455888	Standard	NM_006096		Approved	DRG1, RTP, TDD5, NDR1	uc003yue.2	Q92597	OTTHUMG00000164441	ENST00000414097.2:c.368C>A	8.37:g.134271432G>T	ENSP00000404854:p.Pro123His	Somatic		Capture	SOLID	Phase_I	134340614	NM_001135242	B3KR80|B7Z446|O15207|Q6IBG2|Q9NYR6|Q9UK29	Missense_Mutation	SNP	ENST00000414097.2	37	CCDS34945.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.931531	0.92389	.	.	ENSG00000104419	ENST00000323851;ENST00000414097;ENST00000537882;ENST00000522476;ENST00000520230;ENST00000518480;ENST00000519228;ENST00000519580;ENST00000522890;ENST00000520943;ENST00000521544	T;T;T;T;T;T;T;T;T;T;T	0.28454	1.61;1.61;2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.51398	0.1672	L	0.49126	1.545	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.49113	-0.8973	10	0.54805	T	0.06	-20.8078	17.5858	0.87981	0.0:0.0:1.0:0.0	.	123	Q92597	NDRG1_HUMAN	H	123;123;42;57;140;57;123;123;123;134;123	ENSP00000319977:P123H;ENSP00000404854:P123H;ENSP00000437443:P42H;ENSP00000427894:P57H;ENSP00000428345:P140H;ENSP00000428802:P57H;ENSP00000429994:P123H;ENSP00000429272:P123H;ENSP00000428384:P123H;ENSP00000429840:P134H;ENSP00000429524:P123H	ENSP00000319977:P123H	P	-	2	0	NDRG1	134340614	1.000000	0.71417	0.940000	0.37924	0.986000	0.74619	9.473000	0.97714	2.481000	0.83766	0.561000	0.74099	CCT		NDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378805.1		
AGPAT5	55326	hgsc.bcm.edu	37	8	6605333	6605333	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:6605333G>A	ENST00000285518.6	+	6	1041	c.729G>A	c.(727-729)gaG>gaA	p.E243E	AGPAT5_ENST00000530716.1_3'UTR|MIR4659B_ENST00000580269.1_RNA	NM_018361.3	NP_060831.2	Q9NUQ2	PLCE_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 5	243					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.E243E(1)	AGPAT5/MCPH1(2)	endometrium(2)|kidney(2)|large_intestine(4)|lung(3)	11			STAD - Stomach adenocarcinoma(24;0.0578)	READ - Rectum adenocarcinoma(644;0.156)|COAD - Colon adenocarcinoma(149;0.191)		AGCGAAGAGAGTCACCGACCA	0.418																																					p.E243E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G729A	8						.						104.0	98.0	100.0					8																	6605333		2203	4300	6503	6592741	SO:0001819	synonymous_variant	55326	exon6			AF375789	CCDS34796.1	8p23.1	2013-02-05	2013-02-05		ENSG00000155189	ENSG00000155189	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20886	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, epsilon"""	614796	"""1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)"""				Standard	NM_018361		Approved	FLJ11210, LPAAT-e, LPAAT-epsilon	uc003wqo.3	Q9NUQ2	OTTHUMG00000163656	ENST00000285518.6:c.729G>A	8.37:g.6605333G>A		Somatic		Capture	SOLID	Phase_I	6592741	NM_018361	Q8IZ47|Q9BQG4	Silent	SNP	ENST00000285518.6	37	CCDS34796.1																																																																																				AGPAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374684.1	NM_018361	
MICU3	286097	hgsc.bcm.edu	37	8	16921633	16921633	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:16921633A>G	ENST00000318063.5	+	2	464	c.422A>G	c.(421-423)tAt>tGt	p.Y141C		NM_181723.2	NP_859074.1	Q86XE3	MICU3_HUMAN	mitochondrial calcium uptake family, member 3	141						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.Y141C(1)									TTAGACCTTTATGCCACATCT	0.378																																					p.Y141C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A422G	8						.						198.0	177.0	184.0					8																	16921633		2203	4300	6503	16966004	SO:0001583	missense	286097	exon2			BC032868	CCDS5999.1	8p22	2013-03-26	2013-03-26	2013-03-14	ENSG00000155970	ENSG00000155970		"""EF-hand domain containing"""	27820	protein-coding gene	gene with protein product		610633	"""EF hand domain family A2"", ""EF-hand domain family, member A2"""	EFHA2		23409044	Standard	NM_181723		Approved	DKFZp313A0139	uc003wxd.2	Q86XE3	OTTHUMG00000096965	ENST00000318063.5:c.422A>G	8.37:g.16921633A>G	ENSP00000321455:p.Tyr141Cys	Somatic		Capture	SOLID	Phase_I	16966004	NM_181723	Q8IYZ3	Missense_Mutation	SNP	ENST00000318063.5	37	CCDS5999.1	.	.	.	.	.	.	.	.	.	.	A	5.168	0.216524	0.09810	.	.	ENSG00000155970	ENST00000318063	T	0.50001	0.76	5.23	-1.83	0.07833	.	0.566923	0.18443	N	0.141097	T	0.33177	0.0854	L	0.44542	1.39	0.36093	D	0.843625	B	0.02656	0.0	B	0.01281	0.0	T	0.09378	-1.0677	10	0.38643	T	0.18	-27.2969	7.7382	0.28827	0.5871:0.0:0.3163:0.0966	.	141	Q86XE3	EFHA2_HUMAN	C	141	ENSP00000321455:Y141C	ENSP00000321455:Y141C	Y	+	2	0	EFHA2	16966004	0.998000	0.40836	0.165000	0.22776	0.430000	0.31655	1.300000	0.33436	-0.408000	0.07565	-1.431000	0.01090	TAT		MICU3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214031.1	NM_181723	
NAT2	10	hgsc.bcm.edu	37	8	18257783	18257783	+	Silent	SNP	A	A	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:18257783A>T	ENST00000286479.3	+	2	377	c.270A>T	c.(268-270)ggA>ggT	p.G90G	NAT2_ENST00000520116.1_Intron	NM_000015.2	NP_000006.2	P11245	ARY2_HUMAN	N-acetyltransferase 2 (arylamine N-acetyltransferase)	90					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	arylamine N-acetyltransferase activity (GO:0004060)	p.G90G(1)		kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(2)	12				Colorectal(111;0.0531)|COAD - Colon adenocarcinoma(73;0.21)	Acetaminophen(DB00316)|Clonazepam(DB01068)|Dapsone(DB00250)|Ezogabine(DB04953)|Isoniazid(DB00951)|Sulfamethoxazole(DB01015)	CAATGTTAGGAGGGTATTTTT	0.473									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																												p.G90G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A270T	8						.						89.0	93.0	92.0					8																	18257783		2203	4300	6503	18302063	SO:0001819	synonymous_variant	10	exon2	Familial Cancer Database	incl.: Familial Head and Neck Cancer	D90042	CCDS6008.1	8p22	2012-01-18			ENSG00000156006	ENSG00000156006	2.3.1.5		7646	protein-coding gene	gene with protein product		612182		AAC2		7773298	Standard	NM_000015		Approved		uc003wyw.1	P11245	OTTHUMG00000130826	ENST00000286479.3:c.270A>T	8.37:g.18257783A>T		Somatic		Capture	SOLID	Phase_I	18302063	NM_000015	O43637|O60654|O60655|Q13146|Q16697|Q2MLE4|Q2MLF5|Q2MLG8|Q2MLJ6|Q2MLK4|Q2MLK6|Q2MLN7|Q6LET4|Q86XS0|Q86XS1|Q96KY8|Q96T64|Q96T65|Q9H220	Silent	SNP	ENST00000286479.3	37	CCDS6008.1																																																																																				NAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253380.1	NM_000015	
CSGALNACT1	55790	hgsc.bcm.edu	37	8	19276170	19276170	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:19276170C>T	ENST00000454498.2	-	8	2237	c.1224G>A	c.(1222-1224)caG>caA	p.Q408Q	CSGALNACT1_ENST00000518542.1_5'Flank|CSGALNACT1_ENST00000311540.4_Silent_p.Q408Q|CSGALNACT1_ENST00000544602.1_Silent_p.Q408Q|CSGALNACT1_ENST00000332246.6_Silent_p.Q408Q|CSGALNACT1_ENST00000522854.1_Silent_p.Q408Q	NM_001130518.1	NP_001123990.1	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 1	408					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|endochondral ossification (GO:0001958)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|heparin biosynthetic process (GO:0030210)|nervous system development (GO:0007399)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|UDP-glucuronate metabolic process (GO:0046398)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|intracellular (GO:0005622)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|glucuronosyltransferase activity (GO:0015020)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)|peptidoglycan glycosyltransferase activity (GO:0008955)	p.Q408Q(1)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				Colorectal(111;0.182)		TACTCACCAGCTGCTGTTCCA	0.468																																					p.Q408Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1224A	8						.						98.0	73.0	82.0					8																	19276170		2203	4300	6503	19320450	SO:0001819	synonymous_variant	55790	exon8			AK002126	CCDS6010.1	8p21.3	2013-02-19				ENSG00000147408		"""Beta 4-glycosyltransferases"""	24290	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase"""					17145758, 12446672	Standard	NM_018371		Approved	CSGalNAcT-1, FLJ11264, ChGn	uc011kyo.2	Q8TDX6		ENST00000454498.2:c.1224G>A	8.37:g.19276170C>T		Somatic		Capture	SOLID	Phase_I	19320450	NM_018371	B2RBE4|Q6P9G6|Q8IUF9|Q9NSQ7|Q9NUM9	Silent	SNP	ENST00000454498.2	37	CCDS6010.1																																																																																				CSGALNACT1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375204.1	NM_018371	
PPP3CC	5533	hgsc.bcm.edu	37	8	22380172	22380172	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:22380172C>T	ENST00000240139.5	+	8	1180	c.853C>T	c.(853-855)Cga>Tga	p.R285*	PPP3CC_ENST00000289963.8_Nonsense_Mutation_p.R285*|PPP3CC_ENST00000397775.3_Nonsense_Mutation_p.R285*|PPP3CC_ENST00000518852.1_Nonsense_Mutation_p.R285*	NM_005605.4	NP_005596.2	P48454	PP2BC_HUMAN	protein phosphatase 3, catalytic subunit, gamma isozyme	285					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)	p.R285*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(55;0.104)		BRCA - Breast invasive adenocarcinoma(99;0.00756)|Colorectal(74;0.0238)|COAD - Colon adenocarcinoma(73;0.0835)		TTTCAGGTATCGAATGTACAG	0.373																																					p.R285X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C853T	8						.						89.0	90.0	90.0					8																	22380172		2203	4300	6503	22436117	SO:0001587	stop_gained	5533	exon8				CCDS34859.1, CCDS59094.1, CCDS59093.1	8p21.3	2010-03-17	2010-03-05		ENSG00000120910	ENSG00000120910	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9316	protein-coding gene	gene with protein product	"""calcineurin A gamma"", ""protein phosphatase 2B, catalytic subunit, gamma isoform"""	114107	"""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform (calcineurin A gamma)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform"""			1339277	Standard	NM_005605		Approved	CALNA3, PP2Bgamma	uc011kzi.2	P48454	OTTHUMG00000163802	ENST00000240139.5:c.853C>T	8.37:g.22380172C>T	ENSP00000240139:p.Arg285*	Somatic		Capture	SOLID	Phase_I	22436117	NM_005605	B4DRT5|Q9BSS6|Q9H4M5	Nonsense_Mutation	SNP	ENST00000240139.5	37	CCDS34859.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.883779	0.91814	.	.	ENSG00000120910	ENST00000518852;ENST00000240139;ENST00000289963;ENST00000397775;ENST00000523620	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.4666	17.947	0.89042	0.0:1.0:0.0:0.0	.	.	.	.	X	285;285;285;285;111	.	ENSP00000240139:R285X	R	+	1	2	PPP3CC	22436117	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	3.925000	0.56484	2.527000	0.85204	0.467000	0.42956	CGA		PPP3CC-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375652.1	NM_005605	
DOCK5	80005	hgsc.bcm.edu	37	8	25198440	25198440	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:25198440G>A	ENST00000276440.7	+	23	2419	c.2375G>A	c.(2374-2376)cGc>cAc	p.R792H		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	792					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.R792H(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		AATTCAATTCGCCAGTTATTT	0.398																																					p.R792H	Pancreas(145;34 1887 3271 10937 30165)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2375A	8						.						93.0	89.0	90.0					8																	25198440		2203	4300	6503	25254357	SO:0001583	missense	80005	exon23				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.2375G>A	8.37:g.25198440G>A	ENSP00000276440:p.Arg792His	Somatic		Capture	SOLID	Phase_I	25254357	NM_024940	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	ENST00000276440.7	37	CCDS6047.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.334609	0.81801	.	.	ENSG00000147459	ENST00000276440	T	0.53206	0.63	4.99	4.99	0.66335	Armadillo-type fold (1);	0.055765	0.64402	D	0.000001	T	0.49695	0.1572	L	0.28115	0.83	0.80722	D	1	D;D;D	0.59767	0.986;0.962;0.986	P;P;P	0.56514	0.8;0.696;0.8	T	0.32375	-0.9909	10	0.18710	T	0.47	.	18.4893	0.90841	0.0:0.0:1.0:0.0	.	782;567;792	D3DSS6;Q68DL4;Q9H7D0	.;.;DOCK5_HUMAN	H	792	ENSP00000276440:R792H	ENSP00000276440:R792H	R	+	2	0	DOCK5	25254357	1.000000	0.71417	1.000000	0.80357	0.389000	0.30415	7.406000	0.80017	2.590000	0.87494	0.650000	0.86243	CGC		DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	
BNIP3L	665	hgsc.bcm.edu	37	8	26248888	26248888	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:26248888A>G	ENST00000380629.2	+	2	463	c.230A>G	c.(229-231)gAt>gGt	p.D77G	BNIP3L_ENST00000518611.1_Missense_Mutation_p.D37G|BNIP3L_ENST00000520409.1_Missense_Mutation_p.D37G|BNIP3L_ENST00000523515.1_Missense_Mutation_p.D37G	NM_004331.2	NP_004322.1	O60238	BNI3L_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 3-like	77					defense response to virus (GO:0051607)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrial protein catabolic process (GO:0035694)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.D77G(1)		large_intestine(3)|lung(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0019)|Epithelial(17;1.59e-12)|all cancers(2;3.75e-11)|OV - Ovarian serous cystadenocarcinoma(2;2.57e-08)|Colorectal(74;0.135)		ATTCTTTTGGATGCACAACAT	0.468																																					p.D77G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A230G	8						.						114.0	93.0	100.0					8																	26248888		2203	4300	6503	26304805	SO:0001583	missense	665	exon2			AB004788	CCDS6050.1	8p21	2014-05-13	2002-08-29		ENSG00000104765	ENSG00000104765			1085	protein-coding gene	gene with protein product		605368	"""BCL2/adenovirus E1B 19kD-interacting protein 3-like"""			9523198, 9973195	Standard	NM_004331		Approved	Nix, BNIP3a	uc003xex.1	O60238	OTTHUMG00000099433	ENST00000380629.2:c.230A>G	8.37:g.26248888A>G	ENSP00000370003:p.Asp77Gly	Somatic		Capture	SOLID	Phase_I	26304805	NM_004331	B0AZS9|Q5JW63|Q8NF87	Missense_Mutation	SNP	ENST00000380629.2	37	CCDS6050.1	.	.	.	.	.	.	.	.	.	.	A	32	5.151796	0.94645	.	.	ENSG00000104765	ENST00000380629;ENST00000221209;ENST00000523949;ENST00000523515;ENST00000520409;ENST00000518611	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.80470	0.4629	M	0.83953	2.67	0.80722	D	1	D	0.67145	0.996	D	0.65573	0.936	T	0.83216	-0.0071	9	0.87932	D	0	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	77	O60238	BNI3L_HUMAN	G	77;77;55;37;37;37	.	ENSP00000221209:D77G	D	+	2	0	BNIP3L	26304805	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.324000	0.96373	2.371000	0.80710	0.533000	0.62120	GAT		BNIP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216895.1	NM_004331	
FBXO16	157574	hgsc.bcm.edu	37	8	28309821	28309821	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:28309821G>A	ENST00000380254.2	-	6	828	c.680C>T	c.(679-681)aCa>aTa	p.T227I	FBXO16_ENST00000518734.1_Missense_Mutation_p.T215I|RP11-181B11.2_ENST00000518819.1_RNA|FBXO16_ENST00000517436.1_5'UTR|RP11-181B11.2_ENST00000523935.1_RNA|FBXO16_ENST00000346498.2_Missense_Mutation_p.T215I	NM_001258211.1|NM_172366.3	NP_001245140.1|NP_758954.1	Q8IX29	FBX16_HUMAN	F-box protein 16	227								p.T227I(1)		large_intestine(2)|ovary(1)	3		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.121)|Kidney(114;0.144)|Colorectal(74;0.249)		AATGATATCTGTTGGGTGCTT	0.448																																					p.T227I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C680T	8						.						106.0	104.0	105.0					8																	28309821		2203	4300	6503	28365740	SO:0001583	missense	157574	exon6			AF453435	CCDS6068.1, CCDS59099.1	8p21.1	2008-02-05	2004-06-15		ENSG00000214050	ENSG00000214050		"""F-boxes /  ""other"""""	13618	protein-coding gene	gene with protein product		608519	"""F-box only protein 16"""			12243353	Standard	NM_172366		Approved	FBX16	uc003xgu.4	Q8IX29	OTTHUMG00000102147	ENST00000380254.2:c.680C>T	8.37:g.28309821G>A	ENSP00000369604:p.Thr227Ile	Somatic		Capture	SOLID	Phase_I	28365740	NM_172366	Q3T1B2|Q3T1B3|Q3T1B4	Missense_Mutation	SNP	ENST00000380254.2	37	CCDS6068.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.64|11.64	1.700398|1.700398	0.30142|0.30142	.|.	.|.	ENSG00000214050|ENSG00000214050	ENST00000518248|ENST00000380254;ENST00000346498;ENST00000518734;ENST00000517673	.|T;T;T;T	.|0.49139	.|2.35;2.32;2.34;0.79	5.53|5.53	4.66|4.66	0.58398|0.58398	.|.	.|0.138860	.|0.45867	.|U	.|0.000339	.|T	.|0.42787	.|0.1218	L|L	0.49455|0.49455	1.56|1.56	0.37009|0.37009	D|D	0.895633|0.895633	.|B;B;B	.|0.26635	.|0.155;0.155;0.09	.|B;B;B	.|0.21151	.|0.033;0.033;0.033	.|T	.|0.50320	.|-0.8842	.|10	.|0.66056	.|D	.|0.02	-7.852|-7.852	13.2043|13.2043	0.59787|0.59787	0.0778:0.0:0.9222:0.0|0.0778:0.0:0.9222:0.0	.|.	.|215;215;227	.|Q3T1B3;Q3T1B2;Q8IX29	.|.;.;FBX16_HUMAN	X|I	72|227;215;215;172	.|ENSP00000369604:T227I;ENSP00000341416:T215I;ENSP00000429687:T215I;ENSP00000429390:T172I	.|ENSP00000341416:T215I	Q|T	-|-	1|2	0|0	FBXO16|FBXO16	28365740|28365740	1.000000|1.000000	0.71417|0.71417	0.019000|0.019000	0.16419|0.16419	0.761000|0.761000	0.43186|0.43186	4.193000|4.193000	0.58385|0.58385	1.329000|1.329000	0.45376|0.45376	0.543000|0.543000	0.68304|0.68304	CAG|ACA		FBXO16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219988.2	NM_172366	
FZD3	7976	hgsc.bcm.edu	37	8	28384972	28384972	+	Missense_Mutation	SNP	G	G	A	rs376112066		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:28384972G>A	ENST00000240093.3	+	5	1173	c.695G>A	c.(694-696)cGt>cAt	p.R232H	RNA5SP259_ENST00000365541.1_RNA|FZD3_ENST00000537916.1_Missense_Mutation_p.R232H	NM_017412.3	NP_059108.1	Q9NPG1	FZD3_HUMAN	frizzled class receptor 3	232					canonical Wnt signaling pathway (GO:0060070)|cell proliferation in midbrain (GO:0033278)|commissural neuron axon guidance (GO:0071679)|establishment of planar polarity (GO:0001736)|facial nucleus development (GO:0021754)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|post-anal tail morphogenesis (GO:0036342)|vasculature development (GO:0001944)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|neuron projection membrane (GO:0032589)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.R232H(1)		central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(15)|ovary(1)|prostate(1)|skin(1)	41		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		ACAAGATTCCGTTATCCTGAA	0.353																																					p.R232H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G695A	8						.	G	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	111.0	112.0	112.0		695,695	5.2	1.0	8		112	0,8600		0,0,4300	no	missense,missense	FZD3	NM_017412.3,NM_145866.1	29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	232/667,232/667	28384972	1,13005	2203	4300	6503	28440891	SO:0001583	missense	7976	exon4			AJ272427	CCDS6069.1	8p21	2014-06-27	2014-01-29		ENSG00000104290	ENSG00000104290		"""GPCR / Class F : Frizzled receptors"""	4041	protein-coding gene	gene with protein product		606143	"""frizzled (Drosophila) homolog 3"", ""frizzled homolog 3 (Drosophila)"", ""frizzled 3, seven transmembrane spanning receptor"", ""frizzled family receptor 3"""			10777673, 10873558	Standard	NM_145866		Approved		uc010lvb.3	Q9NPG1	OTTHUMG00000102145	ENST00000240093.3:c.695G>A	8.37:g.28384972G>A	ENSP00000240093:p.Arg232His	Somatic		Capture	SOLID	Phase_I	28440891	NM_145866	A8K615	Missense_Mutation	SNP	ENST00000240093.3	37	CCDS6069.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140452	0.77775	2.27E-4	0.0	ENSG00000104290	ENST00000537916;ENST00000240093	D;D	0.83914	-1.78;-1.78	5.24	5.24	0.73138	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.90957	0.7157	M	0.74546	2.27	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.91852	0.5492	10	0.72032	D	0.01	.	17.8224	0.88654	0.0:0.0:1.0:0.0	.	232	Q9NPG1	FZD3_HUMAN	H	232	ENSP00000437489:R232H;ENSP00000240093:R232H	ENSP00000240093:R232H	R	+	2	0	FZD3	28440891	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.033000	0.88852	2.438000	0.82558	0.655000	0.94253	CGT		FZD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219986.2	NM_145866	
NRG1	3084	hgsc.bcm.edu	37	8	32621363	32621363	+	Missense_Mutation	SNP	G	G	A	rs373628055		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:32621363G>A	ENST00000405005.3	+	12	1366	c.1366G>A	c.(1366-1368)Gtg>Atg	p.V456M	NRG1_ENST00000338921.4_Missense_Mutation_p.V464M|RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000287842.3_Missense_Mutation_p.V453M|NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000521670.1_3'UTR|NRG1_ENST00000356819.4_Missense_Mutation_p.V461M|NRG1_ENST00000519301.1_Missense_Mutation_p.V406M|NRG1_ENST00000287845.5_Missense_Mutation_p.V427M|NRG1_ENST00000539990.1_Missense_Mutation_p.V299M			Q02297	NRG1_HUMAN	neuregulin 1	456					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.V461M(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GTCTCCACCCGTGTCCAGCAT	0.577																																					p.V453M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1357A	8						.	G	MET/VAL,,MET/VAL,MET/VAL,,MET/VAL,MET/VAL,,MET/VAL	0,4406		0,0,2203	120.0	111.0	114.0		1267,,1318,1216,,1381,1357,,1366	4.8	0.6	8		114	1,8599	1.2+/-3.3	0,1,4299	no	missense,utr-3,missense,missense,utr-3,missense,missense,utr-3,missense	NRG1	NM_001159995.1,NM_001159996.1,NM_001159999.1,NM_001160001.1,NM_001160004.1,NM_013956.3,NM_013957.3,NM_013960.3,NM_013964.3	21,,21,21,,21,21,,21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,,benign,benign,,benign,benign,,benign	423/608,,440/625,406/591,,461/646,453/638,,456/641	32621363	1,13005	2203	4300	6503	32740905	SO:0001583	missense	3084	exon12			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1366G>A	8.37:g.32621363G>A	ENSP00000384620:p.Val456Met	Somatic		Capture	SOLID	Phase_I	32740905	NM_013957	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000405005.3	37	CCDS6085.1	.	.	.	.	.	.	.	.	.	.	G	5.382	0.255655	0.10185	0.0	1.16E-4	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000523534;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000287842;ENST00000405005;ENST00000539990	T;T;T;T;T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41	5.74	4.76	0.60689	Neuregulin 1-related, C-terminal (1);	0.568912	0.18253	N	0.146874	T	0.35364	0.0929	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B;B	0.28350	0.208;0.055;0.038;0.029;0.031;0.038;0.031	B;B;B;B;B;B;B	0.24155	0.051;0.012;0.027;0.01;0.012;0.031;0.016	T	0.26258	-1.0108	10	0.45353	T	0.12	-4.3067	13.2516	0.60055	0.1043:0.0:0.8957:0.0	.	299;427;461;464;453;456;461	B7Z1E3;F8W9E3;Q7RTW4;Q02297-2;Q02297-7;Q02297;Q02297-6	.;.;.;.;.;NRG1_HUMAN;.	M	423;406;529;464;461;456;427;453;456;299	ENSP00000430053:V423M;ENSP00000429582:V406M;ENSP00000429067:V529M;ENSP00000343395:V464M;ENSP00000349275:V461M;ENSP00000287840:V456M;ENSP00000287845:V427M;ENSP00000287842:V453M;ENSP00000384620:V456M;ENSP00000439276:V299M	ENSP00000287840:V456M	V	+	1	0	NRG1	32740905	0.006000	0.16342	0.641000	0.29422	0.829000	0.46940	1.738000	0.38207	2.705000	0.92388	0.557000	0.71058	GTG		NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		
C8orf4	56892	hgsc.bcm.edu	37	8	40011215	40011215	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:40011215C>T	ENST00000315792.3	+	1	227	c.164C>T	c.(163-165)tCt>tTt	p.S55F		NM_020130.4	NP_064515	Q9NR00	CH004_HUMAN	chromosome 8 open reading frame 4	55					apoptotic process (GO:0006915)			p.S55F(1)		breast(1)|large_intestine(1)|ovary(1)	3	Ovarian(28;0.0173)	all_cancers(7;5.34e-21)|all_epithelial(6;1.04e-14)|Lung NSC(58;9.35e-06)|all_lung(54;1.39e-05)|Hepatocellular(245;0.00745)|Breast(189;0.0334)|Colorectal(162;0.0815)|Myeloproliferative disorder(644;0.116)|Esophageal squamous(32;0.141)	LUSC - Lung squamous cell carcinoma(45;0.000149)	KIRC - Kidney renal clear cell carcinoma(67;0.0923)|Kidney(114;0.111)		TTCAGAAACTCTGGAGACAAG	0.473																																					p.S55F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C164T	8						.						109.0	108.0	108.0					8																	40011215		2203	4300	6503	40130372	SO:0001583	missense	56892	exon1			AF268037	CCDS6115.1	8p11.2	2014-07-11			ENSG00000176907	ENSG00000176907			1357	protein-coding gene	gene with protein product	"""human thyroid cancer 1"""	607702				11056052, 24937306	Standard	NM_020130		Approved	TC-1, hTC-1	uc003xnq.2	Q9NR00	OTTHUMG00000164045	ENST00000315792.3:c.164C>T	8.37:g.40011215C>T	ENSP00000319914:p.Ser55Phe	Somatic		Capture	SOLID	Phase_I	40130372	NM_020130		Missense_Mutation	SNP	ENST00000315792.3	37	CCDS6115.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918170	0.73098	.	.	ENSG00000176907	ENST00000315792	T	0.38887	1.11	6.08	6.08	0.98989	.	0.048506	0.85682	D	0.000000	T	0.62804	0.2458	L	0.58101	1.795	0.58432	D	0.999995	D	0.76494	0.999	D	0.67548	0.952	T	0.61836	-0.6981	10	0.87932	D	0	-22.7592	19.6529	0.95825	0.0:1.0:0.0:0.0	.	55	Q9NR00	CH004_HUMAN	F	55	ENSP00000319914:S55F	ENSP00000319914:S55F	S	+	2	0	C8orf4	40130372	1.000000	0.71417	0.994000	0.49952	0.965000	0.64279	7.056000	0.76662	2.890000	0.99128	0.655000	0.94253	TCT		C8orf4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376943.1	NM_020130	
HOOK3	84376	hgsc.bcm.edu	37	8	42863019	42863019	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:42863019T>C	ENST00000307602.4	+	18	1885	c.1685T>C	c.(1684-1686)cTa>cCa	p.L562P	HOOK3_ENST00000524839.1_3'UTR	NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	562	Required for association with Golgi.|Required for interaction with MSR1.				cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)	p.L562P(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			AATAATGAACTACAGAAGAAG	0.373			T	RET	papillary thyroid																																p.L562P			Dom	yes		8	8p11.21	84376	hook homolog 3		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1685C	8						.						136.0	128.0	131.0					8																	42863019		2203	4300	6503	42982176	SO:0001583	missense	84376	exon18			AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.1685T>C	8.37:g.42863019T>C	ENSP00000305699:p.Leu562Pro	Somatic		Capture	SOLID	Phase_I	42982176	NM_032410	D3DSY8|Q8NBH0|Q9BY13	Missense_Mutation	SNP	ENST00000307602.4	37	CCDS6139.1	.	.	.	.	.	.	.	.	.	.	T	17.14	3.313923	0.60414	.	.	ENSG00000168172	ENST00000307602;ENST00000533539	T;D	0.83591	2.08;-1.74	5.63	5.63	0.86233	.	0.128833	0.52532	D	0.000065	D	0.90410	0.6998	M	0.75615	2.305	0.58432	D	0.999998	D	0.67145	0.996	D	0.71870	0.975	D	0.91002	0.4843	10	0.56958	D	0.05	-6.7347	16.1381	0.81502	0.0:0.0:0.0:1.0	.	562	Q86VS8	HOOK3_HUMAN	P	562;40	ENSP00000305699:L562P;ENSP00000433953:L40P	ENSP00000305699:L562P	L	+	2	0	HOOK3	42982176	0.996000	0.38824	0.130000	0.21974	0.434000	0.31775	7.195000	0.77798	2.258000	0.74832	0.533000	0.62120	CTA		HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383172.2	NM_032410	
CYP7A1	1581	hgsc.bcm.edu	37	8	59409209	59409209	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:59409209C>A	ENST00000301645.3	-	3	999	c.862G>T	c.(862-864)Gca>Tca	p.A288S		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	288					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.A288S(1)		breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				ATGGTGTTTGCTTGCGATGCC	0.413									Neonatal Giant Cell Hepatitis																												p.A288S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G862T	8						.						120.0	116.0	117.0					8																	59409209		2203	4300	6503	59571763	SO:0001583	missense	1581	exon3	Familial Cancer Database	Neonatal Hemochromatosis	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.862G>T	8.37:g.59409209C>A	ENSP00000301645:p.Ala288Ser	Somatic		Capture	SOLID	Phase_I	59571763	NM_000780	P78454|Q3MIL8|Q7KZ19	Missense_Mutation	SNP	ENST00000301645.3	37	CCDS6171.1	.	.	.	.	.	.	.	.	.	.	C	32	5.186162	0.94885	.	.	ENSG00000167910	ENST00000301645	T	0.12039	2.72	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.34106	0.0886	M	0.65975	2.015	0.80722	D	1	D	0.55172	0.97	D	0.66847	0.947	T	0.03296	-1.1051	10	0.10377	T	0.69	-17.8889	20.0185	0.97487	0.0:1.0:0.0:0.0	.	288	P22680	CP7A1_HUMAN	S	288	ENSP00000301645:A288S	ENSP00000301645:A288S	A	-	1	0	CYP7A1	59571763	1.000000	0.71417	0.991000	0.47740	0.943000	0.58893	5.925000	0.70062	2.809000	0.96659	0.467000	0.42956	GCA		CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378190.1	NM_000780	
CYP7B1	9420	hgsc.bcm.edu	37	8	65527711	65527711	+	Missense_Mutation	SNP	C	C	T	rs201867790		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:65527711C>T	ENST00000310193.3	-	4	1102	c.929G>A	c.(928-930)cGg>cAg	p.R310Q	CYP7B1_ENST00000523954.1_5'UTR	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	310					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)	p.R310Q(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TTCTGGGTGCCGCAGAAGATA	0.473													C|||	1	0.000199681	0.0	0.0	5008	,	,		18550	0.0		0.001	False		,,,				2504	0.0				p.R310Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G929A	8						.	C	GLN/ARG	0,4406		0,0,2203	92.0	85.0	87.0		929	-1.7	1.0	8		87	3,8597	3.0+/-9.4	0,3,4297	yes	missense	CYP7B1	NM_004820.3	43	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	possibly-damaging	310/507	65527711	3,13003	2203	4300	6503	65690265	SO:0001583	missense	9420	exon4			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.929G>A	8.37:g.65527711C>T	ENSP00000310721:p.Arg310Gln	Somatic		Capture	SOLID	Phase_I	65690265	NM_004820	B2RN07|Q9UNF5	Missense_Mutation	SNP	ENST00000310193.3	37	CCDS6180.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	13.38	2.219232	0.39201	0.0	3.49E-4	ENSG00000172817	ENST00000310193	T	0.69685	-0.42	5.93	-1.71	0.08133	.	0.597985	0.19021	N	0.124813	T	0.52273	0.1724	L	0.37507	1.11	0.24162	N	0.995656	B	0.31519	0.327	B	0.31812	0.136	T	0.45425	-0.9262	10	0.39692	T	0.17	-29.0678	12.2283	0.54474	0.0:0.5489:0.0:0.4511	.	310	O75881	CP7B1_HUMAN	Q	310	ENSP00000310721:R310Q	ENSP00000310721:R310Q	R	-	2	0	CYP7B1	65690265	0.996000	0.38824	0.991000	0.47740	0.995000	0.86356	0.437000	0.21543	-0.221000	0.09973	-0.150000	0.13652	CGG		CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378550.1		
PREX2	80243	hgsc.bcm.edu	37	8	68972959	68972959	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:68972959T>C	ENST00000288368.4	+	11	1561	c.1284T>C	c.(1282-1284)ccT>ccC	p.P428P	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	428	DEP 1. {ECO:0000255|PROSITE- ProRule:PRU00066}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.P428P(4)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TTCACAGGCCTGAGGAAGGCG	0.378																																					p.P428P												.	.	4	Substitution - coding silent(4)	large_intestine(2)|lung(2)	c.T1284C	8						.						106.0	107.0	107.0					8																	68972959		2203	4300	6503	69135513	SO:0001819	synonymous_variant	80243	exon11			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1284T>C	8.37:g.68972959T>C		Somatic		Capture	SOLID	Phase_I	69135513	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	ENST00000288368.4	37	CCDS6201.1																																																																																				PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
SULF1	23213	hgsc.bcm.edu	37	8	70550807	70550807	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:70550807G>A	ENST00000260128.4	+	20	3072	c.2355G>A	c.(2353-2355)acG>acA	p.T785T	SULF1_ENST00000402687.4_Silent_p.T785T|SULF1_ENST00000419716.3_Silent_p.T785T|SULF1_ENST00000458141.2_Silent_p.T785T|SULF1_ENST00000521946.1_3'UTR	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	785					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.T785T(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			TTAATGAGACGCATAATTTTC	0.343																																					p.T785T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2355A	8						.						151.0	141.0	144.0					8																	70550807		2203	4300	6503	70713361	SO:0001819	synonymous_variant	23213	exon20			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.2355G>A	8.37:g.70550807G>A		Somatic		Capture	SOLID	Phase_I	70713361	NM_001128205	Q86YV8|Q8NCA2|Q9UPS5	Silent	SNP	ENST00000260128.4	37	CCDS6204.1																																																																																				SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170	
EYA1	2138	hgsc.bcm.edu	37	8	72184071	72184071	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:72184071A>G	ENST00000340726.3	-	10	1527	c.888T>C	c.(886-888)cgT>cgC	p.R296R	EYA1_ENST00000388741.2_Silent_p.R262R|EYA1_ENST00000388743.2_Silent_p.R295R|EYA1_ENST00000419131.1_Silent_p.R291R|EYA1_ENST00000303824.7_Silent_p.R290R|EYA1_ENST00000388740.3_Silent_p.R263R|EYA1_ENST00000388742.4_Silent_p.R296R	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	296					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)	p.R296R(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			CTGAACCTCGACGCAATCGAT	0.458																																					p.R263R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T789C	8						.						257.0	238.0	244.0					8																	72184071		2203	4300	6503	72346625	SO:0001819	synonymous_variant	2138	exon8			AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.888T>C	8.37:g.72184071A>G		Somatic		Capture	SOLID	Phase_I	72346625	NM_172060	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Silent	SNP	ENST00000340726.3	37	CCDS34906.1																																																																																				EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060	
CDH17	1015	hgsc.bcm.edu	37	8	95182655	95182655	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:95182655C>T	ENST00000027335.3	-	9	1160	c.1036G>A	c.(1036-1038)Gta>Ata	p.V346I	CDH17_ENST00000441892.2_Intron|CDH17_ENST00000450165.2_Missense_Mutation_p.V346I	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	346	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)	p.V346I(1)		NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			ACCTCAAATACGGTTACTGGT	0.423																																					p.V346I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1036A	8						.						159.0	146.0	151.0					8																	95182655		2203	4300	6503	95251831	SO:0001583	missense	1015	exon9			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1036G>A	8.37:g.95182655C>T	ENSP00000027335:p.Val346Ile	Somatic		Capture	SOLID	Phase_I	95251831	NM_001144663	Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	37	CCDS6260.1	.	.	.	.	.	.	.	.	.	.	C	8.723	0.914860	0.17907	.	.	ENSG00000079112	ENST00000027335;ENST00000450165	T;T	0.53423	0.62;0.62	5.95	5.07	0.68467	Cadherin (3);Cadherin-like (1);	0.266470	0.26684	N	0.023033	T	0.29458	0.0734	L	0.28192	0.835	0.31416	N	0.674884	B	0.30686	0.29	B	0.24974	0.057	T	0.21895	-1.0232	10	0.31617	T	0.26	-8.7383	6.933	0.24451	0.0:0.7777:0.0:0.2223	.	346	Q12864	CAD17_HUMAN	I	346	ENSP00000027335:V346I;ENSP00000401468:V346I	ENSP00000027335:V346I	V	-	1	0	CDH17	95251831	0.299000	0.24426	0.941000	0.38009	0.380000	0.30137	0.542000	0.23222	2.821000	0.97095	0.650000	0.86243	GTA		CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063	
RAD54B	25788	hgsc.bcm.edu	37	8	95392407	95392407	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:95392407T>C	ENST00000336148.5	-	12	2337	c.2213A>G	c.(2212-2214)tAt>tGt	p.Y738C		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	738	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)	p.Y738C(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			ATCAATGTCATAGAGAATTAA	0.348								Direct reversal of damage;Homologous recombination																													p.Y738C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2213G	8						.						52.0	51.0	52.0					8																	95392407		2203	4300	6503	95461583	SO:0001583	missense	25788	exon12			AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.2213A>G	8.37:g.95392407T>C	ENSP00000336606:p.Tyr738Cys	Somatic		Capture	SOLID	Phase_I	95461583	NM_012415	F6WBS8	Missense_Mutation	SNP	ENST00000336148.5	37	CCDS6262.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.264307	0.80358	.	.	ENSG00000197275	ENST00000336148;ENST00000546218	T	0.77358	-1.09	5.83	5.83	0.93111	Helicase, C-terminal (3);	0.060027	0.64402	D	0.000002	D	0.87939	0.6304	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.89325	0.3643	10	0.87932	D	0	-16.9562	14.7657	0.69637	0.0:0.0:0.0:1.0	.	738	Q9Y620	RA54B_HUMAN	C	738;410	ENSP00000336606:Y738C	ENSP00000336606:Y738C	Y	-	2	0	RAD54B	95461583	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	7.841000	0.86834	2.228000	0.72767	0.528000	0.53228	TAT		RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	NM_012415	
PARP10	84875	hgsc.bcm.edu	37	8	145058186	145058186	+	Silent	SNP	G	G	A	rs139367910		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr8:145058186G>A	ENST00000313028.7	-	7	1861	c.1767C>T	c.(1765-1767)gaC>gaT	p.D589D	PARP10_ENST00000524918.1_Intron|PARP10_ENST00000525773.1_Silent_p.D601D|PARP10_ENST00000533665.1_5'Flank	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	589	Glu-rich.				negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.D589D(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCAGGCTCACGTCCTCCTGGT	0.647																																					p.D589D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1767T	8						.			1,4405	2.1+/-5.4	0,1,2202	48.0	45.0	46.0		1767	0.1	0.0	8	dbSNP_134	46	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PARP10	NM_032789.3		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		589/1026	145058186	2,13004	2203	4300	6503	145130174	SO:0001819	synonymous_variant	84875	exon7			AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.1767C>T	8.37:g.145058186G>A		Somatic		Capture	SOLID	Phase_I	145130174	NM_032789	Q8N2I0|Q8WV05|Q96CH7|Q96K72	Silent	SNP	ENST00000313028.7	37	CCDS34960.1																																																																																				PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383866.1	NM_032789	
KDM5D	8284	hgsc.bcm.edu	37	Y	21878584	21878584	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrY:21878584C>T	ENST00000317961.4	-	14	2005	c.1734G>A	c.(1732-1734)caG>caA	p.Q578Q	KDM5D_ENST00000541639.1_Silent_p.Q609Q|KDM5D_ENST00000382806.2_Silent_p.Q521Q	NM_004653.4	NP_004644.2	Q9BY66	KDM5D_HUMAN	lysine (K)-specific demethylase 5D	578	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.Q578Q(2)		kidney(1)|large_intestine(9)|lung(6)|skin(1)	17					Vitamin C(DB00126)	CCCCTGCACACTGGTTTGTGC	0.443																																					p.Q578Q												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1734A	Y						.						48.0	51.0	51.0					Y																	21878584		589	1914	2503	20337972	SO:0001819	synonymous_variant	8284	exon14			U52191	CCDS14794.1, CCDS55554.1, CCDS55555.1	Yq11	2013-01-28	2009-04-06	2009-04-06	ENSG00000012817	ENSG00000012817		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11115	protein-coding gene	gene with protein product		426000	"""Jumonji, AT rich interactive domain 1D (RBP2-like)"", ""Smcy homolog, Y-linked (mouse)"", ""jumonji, AT rich interactive domain 1D"""	HYA, HY, SMCY, JARID1D		795123, 8841177	Standard	NM_001146705		Approved	KIAA0234	uc011naz.2	Q9BY66	OTTHUMG00000036508	ENST00000317961.4:c.1734G>A	Y.37:g.21878584C>T		Somatic		Capture	SOLID	Phase_I	20337972	NM_004653	A2RU19|A6H8V7|B7ZLX1|Q92509|Q92809|Q9HCU1	Silent	SNP	ENST00000317961.4	37	CCDS14794.1																																																																																				KDM5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088790.1	NM_004653	
EXTL2	2135	hgsc.bcm.edu	37	1	101343076	101343076	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:101343076C>T	ENST00000370114.3	-	3	1825	c.389G>A	c.(388-390)aGg>aAg	p.R130K	EXTL2_ENST00000535414.1_Missense_Mutation_p.R117K|EXTL2_ENST00000370113.3_Missense_Mutation_p.R130K	NM_001033025.2|NM_001261440.1	NP_001028197.1|NP_001248369.1	Q9UBQ6	EXTL2_HUMAN	exostosin-like glycosyltransferase 2	130	Substrate binding. {ECO:0000250|UniProtKB:Q9ES89}.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|N-acetylglucosamine metabolic process (GO:0006044)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	alpha-1,4-N-acetylgalactosaminyltransferase activity (GO:0035248)|glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)	p.R138K(1)|p.R130K(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|skin(1)|urinary_tract(1)	14		all_epithelial(167;2.48e-06)|all_lung(203;0.000414)|Lung NSC(277;0.000946)		Epithelial(280;0.0425)|all cancers(265;0.0628)|COAD - Colon adenocarcinoma(174;0.148)|Colorectal(144;0.167)|Lung(183;0.195)		ATTTCTCATCCTGTTTGCTGT	0.493																																					p.R130K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G389A	1						.						109.0	106.0	107.0					1																	101343076		2203	4299	6502	101115664	SO:0001583	missense	2135	exon3			U76189	CCDS775.1, CCDS72831.1	1p21	2013-03-01	2013-03-01		ENSG00000162694	ENSG00000162694	2.4.1.223	"""Exostosin glycosyltransferase family"""	3516	protein-coding gene	gene with protein product	"""alpha-1,4-N-acteylhexosaminyltransferase"""	602411	"""exostoses (multiple)-like 2"""			9450183, 15831490	Standard	NM_001439		Approved		uc001dtk.2	Q9UBQ6	OTTHUMG00000011814	ENST00000370114.3:c.389G>A	1.37:g.101343076C>T	ENSP00000359132:p.Arg130Lys	Somatic		Capture	SOLID	Phase_I	101115664	NM_001033025	B2R795|D3DT60	Missense_Mutation	SNP	ENST00000370114.3	37	CCDS775.1	.	.	.	.	.	.	.	.	.	.	C	12.34	1.909838	0.33721	.	.	ENSG00000162694	ENST00000370114;ENST00000370113;ENST00000535414;ENST00000450240;ENST00000416479	T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;0.8	5.61	-0.659	0.11424	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.612948	0.17632	N	0.167341	T	0.14013	0.0339	N	0.03084	-0.415	0.19300	N	0.999979	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.002	T	0.40403	-0.9565	10	0.02654	T	1	-11.9246	6.6915	0.23174	0.1111:0.4389:0.0:0.45	.	130;130	Q8N8F1;Q9UBQ6	.;EXTL2_HUMAN	K	130;130;117;138;117	ENSP00000359132:R130K;ENSP00000359131:R130K;ENSP00000444385:R117K;ENSP00000403363:R138K;ENSP00000392255:R117K	ENSP00000359131:R130K	R	-	2	0	EXTL2	101115664	0.000000	0.05858	0.884000	0.34674	0.993000	0.82548	-0.540000	0.06106	-0.074000	0.12820	0.655000	0.94253	AGG		EXTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032705.1	NM_001439	
CELSR2	1952	hgsc.bcm.edu	37	1	109808798	109808798	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:109808798G>A	ENST00000271332.3	+	15	6044	c.5983G>A	c.(5983-5985)Gct>Act	p.A1995T		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1995					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.A1995T(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CGGGCTGCCTGCTGCTGCTCC	0.612																																					p.A1995T	NSCLC(158;1285 2011 34800 34852 42084)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5983A	1						.						71.0	64.0	66.0					1																	109808798		2203	4300	6503	109610321	SO:0001583	missense	1952	exon15			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.5983G>A	1.37:g.109808798G>A	ENSP00000271332:p.Ala1995Thr	Somatic		Capture	SOLID	Phase_I	109610321	NM_001408	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	G	34	5.401429	0.96030	.	.	ENSG00000143126	ENST00000271332	T	0.71698	-0.59	4.6	4.6	0.57074	GPCR, family 2, extracellular hormone receptor domain (2);	.	.	.	.	T	0.78904	0.4357	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.79645	-0.1717	9	0.51188	T	0.08	.	17.6074	0.88042	0.0:0.0:1.0:0.0	.	1995	Q9HCU4	CELR2_HUMAN	T	1995	ENSP00000271332:A1995T	ENSP00000271332:A1995T	A	+	1	0	CELSR2	109610321	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.202000	0.95026	2.387000	0.81309	0.462000	0.41574	GCT		CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
SLC6A17	388662	hgsc.bcm.edu	37	1	110740063	110740063	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:110740063A>G	ENST00000331565.4	+	11	2142	c.1657A>G	c.(1657-1659)Atg>Gtg	p.M553V		NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	553					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)	p.M553V(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		TGGCAGGTTCATGCAGGAGCT	0.562											OREG0013652	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M553V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1657G	1						.						108.0	93.0	98.0					1																	110740063		2201	4299	6500	110541586	SO:0001583	missense	388662	exon11				CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.1657A>G	1.37:g.110740063A>G	ENSP00000330199:p.Met553Val	Somatic	1429	Capture	SOLID	Phase_I	110541586	NM_001010898	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	ENST00000331565.4	37	CCDS30799.1	.	.	.	.	.	.	.	.	.	.	A	13.90	2.376497	0.42105	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.73363	-0.74	5.03	5.03	0.67393	.	0.077474	0.85682	D	0.000000	T	0.49355	0.1552	L	0.39692	1.235	0.58432	D	0.99999	B	0.19583	0.037	B	0.21360	0.034	T	0.50996	-0.8761	10	0.12766	T	0.61	.	14.7445	0.69480	1.0:0.0:0.0:0.0	.	553	Q9H1V8	S6A17_HUMAN	V	553	ENSP00000330199:M553V	ENSP00000330199:M553V	M	+	1	0	SLC6A17	110541586	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.116000	0.77119	1.884000	0.54569	0.455000	0.32223	ATG		SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280	
MOV10	4343	hgsc.bcm.edu	37	1	113242340	113242340	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:113242340C>T	ENST00000413052.2	+	18	3007	c.2617C>T	c.(2617-2619)Cga>Tga	p.R873*	MOV10_ENST00000357443.2_Nonsense_Mutation_p.R873*|MOV10_ENST00000468624.1_3'UTR|MOV10_ENST00000369644.1_Nonsense_Mutation_p.R817*|MOV10_ENST00000369645.1_Nonsense_Mutation_p.R873*|RP11-426L16.10_ENST00000471038.2_5'Flank	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	873					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.R873*(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		AGGCCAAGAACGAAGCGTCAT	0.557																																					p.R873X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2617T	1						.						140.0	142.0	141.0					1																	113242340		2203	4300	6503	113043863	SO:0001587	stop_gained	4343	exon18			AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.2617C>T	1.37:g.113242340C>T	ENSP00000399797:p.Arg873*	Somatic		Capture	SOLID	Phase_I	113043863	NM_020963	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Nonsense_Mutation	SNP	ENST00000413052.2	37	CCDS853.1	.	.	.	.	.	.	.	.	.	.	C	49	15.189980	0.99825	.	.	ENSG00000155363	ENST00000413052;ENST00000369645;ENST00000369644;ENST00000357443;ENST00000369648	.	.	.	5.1	5.1	0.69264	.	0.049045	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.0692	18.109	0.89529	0.0:1.0:0.0:0.0	.	.	.	.	X	873;873;817;873;811	.	ENSP00000350028:R873X	R	+	1	2	MOV10	113043863	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	6.242000	0.72376	2.370000	0.80446	0.467000	0.42956	CGA		MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032906.1	NM_020963	
SYT6	148281	hgsc.bcm.edu	37	1	114682285	114682285	+	Missense_Mutation	SNP	C	C	T	rs138691067		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:114682285C>T	ENST00000610222.1	-	2	610	c.464G>A	c.(463-465)cGt>cAt	p.R155H	SYT6_ENST00000393296.1_Missense_Mutation_p.R155H|SYT6_ENST00000369547.1_Missense_Mutation_p.R70H|SYT6_ENST00000607941.1_Missense_Mutation_p.R70H|SYT6_ENST00000609117.1_Missense_Mutation_p.R70H			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	155					acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)	p.R70H(1)		central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCGGGTGTGACGCATGATGTG	0.622																																					p.R70H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G209A	1						.	C	HIS/ARG	0,4406		0,0,2203	101.0	80.0	87.0		209	5.5	1.0	1	dbSNP_134	87	1,8599	1.2+/-3.3	0,1,4299	no	missense	SYT6	NM_205848.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	70/426	114682285	1,13005	2203	4300	6503	114483808	SO:0001583	missense	148281	exon2				CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.464G>A	1.37:g.114682285C>T	ENSP00000476396:p.Arg155His	Somatic		Capture	SOLID	Phase_I	114483808	NM_205848	B1AMB8|B3KPK1	Missense_Mutation	SNP	ENST00000610222.1	37		.	.	.	.	.	.	.	.	.	.	C	16.36	3.101911	0.56183	0.0	1.16E-4	ENSG00000134207	ENST00000369547;ENST00000393296;ENST00000369546;ENST00000369545;ENST00000425037;ENST00000447981	T;T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;1.47;0.9	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.32615	0.0835	L	0.31207	0.915	0.80722	D	1	B	0.13594	0.008	B	0.14023	0.01	T	0.17349	-1.0372	10	0.17832	T	0.49	.	19.3929	0.94592	0.0:1.0:0.0:0.0	.	155	Q5T7P8	SYT6_HUMAN	H	70;155;70;155;70;70	ENSP00000358560:R70H;ENSP00000376974:R155H;ENSP00000358559:R70H;ENSP00000358558:R155H;ENSP00000412443:R70H;ENSP00000389266:R70H	ENSP00000358558:R155H	R	-	2	0	SYT6	114483808	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.071000	0.57556	2.583000	0.87209	0.655000	0.94253	CGT		SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000314819.2	NM_205848	
CLCN6	1185	hgsc.bcm.edu	37	1	11898486	11898486	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:11898486C>T	ENST00000346436.6	+	21	2442	c.2390C>T	c.(2389-2391)cCg>cTg	p.P797L	NPPA-AS1_ENST00000446542.1_RNA|CLCN6_ENST00000376496.3_Missense_Mutation_p.P797L|CLCN6_ENST00000312413.6_3'UTR|CLCN6_ENST00000376487.3_Missense_Mutation_p.P775L	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	797					cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)	p.P797L(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCTCAACCCGCGCATGATC	0.652											OREG0013104	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P797L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2390T	1						.						91.0	86.0	88.0					1																	11898486		2203	4300	6503	11821073	SO:0001583	missense	1185	exon21			X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.2390C>T	1.37:g.11898486C>T	ENSP00000234488:p.Pro797Leu	Somatic	675	Capture	SOLID	Phase_I	11821073	NM_001286	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Missense_Mutation	SNP	ENST00000346436.6	37	CCDS138.1	.	.	.	.	.	.	.	.	.	.	C	9.617	1.132828	0.21041	.	.	ENSG00000011021	ENST00000346436;ENST00000376487;ENST00000376496	D;D;D	0.86164	-2.08;-2.08;-2.08	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.79287	0.4420	N	0.24115	0.695	0.80722	D	1	B;B	0.32051	0.354;0.241	B;B	0.25506	0.061;0.027	T	0.75903	-0.3153	10	0.23891	T	0.37	-21.3455	18.7705	0.91890	0.0:1.0:0.0:0.0	.	775;797	F8W9R3;P51797	.;CLCN6_HUMAN	L	797;775;797	ENSP00000234488:P797L;ENSP00000365670:P775L;ENSP00000365679:P797L	ENSP00000234488:P797L	P	+	2	0	CLCN6	11821073	1.000000	0.71417	0.964000	0.40570	0.169000	0.22640	7.377000	0.79668	2.677000	0.91161	0.561000	0.74099	CCG		CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006639.2	NM_001286	
ATP1A1	476	hgsc.bcm.edu	37	1	116932065	116932065	+	Silent	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:116932065C>A	ENST00000295598.5	+	8	1011	c.759C>A	c.(757-759)acC>acA	p.T253T	ATP1A1_ENST00000369496.4_Silent_p.T222T|ATP1A1_ENST00000537345.1_Silent_p.T253T|ATP1A1_ENST00000491156.1_3'UTR	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	253					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.T253T(3)		NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	TTTAAGGCACCGCACGTGGTA	0.473																																					p.T253T												.	.	3	Substitution - coding silent(3)	large_intestine(2)|lung(1)	c.C759A	1						.						196.0	187.0	190.0					1																	116932065		2203	4300	6503	116733588	SO:0001819	synonymous_variant	476	exon8			D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.759C>A	1.37:g.116932065C>A		Somatic		Capture	SOLID	Phase_I	116733588	NM_000701	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Silent	SNP	ENST00000295598.5	37	CCDS887.1																																																																																				ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233	
MFN2	9927	hgsc.bcm.edu	37	1	12067119	12067119	+	Missense_Mutation	SNP	G	G	A	rs145413511		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:12067119G>A	ENST00000235329.5	+	17	2204	c.1882G>A	c.(1882-1884)Gca>Aca	p.A628T	MFN2_ENST00000444836.1_Missense_Mutation_p.A628T	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	628					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)	p.A628T(1)|p.A326T(1)		endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		GGTGTGGAAGGCAGTGGGCTG	0.632																																					p.A628T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1882A	1						.	G	THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	128.0	121.0	123.0		1882,1882	3.7	1.0	1	dbSNP_134	123	0,8600		0,0,4300	no	missense,missense	MFN2	NM_001127660.1,NM_014874.3	58,58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	628/758,628/758	12067119	1,13005	2203	4300	6503	11989706	SO:0001583	missense	9927	exon16			AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.1882G>A	1.37:g.12067119G>A	ENSP00000235329:p.Ala628Thr	Somatic		Capture	SOLID	Phase_I	11989706	NM_001127660	A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Missense_Mutation	SNP	ENST00000235329.5	37	CCDS30587.1	.	.	.	.	.	.	.	.	.	.	G	0.535	-0.856204	0.02630	2.27E-4	0.0	ENSG00000116688	ENST00000444836;ENST00000235329;ENST00000376337	D;D	0.95949	-3.86;-3.86	4.6	3.68	0.42216	Fzo/mitofusin HR2 domain (1);	0.000000	0.85682	D	0.000000	D	0.84960	0.5588	N	0.02296	-0.605	0.80722	D	1	B	0.31893	0.345	B	0.33392	0.163	T	0.82926	-0.0215	10	0.02654	T	1	-19.4384	13.8278	0.63361	0.0:0.1542:0.8458:0.0	.	628	O95140	MFN2_HUMAN	T	628;628;326	ENSP00000416338:A628T;ENSP00000235329:A628T	ENSP00000235329:A628T	A	+	1	0	MFN2	11989706	1.000000	0.71417	0.960000	0.40013	0.004000	0.04260	7.455000	0.80726	1.137000	0.42214	-0.175000	0.13238	GCA		MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006859.2	NM_014874	
WDR3	10885	hgsc.bcm.edu	37	1	118483502	118483502	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:118483502G>A	ENST00000349139.5	+	7	775	c.728G>A	c.(727-729)gGa>gAa	p.G243E	WDR3_ENST00000369441.3_3'UTR	NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	243						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G243E(1)		breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		TCTTCTCCTGGAATACAAGAT	0.378																																					p.G243E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G728A	1						.						122.0	130.0	127.0					1																	118483502		2203	4300	6503	118285025	SO:0001583	missense	10885	exon7			AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.728G>A	1.37:g.118483502G>A	ENSP00000308179:p.Gly243Glu	Somatic		Capture	SOLID	Phase_I	118285025	NM_006784		Missense_Mutation	SNP	ENST00000349139.5	37	CCDS898.1	.	.	.	.	.	.	.	.	.	.	G	7.871	0.728157	0.15507	.	.	ENSG00000065183	ENST00000349139	T	0.51071	0.72	5.05	-0.227	0.13102	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.947992	0.08955	N	0.869580	T	0.06600	0.0169	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38887	-0.9640	10	0.07325	T	0.83	-0.2687	6.1058	0.20073	0.2151:0.2506:0.5343:0.0	.	243	Q9UNX4	WDR3_HUMAN	E	243	ENSP00000308179:G243E	ENSP00000308179:G243E	G	+	2	0	WDR3	118285025	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.493000	0.22451	-0.195000	0.10382	-0.175000	0.13238	GGA		WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033720.2	NM_006784	
NOTCH2	4853	hgsc.bcm.edu	37	1	120508076	120508076	+	Splice_Site	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:120508076C>A	ENST00000256646.2	-	10	1900	c.1681G>T	c.(1681-1683)Ggt>Tgt	p.G561C		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	561	EGF-like 14; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.G561C(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGAATCTTACCTGTGGCACAC	0.483			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.G561C			Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1681T	1						.						255.0	236.0	242.0					1																	120508076		2203	4300	6503	120309599	SO:0001630	splice_region_variant	4853	exon10	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.1681+1G>T	1.37:g.120508076C>A		Somatic		Capture	SOLID	Phase_I	120309599	NM_024408	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611298	0.66558	.	.	ENSG00000134250	ENST00000256646;ENST00000539617	D	0.98221	-4.8	4.91	3.99	0.46301	EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.38005	U	0.001849	D	0.99441	0.9802	H	0.99600	4.65	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.994	D	0.98027	1.0374	9	.	.	.	.	14.4046	0.67073	0.0:0.8515:0.1485:0.0	.	522;561;561	D2WEZ3;Q6IQ50;Q04721	.;.;NOTC2_HUMAN	C	561;522	ENSP00000256646:G561C	.	G	-	1	0	NOTCH2	120309599	1.000000	0.71417	1.000000	0.80357	0.558000	0.35554	7.257000	0.78362	1.287000	0.44583	-0.312000	0.09012	GGT		NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	Missense_Mutation
PIAS3	10401	hgsc.bcm.edu	37	1	145581473	145581473	+	Missense_Mutation	SNP	G	G	A	rs587730152		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:145581473G>A	ENST00000393045.2	+	9	1144	c.1054G>A	c.(1054-1056)Gcc>Acc	p.A352T	PIAS3_ENST00000369298.1_Missense_Mutation_p.A317T	NM_006099.3	NP_006090.2	Q9Y6X2	PIAS3_HUMAN	protein inhibitor of activated STAT, 3	352					positive regulation of gene expression (GO:0010628)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)|synapse (GO:0045202)	enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|SUMO ligase activity (GO:0019789)|zinc ion binding (GO:0008270)	p.A343T(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)	28	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CTTCGATGCTGCCCTTTATCT	0.522																																					p.A352T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1054A	1						.						154.0	142.0	146.0					1																	145581473		2203	4300	6503	144292830	SO:0001583	missense	10401	exon9			AB021868	CCDS72866.1	1q21	2011-10-11			ENSG00000131788	ENSG00000131788		"""Zinc fingers, MIZ-type"""	16861	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 5"""	605987				10319586	Standard	NM_006099		Approved	FLJ14651, ZMIZ5	uc001eoc.1	Q9Y6X2	OTTHUMG00000013750	ENST00000393045.2:c.1054G>A	1.37:g.145581473G>A	ENSP00000376765:p.Ala352Thr	Somatic		Capture	SOLID	Phase_I	144292830	NM_006099	Q9UFI3	Missense_Mutation	SNP	ENST00000393045.2	37	CCDS920.2	.	.	.	.	.	.	.	.	.	.	g	16.10	3.027709	0.54790	.	.	ENSG00000131788	ENST00000393045;ENST00000369298	T;T	0.29397	1.57;1.58	5.86	4.95	0.65309	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, MIZ-type (2);	0.000000	0.64402	D	0.000013	T	0.07279	0.0184	N	0.04320	-0.23	0.80722	D	1	B	0.28291	0.206	B	0.33568	0.166	T	0.21177	-1.0253	10	0.16896	T	0.51	-18.9497	12.0133	0.53299	0.0827:0.0:0.9173:0.0	.	352	Q9Y6X2	PIAS3_HUMAN	T	352;317	ENSP00000376765:A352T;ENSP00000358304:A317T	ENSP00000358304:A317T	A	+	1	0	PIAS3	144292830	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.674000	0.54598	2.769000	0.95229	0.651000	0.88453	GCC		PIAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038533.4	NM_006099	
SETDB1	9869	hgsc.bcm.edu	37	1	150921737	150921737	+	Silent	SNP	C	C	A	rs113296072	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:150921737C>A	ENST00000271640.5	+	11	1597	c.1407C>A	c.(1405-1407)ccC>ccA	p.P469P	SETDB1_ENST00000459773.1_Intron|SETDB1_ENST00000368969.4_Silent_p.P469P	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	469					bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.P469P(2)		NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTCTATCCCCCCAAGCAGGTG	0.483																																					p.P469P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1407A	1						.						83.0	78.0	80.0					1																	150921737		2203	4300	6503	149188361	SO:0001819	synonymous_variant	9869	exon11			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.1407C>A	1.37:g.150921737C>A		Somatic		Capture	SOLID	Phase_I	149188361	NM_001145415	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Silent	SNP	ENST00000271640.5	37	CCDS44217.1																																																																																				SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2		
CGN	57530	hgsc.bcm.edu	37	1	151508092	151508092	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:151508092C>T	ENST00000271636.7	+	17	3144	c.3011C>T	c.(3010-3012)aCa>aTa	p.T1004I		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	998					transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)	p.T1004I(1)		NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CAGCTGAGGACAGAGCTCATG	0.557																																					p.T1004I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3011T	1						.						77.0	70.0	72.0					1																	151508092		2203	4300	6503	149774716	SO:0001583	missense	57530	exon17			AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.3011C>T	1.37:g.151508092C>T	ENSP00000271636:p.Thr1004Ile	Somatic		Capture	SOLID	Phase_I	149774716	NM_020770	A6H8L3|A7MD22|Q5T386|Q9NR25	Missense_Mutation	SNP	ENST00000271636.7	37	CCDS999.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.607322	0.46527	.	.	ENSG00000143375	ENST00000271636	T	0.78595	-1.19	5.3	4.35	0.52113	Myosin tail (1);	0.344540	0.33253	N	0.005113	T	0.66458	0.2791	M	0.62088	1.915	0.32131	N	0.586743	P	0.37594	0.601	B	0.36719	0.231	T	0.72137	-0.4381	10	0.56958	D	0.05	-2.0699	14.9311	0.70916	0.0:0.8572:0.1428:0.0	.	998	Q9P2M7	CING_HUMAN	I	1004	ENSP00000271636:T1004I	ENSP00000271636:T1004I	T	+	2	0	CGN	149774716	0.992000	0.36948	0.994000	0.49952	0.538000	0.34931	5.380000	0.66202	2.756000	0.94617	0.563000	0.77884	ACA		CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034900.3	NM_020770	
TUFT1	7286	hgsc.bcm.edu	37	1	151536436	151536436	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:151536436G>A	ENST00000368849.3	+	4	356	c.294G>A	c.(292-294)caG>caA	p.Q98Q	TUFT1_ENST00000353024.3_Silent_p.Q39Q|TUFT1_ENST00000392712.3_Silent_p.Q73Q|TUFT1_ENST00000368848.2_Silent_p.Q73Q|RP11-74C1.4_ENST00000434112.1_RNA|TUFT1_ENST00000538902.1_Silent_p.Q117Q	NM_020127.2	NP_064512.1	Q9NNX1	TUFT1_HUMAN	tuftelin 1	98					bone mineralization (GO:0030282)|odontogenesis (GO:0042476)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	structural constituent of tooth enamel (GO:0030345)	p.Q98Q(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			ATATTAACCAGCTGAAGAGTG	0.423																																					p.Q98Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G294A	1						.						136.0	121.0	126.0					1																	151536436		2203	4300	6503	149803060	SO:0001819	synonymous_variant	7286	exon4			AF254260	CCDS1000.1, CCDS44223.1	1q21	2008-02-05			ENSG00000143367	ENSG00000143367			12422	protein-coding gene	gene with protein product		600087				7919663	Standard	NM_020127		Approved		uc001eyl.3	Q9NNX1	OTTHUMG00000012536	ENST00000368849.3:c.294G>A	1.37:g.151536436G>A		Somatic		Capture	SOLID	Phase_I	149803060	NM_020127	B2RD57|D3DV21|D3DV22|Q5T384|Q5T385|Q9BU28|Q9H5L1	Silent	SNP	ENST00000368849.3	37	CCDS1000.1																																																																																				TUFT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035022.1	NM_020127	
KAZN	23254	hgsc.bcm.edu	37	1	15390116	15390116	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:15390116C>T	ENST00000376030.2	+	7	1390	c.1096C>T	c.(1096-1098)Cag>Tag	p.Q366*	KAZN_ENST00000422387.2_Nonsense_Mutation_p.Q366*|KAZN_ENST00000361144.5_Nonsense_Mutation_p.Q360*|KAZN_ENST00000503743.1_Nonsense_Mutation_p.Q366*|KAZN_ENST00000400798.2_Nonsense_Mutation_p.Q272*|KAZN_ENST00000400797.3_Nonsense_Mutation_p.Q272*	NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	366					keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)		p.Q360*(1)|p.Q366*(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						CCCTATTGTACAGGTAGGTGT	0.577																																					p.Q366X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1096T	1						.						119.0	94.0	103.0					1																	15390116		2203	4300	6503	15262703	SO:0001587	stop_gained	23254	exon7			AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.1096C>T	1.37:g.15390116C>T	ENSP00000365198:p.Gln366*	Somatic		Capture	SOLID	Phase_I	15262703	NM_201628	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Nonsense_Mutation	SNP	ENST00000376030.2	37	CCDS152.2	.	.	.	.	.	.	.	.	.	.	C	38	6.685104	0.97759	.	.	ENSG00000189337	ENST00000376030;ENST00000503743;ENST00000422387;ENST00000361144;ENST00000400798;ENST00000400797	.	.	.	4.57	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-23.5473	14.525	0.67881	0.0:1.0:0.0:0.0	.	.	.	.	X	366;366;366;360;272;272	.	ENSP00000354727:Q360X	Q	+	1	0	KAZN	15262703	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	4.576000	0.60915	2.103000	0.63969	0.491000	0.48974	CAG		KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005690.2	NM_001017999	
CRNN	49860	hgsc.bcm.edu	37	1	152382242	152382242	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:152382242C>A	ENST00000271835.3	-	3	1378	c.1316G>T	c.(1315-1317)gGt>gTt	p.G439V	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	439					response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.G439V(1)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCATTCCTCACCAACCACTGT	0.582																																					p.G439V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1316T	1						.						166.0	126.0	139.0					1																	152382242		2203	4300	6503	150648866	SO:0001583	missense	49860	exon3			AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.1316G>T	1.37:g.152382242C>A	ENSP00000271835:p.Gly439Val	Somatic		Capture	SOLID	Phase_I	150648866	NM_016190	B2RE60|Q8N613	Missense_Mutation	SNP	ENST00000271835.3	37	CCDS1010.1	.	.	.	.	.	.	.	.	.	.	C	7.940	0.742551	0.15642	.	.	ENSG00000143536	ENST00000271835	T	0.05199	3.48	4.77	-2.76	0.05896	.	2.770790	0.00918	N	0.002541	T	0.01189	0.0039	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44997	-0.9291	10	0.34782	T	0.22	.	0.5296	0.00626	0.276:0.1986:0.31:0.2154	.	439	Q9UBG3	CRNN_HUMAN	V	439	ENSP00000271835:G439V	ENSP00000271835:G439V	G	-	2	0	CRNN	150648866	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.916000	0.04029	-0.789000	0.04498	-0.158000	0.13435	GGT		CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	NM_016190	
FAM189B	10712	hgsc.bcm.edu	37	1	155223416	155223416	+	Splice_Site	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:155223416C>A	ENST00000361361.2	-	5	1130	c.621G>T	c.(619-621)acG>acT	p.T207T	FAM189B_ENST00000368368.3_Splice_Site_p.T188T|FAM189B_ENST00000350210.2_Splice_Site_p.T111T|SCAMP3_ENST00000472397.1_5'Flank|FAM189B_ENST00000472550.1_5'UTR	NM_006589.2	NP_006580.2	P81408	F189B_HUMAN	family with sequence similarity 189, member B	207						integral component of membrane (GO:0016021)	WW domain binding (GO:0050699)	p.T207T(1)		breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23						CCCTTCTCACCGTATGCACGA	0.552																																					p.T111T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G333T	1						.						68.0	58.0	61.0					1																	155223416		2203	4300	6503	153490040	SO:0001630	splice_region_variant	10712	exon2			AF070550	CCDS1103.1, CCDS1104.1, CCDS58035.1	1q21	2009-07-09	2009-07-09	2009-07-09	ENSG00000160767	ENSG00000160767			1233	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 2"""	C1orf2		9331372	Standard	NM_006589		Approved	cote1	uc001fjm.3	P81408	OTTHUMG00000035844	ENST00000361361.2:c.621+1G>T	1.37:g.155223416C>A		Somatic		Capture	SOLID	Phase_I	153490040	NM_198264	B1AVS5|Q8IXL3|Q9BR66	Silent	SNP	ENST00000361361.2	37	CCDS1103.1																																																																																				FAM189B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087224.1	NM_006589	Silent
RUSC1	23623	hgsc.bcm.edu	37	1	155297959	155297959	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:155297959G>A	ENST00000368352.5	+	9	2584	c.2433G>A	c.(2431-2433)ctG>ctA	p.L811L	RUSC1_ENST00000368354.3_Silent_p.L705L|RUSC1_ENST00000462780.1_3'UTR|RUSC1_ENST00000292254.4_Silent_p.L342L|RUSC1_ENST00000368349.4_Silent_p.L342L|RUSC1_ENST00000368347.4_Silent_p.L401L	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1	811					positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)	p.L705L(1)|p.L342L(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			CTAGCTGGCTGCCCCCGACAG	0.582																																					p.L342L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1026A	1						.						158.0	163.0	161.0					1																	155297959		2203	4300	6503	153564583	SO:0001819	synonymous_variant	23623	exon8			AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.2433G>A	1.37:g.155297959G>A		Somatic		Capture	SOLID	Phase_I	153564583	NM_014328	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Silent	SNP	ENST00000368352.5	37	CCDS41410.1																																																																																				RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039071.1		
DAP3	7818	hgsc.bcm.edu	37	1	155701737	155701737	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:155701737T>C	ENST00000368336.5	+	11	1030	c.906T>C	c.(904-906)caT>caC	p.H302H	MSTO1_ENST00000452804.2_Intron|DAP3_ENST00000421487.2_Silent_p.H268H|DAP3_ENST00000471642.2_Silent_p.H261H|MSTO1_ENST00000538143.1_Intron|DAP3_ENST00000535183.1_Silent_p.H261H|DAP3_ENST00000343043.3_Silent_p.H302H	NM_001199849.1|NM_004632.3	NP_001186778.1|NP_004623.1	P51398	RT29_HUMAN	death associated protein 3	302					apoptotic mitochondrial changes (GO:0008637)|apoptotic signaling pathway (GO:0097190)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)	p.H302H(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	24	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					TCTTTCAGCATGGAGGCGCCA	0.443																																					p.H302H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T906C	1						.						32.0	32.0	32.0					1																	155701737		2203	4300	6503	153968361	SO:0001819	synonymous_variant	7818	exon12			X83544	CCDS1120.1, CCDS55646.1, CCDS55647.1	1q22	2012-11-14			ENSG00000132676	ENSG00000132676		"""Mitochondrial ribosomal proteins / small subunits"""	2673	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S29"""	602074				7499268, 9284927	Standard	NM_004632		Approved	MRPS29, DAP-3, MRP-S29, bMRP-10, MGC126058, MGC126059, DKFZp686G12159	uc001flr.3	P51398	OTTHUMG00000035439	ENST00000368336.5:c.906T>C	1.37:g.155701737T>C		Somatic		Capture	SOLID	Phase_I	153968361	NM_001199849	B4DP59|B4DY62|E7EM60|Q13044|Q68CT7|Q96Q20	Silent	SNP	ENST00000368336.5	37	CCDS1120.1																																																																																				DAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086042.1	NM_004632	
SMG5	23381	hgsc.bcm.edu	37	1	156244474	156244474	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:156244474C>T	ENST00000361813.5	-	5	602	c.458G>A	c.(457-459)tGc>tAc	p.C153Y	SMG5_ENST00000368267.5_Missense_Mutation_p.C153Y	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	153					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)	p.C153Y(1)		NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					TGGCTTCTTGCATCCTATGAG	0.483																																					p.C153Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G458A	1						.						140.0	121.0	128.0					1																	156244474		2203	4300	6503	154511098	SO:0001583	missense	23381	exon5			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.458G>A	1.37:g.156244474C>T	ENSP00000355261:p.Cys153Tyr	Somatic		Capture	SOLID	Phase_I	154511098	NM_015327	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	ENST00000361813.5	37	CCDS1137.1	.	.	.	.	.	.	.	.	.	.	C	9.323	1.058485	0.19987	.	.	ENSG00000198952	ENST00000361813;ENST00000368267	T;T	0.16457	2.34;2.34	5.6	3.6	0.41247	Telomerase activating protein Est1 (1);	0.128116	0.56097	D	0.000040	T	0.03915	0.0110	L	0.40543	1.245	0.30342	N	0.785572	B	0.02656	0.0	B	0.10450	0.005	T	0.38908	-0.9639	10	0.02654	T	1	-19.9356	12.5249	0.56081	0.4185:0.5815:0.0:0.0	.	153	Q9UPR3	SMG5_HUMAN	Y	153	ENSP00000355261:C153Y;ENSP00000357250:C153Y	ENSP00000355261:C153Y	C	-	2	0	SMG5	154511098	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	2.859000	0.48364	1.337000	0.45525	0.591000	0.81541	TGC		SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327	
OR6N1	128372	hgsc.bcm.edu	37	1	158736209	158736209	+	Missense_Mutation	SNP	C	C	A	rs200212713		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:158736209C>A	ENST00000335094.2	-	1	283	c.264G>T	c.(262-264)gaG>gaT	p.E88D		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E88D(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					TGGTCTTTTTCTCACTGAGCA	0.478																																					p.E88D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G264T	1						.						79.0	75.0	76.0					1																	158736209		2203	4300	6503	157002833	SO:0001583	missense	128372	exon1			BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.264G>T	1.37:g.158736209C>A	ENSP00000335535:p.Glu88Asp	Somatic		Capture	SOLID	Phase_I	157002833	NM_001005185	Q5VUU8|Q96R35	Missense_Mutation	SNP	ENST00000335094.2	37	CCDS30905.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.688905	0.29962	.	.	ENSG00000197403	ENST00000335094	T	0.09817	2.94	5.1	1.97	0.26223	GPCR, rhodopsin-like superfamily (1);	0.142167	0.32134	N	0.006521	T	0.02533	0.0077	L	0.33093	0.98	0.30291	N	0.790338	B	0.02656	0.0	B	0.06405	0.002	T	0.41233	-0.9520	10	0.35671	T	0.21	-19.767	7.9719	0.30132	0.0:0.6427:0.0:0.3573	.	88	Q8NGY5	OR6N1_HUMAN	D	88	ENSP00000335535:E88D	ENSP00000335535:E88D	E	-	3	2	OR6N1	157002833	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	-2.081000	0.01367	0.699000	0.31761	0.655000	0.94253	GAG		OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059067.1	NM_001005185	
CADM3	57863	hgsc.bcm.edu	37	1	159166725	159166725	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:159166725T>C	ENST00000368125.4	+	7	984	c.827T>C	c.(826-828)cTg>cCg	p.L276P	CADM3_ENST00000368124.4_Missense_Mutation_p.L310P|CADM3_ENST00000497636.1_3'UTR|CTA-134P22.2_ENST00000415675.2_RNA	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	276	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.L310P(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					GTGCCACCCCTGAAGATGACC	0.567																																					p.L310P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T929C	1						.						107.0	94.0	98.0					1																	159166725		2203	4300	6503	157433349	SO:0001583	missense	57863	exon8			AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.827T>C	1.37:g.159166725T>C	ENSP00000357107:p.Leu276Pro	Somatic		Capture	SOLID	Phase_I	157433349	NM_021189	Q8IZQ9|Q9NVJ5|Q9UJP1	Missense_Mutation	SNP	ENST00000368125.4	37	CCDS44251.1	.	.	.	.	.	.	.	.	.	.	T	14.78	2.638277	0.47153	.	.	ENSG00000162706	ENST00000368124;ENST00000368125;ENST00000416746	T;T;T	0.15139	2.45;2.45;3.51	5.07	5.07	0.68467	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.187655	0.34906	N	0.003593	T	0.25306	0.0615	L	0.61218	1.895	0.38486	D	0.94784	P;B;D	0.89917	0.919;0.104;1.0	P;B;D	0.74674	0.628;0.131;0.984	T	0.02081	-1.1217	10	0.30078	T	0.28	.	12.8225	0.57700	0.0:0.0:0.0:1.0	.	230;276;310	Q8N126-3;Q8N126;Q8N126-2	.;CADM3_HUMAN;.	P	310;276;230	ENSP00000357106:L310P;ENSP00000357107:L276P;ENSP00000387802:L230P	ENSP00000357106:L310P	L	+	2	0	CADM3	157433349	0.608000	0.26966	0.943000	0.38184	0.994000	0.84299	2.221000	0.42917	2.124000	0.65301	0.482000	0.46254	CTG		CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090330.1	NM_021189	
CFAP45	25790	hgsc.bcm.edu	37	1	159860283	159860283	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:159860283C>A	ENST00000368099.4	-	3	323	c.259G>T	c.(259-261)Gtc>Ttc	p.V87F	CCDC19_ENST00000476696.1_5'UTR|CCDC19_ENST00000426543.2_Missense_Mutation_p.V2F	NM_012337.2	NP_036469.2												p.V87F(1)		endometrium(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	26	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			AGTTCTCGGACCATGTCCCGG	0.517																																					p.V87F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G259T	1						.						176.0	155.0	162.0					1																	159860283		2203	4300	6503	158126907	SO:0001583	missense	25790	exon3																														ENST00000368099.4:c.259G>T	1.37:g.159860283C>A	ENSP00000357079:p.Val87Phe	Somatic		Capture	SOLID	Phase_I	158126907	NM_012337		Missense_Mutation	SNP	ENST00000368099.4	37	CCDS30914.1	.	.	.	.	.	.	.	.	.	.	C	17.82	3.482481	0.63962	.	.	ENSG00000213085	ENST00000368099;ENST00000426543	T;T	0.54071	0.75;0.59	5.6	2.7	0.31948	.	0.217157	0.38272	N	0.001755	T	0.27454	0.0674	L	0.51422	1.61	0.32535	N	0.534498	P;P	0.46706	0.883;0.883	B;B	0.41860	0.368;0.368	T	0.08006	-1.0743	9	.	.	.	-15.8015	6.9414	0.24494	0.0:0.6732:0.0:0.3268	.	87;87	A8K884;Q9UL16	.;CCD19_HUMAN	F	87;2	ENSP00000357079:V87F;ENSP00000403044:V2F	.	V	-	1	0	CCDC19	158126907	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	0.687000	0.25407	1.371000	0.46172	0.563000	0.77884	GTC		CCDC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085979.1		
IGSF8	93185	hgsc.bcm.edu	37	1	160062894	160062894	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:160062894G>A	ENST00000368086.1	-	4	1348	c.1132C>T	c.(1132-1134)Cac>Tac	p.H378Y	IGSF8_ENST00000314485.7_Missense_Mutation_p.H378Y|IGSF8_ENST00000460351.1_5'Flank			Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	378	Ig-like C2-type 3.				cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|nervous system development (GO:0007399)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.H378Y(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(19)|pancreas(1)|prostate(1)|skin(1)	33	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			ATGGCAATGTGTCGGCCCTCA	0.667																																					p.H378Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1132T	1						.						64.0	59.0	61.0					1																	160062894		2203	4300	6503	158329518	SO:0001583	missense	93185	exon4			AF407274	CCDS1195.1	1q23.1	2013-01-11			ENSG00000162729	ENSG00000162729		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17813	protein-coding gene	gene with protein product		606644				11504738, 11673522	Standard	NM_001206665		Approved	CD81P3, EWI2, PGRL, CD316	uc009wtf.3	Q969P0	OTTHUMG00000024075	ENST00000368086.1:c.1132C>T	1.37:g.160062894G>A	ENSP00000357065:p.His378Tyr	Somatic		Capture	SOLID	Phase_I	158329518	NM_052868	Q8NG09|Q96DP4|Q9BTG9	Missense_Mutation	SNP	ENST00000368086.1	37	CCDS1195.1	.	.	.	.	.	.	.	.	.	.	G	16.46	3.129861	0.56721	.	.	ENSG00000162729	ENST00000314485;ENST00000368086;ENST00000358475	T;T	0.25250	1.81;1.81	3.9	3.9	0.45041	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.468395	0.18403	U	0.142285	T	0.27419	0.0673	L	0.40543	1.245	0.34464	D	0.702044	D	0.69078	0.997	D	0.75484	0.986	T	0.06250	-1.0837	10	0.52906	T	0.07	-14.7371	10.7215	0.46042	0.0:0.0:0.8086:0.1914	.	378	Q969P0	IGSF8_HUMAN	Y	378	ENSP00000316664:H378Y;ENSP00000357065:H378Y	ENSP00000316664:H378Y	H	-	1	0	IGSF8	158329518	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.881000	0.56152	1.723000	0.51488	0.313000	0.20887	CAC		IGSF8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060636.1	NM_052868	
DCAF8	50717	hgsc.bcm.edu	37	1	160192508	160192508	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:160192508T>C	ENST00000368073.3	-	11	1807	c.1373A>G	c.(1372-1374)cAc>cGc	p.H458R	DCAF8_ENST00000326837.2_Missense_Mutation_p.H458R|DCAF8_ENST00000556710.1_Missense_Mutation_p.H612R|DCAF8_ENST00000608310.1_Missense_Mutation_p.H612R|DCAF8_ENST00000368074.1_Missense_Mutation_p.H458R			Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	458					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.H458R(1)		cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(16)|skin(3)|upper_aerodigestive_tract(1)	33						GAGGAAGATGTGCCCACAGTC	0.507																																					p.H458R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1373G	1						.						118.0	107.0	111.0					1																	160192508		2203	4300	6503	158459132	SO:0001583	missense	50717	exon11			AK093176	CCDS1200.1	1q22-q23	2013-01-09	2009-07-17	2009-07-17	ENSG00000132716	ENSG00000132716		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24891	protein-coding gene	gene with protein product		615820	"""WD repeat domain 42A"""	WDR42A		11401431	Standard	NM_015726		Approved	H326, FLJ35857	uc010pjb.1	Q5TAQ9	OTTHUMG00000031604	ENST00000368073.3:c.1373A>G	1.37:g.160192508T>C	ENSP00000357052:p.His458Arg	Somatic		Capture	SOLID	Phase_I	158459132	NM_015726	D3DVE6|Q12839|Q4QQI6|Q53F14|Q66K50|Q68CS7|Q96E00	Missense_Mutation	SNP	ENST00000368073.3	37	CCDS1200.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.414774	0.83449	.	.	ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000258465	ENST00000368073;ENST00000326837;ENST00000368074;ENST00000555195;ENST00000540855;ENST00000556710	T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41	5.07	5.07	0.68467	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.140498	0.47455	U	0.000236	T	0.78432	0.4282	L	0.37750	1.13	0.54753	D	0.999987	D;D	0.61080	0.989;0.975	D;P	0.72625	0.978;0.632	T	0.76926	-0.2778	10	0.27082	T	0.32	-8.5031	12.4565	0.55708	0.0:0.0:0.0:1.0	.	612;458	G3V3G9;Q5TAQ9	.;DCAF8_HUMAN	R	458;458;458;612;439;612	ENSP00000357052:H458R;ENSP00000318227:H458R;ENSP00000357053:H458R;ENSP00000451989:H612R;ENSP00000451235:H612R	ENSP00000318227:H458R	H	-	2	0	RP11-574F21.3;DCAF8	158459132	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.993000	0.76245	2.130000	0.65690	0.528000	0.53228	CAC		DCAF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077402.2	NM_015726	
ITLN2	142683	hgsc.bcm.edu	37	1	160922496	160922496	+	Missense_Mutation	SNP	G	G	A	rs200996248		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:160922496G>A	ENST00000368029.3	-	3	164	c.107C>T	c.(106-108)tCg>tTg	p.S36L	ITLN2_ENST00000494442.1_5'Flank|RP11-544M22.1_ENST00000356006.3_RNA	NM_080878.2	NP_543154.1	Q8WWU7	ITLN2_HUMAN	intelectin 2	36						extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.S36L(1)		endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	19	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			GAATTCCCTCGAGAGCATCTC	0.493																																					p.S36L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C107T	1						.	G	LEU/SER	0,4406		0,0,2203	92.0	89.0	90.0		107	-0.5	0.0	1		90	1,8599	1.2+/-3.3	0,1,4299	no	missense	ITLN2	NM_080878.2	145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	36/326	160922496	1,13005	2203	4300	6503	159189120	SO:0001583	missense	142683	exon3			AY065973	CCDS1212.1	1q22-q23.5	2013-02-06			ENSG00000158764	ENSG00000158764		"""Fibrinogen C domain containing"""	20599	protein-coding gene	gene with protein product		609874				11181563	Standard	NM_080878		Approved	HL-2	uc001fxd.3	Q8WWU7	OTTHUMG00000028605	ENST00000368029.3:c.107C>T	1.37:g.160922496G>A	ENSP00000357008:p.Ser36Leu	Somatic		Capture	SOLID	Phase_I	159189120	NM_080878	Q17RR2|Q5VYI0	Missense_Mutation	SNP	ENST00000368029.3	37	CCDS1212.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.564922	0.00903	0.0	1.16E-4	ENSG00000158764	ENST00000368029	T	0.14640	2.49	0.235	-0.47	0.12131	.	7.591240	0.01083	N	0.005029	T	0.01156	0.0038	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.04013	0.001;0.001	T	0.36768	-0.9734	9	0.09843	T	0.71	.	.	.	.	.	35;36	A6NI51;Q8WWU7	.;ITLN2_HUMAN	L	36	ENSP00000357008:S36L	ENSP00000357008:S36L	S	-	2	0	ITLN2	159189120	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.676000	0.01946	-1.808000	0.01234	-1.786000	0.00637	TCG		ITLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071465.1	NM_080878	
B4GALT3	8703	hgsc.bcm.edu	37	1	161145718	161145718	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:161145718T>G	ENST00000319769.5	-	3	355	c.133A>C	c.(133-135)Aca>Cca	p.T45P	B4GALT3_ENST00000470882.1_5'UTR|PPOX_ENST00000432542.2_Intron|PPOX_ENST00000495483.1_Intron|PPOX_ENST00000535223.1_Intron|B4GALT3_ENST00000367998.1_Missense_Mutation_p.T45P	NM_001199873.1|NM_003779.3	NP_001186802.1|NP_003770.1	O60512	B4GT3_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3	45					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)	p.T45P(1)		cervix(1)|endometrium(5)|large_intestine(6)|lung(6)	18	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		N-Acetyl-D-glucosamine(DB00141)	TAGTCAAATGTCGGTCCCTGA	0.597																																					p.T45P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A133C	1						.						96.0	97.0	97.0					1																	161145718		2203	4300	6503	159412342	SO:0001583	missense	8703	exon3			BC006099	CCDS1222.1	1q21-q23	2013-02-19			ENSG00000158850	ENSG00000158850		"""Beta 4-glycosyltransferases"""	926	protein-coding gene	gene with protein product		604014				9405390, 9597550	Standard	NM_001199873		Approved	beta4Gal-T3	uc001fys.2	O60512	OTTHUMG00000034348	ENST00000319769.5:c.133A>C	1.37:g.161145718T>G	ENSP00000320965:p.Thr45Pro	Somatic		Capture	SOLID	Phase_I	159412342	NM_001199874	D3DVG3|O60910|Q9BPZ4|Q9H8T2	Missense_Mutation	SNP	ENST00000319769.5	37	CCDS1222.1	.	.	.	.	.	.	.	.	.	.	T	9.548	1.115048	0.20795	.	.	ENSG00000158850	ENST00000319769;ENST00000407555;ENST00000541560;ENST00000310413;ENST00000367998;ENST00000367997	T;T	0.51574	0.7;0.7	5.37	4.24	0.50183	.	0.266514	0.38492	N	0.001679	T	0.09202	0.0227	N	0.08118	0	0.09310	N	0.999998	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.28554	-1.0040	10	0.19590	T	0.45	.	8.2584	0.31771	0.0:0.163:0.0:0.837	.	45;45	B3KPV4;O60512	.;B4GT3_HUMAN	P	45;22;45;45;45;45	ENSP00000320965:T45P;ENSP00000356977:T45P	ENSP00000308551:T45P	T	-	1	0	B4GALT3	159412342	0.944000	0.32072	0.026000	0.17262	0.320000	0.28249	2.815000	0.48018	0.880000	0.35969	0.383000	0.25322	ACA		B4GALT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083054.1	NM_003779	
OLFML2B	25903	hgsc.bcm.edu	37	1	161970058	161970058	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:161970058C>T	ENST00000294794.3	-	5	1217	c.794G>A	c.(793-795)cGa>cAa	p.R265Q	OLFML2B_ENST00000367940.2_Missense_Mutation_p.R266Q	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	265					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)	p.R265Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			AGCCAGGGGTCGCGTCTGCAG	0.627																																					p.R265Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G794A	1						.						62.0	59.0	60.0					1																	161970058		2203	4300	6503	160236682	SO:0001583	missense	25903	exon5			BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.794G>A	1.37:g.161970058C>T	ENSP00000294794:p.Arg265Gln	Somatic		Capture	SOLID	Phase_I	160236682	NM_015441	B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	ENST00000294794.3	37	CCDS1236.1	.	.	.	.	.	.	.	.	.	.	c	0.169	-1.073587	0.01918	.	.	ENSG00000162745	ENST00000294794;ENST00000367940	D;D	0.86366	-2.11;-2.11	5.22	-3.86	0.04230	.	.	.	.	.	T	0.43033	0.1229	N	0.01874	-0.695	0.09310	N	0.999995	B;B	0.13594	0.008;0.006	B;B	0.06405	0.002;0.001	T	0.09751	-1.0660	8	0.08599	T	0.76	.	13.9839	0.64321	0.0:0.4628:0.0:0.5372	.	266;265	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	Q	265;266	ENSP00000294794:R265Q;ENSP00000356917:R266Q	ENSP00000294794:R265Q	R	-	2	0	OLFML2B	160236682	0.002000	0.14202	0.000000	0.03702	0.007000	0.05969	-0.078000	0.11375	-1.007000	0.03408	-2.299000	0.00261	CGA		OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441	
TMCO1	54499	hgsc.bcm.edu	37	1	165712457	165712457	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:165712457T>C	ENST00000392129.6	-	6	565	c.415A>G	c.(415-417)Aca>Gca	p.T139A	TMCO1_ENST00000580248.1_Missense_Mutation_p.T55A|TMCO1_ENST00000464650.1_Missense_Mutation_p.T55A|TMCO1_ENST00000367881.5_Missense_Mutation_p.T190A	NM_001256165.1|NM_019026.4	NP_001243094.1|NP_061899.2	Q9UM00	TMCO1_HUMAN	transmembrane and coiled-coil domains 1	139						endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.T139A(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)	9	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					GAACAGTCTGTGGTGTCATCT	0.398																																					p.T139A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A415G	1						.						97.0	95.0	96.0					1																	165712457		2203	4300	6503	163979081	SO:0001583	missense	54499	exon6			AB020980	CCDS1251.1, CCDS1251.2	1q22-q25	2008-02-05	2005-07-13	2005-07-13	ENSG00000143183	ENSG00000143183			18188	protein-coding gene	gene with protein product		614123	"""transmembrane and coiled-coil domains 4"""	TMCC4		8619474, 9110174	Standard	NM_019026		Approved	HP10122	uc001gdj.5	Q9UM00	OTTHUMG00000034672	ENST00000392129.6:c.415A>G	1.37:g.165712457T>C	ENSP00000375975:p.Thr139Ala	Somatic		Capture	SOLID	Phase_I	163979081	NM_019026	B2REA0|O75545|Q9BZS3|Q9BZU8	Missense_Mutation	SNP	ENST00000392129.6	37		.	.	.	.	.	.	.	.	.	.	T	19.58	3.854081	0.71719	.	.	ENSG00000143183	ENST00000367881;ENST00000392129	.	.	.	6.17	6.17	0.99709	.	0.048487	0.85682	D	0.000000	T	0.69878	0.3160	M	0.92738	3.34	0.45962	D	0.998782	B;B	0.34147	0.438;0.177	P;B	0.45913	0.497;0.187	T	0.78658	-0.2118	8	0.72032	D	0.01	.	9.975	0.41777	0.1509:0.0:0.0:0.8491	.	127;139	B7Z591;Q9UM00	.;TMCO1_HUMAN	A	139;120	.	ENSP00000356856:T139A	T	-	1	0	TMCO1	163979081	1.000000	0.71417	0.989000	0.46669	0.978000	0.69477	5.739000	0.68622	2.371000	0.80710	0.533000	0.62120	ACA		TMCO1-008	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467850.1	NM_019026	
POGK	57645	hgsc.bcm.edu	37	1	166819183	166819183	+	Missense_Mutation	SNP	G	G	T	rs201172506		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:166819183G>T	ENST00000367875.1	+	5	1727	c.1367G>T	c.(1366-1368)cGg>cTg	p.R456L	POGK_ENST00000367876.4_Missense_Mutation_p.R456L|POGK_ENST00000536514.1_Missense_Mutation_p.R371L|POGK_ENST00000537173.1_Missense_Mutation_p.R338L			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	456	DDE.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R456L(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						GTGTGGAGACGGAGGACAGGA	0.567																																					p.R456L	GBM(76;192 1530 30153 48742)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1367T	1						.						113.0	104.0	107.0					1																	166819183		2203	4300	6503	165085807	SO:0001583	missense	57645	exon5			AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.1367G>T	1.37:g.166819183G>T	ENSP00000356849:p.Arg456Leu	Somatic		Capture	SOLID	Phase_I	165085807	NM_017542	Q5TIJ1|Q8TE07	Missense_Mutation	SNP	ENST00000367875.1	37	CCDS1254.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.242330	0.58995	.	.	ENSG00000143157	ENST00000537173;ENST00000536514;ENST00000367876;ENST00000367875	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.49	4.58	0.56647	.	0.000000	0.44097	D	0.000492	T	0.12263	0.0298	N	0.12182	0.205	0.36299	D	0.856890	B;P;P	0.43169	0.256;0.652;0.8	B;B;B	0.39971	0.191;0.315;0.232	T	0.05750	-1.0866	8	.	.	.	-38.8297	11.8349	0.52319	0.0835:0.0:0.9165:0.0	.	338;371;456	G3V1P0;B4DS22;Q9P215	.;.;POGK_HUMAN	L	338;371;456;456	ENSP00000442763:R338L;ENSP00000441187:R371L;ENSP00000356850:R456L;ENSP00000356849:R456L	.	R	+	2	0	POGK	165085807	0.998000	0.40836	0.213000	0.23690	0.924000	0.55760	2.767000	0.47637	1.547000	0.49401	0.650000	0.86243	CGG		POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082888.1	NM_017542	
TNFSF4	7292	hgsc.bcm.edu	37	1	173155706	173155706	+	Silent	SNP	G	G	A	rs373048163		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:173155706G>A	ENST00000281834.3	-	3	637	c.501C>T	c.(499-501)ggC>ggT	p.G167G	TNFSF4_ENST00000488053.1_5'Flank|TNFSF4_ENST00000367718.1_Silent_p.G117G	NM_003326.3	NP_003317.1	P23510	TNFL4_HUMAN	tumor necrosis factor (ligand) superfamily, member 4	167					acute inflammatory response (GO:0002526)|CD4-positive, alpha-beta T cell costimulation (GO:0035783)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nitrogen dioxide (GO:0035714)|cellular response to prostaglandin E stimulus (GO:0071380)|chemokine (C-C motif) ligand 11 production (GO:0071954)|cholesterol metabolic process (GO:0008203)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|memory T cell activation (GO:0035709)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell activation (GO:0050871)|positive regulation of CD4-positive, alpha-beta T cell costimulation (GO:1900281)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-4-dependent isotype switching to IgE isotypes (GO:2000572)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of memory T cell activation (GO:2000568)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T-helper 2 cell activation (GO:2000570)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of type 2 immune response (GO:0002830)|regulation of adaptive immune response (GO:0002819)|regulation of inflammatory response (GO:0050727)|response to nitrogen dioxide (GO:0035713)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)|T-helper 2 cell activation (GO:0035712)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor binding (GO:0005102)|tumor necrosis factor receptor superfamily binding (GO:0032813)	p.G167G(1)		breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|urinary_tract(1)	12						TCAGTTCTCCGCCATTCACAT	0.458																																					p.G167G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C501T	1						.	G		0,4406		0,0,2203	83.0	76.0	79.0		501	-4.8	0.9	1		79	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TNFSF4	NM_003326.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		167/184	173155706	1,13005	2203	4300	6503	171422329	SO:0001819	synonymous_variant	7292	exon3			D90224	CCDS1306.1, CCDS72985.1	1q25	2008-07-31	2008-07-31		ENSG00000117586	ENSG00000117586		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11934	protein-coding gene	gene with protein product		603594	"""tax-transcriptionally activated glycoprotein 1, 34kD"""	TXGP1		1996093, 8076595	Standard	XM_005245475		Approved	OX-40L, gp34, CD252	uc001giw.3	P23510	OTTHUMG00000034838	ENST00000281834.3:c.501C>T	1.37:g.173155706G>A		Somatic		Capture	SOLID	Phase_I	171422329	NM_003326	Q5JZA5|Q8IV74|Q9HCN9	Silent	SNP	ENST00000281834.3	37	CCDS1306.1																																																																																				TNFSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084271.1		
TNN	63923	hgsc.bcm.edu	37	1	175097762	175097762	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:175097762C>T	ENST00000239462.4	+	15	3323	c.3210C>T	c.(3208-3210)tgC>tgT	p.C1070C		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	1070	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.C1070C(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CTTCGGACTGCAGTCAGGTTC	0.557																																					p.C1070C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3210T	1						.						94.0	89.0	91.0					1																	175097762		2203	4300	6503	173364385	SO:0001819	synonymous_variant	63923	exon15			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.3210C>T	1.37:g.175097762C>T		Somatic		Capture	SOLID	Phase_I	173364385	NM_022093	B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	37	CCDS30943.1																																																																																				TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
RCC2	55920	hgsc.bcm.edu	37	1	17739605	17739605	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:17739605T>C	ENST00000375436.4	-	10	1464	c.1277A>G	c.(1276-1278)gAc>gGc	p.D426G	AC004824.1_ENST00000583469.1_RNA|RCC2_ENST00000375433.3_Missense_Mutation_p.D426G	NM_018715.3	NP_061185.1	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	426					chromosome passenger complex localization to kinetochore (GO:0072356)|endosome organization (GO:0007032)|focal adhesion assembly (GO:0048041)|integrin-mediated signaling pathway (GO:0007229)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of GTPase activity (GO:0034260)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|regulation of cell migration (GO:0030334)	chromosome, centromeric core domain (GO:0034506)|cytosol (GO:0005829)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|Rac GTPase binding (GO:0048365)	p.D426G(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(7)|lung(4)	17		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		GCCGCAGAGGTCCTGCACTGC	0.562																																					p.D426G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1277G	1						.						48.0	45.0	46.0					1																	17739605		2203	4300	6503	17612192	SO:0001583	missense	55920	exon9				CCDS181.1	1p36.13	2010-05-05			ENSG00000179051	ENSG00000179051			30297	protein-coding gene	gene with protein product		609587				10819331, 12919680	Standard	NM_018715		Approved	TD-60	uc001bal.3	Q9P258	OTTHUMG00000002513	ENST00000375436.4:c.1277A>G	1.37:g.17739605T>C	ENSP00000364585:p.Asp426Gly	Somatic		Capture	SOLID	Phase_I	17612192	NM_001136204	Q8IVL9|Q9BSN6|Q9NPV8	Missense_Mutation	SNP	ENST00000375436.4	37	CCDS181.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.813976	0.90790	.	.	ENSG00000179051	ENST00000375436;ENST00000375433	T;T	0.79352	-1.26;-1.26	5.24	5.24	0.73138	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	T	0.79816	0.4511	N	0.26130	0.795	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	T	0.77451	-0.2583	10	0.26408	T	0.33	-33.7103	14.258	0.66065	0.0:0.0:0.0:1.0	.	426	Q9P258	RCC2_HUMAN	G	426	ENSP00000364585:D426G;ENSP00000364582:D426G	ENSP00000364582:D426G	D	-	2	0	RCC2	17612192	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.993000	0.88291	2.113000	0.64589	0.533000	0.62120	GAC		RCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007144.1	NM_018715	
RCC2	55920	hgsc.bcm.edu	37	1	17749253	17749253	+	Silent	SNP	G	G	A	rs182750941	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:17749253G>A	ENST00000375436.4	-	5	790	c.603C>T	c.(601-603)caC>caT	p.H201H	RCC2_ENST00000375433.3_Silent_p.H201H	NM_018715.3	NP_061185.1	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	201					chromosome passenger complex localization to kinetochore (GO:0072356)|endosome organization (GO:0007032)|focal adhesion assembly (GO:0048041)|integrin-mediated signaling pathway (GO:0007229)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of GTPase activity (GO:0034260)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|regulation of cell migration (GO:0030334)	chromosome, centromeric core domain (GO:0034506)|cytosol (GO:0005829)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|Rac GTPase binding (GO:0048365)	p.H201H(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(7)|lung(4)	17		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		CAATCACTTCGTGGCTAAGAC	0.552													G|||	5	0.000998403	0.0	0.0	5008	,	,		20056	0.005		0.0	False		,,,				2504	0.0				p.H201H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C603T	1						.						114.0	91.0	99.0					1																	17749253		2203	4300	6503	17621840	SO:0001819	synonymous_variant	55920	exon4				CCDS181.1	1p36.13	2010-05-05			ENSG00000179051	ENSG00000179051			30297	protein-coding gene	gene with protein product		609587				10819331, 12919680	Standard	NM_018715		Approved	TD-60	uc001bal.3	Q9P258	OTTHUMG00000002513	ENST00000375436.4:c.603C>T	1.37:g.17749253G>A		Somatic		Capture	SOLID	Phase_I	17621840	NM_001136204	Q8IVL9|Q9BSN6|Q9NPV8	Silent	SNP	ENST00000375436.4	37	CCDS181.1																																																																																				RCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007144.1	NM_018715	
ASTN1	460	hgsc.bcm.edu	37	1	176833487	176833487	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:176833487C>T	ENST00000367654.3	-	23	4053	c.3842G>A	c.(3841-3843)aGg>aAg	p.R1281K	ASTN1_ENST00000361833.2_Missense_Mutation_p.R1273K|ASTN1_ENST00000367657.3_Intron	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1281					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.R1273K(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						ACACGTCTTCCTGAGGTCCCG	0.572																																					p.R1273K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3818A	1						.						120.0	115.0	117.0					1																	176833487		2203	4300	6503	175100110	SO:0001583	missense	460	exon23			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3842G>A	1.37:g.176833487C>T	ENSP00000356626:p.Arg1281Lys	Somatic		Capture	SOLID	Phase_I	175100110	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		.	.	.	.	.	.	.	.	.	.	C	6.145	0.394997	0.11638	.	.	ENSG00000152092	ENST00000361833;ENST00000367654	T;T	0.08984	3.03;3.03	4.61	3.67	0.42095	.	0.148909	0.53938	D	0.000044	T	0.03739	0.0106	N	0.12746	0.255	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28073	-1.0055	10	0.02654	T	1	-20.4334	9.2497	0.37547	0.0:0.8173:0.0:0.1827	.	1273	O14525-2	.	K	1273;1281	ENSP00000354536:R1273K;ENSP00000356626:R1281K	ENSP00000354536:R1273K	R	-	2	0	ASTN1	175100110	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.692000	0.37731	2.282000	0.76494	0.555000	0.69702	AGG		ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
LAMC1	3915	hgsc.bcm.edu	37	1	183096447	183096447	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:183096447C>T	ENST00000258341.4	+	17	3288	c.3031C>T	c.(3031-3033)Cgc>Tgc	p.R1011C	LAMC1_ENST00000466964.1_3'UTR	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	1011	Laminin EGF-like 11. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.R1011C(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						TGTGGGAAATCGCTGTGACCA	0.483																																					p.R1011C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3031T	1						.						148.0	122.0	131.0					1																	183096447		2203	4300	6503	181363070	SO:0001583	missense	3915	exon17			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.3031C>T	1.37:g.183096447C>T	ENSP00000258341:p.Arg1011Cys	Somatic		Capture	SOLID	Phase_I	181363070	NM_002293	Q5VYE7	Missense_Mutation	SNP	ENST00000258341.4	37	CCDS1351.1	.	.	.	.	.	.	.	.	.	.	C	32	5.123987	0.94429	.	.	ENSG00000135862	ENST00000258341	T	0.63417	-0.04	5.49	5.49	0.81192	EGF-like, laminin (4);EGF-like region, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.85579	0.5729	H	0.94847	3.59	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.89386	0.3685	10	0.87932	D	0	.	19.3737	0.94500	0.0:1.0:0.0:0.0	.	1011	P11047	LAMC1_HUMAN	C	1011	ENSP00000258341:R1011C	ENSP00000258341:R1011C	R	+	1	0	LAMC1	181363070	1.000000	0.71417	0.968000	0.41197	0.929000	0.56500	7.137000	0.77295	2.578000	0.87016	0.555000	0.69702	CGC		LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293	
HMCN1	83872	hgsc.bcm.edu	37	1	185969315	185969315	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:185969315G>A	ENST00000271588.4	+	26	4242	c.4013G>A	c.(4012-4014)tGt>tAt	p.C1338Y	HMCN1_ENST00000367492.2_Missense_Mutation_p.C1338Y	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1338	Ig-like C2-type 10.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.C1338Y(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GAGTACATCTGTGTGGCAGTC	0.433																																					p.C1338Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4013A	1						.						126.0	114.0	118.0					1																	185969315		2203	4300	6503	184235938	SO:0001583	missense	83872	exon26			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.4013G>A	1.37:g.185969315G>A	ENSP00000271588:p.Cys1338Tyr	Somatic		Capture	SOLID	Phase_I	184235938	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580454	0.86645	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	D;D	0.89552	-2.53;-2.53	5.25	5.25	0.73442	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.043736	0.85682	D	0.000000	D	0.97043	0.9034	H	0.98664	4.295	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.98732	1.0713	10	0.87932	D	0	.	18.915	0.92501	0.0:0.0:1.0:0.0	.	1338	Q96RW7	HMCN1_HUMAN	Y	1338	ENSP00000271588:C1338Y;ENSP00000356462:C1338Y	ENSP00000271588:C1338Y	C	+	2	0	HMCN1	184235938	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.188000	0.94921	2.451000	0.82905	0.558000	0.71614	TGT		HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HMCN1	83872	hgsc.bcm.edu	37	1	186083952	186083952	+	Splice_Site	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:186083952T>C	ENST00000271588.4	+	74	11507	c.11278T>C	c.(11278-11280)Tat>Cat	p.Y3760H	HMCN1_ENST00000367492.2_Splice_Site_p.Y3760H	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3760	Ig-like C2-type 36.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.Y3760H(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTCTTGTAGATATTCCATCTT	0.388																																					p.Y3760H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T11278C	1						.						128.0	127.0	127.0					1																	186083952		2203	4300	6503	184350575	SO:0001630	splice_region_variant	83872	exon74			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11277-1T>C	1.37:g.186083952T>C		Somatic		Capture	SOLID	Phase_I	184350575	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	T	10.80	1.452779	0.26074	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68624	-0.34;-0.34	5.17	2.86	0.33363	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.111526	0.64402	N	0.000005	T	0.57533	0.2060	L	0.55834	1.745	0.46356	D	0.999003	B	0.19073	0.033	B	0.20577	0.03	T	0.49283	-0.8956	10	0.33940	T	0.23	.	8.2427	0.31669	0.0:0.157:0.0:0.843	.	3760	Q96RW7	HMCN1_HUMAN	H	3760	ENSP00000271588:Y3760H;ENSP00000356462:Y3760H	ENSP00000271588:Y3760H	Y	+	1	0	HMCN1	184350575	1.000000	0.71417	0.015000	0.15790	0.478000	0.33099	5.454000	0.66651	0.388000	0.25054	0.460000	0.39030	TAT		HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	Missense_Mutation
ASPM	259266	hgsc.bcm.edu	37	1	197072997	197072997	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:197072997C>A	ENST00000367409.4	-	18	5640	c.5384G>T	c.(5383-5385)aGg>aTg	p.R1795M	ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1795					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.R1795M(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						GAAGTTCTTCCTCTGATTGAC	0.373																																					p.R1795M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5384T	1						.						103.0	103.0	103.0					1																	197072997		2203	4299	6502	195339620	SO:0001583	missense	259266	exon18			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.5384G>T	1.37:g.197072997C>A	ENSP00000356379:p.Arg1795Met	Somatic		Capture	SOLID	Phase_I	195339620	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.381325	0.42207	.	.	ENSG00000066279	ENST00000367409	T	0.73897	-0.79	5.83	5.83	0.93111	.	0.123958	0.53938	D	0.000045	D	0.90424	0.7002	H	0.94542	3.55	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.91172	0.4969	10	0.48119	T	0.1	.	20.1238	0.97972	0.0:1.0:0.0:0.0	.	1795	Q8IZT6	ASPM_HUMAN	M	1795	ENSP00000356379:R1795M	ENSP00000356379:R1795M	R	-	2	0	ASPM	195339620	0.998000	0.40836	0.981000	0.43875	0.819000	0.46315	3.482000	0.53186	2.756000	0.94617	0.585000	0.79938	AGG		ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
ASPM	259266	hgsc.bcm.edu	37	1	197112703	197112703	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:197112703C>T	ENST00000367409.4	-	3	935	c.679G>A	c.(679-681)Gct>Act	p.A227T	ASPM_ENST00000294732.7_Missense_Mutation_p.A227T	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	227					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.A227T(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TCATTGAAAGCAGGGCTAATA	0.393																																					p.A227T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G679A	1						.						134.0	125.0	128.0					1																	197112703		2203	4300	6503	195379326	SO:0001583	missense	259266	exon3			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.679G>A	1.37:g.197112703C>T	ENSP00000356379:p.Ala227Thr	Somatic		Capture	SOLID	Phase_I	195379326	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	6.233	0.411055	0.11812	.	.	ENSG00000066279	ENST00000367409;ENST00000294732	T;T	0.57436	0.4;1.67	5.25	-10.5	0.00291	.	2.064640	0.02084	N	0.052588	T	0.26955	0.0660	N	0.05124	-0.11	0.09310	N	1	B;B	0.23806	0.0;0.091	B;B	0.16289	0.0;0.015	T	0.10870	-1.0611	10	0.19147	T	0.46	.	13.2973	0.60305	0.1033:0.709:0.0873:0.1003	.	227;227	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	T	227	ENSP00000356379:A227T;ENSP00000294732:A227T	ENSP00000294732:A227T	A	-	1	0	ASPM	195379326	0.000000	0.05858	0.000000	0.03702	0.424000	0.31475	-0.444000	0.06854	-2.263000	0.00689	-0.334000	0.08254	GCT		ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
IGFN1	91156	hgsc.bcm.edu	37	1	201186585	201186585	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:201186585C>T	ENST00000335211.4	+	17	9896	c.9766C>T	c.(9766-9768)Cct>Tct	p.P3256S	IGFN1_ENST00000295591.8_Missense_Mutation_p.P416S	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	799						nucleus (GO:0005634)|Z disc (GO:0030018)		p.P3256S(1)|p.P416S(1)		autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CCAGCCGGTGCCTGGTGAGCA	0.592																																					p.P3256S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C9766T	1						.						66.0	60.0	62.0					1																	201186585		2203	4300	6503	199453208	SO:0001583	missense	91156	exon17			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.9766C>T	1.37:g.201186585C>T	ENSP00000334714:p.Pro3256Ser	Somatic		Capture	SOLID	Phase_I	199453208	NM_001164586	F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	CCDS53455.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.19|11.19	1.565019|1.565019	0.27915|0.27915	.|.	.|.	ENSG00000163395|ENSG00000163395	ENST00000412892|ENST00000335211;ENST00000295591	.|T;T	.|0.56103	.|0.48;0.48	4.81|4.81	-0.676|-0.676	0.11361|0.11361	.|.	.|0.618900	.|0.15964	.|N	.|0.236114	T|T	0.23611|0.23611	0.0571|0.0571	N|N	0.10809|0.10809	0.05|0.05	0.09310|0.09310	N|N	0.999996|0.999996	.|B	.|0.20052	.|0.041	.|B	.|0.27262	.|0.078	T|T	0.14062|0.14062	-1.0486|-1.0486	5|10	.|0.13853	.|T	.|0.58	.|.	0.6783|0.6783	0.00870|0.00870	0.1664:0.2857:0.2331:0.3148|0.1664:0.2857:0.2331:0.3148	.|.	.|3256	.|F8WAI1	.|.	V|S	673|3256;416	.|ENSP00000334714:P3256S;ENSP00000295591:P416S	.|ENSP00000295591:P416S	A|P	+|+	2|1	0|0	IGFN1|IGFN1	199453208|199453208	0.000000|0.000000	0.05858|0.05858	0.792000|0.792000	0.32020|0.32020	0.561000|0.561000	0.35649|0.35649	-0.505000|-0.505000	0.06367|0.06367	-0.153000|-0.153000	0.11137|0.11137	0.655000|0.655000	0.94253|0.94253	GCC|CCT		IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275	
OPTC	26254	hgsc.bcm.edu	37	1	203465213	203465213	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:203465213G>T	ENST00000367222.2	+	2	196	c.80G>T	c.(79-81)aGg>aTg	p.R27M		NM_014359.3	NP_055174.1	Q9UBM4	OPT_HUMAN	opticin	27					negative regulation of angiogenesis (GO:0016525)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.R27M(1)		breast(1)|cervix(1)|kidney(5)|large_intestine(3)|lung(8)|pancreas(1)|stomach(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.109)			AGGAAGGAGAGGAAGAGGAGA	0.552																																					p.R27M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G80T	1						.						101.0	90.0	93.0					1																	203465213		2203	4300	6503	201731836	SO:0001583	missense	26254	exon2			AF161702	CCDS1439.1	1q31	2008-02-05			ENSG00000188770	ENSG00000188770			8158	protein-coding gene	gene with protein product	"""oculoglycan"""	605127				10636917	Standard	NM_014359		Approved		uc001gzu.1	Q9UBM4	OTTHUMG00000036100	ENST00000367222.2:c.80G>T	1.37:g.203465213G>T	ENSP00000356191:p.Arg27Met	Somatic		Capture	SOLID	Phase_I	201731836	NM_014359	Q5T2G4	Missense_Mutation	SNP	ENST00000367222.2	37	CCDS1439.1	.	.	.	.	.	.	.	.	.	.	G	17.56	3.421001	0.62622	.	.	ENSG00000188770	ENST00000367222;ENST00000448911	T;T	0.59364	0.47;0.27	3.93	3.93	0.45458	.	0.695013	0.12269	N	0.483998	T	0.62816	0.2459	L	0.53249	1.67	0.09310	N	1	D	0.63046	0.992	P	0.51355	0.667	T	0.55673	-0.8104	10	0.62326	D	0.03	.	12.798	0.57569	0.0:0.0:1.0:0.0	.	27	Q9UBM4	OPT_HUMAN	M	27	ENSP00000356191:R27M;ENSP00000399491:R27M	ENSP00000356191:R27M	R	+	2	0	OPTC	201731836	0.000000	0.05858	0.008000	0.14137	0.468000	0.32798	0.108000	0.15396	2.035000	0.60131	0.557000	0.71058	AGG		OPTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087964.1	NM_014359	
CR2	1380	hgsc.bcm.edu	37	1	207649720	207649720	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:207649720G>A	ENST00000367058.3	+	14	2870	c.2681G>A	c.(2680-2682)tGc>tAc	p.C894Y	CR2_ENST00000367057.3_Missense_Mutation_p.C953Y|CR2_ENST00000458541.2_Missense_Mutation_p.C867Y|CR2_ENST00000367059.3_Intron	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	894	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)	p.C953Y(1)		NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CTCCTTCTTTGCACACATGAG	0.428																																					p.C953Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2858A	1						.						88.0	79.0	82.0					1																	207649720		2203	4300	6503	205716343	SO:0001583	missense	1380	exon15			M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.2681G>A	1.37:g.207649720G>A	ENSP00000356025:p.Cys894Tyr	Somatic		Capture	SOLID	Phase_I	205716343	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	37	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606140	0.66445	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000458541	D;D;D	0.98090	-4.71;-4.71;-4.71	4.87	4.87	0.63330	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	D	0.99351	0.9772	H	0.99712	4.72	0.52099	D	0.999946	D;D	0.76494	0.999;0.999	D;D	0.79108	0.992;0.983	D	0.98029	1.0375	9	0.87932	D	0	.	14.2451	0.65983	0.0:0.0:1.0:0.0	.	894;953	P20023;P20023-3	CR2_HUMAN;.	Y	894;953;867	ENSP00000356025:C894Y;ENSP00000356024:C953Y;ENSP00000404222:C867Y	ENSP00000356024:C953Y	C	+	2	0	CR2	205716343	1.000000	0.71417	0.818000	0.32626	0.983000	0.72400	4.943000	0.63554	2.643000	0.89663	0.655000	0.94253	TGC		CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
CAMK1G	57172	hgsc.bcm.edu	37	1	209779711	209779711	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:209779711T>C	ENST00000009105.1	+	6	727	c.482T>C	c.(481-483)aTg>aCg	p.M161T	CAMK1G_ENST00000361322.2_Missense_Mutation_p.M161T			Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	161	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)	p.M161T(1)		breast(2)|central_nervous_system(1)|large_intestine(8)|lung(8)|stomach(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.0475)		TCTAAGATCATGATCACTGAC	0.468																																					p.M161T	Ovarian(163;530 1939 9680 28669 48710)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T482C	1						.						185.0	166.0	173.0					1																	209779711		2203	4300	6503	207846334	SO:0001583	missense	57172	exon6				CCDS1486.1	1q32.2	2012-09-20			ENSG00000008118	ENSG00000008118			14585	protein-coding gene	gene with protein product		614994				12637513	Standard	NM_020439		Approved	VWS1, CLICKIII, dJ272L16.1	uc001hhd.3	Q96NX5	OTTHUMG00000036361	ENST00000009105.1:c.482T>C	1.37:g.209779711T>C	ENSP00000009105:p.Met161Thr	Somatic		Capture	SOLID	Phase_I	207846334	NM_020439	Q86UH5|Q9Y3J7	Missense_Mutation	SNP	ENST00000009105.1	37	CCDS1486.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.004805	0.74932	.	.	ENSG00000008118	ENST00000009105;ENST00000423146;ENST00000361322	T;T;T	0.38887	1.11;1.88;1.11	5.41	5.41	0.78517	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.45716	0.1356	N	0.05441	-0.05	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.91635	0.996;0.999	T	0.58008	-0.7712	10	0.72032	D	0.01	.	15.4516	0.75277	0.0:0.0:0.0:1.0	.	161;161	Q96NX5-2;Q96NX5	.;KCC1G_HUMAN	T	161	ENSP00000009105:M161T;ENSP00000392173:M161T;ENSP00000354861:M161T	ENSP00000009105:M161T	M	+	2	0	CAMK1G	207846334	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	7.692000	0.84203	2.038000	0.60285	0.460000	0.39030	ATG		CAMK1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088526.1	NM_020439	
KCNK2	3776	hgsc.bcm.edu	37	1	215342668	215342668	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:215342668G>T	ENST00000444842.2	+	4	752	c.602G>T	c.(601-603)gGa>gTa	p.G201V	KCNK2_ENST00000391895.2_Missense_Mutation_p.G197V|KCNK2_ENST00000391894.2_Missense_Mutation_p.G186V	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	201					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)	p.G186V(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	accatatttggaaaaggaatt	0.338																																					p.G197V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G590T	1						.						105.0	105.0	105.0					1																	215342668		2203	4300	6503	213409291	SO:0001583	missense	3776	exon4			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.602G>T	1.37:g.215342668G>T	ENSP00000394033:p.Gly201Val	Somatic		Capture	SOLID	Phase_I	213409291	NM_001017424	A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	ENST00000444842.2	37	CCDS41467.1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.527930	0.64860	.	.	ENSG00000082482	ENST00000391895;ENST00000391894;ENST00000444842	T;T;T	0.21031	2.03;2.04;2.03	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.21186	0.0510	L	0.34521	1.04	0.80722	D	1	B;B;B	0.12013	0.004;0.005;0.002	B;B;B	0.15870	0.009;0.011;0.014	T	0.02942	-1.1091	10	0.30854	T	0.27	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	186;201;197	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	V	197;186;201	ENSP00000375765:G197V;ENSP00000375764:G186V;ENSP00000394033:G201V	ENSP00000375764:G186V	G	+	2	0	KCNK2	213409291	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	GGA		KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217	
DUSP10	11221	hgsc.bcm.edu	37	1	221912925	221912925	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:221912925C>A	ENST00000366899.3	-	2	400	c.162G>T	c.(160-162)aaG>aaT	p.K54N	DUSP10_ENST00000468085.1_5'Flank|DUSP10_ENST00000544095.1_5'Flank|DUSP10_ENST00000323825.3_Intron	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10	54					inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.K54N(1)		NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		GATTCGCAGCCTTGAGGGACA	0.562																																					p.K54N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G162T	1						.						123.0	112.0	116.0					1																	221912925		2203	4300	6503	219979548	SO:0001583	missense	11221	exon2			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.162G>T	1.37:g.221912925C>A	ENSP00000355866:p.Lys54Asn	Somatic		Capture	SOLID	Phase_I	219979548	NM_007207	D3DTB4|Q6GSI4|Q9H9Z5	Missense_Mutation	SNP	ENST00000366899.3	37	CCDS1528.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.447482	0.43429	.	.	ENSG00000143507	ENST00000366899	T	0.02579	4.24	5.52	4.6	0.57074	.	0.192132	0.47455	D	0.000239	T	0.01940	0.0061	N	0.08118	0	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.55483	-0.8134	10	0.51188	T	0.08	.	10.1935	0.43041	0.0:0.7931:0.1345:0.0724	.	54	Q9Y6W6	DUS10_HUMAN	N	54	ENSP00000355866:K54N	ENSP00000355866:K54N	K	-	3	2	DUSP10	219979548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.607000	0.61133	2.615000	0.88500	0.591000	0.81541	AAG		DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090716.1	NM_007207	
SPRTN	83932	hgsc.bcm.edu	37	1	231474149	231474149	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:231474149T>C	ENST00000295050.7	+	1	356	c.20T>C	c.(19-21)tTg>tCg	p.L7S	SPRTN_ENST00000008440.9_Missense_Mutation_p.L7S|SPRTN_ENST00000391858.4_Missense_Mutation_p.L7S|EXOC8_ENST00000360394.2_5'Flank|EXOC8_ENST00000366645.1_5'Flank	NM_001010984.2|NM_032018.5	NP_001010984.1|NP_114407.3	Q9H040	SPRTN_HUMAN	SprT-like N-terminal domain	7					cellular response to DNA damage stimulus (GO:0006974)|positive regulation of protein ubiquitination (GO:0031398)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|K63-linked polyubiquitin binding (GO:0070530)|metal ion binding (GO:0046872)|ubiquitin binding (GO:0043130)	p.L7S(1)									GACTTGATGTTGGCACTGCGG	0.652																																					p.L7S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T20C	1						.						98.0	91.0	93.0					1																	231474149		2203	4300	6503	229540772	SO:0001583	missense	83932	exon1			AL512744	CCDS1594.1, CCDS31054.1, CCDS58066.1	1q42.12-q43	2013-01-30	2012-06-18	2012-06-18	ENSG00000010072	ENSG00000010072			25356	protein-coding gene	gene with protein product	"""SprT-like domain at the N terminus"", ""DNA damage-targeting VCP (p97) adaptor"""		"""chromosome 1 open reading frame 124"""	C1orf124		22681887	Standard	NM_032018		Approved	DKFZP547N043, Spartan, DVC1	uc001hur.4	Q9H040	OTTHUMG00000038022	ENST00000295050.7:c.20T>C	1.37:g.231474149T>C	ENSP00000295050:p.Leu7Ser	Somatic		Capture	SOLID	Phase_I	229540772	NM_001010984	B1AKT0|B5MEF7|Q5TE78|Q6UWW6|Q96BC5|Q96KA0	Missense_Mutation	SNP	ENST00000295050.7	37	CCDS1594.1	.	.	.	.	.	.	.	.	.	.	T	17.38	3.376188	0.61735	.	.	ENSG00000010072	ENST00000391858;ENST00000295050;ENST00000008440;ENST00000545269	T	0.58506	0.33	4.86	4.86	0.63082	.	0.163364	0.41823	D	0.000818	T	0.69223	0.3087	M	0.65498	2.005	0.31040	N	0.716467	P;P;D	0.63880	0.931;0.943;0.993	P;P;P	0.58454	0.621;0.777;0.839	T	0.74411	-0.3674	10	0.87932	D	0	-8.3443	13.1842	0.59672	0.0:0.0:0.0:1.0	.	7;7;7	B1AKT0;Q9H040-2;Q9H040	.;.;CA124_HUMAN	S	7	ENSP00000295050:L7S	ENSP00000008440:L7S	L	+	2	0	C1orf124	229540772	0.942000	0.31987	0.601000	0.28877	0.090000	0.18270	2.366000	0.44204	2.047000	0.60756	0.379000	0.24179	TTG		SPRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092858.1	NM_032018	
GRHL3	57822	hgsc.bcm.edu	37	1	24669383	24669383	+	Splice_Site	SNP	C	C	T	rs202191841	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:24669383C>T	ENST00000350501.5	+	11	1414	c.1287C>T	c.(1285-1287)ggC>ggT	p.G429G	GRHL3_ENST00000361548.4_Splice_Site_p.G429G|GRHL3_ENST00000342072.4_Splice_Site_p.G336G|GRHL3_ENST00000236255.4_Splice_Site_p.G434G|GRHL3_ENST00000356046.2_Splice_Site_p.G383G	NM_198174.2	NP_937817.3	Q8TE85	GRHL3_HUMAN	grainyhead-like 3 (Drosophila)	429					central nervous system development (GO:0007417)|cochlea morphogenesis (GO:0090103)|ectoderm development (GO:0007398)|epidermis development (GO:0008544)|establishment of planar polarity (GO:0001736)|eyelid development in camera-type eye (GO:0061029)|pattern specification process (GO:0007389)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.G434G(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		TCCCATCAGGCGTCAAGGGCT	0.632													C|||	3	0.000599042	0.0	0.0	5008	,	,		17713	0.0		0.001	False		,,,				2504	0.002				p.G429G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1287T	1						.	C	,,,	0,4406		0,0,2203	95.0	101.0	99.0		1149,1302,1287,1287	-1.3	0.9	1		99	1,8599	1.2+/-3.3	0,1,4299	yes	coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice	GRHL3	NM_001195010.1,NM_021180.3,NM_198173.2,NM_198174.2	,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,	383/557,434/608,429/603,429/627	24669383	1,13005	2203	4300	6503	24541970	SO:0001630	splice_region_variant	57822	exon11			AY231161	CCDS251.1, CCDS252.1, CCDS44088.1, CCDS252.2, CCDS53284.1	1p36	2008-02-05	2005-07-11	2005-07-11	ENSG00000158055	ENSG00000158055			25839	protein-coding gene	gene with protein product		608317	"""transcription factor CP2-like 4"""	TFCP2L4		12549979	Standard	NM_021180		Approved	SOM	uc021oiw.1	Q8TE85	OTTHUMG00000003040	ENST00000350501.5:c.1286-1C>T	1.37:g.24669383C>T		Somatic		Capture	SOLID	Phase_I	24541970	NM_198173	A2A297|B2RCL1|G3XAF0|Q5TH78|Q86Y06|Q8N407	Silent	SNP	ENST00000350501.5	37	CCDS252.2																																																																																				GRHL3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000009047.2	NM_021180	Silent
STPG1	90529	hgsc.bcm.edu	37	1	24696292	24696292	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:24696292C>T	ENST00000374409.1	-	7	863	c.609G>A	c.(607-609)tcG>tcA	p.S203S	STPG1_ENST00000440416.1_Silent_p.S156S|STPG1_ENST00000337248.4_Silent_p.S203S|STPG1_ENST00000468303.1_5'UTR|STPG1_ENST00000003583.8_Silent_p.S156S	NM_001199012.1	NP_001185941.1	Q5TH74	STPG1_HUMAN	sperm-tail PG-rich repeat containing 1	203					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S156S(1)									ATGTATTTGGCGACTGCTTCA	0.388																																					p.S203S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G609A	1						.						112.0	116.0	115.0					1																	24696292		2203	4300	6503	24568879	SO:0001819	synonymous_variant	90529	exon7			BC047705	CCDS253.1, CCDS55581.1	1p36.11	2012-10-31	2012-07-30	2012-07-30	ENSG00000001460	ENSG00000001460			28070	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 2"""	615826	"""chromosome 1 open reading frame 201"""	C1orf201		23028632	Standard	NM_001199012		Approved	FLJ33340, MAPO2	uc001bjc.3	Q5TH74	OTTHUMG00000003297	ENST00000374409.1:c.609G>A	1.37:g.24696292C>T		Somatic		Capture	SOLID	Phase_I	24568879	NM_001199013	Q49AP0|Q6P3R4|Q86VU9|Q8WVQ3	Silent	SNP	ENST00000374409.1	37	CCDS55581.1																																																																																				STPG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009172.1	NM_178122	
SLC35F3	148641	hgsc.bcm.edu	37	1	234458950	234458950	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:234458950G>A	ENST00000366617.3	+	7	1455	c.1227G>A	c.(1225-1227)caG>caA	p.Q409Q	SLC35F3_ENST00000366618.3_Silent_p.Q478Q			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	409					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)		p.Q478Q(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			CAGGACCTCAGAGCAAGAACA	0.582											OREG0014330	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q478Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1434A	1						.						60.0	59.0	60.0					1																	234458950		2203	4300	6503	232525573	SO:0001819	synonymous_variant	148641	exon8				CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.1227G>A	1.37:g.234458950G>A		Somatic	2373	Capture	SOLID	Phase_I	232525573	NM_173508	Q5TDD6|Q8N9C9	Silent	SNP	ENST00000366617.3	37																																																																																					SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000128322.1	NM_173508	
THAP3	90326	hgsc.bcm.edu	37	1	6688716	6688716	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:6688716G>A	ENST00000054650.4	+	3	390	c.232G>A	c.(232-234)Gtg>Atg	p.V78M	THAP3_ENST00000377627.3_Missense_Mutation_p.V78M|THAP3_ENST00000307896.6_Missense_Mutation_p.V78M	NM_001195753.1	NP_001182682.1	Q8WTV1	THAP3_HUMAN	THAP domain containing, apoptosis associated protein 3	78							DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V78M(1)		breast(1)|cervix(1)|large_intestine(1)|prostate(1)	4	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		GCACAATGCCGTGCCCACGGT	0.592																																					p.V78M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G232A	1						.						68.0	53.0	58.0					1																	6688716		2203	4300	6503	6611303	SO:0001583	missense	90326	exon2			BC022081	CCDS86.1, CCDS55572.1, CCDS55573.1	1p36.1	2013-01-25			ENSG00000041988	ENSG00000041988		"""THAP (C2CH-type zinc finger) domain containing"""	20855	protein-coding gene	gene with protein product		612532				12575992	Standard	NM_138350		Approved		uc001aod.3	Q8WTV1	OTTHUMG00000001440	ENST00000054650.4:c.232G>A	1.37:g.6688716G>A	ENSP00000054650:p.Val78Met	Somatic		Capture	SOLID	Phase_I	6611303	NM_138350	Q569K1|Q5TH66|Q5TH67|Q8N8T6|Q9BSC7|Q9Y3H2|Q9Y3H3	Missense_Mutation	SNP	ENST00000054650.4	37	CCDS55572.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.287021	0.80803	.	.	ENSG00000041988	ENST00000054650;ENST00000307896;ENST00000377627	D;D;D	0.97404	-4.37;-4.37;-4.37	5.1	5.1	0.69264	Zinc finger, C2CH-type (4);	0.000000	0.49305	D	0.000141	D	0.98438	0.9480	M	0.86805	2.84	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.983;0.983;0.99	D	0.99312	1.0904	10	0.87932	D	0	-23.0571	14.0088	0.64483	0.0:0.0:1.0:0.0	.	78;78;78	Q8WTV1-4;Q8WTV1-3;Q8WTV1	.;.;THAP3_HUMAN	M	78	ENSP00000054650:V78M;ENSP00000311537:V78M;ENSP00000366854:V78M	ENSP00000054650:V78M	V	+	1	0	THAP3	6611303	1.000000	0.71417	0.937000	0.37676	0.795000	0.44927	7.019000	0.76412	2.367000	0.80283	0.555000	0.69702	GTG		THAP3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004203.1	NM_138350	
VAMP3	9341	hgsc.bcm.edu	37	1	7837300	7837300	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:7837300C>T	ENST00000054666.6	+	3	268	c.153C>T	c.(151-153)gaC>gaT	p.D51D	RP3-467L1.6_ENST00000602406.1_RNA|VAMP3_ENST00000470357.1_Silent_p.D23D	NM_004781.3	NP_004772.1	Q15836	VAMP3_HUMAN	vesicle-associated membrane protein 3	51	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				calcium ion-dependent exocytosis (GO:0017156)|exocytosis (GO:0006887)|Golgi to plasma membrane protein transport (GO:0043001)|membrane fusion (GO:0061025)|positive regulation of receptor recycling (GO:0001921)|protein complex assembly (GO:0006461)|retrograde transport, endosome to Golgi (GO:0042147)|SNARE complex assembly (GO:0035493)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)|SNARE complex (GO:0031201)|synapse (GO:0045202)		p.D51D(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)	6	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;6.33e-69)|GBM - Glioblastoma multiforme(8;2.07e-34)|Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.38e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000805)|KIRC - Kidney renal clear cell carcinoma(229;0.000917)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)		ACCGTGCAGACGCACTGCAGG	0.468																																					p.D51D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C153T	1						.						90.0	87.0	88.0					1																	7837300		2203	4300	6503	7759887	SO:0001819	synonymous_variant	9341	exon3			BC003570	CCDS88.1	1p36.23	2013-02-13	2012-10-17		ENSG00000049245	ENSG00000049245		"""Vesicle-associated membrane proteins"""	12644	protein-coding gene	gene with protein product	"""cellubrevin"""	603657				9885218	Standard	NM_004781		Approved	CEB	uc001aol.3	Q15836	OTTHUMG00000001225	ENST00000054666.6:c.153C>T	1.37:g.7837300C>T		Somatic		Capture	SOLID	Phase_I	7759887	NM_004781	Q9BRV4	Silent	SNP	ENST00000054666.6	37	CCDS88.1																																																																																				VAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003625.1	NM_004781	
PER3	8863	hgsc.bcm.edu	37	1	7886635	7886635	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:7886635G>A	ENST00000361923.2	+	16	2204	c.2029G>A	c.(2029-2031)Gct>Act	p.A677T	PER3_ENST00000377532.3_Missense_Mutation_p.A685T|RP3-467L1.4_ENST00000451646.1_RNA	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	677	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.A677T(1)		breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		GCTCACAGCGGCTGTTCTGTC	0.517																																					p.A677T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2029A	1						.						63.0	57.0	59.0					1																	7886635		2203	4300	6503	7809222	SO:0001583	missense	8863	exon16			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2029G>A	1.37:g.7886635G>A	ENSP00000355031:p.Ala677Thr	Somatic		Capture	SOLID	Phase_I	7809222	NM_016831	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	37	CCDS89.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104313	0.76983	.	.	ENSG00000049246	ENST00000377532;ENST00000361923	T;T	0.10668	2.85;2.85	4.62	4.62	0.57501	.	0.122561	0.52532	D	0.000069	T	0.31071	0.0785	M	0.68593	2.085	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.74023	0.96;0.959;0.982;0.96	T	0.03576	-1.1023	10	0.48119	T	0.1	.	16.6475	0.85180	0.0:0.0:1.0:0.0	.	677;685;685;677	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	T	685;677	ENSP00000366755:A685T;ENSP00000355031:A677T	ENSP00000355031:A677T	A	+	1	0	PER3	7809222	1.000000	0.71417	0.004000	0.12327	0.037000	0.13140	7.404000	0.79996	2.391000	0.81399	0.655000	0.94253	GCT		PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
RERE	473	hgsc.bcm.edu	37	1	8716051	8716051	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:8716051A>G	ENST00000337907.3	-	3	940	c.306T>C	c.(304-306)gaT>gaC	p.D102D	RERE_ENST00000400907.2_Silent_p.D102D|RERE_ENST00000400908.2_Silent_p.D102D	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	102					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.D102D(1)		central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		TGTAGACCACATCATCTTCAG	0.423																																					p.D102D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T306C	1						.						237.0	213.0	221.0					1																	8716051		2203	4300	6503	8638638	SO:0001819	synonymous_variant	473	exon3			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.306T>C	1.37:g.8716051A>G		Somatic		Capture	SOLID	Phase_I	8638638	NM_012102	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Silent	SNP	ENST00000337907.3	37	CCDS95.1																																																																																				RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
MAN1C1	57134	hgsc.bcm.edu	37	1	26109126	26109126	+	Silent	SNP	C	C	T	rs150201998	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:26109126C>T	ENST00000374332.4	+	11	2031	c.1701C>T	c.(1699-1701)gaC>gaT	p.D567D	MAN1C1_ENST00000263979.3_Silent_p.D387D|MAN1C1_ENST00000374329.1_Silent_p.D338D	NM_020379.2	NP_065112.1	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1	567					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.D567D(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(7)|pancreas(1)|prostate(1)|skin(2)	25		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		GGATCCAAGACGTGTACAGTA	0.537													C|||	9	0.00179712	0.0	0.0	5008	,	,		20164	0.0		0.0	False		,,,				2504	0.0092				p.D567D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1701T	1						.	C		0,4406		0,0,2203	144.0	132.0	136.0		1701	-5.2	0.6	1	dbSNP_134	136	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	MAN1C1	NM_020379.2		0,4,6499	TT,TC,CC		0.0465,0.0,0.0308		567/631	26109126	4,13002	2203	4300	6503	25981713	SO:0001819	synonymous_variant	57134	exon11			AF261655	CCDS265.1	1p35	2008-02-05			ENSG00000117643	ENSG00000117643			19080	protein-coding gene	gene with protein product						10915796	Standard	XM_005245945		Approved	HMIC	uc001bkm.2	Q9NR34	OTTHUMG00000004417	ENST00000374332.4:c.1701C>T	1.37:g.26109126C>T		Somatic		Capture	SOLID	Phase_I	25981713	NM_020379	A6NNE2|B2RNP2|Q9Y545	Silent	SNP	ENST00000374332.4	37	CCDS265.1	.	.	.	.	.	.	.	.	.	.	C	8.775	0.926875	0.18056	0.0	4.65E-4	ENSG00000117643	ENST00000374331	.	.	.	5.0	-5.24	0.02789	.	.	.	.	.	T	0.70430	0.3223	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.76116	-0.3077	5	0.87932	D	0	.	15.8555	0.78975	0.0:0.3677:0.0:0.6323	.	.	.	.	C	387	.	ENSP00000363451:R387C	R	+	1	0	MAN1C1	25981713	0.001000	0.12720	0.649000	0.29536	0.808000	0.45660	-1.568000	0.02144	-1.037000	0.03283	-0.258000	0.10820	CGT		MAN1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012828.3	NM_020379	
ARID1A	8289	hgsc.bcm.edu	37	1	27101496	27101496	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:27101496G>T	ENST00000324856.7	+	18	5149	c.4778G>T	c.(4777-4779)cGg>cTg	p.R1593L	ARID1A_ENST00000540690.1_Intron|ARID1A_ENST00000457599.2_Missense_Mutation_p.R1376L|ARID1A_ENST00000374152.2_Missense_Mutation_p.R1210L	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1593					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.R1593L(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CCCCTGCCCCGGCCAATGGAG	0.592			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.R1593L			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4778T	1						.						72.0	72.0	72.0					1																	27101496		2203	4300	6503	26974083	SO:0001583	missense	8289	exon18			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4778G>T	1.37:g.27101496G>T	ENSP00000320485:p.Arg1593Leu	Somatic		Capture	SOLID	Phase_I	26974083	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.728202	0.69074	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	T;T;T	0.03272	4.2;4.1;3.99	5.0	4.04	0.47022	.	0.055900	0.64402	D	0.000001	T	0.08358	0.0208	M	0.66939	2.045	0.80722	D	1	P;P;P;P	0.52577	0.904;0.954;0.675;0.546	P;B;B;B	0.46510	0.519;0.41;0.324;0.173	T	0.02751	-1.1115	10	0.66056	D	0.02	-15.7355	13.9216	0.63935	0.0:0.151:0.8489:0.0	.	1210;1593;1376;1246	O14497-3;O14497;O14497-2;Q4LE49	.;ARI1A_HUMAN;.;.	L	1593;1376;1210	ENSP00000320485:R1593L;ENSP00000387636:R1376L;ENSP00000363267:R1210L	ENSP00000320485:R1593L	R	+	2	0	ARID1A	26974083	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.307000	0.78920	2.617000	0.88574	0.655000	0.94253	CGG		ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
SESN2	83667	hgsc.bcm.edu	37	1	28595715	28595715	+	Missense_Mutation	SNP	C	C	T	rs367784435		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:28595715C>T	ENST00000253063.3	+	2	433	c.112C>T	c.(112-114)Cgg>Tgg	p.R38W		NM_031459.4	NP_113647.1	P58004	SESN2_HUMAN	sestrin 2	38					autophagy (GO:0006914)|fatty acid beta-oxidation (GO:0006635)|glucose import (GO:0046323)|mitochondrial DNA metabolic process (GO:0032042)|protein kinase B signaling (GO:0043491)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of response to reactive oxygen species (GO:1901031)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R38W(1)		cervix(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	27		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		GAGCCGGGCTCGGCGAGGCCC	0.557																																					p.R38W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C112T	1						.						57.0	63.0	61.0					1																	28595715		2203	4300	6503	28468302	SO:0001583	missense	83667	exon2			AY123223	CCDS321.1	1p35.2	2008-02-05			ENSG00000130766	ENSG00000130766			20746	protein-coding gene	gene with protein product		607767				12607115, 12203114	Standard	NM_031459		Approved	SES2, DKFZp761M0212, HI95, SEST2	uc001bps.3	P58004	OTTHUMG00000003532	ENST00000253063.3:c.112C>T	1.37:g.28595715C>T	ENSP00000253063:p.Arg38Trp	Somatic		Capture	SOLID	Phase_I	28468302	NM_031459	Q5T7D0|Q96SI5	Missense_Mutation	SNP	ENST00000253063.3	37	CCDS321.1	.	.	.	.	.	.	.	.	.	.	C	15.10	2.732253	0.48939	.	.	ENSG00000130766	ENST00000253063	T	0.20069	2.1	5.38	3.51	0.40186	.	0.435275	0.25771	N	0.028401	T	0.10121	0.0248	N	0.08118	0	0.29249	N	0.872103	B	0.06786	0.001	B	0.01281	0.0	T	0.13308	-1.0514	10	0.38643	T	0.18	-13.795	8.1186	0.30957	0.0:0.7216:0.1309:0.1475	.	38	P58004	SESN2_HUMAN	W	38	ENSP00000253063:R38W	ENSP00000253063:R38W	R	+	1	2	SESN2	28468302	0.700000	0.27796	0.652000	0.29579	0.872000	0.50106	1.308000	0.33528	0.658000	0.30925	0.655000	0.94253	CGG		SESN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009840.1		
BAI2	576	hgsc.bcm.edu	37	1	32204200	32204200	+	Missense_Mutation	SNP	T	T	C	rs200047466		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:32204200T>C	ENST00000373658.3	-	17	2974	c.2633A>G	c.(2632-2634)gAc>gGc	p.D878G	BAI2_ENST00000398556.3_Missense_Mutation_p.D826G|BAI2_ENST00000440175.2_Missense_Mutation_p.D520G|BAI2_ENST00000398542.1_Missense_Mutation_p.D811G|BAI2_ENST00000398538.1_Missense_Mutation_p.D866G|BAI2_ENST00000373655.2_Missense_Mutation_p.D878G|BAI2_ENST00000465256.1_5'Flank|BAI2_ENST00000257070.4_Missense_Mutation_p.D878G|BAI2_ENST00000398547.1_Missense_Mutation_p.D811G|BAI2_ENST00000527361.1_Missense_Mutation_p.D878G	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	878	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.D878G(1)		breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		TCTGGAGTAGTCCCAGCTGGC	0.617																																					p.D878G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2633G	1						.						49.0	44.0	46.0					1																	32204200		2203	4300	6503	31976787	SO:0001583	missense	576	exon17			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.2633A>G	1.37:g.32204200T>C	ENSP00000362762:p.Asp878Gly	Somatic		Capture	SOLID	Phase_I	31976787	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	.	.	.	.	.	.	.	.	.	.	T	25.5	4.640516	0.87859	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538;ENST00000420125	T;T;T;T;T;T;T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64	4.93	4.93	0.64822	GPS domain (3);	0.336494	0.21695	N	0.070512	D	0.84813	0.5555	M	0.87456	2.885	0.48452	D	0.999657	P;D;B;P;B;D	0.69078	0.591;0.997;0.337;0.656;0.05;0.997	B;D;B;B;B;D	0.71870	0.399;0.957;0.232;0.317;0.094;0.975	D	0.87152	0.2209	10	0.72032	D	0.01	.	12.8567	0.57890	0.0:0.0:0.0:1.0	.	878;866;520;811;878;878	O60241-4;O60241-3;B4DKC3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	G	826;811;878;878;811;878;878;520;866;816	ENSP00000381564:D826G;ENSP00000381555:D811G;ENSP00000362762:D878G;ENSP00000362759:D878G;ENSP00000381550:D811G;ENSP00000257070:D878G;ENSP00000435397:D878G;ENSP00000391071:D520G;ENSP00000381548:D866G;ENSP00000410921:D816G	ENSP00000257070:D878G	D	-	2	0	BAI2	31976787	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.734000	0.38166	1.985000	0.57927	0.533000	0.62120	GAC		BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
EIF3I	8668	hgsc.bcm.edu	37	1	32692072	32692072	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:32692072C>A	ENST00000373586.1	+	6	541	c.469C>A	c.(469-471)Ctg>Atg	p.L157M	EIF3I_ENST00000471486.1_3'UTR	NM_003757.2	NP_003748.1			eukaryotic translation initiation factor 3, subunit I									p.L157M(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				TTGGGGACCCCTGGGGGAGTG	0.527																																					p.L157M	Colon(102;1138 2140 2180 17876)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C469A	1						.						192.0	199.0	196.0					1																	32692072		2203	4300	6503	32464659	SO:0001583	missense	8668	exon6			U39067	CCDS357.1	1p34.1	2013-01-10	2007-07-27	2007-07-27	ENSG00000084623	ENSG00000084623		"""WD repeat domain containing"""	3272	protein-coding gene	gene with protein product		603911	"""eukaryotic translation initiation factor 3, subunit 2 beta, 36kDa"""	EIF3S2		7566156, 8995409	Standard	NM_003757		Approved	TRIP-1, eIF3-beta, eIF3-p36, eIF3i	uc009vuc.3	Q13347	OTTHUMG00000007364	ENST00000373586.1:c.469C>A	1.37:g.32692072C>A	ENSP00000362688:p.Leu157Met	Somatic		Capture	SOLID	Phase_I	32464659	NM_003757		Missense_Mutation	SNP	ENST00000373586.1	37	CCDS357.1	.	.	.	.	.	.	.	.	.	.	c	13.81	2.348655	0.41599	.	.	ENSG00000084623	ENST00000373586	T	0.81415	-1.49	4.45	2.51	0.30379	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000001	T	0.74359	0.3706	L	0.54323	1.7	0.52099	D	0.999943	P	0.39326	0.668	B	0.38327	0.271	T	0.73379	-0.4001	10	0.45353	T	0.12	-31.2694	10.6802	0.45811	0.0:0.7685:0.0:0.2314	.	157	Q13347	EIF3I_HUMAN	M	157	ENSP00000362688:L157M	ENSP00000362688:L157M	L	+	1	2	EIF3I	32464659	0.980000	0.34600	0.997000	0.53966	0.971000	0.66376	2.469000	0.45110	0.991000	0.38814	0.457000	0.33378	CTG		EIF3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019282.2	NM_003757	
PHC2	1912	hgsc.bcm.edu	37	1	33820017	33820017	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:33820017G>A	ENST00000257118.5	-	8	1593	c.1540C>T	c.(1540-1542)Ccg>Tcg	p.P514S	RP11-415J8.5_ENST00000432703.1_RNA|PHC2_ENST00000373416.1_5'UTR|PHC2_ENST00000431992.1_Missense_Mutation_p.P485S|PHC2_ENST00000373422.3_Missense_Mutation_p.P120S|PHC2_ENST00000419414.2_Missense_Mutation_p.P515S	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	514					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.P514S(1)		autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GCTGGGGACGGCTGGATGTTA	0.607																																					p.P514S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1540T	1						.						100.0	90.0	93.0					1																	33820017		2203	4300	6503	33592604	SO:0001583	missense	1912	exon8			AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.1540C>T	1.37:g.33820017G>A	ENSP00000257118:p.Pro514Ser	Somatic		Capture	SOLID	Phase_I	33592604	NM_198040	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	ENST00000257118.5	37	CCDS378.1	.	.	.	.	.	.	.	.	.	.	G	5.145	0.212396	0.09757	.	.	ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000373422;ENST00000419414	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	5.82	4.91	0.64330	.	0.478290	0.21747	N	0.069728	T	0.27419	0.0673	N	0.19112	0.55	0.80722	D	1	B;B;B	0.12630	0.006;0.006;0.006	B;B;B	0.11329	0.006;0.006;0.006	T	0.04579	-1.0941	10	0.09843	T	0.71	1.8311	13.9825	0.64313	0.0789:0.0:0.9211:0.0	.	515;486;514	A8KA40;B7ZLY0;Q8IXK0	.;.;PHC2_HUMAN	S	485;514;120;515	ENSP00000389436:P485S;ENSP00000257118:P514S;ENSP00000362521:P120S;ENSP00000391440:P515S	ENSP00000257118:P514S	P	-	1	0	PHC2	33592604	1.000000	0.71417	0.998000	0.56505	0.912000	0.54170	3.238000	0.51352	0.821000	0.34540	-1.119000	0.02030	CCG		PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000011895.1	NM_198040	
CSMD2	114784	hgsc.bcm.edu	37	1	34128601	34128601	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:34128601G>A	ENST00000373380.1	-	5	983	c.763C>T	c.(763-765)Ctg>Ttg	p.L255L	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Silent_p.L1382L			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1342	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L1342L(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGGCCACTCAGCTCCTTCAGC	0.597																																					p.L1342L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4024T	1						.						97.0	90.0	92.0					1																	34128601		2203	4300	6503	33901188	SO:0001819	synonymous_variant	114784	exon26			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.763C>T	1.37:g.34128601G>A		Somatic		Capture	SOLID	Phase_I	33901188	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373380.1	37																																																																																					CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	
C1orf94	84970	hgsc.bcm.edu	37	1	34677981	34677981	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:34677981G>A	ENST00000488417.1	+	6	1815	c.1695G>A	c.(1693-1695)ccG>ccA	p.P565P	C1orf94_ENST00000373374.3_Silent_p.P375P	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	565								p.P375P(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				GAGATGGACCGCAGTACCTCT	0.567																																					p.P375P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1125A	1						.						72.0	63.0	66.0					1																	34677981		2203	4300	6503	34450568	SO:0001819	synonymous_variant	84970	exon6			AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.1695G>A	1.37:g.34677981G>A		Somatic		Capture	SOLID	Phase_I	34450568	NM_032884	B3KVT1|D3DPR3|E9PJ76|Q96IC8	Silent	SNP	ENST00000488417.1	37	CCDS44108.1																																																																																				C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036845.2	NM_032884	
THRAP3	9967	hgsc.bcm.edu	37	1	36755228	36755228	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:36755228T>C	ENST00000354618.5	+	5	1832	c.1608T>C	c.(1606-1608)ccT>ccC	p.P536P	THRAP3_ENST00000469141.2_Silent_p.P536P	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	536	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.P536P(1)		breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCTCATCACCTCCCCCAAGAA	0.517			T	USP6	aneurysmal bone cysts																																p.P536P	Pancreas(129;785 1795 20938 23278 32581)		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1608C	1						.						82.0	91.0	88.0					1																	36755228		2203	4300	6503	36527815	SO:0001819	synonymous_variant	9967	exon5			AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.1608T>C	1.37:g.36755228T>C		Somatic		Capture	SOLID	Phase_I	36527815	NM_005119	D3DPS5|Q5VTK6	Silent	SNP	ENST00000354618.5	37	CCDS405.1																																																																																				THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119	
MACF1	23499	hgsc.bcm.edu	37	1	39851499	39851499	+	Missense_Mutation	SNP	G	G	A	rs148218837		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:39851499G>A	ENST00000372915.3	+	56	14344	c.14257G>A	c.(14257-14259)Gat>Aat	p.D4753N	MACF1_ENST00000564288.1_Missense_Mutation_p.D4748N|MACF1_ENST00000545844.1_Missense_Mutation_p.D2686N|MACF1_ENST00000361689.2_Missense_Mutation_p.D2686N|MACF1_ENST00000567887.1_Missense_Mutation_p.D4785N|MACF1_ENST00000289893.4_Missense_Mutation_p.D3188N|MACF1_ENST00000539005.1_Missense_Mutation_p.D2665N|MACF1_ENST00000317713.7_Missense_Mutation_p.D2686N			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4753					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.D3188N(1)|p.D2686N(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GACACTGTGCGATGAACTCTC	0.498																																					p.D2686N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G8056A	1						.						119.0	109.0	113.0					1																	39851499		2203	4300	6503	39624086	SO:0001583	missense	23499	exon53			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.14257G>A	1.37:g.39851499G>A	ENSP00000362006:p.Asp4753Asn	Somatic		Capture	SOLID	Phase_I	39624086	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.25|10.25	1.299325|1.299325	0.23650|0.23650	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.35048|.	1.33;1.33;1.33;1.33;1.33;1.33|.	6.06|6.06	0.978|0.978	0.19740|0.19740	.|.	0.401806|.	0.23307|.	N|.	0.049608|.	T|T	0.24353|0.24353	0.0590|0.0590	L|L	0.27053|0.27053	0.805|0.805	0.21527|0.21527	N|N	0.999654|0.999654	B;B;B|.	0.17038|.	0.015;0.02;0.012|.	B;B;B|.	0.15484|.	0.013;0.009;0.009|.	T|T	0.25641|0.25641	-1.0126|-1.0126	10|5	0.26408|.	T|.	0.33|.	.|.	6.3059|6.3059	0.21139|0.21139	0.3081:0.1222:0.5698:0.0|0.3081:0.1222:0.5698:0.0	.|.	4753;2686;2630|.	Q9UPN3;F8W8Q1;Q9UPN3-3|.	MACF1_HUMAN;.;.|.	N|Q	2686;4753;2686;2686;2665;3188|1798	ENSP00000439537:D2686N;ENSP00000362006:D4753N;ENSP00000354573:D2686N;ENSP00000313438:D2686N;ENSP00000444364:D2665N;ENSP00000289893:D3188N|.	ENSP00000289893:D3188N|.	D|R	+|+	1|2	0|0	MACF1|MACF1	39624086|39624086	0.001000|0.001000	0.12720|0.12720	0.114000|0.114000	0.21550|0.21550	0.937000|0.937000	0.57800|0.57800	-0.058000|-0.058000	0.11750|0.11750	-0.056000|-0.056000	0.13221|0.13221	0.655000|0.655000	0.94253|0.94253	GAT|CGA		MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
MACF1	23499	hgsc.bcm.edu	37	1	39853872	39853872	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:39853872G>T	ENST00000372915.3	+	57	15460	c.15373G>T	c.(15373-15375)Ggg>Tgg	p.G5125W	MACF1_ENST00000564288.1_Missense_Mutation_p.G5120W|MACF1_ENST00000545844.1_Missense_Mutation_p.G3058W|MACF1_ENST00000361689.2_Missense_Mutation_p.G3058W|MACF1_ENST00000567887.1_Missense_Mutation_p.G5157W|MACF1_ENST00000289893.4_Missense_Mutation_p.G3560W|MACF1_ENST00000539005.1_Missense_Mutation_p.G3037W|MACF1_ENST00000317713.7_Missense_Mutation_p.G3058W			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5125					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.G3560W(1)|p.G3058W(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAAGCTGGAGGGGATTGGCCA	0.507																																					p.G3058W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G9172T	1						.						110.0	96.0	100.0					1																	39853872		2203	4300	6503	39626459	SO:0001583	missense	23499	exon54			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.15373G>T	1.37:g.39853872G>T	ENSP00000362006:p.Gly5125Trp	Somatic		Capture	SOLID	Phase_I	39626459	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.4|20.4	3.978450|3.978450	0.74360|0.74360	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000372925|ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	.|T;T;T;T;T;T	.|0.35236	.|1.32;1.32;1.32;1.32;1.32;1.32	5.9|5.9	5.9|5.9	0.94986|0.94986	.|.	0.000000|0.000000	0.64402|0.64402	D|D	0.000005|0.000005	T|T	0.63129|0.63129	0.2485|0.2485	M|M	0.70595|0.70595	2.14|2.14	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	T|T	0.63598|0.63598	-0.6601|-0.6601	6|10	.|0.87932	.|D	.|0	.|.	20.2723|20.2723	0.98479|0.98479	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|5125;3058;3002	.|Q9UPN3;F8W8Q1;Q9UPN3-3	.|MACF1_HUMAN;.;.	V|W	2170|3058;5125;3058;3058;3037;3560	.|ENSP00000439537:G3058W;ENSP00000362006:G5125W;ENSP00000354573:G3058W;ENSP00000313438:G3058W;ENSP00000444364:G3037W;ENSP00000289893:G3560W	.|ENSP00000289893:G3560W	G|G	+|+	2|1	0|0	MACF1|MACF1	39626459|39626459	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.987000|0.987000	0.75469|0.75469	9.869000|9.869000	0.99810|0.99810	2.793000|2.793000	0.96121|0.96121	0.563000|0.563000	0.77884|0.77884	GGG|GGG		MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
MACF1	23499	hgsc.bcm.edu	37	1	39888438	39888438	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:39888438T>C	ENST00000372915.3	+	59	16117	c.16030T>C	c.(16030-16032)Ttg>Ctg	p.L5344L	MACF1_ENST00000564288.1_Silent_p.L5339L|MACF1_ENST00000545844.1_Silent_p.L3277L|MACF1_ENST00000361689.2_Silent_p.L3277L|MACF1_ENST00000567887.1_Silent_p.L5376L|MACF1_ENST00000289893.4_Silent_p.L3779L|MACF1_ENST00000539005.1_Silent_p.L3256L|MACF1_ENST00000317713.7_Silent_p.L3277L			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5344					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.L3779L(1)|p.L3277L(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGAAGCTTTGTTGCATTGTGG	0.443																																					p.L3277L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T9829C	1						.						139.0	129.0	132.0					1																	39888438		2203	4300	6503	39661025	SO:0001819	synonymous_variant	23499	exon56			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.16030T>C	1.37:g.39888438T>C		Somatic		Capture	SOLID	Phase_I	39661025	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	T	8.258	0.810623	0.16537	.	.	ENSG00000127603	ENST00000372925	.	.	.	5.84	4.72	0.59763	.	.	.	.	.	T	0.59432	0.2193	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56245	-0.8011	4	.	.	.	.	8.7454	0.34583	0.0:0.209:0.0:0.791	.	.	.	.	A	2389	.	.	V	+	2	0	MACF1	39661025	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	1.433000	0.34947	1.043000	0.40175	0.528000	0.53228	GTT		MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
KCNQ4	9132	hgsc.bcm.edu	37	1	41285616	41285616	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:41285616G>T	ENST00000347132.5	+	6	986	c.904G>T	c.(904-906)Ggc>Tgc	p.G302C	KCNQ4_ENST00000509682.2_Missense_Mutation_p.G302C|KCNQ4_ENST00000506017.1_3'UTR	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	302					inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)	p.G302C(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	CCTGGCTGCTGGCTTCGCCTT	0.587																																					p.G302C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G904T	1						.						135.0	131.0	132.0					1																	41285616		2203	4300	6503	41058203	SO:0001583	missense	9132	exon6			AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.904G>T	1.37:g.41285616G>T	ENSP00000262916:p.Gly302Cys	Somatic		Capture	SOLID	Phase_I	41058203	NM_004700	O96025	Missense_Mutation	SNP	ENST00000347132.5	37	CCDS456.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.93|16.93	3.258677|3.258677	0.59321|0.59321	.|.	.|.	ENSG00000117013|ENSG00000117013	ENST00000347132;ENST00000509682|ENST00000443478	D;D|.	0.98437|.	-4.93;-4.93|.	5.71|5.71	5.71|5.71	0.89125|0.89125	Ion transport (1);|.	0.105719|.	0.64402|.	D|.	0.000005|.	T|T	0.57286|0.57286	0.2043|0.2043	L|L	0.31120|0.31120	0.905|0.905	0.80722|0.80722	D|D	1|1	B;P|.	0.42357|.	0.008;0.777|.	B;B|.	0.42738|.	0.023;0.396|.	T|T	0.50964|0.50964	-0.8765|-0.8765	10|5	0.45353|.	T|.	0.12|.	-29.7026|-29.7026	17.3353|17.3353	0.87278|0.87278	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	302;302|.	P56696-2;P56696|.	.;KCNQ4_HUMAN|.	C|L	302|197	ENSP00000262916:G302C;ENSP00000423756:G302C|.	ENSP00000262916:G302C|.	G|W	+|+	1|2	0|0	KCNQ4|KCNQ4	41058203|41058203	0.996000|0.996000	0.38824|0.38824	0.990000|0.990000	0.47175|0.47175	0.998000|0.998000	0.95712|0.95712	2.349000|2.349000	0.44054|0.44054	2.700000|2.700000	0.92200|0.92200	0.655000|0.655000	0.94253|0.94253	GGC|TGG		KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000020812.1	NM_004700	
PTPRF	5792	hgsc.bcm.edu	37	1	44064521	44064521	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:44064521G>A	ENST00000359947.4	+	13	2590	c.2250G>A	c.(2248-2250)cgG>cgA	p.R750R	PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000422171.2_Silent_p.R107R|PTPRF_ENST00000438120.1_Silent_p.R750R|PTPRF_ENST00000372413.3_Silent_p.R750R|PTPRF_ENST00000372414.3_Silent_p.R750R	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	750	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R740R(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCTACGTGCGGCTGGAGAATG	0.632																																					p.R750R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2250A	1						.						67.0	57.0	60.0					1																	44064521		2203	4300	6503	43837108	SO:0001819	synonymous_variant	5792	exon13			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.2250G>A	1.37:g.44064521G>A		Somatic		Capture	SOLID	Phase_I	43837108	NM_130440	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Silent	SNP	ENST00000359947.4	37	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.30|10.30	1.312173|1.312173	0.23908|0.23908	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000412568;ENST00000414879|ENST00000429895	.|.	.|.	.|.	4.35|4.35	2.4|2.4	0.29515|0.29515	.|.	.|.	.|.	.|.	.|.	T|T	0.54415|0.54415	0.1857|0.1857	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.48536|0.48536	-0.9027|-0.9027	4|4	.|.	.|.	.|.	.|.	6.3239|6.3239	0.21232|0.21232	0.1666:0.0:0.6854:0.148|0.1666:0.0:0.6854:0.148	.|.	.|.	.|.	.|.	T|D	316;173|407	.|.	.|.	A|G	+|+	1|2	0|0	PTPRF|PTPRF	43837108|43837108	0.831000|0.831000	0.29352|0.29352	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	0.150000|0.150000	0.16263|0.16263	0.955000|0.955000	0.37878|0.37878	0.449000|0.449000	0.29647|0.29647	GCT|GGC		PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
PTCH2	8643	hgsc.bcm.edu	37	1	45288982	45288982	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:45288982C>T	ENST00000372192.3	-	20	3320	c.3190G>A	c.(3190-3192)Gat>Aat	p.D1064N	PTCH2_ENST00000447098.2_Missense_Mutation_p.D1064N	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	1064					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)	p.D1064N(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					ATGGCCCCATCGGTCACGGGG	0.622									Basal Cell Nevus syndrome																												p.D1064N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3190A	1						.						66.0	65.0	66.0					1																	45288982		2203	4300	6503	45061569	SO:0001583	missense	8643	exon20	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.3190G>A	1.37:g.45288982C>T	ENSP00000361266:p.Asp1064Asn	Somatic		Capture	SOLID	Phase_I	45061569	NM_001166292	O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	ENST00000372192.3	37	CCDS516.1	.	.	.	.	.	.	.	.	.	.	c	21.1	4.101388	0.76983	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.85258	-1.96;-1.96	4.32	4.32	0.51571	.	0.128957	0.34986	N	0.003527	D	0.87208	0.6120	L	0.35414	1.06	0.58432	D	0.999999	P;D	0.65815	0.88;0.995	P;D	0.64687	0.521;0.928	D	0.86147	0.1585	9	.	.	.	-22.7774	16.9784	0.86320	0.0:1.0:0.0:0.0	.	1064;1064	Q9Y6C5-2;Q9Y6C5	.;PTC2_HUMAN	N	1064	ENSP00000389703:D1064N;ENSP00000361266:D1064N	.	D	-	1	0	PTCH2	45061569	1.000000	0.71417	0.885000	0.34714	0.447000	0.32167	7.186000	0.77722	2.398000	0.81561	0.479000	0.44913	GAT		PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4	NM_003738	
LRRC41	10489	hgsc.bcm.edu	37	1	46751360	46751360	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:46751360C>T	ENST00000343304.6	-	4	1454	c.1169G>A	c.(1168-1170)cGt>cAt	p.R390H	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	390					protein ubiquitination (GO:0016567)	membrane (GO:0016020)		p.R390H(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					TCGCTTGAAACGCTTTAGGGG	0.567																																					p.R390H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1169A	1						.						78.0	83.0	81.0					1																	46751360		2203	4300	6503	46523947	SO:0001583	missense	10489	exon4			AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.1169G>A	1.37:g.46751360C>T	ENSP00000343298:p.Arg390His	Somatic		Capture	SOLID	Phase_I	46523947	NM_006369	A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Missense_Mutation	SNP	ENST00000343304.6	37	CCDS533.1	.	.	.	.	.	.	.	.	.	.	c	21.1	4.101274	0.76983	.	.	ENSG00000132128	ENST00000343304;ENST00000371972	T	0.53857	0.6	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000006	T	0.56790	0.2009	N	0.24115	0.695	0.36887	D	0.889672	D;D;D	0.76494	0.999;0.999;0.998	P;P;P	0.60236	0.818;0.871;0.706	T	0.66292	-0.5960	10	0.87932	D	0	-1.0368	16.3086	0.82859	0.0:1.0:0.0:0.0	.	390;368;390	Q15345-3;E9PE58;Q15345	.;.;LRC41_HUMAN	H	390;368	ENSP00000343298:R390H	ENSP00000343298:R390H	R	-	2	0	LRRC41	46523947	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.970000	0.40520	2.611000	0.88343	0.450000	0.29827	CGT		LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021438.1	NM_006369	
FAF1	11124	hgsc.bcm.edu	37	1	51210408	51210408	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:51210408G>T	ENST00000396153.2	-	5	858	c.407C>A	c.(406-408)cCt>cAt	p.P136H	FAF1_ENST00000371778.4_Missense_Mutation_p.P136H	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	136					apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.0?(2)|p.P136H(1)		breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		TTTGGACACAGGTATCTGAAG	0.318																																					p.P136H												.	.	3	Whole gene deletion(2)|Substitution - Missense(1)	thyroid(1)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.C407A	1						.						141.0	137.0	138.0					1																	51210408		2203	4299	6502	50982996	SO:0001583	missense	11124	exon5			AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.407C>A	1.37:g.51210408G>T	ENSP00000379457:p.Pro136His	Somatic		Capture	SOLID	Phase_I	50982996	NM_007051	Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Missense_Mutation	SNP	ENST00000396153.2	37	CCDS554.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.565805	0.86439	.	.	ENSG00000185104	ENST00000396153;ENST00000371778;ENST00000371780;ENST00000543607	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.62792	0.2457	L	0.58101	1.795	0.80722	D	1	P	0.49696	0.927	P	0.45946	0.498	T	0.66850	-0.5819	9	0.87932	D	0	-8.0991	18.9445	0.92616	0.0:0.0:1.0:0.0	.	136	Q9UNN5	FAF1_HUMAN	H	136;136;128;136	.	ENSP00000360843:P136H	P	-	2	0	FAF1	50982996	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.089000	0.89525	2.768000	0.95171	0.655000	0.94253	CCT		FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021807.1	NM_007051	
CYP2J2	1573	hgsc.bcm.edu	37	1	60373596	60373596	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:60373596T>A	ENST00000371204.3	-	6	908	c.865A>T	c.(865-867)Aca>Tca	p.T289S	CYP2J2_ENST00000492633.1_5'UTR	NM_000775.2	NP_000766.2	P51589	CP2J2_HUMAN	cytochrome P450, family 2, subfamily J, polypeptide 2	289					arachidonic acid metabolic process (GO:0019369)|epoxygenase P450 pathway (GO:0019373)|icosanoid metabolic process (GO:0006690)|linoleic acid metabolic process (GO:0043651)|regulation of heart contraction (GO:0008016)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	arachidonic acid 11,12-epoxygenase activity (GO:0008405)|arachidonic acid 14,15-epoxygenase activity (GO:0008404)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|linoleic acid epoxygenase activity (GO:0071614)	p.T289S(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|skin(1)	26	all_cancers(7;0.000396)				Apixaban(DB06605)|Astemizole(DB00637)|Cholecalciferol(DB00169)|Levomilnacipran(DB08918)|Masoprocol(DB00179)|Rivaroxaban(DB06228)	GGATTGCCTGTGTGCTAGAAA	0.443																																					p.T289S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A865T	1						.						144.0	137.0	139.0					1																	60373596		2203	4300	6503	60146184	SO:0001583	missense	1573	exon6			BC032594	CCDS613.1	1p31.3-p31.2	2008-02-05	2003-01-14		ENSG00000134716	ENSG00000134716		"""Cytochrome P450s"""	2634	protein-coding gene	gene with protein product		601258	"""cytochrome P450, subfamily IIJ (arachidonic acid epoxygenase) polypeptide 2"""			9570962	Standard	NM_000775		Approved		uc001czq.3	P51589	OTTHUMG00000008991	ENST00000371204.3:c.865A>T	1.37:g.60373596T>A	ENSP00000360247:p.Thr289Ser	Somatic		Capture	SOLID	Phase_I	60146184	NM_000775	B2RD33|Q8TF13	Missense_Mutation	SNP	ENST00000371204.3	37	CCDS613.1	.	.	.	.	.	.	.	.	.	.	T	10.40	1.340711	0.24339	.	.	ENSG00000134716	ENST00000371204	T	0.78707	-1.2	5.68	-1.7	0.08159	.	1.969230	0.02007	N	0.046714	T	0.51719	0.1691	N	0.02379	-0.575	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.42766	-0.9432	10	0.51188	T	0.08	.	2.0892	0.03653	0.2336:0.0731:0.2866:0.4066	.	289	P51589	CP2J2_HUMAN	S	289	ENSP00000360247:T289S	ENSP00000360247:T289S	T	-	1	0	CYP2J2	60146184	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.043000	0.12043	-0.588000	0.05882	-0.376000	0.06991	ACA		CYP2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024940.1	NM_000775	
DOCK7	85440	hgsc.bcm.edu	37	1	62995045	62995045	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:62995045C>T	ENST00000340370.5	-	29	3608	c.3591G>A	c.(3589-3591)cgG>cgA	p.R1197R	DOCK7_ENST00000251157.5_Silent_p.R1228R	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1228					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)	p.R1197R(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						GGTCAGAGTACCGCGGGTCTG	0.403																																					p.R1197R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3591A	1						.						107.0	101.0	103.0					1																	62995045		2203	4300	6503	62767633	SO:0001819	synonymous_variant	85440	exon29				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.3591G>A	1.37:g.62995045C>T		Somatic		Capture	SOLID	Phase_I	62767633	NM_033407	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Silent	SNP	ENST00000340370.5	37	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	C	9.399	1.077514	0.20227	.	.	ENSG00000116641	ENST00000454575	.	.	.	5.84	4.91	0.64330	.	.	.	.	.	T	0.72906	0.3519	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72818	-0.4178	4	.	.	.	.	16.7412	0.85460	0.0:0.8707:0.1293:0.0	.	.	.	.	I	400	.	.	V	-	1	0	DOCK7	62767633	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.953000	0.40352	1.402000	0.46780	0.591000	0.81541	GTA		DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
PDE4B	5142	hgsc.bcm.edu	37	1	66458709	66458709	+	Intron	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:66458709T>C	ENST00000329654.4	+	3	468				PDE4B_ENST00000371049.3_Intron|PDE4B_ENST00000423207.2_Silent_p.P40P	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific						cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.P40P(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	GAAACAGACCTACATCTCCTA	0.433																																					p.P40P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T120C	1						.						106.0	101.0	103.0					1																	66458709		2203	4300	6503	66231297	SO:0001627	intron_variant	5142	exon1			L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.281+74191T>C	1.37:g.66458709T>C		Somatic		Capture	SOLID	Phase_I	66231297	NM_001037340	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Silent	SNP	ENST00000329654.4	37	CCDS632.1																																																																																				PDE4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025188.3	NM_002600	
NEGR1	257194	hgsc.bcm.edu	37	1	72163820	72163820	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:72163820T>G	ENST00000357731.5	-	4	777	c.538A>C	c.(538-540)Aaa>Caa	p.K180Q	NEGR1_ENST00000306821.3_Missense_Mutation_p.K52Q|NEGR1_ENST00000467479.1_5'UTR|NEGR1_ENST00000434200.1_Intron	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	180	Ig-like C2-type 2.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.K180Q(1)		endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		TCAAATGGTTTTGCTATAAAA	0.373																																					p.K180Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A538C	1						.						78.0	75.0	76.0					1																	72163820		2203	4300	6503	71936408	SO:0001583	missense	257194	exon4			AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.538A>C	1.37:g.72163820T>G	ENSP00000350364:p.Lys180Gln	Somatic		Capture	SOLID	Phase_I	71936408	NM_173808	Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	ENST00000357731.5	37	CCDS661.1	.	.	.	.	.	.	.	.	.	.	T	13.93	2.384427	0.42308	.	.	ENSG00000172260	ENST00000357731;ENST00000306821	T;T	0.67865	-0.29;-0.29	5.74	5.74	0.90152	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.045819	0.85682	D	0.000000	T	0.32102	0.0818	N	0.12663	0.25	0.80722	D	1	B	0.22604	0.072	B	0.25987	0.065	T	0.30149	-0.9988	10	0.12430	T	0.62	-14.5636	15.6872	0.77421	0.0:0.0:0.0:1.0	.	180	Q7Z3B1	NEGR1_HUMAN	Q	180;52	ENSP00000350364:K180Q;ENSP00000305938:K52Q	ENSP00000305938:K52Q	K	-	1	0	NEGR1	71936408	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.425000	0.44723	2.187000	0.69744	0.482000	0.46254	AAA		NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026722.4	NM_173808	
FPGT	8790	hgsc.bcm.edu	37	1	74670226	74670226	+	Silent	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:74670226C>A	ENST00000609362.1	+	4	532	c.495C>A	c.(493-495)acC>acA	p.T165T	FPGT_ENST00000370894.5_Intron|FPGT_ENST00000467578.2_3'UTR|FPGT_ENST00000524915.1_Intron|FPGT-TNNI3K_ENST00000533006.1_Intron|TNNI3K_ENST00000370891.2_Intron|FPGT-TNNI3K_ENST00000370895.1_Intron|FPGT-TNNI3K_ENST00000557284.2_Intron|FPGT_ENST00000534056.1_Intron|FPGT-TNNI3K_ENST00000370899.3_Intron|FPGT-TNNI3K_ENST00000370893.1_Intron|FPGT_ENST00000370898.3_Silent_p.T178T	NM_003838.4	NP_003829.3	O14772	FPGT_HUMAN	fucose-1-phosphate guanylyltransferase	165					fucose metabolic process (GO:0006004)	cytoplasm (GO:0005737)	catalytic activity (GO:0003824)|fucose-1-phosphate guanylyltransferase activity (GO:0047341)|GTP binding (GO:0005525)	p.T165T(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	39						TTCTGGTTACCTGTGCAGATG	0.363																																					p.T165T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C495A	1						.						109.0	109.0	109.0					1																	74670226		2203	4300	6503	74442814	SO:0001819	synonymous_variant	8790	exon4			AF017445	CCDS663.1, CCDS663.2	1p31.1	2013-09-24			ENSG00000254685	ENSG00000254685	2.7.7.30		3825	protein-coding gene	gene with protein product		603609				9804772	Standard	NM_003838		Approved	GFPP		O14772	OTTHUMG00000009571	ENST00000609362.1:c.495C>A	1.37:g.74670226C>A		Somatic		Capture	SOLID	Phase_I	74442814	NM_003838	A6NMH3|B4DRX2|B4E2Y7|E9PNQ2|Q8N5J7	Silent	SNP	ENST00000609362.1	37	CCDS663.1																																																																																				FPGT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ERICH3	127254	hgsc.bcm.edu	37	1	75072514	75072514	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:75072514T>C	ENST00000326665.5	-	10	1478	c.1260A>G	c.(1258-1260)aaA>aaG	p.K420K	C1orf173_ENST00000420661.2_Silent_p.K223K|RP4-612J11.1_ENST00000416017.1_RNA	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		420	Glu-rich.							p.K420K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						GTTCCTCTCCTTTCTCAGTGC	0.403																																					p.K420K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1260G	1						.						131.0	126.0	128.0					1																	75072514		2203	4299	6502	74845102	SO:0001819	synonymous_variant	127254	exon10																														ENST00000326665.5:c.1260A>G	1.37:g.75072514T>C		Somatic		Capture	SOLID	Phase_I	74845102	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	ENST00000326665.5	37	CCDS30755.1																																																																																				C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
PTGFR	5737	hgsc.bcm.edu	37	1	78958519	78958519	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:78958519T>A	ENST00000370757.3	+	2	328	c.91T>A	c.(91-93)Ttt>Att	p.F31I	PTGFR_ENST00000370756.3_Missense_Mutation_p.F31I|PTGFR_ENST00000370758.1_Missense_Mutation_p.F31I	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	31					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)			breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	GCTTTCCGTATTTTTTTCAGT	0.453																																					p.F31I												.	.	0			c.T91A	1						.						82.0	85.0	84.0					1																	78958519		2203	4300	6503	78731107	SO:0001583	missense	5737	exon2			AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.91T>A	1.37:g.78958519T>A	ENSP00000359793:p.Phe31Ile	Somatic		Capture	SOLID	Phase_I	78731107	NM_000959	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	37	CCDS686.1	.	.	.	.	.	.	.	.	.	.	T	8.728	0.916003	0.17907	.	.	ENSG00000122420	ENST00000370758;ENST00000370757;ENST00000370756	T;T;T	0.34667	1.35;1.35;1.35	5.55	5.55	0.83447	.	0.575741	0.19849	N	0.104687	T	0.17831	0.0428	L	0.50333	1.59	0.27405	N	0.954736	B;B	0.31077	0.062;0.307	B;B	0.30572	0.022;0.117	T	0.12243	-1.0555	10	0.18276	T	0.48	-11.1575	16.0049	0.80354	0.0:0.0:0.0:1.0	.	31;31	P43088;P43088-2	PF2R_HUMAN;.	I	31	ENSP00000359794:F31I;ENSP00000359793:F31I;ENSP00000359792:F31I	ENSP00000359792:F31I	F	+	1	0	PTGFR	78731107	1.000000	0.71417	0.800000	0.32199	0.347000	0.29111	4.520000	0.60524	2.243000	0.73865	0.533000	0.62120	TTT		PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959	
LPHN2	23266	hgsc.bcm.edu	37	1	82436147	82436147	+	Silent	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:82436147T>G	ENST00000370728.1	+	18	3516	c.2871T>G	c.(2869-2871)ggT>ggG	p.G957G	LPHN2_ENST00000370725.1_Silent_p.G957G|LPHN2_ENST00000370717.2_Silent_p.G957G|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370727.1_Silent_p.G957G|LPHN2_ENST00000370715.1_Silent_p.G944G|LPHN2_ENST00000370713.1_Silent_p.G944G|LPHN2_ENST00000370730.1_Silent_p.G957G|LPHN2_ENST00000370721.1_Silent_p.G882G|LPHN2_ENST00000359929.3_Silent_p.G944G|LPHN2_ENST00000394879.1_Silent_p.G944G|LPHN2_ENST00000370723.1_Silent_p.G944G|LPHN2_ENST00000271029.4_Silent_p.G957G|LPHN2_ENST00000319517.6_Silent_p.G944G|LPHN2_ENST00000335786.5_Silent_p.G957G			O95490	LPHN2_HUMAN	latrophilin 2	957					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)	p.G944G(1)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		ATGTTGCTGGTTACTTGTTTC	0.388																																					p.G944G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2832G	1						.						114.0	114.0	114.0					1																	82436147		2203	4300	6503	82208735	SO:0001819	synonymous_variant	23266	exon14			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.2871T>G	1.37:g.82436147T>G		Somatic		Capture	SOLID	Phase_I	82208735	NM_012302	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Silent	SNP	ENST00000370728.1	37		.	.	.	.	.	.	.	.	.	.	T	6.370	0.436378	0.12104	.	.	ENSG00000117114	ENST00000449420	.	.	.	5.73	-1.29	0.09288	.	.	.	.	.	T	0.36991	0.0987	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34104	-0.9842	4	.	.	.	.	7.7415	0.28843	0.0:0.3771:0.1183:0.5046	.	.	.	.	G	825	.	.	V	+	2	0	LPHN2	82208735	0.970000	0.33590	0.997000	0.53966	0.993000	0.82548	0.121000	0.15667	-0.110000	0.12022	-0.326000	0.08463	GTT		LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302	
GCSAML	148823	hgsc.bcm.edu	37	1	247712502	247712502	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr1:247712502T>A	ENST00000366488.4	+	1	113	c.9T>A	c.(7-9)aaT>aaA	p.N3K	GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000366491.2_Missense_Mutation_p.N3K|GCSAML_ENST00000366490.3_Missense_Mutation_p.I124N|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000366489.1_Missense_Mutation_p.N3K|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000536561.1_Missense_Mutation_p.N3K	NM_001281836.1|NM_001281837.1|NM_001281853.1|NM_145278.3	NP_001268765.1|NP_001268766.1|NP_001268782.1|NP_660321.1	Q5JQS6	GSAML_HUMAN	germinal center-associated, signaling and motility-like	3								p.N3K(1)									AGATGGGAAATTATCTCCTGC	0.468																																					p.N3K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T9A	1						.						102.0	93.0	96.0					1																	247712502		2203	4300	6503	245779125	SO:0001583	missense	148823	exon1			AK126682	CCDS1635.1, CCDS60470.1, CCDS73058.1	1q44	2012-08-23	2012-08-23	2012-08-23	ENSG00000169224	ENSG00000169224			29583	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 150"""	C1orf150			Standard	NM_001281834		Approved	FLJ44728	uc001idf.3	Q5JQS6	OTTHUMG00000040648	ENST00000366488.4:c.9T>A	1.37:g.247712502T>A	ENSP00000355444:p.Asn3Lys	Somatic		Capture	SOLID	Phase_I	245779125	NM_145278	B2R4Y5|B3KX46|Q5JQT3	Missense_Mutation	SNP	ENST00000366488.4	37	CCDS1635.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.85|16.85	3.235510|3.235510	0.58886|0.58886	.|.	.|.	ENSG00000169224|ENSG00000169224	ENST00000366490|ENST00000366491;ENST00000366489;ENST00000526896;ENST00000366488;ENST00000536561	.|.	.|.	.|.	3.41|3.41	0.196|0.196	0.15159|0.15159	.|.	.|.	.|.	.|.	.|.	T|T	0.36524|0.36524	0.0970|0.0970	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.83275	.|0.996	T|T	0.18967|0.18967	-1.0320|-1.0320	6|8	0.87932|0.87932	D|D	0|0	-13.0289|-13.0289	5.4039|5.4039	0.16310|0.16310	0.0:0.3651:0.0:0.6349|0.0:0.3651:0.0:0.6349	.|.	.|3	.|Q5JQS6	.|CA150_HUMAN	N|K	124|3	.|.	ENSP00000355446:I124N|ENSP00000355444:N3K	I|N	+|+	2|3	0|2	C1orf150|C1orf150	245779125|245779125	0.552000|0.552000	0.26505|0.26505	0.028000|0.028000	0.17463|0.17463	0.958000|0.958000	0.62258|0.62258	0.720000|0.720000	0.25896|0.25896	0.024000|0.024000	0.15214|0.15214	0.482000|0.482000	0.46254|0.46254	ATT|AAT		GCSAML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097745.4	NM_145278	
RNF141	50862	hgsc.bcm.edu	37	11	10540639	10540639	+	Missense_Mutation	SNP	G	G	A	rs200883825		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:10540639G>A	ENST00000265981.2	-	5	626	c.484C>T	c.(484-486)Cgg>Tgg	p.R162W	RNF141_ENST00000528665.1_Missense_Mutation_p.R162W	NM_016422.3	NP_057506.2	Q8WVD5	RN141_HUMAN	ring finger protein 141	162					protein autoubiquitination (GO:0051865)|regulation of transcription, DNA-templated (GO:0006355)		DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R162W(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(3)|urinary_tract(1)	9				all cancers(16;4.63e-08)|Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.064)		AGGTCAGCCCGCCCATCCATA	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		17759	0.001		0.0	False		,,,				2504	0.0				p.R162W	Ovarian(8;377 410 25844 26058 41491)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C484T	11						.						156.0	122.0	133.0					11																	10540639		2201	4294	6495	10497215	SO:0001583	missense	50862	exon5			AF214680	CCDS7803.1	11p15.3	2013-01-09			ENSG00000110315	ENSG00000110315		"""RING-type (C3HC4) zinc fingers"""	21159	protein-coding gene	gene with protein product						11672448	Standard	NM_016422		Approved	ZFP26, ZNF230	uc001mis.1	Q8WVD5		ENST00000265981.2:c.484C>T	11.37:g.10540639G>A	ENSP00000265981:p.Arg162Trp	Somatic		Capture	SOLID	Phase_I	10497215	NM_016422	A8K149|Q9NZB4	Missense_Mutation	SNP	ENST00000265981.2	37	CCDS7803.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	23.2	4.390862	0.82902	.	.	ENSG00000110315	ENST00000265981;ENST00000528665;ENST00000533412	T;T;T	0.67698	0.99;-0.28;-0.28	5.92	5.0	0.66597	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.056926	0.64402	D	0.000001	T	0.71929	0.3398	L	0.39397	1.21	0.48236	D	0.999613	D	0.69078	0.997	P	0.57057	0.812	T	0.75578	-0.3269	10	0.72032	D	0.01	-8.6155	16.606	0.84830	0.0:0.0:0.8689:0.1311	.	162	Q8WVD5	RN141_HUMAN	W	162	ENSP00000265981:R162W;ENSP00000434320:R162W;ENSP00000435086:R162W	ENSP00000265981:R162W	R	-	1	2	RNF141	10497215	1.000000	0.71417	0.891000	0.34965	0.861000	0.49209	4.756000	0.62205	1.492000	0.48499	0.655000	0.94253	CGG		RNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385888.1	NM_016422	
TRPC6	7225	hgsc.bcm.edu	37	11	101362466	101362466	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:101362466C>T	ENST00000344327.3	-	3	1373	c.949G>A	c.(949-951)Gac>Aac	p.D317N	TRPC6_ENST00000532133.1_Missense_Mutation_p.D317N|TRPC6_ENST00000360497.4_Missense_Mutation_p.D317N|TRPC6_ENST00000348423.4_Intron	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	317					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.D317N(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TTTTTGTAGTCATTCTAGGAA	0.368																																					p.D317N	Colon(166;1315 1927 11094 12848 34731)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G949A	11						.						62.0	61.0	61.0					11																	101362466		2203	4299	6502	100867676	SO:0001583	missense	7225	exon3			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.949G>A	11.37:g.101362466C>T	ENSP00000340913:p.Asp317Asn	Somatic		Capture	SOLID	Phase_I	100867676	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.881046	0.91740	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000360497	T;T;T	0.63580	-0.05;-0.05;-0.05	6.14	6.14	0.99180	.	0.086330	0.85682	D	0.000000	T	0.81054	0.4743	M	0.81942	2.565	0.80722	D	1	D;D	0.65815	0.995;0.991	D;P	0.64687	0.928;0.848	T	0.81468	-0.0919	10	0.87932	D	0	-17.1925	20.8597	0.99761	0.0:1.0:0.0:0.0	.	317;317	Q9Y210-3;Q9Y210	.;TRPC6_HUMAN	N	317	ENSP00000340913:D317N;ENSP00000435574:D317N;ENSP00000353687:D317N	ENSP00000340913:D317N	D	-	1	0	TRPC6	100867676	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.731000	0.84895	2.937000	0.99478	0.650000	0.86243	GAC		TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
EXPH5	23086	hgsc.bcm.edu	37	11	108383882	108383882	+	Silent	SNP	C	C	T	rs367982814		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:108383882C>T	ENST00000265843.4	-	6	2462	c.2352G>A	c.(2350-2352)ccG>ccA	p.P784P	EXPH5_ENST00000525344.1_Silent_p.P777P|EXPH5_ENST00000524840.1_5'Flank|EXPH5_ENST00000443411.1_Silent_p.P596P|EXPH5_ENST00000428840.1_Silent_p.P708P	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	784					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)	p.P784P(1)		breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TATCTGTGTGCGGTATATACA	0.378																																					p.P784P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2352A	11						.	C		0,4402		0,0,2201	122.0	131.0	128.0		2352	-0.2	0.0	11		128	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous	EXPH5	NM_015065.2		0,1,6498	TT,TC,CC		0.0116,0.0,0.0077		784/1990	108383882	1,12997	2201	4298	6499	107889092	SO:0001819	synonymous_variant	23086	exon6				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.2352G>A	11.37:g.108383882C>T		Somatic		Capture	SOLID	Phase_I	107889092	NM_015065	Q2KHM1|Q9Y4D6	Silent	SNP	ENST00000265843.4	37	CCDS8341.1																																																																																				EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065	
CRYAB	1410	hgsc.bcm.edu	37	11	111779528	111779528	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:111779528C>T	ENST00000533475.1	-	4	937	c.488G>A	c.(487-489)cGt>cAt	p.R163H	CRYAB_ENST00000533280.1_Missense_Mutation_p.R96H|CRYAB_ENST00000527950.1_Missense_Mutation_p.R163H|CRYAB_ENST00000531198.1_Missense_Mutation_p.R163H|CRYAB_ENST00000526180.1_Missense_Mutation_p.R163H|CRYAB_ENST00000227251.3_Missense_Mutation_p.R163H|CRYAB_ENST00000525823.1_Missense_Mutation_p.R96H	NM_001885.1	NP_001876.1	P02511	CRYAB_HUMAN	crystallin, alpha B	163					aging (GO:0007568)|apoptotic process involved in morphogenesis (GO:0060561)|cellular response to gamma radiation (GO:0071480)|glucose metabolic process (GO:0006006)|lens development in camera-type eye (GO:0002088)|microtubule polymerization or depolymerization (GO:0031109)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of gene expression (GO:0010629)|negative regulation of intracellular transport (GO:0032387)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|protein folding (GO:0006457)|protein homooligomerization (GO:0051260)|regulation of cell death (GO:0010941)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|stress-activated MAPK cascade (GO:0051403)|tubulin complex assembly (GO:0007021)	actin filament bundle (GO:0032432)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)|unfolded protein binding (GO:0051082)	p.R163H(1)		endometrium(1)|large_intestine(1)|lung(2)|skin(4)	8		all_cancers(61;1.26e-15)|all_epithelial(67;9.52e-10)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.57e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|all cancers(92;6.57e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.051)		CTTCTCTTCACGGGTGATGGG	0.493																																					p.R163H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G488A	11						.						121.0	111.0	115.0					11																	111779528		2201	4297	6498	111284738	SO:0001583	missense	1410	exon3				CCDS8351.1	11q22.3-q23.1	2014-09-17				ENSG00000109846		"""Heat shock proteins / HSPB"""	2389	protein-coding gene	gene with protein product		123590		CRYA2		8431633	Standard	NM_001885		Approved	HSPB5	uc001pmf.1	P02511		ENST00000533475.1:c.488G>A	11.37:g.111779528C>T	ENSP00000433560:p.Arg163His	Somatic		Capture	SOLID	Phase_I	111284738	NM_001885	B0YIX0|O43416|Q9UC37|Q9UC38|Q9UC39|Q9UC40|Q9UC41	Missense_Mutation	SNP	ENST00000533475.1	37	CCDS8351.1	.	.	.	.	.	.	.	.	.	.	C	33	5.198260	0.94997	.	.	ENSG00000109846	ENST00000526180;ENST00000533280;ENST00000525823;ENST00000533475;ENST00000527950;ENST00000227251;ENST00000531198;ENST00000528961;ENST00000527899;ENST00000526167	D;D;D;D;D;D;D;D;D;D	0.95724	-2.74;-3.79;-3.79;-2.74;-2.74;-2.74;-2.74;-3.79;-2.74;-3.79	5.97	5.97	0.96955	.	0.165138	0.56097	D	0.000025	D	0.96018	0.8703	L	0.35288	1.05	0.80722	D	1	D	0.89917	1.0	D	0.69307	0.963	D	0.93998	0.7273	10	0.22706	T	0.39	-6.6279	20.4388	0.99107	0.0:1.0:0.0:0.0	.	163	P02511	CRYAB_HUMAN	H	163;96;96;163;163;163;163;96;163;96	ENSP00000436051:R163H;ENSP00000435046:R96H;ENSP00000435411:R96H;ENSP00000433560:R163H;ENSP00000437149:R163H;ENSP00000227251:R163H;ENSP00000434247:R163H;ENSP00000435960:R96H;ENSP00000436089:R163H;ENSP00000434793:R96H	ENSP00000227251:R163H	R	-	2	0	CRYAB	111284738	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.457000	0.66672	2.836000	0.97738	0.655000	0.94253	CGT		CRYAB-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391658.1		
SORL1	6653	hgsc.bcm.edu	37	11	121481817	121481817	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:121481817T>C	ENST00000260197.7	+	39	5401	c.5272T>C	c.(5272-5274)Tat>Cat	p.Y1758H	SORL1_ENST00000527934.1_Missense_Mutation_p.Y373H|SORL1_ENST00000534286.1_Missense_Mutation_p.Y668H|SORL1_ENST00000532694.1_Missense_Mutation_p.Y604H|SORL1_ENST00000525532.1_Missense_Mutation_p.Y702H	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1758	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)	p.Y1758H(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		CATTGACAGCTATGGTGAAAA	0.418																																					p.Y1758H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T5272C	11						.						124.0	116.0	119.0					11																	121481817		2202	4299	6501	120987027	SO:0001583	missense	6653	exon39			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.5272T>C	11.37:g.121481817T>C	ENSP00000260197:p.Tyr1758His	Somatic		Capture	SOLID	Phase_I	120987027	NM_003105	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	T	12.37	1.917697	0.33815	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286;ENST00000527934	T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61	5.49	5.49	0.81192	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.398022	0.25701	N	0.028867	T	0.35970	0.0950	L	0.29908	0.895	0.37593	D	0.920245	P;B	0.38922	0.651;0.371	B;B	0.36608	0.229;0.121	T	0.34477	-0.9827	10	0.26408	T	0.33	.	14.1186	0.65172	0.0:0.0:0.0:1.0	.	373;1758	E9PKB0;Q92673	.;SORL_HUMAN	H	1758;702;604;668;373	ENSP00000260197:Y1758H;ENSP00000434634:Y702H;ENSP00000432131:Y604H;ENSP00000436447:Y668H;ENSP00000435405:Y373H	ENSP00000260197:Y1758H	Y	+	1	0	SORL1	120987027	1.000000	0.71417	0.962000	0.40283	0.938000	0.57974	4.852000	0.62904	2.207000	0.71202	0.533000	0.62120	TAT		SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
OR4D5	219875	hgsc.bcm.edu	37	11	123811224	123811224	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:123811224C>A	ENST00000307033.2	+	1	975	c.901C>A	c.(901-903)Ctg>Atg	p.L301M		NM_001001965.1	NP_001001965.1	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D, member 5	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L301L(2)|p.L301M(1)		autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CATGAAGAAGCTGTGGAGGAG	0.493																																					p.L301M												.	.	3	Substitution - coding silent(2)|Substitution - Missense(1)	lung(2)|large_intestine(1)	c.C901A	11						.						85.0	84.0	85.0					11																	123811224		2202	4299	6501	123316434	SO:0001583	missense	219875	exon1			BK004316	CCDS31699.1	11q24.1	2012-08-09			ENSG00000171014	ENSG00000171014		"""GPCR / Class A : Olfactory receptors"""	14852	protein-coding gene	gene with protein product							Standard	NM_001001965		Approved		uc001pzk.1	Q8NGN0	OTTHUMG00000165961	ENST00000307033.2:c.901C>A	11.37:g.123811224C>A	ENSP00000305970:p.Leu301Met	Somatic		Capture	SOLID	Phase_I	123316434	NM_001001965	B9EGZ4|Q6IFE6	Missense_Mutation	SNP	ENST00000307033.2	37	CCDS31699.1	.	.	.	.	.	.	.	.	.	.	C	9.944	1.218407	0.22373	.	.	ENSG00000171014	ENST00000307033	T	0.42900	0.96	5.15	0.951	0.19579	.	0.000000	0.34245	U	0.004137	T	0.31263	0.0791	N	0.16478	0.41	0.25112	N	0.990709	P	0.52842	0.956	P	0.52514	0.701	T	0.11690	-1.0577	10	0.62326	D	0.03	-6.3148	4.6715	0.12691	0.2819:0.4843:0.0:0.2338	.	301	Q8NGN0	OR4D5_HUMAN	M	301	ENSP00000305970:L301M	ENSP00000305970:L301M	L	+	1	2	OR4D5	123316434	0.000000	0.05858	0.970000	0.41538	0.115000	0.19883	-1.913000	0.01580	0.203000	0.20529	-0.757000	0.03467	CTG		OR4D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387263.1	NM_001001965	
TH	7054	hgsc.bcm.edu	37	11	2193002	2193002	+	Silent	SNP	G	G	A	rs562609508	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:2193002G>A	ENST00000381178.1	-	1	33	c.15C>T	c.(13-15)gaC>gaT	p.D5D	TH_ENST00000333684.5_Silent_p.D5D|TH_ENST00000352909.3_Silent_p.D5D|TH_ENST00000381175.1_Silent_p.D5D|MIR4686_ENST00000584128.1_RNA	NM_199292.2	NP_954986.2	P07101	TY3H_HUMAN	tyrosine hydroxylase	5					anatomical structure morphogenesis (GO:0009653)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to manganese ion (GO:0071287)|cellular response to nicotine (GO:0071316)|cerebral cortex development (GO:0021987)|circadian sleep/wake cycle (GO:0042745)|dopamine biosynthetic process (GO:0042416)|dopamine biosynthetic process from tyrosine (GO:0006585)|eating behavior (GO:0042755)|embryonic camera-type eye morphogenesis (GO:0048596)|epinephrine biosynthetic process (GO:0042418)|eye photoreceptor cell development (GO:0042462)|fatty acid metabolic process (GO:0006631)|glycoside metabolic process (GO:0016137)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|isoquinoline alkaloid metabolic process (GO:0033076)|learning (GO:0007612)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|memory (GO:0007613)|multicellular organismal aging (GO:0010259)|neurotransmitter biosynthetic process (GO:0042136)|norepinephrine biosynthetic process (GO:0042421)|organ morphogenesis (GO:0009887)|phthalate metabolic process (GO:0018963)|phytoalexin metabolic process (GO:0052314)|pigmentation (GO:0043473)|regulation of heart contraction (GO:0008016)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to corticosterone (GO:0051412)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to herbicide (GO:0009635)|response to hypoxia (GO:0001666)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to nutrient levels (GO:0031667)|response to peptide hormone (GO:0043434)|response to pyrethroid (GO:0046684)|response to salt stress (GO:0009651)|response to water deprivation (GO:0009414)|response to zinc ion (GO:0010043)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|sphingolipid metabolic process (GO:0006665)|synaptic transmission, dopaminergic (GO:0001963)|synaptic vesicle amine transport (GO:0015842)|terpene metabolic process (GO:0042214)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|melanosome membrane (GO:0033162)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perikaryon (GO:0043204)|smooth endoplasmic reticulum (GO:0005790)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	amino acid binding (GO:0016597)|dopamine binding (GO:0035240)|enzyme binding (GO:0019899)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|oxygen binding (GO:0019825)|tetrahydrobiopterin binding (GO:0034617)|tyrosine 3-monooxygenase activity (GO:0004511)	p.D5D(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(7)|skin(1)	11		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	GCGTGGTGGCGTCGGGGGTGG	0.667													g|||	2	0.000399361	0.0008	0.0	5008	,	,		15312	0.0		0.001	False		,,,				2504	0.0				p.D5D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C15T	11						.						64.0	58.0	60.0					11																	2193002		2202	4299	6501	2149578	SO:0001819	synonymous_variant	7054	exon1			X05290	CCDS7730.1, CCDS7731.1, CCDS31338.1	11p15.5	2013-06-03			ENSG00000180176	ENSG00000180176	1.14.16.2		11782	protein-coding gene	gene with protein product	"""tyrosine 3-monooxygenase"""	191290					Standard	NM_199292		Approved	DYT5b	uc001lvq.3	P07101	OTTHUMG00000009559	ENST00000381178.1:c.15C>T	11.37:g.2193002G>A		Somatic		Capture	SOLID	Phase_I	2149578	NM_000360	B7ZL70|B7ZL73|Q0PWM2|Q0PWM3|Q15585|Q15588|Q15589|Q2M3B4	Silent	SNP	ENST00000381178.1	37	CCDS7731.1																																																																																				TH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026597.1	NM_000360	
CNGA4	1262	hgsc.bcm.edu	37	11	6261580	6261580	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:6261580C>A	ENST00000379936.2	+	4	671	c.556C>A	c.(556-558)Cta>Ata	p.L186I	CNGA4_ENST00000533426.1_Intron	NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	186					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.L186I(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAACAGCTGCCTATACTTTGC	0.592																																					p.L186I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C556A	11						.						66.0	66.0	66.0					11																	6261580		2197	4293	6490	6218156	SO:0001583	missense	1262	exon4			AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.556C>A	11.37:g.6261580C>A	ENSP00000369268:p.Leu186Ile	Somatic		Capture	SOLID	Phase_I	6218156	NM_001037329		Missense_Mutation	SNP	ENST00000379936.2	37	CCDS31408.1	.	.	.	.	.	.	.	.	.	.	C	2.824	-0.244201	0.05906	.	.	ENSG00000132259	ENST00000379936	D	0.97772	-4.53	5.25	2.33	0.28932	Ion transport (1);	0.135795	0.51477	D	0.000100	D	0.90563	0.7042	N	0.05467	-0.045	0.34745	D	0.731146	B;B	0.28760	0.221;0.162	B;B	0.32393	0.145;0.051	D	0.85094	0.0953	10	0.10377	T	0.69	.	5.2824	0.15682	0.0:0.6073:0.1471:0.2457	.	186;146	Q8IV77;Q8IV77-2	CNGA4_HUMAN;.	I	186	ENSP00000369268:L186I	ENSP00000369268:L186I	L	+	1	2	CNGA4	6218156	0.000000	0.05858	0.090000	0.20809	0.989000	0.77384	-0.504000	0.06375	0.290000	0.22444	0.650000	0.86243	CTA		CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383765.2	NM_001037329	
DCHS1	8642	hgsc.bcm.edu	37	11	6648199	6648199	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:6648199C>T	ENST00000299441.3	-	14	6482	c.6071G>A	c.(6070-6072)cGc>cAc	p.R2024H		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2024	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R2024H(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TACAGGAGAGCGGGCCACGCG	0.582																																					p.R2024H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6071A	11						.						46.0	43.0	44.0					11																	6648199		2201	4296	6497	6604775	SO:0001583	missense	8642	exon14			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.6071G>A	11.37:g.6648199C>T	ENSP00000299441:p.Arg2024His	Somatic		Capture	SOLID	Phase_I	6604775	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	17.31	3.357088	0.61293	.	.	ENSG00000166341	ENST00000299441	T	0.63255	-0.03	5.18	3.27	0.37495	Cadherin (3);Cadherin-like (1);	0.290613	0.24884	N	0.034839	T	0.49321	0.1550	L	0.45051	1.395	0.40153	D	0.97697	B	0.02656	0.0	B	0.01281	0.0	T	0.48927	-0.8991	10	0.41790	T	0.15	.	7.0358	0.24993	0.0:0.7286:0.0:0.2714	.	2024	Q96JQ0	PCD16_HUMAN	H	2024	ENSP00000299441:R2024H	ENSP00000299441:R2024H	R	-	2	0	DCHS1	6604775	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.163000	0.50763	1.414000	0.47017	0.462000	0.41574	CGC		DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
DENND5A	23258	hgsc.bcm.edu	37	11	9165793	9165793	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:9165793A>G	ENST00000328194.3	-	19	3475	c.3155T>C	c.(3154-3156)aTg>aCg	p.M1052T	DENND5A_ENST00000527700.1_Missense_Mutation_p.M395T|DENND5A_ENST00000530044.1_Missense_Mutation_p.M1052T	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	1052	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.M1052T(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TCCATCATCCATGCCCTTCCC	0.612																																					p.M1052T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3155C	11						.						56.0	49.0	51.0					11																	9165793		2201	4296	6497	9122369	SO:0001583	missense	23258	exon19			AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.3155T>C	11.37:g.9165793A>G	ENSP00000328524:p.Met1052Thr	Somatic		Capture	SOLID	Phase_I	9122369	NM_015213	B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Missense_Mutation	SNP	ENST00000328194.3	37	CCDS31423.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.59|14.59	2.582223|2.582223	0.46006|0.46006	.|.	.|.	ENSG00000184014|ENSG00000184014	ENST00000328194;ENST00000530044;ENST00000527700|ENST00000525784	T;T;T|.	0.62364|.	0.03;0.03;0.03|.	5.76|5.76	4.64|4.64	0.57946|0.57946	Lipoxygenase, LH2 (2);Lipase/lipooxygenase, PLAT/LH2 (1);|.	0.219510|.	0.53938|.	D|.	0.000042|.	T|T	0.24851|0.24851	0.0603|0.0603	N|N	0.03608|0.03608	-0.345|-0.345	0.40681|0.40681	D|D	0.982301|0.982301	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.06405|.	0.002;0.002|.	T|T	0.13361|0.13361	-1.0512|-1.0512	10|5	0.72032|.	D|.	0.01|.	.|.	8.3563|8.3563	0.32331|0.32331	0.7973:0.1334:0.0693:0.0|0.7973:0.1334:0.0693:0.0	.|.	1052;1052|.	E9PS91;Q6IQ26|.	.;DEN5A_HUMAN|.	T|R	1052;1052;395|100	ENSP00000328524:M1052T;ENSP00000435866:M1052T;ENSP00000432549:M395T|.	ENSP00000328524:M1052T|.	M|W	-|-	2|1	0|0	DENND5A|DENND5A	9122369|9122369	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.531000|7.531000	0.81973|0.81973	2.191000|2.191000	0.70037|0.70037	0.533000|0.533000	0.62120|0.62120	ATG|TGG		DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385910.2	NM_015213	
DENND5A	23258	hgsc.bcm.edu	37	11	9225363	9225363	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:9225363C>T	ENST00000328194.3	-	4	1113	c.793G>A	c.(793-795)Gtc>Atc	p.V265I	DENND5A_ENST00000530044.1_Missense_Mutation_p.V265I	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	265	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.V265I(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GGCCCATAGACCCCAGAAAAC	0.522																																					p.V265I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G793A	11						.						64.0	69.0	67.0					11																	9225363		2201	4296	6497	9181939	SO:0001583	missense	23258	exon4			AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.793G>A	11.37:g.9225363C>T	ENSP00000328524:p.Val265Ile	Somatic		Capture	SOLID	Phase_I	9181939	NM_015213	B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Missense_Mutation	SNP	ENST00000328194.3	37	CCDS31423.1	.	.	.	.	.	.	.	.	.	.	C	18.06	3.540281	0.65085	.	.	ENSG00000184014	ENST00000328194;ENST00000530044	T;T	0.12255	2.7;2.7	5.31	5.31	0.75309	DENN (3);	0.000000	0.85682	D	0.000000	T	0.16257	0.0391	L	0.42245	1.32	0.80722	D	1	B;P	0.35944	0.082;0.529	B;B	0.37888	0.117;0.26	T	0.04165	-1.0972	10	0.23891	T	0.37	.	18.9731	0.92722	0.0:1.0:0.0:0.0	.	265;265	E9PS91;Q6IQ26	.;DEN5A_HUMAN	I	265	ENSP00000328524:V265I;ENSP00000435866:V265I	ENSP00000328524:V265I	V	-	1	0	DENND5A	9181939	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.814000	0.86154	2.471000	0.83476	0.650000	0.86243	GTC		DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385910.2	NM_015213	
ZNF143	7702	hgsc.bcm.edu	37	11	9494299	9494299	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:9494299T>C	ENST00000396602.2	+	3	307	c.188T>C	c.(187-189)aTa>aCa	p.I63T	ZNF143_ENST00000530463.1_Missense_Mutation_p.I63T|ZNF143_ENST00000396604.1_Missense_Mutation_p.I63T|ZNF143_ENST00000299606.2_Missense_Mutation_p.I63T|ZNF143_ENST00000396597.3_Intron	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143	63					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I63T(1)		endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		ACTGCTTACATACAACACAAT	0.373																																					p.I63T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T188C	11						.						147.0	136.0	140.0					11																	9494299		2201	4294	6495	9450875	SO:0001583	missense	7702	exon3			U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.188T>C	11.37:g.9494299T>C	ENSP00000379847:p.Ile63Thr	Somatic		Capture	SOLID	Phase_I	9450875	NM_003442	A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	Missense_Mutation	SNP	ENST00000396602.2	37	CCDS7799.2	.	.	.	.	.	.	.	.	.	.	T	17.52	3.411226	0.62399	.	.	ENSG00000166478	ENST00000531943;ENST00000396604;ENST00000396602;ENST00000530463;ENST00000532577;ENST00000438144;ENST00000526657;ENST00000299606;ENST00000534265;ENST00000412390;ENST00000414370;ENST00000417726	T;T;T;T;T;T;T;T;T;T	0.56275	0.61;2.55;2.55;2.55;0.68;0.67;0.47;2.61;0.67;0.62	5.23	5.23	0.72850	.	0.074055	0.53938	D	0.000043	T	0.52677	0.1749	M	0.61703	1.905	0.80722	D	1	B;B	0.19200	0.034;0.034	B;B	0.16722	0.016;0.016	T	0.54715	-0.8252	10	0.87932	D	0	.	15.2885	0.73849	0.0:0.0:0.0:1.0	.	63;63	E7ER34;P52747	.;ZN143_HUMAN	T	63	ENSP00000434638:I63T;ENSP00000379849:I63T;ENSP00000379847:I63T;ENSP00000432154:I63T;ENSP00000433221:I63T;ENSP00000409432:I63T;ENSP00000435881:I63T;ENSP00000299606:I63T;ENSP00000433743:I63T;ENSP00000388628:I63T	ENSP00000299606:I63T	I	+	2	0	ZNF143	9450875	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.395000	0.79876	2.198000	0.70561	0.528000	0.53228	ATA		ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313921.2	NM_003442	
SBF2	81846	hgsc.bcm.edu	37	11	9983576	9983576	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:9983576G>A	ENST00000256190.8	-	16	1925	c.1788C>T	c.(1786-1788)gtC>gtT	p.V596V		NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	596					cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.V596V(1)		breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		GGTTTTGCTGGACATGCAAAC	0.418																																					p.V596V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1788T	11						.						160.0	131.0	141.0					11																	9983576		2201	4294	6495	9940152	SO:0001819	synonymous_variant	81846	exon16			AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.1788C>T	11.37:g.9983576G>A		Somatic		Capture	SOLID	Phase_I	9940152	NM_030962	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Silent	SNP	ENST00000256190.8	37	CCDS31427.1	.	.	.	.	.	.	.	.	.	.	G	9.486	1.099345	0.20552	.	.	ENSG00000133812	ENST00000420722	.	.	.	5.7	-2.33	0.06724	.	.	.	.	.	T	0.39332	0.1074	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30909	-0.9962	4	.	.	.	.	1.8034	0.03076	0.3827:0.093:0.3192:0.205	.	.	.	.	S	203	.	.	P	-	1	0	SBF2	9940152	0.997000	0.39634	0.994000	0.49952	0.978000	0.69477	0.485000	0.22324	-0.217000	0.10033	0.557000	0.71058	CCA		SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962	
GTF2H1	2965	hgsc.bcm.edu	37	11	18369442	18369442	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:18369442C>T	ENST00000265963.4	+	9	1189	c.1029C>T	c.(1027-1029)gaC>gaT	p.D343D	GTF2H1_ENST00000534641.1_Silent_p.D227D|GTF2H1_ENST00000453096.2_Silent_p.D343D|GTF2H1_ENST00000524753.4_Silent_p.D139D|GTF2H1_ENST00000530496.2_Silent_p.D31D	NM_005316.3	NP_005307.1	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1, 62kDa	343					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.D343D(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	20						GAGATGCAGACTGCTTTCAGC	0.383								Nucleotide excision repair (NER)																													p.D343D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1029T	11						.						67.0	67.0	67.0					11																	18369442		2199	4293	6492	18326018	SO:0001819	synonymous_variant	2965	exon10				CCDS7838.1	11p15.1-p14	2012-11-05	2002-08-29		ENSG00000110768	ENSG00000110768		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4655	protein-coding gene	gene with protein product		189972	"""general transcription factor IIH, polypeptide 1 (62kD subunit)"""			1529339, 8162052	Standard	NM_005316		Approved	BTF2, P62, TFIIH	uc001moh.2	P32780	OTTHUMG00000167690	ENST00000265963.4:c.1029C>T	11.37:g.18369442C>T		Somatic		Capture	SOLID	Phase_I	18326018	NM_001142307	B3KXE0|D3DQY2|Q6I9Y7|Q9H5K5|Q9NQD9	Silent	SNP	ENST00000265963.4	37	CCDS7838.1																																																																																				GTF2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395627.2	NM_005316	
FSHB	2488	hgsc.bcm.edu	37	11	30255300	30255300	+	Nonsense_Mutation	SNP	C	C	T	rs374623109		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:30255300C>T	ENST00000417547.1	+	3	382	c.343C>T	c.(343-345)Cga>Tga	p.R115*	FSHB_ENST00000254122.3_Nonsense_Mutation_p.R115*|FSHB_ENST00000533718.1_Nonsense_Mutation_p.R115*	NM_001018080.1	NP_001018090.1	P01225	FSHB_HUMAN	follicle stimulating hormone, beta polypeptide	115					cellular protein metabolic process (GO:0044267)|female gamete generation (GO:0007292)|female pregnancy (GO:0007565)|follicle-stimulating hormone signaling pathway (GO:0042699)|peptide hormone processing (GO:0016486)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone biosynthetic process (GO:0006701)|regulation of osteoclast differentiation (GO:0045670)|Sertoli cell proliferation (GO:0060011)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	hormone activity (GO:0005179)	p.R115*(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	12						TTGTACTGTGCGAGGCCTGGG	0.517																																					p.R115X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C343T	11						.	C	stop/ARG,stop/ARG	0,4404		0,0,2202	80.0	68.0	72.0		343,343	2.7	0.2	11		72	1,8597	1.2+/-3.3	0,1,4298	no	stop-gained,stop-gained	FSHB	NM_000510.2,NM_001018080.1	,	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	,	115/130,115/130	30255300	1,13001	2202	4299	6501	30211876	SO:0001587	stop_gained	2488	exon3				CCDS7868.1	11p13	2013-02-26				ENSG00000131808		"""Endogenous ligands"""	3964	protein-coding gene	gene with protein product	"""follitropin, beta chain"", ""follicle-stimulating hormone beta subunit"""	136530				2885163, 3151250	Standard	NM_000510		Approved		uc001msm.3	P01225		ENST00000417547.1:c.343C>T	11.37:g.30255300C>T	ENSP00000416606:p.Arg115*	Somatic		Capture	SOLID	Phase_I	30211876	NM_000510	A2TF08|A5JVV3|Q14D61	Nonsense_Mutation	SNP	ENST00000417547.1	37	CCDS7868.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.947427	0.53186	0.0	1.16E-4	ENSG00000131808	ENST00000254122;ENST00000417547;ENST00000533718	.	.	.	5.65	2.67	0.31697	.	0.426305	0.22879	N	0.054524	.	.	.	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	15.0102	0.71545	0.693:0.307:0.0:0.0	.	.	.	.	X	115	.	ENSP00000254122:R115X	R	+	1	2	FSHB	30211876	0.012000	0.17670	0.220000	0.23810	0.393000	0.30537	-0.524000	0.06222	0.425000	0.26087	-0.182000	0.12963	CGA		FSHB-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389757.1	NM_000510	
ARFGAP2	84364	hgsc.bcm.edu	37	11	47187900	47187900	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:47187900G>A	ENST00000524782.1	-	15	1692	c.1464C>T	c.(1462-1464)gaC>gaT	p.D488D	ARFGAP2_ENST00000419701.2_Silent_p.D381D|ARFGAP2_ENST00000319543.6_Silent_p.D219D|RP11-390K5.6_ENST00000524412.1_RNA|ARFGAP2_ENST00000395449.3_5'UTR|ARFGAP2_ENST00000426335.2_Silent_p.D352D	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	488	Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.D488D(1)		breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						ACTGGGCAATGTCCGCTGTAG	0.562																																					p.D488D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1464T	11						.						160.0	138.0	146.0					11																	47187900		2201	4299	6500	47144476	SO:0001819	synonymous_variant	84364	exon15			AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.1464C>T	11.37:g.47187900G>A		Somatic		Capture	SOLID	Phase_I	47144476	NM_032389	B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Silent	SNP	ENST00000524782.1	37	CCDS7926.1	.	.	.	.	.	.	.	.	.	.	G	9.112	1.006749	0.19199	.	.	ENSG00000149182	ENST00000527776	.	.	.	5.41	3.56	0.40772	.	.	.	.	.	T	0.58595	0.2133	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53351	-0.8451	4	.	.	.	-20.0251	8.638	0.33959	0.3522:0.0:0.6478:0.0	.	.	.	.	Y	210	.	.	H	-	1	0	ARFGAP2	47144476	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.164000	0.42387	0.774000	0.33427	0.650000	0.86243	CAT		ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391425.1	NM_032389	
OR5W2	390148	hgsc.bcm.edu	37	11	55681931	55681931	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:55681931A>G	ENST00000344514.1	-	1	127	c.128T>C	c.(127-129)cTt>cCt	p.L43P		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	43						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L43P(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TATCATTCCAAGATTTGCTGA	0.353																																					p.L43P	Melanoma(48;171 1190 15239 43886 49348)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T128C	11						.						77.0	78.0	78.0					11																	55681931		2201	4296	6497	55438507	SO:0001583	missense	390148	exon1			BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.128T>C	11.37:g.55681931A>G	ENSP00000342448:p.Leu43Pro	Somatic		Capture	SOLID	Phase_I	55438507	NM_001001960		Missense_Mutation	SNP	ENST00000344514.1	37	CCDS31513.1	.	.	.	.	.	.	.	.	.	.	A	11.90	1.776707	0.31411	.	.	ENSG00000187612	ENST00000344514	T	0.00433	7.43	5.01	5.01	0.66863	GPCR, rhodopsin-like superfamily (1);	0.505383	0.14774	N	0.299227	T	0.01353	0.0044	M	0.88377	2.95	0.51233	D	0.999918	D	0.63880	0.993	P	0.62014	0.897	T	0.57452	-0.7809	10	0.87932	D	0	.	12.6788	0.56910	1.0:0.0:0.0:0.0	.	43	Q8NH69	OR5W2_HUMAN	P	43	ENSP00000342448:L43P	ENSP00000342448:L43P	L	-	2	0	OR5W2	55438507	0.015000	0.18098	0.536000	0.28039	0.114000	0.19823	2.799000	0.47892	1.874000	0.54306	0.448000	0.29417	CTT		OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391523.1	NM_001001960	
OR8H1	219469	hgsc.bcm.edu	37	11	56057917	56057917	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:56057917C>T	ENST00000313022.2	-	1	649	c.622G>A	c.(622-624)Gtg>Atg	p.V208M		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V208M(1)		NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					ATAAGGGACACCATCAGGGTG	0.418																																					p.V208M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G622A	11						.						155.0	139.0	144.0					11																	56057917		2201	4296	6497	55814493	SO:0001583	missense	219469	exon1			AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.622G>A	11.37:g.56057917C>T	ENSP00000323595:p.Val208Met	Somatic		Capture	SOLID	Phase_I	55814493	NM_001005199	B2RNI7|Q6IFC5	Missense_Mutation	SNP	ENST00000313022.2	37	CCDS31526.1	.	.	.	.	.	.	.	.	.	.	C	6.071	0.381438	0.11524	.	.	ENSG00000181693	ENST00000313022;ENST00000395186	T	0.40225	1.04	3.81	-1.18	0.09617	GPCR, rhodopsin-like superfamily (1);	0.983190	0.08287	N	0.969029	T	0.30759	0.0775	L	0.41961	1.31	0.09310	N	1	B	0.12013	0.005	B	0.23018	0.043	T	0.33624	-0.9861	10	0.38643	T	0.18	.	3.578	0.07942	0.422:0.3573:0.1375:0.0832	.	208	Q8NGG4	OR8H1_HUMAN	M	208;204	ENSP00000323595:V208M	ENSP00000323595:V208M	V	-	1	0	OR8H1	55814493	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.580000	0.00907	-0.004000	0.14419	-0.323000	0.08544	GTG		OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370019.1	NM_001005199	
TMEM132A	54972	hgsc.bcm.edu	37	11	60699186	60699186	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:60699186T>C	ENST00000453848.2	+	6	1200	c.1042T>C	c.(1042-1044)Tgg>Cgg	p.W348R	TMEM132A_ENST00000005286.4_Missense_Mutation_p.W349R			Q24JP5	T132A_HUMAN	transmembrane protein 132A	348						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.W349R(1)		breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						TGAGTTCCTATGGGTGGACTT	0.587																																					p.W349R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1045C	11						.						105.0	97.0	100.0					11																	60699186		2203	4299	6502	60455762	SO:0001583	missense	54972	exon6			AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.1042T>C	11.37:g.60699186T>C	ENSP00000405823:p.Trp348Arg	Somatic		Capture	SOLID	Phase_I	60455762	NM_017870	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Missense_Mutation	SNP	ENST00000453848.2	37	CCDS44618.1	.	.	.	.	.	.	.	.	.	.	T	0.588	-0.834200	0.02713	.	.	ENSG00000006118	ENST00000444690;ENST00000453848;ENST00000005286	T;T	0.12569	2.67;2.67	4.79	3.66	0.41972	.	0.285203	0.24909	N	0.034636	T	0.09774	0.0240	L	0.29908	0.895	0.32328	N	0.561518	B;B;B;B	0.16396	0.01;0.012;0.017;0.007	B;B;B;B	0.13407	0.008;0.009;0.009;0.005	T	0.03483	-1.1032	10	0.87932	D	0	.	7.0312	0.24969	0.0:0.1645:0.0:0.8355	.	337;99;348;349	Q24JP5-3;Q24JP5-4;Q24JP5;Q24JP5-2	.;.;T132A_HUMAN;.	R	99;348;349	ENSP00000405823:W348R;ENSP00000005286:W349R	ENSP00000005286:W349R	W	+	1	0	TMEM132A	60455762	1.000000	0.71417	0.997000	0.53966	0.305000	0.27757	1.400000	0.34577	1.940000	0.56252	0.374000	0.22700	TGG		TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	
NRXN2	9379	hgsc.bcm.edu	37	11	64419611	64419611	+	Missense_Mutation	SNP	G	G	A	rs375234912		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:64419611G>A	ENST00000377551.1	-	12	2643	c.2432C>T	c.(2431-2433)aCg>aTg	p.T811M	NRXN2_ENST00000409571.1_Missense_Mutation_p.T804M|NRXN2_ENST00000265459.6_Missense_Mutation_p.T811M|NRXN2_ENST00000377559.3_Missense_Mutation_p.T771M|AP001092.4_ENST00000433606.1_RNA			Q9P2S2	NRX2A_HUMAN	neurexin 2	811	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)	p.T811M(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						CGCAAACAGCGTTTCGGGGCC	0.567																																					p.T811M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2432T	11						.						83.0	60.0	68.0					11																	64419611		2201	4297	6498	64176187	SO:0001583	missense	9379	exon13				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.2432C>T	11.37:g.64419611G>A	ENSP00000366774:p.Thr811Met	Somatic		Capture	SOLID	Phase_I	64176187	NM_015080	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	ENST00000377551.1	37	CCDS8077.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341233	0.60963	.	.	ENSG00000110076	ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38	4.91	4.91	0.64330	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.43260	U	0.000582	D	0.85470	0.5704	L	0.59912	1.85	0.47094	D	0.999318	P;D;P	0.61080	0.952;0.989;0.85	B;P;B	0.58077	0.34;0.832;0.25	D	0.86946	0.2082	10	0.72032	D	0.01	.	15.6201	0.76799	0.0:0.0:1.0:0.0	.	771;811;557	Q9P2S2-2;Q9P2S2;E7EV67	.;NRX2A_HUMAN;.	M	811;771;811;771;804	ENSP00000366774:T811M;ENSP00000366782:T771M;ENSP00000265459:T811M;ENSP00000386416:T804M	ENSP00000265459:T811M	T	-	2	0	NRXN2	64176187	1.000000	0.71417	0.991000	0.47740	0.935000	0.57460	5.882000	0.69714	2.553000	0.86117	0.561000	0.74099	ACG		NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
EFEMP2	30008	hgsc.bcm.edu	37	11	65638689	65638689	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:65638689G>A	ENST00000307998.6	-	4	536	c.306C>T	c.(304-306)ccC>ccT	p.P102P	EFEMP2_ENST00000528176.1_Silent_p.P102P	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	102					blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)	p.P102P(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		GGTGTTGAGCGGGAGGCACTG	0.652																																					p.P102P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C306T	11						.						80.0	86.0	84.0					11																	65638689		2201	4296	6497	65395265	SO:0001819	synonymous_variant	30008	exon4			AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.306C>T	11.37:g.65638689G>A		Somatic		Capture	SOLID	Phase_I	65395265	NM_016938	A8K7R4|B3KM31|B3KQT1|O75967	Silent	SNP	ENST00000307998.6	37	CCDS8116.1																																																																																				EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391047.4	NM_016938	
SUV420H1	51111	hgsc.bcm.edu	37	11	67926092	67926092	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:67926092T>C	ENST00000304363.4	-	11	2074	c.1721A>G	c.(1720-1722)gAc>gGc	p.D574G		NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	574					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)	p.D574G(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						TTCACCACTGTCGGGGCAAGG	0.498																																					p.D574G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1721G	11						.						131.0	123.0	126.0					11																	67926092		2200	4294	6494	67682668	SO:0001583	missense	51111	exon11			AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.1721A>G	11.37:g.67926092T>C	ENSP00000305899:p.Asp574Gly	Somatic		Capture	SOLID	Phase_I	67682668	NM_017635	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	ENST00000304363.4	37	CCDS31623.1	.	.	.	.	.	.	.	.	.	.	T	12.87	2.067716	0.36470	.	.	ENSG00000110066	ENST00000304363	T	0.51817	0.69	5.07	2.71	0.32032	.	0.354583	0.35677	N	0.003044	T	0.29882	0.0747	L	0.29908	0.895	0.19775	N	0.999955	B	0.32573	0.376	B	0.26770	0.073	T	0.11690	-1.0577	10	0.40728	T	0.16	-10.106	7.8476	0.29435	0.0:0.0723:0.1385:0.7892	.	574	Q4FZB7	SV421_HUMAN	G	574	ENSP00000305899:D574G	ENSP00000305899:D574G	D	-	2	0	SUV420H1	67682668	0.673000	0.27539	0.001000	0.08648	0.050000	0.14768	3.109000	0.50345	0.388000	0.25054	0.402000	0.26972	GAC		SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318319.1	NM_017635	
MYEOV	26579	hgsc.bcm.edu	37	11	69063429	69063429	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:69063429T>C	ENST00000308946.3	+	3	962	c.512T>C	c.(511-513)gTg>gCg	p.V171A	MYEOV_ENST00000535407.1_Missense_Mutation_p.V113A|MYEOV_ENST00000441339.2_Missense_Mutation_p.V171A	NM_138768.2	NP_620123.2	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	171								p.V171A(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|urinary_tract(1)	24	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		GCCTTTAGAGTGGGCGTTGAG	0.592																																					p.V171A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T512C	11						.						209.0	198.0	201.0					11																	69063429		2200	4294	6494	68820005	SO:0001583	missense	26579	exon3			AJ223366	CCDS8190.1, CCDS73340.1	11q13.2	2013-03-27	2013-03-27			ENSG00000172927			7563	protein-coding gene	gene with protein product		605625	"""myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)"""			10753852	Standard	XM_005273908		Approved	OCIM	uc001oov.3	Q96EZ4		ENST00000308946.3:c.512T>C	11.37:g.69063429T>C	ENSP00000308330:p.Val171Ala	Somatic		Capture	SOLID	Phase_I	68820005	NM_138768	Q9UGN6|Q9UGN7	Missense_Mutation	SNP	ENST00000308946.3	37	CCDS8190.1	.	.	.	.	.	.	.	.	.	.	T	6.036	0.375041	0.11409	.	.	ENSG00000172927	ENST00000441339;ENST00000308946;ENST00000535407	T;T;T	0.24151	1.87;1.87;1.87	1.57	0.331	0.15933	.	.	.	.	.	T	0.11665	0.0284	N	0.08118	0	0.09310	N	1	D	0.58620	0.983	B	0.42319	0.383	T	0.15235	-1.0444	9	0.87932	D	0	.	4.3543	0.11170	0.0:0.0:0.3571:0.6429	.	171	Q96EZ4	MYEOV_HUMAN	A	171;171;113	ENSP00000412482:V171A;ENSP00000308330:V171A;ENSP00000438100:V113A	ENSP00000308330:V171A	V	+	2	0	MYEOV	68820005	0.006000	0.16342	0.005000	0.12908	0.012000	0.07955	-0.160000	0.10041	0.065000	0.16485	0.402000	0.26972	GTG		MYEOV-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396548.1		
CAPN5	726	hgsc.bcm.edu	37	11	76826528	76826528	+	Missense_Mutation	SNP	C	C	T	rs373951153		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:76826528C>T	ENST00000278559.3	+	6	976	c.787C>T	c.(787-789)Cgc>Tgc	p.R263C	CAPN5_ENST00000529629.1_Missense_Mutation_p.R263C|CAPN5_ENST00000531028.1_Intron|CAPN5_ENST00000456580.2_Missense_Mutation_p.R303C	NM_004055.4	NP_004046.2	O15484	CAN5_HUMAN	calpain 5	263	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.R263C(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(7)|lung(17)|urinary_tract(1)	30						GCGCAAGGTGCGCCTGGGCCA	0.657																																					p.R263C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C787T	11						.		CYS/ARG	0,4400		0,0,2200	44.0	40.0	41.0		787	5.1	1.0	11		41	1,8583	1.2+/-3.3	0,1,4291	no	missense	CAPN5	NM_004055.4	180	0,1,6491	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	263/641	76826528	1,12983	2200	4292	6492	76504176	SO:0001583	missense	726	exon6				CCDS8248.1	11q14	2014-01-29				ENSG00000149260			1482	protein-coding gene	gene with protein product		602537	"""vitreoretinopathy, neovascular inflammatory"""	VRNI		9503024, 9367857, 23055945	Standard	NM_004055		Approved	nCL-3, HTRA3, ADNIV	uc001oxx.3	O15484		ENST00000278559.3:c.787C>T	11.37:g.76826528C>T	ENSP00000278559:p.Arg263Cys	Somatic		Capture	SOLID	Phase_I	76504176	NM_004055	O00263	Missense_Mutation	SNP	ENST00000278559.3	37	CCDS8248.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.769794	0.90020	0.0	1.16E-4	ENSG00000149260	ENST00000278559;ENST00000360841;ENST00000529629;ENST00000456580;ENST00000544318	D;D;D	0.87887	-2.31;-2.31;-2.31	5.11	5.11	0.69529	Peptidase C2, calpain, catalytic domain (3);	0.055108	0.64402	D	0.000001	D	0.93449	0.7910	M	0.78344	2.41	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.978;0.964;1.0	D	0.94165	0.7418	10	0.72032	D	0.01	.	17.5326	0.87819	0.0:1.0:0.0:0.0	.	301;303;303;263	Q59GM2;E7EV01;Q6ZRM8;O15484	.;.;.;CAN5_HUMAN	C	263;303;263;303;303	ENSP00000278559:R263C;ENSP00000432332:R263C;ENSP00000409996:R303C	ENSP00000278559:R263C	R	+	1	0	CAPN5	76504176	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.781000	0.62389	2.368000	0.80403	0.561000	0.74099	CGC		CAPN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382564.2	NM_004055	
ALG8	79053	hgsc.bcm.edu	37	11	77835071	77835071	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:77835071G>A	ENST00000299626.5	-	3	435	c.364C>T	c.(364-366)Cgt>Tgt	p.R122C	ALG8_ENST00000532552.2_Intron|ALG8_ENST00000376156.3_Missense_Mutation_p.R122C	NM_024079.4	NP_076984.2	Q9BVK2	ALG8_HUMAN	ALG8, alpha-1,3-glucosyltransferase	122					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)	p.R122C(1)		NS(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	30	all_cancers(14;3.62e-19)|all_epithelial(13;1.27e-21)|Breast(9;8.51e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;9.66e-25)			ACTTACTCACGGACAGCATAC	0.363																																					p.R122C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C364T	11						.						90.0	88.0	89.0					11																	77835071		2200	4292	6492	77512719	SO:0001583	missense	79053	exon3			AJ224875	CCDS8258.1, CCDS41692.1	11q14.1	2013-03-01	2013-03-01		ENSG00000159063	ENSG00000159063	2.4.1.265		23161	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Glc(1)Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	608103	"""asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""				Standard	XM_005274247		Approved	MGC2840	uc001oza.1	Q9BVK2	OTTHUMG00000166594	ENST00000299626.5:c.364C>T	11.37:g.77835071G>A	ENSP00000299626:p.Arg122Cys	Somatic		Capture	SOLID	Phase_I	77512719	NM_001007027	A6NDW6|O60860	Missense_Mutation	SNP	ENST00000299626.5	37	CCDS8258.1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.227375	0.39399	.	.	ENSG00000159063	ENST00000299626;ENST00000376156;ENST00000525755;ENST00000530454;ENST00000525870;ENST00000527099;ENST00000530910;ENST00000525761	D;D;D;D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.75	6.01	1.56	0.23342	.	0.543977	0.21083	N	0.080449	T	0.79393	0.4438	L	0.48362	1.52	0.23010	N	0.998437	B;B	0.27765	0.033;0.188	B;B	0.29862	0.082;0.108	T	0.68006	-0.5523	10	0.39692	T	0.17	.	11.0083	0.47649	0.2867:0.0:0.7133:0.0	.	122;122	Q9BVK2;A6NDW6	ALG8_HUMAN;.	C	122;122;71;123;34;34;113;96	ENSP00000299626:R122C;ENSP00000365326:R122C;ENSP00000435467:R71C;ENSP00000434660:R123C;ENSP00000435417:R34C;ENSP00000436064:R34C;ENSP00000437033:R113C;ENSP00000431357:R96C	ENSP00000299626:R122C	R	-	1	0	ALG8	77512719	0.930000	0.31532	0.603000	0.28903	0.964000	0.63967	2.475000	0.45162	0.441000	0.26529	0.650000	0.86243	CGT		ALG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390637.1	NM_024079	
CHORDC1	26973	hgsc.bcm.edu	37	11	89938645	89938645	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:89938645A>G	ENST00000320585.6	-	8	1061	c.652T>C	c.(652-654)Tgg>Cgg	p.W218R	CHORDC1_ENST00000529987.1_Missense_Mutation_p.W30R|CHORDC1_ENST00000529726.1_Missense_Mutation_p.W30R|CHORDC1_ENST00000457199.2_Missense_Mutation_p.W199R	NM_012124.2	NP_036256.2	Q9UHD1	CHRD1_HUMAN	cysteine and histidine-rich domain (CHORD) containing 1	218	Interaction with HSP90AA1 and HSP90AB1. {ECO:0000250}.				chaperone-mediated protein folding (GO:0061077)|negative regulation of Rho-dependent protein serine/threonine kinase activity (GO:2000299)|regulation of cellular response to heat (GO:1900034)|regulation of centrosome duplication (GO:0010824)|response to stress (GO:0006950)		Hsp90 protein binding (GO:0051879)|zinc ion binding (GO:0008270)	p.W218R(1)		endometrium(2)|large_intestine(2)|liver(1)|lung(6)	11		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)				TTTTTAGTCCACATGTGTTTC	0.318																																					p.W218R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T652C	11						.						84.0	83.0	84.0					11																	89938645		2201	4297	6498	89578293	SO:0001583	missense	26973	exon8			AF192466	CCDS8289.1, CCDS44705.1	11q14.3	2011-01-25	2011-01-25		ENSG00000110172	ENSG00000110172			14525	protein-coding gene	gene with protein product		604353	"""cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1"", ""cysteine and histidine-rich domain (CHORD)-containing 1"""			10571178	Standard	NM_012124		Approved	CHP1	uc001pdg.2	Q9UHD1	OTTHUMG00000167305	ENST00000320585.6:c.652T>C	11.37:g.89938645A>G	ENSP00000319255:p.Trp218Arg	Somatic		Capture	SOLID	Phase_I	89578293	NM_012124	B2R6P8|Q6IN49|Q8WVL9|Q9H3D6	Missense_Mutation	SNP	ENST00000320585.6	37	CCDS8289.1	.	.	.	.	.	.	.	.	.	.	A	19.88	3.909952	0.72983	.	.	ENSG00000110172	ENST00000320585;ENST00000529987;ENST00000457199;ENST00000529726	T;T;T;T	0.50548	0.74;0.94;0.86;0.94	5.16	5.16	0.70880	HSP20-like chaperone (1);	0.117068	0.64402	D	0.000007	T	0.74772	0.3760	M	0.91459	3.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.81206	-0.1038	9	.	.	.	-0.7388	15.0125	0.71560	1.0:0.0:0.0:0.0	.	199;218	Q9UHD1-2;Q9UHD1	.;CHRD1_HUMAN	R	218;30;199;30	ENSP00000319255:W218R;ENSP00000433719:W30R;ENSP00000401080:W199R;ENSP00000436632:W30R	.	W	-	1	0	CHORDC1	89578293	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.381000	0.90152	2.093000	0.63338	0.529000	0.55759	TGG		CHORDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394111.1	NM_012124	
OR6T1	219874	hgsc.bcm.edu	37	11	123814142	123814142	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr11:123814142A>G	ENST00000321252.2	-	1	438	c.404T>C	c.(403-405)cTg>cCg	p.L135P		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	135						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L135P(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		GCCATTCATCAGGGTCTCATA	0.552																																					p.L135P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T404C	11						.						69.0	63.0	65.0					11																	123814142		2202	4299	6501	123319352	SO:0001583	missense	219874	exon1			AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.404T>C	11.37:g.123814142A>G	ENSP00000325203:p.Leu135Pro	Somatic		Capture	SOLID	Phase_I	123319352	NM_001005187	Q6IFE7	Missense_Mutation	SNP	ENST00000321252.2	37	CCDS31700.1	.	.	.	.	.	.	.	.	.	.	A	11.67	1.709180	0.30322	.	.	ENSG00000181499	ENST00000321252	T	0.33654	1.4	3.85	3.85	0.44370	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.62732	0.2452	M	0.89353	3.025	0.29728	N	0.838105	D	0.69078	0.997	D	0.68765	0.96	T	0.63047	-0.6724	9	0.87932	D	0	-54.6711	10.6245	0.45500	1.0:0.0:0.0:0.0	.	135	Q8NGN1	OR6T1_HUMAN	P	135	ENSP00000325203:L135P	ENSP00000325203:L135P	L	-	2	0	OR6T1	123319352	0.011000	0.17503	0.119000	0.21687	0.232000	0.25224	2.644000	0.46613	1.600000	0.50102	0.460000	0.39030	CTG		OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387264.1	NM_001005187	
MCHR2	84539	hgsc.bcm.edu	37	6	100395737	100395737	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:100395737T>C	ENST00000281806.2	-	3	607	c.293A>G	c.(292-294)gAg>gGg	p.E98G	MCHR2_ENST00000369212.2_Missense_Mutation_p.E98G	NM_001040179.1	NP_001035269.1	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.E98G(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	39		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		AAACACCCACTCTCCCCCTCG	0.498																																					p.E98G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A293G	6						.						108.0	111.0	110.0					6																	100395737		2203	4300	6503	100502458	SO:0001583	missense	84539	exon3			AF347063	CCDS5044.1	6q16	2012-08-08	2006-02-15	2006-02-15	ENSG00000152034	ENSG00000152034		"""GPCR / Class A : MCH receptors"""	20867	protein-coding gene	gene with protein product		606111	"""G protein-coupled receptor 145"""	GPR145		11355873, 11274220	Standard	NM_032503		Approved	SLT, MCH2, MCH2R	uc003pqi.1	Q969V1	OTTHUMG00000015270	ENST00000281806.2:c.293A>G	6.37:g.100395737T>C	ENSP00000281806:p.Glu98Gly	Somatic		Capture	SOLID	Phase_I	100502458	NM_001040179	B3KVW4|E1P5D7|Q5VTV7|Q6Q377|Q9BXA8	Missense_Mutation	SNP	ENST00000281806.2	37	CCDS5044.1	.	.	.	.	.	.	.	.	.	.	T	12.82	2.053683	0.36277	.	.	ENSG00000152034	ENST00000445970;ENST00000281806;ENST00000369212	T;T;T	0.73363	-0.74;-0.74;-0.74	4.57	4.57	0.56435	GPCR, rhodopsin-like superfamily (1);	0.276082	0.29730	N	0.011352	T	0.42359	0.1199	N	0.17838	0.53	0.35191	D	0.773398	P	0.37731	0.607	B	0.35770	0.21	T	0.44298	-0.9337	10	0.25751	T	0.34	.	11.9214	0.52793	0.0:0.0:0.0:1.0	.	98	Q969V1	MCHR2_HUMAN	G	98	ENSP00000403490:E98G;ENSP00000281806:E98G;ENSP00000358214:E98G	ENSP00000281806:E98G	E	-	2	0	MCHR2	100502458	0.827000	0.29292	1.000000	0.80357	0.831000	0.47069	1.836000	0.39191	1.699000	0.51192	0.528000	0.53228	GAG		MCHR2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041620.2	NM_032503	
RSPH4A	345895	hgsc.bcm.edu	37	6	116953382	116953382	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:116953382T>A	ENST00000229554.5	+	6	2066	c.1929T>A	c.(1927-1929)aaT>aaA	p.N643K	RSPH4A_ENST00000368581.4_Missense_Mutation_p.I598N|RSPH4A_ENST00000368580.4_Missense_Mutation_p.N396K	NM_001010892.2	NP_001010892.1	Q5TD94	RSH4A_HUMAN	radial spoke head 4 homolog A (Chlamydomonas)	643					axoneme assembly (GO:0035082)|cilium movement (GO:0003341)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|radial spoke (GO:0001534)		p.N643K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						AGTTTGAAAATTTCTACATAG	0.338									Kartagener syndrome																												p.I598N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1793A	6						.						25.0	26.0	26.0					6																	116953382		2203	4300	6503	117060075	SO:0001583	missense	345895	exon5	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome		CCDS34521.1, CCDS55051.1	6q22.1	2012-05-03	2009-02-17	2009-02-17	ENSG00000111834	ENSG00000111834			21558	protein-coding gene	gene with protein product		612647	"""radial spokehead-like 3"""	RSHL3		19200523	Standard	NM_001010892		Approved	dJ412I7.1, FLJ37974, RSPH6B, CILD11	uc003pxe.2	Q5TD94	OTTHUMG00000015444	ENST00000229554.5:c.1929T>A	6.37:g.116953382T>A	ENSP00000229554:p.Asn643Lys	Somatic		Capture	SOLID	Phase_I	117060075	NM_001161664	B4DSI1|Q3KP24|Q5TD95	Missense_Mutation	SNP	ENST00000229554.5	37	CCDS34521.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.62|13.62	2.291011|2.291011	0.40494|0.40494	.|.	.|.	ENSG00000111834|ENSG00000111834	ENST00000368581|ENST00000229554;ENST00000447842;ENST00000368580	T|T;T	0.67523|0.18657	-0.27|2.2;2.2	5.99|5.99	1.02|1.02	0.19986|0.19986	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.25419|0.25419	0.0618|0.0618	.|.	.|.	.|.	0.23913|0.23913	N|N	0.996489|0.996489	P|D	0.49783|0.89917	0.928|1.0	P|D	0.48921|0.91635	0.595|0.999	T|T	0.07712|0.07712	-1.0758|-1.0758	8|9	0.87932|0.66056	D|D	0|0.02	-23.2767|-23.2767	8.7784|8.7784	0.34776|0.34776	0.0:0.4094:0.0:0.5906|0.0:0.4094:0.0:0.5906	.|.	598|643	Q5TD94-3|Q5TD94	.|RSH4A_HUMAN	N|K	598|643;438;396	ENSP00000357570:I598N|ENSP00000229554:N643K;ENSP00000357569:N396K	ENSP00000357570:I598N|ENSP00000229554:N643K	I|N	+|+	2|3	0|2	RSPH4A|RSPH4A	117060075|117060075	0.983000|0.983000	0.35010|0.35010	0.928000|0.928000	0.36995|0.36995	0.989000|0.989000	0.77384|0.77384	0.466000|0.466000	0.22019|0.22019	-0.041000|-0.041000	0.13558|0.13558	0.533000|0.533000	0.62120|0.62120	ATT|AAT		RSPH4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041960.1	NM_001010892	
TMEM200A	114801	hgsc.bcm.edu	37	6	130762503	130762503	+	Silent	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:130762503T>G	ENST00000296978.3	+	3	1807	c.936T>G	c.(934-936)gcT>gcG	p.A312A	TMEM200A_ENST00000545622.1_Silent_p.A312A|TMEM200A_ENST00000392429.1_Silent_p.A312A	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	312						integral component of membrane (GO:0016021)		p.A312A(2)		NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		CTGAAGATGCTGACAACCTCA	0.433																																					p.A312A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T936G	6						.						117.0	110.0	112.0					6																	130762503		2203	4300	6503	130804196	SO:0001819	synonymous_variant	114801	exon2			AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.936T>G	6.37:g.130762503T>G		Somatic		Capture	SOLID	Phase_I	130804196	NM_052913	Q96PX5	Silent	SNP	ENST00000296978.3	37	CCDS5140.1																																																																																				TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042201.1	NM_052913	
EPB41L2	2037	hgsc.bcm.edu	37	6	131191036	131191036	+	Silent	SNP	G	G	T	rs373818716		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:131191036G>T	ENST00000337057.3	-	15	2455	c.2274C>A	c.(2272-2274)ccC>ccA	p.P758P	EPB41L2_ENST00000524581.1_Silent_p.P136P|EPB41L2_ENST00000527411.1_Silent_p.P688P|EPB41L2_ENST00000445890.2_Intron|EPB41L2_ENST00000527659.1_Silent_p.P688P|EPB41L2_ENST00000530481.1_Silent_p.P688P|EPB41L2_ENST00000525271.1_Intron|EPB41L2_ENST00000528282.1_Intron|EPB41L2_ENST00000368128.2_Silent_p.P758P|EPB41L2_ENST00000525193.1_Intron|EPB41L2_ENST00000529208.1_Silent_p.P688P|EPB41L2_ENST00000531410.1_Intron|EPB41L2_ENST00000392427.3_Intron|EPB41L2_ENST00000530757.1_Intron	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	758					cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)	p.P758P(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		CTCGGTGGTGGGGACGGTACT	0.592																																					p.P688P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2064A	6						.						121.0	109.0	113.0					6																	131191036		2203	4300	6503	131232729	SO:0001819	synonymous_variant	2037	exon13			AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.2274C>A	6.37:g.131191036G>T		Somatic		Capture	SOLID	Phase_I	131232729	NM_001199388	B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Silent	SNP	ENST00000337057.3	37	CCDS5141.1	.	.	.	.	.	.	.	.	.	.	G	6.588	0.476910	0.12521	.	.	ENSG00000079819	ENST00000456097	.	.	.	5.6	5.6	0.85130	.	0.133677	0.49916	D	0.000127	T	0.66992	0.2846	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71603	-0.4543	6	0.87932	D	0	.	12.4485	0.55666	0.0:0.0:0.7893:0.2106	.	.	.	.	T	301	.	ENSP00000397580:P301T	P	-	1	0	EPB41L2	131232729	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	1.609000	0.36858	2.641000	0.89580	0.462000	0.41574	CCA		EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042204.3		
TAAR5	9038	hgsc.bcm.edu	37	6	132910231	132910231	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:132910231A>G	ENST00000258034.2	-	1	646	c.595T>C	c.(595-597)Ttt>Ctt	p.F199L		NM_003967.2	NP_003958.2	O14804	TAAR5_HUMAN	trace amine associated receptor 5	199					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|trimethylamine receptor activity (GO:1990081)	p.F199L(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	32	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		CAGCCCCAAAATTTATTGAGC	0.483																																					p.F199L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T595C	6						.						46.0	47.0	46.0					6																	132910231		2202	4299	6501	132951924	SO:0001583	missense	9038	exon1			AF021818	CCDS5156.1	6q23.2	2012-08-08			ENSG00000135569	ENSG00000135569		"""GPCR / Class A : Trace amine associated receptors"""	30236	protein-coding gene	gene with protein product		607405				9464258, 15718104	Standard	NM_003967		Approved	PNR	uc003qdk.2	O14804	OTTHUMG00000015581	ENST00000258034.2:c.595T>C	6.37:g.132910231A>G	ENSP00000258034:p.Phe199Leu	Somatic		Capture	SOLID	Phase_I	132951924	NM_003967	D8KZS1|Q2M1V1|Q4VBL1|Q5VUQ3|Q6NTA8	Missense_Mutation	SNP	ENST00000258034.2	37	CCDS5156.1	.	.	.	.	.	.	.	.	.	.	A	10.66	1.413152	0.25465	.	.	ENSG00000135569	ENST00000258034	T	0.34859	1.34	5.58	3.06	0.35304	GPCR, rhodopsin-like superfamily (1);	0.233454	0.31404	N	0.007706	T	0.01976	0.0062	N	0.00729	-1.24	0.23249	N	0.998049	B	0.02656	0.0	B	0.11329	0.006	T	0.45804	-0.9236	10	0.02654	T	1	-13.4624	4.0997	0.10007	0.4382:0.0:0.0965:0.4654	.	199	O14804	TAAR5_HUMAN	L	199	ENSP00000258034:F199L	ENSP00000258034:F199L	F	-	1	0	TAAR5	132951924	0.000000	0.05858	1.000000	0.80357	0.991000	0.79684	-0.362000	0.07602	1.112000	0.41740	0.533000	0.62120	TTT		TAAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042257.1	NM_003967	
MAP3K5	4217	hgsc.bcm.edu	37	6	136980408	136980408	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:136980408A>G	ENST00000359015.4	-	9	1835	c.1475T>C	c.(1474-1476)aTg>aCg	p.M492T	MAP3K5_ENST00000355845.4_5'Flank	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	492					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)	p.M492T(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		AATGACTCTCATGTGGTCATT	0.383																																					p.M492T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1475C	6						.						80.0	81.0	80.0					6																	136980408		2203	4300	6503	137022101	SO:0001583	missense	4217	exon9			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.1475T>C	6.37:g.136980408A>G	ENSP00000351908:p.Met492Thr	Somatic		Capture	SOLID	Phase_I	137022101	NM_005923	A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	ENST00000359015.4	37	CCDS5179.1	.	.	.	.	.	.	.	.	.	.	A	4.027	0.002413	0.07819	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.08634	3.07	5.92	4.77	0.60923	.	0.708709	0.14909	N	0.291358	T	0.00637	0.0021	N	0.00729	-1.24	0.22412	N	0.999122	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.46076	-0.9217	10	0.09338	T	0.73	.	8.1321	0.31033	0.7873:0.0:0.2127:0.0	.	572;337;492	Q59GL6;B4DF67;Q99683	.;.;M3K5_HUMAN	T	492;572	ENSP00000351908:M492T	ENSP00000351908:M492T	M	-	2	0	MAP3K5	137022101	0.979000	0.34478	0.985000	0.45067	0.997000	0.91878	2.747000	0.47475	1.076000	0.40961	0.528000	0.53228	ATG		MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1		
FBXO30	84085	hgsc.bcm.edu	37	6	146126292	146126292	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:146126292G>T	ENST00000237281.4	-	2	1416	c.1250C>A	c.(1249-1251)cCt>cAt	p.P417H		NM_032145.4	NP_115521.3	Q8TB52	FBX30_HUMAN	F-box protein 30	417							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P417H(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		GAGGCCCATAGGATCTTCTGC	0.418																																					p.P417H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1250A	6						.						200.0	209.0	206.0					6																	146126292		2203	4300	6503	146167985	SO:0001583	missense	84085	exon2			AF248640	CCDS5208.1	6q24	2008-02-05	2004-06-15		ENSG00000118496	ENSG00000118496		"""F-boxes /  ""other"""""	15600	protein-coding gene	gene with protein product		609101	"""F-box only protein, helicase, 18"""				Standard	XM_005267159		Approved	MGC21674, Fbx30	uc003qla.3	Q8TB52	OTTHUMG00000015749	ENST00000237281.4:c.1250C>A	6.37:g.146126292G>T	ENSP00000237281:p.Pro417His	Somatic		Capture	SOLID	Phase_I	146167985	NM_032145	Q9BXZ7	Missense_Mutation	SNP	ENST00000237281.4	37	CCDS5208.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.519491	0.64634	.	.	ENSG00000118496	ENST00000237281	T	0.42900	0.96	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.60495	0.2273	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.60637	-0.7224	10	0.62326	D	0.03	-13.8229	20.1041	0.97884	0.0:0.0:1.0:0.0	.	417	Q8TB52	FBX30_HUMAN	H	417	ENSP00000237281:P417H	ENSP00000237281:P417H	P	-	2	0	FBXO30	146167985	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	9.420000	0.97426	2.826000	0.97356	0.655000	0.94253	CCT		FBXO30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042570.2		
GRM1	2911	hgsc.bcm.edu	37	6	146720157	146720157	+	Missense_Mutation	SNP	G	G	A	rs200495057		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:146720157G>A	ENST00000282753.1	+	7	2217	c.1982G>A	c.(1981-1983)cGc>cAc	p.R661H	GRM1_ENST00000355289.4_Missense_Mutation_p.R661H|GRM1_ENST00000361719.2_Missense_Mutation_p.R661H|GRM1_ENST00000507907.1_Missense_Mutation_p.R661H|GRM1_ENST00000492807.2_Missense_Mutation_p.R661H|GRM1_ENST00000392299.2_Missense_Mutation_p.R661H			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	661					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.R661H(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		TACCTCCAGCGCCTCTTGGTT	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		22918	0.0		0.0	False		,,,				2504	0.001				p.R661H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1982A	6						.						337.0	307.0	317.0					6																	146720157		2203	4300	6503	146761850	SO:0001583	missense	2911	exon8			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.1982G>A	6.37:g.146720157G>A	ENSP00000282753:p.Arg661His	Somatic		Capture	SOLID	Phase_I	146761850	NM_001114329	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.715137	0.89112	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51;-2.51	5.51	5.51	0.81932	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.90769	0.7102	L	0.33245	0.995	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.948;0.999;0.948	D	0.91959	0.5577	10	0.87932	D	0	.	19.4081	0.94656	0.0:0.0:1.0:0.0	.	661;661;661	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	H	661	ENSP00000354896:R661H;ENSP00000376119:R661H;ENSP00000424095:R661H;ENSP00000282753:R661H;ENSP00000347437:R661H;ENSP00000425599:R661H	ENSP00000282753:R661H	R	+	2	0	GRM1	146761850	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.604000	0.88044	0.585000	0.79938	CGC		GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
PLEKHG1	57480	hgsc.bcm.edu	37	6	151161533	151161533	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:151161533A>G	ENST00000358517.2	+	16	3870	c.3659A>G	c.(3658-3660)cAg>cGg	p.Q1220R	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.Q1220R			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	1220							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Q1220R(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		GAGAGTCACCAGGACTTGCTG	0.458																																					p.Q1220R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3659G	6						.						86.0	83.0	84.0					6																	151161533		2203	4300	6503	151203226	SO:0001583	missense	57480	exon17			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.3659A>G	6.37:g.151161533A>G	ENSP00000351318:p.Gln1220Arg	Somatic		Capture	SOLID	Phase_I	151203226	NM_001029884	Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	37	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	A	18.39	3.613974	0.66672	.	.	ENSG00000120278	ENST00000367328;ENST00000358517	T;T	0.60920	0.15;0.15	5.67	5.67	0.87782	.	0.110995	0.64402	D	0.000004	T	0.61776	0.2374	M	0.64997	1.995	0.44789	D	0.997798	D;D	0.69078	0.997;0.997	P;P	0.56042	0.79;0.79	T	0.67852	-0.5563	10	0.87932	D	0	.	15.9173	0.79531	1.0:0.0:0.0:0.0	.	1027;1220	Q5EBL9;Q9ULL1	.;PKHG1_HUMAN	R	1220	ENSP00000356297:Q1220R;ENSP00000351318:Q1220R	ENSP00000351318:Q1220R	Q	+	2	0	PLEKHG1	151203226	1.000000	0.71417	0.999000	0.59377	0.387000	0.30353	8.668000	0.91158	2.170000	0.68504	0.533000	0.62120	CAG		PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
SYNE1	23345	hgsc.bcm.edu	37	6	152650952	152650952	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:152650952C>A	ENST00000367255.5	-	78	15469	c.14868G>T	c.(14866-14868)aaG>aaT	p.K4956N	SYNE1_ENST00000448038.1_Missense_Mutation_p.K4885N|SYNE1_ENST00000423061.1_Missense_Mutation_p.K4885N|SYNE1_ENST00000341594.5_Missense_Mutation_p.K4703N|SYNE1_ENST00000265368.4_Missense_Mutation_p.K4956N	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4956					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.K4956N(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AAATCAGCTCCTTGGCCTTTG	0.473										HNSCC(10;0.0054)																											p.K4885N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G14655T	6						.						227.0	225.0	226.0					6																	152650952		2203	4300	6503	152692645	SO:0001583	missense	23345	exon77			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.14868G>T	6.37:g.152650952C>A	ENSP00000356224:p.Lys4956Asn	Somatic		Capture	SOLID	Phase_I	152692645	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	6.017	0.371434	0.11409	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8	6.03	4.2	0.49525	.	0.000000	0.64402	D	0.000005	T	0.18045	0.0433	L	0.34521	1.04	0.80722	D	1	P;B;B;B	0.36315	0.547;0.412;0.412;0.222	B;B;B;B	0.34093	0.175;0.078;0.078;0.093	T	0.03922	-1.0992	10	0.38643	T	0.18	.	8.583	0.33642	0.0:0.7038:0.0:0.2962	.	4956;4956;4956;4885	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	N	4956;4885;4956;4885;4703	ENSP00000356224:K4956N;ENSP00000396024:K4885N;ENSP00000265368:K4956N;ENSP00000390975:K4885N;ENSP00000341887:K4703N	ENSP00000265368:K4956N	K	-	3	2	SYNE1	152692645	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	0.774000	0.26675	0.827000	0.34685	0.655000	0.94253	AAG		SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE1	23345	hgsc.bcm.edu	37	6	152809633	152809633	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:152809633T>G	ENST00000367255.5	-	12	1546	c.945A>C	c.(943-945)gaA>gaC	p.E315D	SYNE1_ENST00000448038.1_Missense_Mutation_p.E322D|SYNE1_ENST00000466159.2_Missense_Mutation_p.E315D|SYNE1_ENST00000367248.3_Missense_Mutation_p.E305D|SYNE1_ENST00000423061.1_Missense_Mutation_p.E322D|SYNE1_ENST00000413186.2_Missense_Mutation_p.E315D|SYNE1_ENST00000341594.5_Missense_Mutation_p.E315D|SYNE1_ENST00000265368.4_Missense_Mutation_p.E315D|SYNE1_ENST00000367253.4_Missense_Mutation_p.E315D	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	315					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.E315D(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTACTCTGTCTTCTCTCTGGA	0.299										HNSCC(10;0.0054)																											p.E322D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A966C	6						.						96.0	94.0	95.0					6																	152809633		2201	4295	6496	152851326	SO:0001583	missense	23345	exon12			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.945A>C	6.37:g.152809633T>G	ENSP00000356224:p.Glu315Asp	Somatic		Capture	SOLID	Phase_I	152851326	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	12.95	2.090265	0.36855	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	T;T;T;T;T;D;D;D;D;D	0.92446	0.41;0.4;0.31;0.4;0.59;-2.38;-2.63;-2.52;-2.76;-3.04	5.41	2.91	0.33838	.	0.199696	0.34828	N	0.003647	T	0.80929	0.4718	L	0.46885	1.475	0.80722	D	1	B;B;B;B;B	0.14012	0.009;0.002;0.005;0.002;0.004	B;B;B;B;B	0.23419	0.011;0.004;0.046;0.004;0.014	T	0.71813	-0.4479	10	0.24483	T	0.36	.	10.399	0.44218	0.2692:0.0:0.0:0.7308	.	298;315;315;315;322	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	D	315;322;315;322;315;315;305;315;315;298	ENSP00000356224:E315D;ENSP00000396024:E322D;ENSP00000265368:E315D;ENSP00000390975:E322D;ENSP00000341887:E315D;ENSP00000356222:E315D;ENSP00000356217:E305D;ENSP00000414510:E315D;ENSP00000446021:E315D;ENSP00000441264:E298D	ENSP00000265368:E315D	E	-	3	2	SYNE1	152851326	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	1.905000	0.39878	0.315000	0.23110	0.528000	0.53228	GAA		SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
ARID1B	57492	hgsc.bcm.edu	37	6	157502144	157502144	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:157502144G>T	ENST00000350026.5	+	11	3139	c.3138G>T	c.(3136-3138)aaG>aaT	p.K1046N	ARID1B_ENST00000275248.4_Missense_Mutation_p.K1041N|ARID1B_ENST00000367148.1_Missense_Mutation_p.K1099N|ARID1B_ENST00000346085.5_Missense_Mutation_p.K1059N|ARID1B_ENST00000478761.2_3'UTR	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1046					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.K1041N(1)		NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		AGATCACGAAGGTGTACGAGC	0.577																																					p.K1046N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3138T	6						.						80.0	65.0	70.0					6																	157502144		2203	4296	6499	157543836	SO:0001583	missense	57492	exon11			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.3138G>T	6.37:g.157502144G>T	ENSP00000055163:p.Lys1046Asn	Somatic		Capture	SOLID	Phase_I	157543836	NM_017519	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	37	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	G	14.63	2.591929	0.46214	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000354354;ENST00000414678;ENST00000319584;ENST00000400790	T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.76	3.72	0.42706	ARID/BRIGHT DNA-binding domain (2);	0.109101	0.64402	D	0.000009	T	0.18425	0.0442	L	0.53249	1.67	0.37573	D	0.91949	P;P;P;P	0.45126	0.851;0.566;0.693;0.693	B;B;B;B	0.37550	0.253;0.082;0.171;0.171	T	0.13575	-1.0504	10	0.87932	D	0	.	4.4736	0.11724	0.4396:0.0:0.5604:0.0	.	296;1046;1059;1041	Q8NFD5-4;Q8NFD5;Q8NFD5-2;G3XAA0	.;ARI1B_HUMAN;.;.	N	1059;1046;1099;1041;516;568;521;113	ENSP00000344546:K1059N;ENSP00000055163:K1046N;ENSP00000356116:K1099N;ENSP00000275248:K1041N;ENSP00000412835:K568N;ENSP00000313006:K521N;ENSP00000383596:K113N	ENSP00000275248:K1041N	K	+	3	2	ARID1B	157543836	0.990000	0.36364	1.000000	0.80357	0.834000	0.47266	0.218000	0.17622	1.408000	0.46895	0.650000	0.86243	AAG		ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
ZDHHC14	79683	hgsc.bcm.edu	37	6	158014057	158014057	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:158014057G>A	ENST00000359775.5	+	3	1333	c.444G>A	c.(442-444)ccG>ccA	p.P148P	ZDHHC14_ENST00000341375.8_3'UTR|ZDHHC14_ENST00000414563.2_Silent_p.P148P			Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14	148					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.P148P(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	17		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		GGTACCGCCCGCCTCCCAGAA	0.562																																					p.P148P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G444A	6						.						88.0	87.0	87.0					6																	158014057		2203	4296	6499	157934045	SO:0001819	synonymous_variant	79683	exon3			AF542388	CCDS5252.1, CCDS47510.1	6q25.3	2008-05-02			ENSG00000175048	ENSG00000175048		"""Zinc fingers, DHHC-type"""	20341	protein-coding gene	gene with protein product							Standard	NM_024630		Approved	FLJ20984, NEW1CP	uc003qqt.3	Q8IZN3	OTTHUMG00000015896	ENST00000359775.5:c.444G>A	6.37:g.158014057G>A		Somatic		Capture	SOLID	Phase_I	157934045	NM_153746	A6NDB7|Q5JS07|Q5JS08|Q6PHS4|Q8IZN2|Q9H7F1	Silent	SNP	ENST00000359775.5	37	CCDS5252.1	.	.	.	.	.	.	.	.	.	.	G	11.07	1.530616	0.27387	.	.	ENSG00000175048	ENST00000340347	.	.	.	5.71	-5.02	0.02982	.	.	.	.	.	T	0.30386	0.0763	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61168	-0.7117	4	.	.	.	-2.8982	5.965	0.19320	0.3205:0.1007:0.4877:0.0911	.	.	.	.	H	6	.	.	R	+	2	0	ZDHHC14	157934045	0.066000	0.20996	0.996000	0.52242	0.997000	0.91878	-0.566000	0.05922	2.687000	0.91594	0.655000	0.94253	CGC		ZDHHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042841.2	NM_153746	
SYNJ2	8871	hgsc.bcm.edu	37	6	158454667	158454667	+	Silent	SNP	C	C	A	rs192173247	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:158454667C>A	ENST00000355585.4	+	4	741	c.666C>A	c.(664-666)ggC>ggA	p.G222G	SYNJ2_ENST00000449859.2_Silent_p.G171G|SYNJ2_ENST00000367122.2_Silent_p.G222G|SYNJ2_ENST00000367121.3_Silent_p.G222G	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	222	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)	p.G222G(1)		biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		ACACCCGTGGCGTGAACGACG	0.617																																					p.G222G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C666A	6						.						89.0	72.0	78.0					6																	158454667		2203	4300	6503	158374655	SO:0001819	synonymous_variant	8871	exon4			AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.666C>A	6.37:g.158454667C>A		Somatic		Capture	SOLID	Phase_I	158374655	NM_003898	Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Silent	SNP	ENST00000355585.4	37	CCDS5254.1																																																																																				SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042858.2		
SERAC1	84947	hgsc.bcm.edu	37	6	158549197	158549197	+	Missense_Mutation	SNP	G	G	A	rs576130525		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:158549197G>A	ENST00000367104.3	-	10	1089	c.958C>T	c.(958-960)Cgt>Tgt	p.R320C	SERAC1_ENST00000367101.1_Missense_Mutation_p.R320C|SERAC1_ENST00000367102.2_Missense_Mutation_p.R320C	NM_032861.3	NP_116250.3	Q96JX3	SRAC1_HUMAN	serine active site containing 1	320					extracellular matrix organization (GO:0030198)|GPI anchor metabolic process (GO:0006505)|intracellular protein transport (GO:0006886)|phospholipid biosynthetic process (GO:0008654)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)	p.R320C(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	15		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		CCAATGACACGCATTATATTT	0.393													G|||	1	0.000199681	0.0	0.0	5008	,	,		21016	0.0		0.0	False		,,,				2504	0.001				p.R320C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C958T	6						.						140.0	137.0	138.0					6																	158549197		2203	4300	6503	158469185	SO:0001583	missense	84947	exon10			BC001705	CCDS5255.1	6q25.3	2003-05-12			ENSG00000122335	ENSG00000122335			21061	protein-coding gene	gene with protein product		614725					Standard	NM_032861		Approved	FLJ14917	uc003qrc.2	Q96JX3	OTTHUMG00000015905	ENST00000367104.3:c.958C>T	6.37:g.158549197G>A	ENSP00000356071:p.Arg320Cys	Somatic		Capture	SOLID	Phase_I	158469185	NM_032861	Q49AT1|Q5VTX3|Q6PKF3	Missense_Mutation	SNP	ENST00000367104.3	37	CCDS5255.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.290420	0.80914	.	.	ENSG00000122335	ENST00000367102;ENST00000367104;ENST00000367101	T;T;T	0.50548	0.74;0.74;0.74	5.34	4.44	0.53790	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59390	0.2190	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.68943	0.961	T	0.67405	-0.5679	10	0.87932	D	0	-13.066	14.8762	0.70496	0.0:0.0:0.8511:0.1489	.	320	Q96JX3	SRAC1_HUMAN	C	320	ENSP00000356069:R320C;ENSP00000356071:R320C;ENSP00000356068:R320C	ENSP00000356068:R320C	R	-	1	0	SERAC1	158469185	1.000000	0.71417	0.749000	0.31150	0.974000	0.67602	5.906000	0.69900	1.259000	0.44117	0.655000	0.94253	CGT		SERAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042862.1	NM_032861	
SERAC1	84947	hgsc.bcm.edu	37	6	158567844	158567844	+	Missense_Mutation	SNP	G	G	A	rs114627933		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:158567844G>A	ENST00000367104.3	-	6	588	c.457C>T	c.(457-459)Cgg>Tgg	p.R153W	SERAC1_ENST00000607000.1_Missense_Mutation_p.R153W|SERAC1_ENST00000367101.1_Missense_Mutation_p.R153W|SERAC1_ENST00000367102.2_Missense_Mutation_p.R153W	NM_032861.3	NP_116250.3	Q96JX3	SRAC1_HUMAN	serine active site containing 1	153					extracellular matrix organization (GO:0030198)|GPI anchor metabolic process (GO:0006505)|intracellular protein transport (GO:0006886)|phospholipid biosynthetic process (GO:0008654)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)	p.R153W(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	15		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		GACATTTCCCGCACAGCCTCG	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		16176	0.001		0.0	False		,,,				2504	0.0				p.R153W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C457T	6						.						216.0	188.0	197.0					6																	158567844		2203	4300	6503	158487832	SO:0001583	missense	84947	exon6			BC001705	CCDS5255.1	6q25.3	2003-05-12			ENSG00000122335	ENSG00000122335			21061	protein-coding gene	gene with protein product		614725					Standard	NM_032861		Approved	FLJ14917	uc003qrc.2	Q96JX3	OTTHUMG00000015905	ENST00000367104.3:c.457C>T	6.37:g.158567844G>A	ENSP00000356071:p.Arg153Trp	Somatic		Capture	SOLID	Phase_I	158487832	NM_032861	Q49AT1|Q5VTX3|Q6PKF3	Missense_Mutation	SNP	ENST00000367104.3	37	CCDS5255.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	13.43	2.234052	0.39498	.	.	ENSG00000122335	ENST00000367102;ENST00000367104;ENST00000367101	T;T;T	0.44881	0.91;0.91;0.91	5.66	3.68	0.42216	Armadillo-like helical (1);	0.412733	0.29145	N	0.013005	T	0.14830	0.0358	L	0.29908	0.895	0.29598	N	0.847939	D	0.63046	0.992	B	0.42653	0.394	T	0.04593	-1.0940	10	0.72032	D	0.01	-3.8768	7.4278	0.27109	0.0:0.2382:0.409:0.3528	.	153	Q96JX3	SRAC1_HUMAN	W	153	ENSP00000356069:R153W;ENSP00000356071:R153W;ENSP00000356068:R153W	ENSP00000356068:R153W	R	-	1	2	SERAC1	158487832	1.000000	0.71417	0.723000	0.30687	0.010000	0.07245	2.003000	0.40844	0.727000	0.32360	-0.521000	0.04368	CGG		SERAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042862.1	NM_032861	
MYLK4	340156	hgsc.bcm.edu	37	6	2689135	2689135	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:2689135T>C	ENST00000274643.7	-	4	633	c.291A>G	c.(289-291)caA>caG	p.Q97Q	MYLK4_ENST00000268446.5_Silent_p.Q97Q	NM_001012418.3	NP_001012418.2	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4	97						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Q97Q(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				TGACCGCTCCTTGCTTGGCTG	0.473																																					p.Q97Q												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A291G	6						.						204.0	212.0	209.0					6																	2689135		2203	4300	6503	2634134	SO:0001819	synonymous_variant	340156	exon4				CCDS34330.1	6p25.2	2008-01-23			ENSG00000145949	ENSG00000145949			27972	protein-coding gene	gene with protein product	"""caMLCK like"""						Standard	NM_001012418		Approved	SgK085	uc003mty.4	Q86YV6	OTTHUMG00000014121	ENST00000274643.7:c.291A>G	6.37:g.2689135T>C		Somatic		Capture	SOLID	Phase_I	2634134	NM_001012418	A2RUC0|Q5TAW2	Silent	SNP	ENST00000274643.7	37	CCDS34330.1																																																																																				MYLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039632.2	NM_001012418	
SERPINB9	5272	hgsc.bcm.edu	37	6	2890502	2890502	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:2890502G>A	ENST00000380698.4	-	7	1115	c.1026C>T	c.(1024-1026)tgC>tgT	p.C342C		NM_004155.5	NP_004146.1	P50453	SPB9_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 9	342					cellular response to estrogen stimulus (GO:0071391)|immune response (GO:0006955)|mast cell mediated immunity (GO:0002448)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.C342C(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(5)|pancreas(1)|prostate(1)	15	Ovarian(93;0.0412)	all_hematologic(90;0.108)				CAGATTCCATGCAGCACTCTG	0.532																																					p.C342C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1026T	6						.						97.0	85.0	89.0					6																	2890502		2203	4300	6503	2835501	SO:0001819	synonymous_variant	5272	exon7			L40378	CCDS4478.1	6p25.2	2014-02-18	2005-08-18		ENSG00000170542	ENSG00000170542		"""Serine (or cysteine) peptidase inhibitors"""	8955	protein-coding gene	gene with protein product		601799	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 9"""	PI9		8530382, 9858835, 24172014	Standard	NM_004155		Approved	CAP3	uc003mug.4	P50453	OTTHUMG00000014131	ENST00000380698.4:c.1026C>T	6.37:g.2890502G>A		Somatic		Capture	SOLID	Phase_I	2835501	NM_004155	B2RBW3|Q5TD03	Silent	SNP	ENST00000380698.4	37	CCDS4478.1																																																																																				SERPINB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039656.1		
NRN1	51299	hgsc.bcm.edu	37	6	5999293	5999293	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:5999293G>A	ENST00000244766.2	-	3	562	c.345C>T	c.(343-345)aaC>aaT	p.N115N	NRN1_ENST00000495850.1_5'UTR	NM_001278710.1|NM_016588.2	NP_001265639.1|NP_057672.1	Q9NPD7	NRN1_HUMAN	neuritin 1	115				SGN -> RAT (in Ref. 3; AAP97232). {ECO:0000305}.	nervous system development (GO:0007399)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|anchored component of membrane (GO:0031225)|cell junction (GO:0030054)|synapse (GO:0045202)		p.N115N(1)		endometrium(2)|large_intestine(2)|lung(4)	8	Ovarian(93;0.0816)	all_hematologic(90;0.151)		OV - Ovarian serous cystadenocarcinoma(45;0.00415)		CCGCCGCCCCGTTGCCGCTGC	0.587																																					p.N115N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C345T	6						.						62.0	61.0	61.0					6																	5999293		2203	4300	6503	5944292	SO:0001819	synonymous_variant	51299	exon3			AF136631	CCDS4495.1, CCDS75393.1	6p25.1	2008-02-05			ENSG00000124785	ENSG00000124785			17972	protein-coding gene	gene with protein product		607409				9122250	Standard	NM_016588		Approved	NRN	uc003mwu.3	Q9NPD7	OTTHUMG00000014184	ENST00000244766.2:c.345C>T	6.37:g.5999293G>A		Somatic		Capture	SOLID	Phase_I	5944292	NM_016588	B2RA93|Q7Z4Y1	Silent	SNP	ENST00000244766.2	37	CCDS4495.1																																																																																				NRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039753.1		
DCDC2	51473	hgsc.bcm.edu	37	6	24357803	24357803	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:24357803A>C	ENST00000378454.3	-	1	477	c.176T>G	c.(175-177)tTt>tGt	p.F59C	KAAG1_ENST00000274766.1_5'UTR	NM_001195610.1|NM_016356.3	NP_001182539.1|NP_057440.2	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	59	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				cellular defense response (GO:0006968)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|neuron migration (GO:0001764)|visual learning (GO:0008542)			p.F59C(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32		Ovarian(999;0.101)				GACGGCCCCAAAGGGTGCCTG	0.627																																					p.F59C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T176G	6						.						38.0	39.0	39.0					6																	24357803		2203	4300	6503	24465782	SO:0001583	missense	51473	exon2			AB032980	CCDS4550.1	6p22.1	2008-02-05			ENSG00000146038	ENSG00000146038			18141	protein-coding gene	gene with protein product		605755				10601354, 10574461	Standard	NM_001195610		Approved	RU2, KIAA1154, DCDC2A	uc003ndx.3	Q9UHG0	OTTHUMG00000016275	ENST00000378454.3:c.176T>G	6.37:g.24357803A>C	ENSP00000367715:p.Phe59Cys	Somatic		Capture	SOLID	Phase_I	24465782	NM_001195610	Q5VTR8|Q5VTR9|Q86W35|Q9UFD1|Q9UHG1|Q9ULR6	Missense_Mutation	SNP	ENST00000378454.3	37	CCDS4550.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.92|19.92	3.916697|3.916697	0.73098|0.73098	.|.	.|.	ENSG00000146038|ENSG00000146038	ENST00000378454;ENST00000451359|ENST00000436313	D|.	0.92495|.	-3.05|.	5.66|5.66	5.66|5.66	0.87406|0.87406	Doublecortin domain (5);|.	0.052314|.	0.85682|.	D|.	0.000000|.	T|T	0.75510|0.75510	0.3859|0.3859	M|M	0.86651|0.86651	2.83|2.83	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.79519|0.79519	-0.1770|-0.1770	10|5	0.56958|.	D|.	0.05|.	-20.1369|-20.1369	15.9043|15.9043	0.79412|0.79412	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	59|.	Q9UHG0|.	DCDC2_HUMAN|.	C|V	59|27	ENSP00000367715:F59C|.	ENSP00000367715:F59C|.	F|L	-|-	2|1	0|2	DCDC2|DCDC2	24465782|24465782	1.000000|1.000000	0.71417|0.71417	0.970000|0.970000	0.41538|0.41538	0.471000|0.471000	0.32888|0.32888	9.011000|9.011000	0.93618|0.93618	2.160000|2.160000	0.67779|0.67779	0.528000|0.528000	0.53228|0.53228	TTT|TTG		DCDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043604.1	NM_016356	
ALDH5A1	7915	hgsc.bcm.edu	37	6	24523085	24523085	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:24523085C>T	ENST00000357578.3	+	7	1250	c.1105C>T	c.(1105-1107)Cgc>Tgc	p.R369C	ALDH5A1_ENST00000546278.1_Missense_Mutation_p.R281C|ALDH5A1_ENST00000491546.1_Missense_Mutation_p.R341C|ALDH5A1_ENST00000348925.2_Missense_Mutation_p.R382C	NM_001080.3	NP_001071.1	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5 family, member A1	369					acetate metabolic process (GO:0006083)|central nervous system development (GO:0007417)|galactosylceramide metabolic process (GO:0006681)|gamma-aminobutyric acid catabolic process (GO:0009450)|glucose metabolic process (GO:0006006)|glucosylceramide metabolic process (GO:0006678)|glutamate metabolic process (GO:0006536)|glutamine metabolic process (GO:0006541)|glutathione metabolic process (GO:0006749)|glycerophospholipid metabolic process (GO:0006650)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|respiratory electron transport chain (GO:0022904)|short-chain fatty acid metabolic process (GO:0046459)|succinate metabolic process (GO:0006105)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	protein homodimerization activity (GO:0042803)|succinate-semialdehyde dehydrogenase (NAD+) activity (GO:0004777)|succinate-semialdehyde dehydrogenase [NAD(P)+] activity (GO:0009013)	p.R382C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|skin(2)|urinary_tract(1)	20					Chlormerodrin(DB00534)|Succinic acid(DB00139)|Valproic Acid(DB00313)	GAAGAACCTGCGCGTAGGTAA	0.413																																					p.R382C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1144T	6						.						131.0	132.0	132.0					6																	24523085		2203	4300	6503	24631064	SO:0001583	missense	7915	exon8			L34820	CCDS4555.1, CCDS4556.1	6p22	2013-06-03	2008-07-31		ENSG00000112294	ENSG00000112294	1.2.1.24	"""Aldehyde dehydrogenases"""	408	protein-coding gene	gene with protein product	"""succinate-semialdehyde dehydrogenase"""	610045				7814412, 9059628	Standard	NM_001080		Approved	SSADH, SSDH	uc003nef.3	P51649	OTTHUMG00000014356	ENST00000357578.3:c.1105C>T	6.37:g.24523085C>T	ENSP00000350191:p.Arg369Cys	Somatic		Capture	SOLID	Phase_I	24631064	NM_170740	B2RD26|G5E949|Q546H9|Q8N3W6	Missense_Mutation	SNP	ENST00000357578.3	37	CCDS4555.1	.	.	.	.	.	.	.	.	.	.	C	11.24	1.581095	0.28180	.	.	ENSG00000112294	ENST00000357578;ENST00000546278;ENST00000491546;ENST00000348925	T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18	5.2	5.2	0.72013	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.424252	0.26140	N	0.026102	T	0.78648	0.4316	M	0.90425	3.115	0.58432	D	0.999999	B;B	0.20164	0.03;0.042	B;B	0.14023	0.01;0.009	T	0.78365	-0.2232	10	0.87932	D	0	-11.4516	19.2916	0.94102	0.0:1.0:0.0:0.0	.	369;382	P51649;G5E949	SSDH_HUMAN;.	C	369;281;341;382	ENSP00000350191:R369C;ENSP00000438193:R281C;ENSP00000417687:R341C;ENSP00000314649:R382C	ENSP00000314649:R382C	R	+	1	0	ALDH5A1	24631064	0.395000	0.25254	0.518000	0.27811	0.017000	0.09413	2.695000	0.47043	2.861000	0.98227	0.655000	0.94253	CGC		ALDH5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040007.2		
HIST1H4E	8367	hgsc.bcm.edu	37	6	26205178	26205178	+	Silent	SNP	C	C	T	rs116339316	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:26205178C>T	ENST00000360441.4	+	1	321	c.306C>T	c.(304-306)ggC>ggT	p.G102G		NM_003545.3	NP_003536.1	P62805	H4_HUMAN	histone cluster 1, H4e	102					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.G102G(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	18		all_hematologic(11;0.196)				ACGGCTTCGGCGGCTAATGCT	0.537																																					p.G102G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C306T	6						.						100.0	87.0	91.0					6																	26205178		2203	4300	6503	26313157	SO:0001819	synonymous_variant	8367	exon1			Z80787	CCDS4593.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198518	ENSG00000276966		"""Histones / Replication-dependent"""	4790	protein-coding gene	gene with protein product		602830	"""H4 histone family, member J"", ""histone 1, H4e"""	H4FJ		9119399, 12408966	Standard	NM_003545		Approved	H4/j	uc003ngy.3	P62805	OTTHUMG00000014441	ENST00000360441.4:c.306C>T	6.37:g.26205178C>T		Somatic		Capture	SOLID	Phase_I	26313157	NM_003545	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	ENST00000360441.4	37	CCDS4593.1																																																																																				HIST1H4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040104.1	NM_003545	
BTN3A1	11119	hgsc.bcm.edu	37	6	26413606	26413606	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:26413606G>A	ENST00000289361.6	+	10	1596	c.1228G>A	c.(1228-1230)Ggg>Agg	p.G410R	BTN3A1_ENST00000414912.2_Missense_Mutation_p.G358R	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	410	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G410R(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						GTGGCATATAGGGGTGTGCAG	0.473																																					p.G358R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1072A	6						.						161.0	167.0	165.0					6																	26413606		2203	4300	6503	26521585	SO:0001583	missense	11119	exon10			U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.1228G>A	6.37:g.26413606G>A	ENSP00000289361:p.Gly410Arg	Somatic		Capture	SOLID	Phase_I	26521585	NM_001145008	A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Missense_Mutation	SNP	ENST00000289361.6	37	CCDS4608.1	.	.	.	.	.	.	.	.	.	.	.	22.1	4.249671	0.80024	.	.	ENSG00000026950	ENST00000289361;ENST00000414912	D;D	0.99201	-5.55;-5.55	2.31	2.31	0.28768	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	D	0.99551	0.9839	H	0.99286	4.5	0.40298	D	0.978572	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98132	1.0431	9	0.87932	D	0	.	10.6762	0.45787	0.0:0.0:1.0:0.0	.	358;410	E9PGB4;O00481	.;BT3A1_HUMAN	R	410;358	ENSP00000289361:G410R;ENSP00000406667:G358R	ENSP00000289361:G410R	G	+	1	0	BTN3A1	26521585	1.000000	0.71417	0.042000	0.18584	0.410000	0.31052	6.080000	0.71299	1.573000	0.49748	0.609000	0.83330	GGG		BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040112.3		
ZKSCAN8	7745	hgsc.bcm.edu	37	6	28121315	28121315	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:28121315G>A	ENST00000330236.6	+	6	1441	c.1257G>A	c.(1255-1257)gcG>gcA	p.A419A	ZKSCAN8_ENST00000457389.2_Silent_p.A419A	NM_001278119.1|NM_001278121.1|NM_001278122.1|NM_006298.2	NP_001265048.1|NP_001265050.1|NP_001265051.1|NP_006289.2	Q15776	ZKSC8_HUMAN	zinc finger with KRAB and SCAN domains 8	419					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A419A(1)									GTCAGAGTGCGGGCCTTATTC	0.498																																					p.A419A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1257A	6						.						77.0	81.0	80.0					6																	28121315		2203	4300	6503	28229294	SO:0001819	synonymous_variant	7745	exon6				CCDS4645.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000198315	ENSG00000198315		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12983	protein-coding gene	gene with protein product		602240	"""zinc finger protein 192"""	ZNF192			Standard	NM_001278119		Approved	LD5-1, ZSCAN40	uc003nkn.2	Q15776	OTTHUMG00000014510	ENST00000330236.6:c.1257G>A	6.37:g.28121315G>A		Somatic		Capture	SOLID	Phase_I	28229294	NM_006298	A1L3D4|B4DYF1|Q4VAR1|Q4VAR2|Q4VAR3|Q9H4T1	Silent	SNP	ENST00000330236.6	37	CCDS4645.1																																																																																				ZKSCAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040178.2		
GABBR1	2550	hgsc.bcm.edu	37	6	29572395	29572395	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:29572395C>T	ENST00000377034.4	-	22	2923	c.2588G>A	c.(2587-2589)cGa>cAa	p.R863Q	GABBR1_ENST00000377016.4_Missense_Mutation_p.R801Q|GABBR1_ENST00000355973.3_Missense_Mutation_p.R746Q|GABBR1_ENST00000376977.3_3'UTR|GABBR1_ENST00000377012.4_Missense_Mutation_p.R746Q	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	863					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.R863Q(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	CCATTCCCCTCGGGTGATCAG	0.592																																					p.R801Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2402A	6						.						128.0	106.0	114.0					6																	29572395		1510	2709	4219	29680374	SO:0001583	missense	2550	exon21			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.2588G>A	6.37:g.29572395C>T	ENSP00000366233:p.Arg863Gln	Somatic		Capture	SOLID	Phase_I	29680374	NM_021904	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	37	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.947174	0.92593	.	.	ENSG00000204681	ENST00000355973;ENST00000377016;ENST00000377012;ENST00000377034	D;D;D;T	0.83755	-1.76;-1.66;-1.76;-0.54	4.74	4.74	0.60224	GPCR, family 3, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.81889	0.4918	L	0.29908	0.895	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.77557	0.99;0.978;0.978	T	0.79787	-0.1656	10	0.30078	T	0.28	-1.1847	15.6169	0.76775	0.0:1.0:0.0:0.0	.	801;863;746	Q9UBS5-3;Q9UBS5;Q5SUJ9	.;GABR1_HUMAN;.	Q	746;801;746;863	ENSP00000348248:R746Q;ENSP00000366215:R801Q;ENSP00000366211:R746Q;ENSP00000366233:R863Q	ENSP00000348248:R746Q	R	-	2	0	GABBR1	29680374	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.099000	0.76981	2.639000	0.89480	0.655000	0.94253	CGA		GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
TRIM40	135644	hgsc.bcm.edu	37	6	30113786	30113786	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:30113786C>T	ENST00000396581.1	+	3	747	c.361C>T	c.(361-363)Cgg>Tgg	p.R121W	TRIM40_ENST00000376724.2_Missense_Mutation_p.R121W|TRIM40_ENST00000307859.4_Missense_Mutation_p.R121W			Q6P9F5	TRI40_HUMAN	tripartite motif containing 40	121					negative regulation of cell growth (GO:0030308)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein localization to nucleus (GO:1900181)|protein neddylation (GO:0045116)	IkappaB kinase complex (GO:0008385)	zinc ion binding (GO:0008270)	p.R121W(1)		ovary(1)	1						ACTCAATCGCCGGAGCAGGAA	0.572																																					p.R121W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C361T	6						.						63.0	54.0	57.0					6																	30113786		1511	2709	4220	30221765	SO:0001583	missense	135644	exon2			AF489517	CCDS4675.1, CCDS69069.1	6p21.31	2013-01-09	2011-01-25		ENSG00000204614	ENSG00000204614		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18736	protein-coding gene	gene with protein product			"""tripartite motif-containing 40"""				Standard	NM_138700		Approved	RNF35	uc003npm.2	Q6P9F5	OTTHUMG00000031083	ENST00000396581.1:c.361C>T	6.37:g.30113786C>T	ENSP00000379826:p.Arg121Trp	Somatic		Capture	SOLID	Phase_I	30221765	NM_138700	Q5SRJ6|Q5SS36|Q8TD96	Missense_Mutation	SNP	ENST00000396581.1	37		.	.	.	.	.	.	.	.	.	.	C	12.21	1.868763	0.32977	.	.	ENSG00000204614	ENST00000396581;ENST00000376724;ENST00000307859	T;T;T	0.57273	0.41;0.41;0.41	4.82	-5.89	0.02282	.	0.465710	0.17254	N	0.181059	T	0.50017	0.1591	M	0.64997	1.995	0.09310	N	1	D;D	0.76494	0.999;0.999	P;P	0.61722	0.798;0.893	T	0.64183	-0.6467	10	0.62326	D	0.03	.	17.5651	0.87917	0.2113:0.7887:0.0:0.0	.	121;121	Q5SRJ6;Q6P9F5	.;TRI40_HUMAN	W	121	ENSP00000379826:R121W;ENSP00000365914:R121W;ENSP00000308310:R121W	ENSP00000308310:R121W	R	+	1	2	TRIM40	30221765	0.000000	0.05858	0.001000	0.08648	0.292000	0.27327	-0.628000	0.05515	-0.786000	0.04516	-1.450000	0.01041	CGG		TRIM40-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000076117.2		
MDC1	9656	hgsc.bcm.edu	37	6	30671907	30671907	+	Silent	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:30671907T>G	ENST00000376406.3	-	10	5700	c.5053A>C	c.(5053-5055)Agg>Cgg	p.R1685R	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Silent_p.R1421R	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1685					DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)	p.R1685R(1)		breast(2)|kidney(1)|ovary(1)	4						GTGGAAGACCTCAGTGTTTTG	0.537								Other conserved DNA damage response genes																													p.R1685R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A5053C	6						.						105.0	112.0	109.0					6																	30671907		2203	4300	6503	30779886	SO:0001819	synonymous_variant	9656	exon10			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.5053A>C	6.37:g.30671907T>G		Somatic		Capture	SOLID	Phase_I	30779886	NM_014641	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Silent	SNP	ENST00000376406.3	37	CCDS34384.1																																																																																				MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
PRRC2A	7916	hgsc.bcm.edu	37	6	31600384	31600384	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:31600384C>T	ENST00000376033.2	+	16	4168	c.3934C>T	c.(3934-3936)Cag>Tag	p.Q1312*	PRRC2A_ENST00000376007.4_Nonsense_Mutation_p.Q1312*	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1312	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.Q1312*(1)		breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						TCTGTCAAACCAGAACTCAGA	0.602																																					p.Q1312X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3934T	6						.						82.0	89.0	86.0					6																	31600384		1511	2709	4220	31708363	SO:0001587	stop_gained	7916	exon16			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.3934C>T	6.37:g.31600384C>T	ENSP00000365201:p.Gln1312*	Somatic		Capture	SOLID	Phase_I	31708363	NM_004638	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Nonsense_Mutation	SNP	ENST00000376033.2	37	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	C	44	11.033199	0.99506	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	.	.	.	5.22	5.22	0.72569	.	0.000000	0.53938	D	0.000056	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-14.5556	13.4378	0.61094	0.0:0.8423:0.1577:0.0	.	.	.	.	X	1306;1295;1312;1312;537	.	ENSP00000365175:Q1312X	Q	+	1	0	PRRC2A	31708363	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.339000	0.65953	2.714000	0.92807	0.561000	0.74099	CAG		PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	
HSPA1L	3305	hgsc.bcm.edu	37	6	31778363	31778363	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:31778363G>A	ENST00000375654.4	-	2	1576	c.1387C>T	c.(1387-1389)Ctg>Ttg	p.L463L	HSPA1L_ENST00000417199.3_Silent_p.L463L	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	463					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)	p.L463L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						ATTCCAGTCAGGTCAAACCGC	0.547																																					p.L463L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1387T	6						.						123.0	116.0	119.0					6																	31778363		2203	4300	6503	31886342	SO:0001819	synonymous_variant	3305	exon2			D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1387C>T	6.37:g.31778363G>A		Somatic		Capture	SOLID	Phase_I	31886342	NM_005527	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Silent	SNP	ENST00000375654.4	37	CCDS34413.1																																																																																				HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
SLC44A4	80736	hgsc.bcm.edu	37	6	31831440	31831440	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:31831440G>A	ENST00000229729.6	-	21	2117	c.2097C>T	c.(2095-2097)aaC>aaT	p.N699N	NEU1_ENST00000375631.4_5'Flank|SLC44A4_ENST00000375562.4_Silent_p.N657N|SLC44A4_ENST00000544672.1_Silent_p.N623N	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	699					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N699N(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	GGGGCGCCTCGTTCTTCTTGC	0.597																																					p.N657N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1971T	6						.						66.0	60.0	62.0					6																	31831440		1511	2709	4220	31939419	SO:0001819	synonymous_variant	80736	exon20			AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.2097C>T	6.37:g.31831440G>A		Somatic		Capture	SOLID	Phase_I	31939419	NM_001178044	A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Silent	SNP	ENST00000229729.6	37	CCDS4724.2																																																																																				SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076234.3		
AGPAT1	10554	hgsc.bcm.edu	37	6	32137083	32137083	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:32137083G>A	ENST00000395499.1	-	7	1401	c.822C>T	c.(820-822)gaC>gaT	p.D274D	AGPAT1_ENST00000375107.3_Silent_p.D274D|AGPAT1_ENST00000395497.1_Silent_p.D274D|AGPAT1_ENST00000395496.1_Silent_p.D274D|AGPAT1_ENST00000490711.1_5'UTR|AGPAT1_ENST00000336984.6_Silent_p.D274D|AGPAT1_ENST00000375104.2_Silent_p.D274D|AGPAT1_ENST00000412465.2_Silent_p.D162D|PPT2-EGFL8_ENST00000422437.1_3'UTR			Q99943	PLCA_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 1	274					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.D274D(1)		central_nervous_system(1)|large_intestine(3)|lung(6)|ovary(2)	12						TCTTCAGATAGTCACCACCAC	0.617																																					p.D274D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C822T	6						.						83.0	83.0	83.0					6																	32137083		1511	2709	4220	32245061	SO:0001819	synonymous_variant	10554	exon7			U56417	CCDS4744.1	6p21.3	2013-02-05	2013-02-05		ENSG00000204310	ENSG00000204310	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	324	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, alpha"""	603099	"""1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)"""			9461603, 9291118	Standard	NM_032741		Approved	LPAAT-alpha	uc003oae.3	Q99943	OTTHUMG00000031210	ENST00000395499.1:c.822C>T	6.37:g.32137083G>A		Somatic		Capture	SOLID	Phase_I	32245061	NM_032741	A2BFI5|Q5BL03	Silent	SNP	ENST00000395499.1	37	CCDS4744.1																																																																																				AGPAT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268941.1	NM_006411	
COL11A2	1302	hgsc.bcm.edu	37	6	33146105	33146105	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:33146105G>A	ENST00000374708.4	-	18	1798	c.1540C>T	c.(1540-1542)Cga>Tga	p.R514*	COL11A2_ENST00000477772.1_5'Flank|COL11A2_ENST00000395197.1_Nonsense_Mutation_p.R540*|COL11A2_ENST00000341947.2_Nonsense_Mutation_p.R600*|COL11A2_ENST00000361917.1_Nonsense_Mutation_p.R493*|COL11A2_ENST00000374712.1_Nonsense_Mutation_p.R519*|COL11A2_ENST00000357486.1_Nonsense_Mutation_p.R579*|COL11A2_ENST00000374714.1_Nonsense_Mutation_p.R574*|COL11A2_ENST00000374713.1_Nonsense_Mutation_p.R553*	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	600	Collagen-like 2.|Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.R600*(1)		biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						GGCAGCCCTCGAGGCCCAATC	0.627																																					p.R514X	Melanoma(1;90 116 3946 5341 17093)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1540T	6						.						97.0	92.0	94.0					6																	33146105		1511	2709	4220	33254083	SO:0001587	stop_gained	1302	exon18			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1540C>T	6.37:g.33146105G>A	ENSP00000363840:p.Arg514*	Somatic		Capture	SOLID	Phase_I	33254083	NM_080681	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Nonsense_Mutation	SNP	ENST00000374708.4	37	CCDS43452.1	.	.	.	.	.	.	.	.	.	.	G	40	8.006014	0.98605	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000457788	.	.	.	4.13	4.13	0.48395	.	0.064498	0.56097	D	0.000025	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9342	0.64015	0.0:0.0:1.0:0.0	.	.	.	.	X	514;600;579;574;553;540;519;493;600	.	ENSP00000339915:R600X	R	-	1	2	COL11A2	33254083	0.424000	0.25490	0.999000	0.59377	0.961000	0.63080	1.242000	0.32755	2.124000	0.65301	0.448000	0.29417	CGA		COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2		
B3GALT4	8705	hgsc.bcm.edu	37	6	33246144	33246144	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:33246144C>G	ENST00000451237.1	+	1	1228	c.948C>G	c.(946-948)caC>caG	p.H316Q		NM_003782.3	NP_003773.1	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4	316					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ganglioside galactosyltransferase activity (GO:0047915)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)	p.H316Q(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	13						GTGCCACCCACTACCCGCTAG	0.617																																					p.H316Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C948G	6						.						77.0	82.0	80.0					6																	33246144		2203	4300	6503	33354122	SO:0001583	missense	8705	exon1			Y15061	CCDS34425.1	6p21.3	2013-02-19			ENSG00000235863	ENSG00000235863		"""Beta 3-glycosyltransferases"""	919	protein-coding gene	gene with protein product		603095				9582303	Standard	NM_003782		Approved	beta3Gal-T4, GalT4	uc003odr.3	O96024	OTTHUMG00000031100	ENST00000451237.1:c.948C>G	6.37:g.33246144C>G	ENSP00000390784:p.His316Gln	Somatic		Capture	SOLID	Phase_I	33354122	NM_003782		Missense_Mutation	SNP	ENST00000451237.1	37	CCDS34425.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.445289	0.25987	.	.	ENSG00000235863	ENST00000451237	T	0.46819	0.86	4.29	2.28	0.28536	.	0.706692	0.13463	N	0.385991	T	0.10680	0.0261	N	0.24115	0.695	0.30305	N	0.789079	P	0.42827	0.791	B	0.34385	0.181	T	0.05257	-1.0896	10	0.20046	T	0.44	.	6.1578	0.20348	0.1783:0.7103:0.0:0.1114	.	316	O96024	B3GT4_HUMAN	Q	316	ENSP00000390784:H316Q	ENSP00000390784:H316Q	H	+	3	2	B3GALT4	33354122	0.126000	0.22350	1.000000	0.80357	0.927000	0.56198	0.445000	0.21677	0.943000	0.37553	-0.366000	0.07423	CAC		B3GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076162.2		
SLC26A8	116369	hgsc.bcm.edu	37	6	35967770	35967770	+	Splice_Site	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:35967770A>G	ENST00000490799.1	-	4	797	c.444T>C	c.(442-444)atT>atC	p.I148I	SLC26A8_ENST00000394602.2_Splice_Site_p.I148I|SLC26A8_ENST00000355574.2_Splice_Site_p.I148I	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8									p.I148I(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						TGAACTCACCAATGGACATTT	0.398																																					p.I148I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T444C	6						.						164.0	167.0	166.0					6																	35967770		2203	4300	6503	36075748	SO:0001630	splice_region_variant	116369	exon4			AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.445+1T>C	6.37:g.35967770A>G		Somatic		Capture	SOLID	Phase_I	36075748	NM_052961		Silent	SNP	ENST00000490799.1	37	CCDS4813.1																																																																																				SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040325.2		Silent
DNAH8	1769	hgsc.bcm.edu	37	6	38729519	38729519	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:38729519T>C	ENST00000359357.3	+	9	1160	c.906T>C	c.(904-906)acT>acC	p.T302T	DNAH8_ENST00000449981.2_Silent_p.T519T|DNAH8_ENST00000441566.1_Silent_p.T302T			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	302					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T302T(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CATATATTACTGATGGAGGAT	0.264																																					p.T302T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T906C	6						.						84.0	88.0	86.0					6																	38729519		2203	4299	6502	38837497	SO:0001819	synonymous_variant	1769	exon9			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.906T>C	6.37:g.38729519T>C		Somatic		Capture	SOLID	Phase_I	38837497	NM_001371	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37																																																																																					DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
DNAH8	1769	hgsc.bcm.edu	37	6	38850746	38850746	+	Missense_Mutation	SNP	C	C	A	rs369613804		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:38850746C>A	ENST00000359357.3	+	52	7522	c.7268C>A	c.(7267-7269)cCg>cAg	p.P2423Q	DNAH8_ENST00000449981.2_Missense_Mutation_p.P2640Q|DNAH8_ENST00000441566.1_Missense_Mutation_p.P2387Q			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2423	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.P2423Q(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GACAGTATTCCGGAATATTCA	0.284																																					p.P2423Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C7268A	6						.						94.0	103.0	100.0					6																	38850746		2203	4296	6499	38958724	SO:0001583	missense	1769	exon52			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.7268C>A	6.37:g.38850746C>A	ENSP00000352312:p.Pro2423Gln	Somatic		Capture	SOLID	Phase_I	38958724	NM_001371	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	C	22.7	4.318296	0.81469	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.16597	2.33;2.33;2.33	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.39064	0.1064	M	0.83692	2.655	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.06267	-1.0836	10	0.27082	T	0.32	.	20.1991	0.98252	0.0:1.0:0.0:0.0	.	2423	Q96JB1	DYH8_HUMAN	Q	2628;2628;2423;2387	ENSP00000333363:P2628Q;ENSP00000352312:P2423Q;ENSP00000402294:P2387Q	ENSP00000333363:P2628Q	P	+	2	0	DNAH8	38958724	1.000000	0.71417	0.998000	0.56505	0.590000	0.36582	7.788000	0.85771	2.775000	0.95449	0.650000	0.86243	CCG		DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
DNAH8	1769	hgsc.bcm.edu	37	6	38867575	38867575	+	Silent	SNP	G	G	A	rs201691475	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:38867575G>A	ENST00000359357.3	+	60	8690	c.8436G>A	c.(8434-8436)tcG>tcA	p.S2812S	DNAH8_ENST00000449981.2_Silent_p.S3029S|DNAH8_ENST00000441566.1_Silent_p.S2776S			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2812	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.S2812S(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TTCGAACGTCGTGTGGAAATG	0.368													G|||	2	0.000399361	0.0	0.0	5008	,	,		17206	0.0		0.001	False		,,,				2504	0.001				p.S2812S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G8436A	6						.	G		0,4406		0,0,2203	144.0	133.0	137.0		9087	-9.1	0.7	6		137	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	DNAH8	NM_001206927.1		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		3029/4708	38867575	2,13004	2203	4300	6503	38975553	SO:0001819	synonymous_variant	1769	exon60			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.8436G>A	6.37:g.38867575G>A		Somatic		Capture	SOLID	Phase_I	38975553	NM_001371	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37																																																																																					DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
TREM2	54209	hgsc.bcm.edu	37	6	41129237	41129237	+	Missense_Mutation	SNP	C	C	T	rs374851046		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:41129237C>T	ENST00000373113.3	-	2	248	c.155G>A	c.(154-156)cGc>cAc	p.R52H	TREM2_ENST00000373122.4_Missense_Mutation_p.R52H|TREM2_ENST00000338469.3_Missense_Mutation_p.R52H	NM_018965.2	NP_061838.1	Q9NZC2	TREM2_HUMAN	triggering receptor expressed on myeloid cells 2	52	Ig-like V-type.				axon guidance (GO:0007411)|dendritic cell differentiation (GO:0097028)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|positive regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002588)|positive regulation of C-C chemokine receptor CCR7 signaling pathway (GO:1903082)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of CD40 signaling pathway (GO:2000350)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein localization to plasma membrane (GO:1903078)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)	p.R52H(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	11	Ovarian(28;0.0418)|Colorectal(47;0.196)					TCCCAGCTGGCGGCACCAGGC	0.632																																					p.R52H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G155A	6						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	71.0	63.0	66.0		155	5.5	1.0	6		66	0,8600		0,0,4300	no	missense	TREM2	NM_018965.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	52/231	41129237	1,13005	2203	4300	6503	41237215	SO:0001583	missense	54209	exon2			AF213457	CCDS4852.1, CCDS64422.1	6p21.1	2014-09-17	2002-08-15		ENSG00000095970	ENSG00000095970		"""Immunoglobulin superfamily / V-set domain containing"""	17761	protein-coding gene	gene with protein product		605086	"""triggering receptor expressed on myeloid cells 2a"""			10799849, 12080485	Standard	NM_001271821		Approved	TREM-2, Trem2a, Trem2b, Trem2c	uc003opy.3	Q9NZC2	OTTHUMG00000014671	ENST00000373113.3:c.155G>A	6.37:g.41129237C>T	ENSP00000362205:p.Arg52His	Somatic		Capture	SOLID	Phase_I	41237215	NM_018965	Q8N5H8|Q8WYN6	Missense_Mutation	SNP	ENST00000373113.3	37	CCDS4852.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.315177	0.81358	2.27E-4	0.0	ENSG00000095970	ENST00000373113;ENST00000338469;ENST00000373122	T;T;T	0.70749	-0.51;-0.51;-0.51	5.51	5.51	0.81932	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000004	T	0.79227	0.4410	M	0.76002	2.32	0.37590	D	0.920136	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.987;1.0	T	0.82057	-0.0646	10	0.66056	D	0.02	-38.4295	12.0197	0.53336	0.0:0.9178:0.0:0.0822	.	52;52;52	Q9NZC2-2;Q9NZC2-3;Q9NZC2	.;.;TREM2_HUMAN	H	52	ENSP00000362205:R52H;ENSP00000342651:R52H;ENSP00000362214:R52H	ENSP00000342651:R52H	R	-	2	0	TREM2	41237215	0.998000	0.40836	1.000000	0.80357	0.962000	0.63368	1.760000	0.38430	2.599000	0.87857	0.561000	0.74099	CGC		TREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040499.1	NM_018965	
TMEM63B	55362	hgsc.bcm.edu	37	6	44116545	44116545	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:44116545C>T	ENST00000259746.9	+	15	1459	c.1276C>T	c.(1276-1278)Cga>Tga	p.R426*	TMEM63B_ENST00000323267.6_Nonsense_Mutation_p.R426*			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	426					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)	p.R426*(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			CCTCTCCATCCGAGGCTTCAT	0.597																																					p.R426X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1276T	6						.						267.0	199.0	222.0					6																	44116545		2203	4300	6503	44224523	SO:0001587	stop_gained	55362	exon15			BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.1276C>T	6.37:g.44116545C>T	ENSP00000259746:p.Arg426*	Somatic		Capture	SOLID	Phase_I	44224523	NM_018426	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Nonsense_Mutation	SNP	ENST00000259746.9	37	CCDS34461.1	.	.	.	.	.	.	.	.	.	.	C	38	6.821986	0.97865	.	.	ENSG00000137216	ENST00000259746;ENST00000323267	.	.	.	4.48	4.48	0.54585	.	0.118064	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3354	0.83059	0.0:1.0:0.0:0.0	.	.	.	.	X	426	.	ENSP00000259746:R426X	R	+	1	2	TMEM63B	44224523	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	3.938000	0.56583	2.319000	0.78375	0.591000	0.81541	CGA		TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040712.2	XM_166410	
KLHL31	401265	hgsc.bcm.edu	37	6	53518912	53518912	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:53518912T>C	ENST00000407079.1	-	1	1158	c.1159A>G	c.(1159-1161)Agc>Ggc	p.S387G	KLHL31_ENST00000370905.3_Missense_Mutation_p.S387G			Q9H511	KLH31_HUMAN	kelch-like family member 31	387					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.S387G(1)		autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(3)	20	Lung NSC(77;0.0158)					CAGAAATTGCTGACTGCATGC	0.368																																					p.S387G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1159G	6						.						88.0	85.0	86.0					6																	53518912		2203	4300	6503	53626871	SO:0001583	missense	401265	exon2				CCDS34478.1	6p12.1	2013-09-27	2013-02-22	2007-01-09	ENSG00000124743	ENSG00000124743		"""Kelch-like"", ""BTB/POZ domain containing"""	21353	protein-coding gene	gene with protein product		610749	"""kelch repeat and BTB (POZ) domain containing 1"", ""kelch-like 31 (Drosophila)"""	KBTBD1			Standard	NM_001003760		Approved	bA345L23.2, BKLHD6	uc003pcb.4	Q9H511	OTTHUMG00000014882	ENST00000407079.1:c.1159A>G	6.37:g.53518912T>C	ENSP00000384644:p.Ser387Gly	Somatic		Capture	SOLID	Phase_I	53626871	NM_001003760	A6N9J2|B2RP49	Missense_Mutation	SNP	ENST00000407079.1	37	CCDS34478.1	.	.	.	.	.	.	.	.	.	.	T	13.05	2.121200	0.37436	.	.	ENSG00000124743	ENST00000370905;ENST00000407079	T;T	0.80994	-1.44;-1.44	5.25	5.25	0.73442	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.58921	0.2156	L	0.28274	0.84	0.80722	D	1	B	0.10296	0.003	B	0.17979	0.02	T	0.58289	-0.7662	10	0.32370	T	0.25	.	15.1853	0.72996	0.0:0.0:0.0:1.0	.	387	Q9H511	KLH31_HUMAN	G	387	ENSP00000359942:S387G;ENSP00000384644:S387G	ENSP00000359942:S387G	S	-	1	0	KLHL31	53626871	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	1.984000	0.57885	0.533000	0.62120	AGC		KLHL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040965.1	NM_001003760	
KCNQ5	56479	hgsc.bcm.edu	37	6	73787558	73787558	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:73787558A>C	ENST00000370398.1	+	5	975	c.866A>C	c.(865-867)aAg>aCg	p.K289T	KCNQ5_ENST00000403813.2_Missense_Mutation_p.K289T|KCNQ5_ENST00000402622.2_Missense_Mutation_p.K289T|KCNQ5_ENST00000355635.3_Missense_Mutation_p.K289T|KCNQ5_ENST00000342056.2_Missense_Mutation_p.K289T|KCNQ5_ENST00000414165.2_Missense_Mutation_p.K289T|KCNQ5_ENST00000370392.1_Missense_Mutation_p.K289T|KCNQ5_ENST00000355194.4_Missense_Mutation_p.K289T	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	289					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)	p.K289T(1)		breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	CTGGTGGAAAAGGATGCCAAT	0.318																																					p.K289T	GBM(142;1375 1859 14391 23261 44706)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A866C	6						.						120.0	105.0	110.0					6																	73787558		2203	4300	6503	73844279	SO:0001583	missense	56479	exon5			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.866A>C	6.37:g.73787558A>C	ENSP00000359425:p.Lys289Thr	Somatic		Capture	SOLID	Phase_I	73844279	NM_001160133	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	37	CCDS4976.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.609778	0.87258	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000370392;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D;D	0.97642	-4.47;-4.47;-4.47;-4.47;-4.47;-4.47;-4.47;-4.47	5.86	5.86	0.93980	Ion transport (1);	0.056593	0.85682	D	0.000000	D	0.97911	0.9313	M	0.71581	2.175	0.80722	D	1	D;D;D;D;D;D	0.71674	0.964;0.998;0.991;0.989;0.996;0.974	P;D;D;D;D;P	0.71870	0.839;0.958;0.934;0.956;0.975;0.804	D	0.99107	1.0845	10	0.87932	D	0	-16.2139	16.2507	0.82485	1.0:0.0:0.0:0.0	.	289;289;289;289;289;289	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82;Q9NR82-4	.;.;.;.;KCNQ5_HUMAN;.	T	289	ENSP00000345055:K289T;ENSP00000347326:K289T;ENSP00000359425:K289T;ENSP00000359419:K289T;ENSP00000385501:K289T;ENSP00000347853:K289T;ENSP00000384453:K289T;ENSP00000409861:K289T	ENSP00000345055:K289T	K	+	2	0	KCNQ5	73844279	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.339000	0.96797	2.237000	0.73441	0.528000	0.53228	AAG		KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842	
SLC17A5	26503	hgsc.bcm.edu	37	6	74351414	74351414	+	Splice_Site	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:74351414C>A	ENST00000355773.5	-	3	793	c.525G>T	c.(523-525)gaG>gaT	p.E175D	SLC17A5_ENST00000481996.1_5'UTR|SLC17A5_ENST00000393019.3_Splice_Site_p.E175D	NM_012434.4	NP_036566.1	Q9NRA2	S17A5_HUMAN	solute carrier family 17 (acidic sugar transporter), member 5	175					amino acid transport (GO:0006865)|anion transport (GO:0006820)|ion transport (GO:0006811)|proton transport (GO:0015992)|sialic acid transport (GO:0015739)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	sialic acid transmembrane transporter activity (GO:0015136)|sugar:proton symporter activity (GO:0005351)	p.E175D(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						AGAAAATTACCTCTCCTAGTC	0.413																																					p.E175D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G525T	6						.						125.0	124.0	124.0					6																	74351414		2203	4300	6503	74408135	SO:0001630	splice_region_variant	26503	exon3			AJ387747	CCDS4981.1	6q13	2013-07-18	2013-07-18		ENSG00000119899	ENSG00000119899		"""Solute carriers"""	10933	protein-coding gene	gene with protein product		604322	"""sialic acid storage disease"", ""solute carrier family 17 (anion/sugar transporter), member 5"""	SIASD		10581036, 8198127	Standard	NM_012434		Approved	AST, SD, ISSD, NSD, SIALIN, SLD	uc003phn.4	Q9NRA2	OTTHUMG00000015039	ENST00000355773.5:c.525+1G>T	6.37:g.74351414C>A		Somatic		Capture	SOLID	Phase_I	74408135	NM_012434	Q5SZ76|Q8NBR5|Q9UGH0	Missense_Mutation	SNP	ENST00000355773.5	37	CCDS4981.1	.	.	.	.	.	.	.	.	.	.	C	18.92	3.725171	0.68959	.	.	ENSG00000119899	ENST00000355773;ENST00000393019	T;T	0.58797	0.31;0.31	5.32	5.32	0.75619	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.049760	0.85682	D	0.000000	T	0.79958	0.4536	M	0.93106	3.38	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.84809	0.0789	9	.	.	.	.	18.9959	0.92812	0.0:1.0:0.0:0.0	.	175	Q9NRA2	S17A5_HUMAN	D	175	ENSP00000348019:E175D;ENSP00000376742:E175D	.	E	-	3	2	SLC17A5	74408135	1.000000	0.71417	1.000000	0.80357	0.134000	0.20937	7.251000	0.78297	2.487000	0.83934	0.591000	0.81541	GAG		SLC17A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041228.1		Missense_Mutation
FILIP1	27145	hgsc.bcm.edu	37	6	76023010	76023010	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:76023010G>A	ENST00000237172.7	-	5	2868	c.2538C>T	c.(2536-2538)ccC>ccT	p.P846P	FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000393004.2_Silent_p.P846P|FILIP1_ENST00000370020.1_Silent_p.P747P	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	846								p.P846P(3)		breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						ATCTTTCCACGGGTTTCTTCA	0.448																																					p.P846P												.	.	3	Substitution - coding silent(3)	lung(2)|large_intestine(1)	c.C2538T	6						.						119.0	131.0	127.0					6																	76023010		2203	4300	6503	76079730	SO:0001819	synonymous_variant	27145	exon5			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.2538C>T	6.37:g.76023010G>A		Somatic		Capture	SOLID	Phase_I	76079730	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Silent	SNP	ENST00000237172.7	37	CCDS4984.1																																																																																				FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
FILIP1	27145	hgsc.bcm.edu	37	6	76063393	76063393	+	Missense_Mutation	SNP	C	C	T	rs143502875		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:76063393C>T	ENST00000237172.7	-	4	821	c.491G>A	c.(490-492)cGc>cAc	p.R164H	FILIP1_ENST00000393004.2_Missense_Mutation_p.R164H|FILIP1_ENST00000370020.1_Missense_Mutation_p.R65H	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	164								p.R164H(1)		breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						CTCTAGCATGCGCCGGTAGGT	0.443																																					p.R164H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G491A	6						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	140.0	126.0	130.0		491	5.8	1.0	6	dbSNP_134	130	0,8600		0,0,4300	yes	missense	FILIP1	NM_015687.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	164/1214	76063393	1,13005	2203	4300	6503	76120113	SO:0001583	missense	27145	exon4			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.491G>A	6.37:g.76063393C>T	ENSP00000237172:p.Arg164His	Somatic		Capture	SOLID	Phase_I	76120113	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	ENST00000237172.7	37	CCDS4984.1	.	.	.	.	.	.	.	.	.	.	C	36	5.672883	0.96754	2.27E-4	0.0	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.56103	0.48;0.48;0.48	5.79	5.79	0.91817	Cortactin-binding protein-2, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.69278	0.3093	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.996	T	0.69518	-0.5124	10	0.59425	D	0.04	-13.2489	20.0366	0.97561	0.0:1.0:0.0:0.0	.	164;164;164	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	H	164;164;65	ENSP00000376728:R164H;ENSP00000237172:R164H;ENSP00000359037:R65H	ENSP00000237172:R164H	R	-	2	0	FILIP1	76120113	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.601000	0.82783	2.736000	0.93811	0.561000	0.74099	CGC		FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
UBE3D	90025	hgsc.bcm.edu	37	6	83767664	83767664	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:83767664C>T	ENST00000369747.3	-	2	277	c.155G>A	c.(154-156)tGc>tAc	p.C52Y		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	52					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)	p.C52Y(1)									GATTTCTGTGCAGCCTTCAGG	0.483											OREG0017549	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C52Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G155A	6						.						76.0	72.0	73.0					6																	83767664		2203	4300	6503	83824383	SO:0001583	missense	90025	exon2			AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.155G>A	6.37:g.83767664C>T	ENSP00000358762:p.Cys52Tyr	Somatic	1224	Capture	SOLID	Phase_I	83824383	NM_198920	B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Missense_Mutation	SNP	ENST00000369747.3	37	CCDS34491.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.425075	0.43020	.	.	ENSG00000118420	ENST00000369747	T	0.29917	1.55	5.31	5.31	0.75309	.	0.221687	0.49305	D	0.000156	T	0.46756	0.1409	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.989	T	0.33904	-0.9850	10	0.51188	T	0.08	-26.1064	16.0154	0.80434	0.0:1.0:0.0:0.0	.	52;52	D6RD24;Q7Z6J8	.;UB2CB_HUMAN	Y	52	ENSP00000358762:C52Y	ENSP00000358762:C52Y	C	-	2	0	UBE2CBP	83824383	1.000000	0.71417	1.000000	0.80357	0.076000	0.17211	4.243000	0.58721	2.768000	0.95171	0.650000	0.86243	TGC		UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041347.7	NM_198920	
KLHL32	114792	hgsc.bcm.edu	37	6	97533133	97533133	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:97533133A>C	ENST00000369261.4	+	6	906	c.543A>C	c.(541-543)gaA>gaC	p.E181D	KLHL32_ENST00000539200.1_Missense_Mutation_p.E112D|KLHL32_ENST00000536676.1_Missense_Mutation_p.E145D|KLHL32_ENST00000544166.1_Intron	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	181								p.E181D(1)		breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		GCCCAGAAGAAGTTCTAACGC	0.517																																					p.E181D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A543C	6						.						93.0	91.0	92.0					6																	97533133		2203	4300	6503	97639854	SO:0001583	missense	114792	exon6			AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.543A>C	6.37:g.97533133A>C	ENSP00000358265:p.Glu181Asp	Somatic		Capture	SOLID	Phase_I	97639854	NM_052904	B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	37	CCDS5038.1	.	.	.	.	.	.	.	.	.	.	T	0.040	-1.290124	0.01387	.	.	ENSG00000186231	ENST00000369255;ENST00000369261;ENST00000536676;ENST00000539200;ENST00000447886	T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55	6.17	-7.65	0.01281	BTB/Kelch-associated (2);	0.154450	0.56097	N	0.000023	T	0.27241	0.0668	N	0.21545	0.675	0.80722	D	1	B;B;B;B	0.15473	0.013;0.0;0.001;0.001	B;B;B;B	0.25405	0.06;0.005;0.012;0.007	T	0.03875	-1.0996	10	0.51188	T	0.08	.	3.6097	0.08055	0.1869:0.0989:0.1299:0.5843	.	112;145;181;181	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	D	107;181;145;112;77	ENSP00000358265:E181D;ENSP00000440382:E145D;ENSP00000441527:E112D;ENSP00000389310:E77D	ENSP00000358259:E107D	E	+	3	2	KLHL32	97639854	0.995000	0.38212	0.260000	0.24451	0.193000	0.23685	0.286000	0.18902	-1.544000	0.01721	-1.808000	0.00615	GAA		KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041570.1	NM_052904	
PNISR	25957	hgsc.bcm.edu	37	6	99848922	99848922	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:99848922C>A	ENST00000369239.5	-	12	2116	c.1912G>T	c.(1912-1914)Gat>Tat	p.D638Y	PNISR_ENST00000438806.1_Missense_Mutation_p.D638Y	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	638						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.D638Y(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TTACGCCTATCTCGACTCCTA	0.468																																					p.D638Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1912T	6						.						125.0	116.0	119.0					6																	99848922		2203	4300	6503	99955643	SO:0001583	missense	25957	exon11			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.1912G>T	6.37:g.99848922C>A	ENSP00000358242:p.Asp638Tyr	Somatic		Capture	SOLID	Phase_I	99955643	NM_015491	A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Missense_Mutation	SNP	ENST00000369239.5	37	CCDS5043.1	.	.	.	.	.	.	.	.	.	.	C	17.59	3.428638	0.62844	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	.	.	.	5.74	5.74	0.90152	.	0.304152	0.40064	N	0.001190	T	0.51736	0.1692	N	0.24115	0.695	0.80722	D	1	P	0.49559	0.925	P	0.53062	0.717	T	0.56257	-0.8009	9	0.66056	D	0.02	.	20.2835	0.98531	0.0:1.0:0.0:0.0	.	638	Q8TF01	PNISR_HUMAN	Y	638	.	ENSP00000358242:D638Y	D	-	1	0	PNISR	99955643	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.421000	0.66447	2.873000	0.98535	0.643000	0.83706	GAT		PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041598.1	NM_032870	
IGF2R	3482	hgsc.bcm.edu	37	6	160477545	160477545	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Visver			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr6:160477545G>A	ENST00000356956.1	+	20	2932	c.2784G>A	c.(2782-2784)acG>acA	p.T928T		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	928					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.T928T(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	AGACAACGACGGATACAGACC	0.562																																					p.T928T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2784A	6						.						184.0	139.0	154.0					6																	160477545		2203	4300	6503	160397535	SO:0001819	synonymous_variant	3482	exon20			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.2784G>A	6.37:g.160477545G>A		Somatic		Capture	SOLID	Phase_I	160397535	NM_000876	Q7Z7G9|Q96PT5	Silent	SNP	ENST00000356956.1	37	CCDS5273.1																																																																																				IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
ZNF18	7566	hgsc.bcm.edu	37	17	11893862	11893862	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:11893862C>T	ENST00000322748.3	-	6	1187	c.583G>A	c.(583-585)Gct>Act	p.A195T	ZNF18_ENST00000580306.2_Missense_Mutation_p.A195T|ZNF18_ENST00000454073.3_Missense_Mutation_p.A195T	NM_144680.2	NP_653281.2	P17022	ZNF18_HUMAN	zinc finger protein 18	195					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.A195T(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)	14				Colorectal(4;3.33e-05)|COAD - Colon adenocarcinoma(4;0.000494)|READ - Rectum adenocarcinoma(10;0.233)		TGGGAGGCAGCCAGGGCTGAA	0.542																																					p.A195T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G583A	17						.						29.0	31.0	31.0					17																	11893862		2203	4300	6503	11834587	SO:0001583	missense	7566	exon6			X52342	CCDS32568.1	17p12	2013-01-09	2006-05-10		ENSG00000154957	ENSG00000154957		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12969	protein-coding gene	gene with protein product		194524	"""zinc finger protein 18 (KOX 11)"""			15702252	Standard	XM_005256786		Approved	ZKSCAN6, KOX11, HDSG1, Zfp535, ZNF535, ZSCAN38	uc002gng.1	P17022	OTTHUMG00000178307	ENST00000322748.3:c.583G>A	17.37:g.11893862C>T	ENSP00000315664:p.Ala195Thr	Somatic		Capture	SOLID	Phase_I	11834587	NM_144680	Q5QHQ3|Q8IYC4|Q8NAH6	Missense_Mutation	SNP	ENST00000322748.3	37	CCDS32568.1	.	.	.	.	.	.	.	.	.	.	C	17.18	3.323934	0.60634	.	.	ENSG00000154957	ENST00000454073;ENST00000322748	T;T	0.06687	3.3;3.27	5.62	3.5	0.40072	.	0.255560	0.27917	N	0.017335	T	0.05868	0.0153	L	0.27053	0.805	0.23144	N	0.99823	B;B	0.30937	0.301;0.2	B;B	0.30572	0.117;0.055	T	0.32241	-0.9914	10	0.37606	T	0.19	-5.671	7.1823	0.25780	0.0:0.7366:0.1726:0.0908	.	195;195	P17022-2;P17022	.;ZNF18_HUMAN	T	195	ENSP00000391376:A195T;ENSP00000315664:A195T	ENSP00000315664:A195T	A	-	1	0	ZNF18	11834587	0.002000	0.14202	0.850000	0.33497	0.867000	0.49689	-0.396000	0.07278	1.492000	0.48499	0.650000	0.86243	GCT		ZNF18-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441450.2	XM_085596	
INPP5K	51763	hgsc.bcm.edu	37	17	1412571	1412571	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:1412571G>A	ENST00000421807.2	-	5	843	c.455C>T	c.(454-456)cCc>cTc	p.P152L	INPP5K_ENST00000397335.3_Missense_Mutation_p.P60L|INPP5K_ENST00000406424.4_Missense_Mutation_p.P76L|INPP5K_ENST00000542125.1_Intron|INPP5K_ENST00000320345.6_Missense_Mutation_p.P76L	NM_016532.3	NP_057616.2	Q9BT40	INP5K_HUMAN	inositol polyphosphate-5-phosphatase K	152	Catalytic. {ECO:0000255}.				actin cytoskeleton organization (GO:0030036)|cellular response to cAMP (GO:0071320)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hormone stimulus (GO:0032870)|cellular response to insulin stimulus (GO:0032869)|cellular response to tumor necrosis factor (GO:0071356)|dephosphorylation (GO:0016311)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inositol phosphate dephosphorylation (GO:0046855)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of dephosphorylation (GO:0035305)|negative regulation of glucose transport (GO:0010829)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of stress fiber assembly (GO:0051497)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of renal water transport (GO:2001153)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|protein targeting to plasma membrane (GO:0072661)|regulation of glycogen biosynthetic process (GO:0005979)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	inositol bisphosphate phosphatase activity (GO:0016312)|inositol trisphosphate phosphatase activity (GO:0046030)|inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|lipid phosphatase activity (GO:0042577)|phosphatidylinositol phosphate 5-phosphatase activity (GO:0034595)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:0034485)|vasopressin receptor activity (GO:0005000)	p.P152L(1)|p.P76L(1)		endometrium(1)|large_intestine(7)|lung(3)|skin(1)	12						GGAAATGTGGGGAGGCAGGTG	0.517																																					p.P152L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C455T	17						.						114.0	88.0	97.0					17																	1412571		2203	4300	6503	1359321	SO:0001583	missense	51763	exon5				CCDS11004.1, CCDS11005.1	17p13.3	2008-09-09			ENSG00000132376	ENSG00000132376			33882	protein-coding gene	gene with protein product	"""skeletal muscle and kidney enriched inositol phosphatase"""	607875				10753883, 12536145	Standard	NM_016532		Approved	SKIP	uc002fsr.3	Q9BT40	OTTHUMG00000150648	ENST00000421807.2:c.455C>T	17.37:g.1412571G>A	ENSP00000413937:p.Pro152Leu	Somatic		Capture	SOLID	Phase_I	1359321	NM_016532	B2R6I2|B2R750|D3DTH8|Q15733|Q9NPJ5|Q9P2R5	Missense_Mutation	SNP	ENST00000421807.2	37	CCDS11004.1	.	.	.	.	.	.	.	.	.	.	G	33	5.262981	0.95399	.	.	ENSG00000132376	ENST00000421807;ENST00000406424;ENST00000350761;ENST00000320345;ENST00000397335;ENST00000449479;ENST00000445774	D;D;D;D	0.95272	-3.66;-3.66;-3.66;-3.66	5.22	5.22	0.72569	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.110837	0.64402	D	0.000011	D	0.96374	0.8817	M	0.76574	2.34	0.58432	D	0.999999	P	0.47604	0.898	P	0.55667	0.781	D	0.96905	0.9663	10	0.87932	D	0	-18.2083	17.7773	0.88513	0.0:0.0:1.0:0.0	.	152	Q9BT40	INP5K_HUMAN	L	76;76;152;76;60;60;76	ENSP00000385177:P76L;ENSP00000318476:P76L;ENSP00000380496:P60L;ENSP00000413259:P60L	ENSP00000318476:P76L	P	-	2	0	INPP5K	1359321	1.000000	0.71417	0.995000	0.50966	0.978000	0.69477	9.341000	0.97041	2.445000	0.82738	0.561000	0.74099	CCC		INPP5K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319381.4		
MYOCD	93649	hgsc.bcm.edu	37	17	12647712	12647712	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:12647712A>G	ENST00000343344.4	+	8	930	c.930A>G	c.(928-930)caA>caG	p.Q310Q	MYOCD_ENST00000425538.1_Silent_p.Q310Q|AC005358.1_ENST00000609971.1_Silent_p.Q214Q|MYOCD_ENST00000395988.1_3'UTR			Q8IZQ8	MYCD_HUMAN	myocardin	310	Gln-rich.				cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		agcagcagcaacaCCGATTCA	0.582																																					p.Q310Q												.	.	0			c.A930G	17						.						42.0	30.0	34.0					17																	12647712		2203	4300	6503	12588437	SO:0001819	synonymous_variant	93649	exon8			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.930A>G	17.37:g.12647712A>G		Somatic		Capture	SOLID	Phase_I	12588437	NM_001146312	Q5UBU5|Q8N7Q1	Silent	SNP	ENST00000343344.4	37	CCDS11163.1																																																																																				MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604	
SLC13A2	9058	hgsc.bcm.edu	37	17	26822677	26822677	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:26822677C>T	ENST00000314669.5	+	10	1733	c.1313C>T	c.(1312-1314)tCg>tTg	p.S438L	SLC13A2_ENST00000537681.1_Missense_Mutation_p.S367L|SLC13A2_ENST00000444914.3_Missense_Mutation_p.S487L|SLC13A2_ENST00000545060.1_Missense_Mutation_p.S395L	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2	438					dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)	p.S438L(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	CCACAGCGATCGGGCCTGTCA	0.617																																					p.S395L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1184T	17						.						100.0	82.0	88.0					17																	26822677		2203	4300	6503	23846804	SO:0001583	missense	9058	exon9			U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.1313C>T	17.37:g.26822677C>T	ENSP00000316202:p.Ser438Leu	Somatic		Capture	SOLID	Phase_I	23846804	NM_001145976	B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Missense_Mutation	SNP	ENST00000314669.5	37	CCDS11231.1	.	.	.	.	.	.	.	.	.	.	C	34	5.331056	0.95733	.	.	ENSG00000007216	ENST00000314669;ENST00000444914;ENST00000545060;ENST00000537681	T;T;T;T	0.02890	4.12;4.12;4.12;4.12	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.31009	0.0783	H	0.98388	4.22	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	T	0.57785	-0.7751	10	0.87932	D	0	-9.9641	18.9994	0.92828	0.0:1.0:0.0:0.0	.	395;487;367;438	F5GWV6;E7ETH5;G3V1L2;Q13183	.;.;.;S13A2_HUMAN	L	438;487;395;367	ENSP00000316202:S438L;ENSP00000392411:S487L;ENSP00000441935:S395L;ENSP00000440802:S367L	ENSP00000316202:S438L	S	+	2	0	SLC13A2	23846804	1.000000	0.71417	0.201000	0.23476	0.095000	0.18619	7.638000	0.83328	2.499000	0.84300	0.563000	0.77884	TCG		SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255722.1	NM_003984	
SUPT6H	6830	hgsc.bcm.edu	37	17	27031804	27031804	+	IGR	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:27031804A>G	ENST00000314616.6	+	0	6518				PROCA1_ENST00000579650.1_5'UTR|PROCA1_ENST00000581289.1_Intron|PROCA1_ENST00000439862.3_Missense_Mutation_p.I52T|PROCA1_ENST00000301039.2_Missense_Mutation_p.I50T	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I50T(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					AGGGTAGATGATGTGCCCAGT	0.597																																					p.I50T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T149C	17						.						134.0	107.0	116.0					17																	27031804		2203	4300	6503	24055931	SO:0001628	intergenic_variant	147011	exon2			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27031804A>G		Somatic		Capture	SOLID	Phase_I	24055931	NM_152465	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	A	14.33	2.504080	0.44558	.	.	ENSG00000167525	ENST00000301039;ENST00000439862;ENST00000415329;ENST00000422880	T;T	0.04234	3.67;3.67	5.3	4.19	0.49359	.	0.266889	0.36972	N	0.002316	T	0.04452	0.0122	L	0.43923	1.385	0.27504	N	0.951895	B;B	0.29988	0.264;0.23	B;B	0.24006	0.05;0.047	T	0.36768	-0.9734	10	0.22109	T	0.4	2.6194	8.2213	0.31543	0.9069:0.0:0.0931:0.0	.	52;50	G5E9R8;Q8NCQ7-2	.;.	T	50;52;78;52	ENSP00000301039:I50T;ENSP00000411400:I52T	ENSP00000301039:I50T	I	-	2	0	PROCA1	24055931	1.000000	0.71417	0.995000	0.50966	0.937000	0.57800	3.720000	0.54933	0.803000	0.34113	0.533000	0.62120	ATC		SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
PEX12	5193	hgsc.bcm.edu	37	17	33904946	33904946	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:33904946G>A	ENST00000225873.4	-	1	702	c.95C>T	c.(94-96)gCa>gTa	p.A32V		NM_000286.2	NP_000277.1	O00623	PEX12_HUMAN	peroxisomal biogenesis factor 12	32					peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	integral component of peroxisomal membrane (GO:0005779)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)	p.A32V(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(8)	18				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGGTCTCACTGCTGTCATTAA	0.463																																					p.A32V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C95T	17						.						133.0	124.0	127.0					17																	33904946		2203	4300	6503	30929059	SO:0001583	missense	5193	exon1			U91521	CCDS11296.1	17q21.1	2011-02-10			ENSG00000108733	ENSG00000108733			8854	protein-coding gene	gene with protein product		601758				9090384	Standard	NM_000286		Approved		uc002hjp.3	O00623	OTTHUMG00000132951	ENST00000225873.4:c.95C>T	17.37:g.33904946G>A	ENSP00000225873:p.Ala32Val	Somatic		Capture	SOLID	Phase_I	30929059	NM_000286	B2R6M2	Missense_Mutation	SNP	ENST00000225873.4	37	CCDS11296.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.147528	0.77888	.	.	ENSG00000108733	ENST00000424525;ENST00000225873	T	0.74002	-0.8	5.51	5.51	0.81932	Pex, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.66607	0.2806	L	0.34521	1.04	0.80722	D	1	P	0.35272	0.493	B	0.36719	0.231	T	0.62709	-0.6797	10	0.17832	T	0.49	-14.0748	18.414	0.90562	0.0:0.0:1.0:0.0	.	32	O00623	PEX12_HUMAN	V	32	ENSP00000225873:A32V	ENSP00000225873:A32V	A	-	2	0	PEX12	30929059	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.676000	0.68131	2.582000	0.87167	0.650000	0.86243	GCA		PEX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256489.2	NM_000286	
PLXDC1	57125	hgsc.bcm.edu	37	17	37243862	37243862	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:37243862G>A	ENST00000315392.4	-	8	1116	c.905C>T	c.(904-906)cCg>cTg	p.P302L	PLXDC1_ENST00000539608.1_Missense_Mutation_p.P229L|PLXDC1_ENST00000493200.1_5'UTR|PLXDC1_ENST00000444911.2_Missense_Mutation_p.P262L|PLXDC1_ENST00000394316.2_Missense_Mutation_p.P302L	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1	302					angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)	p.P302L(1)		kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						CTACTCACTCGGCAATGGGGT	0.557																																					p.P302L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C905T	17						.						87.0	65.0	72.0					17																	37243862		2203	4300	6503	34497388	SO:0001583	missense	57125	exon8			AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.905C>T	17.37:g.37243862G>A	ENSP00000323927:p.Pro302Leu	Somatic		Capture	SOLID	Phase_I	34497388	NM_020405	B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	Missense_Mutation	SNP	ENST00000315392.4	37	CCDS11333.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004562	0.35320	.	.	ENSG00000161381	ENST00000315392;ENST00000394318;ENST00000539608;ENST00000444911;ENST00000394316	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	6.04	6.04	0.98038	.	0.060724	0.64402	D	0.000003	T	0.74176	0.3682	M	0.73962	2.25	0.80722	D	1	B;P	0.52316	0.42;0.952	B;B	0.32624	0.061;0.149	T	0.80663	-0.1282	10	0.87932	D	0	-33.3474	16.0793	0.80989	0.0:0.0:1.0:0.0	.	262;302	B4E173;Q8IUK5	.;PXDC1_HUMAN	L	302;229;229;262;302	ENSP00000323927:P302L;ENSP00000441881:P229L;ENSP00000409687:P262L;ENSP00000377851:P302L	ENSP00000323927:P302L	P	-	2	0	PLXDC1	34497388	1.000000	0.71417	0.996000	0.52242	0.364000	0.29643	6.795000	0.75140	2.873000	0.98535	0.561000	0.74099	CCG		PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256892.2	NM_020405	
CNTNAP1	8506	hgsc.bcm.edu	37	17	40836223	40836223	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:40836223G>A	ENST00000264638.4	+	3	556	c.339G>A	c.(337-339)ccG>ccA	p.P113P	CTD-3193K9.4_ENST00000593139.1_RNA|CCR10_ENST00000591765.1_5'Flank|CCR10_ENST00000332438.4_5'Flank|CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	113	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)	p.P113P(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		GCTGGACACCGTTCTACCAGC	0.627																																					p.P113P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G339A	17						.						111.0	112.0	112.0					17																	40836223		2203	4300	6503	38089749	SO:0001819	synonymous_variant	8506	exon3			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.339G>A	17.37:g.40836223G>A		Somatic		Capture	SOLID	Phase_I	38089749	NM_003632		Silent	SNP	ENST00000264638.4	37	CCDS11436.1																																																																																				CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1	NM_003632	
BRCA1	672	hgsc.bcm.edu	37	17	41251830	41251830	+	Missense_Mutation	SNP	C	C	T	rs80357264		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:41251830C>T	ENST00000357654.3	-	7	627	c.509G>A	c.(508-510)cGg>cAg	p.R170Q	BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_5'UTR|BRCA1_ENST00000493795.1_Missense_Mutation_p.R123Q|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000346315.3_Missense_Mutation_p.R170Q|BRCA1_ENST00000352993.3_Missense_Mutation_p.R170Q|BRCA1_ENST00000491747.2_Missense_Mutation_p.R170Q|BRCA1_ENST00000468300.1_Missense_Mutation_p.R170Q|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000354071.3_Missense_Mutation_p.R170Q|BRCA1_ENST00000351666.3_Missense_Mutation_p.R170Q|BRCA1_ENST00000471181.2_Missense_Mutation_p.R170Q	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	170			R -> W (in BC; unknown pathological significance; functionally neutral in vitro).		androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R170Q(1)		NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AGGTTGTATCCGCTGCTTTGT	0.383			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.R170Q		yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G509A	17						.						177.0	169.0	171.0					17																	41251830		2203	4300	6503	38505356	SO:0001583	missense	672	exon7	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.509G>A	17.37:g.41251830C>T	ENSP00000350283:p.Arg170Gln	Somatic		Capture	SOLID	Phase_I	38505356	NM_007294	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	37	CCDS11453.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.252|1.252	-0.618228|-0.618228	0.03663|0.03663	.|.	.|.	ENSG00000012048|ENSG00000012048	ENST00000473961|ENST00000357654;ENST00000412061;ENST00000354071;ENST00000352993;ENST00000346315;ENST00000351666;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919;ENST00000487825;ENST00000470026;ENST00000477152;ENST00000494123;ENST00000476777	.|D;D;D;D;D;D;D;D;D;D;D;D;T;D;D;D;D	.|0.96265	.|-1.97;-2.07;-2.17;-2.06;-2.3;-2.04;-2.4;-1.98;-2.08;-1.89;-1.59;-2.05;-1.44;-2.55;-3.96;-2.24;-1.91	5.11|5.11	2.91|2.91	0.33838|0.33838	.|.	.|0.527792	.|0.17532	.|N	.|0.170826	T|T	0.79941|0.79941	0.4533|0.4533	N|N	0.00210|0.00210	-1.845|-1.845	0.21355|0.21355	N|N	0.999718|0.999718	.|B;B;B;B;B;B;B;B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	.|B;B;B;B;B;B;B;B;B;B;B	.|0.01281	.|0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T|T	0.73078|0.73078	-0.4096|-0.4096	5|10	.|0.02654	.|T	.|1	.|.	9.3002|9.3002	0.37840|0.37840	0.0:0.0933:0.0:0.9067|0.0:0.0933:0.0:0.9067	.|.	.|169;123;169;170;170;170;170;170;170;170;170	.|E7EUM2;B4DES0;E7ETR2;E7EMP0;E7ERL4;Q5YLB2;P38398-3;Q6IN79;E9PFC7;P38398;P38398-2	.|.;.;.;.;.;.;.;.;.;BRCA1_HUMAN;.	R|Q	77|170;170;170;170;170;170;170;123;170;123;169;169;85;123;86;170;144;170;169	.|ENSP00000350283:R170Q;ENSP00000326002:R170Q;ENSP00000312236:R170Q;ENSP00000246907:R170Q;ENSP00000338007:R170Q;ENSP00000417148:R170Q;ENSP00000377294:R123Q;ENSP00000418960:R170Q;ENSP00000418775:R123Q;ENSP00000420412:R169Q;ENSP00000419481:R85Q;ENSP00000418819:R123Q;ENSP00000418212:R86Q;ENSP00000419274:R170Q;ENSP00000419988:R144Q;ENSP00000419103:R170Q;ENSP00000417554:R169Q	.|ENSP00000246907:R170Q	G|R	-|-	1|2	0|0	BRCA1|BRCA1	38505356|38505356	0.020000|0.020000	0.18652|0.18652	0.388000|0.388000	0.26195|0.26195	0.683000|0.683000	0.39861|0.39861	0.792000|0.792000	0.26929|0.26929	0.516000|0.516000	0.28340|0.28340	-1.199000|-1.199000	0.01669|0.01669	GGA|CGG		BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
SLC4A1	6521	hgsc.bcm.edu	37	17	42333105	42333105	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:42333105G>A	ENST00000262418.6	-	14	1891	c.1736C>T	c.(1735-1737)gCc>gTc	p.A579V	AC003043.1_ENST00000597382.1_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	579	Involved in anion transport.|Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.A579V(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		GAAGGTACCGGCCATGAGCAC	0.547																																					p.A579V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1736T	17						.						164.0	149.0	154.0					17																	42333105		2203	4300	6503	39688631	SO:0001583	missense	6521	exon14				CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.1736C>T	17.37:g.42333105G>A	ENSP00000262418:p.Ala579Val	Somatic		Capture	SOLID	Phase_I	39688631	NM_000342	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Missense_Mutation	SNP	ENST00000262418.6	37	CCDS11481.1	.	.	.	.	.	.	.	.	.	.	g	15.23	2.772498	0.49680	.	.	ENSG00000004939	ENST00000262418	T	0.77877	-1.13	5.62	3.61	0.41365	Bicarbonate transporter, C-terminal (1);	0.339098	0.31210	N	0.008046	T	0.63988	0.2558	L	0.28192	0.835	0.38128	D	0.938061	B	0.09022	0.002	B	0.09377	0.004	T	0.59637	-0.7417	10	0.45353	T	0.12	.	9.4136	0.38507	0.2216:0.0:0.7784:0.0	.	579	P02730	B3AT_HUMAN	V	579	ENSP00000262418:A579V	ENSP00000262418:A579V	A	-	2	0	SLC4A1	39688631	0.849000	0.29639	0.946000	0.38457	0.875000	0.50365	1.420000	0.34804	0.720000	0.32209	0.655000	0.94253	GCC		SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	NM_000342	
ADAM11	4185	hgsc.bcm.edu	37	17	42850229	42850229	+	Missense_Mutation	SNP	G	G	A	rs200895725		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:42850229G>A	ENST00000200557.6	+	9	852	c.683G>A	c.(682-684)cGc>cAc	p.R228H	ADAM11_ENST00000535346.1_Missense_Mutation_p.R28H	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	228					integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R228H(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				CCCCAGGTCCGCCGGGGCCAC	0.607																																					p.R228H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G683A	17						.						61.0	62.0	62.0					17																	42850229		2203	4300	6503	40205755	SO:0001583	missense	4185	exon9			D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.683G>A	17.37:g.42850229G>A	ENSP00000200557:p.Arg228His	Somatic		Capture	SOLID	Phase_I	40205755	NM_002390	Q14808|Q14809|Q14810	Missense_Mutation	SNP	ENST00000200557.6	37	CCDS11486.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.110440	0.56398	.	.	ENSG00000073670	ENST00000200557;ENST00000535346;ENST00000355638	T;T	0.02421	4.3;4.67	4.64	4.64	0.57946	.	0.165039	0.39985	N	0.001206	T	0.01905	0.0060	N	0.08118	0	0.58432	D	0.999997	B;B	0.24675	0.025;0.109	B;B	0.20577	0.009;0.03	T	0.59553	-0.7433	10	0.38643	T	0.18	.	10.7225	0.46048	0.0946:0.0:0.9054:0.0	.	28;228	B4DKD2;O75078	.;ADA11_HUMAN	H	228;28;128	ENSP00000200557:R228H;ENSP00000443773:R28H	ENSP00000200557:R228H	R	+	2	0	ADAM11	40205755	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.860000	0.62961	2.118000	0.64928	0.297000	0.19635	CGC		ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444531.1	NM_002390	
SCRN2	90507	hgsc.bcm.edu	37	17	45917738	45917738	+	Splice_Site	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:45917738A>G	ENST00000290216.9	-	3	300	c.175T>C	c.(175-177)Tgc>Cgc	p.C59R	SCRN2_ENST00000407215.3_Splice_Site_p.C59R|SCRN2_ENST00000584123.1_Splice_Site_p.C67R	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	59						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)	p.C59R(1)		cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						ATGTAGGTGCACTGGAGGTGA	0.567																																					p.C59R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T175C	17						.						69.0	53.0	58.0					17																	45917738		2203	4300	6503	43272737	SO:0001630	splice_region_variant	90507	exon3			BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.175-1T>C	17.37:g.45917738A>G		Somatic		Capture	SOLID	Phase_I	43272737	NM_001145023	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Missense_Mutation	SNP	ENST00000290216.9	37	CCDS11519.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.752410	0.89753	.	.	ENSG00000141295	ENST00000290216;ENST00000407215	T;T	0.10382	2.99;2.88	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.42314	0.1197	M	0.92555	3.32	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.55321	-0.8159	10	0.87932	D	0	-21.162	13.8558	0.63527	1.0:0.0:0.0:0.0	.	59;59;59	E9PBV5;Q96FV2;B7Z8S7	.;SCRN2_HUMAN;.	R	59	ENSP00000290216:C59R;ENSP00000383935:C59R	ENSP00000290216:C59R	C	-	1	0	SCRN2	43272737	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.288000	0.96055	1.919000	0.55581	0.533000	0.62120	TGC		SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	Missense_Mutation
KAT7	11143	hgsc.bcm.edu	37	17	47895364	47895364	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:47895364C>T	ENST00000259021.4	+	9	1426	c.1146C>T	c.(1144-1146)cgC>cgT	p.R382R	KAT7_ENST00000509773.1_Silent_p.R272R|KAT7_ENST00000513980.1_Intron|KAT7_ENST00000510819.1_Silent_p.R213R|KAT7_ENST00000503935.2_Silent_p.R226R|KAT7_ENST00000454930.2_Silent_p.R243R|KAT7_ENST00000435742.2_Silent_p.R196R|KAT7_ENST00000424009.2_Silent_p.R352R	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	382	MYST-type HAT.				chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R382R(1)									CGATACTCCGCCGGCACATGG	0.458																																					p.R272R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C816T	17						.						58.0	57.0	57.0					17																	47895364		2203	4300	6503	45250363	SO:0001819	synonymous_variant	11143	exon7			AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.1146C>T	17.37:g.47895364C>T		Somatic		Capture	SOLID	Phase_I	45250363	NM_001199157	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Silent	SNP	ENST00000259021.4	37	CCDS11554.1																																																																																				KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366032.1	NM_007067	
NUP88	4927	hgsc.bcm.edu	37	17	5308516	5308516	+	Missense_Mutation	SNP	G	G	A	rs370008628		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:5308516G>A	ENST00000573584.1	-	6	1414	c.905C>T	c.(904-906)gCg>gTg	p.A302V		NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	302					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.A302V(2)		endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						ATCTTCAGCCGCAGGATGCAT	0.438																																					p.A302V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C905T	17						.	G	VAL/ALA	0,4406		0,0,2203	171.0	133.0	146.0		905	4.8	1.0	17		146	1,8599	1.2+/-3.3	0,1,4299	no	missense	NUP88	NM_002532.4	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	302/742	5308516	1,13005	2203	4300	6503	5249240	SO:0001583	missense	4927	exon6			Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.905C>T	17.37:g.5308516G>A	ENSP00000458954:p.Ala302Val	Somatic		Capture	SOLID	Phase_I	5249240	NM_002532	D3DTM2|Q9BWE5	Missense_Mutation	SNP	ENST00000573584.1	37	CCDS11070.1	.	.	.	.	.	.	.	.	.	.	G	32	5.145788	0.94603	0.0	1.16E-4	ENSG00000108559	ENST00000225696;ENST00000543132	.	.	.	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.77837	0.4190	M	0.72118	2.19	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;P;D	0.91635	0.936;0.874;0.999	T	0.75912	-0.3150	9	0.35671	T	0.21	-13.1062	17.4474	0.87581	0.0:0.0:1.0:0.0	.	302;171;302	B7Z5I6;B4DP20;Q99567	.;.;NUP88_HUMAN	V	302;171	.	ENSP00000225696:A302V	A	-	2	0	NUP88	5249240	1.000000	0.71417	0.968000	0.41197	0.952000	0.60782	9.497000	0.97970	2.677000	0.91161	0.655000	0.94253	GCG		NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216918.3	NM_002532	
COL1A1	1277	hgsc.bcm.edu	37	17	48268238	48268238	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:48268238G>A	ENST00000225964.5	-	33	2401	c.2283C>T	c.(2281-2283)ggC>ggT	p.G761G		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	761	Triple-helical region.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.G761G(3)	COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	GACCACGGACGCCATCTTTGC	0.587			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																														p.G761G			Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C2283T	17						.						119.0	93.0	102.0					17																	48268238		2203	4300	6503	45623237	SO:0001819	synonymous_variant	1277	exon33			Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.2283C>T	17.37:g.48268238G>A		Somatic		Capture	SOLID	Phase_I	45623237	NM_000088	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Silent	SNP	ENST00000225964.5	37	CCDS11561.1																																																																																				COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2		
PPM1D	8493	hgsc.bcm.edu	37	17	58678153	58678153	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:58678153G>A	ENST00000305921.3	+	1	610	c.378G>A	c.(376-378)aaG>aaA	p.K126K		NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	126	PP2C-like.				G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.K126K(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			TCATCAAGAAGCAGAAGGGTT	0.612																																					p.K126K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G378A	17						.						48.0	37.0	41.0					17																	58678153		2027	4081	6108	56032935	SO:0001819	synonymous_variant	8493	exon1			U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.378G>A	17.37:g.58678153G>A		Somatic		Capture	SOLID	Phase_I	56032935	NM_003620	Q53XP4|Q6P991|Q8IVR6	Silent	SNP	ENST00000305921.3	37	CCDS11625.1																																																																																				PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449474.1	NM_003620	
SMURF2	64750	hgsc.bcm.edu	37	17	62579600	62579600	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:62579600G>A	ENST00000262435.9	-	7	735	c.548C>T	c.(547-549)aCg>aTg	p.T183M	SMURF2_ENST00000578200.1_Intron	NM_022739.3	NP_073576.1	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2	183	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				BMP signaling pathway (GO:0030509)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|SMAD binding (GO:0046332)|ubiquitin-protein transferase activity (GO:0004842)	p.T183M(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(4)	22	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			CTCCCATTGCGTAGTTCTTGT	0.393																																					p.T183M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C548T	17						.						181.0	142.0	155.0					17																	62579600		2203	4300	6503	60010062	SO:0001583	missense	64750	exon7			AF301463	CCDS32707.1	17q22-q23	2012-10-05			ENSG00000108854	ENSG00000108854			16809	protein-coding gene	gene with protein product		605532				11016919	Standard	XM_005257585		Approved		uc002jep.1	Q9HAU4	OTTHUMG00000179189	ENST00000262435.9:c.548C>T	17.37:g.62579600G>A	ENSP00000262435:p.Thr183Met	Somatic		Capture	SOLID	Phase_I	60010062	NM_022739	Q52LL1|Q9H260	Missense_Mutation	SNP	ENST00000262435.9	37	CCDS32707.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.011421	0.35511	.	.	ENSG00000108854	ENST00000262435	D	0.89050	-2.46	5.22	5.22	0.72569	WW/Rsp5/WWP (5);	0.091491	0.85682	D	0.000000	D	0.96519	0.8864	H	0.96489	3.83	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.97551	1.0092	10	0.72032	D	0.01	.	19.1301	0.93402	0.0:0.0:1.0:0.0	.	183	Q9HAU4	SMUF2_HUMAN	M	183	ENSP00000262435:T183M	ENSP00000262435:T183M	T	-	2	0	SMURF2	60010062	1.000000	0.71417	0.968000	0.41197	0.468000	0.32798	9.051000	0.93849	2.579000	0.87056	0.585000	0.79938	ACG		SMURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445227.1	NM_022739	
AXIN2	8313	hgsc.bcm.edu	37	17	63530162	63530162	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:63530162G>A	ENST00000375702.5	-	8	2186	c.2078C>T	c.(2077-2079)gCg>gTg	p.A693V	AXIN2_ENST00000307078.5_Missense_Mutation_p.A758V			Q9Y2T1	AXIN2_HUMAN	axin 2	758					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)	p.A758V(2)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						GGCCTGGAGCGCGTGGACACC	0.463									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																												p.A758V												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C2273T	17						.						81.0	84.0	83.0					17																	63530162		2203	4300	6503	60960624	SO:0001583	missense	8313	exon10	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.2078C>T	17.37:g.63530162G>A	ENSP00000364854:p.Ala693Val	Somatic		Capture	SOLID	Phase_I	60960624	NM_004655	Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	ENST00000375702.5	37		.	.	.	.	.	.	.	.	.	.	G	13.92	2.380659	0.42207	.	.	ENSG00000168646	ENST00000307078;ENST00000375702	T;T	0.65364	-0.14;-0.15	5.67	4.7	0.59300	.	0.718286	0.14315	N	0.327459	T	0.45617	0.1351	L	0.27053	0.805	0.09310	N	1	P;B	0.35307	0.494;0.226	B;B	0.27380	0.079;0.028	T	0.42396	-0.9454	10	0.72032	D	0.01	-10.4107	9.3882	0.38356	0.0718:0.0:0.785:0.1432	.	758;693	Q9Y2T1;E7ES00	AXIN2_HUMAN;.	V	758;693	ENSP00000302625:A758V;ENSP00000364854:A693V	ENSP00000302625:A758V	A	-	2	0	AXIN2	60960624	0.664000	0.27457	0.529000	0.27951	0.848000	0.48234	3.993000	0.56987	1.398000	0.46701	0.561000	0.74099	GCG		AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000445901.1	NM_004655	
APOH	350	hgsc.bcm.edu	37	17	64224271	64224271	+	Silent	SNP	C	C	T	rs666	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:64224271C>T	ENST00000205948.6	-	2	145	c.108G>A	c.(106-108)ccG>ccA	p.P36P		NM_000042.2	NP_000033.2	P02749	APOH_HUMAN	apolipoprotein H (beta-2-glycoprotein I)	36	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation, intrinsic pathway (GO:0007597)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|plasminogen activation (GO:0031639)|positive regulation of blood coagulation (GO:0030194)|positive regulation of lipoprotein lipase activity (GO:0051006)|regulation of fibrinolysis (GO:0051917)|triglyceride metabolic process (GO:0006641)|triglyceride transport (GO:0034197)	cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipid binding (GO:0005543)	p.P36P(1)		central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			ATGTTTTTAACGGGACCACTG	0.448													c|||	4	0.000798722	0.0	0.0	5008	,	,		20877	0.004		0.0	False		,,,				2504	0.0				p.P36P	Melanoma(155;624 1882 16869 48804 51309)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G108A	17						.						169.0	163.0	165.0					17																	64224271		2203	4300	6503	61654733	SO:0001819	synonymous_variant	350	exon2				CCDS11663.1	17q24.2	2013-01-24				ENSG00000091583		"""Apolipoproteins"""	616	protein-coding gene	gene with protein product	"""beta-2-glycoprotein I"""	138700		B2G1		1582254	Standard	NM_000042		Approved	BG	uc002jfn.4	P02749		ENST00000205948.6:c.108G>A	17.37:g.64224271C>T		Somatic		Capture	SOLID	Phase_I	61654733	NM_000042	B2R9M3|Q9UCN7	Silent	SNP	ENST00000205948.6	37	CCDS11663.1																																																																																				APOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446926.1	NM_000042	
ARSG	22901	hgsc.bcm.edu	37	17	66391274	66391274	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:66391274G>A	ENST00000448504.2	+	10	1948	c.1152G>A	c.(1150-1152)cgG>cgA	p.R384R	ARSG_ENST00000582154.1_3'UTR|ARSG_ENST00000452479.2_Silent_p.R220R	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	384					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.R384R(1)		NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTCAAGGACGGCGCTTTGATG	0.567																																					p.R384R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1152A	17						.						164.0	125.0	138.0					17																	66391274		2203	4300	6503	63902869	SO:0001819	synonymous_variant	22901	exon10			AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.1152G>A	17.37:g.66391274G>A		Somatic		Capture	SOLID	Phase_I	63902869	NM_014960	Q6UXF2|Q9Y2K4	Silent	SNP	ENST00000448504.2	37	CCDS11676.1																																																																																				ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448369.1	NM_014960	
SPNS3	201305	hgsc.bcm.edu	37	17	4391169	4391169	+	Missense_Mutation	SNP	G	G	A	rs368604785		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:4391169G>A	ENST00000355530.2	+	12	1799	c.1519G>A	c.(1519-1521)Gcc>Acc	p.A507T	SPNS3_ENST00000333476.2_Missense_Mutation_p.A380T|RP13-580F15.2_ENST00000576086.1_RNA	NM_182538.4	NP_872344.3	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3 (Drosophila)	507			A -> T (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.A507T(2)		NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(6)|stomach(2)	28						GGGCGCTGGCGCCTCTACAGA	0.617																																					p.A507T												SPNS3,large_intestine,NS,Substitution - Missense,0	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1519A	17						.	G	THR/ALA	0,4406		0,0,2203	87.0	78.0	81.0		1519	-2.2	0.0	17		81	1,8599	1.2+/-3.3	0,1,4299	no	missense	SPNS3	NM_182538.4	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	507/513	4391169	1,13005	2203	4300	6503	4337918	SO:0001583	missense	201305	exon12				CCDS11045.1	17p13.2	2014-08-12			ENSG00000182557	ENSG00000182557			28433	protein-coding gene	gene with protein product		611701					Standard	NM_182538		Approved	MGC29671	uc002fxt.3	Q6ZMD2	OTTHUMG00000177737	ENST00000355530.2:c.1519G>A	17.37:g.4391169G>A	ENSP00000347721:p.Ala507Thr	Somatic		Capture	SOLID	Phase_I	4337918	NM_182538	Q8IZ31	Missense_Mutation	SNP	ENST00000355530.2	37	CCDS11045.1	.	.	.	.	.	.	.	.	.	.	G	6.157	0.397148	0.11638	0.0	1.16E-4	ENSG00000182557	ENST00000355530;ENST00000333476	T;T	0.22134	2.55;1.97	4.18	-2.25	0.06888	.	2.316180	0.01560	N	0.020067	T	0.12135	0.0295	L	0.31294	0.92	0.09310	N	1	B;B	0.18610	0.003;0.029	B;B	0.10450	0.005;0.002	T	0.17561	-1.0365	10	0.02654	T	1	-0.7991	4.5434	0.12069	0.5123:0.1717:0.316:0.0	.	380;507	Q6ZMD2-2;Q6ZMD2	.;SPNS3_HUMAN	T	507;380	ENSP00000347721:A507T;ENSP00000333207:A380T	ENSP00000333207:A380T	A	+	1	0	SPNS3	4337918	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.102000	0.10956	-0.323000	0.08602	-0.339000	0.08088	GCC		SPNS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438793.1	NM_182538	
TP53	7157	hgsc.bcm.edu	37	17	7578407	7578407	+	Missense_Mutation	SNP	G	G	A	rs138729528		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:7578407G>A	ENST00000269305.4	-	5	712	c.523C>T	c.(523-525)Cgc>Tgc	p.R175C	TP53_ENST00000413465.2_Missense_Mutation_p.R175C|TP53_ENST00000445888.2_Missense_Mutation_p.R175C|TP53_ENST00000455263.2_Missense_Mutation_p.R175C|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.R175C|TP53_ENST00000420246.2_Missense_Mutation_p.R175C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175G(20)|p.R175C(19)|p.0?(8)|p.R175S(5)|p.R43G(3)|p.R174fs*24(3)|p.R82G(3)|p.R175_E180delRCPHHE(3)|p.R43C(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.R82C(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R175fs*6(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R175fs*72(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.S149fs*72(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGGGGCAGCGCCTCACAACC	0.657		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			G|||	1	0.000199681	0.0	0.0	5008	,	,		15591	0.0		0.0	False		,,,				2504	0.001				p.R175C	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,lung,NS,Substitution - Missense,+1	.	93	Substitution - Missense(54)|Deletion - Frameshift(19)|Deletion - In frame(8)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(1)	large_intestine(25)|lung(19)|breast(11)|upper_aerodigestive_tract(8)|oesophagus(7)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|liver(4)|bone(4)|stomach(2)|salivary_gland(2)|urinary_tract(2)|cervix(1)	c.C523T	17	GRCh37	CM011013	TP53	M	rs138729528	.						50.0	50.0	50.0					17																	7578407		2203	4300	6503	7519132	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.523C>T	17.37:g.7578407G>A	ENSP00000269305:p.Arg175Cys	Somatic		Capture	SOLID	Phase_I	7519132	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.778621	0.70107	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	5.41	2.14	0.27477	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99837	0.9926	M	0.89030	3	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.997;1.0;1.0;0.998;0.989;1.0	D	0.98336	1.0536	10	0.87932	D	0	-11.8679	4.599	0.12343	0.171:0.0:0.5642:0.2648	.	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175C;ENSP00000352610:R175C;ENSP00000269305:R175C;ENSP00000398846:R175C;ENSP00000391127:R175C;ENSP00000391478:R175C;ENSP00000425104:R43C;ENSP00000423862:R82C	ENSP00000269305:R175C	R	-	1	0	TP53	7519132	1.000000	0.71417	0.786000	0.31890	0.745000	0.42441	4.630000	0.61297	0.778000	0.33520	-0.140000	0.14226	CGC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH2	146754	hgsc.bcm.edu	37	17	7690256	7690256	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:7690256G>A	ENST00000572933.1	+	42	7968	c.6508G>A	c.(6508-6510)Gtg>Atg	p.V2170M	DNAH2_ENST00000389173.2_Missense_Mutation_p.V2170M			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2170	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.V2170M(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CGATGGCCCCGTGGACACACT	0.582																																					p.V2170M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6508A	17						.						98.0	65.0	76.0					17																	7690256		2203	4300	6503	7630981	SO:0001583	missense	146754	exon41			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.6508G>A	17.37:g.7690256G>A	ENSP00000458355:p.Val2170Met	Somatic		Capture	SOLID	Phase_I	7630981	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.029882	0.93575	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	D	0.94138	-3.36	5.05	5.05	0.67936	ATPase, dynein-related, AAA domain (1);	0.000000	0.64402	D	0.000001	D	0.97857	0.9296	H	0.95917	3.74	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98997	1.0810	10	0.87932	D	0	.	17.3337	0.87274	0.0:0.0:1.0:0.0	.	2170	Q9P225	DYH2_HUMAN	M	2170	ENSP00000373825:V2170M	ENSP00000353818:V2170M	V	+	1	0	DNAH2	7630981	1.000000	0.71417	0.985000	0.45067	0.920000	0.55202	5.902000	0.69869	2.615000	0.88500	0.573000	0.79308	GTG		DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
CNTROB	116840	hgsc.bcm.edu	37	17	7852763	7852763	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:7852763G>A	ENST00000563694.1	+	19	3572	c.2647G>A	c.(2647-2649)Gca>Aca	p.A883T	CNTROB_ENST00000565740.1_Missense_Mutation_p.A884T|CNTROB_ENST00000380255.3_3'UTR|CNTROB_ENST00000380262.3_Missense_Mutation_p.A905T	NM_053051.3	NP_444279.2	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	883	Required for centrosome localization.				centriole replication (GO:0007099)|centrosome separation (GO:0051299)|cytokinesis (GO:0000910)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)	p.A905T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)				AAAACCTCCCGCACGGAAGAA	0.587																																					p.A883T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2647A	17						.						61.0	67.0	65.0					17																	7852763		2203	4300	6503	7793488	SO:0001583	missense	116840	exon19			AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037			29616	protein-coding gene	gene with protein product	"""centrobin"""	611425				11984006, 16275750	Standard	NM_001037144		Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.2647G>A	17.37:g.7852763G>A	ENSP00000456335:p.Ala883Thr	Somatic		Capture	SOLID	Phase_I	7793488	NM_053051	A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	Missense_Mutation	SNP	ENST00000563694.1	37	CCDS11126.1	.	.	.	.	.	.	.	.	.	.	G	9.655	1.142706	0.21205	.	.	ENSG00000170037	ENST00000380262	T	0.46819	0.86	6.06	0.433	0.16534	.	0.658928	0.14027	N	0.346383	T	0.29223	0.0727	L	0.27053	0.805	0.09310	N	0.999993	B;B;B	0.10296	0.001;0.003;0.003	B;B;B	0.06405	0.002;0.002;0.002	T	0.16129	-1.0413	10	0.48119	T	0.1	-1.6696	4.6057	0.12376	0.3206:0.0:0.5396:0.1398	.	884;883;905	Q8N137-3;Q8N137;Q8N137-2	.;CNTRB_HUMAN;.	T	905	ENSP00000369614:A905T	ENSP00000369614:A905T	A	+	1	0	CNTROB	7793488	0.001000	0.12720	0.007000	0.13788	0.376000	0.30014	0.155000	0.16362	-0.094000	0.12374	-1.876000	0.00548	GCA		CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421372.1	NM_053051	
MYH10	4628	hgsc.bcm.edu	37	17	8390909	8390909	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:8390909G>A	ENST00000269243.4	-	34	4933	c.4795C>T	c.(4795-4797)Cgg>Tgg	p.R1599W	MYH10_ENST00000379980.4_Missense_Mutation_p.R1615W|MYH10_ENST00000360416.3_Missense_Mutation_p.R1630W|MYH10_ENST00000396239.1_Missense_Mutation_p.R1620W	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1599					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.R1599W(1)		breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						TCGAGCTCCCGCACCTAATGG	0.547																																					p.R1599W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4795T	17						.						147.0	151.0	150.0					17																	8390909		2203	4300	6503	8331634	SO:0001583	missense	4628	exon34			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.4795C>T	17.37:g.8390909G>A	ENSP00000269243:p.Arg1599Trp	Somatic		Capture	SOLID	Phase_I	8331634	NM_005964	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	ENST00000269243.4	37	CCDS11144.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.641590	0.87859	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26	4.99	4.99	0.66335	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.89458	0.6721	M	0.85197	2.74	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.77004	0.989;0.982;0.989	D	0.90782	0.4680	10	0.87932	D	0	.	18.8124	0.92063	0.0:0.0:1.0:0.0	.	1608;1630;1599	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	W	1599;1630;1620;1615	ENSP00000269243:R1599W;ENSP00000353590:R1630W;ENSP00000379539:R1620W;ENSP00000369315:R1615W	ENSP00000269243:R1599W	R	-	1	2	MYH10	8331634	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.666000	0.83877	2.754000	0.94517	0.655000	0.94253	CGG		MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
MYH10	4628	hgsc.bcm.edu	37	17	8409733	8409733	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:8409733C>T	ENST00000269243.4	-	25	3334	c.3196G>A	c.(3196-3198)Gac>Aac	p.D1066N	MYH10_ENST00000360416.3_Missense_Mutation_p.D1097N|MYH10_ENST00000396239.1_Missense_Mutation_p.D1087N|MYH10_ENST00000379980.4_Missense_Mutation_p.D1082N	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1066					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.D1066N(1)		breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						TCCTGCAGGTCGGTCGTCTCC	0.537																																					p.D1066N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3196A	17						.						127.0	108.0	115.0					17																	8409733		2203	4300	6503	8350458	SO:0001583	missense	4628	exon25			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.3196G>A	17.37:g.8409733C>T	ENSP00000269243:p.Asp1066Asn	Somatic		Capture	SOLID	Phase_I	8350458	NM_005964	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	ENST00000269243.4	37	CCDS11144.1	.	.	.	.	.	.	.	.	.	.	C	33	5.211385	0.95069	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	D	0.94000	0.8078	M	0.79343	2.45	0.80722	D	1	D;D;D	0.62365	0.991;0.97;0.991	P;D;P	0.63793	0.83;0.918;0.83	D	0.94473	0.7686	10	0.72032	D	0.01	.	18.5613	0.91101	0.0:1.0:0.0:0.0	.	1075;1097;1066	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	N	1066;1097;1087;1082	ENSP00000269243:D1066N;ENSP00000353590:D1097N;ENSP00000379539:D1087N;ENSP00000369315:D1082N	ENSP00000269243:D1066N	D	-	1	0	MYH10	8350458	1.000000	0.71417	0.949000	0.38748	0.503000	0.33858	7.603000	0.82811	2.672000	0.90937	0.563000	0.77884	GAC		MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
WDR16	146845	hgsc.bcm.edu	37	17	9503415	9503415	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:9503415G>A	ENST00000352665.5	+	6	737	c.668G>A	c.(667-669)gGc>gAc	p.G223D	WDR16_ENST00000299764.5_Missense_Mutation_p.G233D|WDR16_ENST00000396219.3_Missense_Mutation_p.G155D	NM_145054.4	NP_659491.4			WD repeat domain 16									p.G223D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						TTCTACCTTGGCACCACGACT	0.463																																					p.G223D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G668A	17						.						177.0	171.0	173.0					17																	9503415		2203	4300	6503	9444140	SO:0001583	missense	146845	exon6			AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.668G>A	17.37:g.9503415G>A	ENSP00000339449:p.Gly223Asp	Somatic		Capture	SOLID	Phase_I	9444140	NM_145054		Missense_Mutation	SNP	ENST00000352665.5	37	CCDS11149.2	.	.	.	.	.	.	.	.	.	.	G	27.8	4.866902	0.91511	.	.	ENSG00000166596	ENST00000352665;ENST00000396219;ENST00000299764	T;D;T	0.91577	2.29;-2.87;4.45	5.77	5.77	0.91146	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.96405	0.8827	M	0.90705	3.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.997	D	0.96557	0.9412	10	0.87932	D	0	-26.0954	19.133	0.93415	0.0:0.0:1.0:0.0	.	233;155;223	Q8N1V2-2;Q8N1V2-3;Q8N1V2	.;.;WDR16_HUMAN	D	223;155;233	ENSP00000339449:G223D;ENSP00000379521:G155D;ENSP00000299764:G233D	ENSP00000299764:G233D	G	+	2	0	WDR16	9444140	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.218000	0.77991	2.885000	0.99019	0.655000	0.94253	GGC		WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316569.2	NM_145054	
CDC27	996	hgsc.bcm.edu	37	17	45216162	45216162	+	Missense_Mutation	SNP	A	A	C	rs111227623		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:45216162A>C	ENST00000066544.3	-	13	1740	c.1647T>G	c.(1645-1647)gaT>gaG	p.D549E	CDC27_ENST00000531206.1_Missense_Mutation_p.D555E|CDC27_ENST00000446365.2_Missense_Mutation_p.D488E|CDC27_ENST00000527547.1_Missense_Mutation_p.D548E	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	549					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.D549E(4)|p.D555E(2)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AAAGAGCAACATCTTTTTGAA	0.348																																					p.D555E												CDC27,lung,NS,Substitution - Missense,0	.	6	Substitution - Missense(6)	large_intestine(4)|ovary(1)|lung(1)	c.T1665G	17						.						46.0	51.0	49.0					17																	45216162		2202	4299	6501	42571161	SO:0001583	missense	996	exon13			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1647T>G	17.37:g.45216162A>C	ENSP00000066544:p.Asp549Glu	Somatic		Capture	SOLID	Phase_I	42571161	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	6.981	0.550975	0.13374	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.65364	-0.14;-0.15;0.15;-0.12	5.57	-0.476	0.12100	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.25158	0.0611	N	0.01473	-0.845	0.48040	D	0.999577	B;B;B;B	0.27192	0.052;0.171;0.171;0.052	B;B;B;B	0.27715	0.021;0.082;0.082;0.021	T	0.36261	-0.9755	10	0.02654	T	1	-6.7614	9.4643	0.38802	0.6029:0.0:0.3971:0.0	.	488;548;555;549	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	E	549;555;488;548	ENSP00000066544:D549E;ENSP00000434614:D555E;ENSP00000392802:D488E;ENSP00000437339:D548E	ENSP00000066544:D549E	D	-	3	2	CDC27	42571161	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	1.462000	0.35266	-0.146000	0.11274	-0.256000	0.11100	GAT		CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
RNF213	57674	hgsc.bcm.edu	37	17	78332235	78332235	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr17:78332235T>C	ENST00000582970.1	+	37	11153	c.11010T>C	c.(11008-11010)agT>agC	p.S3670S	RNF213_ENST00000336301.6_Silent_p.S1743S|RNF213_ENST00000508628.2_Silent_p.S3719S|CTD-2047H16.4_ENST00000575034.1_RNA|CTD-2047H16.4_ENST00000572151.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3670					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S1743S(1)|p.S3719S(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TTATTTTCAGTGACACGATGC	0.468																																					p.S3719S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T11157C	17						.						106.0	87.0	94.0					17																	78332235		2203	4300	6503	75946830	SO:0001819	synonymous_variant	57674	exon38			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.11010T>C	17.37:g.78332235T>C		Somatic		Capture	SOLID	Phase_I	75946830	NM_020914	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	37	CCDS58606.1																																																																																				RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
HSPA13	6782	hgsc.bcm.edu	37	21	15745957	15745957	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr21:15745957T>C	ENST00000285667.3	-	5	1464	c.1397A>G	c.(1396-1398)cAa>cGa	p.Q466R	HSPA13_ENST00000544452.1_Missense_Mutation_p.Q258R	NM_006948.4	NP_008879.3	P48723	HSP13_HUMAN	heat shock protein 70kDa family, member 13	466						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)	p.Q466R(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						GTTGGTTTTTTGTAAATGCTT	0.398																																					p.Q466R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1397G	21						.						37.0	37.0	37.0					21																	15745957		2203	4295	6498	14667828	SO:0001583	missense	6782	exon5				CCDS13567.1	21q11.1	2011-09-02	2008-06-17	2008-06-17	ENSG00000155304	ENSG00000155304		"""Heat shock proteins / HSP70"""	11375	protein-coding gene	gene with protein product		601100	"""stress 70 protein chaperone, microsome-associated, 60kD"", ""stress 70 protein chaperone, microsome-associated, 60kDa"""	STCH		8825657	Standard	NM_006948		Approved		uc002yjt.3	P48723	OTTHUMG00000074261	ENST00000285667.3:c.1397A>G	21.37:g.15745957T>C	ENSP00000285667:p.Gln466Arg	Somatic		Capture	SOLID	Phase_I	14667828	NM_006948	B2R616|Q8NE40	Missense_Mutation	SNP	ENST00000285667.3	37	CCDS13567.1	.	.	.	.	.	.	.	.	.	.	T	4.837	0.155623	0.09236	.	.	ENSG00000155304	ENST00000285667;ENST00000544452	T;T	0.07908	4.94;3.15	5.41	4.1	0.47936	.	0.136943	0.46145	U	0.000305	T	0.03305	0.0096	N	0.03608	-0.345	0.34405	D	0.695763	B	0.02656	0.0	B	0.04013	0.001	T	0.12889	-1.0530	10	0.87932	D	0	-12.3002	3.4984	0.07664	0.0:0.328:0.0:0.672	.	466	P48723	HSP13_HUMAN	R	466;258	ENSP00000285667:Q466R;ENSP00000441986:Q258R	ENSP00000285667:Q466R	Q	-	2	0	HSPA13	14667828	0.993000	0.37304	1.000000	0.80357	0.997000	0.91878	2.680000	0.46918	2.169000	0.68431	0.533000	0.62120	CAA		HSPA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157815.1		
PAXBP1	94104	hgsc.bcm.edu	37	21	34120841	34120841	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr21:34120841C>T	ENST00000331923.4	-	11	2081	c.1892G>A	c.(1891-1893)cGa>cAa	p.R631Q	PAXBP1_ENST00000290178.4_Missense_Mutation_p.R631Q	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	631					muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R631Q(1)									GAGCTGAAGTCGTATGAGGGG	0.378																																					p.R631Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1892A	21						.						87.0	85.0	85.0					21																	34120841		2203	4300	6503	33042712	SO:0001583	missense	94104	exon11			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.1892G>A	21.37:g.34120841C>T	ENSP00000328992:p.Arg631Gln	Somatic		Capture	SOLID	Phase_I	33042712	NM_013329	D3DSE7|Q96DU8|Q9NYQ0	Missense_Mutation	SNP	ENST00000331923.4	37	CCDS13619.1	.	.	.	.	.	.	.	.	.	.	C	36	5.793089	0.96952	.	.	ENSG00000159086	ENST00000331923;ENST00000290178	T;T	0.55052	0.54;0.54	6.16	6.16	0.99307	GC-rich sequence DNA-binding factor domain (1);	0.000000	0.85682	D	0.000000	T	0.77896	0.4199	M	0.85041	2.73	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.99;0.994;0.999	T	0.78909	-0.2018	10	0.72032	D	0.01	-18.4732	20.4549	0.99139	0.0:1.0:0.0:0.0	.	631;631;140	Q9Y5B6-2;Q9Y5B6;B3KSC0	.;GCFC1_HUMAN;.	Q	631	ENSP00000328992:R631Q;ENSP00000290178:R631Q	ENSP00000290178:R631Q	R	-	2	0	GCFC1	33042712	1.000000	0.71417	0.926000	0.36857	0.955000	0.61496	5.784000	0.68990	2.937000	0.99478	0.650000	0.86243	CGA		PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139563.1	NM_013329	
TRAPPC10	7109	hgsc.bcm.edu	37	21	45511858	45511858	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr21:45511858A>G	ENST00000291574.4	+	19	3100	c.2925A>G	c.(2923-2925)tcA>tcG	p.S975S	TRAPPC10_ENST00000483973.1_3'UTR	NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	975					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)	p.S975S(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						TTCAGCTGTCAGATAGTTATC	0.373																																					p.S975S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2925G	21						.						164.0	163.0	164.0					21																	45511858		2203	4300	6503	44336286	SO:0001819	synonymous_variant	7109	exon19			U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.2925A>G	21.37:g.45511858A>G		Somatic		Capture	SOLID	Phase_I	44336286	NM_003274	Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Silent	SNP	ENST00000291574.4	37	CCDS13704.1																																																																																				TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1	NM_003274	
MCM3AP	8888	hgsc.bcm.edu	37	21	47664934	47664934	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr21:47664934T>C	ENST00000397708.1	-	24	5079	c.4825A>G	c.(4825-4827)Att>Gtt	p.I1609V	MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP-AS1_ENST00000455567.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|AP001469.7_ENST00000444966.1_RNA|MCM3AP_ENST00000291688.1_Missense_Mutation_p.I1609V|MCM3AP-AS1_ENST00000591223.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP_ENST00000467026.1_5'UTR|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP-AS1_ENST00000421927.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1609					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)	p.I1609V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					AACAGCTCAATGATGGCGCCA	0.557																																					p.I1609V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4825G	21						.						117.0	104.0	108.0					21																	47664934		2203	4300	6503	46489362	SO:0001583	missense	8888	exon23			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.4825A>G	21.37:g.47664934T>C	ENSP00000380820:p.Ile1609Val	Somatic		Capture	SOLID	Phase_I	46489362	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	T	6.443	0.449789	0.12223	.	.	ENSG00000160294	ENST00000397708;ENST00000291688;ENST00000539647	T;T	0.03663	3.85;3.85	5.45	3.08	0.35506	.	0.149625	0.64402	N	0.000013	T	0.03739	0.0106	L	0.41415	1.275	0.35759	D	0.819994	B;B	0.19583	0.032;0.037	B;B	0.22386	0.012;0.039	T	0.41070	-0.9529	10	0.19147	T	0.46	-13.6613	9.6101	0.39657	0.0:0.1426:0.0:0.8574	.	1609;104	O60318;B3KT88	MCM3A_HUMAN;.	V	1609;1609;104	ENSP00000380820:I1609V;ENSP00000291688:I1609V	ENSP00000291688:I1609V	I	-	1	0	MCM3AP	46489362	1.000000	0.71417	0.670000	0.29842	0.262000	0.26303	2.004000	0.40854	0.370000	0.24538	0.533000	0.62120	ATT		MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
MCM3AP	8888	hgsc.bcm.edu	37	21	47699944	47699944	+	Missense_Mutation	SNP	C	C	T	rs149627512	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr21:47699944C>T	ENST00000397708.1	-	5	1884	c.1630G>A	c.(1630-1632)Gca>Aca	p.A544T	MCM3AP_ENST00000291688.1_Missense_Mutation_p.A544T			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	544	DNA primase.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)	p.A544T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					GTCCTCCCTGCGGCCTTGCCA	0.542													C|||	2	0.000399361	0.0	0.0	5008	,	,		19124	0.0		0.0	False		,,,				2504	0.002				p.A544T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1630A	21						.	C	THR/ALA	0,4406		0,0,2203	121.0	111.0	114.0		1630	-4.4	0.0	21	dbSNP_134	114	2,8598	2.2+/-6.3	0,2,4298	no	missense	MCM3AP	NM_003906.3	58	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	544/1981	47699944	2,13004	2203	4300	6503	46524372	SO:0001583	missense	8888	exon4			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.1630G>A	21.37:g.47699944C>T	ENSP00000380820:p.Ala544Thr	Somatic		Capture	SOLID	Phase_I	46524372	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	C	4.539	0.099978	0.08681	0.0	2.33E-4	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.03413	3.94;3.94	5.12	-4.39	0.03611	.	1.407880	0.04610	N	0.400043	T	0.01627	0.0052	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.45848	-0.9233	10	0.12103	T	0.63	0.2285	1.6595	0.02788	0.4855:0.1392:0.1058:0.2695	.	544	O60318	MCM3A_HUMAN	T	544	ENSP00000380820:A544T;ENSP00000291688:A544T	ENSP00000291688:A544T	A	-	1	0	MCM3AP	46524372	0.000000	0.05858	0.000000	0.03702	0.069000	0.16628	-0.038000	0.12144	-0.570000	0.06022	-1.475000	0.01000	GCA		MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
PCNT	5116	hgsc.bcm.edu	37	21	47836181	47836181	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr21:47836181G>A	ENST00000359568.5	+	30	6456	c.6349G>A	c.(6349-6351)Gga>Aga	p.G2117R	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2117					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.G2117R(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					TTCCTGTGACGGAGAAGAGCC	0.522																																					p.G2117R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6349A	21						.						100.0	93.0	96.0					21																	47836181		2203	4300	6503	46660609	SO:0001583	missense	5116	exon30			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.6349G>A	21.37:g.47836181G>A	ENSP00000352572:p.Gly2117Arg	Somatic		Capture	SOLID	Phase_I	46660609	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.605844	0.28623	.	.	ENSG00000160299	ENST00000359568	T	0.01484	4.84	4.82	-3.2	0.05156	.	0.787871	0.10409	N	0.678157	T	0.01558	0.0050	L	0.50333	1.59	0.09310	N	1	B;P	0.35628	0.389;0.513	B;B	0.21546	0.035;0.015	T	0.41413	-0.9510	10	0.39692	T	0.17	.	6.2835	0.21021	0.4115:0.3458:0.2427:0.0	.	1999;2117	O95613-2;O95613	.;PCNT_HUMAN	R	2117	ENSP00000352572:G2117R	ENSP00000352572:G2117R	G	+	1	0	PCNT	46660609	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.841000	0.04359	-0.405000	0.07599	0.655000	0.94253	GGA		PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
TNFRSF17	608	hgsc.bcm.edu	37	16	12060135	12060135	+	Missense_Mutation	SNP	G	G	A	rs146604927		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:12060135G>A	ENST00000053243.1	+	2	432	c.214G>A	c.(214-216)Gtg>Atg	p.V72M	TNFRSF17_ENST00000396495.3_Intron|RP11-166B2.1_ENST00000532936.1_Intron	NM_001192.2	NP_001183.2	Q02223	TNR17_HUMAN	tumor necrosis factor receptor superfamily, member 17	72					cell proliferation (GO:0008283)|immune system process (GO:0002376)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.V72M(1)		large_intestine(3)|lung(3)	6						GGCAGTTTTCGTGCTAATGTT	0.368			T	IL2	intestinal T-cell lymphoma																																p.V72M			Dom	yes		16	16p13.1	608	"""tumor necrosis factor receptor superfamily, member 17"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G214A	16						.						140.0	128.0	132.0					16																	12060135		2197	4300	6497	11967636	SO:0001583	missense	608	exon2			Z29574	CCDS10552.1	16p13.1	2013-05-22			ENSG00000048462	ENSG00000048462		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11913	protein-coding gene	gene with protein product		109545		BCMA		1396583, 8165126	Standard	NM_001192		Approved	BCM, CD269, TNFRSF13A	uc002dbv.3	Q02223	OTTHUMG00000129826	ENST00000053243.1:c.214G>A	16.37:g.12060135G>A	ENSP00000053243:p.Val72Met	Somatic		Capture	SOLID	Phase_I	11967636	NM_001192	Q2TQ40	Missense_Mutation	SNP	ENST00000053243.1	37	CCDS10552.1	.	.	.	.	.	.	.	.	.	.	G	11.83	1.754369	0.31046	.	.	ENSG00000048462	ENST00000053243;ENST00000435355	T	0.11604	2.76	6.06	1.07	0.20283	.	0.488825	0.17855	N	0.159714	T	0.07188	0.0182	L	0.51422	1.61	0.18873	N	0.999985	P;P	0.47253	0.669;0.892	B;B	0.31442	0.058;0.13	T	0.31586	-0.9938	10	0.72032	D	0.01	-8.6814	5.7124	0.17943	0.2402:0.0:0.6071:0.1527	.	69;72	E7EQ20;Q02223	.;TNR17_HUMAN	M	72;69	ENSP00000053243:V72M	ENSP00000053243:V72M	V	+	1	0	TNFRSF17	11967636	0.000000	0.05858	0.010000	0.14722	0.069000	0.16628	0.356000	0.20181	0.324000	0.23333	-0.136000	0.14681	GTG		TNFRSF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252062.1		
TNFRSF17	608	hgsc.bcm.edu	37	16	12061605	12061605	+	Silent	SNP	C	C	T	rs35434482	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:12061605C>T	ENST00000053243.1	+	3	674	c.456C>T	c.(454-456)ggC>ggT	p.G152G	TNFRSF17_ENST00000396495.3_Silent_p.G103G|RP11-166B2.1_ENST00000532936.1_Intron	NM_001192.2	NP_001183.2	Q02223	TNR17_HUMAN	tumor necrosis factor receptor superfamily, member 17	152					cell proliferation (GO:0008283)|immune system process (GO:0002376)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.G152G(1)		large_intestine(3)|lung(3)	6						TGGAGGAAGGCGCAACCATTC	0.483			T	IL2	intestinal T-cell lymphoma								C|||	17	0.00339457	0.0113	0.0029	5008	,	,		19890	0.0		0.0	False		,,,				2504	0.0				p.G152G			Dom	yes		16	16p13.1	608	"""tumor necrosis factor receptor superfamily, member 17"""		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C456T	16						.	C		33,4361	38.4+/-70.7	0,33,2164	141.0	117.0	125.0		456	-10.8	0.1	16	dbSNP_126	125	3,8597	2.2+/-6.3	0,3,4297	no	coding-synonymous	TNFRSF17	NM_001192.2		0,36,6461	TT,TC,CC		0.0349,0.751,0.2771		152/185	12061605	36,12958	2197	4300	6497	11969106	SO:0001819	synonymous_variant	608	exon3			Z29574	CCDS10552.1	16p13.1	2013-05-22			ENSG00000048462	ENSG00000048462		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11913	protein-coding gene	gene with protein product		109545		BCMA		1396583, 8165126	Standard	NM_001192		Approved	BCM, CD269, TNFRSF13A	uc002dbv.3	Q02223	OTTHUMG00000129826	ENST00000053243.1:c.456C>T	16.37:g.12061605C>T		Somatic		Capture	SOLID	Phase_I	11969106	NM_001192	Q2TQ40	Silent	SNP	ENST00000053243.1	37	CCDS10552.1																																																																																				TNFRSF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252062.1		
ERCC4	2072	hgsc.bcm.edu	37	16	14041799	14041799	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:14041799T>C	ENST00000311895.7	+	11	2355	c.2346T>C	c.(2344-2346)aaT>aaC	p.N782N		NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	782	Nuclease.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.N782N(1)		NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						TCTCCAGCAATGACATTAGTT	0.517			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.N782N		yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2346C	16						.						111.0	105.0	107.0					16																	14041799		2197	4300	6497	13949300	SO:0001819	synonymous_variant	2072	exon11	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.2346T>C	16.37:g.14041799T>C		Somatic		Capture	SOLID	Phase_I	13949300	NM_005236	A5PKV6|A8K111|O00140|Q8TD83	Silent	SNP	ENST00000311895.7	37	CCDS32390.1																																																																																				ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	NM_005236	
SYT17	51760	hgsc.bcm.edu	37	16	19191755	19191755	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:19191755C>T	ENST00000355377.2	+	4	623	c.225C>T	c.(223-225)caC>caT	p.H75H	SYT17_ENST00000562711.2_Silent_p.H71H|SYT17_ENST00000568115.1_Silent_p.H14H|SYT17_ENST00000562034.1_Silent_p.H14H	NM_016524.2	NP_057608.2	Q9BSW7	SYT17_HUMAN	synaptotagmin XVII	75					exocytosis (GO:0006887)	membrane (GO:0016020)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)	p.H75H(1)		NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	17						ACTCTGTCCACACGGCCAGCG	0.597											OREG0023658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H75H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C225T	16						.						97.0	76.0	83.0					16																	19191755		2197	4300	6497	19099256	SO:0001819	synonymous_variant	51760	exon4				CCDS10575.1	16p12.3	2013-01-21			ENSG00000103528	ENSG00000103528		"""Synaptotagmins"""	24119	protein-coding gene	gene with protein product	"""B/K protein"""					10493829	Standard	NM_016524		Approved		uc002dfw.3	Q9BSW7	OTTHUMG00000131461	ENST00000355377.2:c.225C>T	16.37:g.19191755C>T		Somatic	731	Capture	SOLID	Phase_I	19099256	NM_016524	O43330|Q9NZ18	Silent	SNP	ENST00000355377.2	37	CCDS10575.1																																																																																				SYT17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254286.2	NM_016524	
PDPK1	5170	hgsc.bcm.edu	37	16	2647272	2647272	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:2647272A>G	ENST00000342085.4	+	13	1699	c.1550A>G	c.(1549-1551)cAc>cGc	p.H517R	PDPK1_ENST00000268673.7_Missense_Mutation_p.H390R|PDPK1_ENST00000354836.5_Missense_Mutation_p.H493R|PDPK1_ENST00000441549.3_Intron|CTD-3126B10.1_ENST00000562166.1_RNA|PDPK1_ENST00000389224.3_Missense_Mutation_p.H490R	NM_002613.4	NP_002604.1	O15530	PDPK1_HUMAN	3-phosphoinositide dependent protein kinase 1	517	PH.				actin cytoskeleton organization (GO:0030036)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway (GO:0097191)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|focal adhesion assembly (GO:0048041)|hyperosmotic response (GO:0006972)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of endothelial cell migration (GO:0010594)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of mast cell degranulation (GO:0043304)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	3-phosphoinositide-dependent protein kinase activity (GO:0004676)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein serine/threonine kinase activity (GO:0004674)	p.H517R(1)		central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	7		Ovarian(90;0.17)			Celecoxib(DB00482)	TTCTTTGTCCACACGGTGAGT	0.493																																					p.H517R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1550G	16						.						77.0	78.0	77.0					16																	2647272		2198	4300	6498	2587273	SO:0001583	missense	5170	exon13			AF017995	CCDS10472.1, CCDS10473.1, CCDS58411.1	16p13.3	2014-03-20	2014-03-20		ENSG00000140992	ENSG00000140992			8816	protein-coding gene	gene with protein product	"""PkB kinase"""	605213				9094314, 9445477	Standard	NM_002613		Approved	PDK1	uc002cqs.4	O15530	OTTHUMG00000128874	ENST00000342085.4:c.1550A>G	16.37:g.2647272A>G	ENSP00000344220:p.His517Arg	Somatic		Capture	SOLID	Phase_I	2587273	NM_002613	H0Y4Z0|Q59EH6|Q6FI20|Q8IV52|Q9BRD5	Missense_Mutation	SNP	ENST00000342085.4	37	CCDS10472.1	.	.	.	.	.	.	.	.	.	.	-	19.03	3.748244	0.69533	.	.	ENSG00000140992	ENST00000342085;ENST00000268673;ENST00000354836;ENST00000389224	T;T;T;T	0.22539	1.95;1.95;1.95;1.95	5.01	5.01	0.66863	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.49575	0.1565	M	0.84948	2.725	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.78314	0.991;0.957	T	0.54761	-0.8245	10	0.51188	T	0.08	-17.8767	13.6865	0.62520	1.0:0.0:0.0:0.0	.	390;517	O15530-4;O15530	.;PDPK1_HUMAN	R	517;390;493;490	ENSP00000344220:H517R;ENSP00000268673:H390R;ENSP00000346895:H493R;ENSP00000373876:H490R	ENSP00000268673:H390R	H	+	2	0	PDPK1	2587273	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	9.083000	0.94067	2.111000	0.64477	0.533000	0.62120	CAC		PDPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250831.3		
SRRM2	23524	hgsc.bcm.edu	37	16	2815286	2815286	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:2815286A>G	ENST00000301740.8	+	11	5306	c.4757A>G	c.(4756-4758)gAc>gGc	p.D1586G		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1586	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.D1586G(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CCAGAGGTTGACAGCAAATCT	0.527																																					p.D1586G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4757G	16						.						91.0	80.0	84.0					16																	2815286		2198	4300	6498	2755287	SO:0001583	missense	23524	exon11			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.4757A>G	16.37:g.2815286A>G	ENSP00000301740:p.Asp1586Gly	Somatic		Capture	SOLID	Phase_I	2755287	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	A	11.37	1.619896	0.28801	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.27557	1.66	5.18	5.18	0.71444	.	0.190191	0.37012	N	0.002290	T	0.29158	0.0725	L	0.58101	1.795	0.25507	N	0.987497	B	0.26635	0.155	B	0.28232	0.087	T	0.22836	-1.0205	10	0.44086	T	0.13	-1.6626	7.6978	0.28604	0.9058:0.0:0.0942:0.0	.	1586	Q9UQ35	SRRM2_HUMAN	G	1586;1586;838	ENSP00000301740:D1586G	ENSP00000301740:D1586G	D	+	2	0	SRRM2	2755287	0.427000	0.25514	0.786000	0.31890	0.964000	0.63967	1.534000	0.36051	1.962000	0.57031	0.533000	0.62120	GAC		SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
SRRM2	23524	hgsc.bcm.edu	37	16	2816687	2816687	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:2816687G>A	ENST00000301740.8	+	11	6707	c.6158G>A	c.(6157-6159)cGc>cAc	p.R2053H		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2053	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.R2053H(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						ATCCGCCGCCGCTCCAGATCC	0.572																																					p.R2053H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6158A	16						.						73.0	55.0	61.0					16																	2816687		2198	4300	6498	2756688	SO:0001583	missense	23524	exon11			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.6158G>A	16.37:g.2816687G>A	ENSP00000301740:p.Arg2053His	Somatic		Capture	SOLID	Phase_I	2756688	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	G	11.97	1.798352	0.31777	.	.	ENSG00000167978	ENST00000301740;ENST00000544933	T	0.24908	1.83	5.47	5.47	0.80525	.	0.000000	0.64402	D	0.000017	T	0.28764	0.0713	N	0.08118	0	0.35307	D	0.783506	D	0.76494	0.999	P	0.62435	0.902	T	0.40440	-0.9563	10	0.35671	T	0.21	-6.2072	16.8142	0.85729	0.0:0.0:1.0:0.0	.	2053	Q9UQ35	SRRM2_HUMAN	H	2053;1305	ENSP00000301740:R2053H	ENSP00000301740:R2053H	R	+	2	0	SRRM2	2756688	1.000000	0.71417	0.982000	0.44146	0.917000	0.54804	4.927000	0.63440	2.577000	0.86979	0.655000	0.94253	CGC		SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
COG7	91949	hgsc.bcm.edu	37	16	23404616	23404616	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:23404616T>C	ENST00000307149.5	-	15	2125	c.1940A>G	c.(1939-1941)cAg>cGg	p.Q647R	COG7_ENST00000569635.1_Intron	NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	647					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.Q647R(1)		breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		AGAGTCCTCCTGAGTCACAAA	0.512																																					p.Q647R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1940G	16						.						85.0	70.0	75.0					16																	23404616		2197	4300	6497	23312117	SO:0001583	missense	91949	exon15			AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.1940A>G	16.37:g.23404616T>C	ENSP00000305442:p.Gln647Arg	Somatic		Capture	SOLID	Phase_I	23312117	NM_153603	Q6UWU7	Missense_Mutation	SNP	ENST00000307149.5	37	CCDS10610.1	.	.	.	.	.	.	.	.	.	.	T	17.99	3.522809	0.64747	.	.	ENSG00000168434	ENST00000307149	T	0.44482	0.92	4.98	4.98	0.66077	.	0.053567	0.85682	D	0.000000	T	0.32466	0.0830	N	0.04508	-0.205	0.53688	D	0.999971	D	0.60160	0.987	P	0.61592	0.891	T	0.15407	-1.0438	10	0.09843	T	0.71	-27.007	10.0848	0.42412	0.0:0.0:0.1685:0.8314	.	647	P83436	COG7_HUMAN	R	647	ENSP00000305442:Q647R	ENSP00000305442:Q647R	Q	-	2	0	COG7	23312117	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.168000	0.71908	1.866000	0.54105	0.533000	0.62120	CAG		COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211625.1		
CLN3	1201	hgsc.bcm.edu	37	16	28488849	28488849	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:28488849G>T	ENST00000569430.1	-	17	2124	c.1305C>A	c.(1303-1305)tgC>tgA	p.C435*	CLN3_ENST00000567963.1_Nonsense_Mutation_p.C338*|CLN3_ENST00000357806.7_Nonsense_Mutation_p.C336*|CLN3_ENST00000360019.2_Nonsense_Mutation_p.C435*|CLN3_ENST00000355477.5_Nonsense_Mutation_p.C387*|CLN3_ENST00000354630.5_Nonsense_Mutation_p.C418*|CLN3_ENST00000568224.1_Nonsense_Mutation_p.C357*|CLN3_ENST00000565316.1_Nonsense_Mutation_p.C418*|CLN3_ENST00000395653.4_Nonsense_Mutation_p.C335*|CLN3_ENST00000535392.1_Nonsense_Mutation_p.C357*|CLN3_ENST00000333496.9_Nonsense_Mutation_p.C411*|CLN3_ENST00000357857.9_Nonsense_Mutation_p.C381*|CLN3_ENST00000359984.7_Nonsense_Mutation_p.C435*			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	435					action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)	p.C435*(1)		breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						AGGAGAGCTGGCAGAGGAAGT	0.612																																					p.C435X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1305A	16						.						55.0	61.0	59.0					16																	28488849		2197	4300	6497	28396350	SO:0001587	stop_gained	1201	exon16			U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.1305C>A	16.37:g.28488849G>T	ENSP00000454229:p.Cys435*	Somatic		Capture	SOLID	Phase_I	28396350	NM_001042432	B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	Nonsense_Mutation	SNP	ENST00000569430.1	37	CCDS10632.1	.	.	.	.	.	.	.	.	.	.	g	37	6.173450	0.97348	.	.	ENSG00000188603	ENST00000535392;ENST00000359984;ENST00000360019;ENST00000354630;ENST00000355477;ENST00000357857;ENST00000395653;ENST00000357806	.	.	.	5.16	0.773	0.18516	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.9381	7.9304	0.29899	0.4581:0.0:0.5419:0.0	.	.	.	.	X	357;435;435;418;387;381;335;336	.	ENSP00000346650:C418X	C	-	3	2	CLN3	28396350	1.000000	0.71417	0.749000	0.31150	0.854000	0.48673	2.069000	0.41481	-0.076000	0.12775	0.561000	0.74099	TGC		CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214115.2		
SH2B1	25970	hgsc.bcm.edu	37	16	28883934	28883934	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:28883934A>T	ENST00000322610.8	+	10	2244	c.1805A>T	c.(1804-1806)gAg>gTg	p.E602V	SH2B1_ENST00000337120.5_Missense_Mutation_p.E602V|SH2B1_ENST00000538342.1_Missense_Mutation_p.E266V|SH2B1_ENST00000545570.1_Missense_Mutation_p.E292V|SH2B1_ENST00000395532.4_Missense_Mutation_p.E602V|SH2B1_ENST00000359285.5_Missense_Mutation_p.E602V|SH2B1_ENST00000563674.1_Intron			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	602	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.E602V(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						GATATGCTCGAGCACTTCCGG	0.612																																					p.E602V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1805T	16						.						141.0	122.0	128.0					16																	28883934		2197	4300	6497	28791435	SO:0001583	missense	25970	exon7			AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.1805A>T	16.37:g.28883934A>T	ENSP00000321221:p.Glu602Val	Somatic		Capture	SOLID	Phase_I	28791435	NM_015503	A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	ENST00000322610.8	37	CCDS53996.1	.	.	.	.	.	.	.	.	.	.	a	13.21	2.168469	0.38315	.	.	ENSG00000178188	ENST00000322610;ENST00000545570;ENST00000359285;ENST00000538342;ENST00000395532;ENST00000337120	T;T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01;-0.01	5.1	4.01	0.46588	SH2 motif (5);	0.129193	0.50627	D	0.000117	T	0.74854	0.3771	M	0.90977	3.165	0.42234	D	0.991906	B;B;B;P;P	0.45768	0.108;0.023;0.005;0.866;0.648	B;B;B;P;B	0.51135	0.242;0.035;0.032;0.66;0.267	T	0.79633	-0.1722	10	0.59425	D	0.04	-4.5342	9.362	0.38201	0.9138:0.0:0.0862:0.0	.	266;292;602;602;602	B4DLN5;F5GXU7;Q9NRF2-2;Q9NRF2-3;Q9NRF2	.;.;.;.;SH2B1_HUMAN	V	602;292;602;266;602;602	ENSP00000321221:E602V;ENSP00000440354:E292V;ENSP00000352232:E602V;ENSP00000438784:E266V;ENSP00000378903:E602V;ENSP00000337163:E602V	ENSP00000321221:E602V	E	+	2	0	SH2B1	28791435	0.995000	0.38212	1.000000	0.80357	0.997000	0.91878	1.496000	0.35638	1.915000	0.55452	0.456000	0.33151	GAG		SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503	
CD2BP2	10421	hgsc.bcm.edu	37	16	30365563	30365563	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:30365563C>A	ENST00000305596.3	-	3	334	c.159G>T	c.(157-159)gaG>gaT	p.E53D	CD2BP2_ENST00000569466.1_Missense_Mutation_p.E53D|RP11-347C12.10_ENST00000563252.1_lincRNA	NM_006110.2	NP_006101.1	O95400	CD2B2_HUMAN	CD2 (cytoplasmic tail) binding protein 2	53					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of phosphatase activity (GO:0010923)|RNA splicing (GO:0008380)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	ribonucleoprotein complex binding (GO:0043021)	p.E53D(2)		breast(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	15						CATCATCATCCTCCTCCTCAT	0.517																																					p.E53D												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G159T	16						.						233.0	224.0	227.0					16																	30365563		2197	4300	6497	30273064	SO:0001583	missense	10421	exon3			AF104222	CCDS10675.1	16p11.2	2012-04-17	2006-03-28		ENSG00000169217	ENSG00000169217		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 59"""	604470	"""CD2 antigen (cytoplasmic tail)-binding protein 2"""			9843987	Standard	NM_006110		Approved	LIN1, Snu40, PPP1R59	uc002dxs.3	O95400	OTTHUMG00000132397	ENST00000305596.3:c.159G>T	16.37:g.30365563C>A	ENSP00000304903:p.Glu53Asp	Somatic		Capture	SOLID	Phase_I	30273064	NM_006110	B2RDX2|Q9ULP2	Missense_Mutation	SNP	ENST00000305596.3	37	CCDS10675.1	.	.	.	.	.	.	.	.	.	.	A	0.034	-1.315750	0.01331	.	.	ENSG00000169217	ENST00000305596	T	0.26660	1.72	0.0465	0.0465	0.14256	.	0.149066	0.64402	N	0.000019	T	0.11067	0.0270	N	0.00869	-1.13	0.19300	N	0.99997	D	0.89917	1.0	D	0.80764	0.994	T	0.40572	-0.9556	9	0.02654	T	1	.	.	.	.	.	53	O95400	CD2B2_HUMAN	D	53	ENSP00000304903:E53D	ENSP00000304903:E53D	E	-	3	2	CD2BP2	30273064	0.876000	0.30132	0.875000	0.34327	0.570000	0.35934	-2.388000	0.01059	-1.589000	0.01625	-1.596000	0.00833	GAG		CD2BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255528.1	NM_006110	
SETD1A	9739	hgsc.bcm.edu	37	16	30975475	30975475	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:30975475G>A	ENST00000262519.8	+	6	1386	c.700G>A	c.(700-702)Gtg>Atg	p.V234M		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	234					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.V234M(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CACCACTGCGGTGGGCACTCC	0.627																																					p.V234M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G700A	16						.						98.0	88.0	91.0					16																	30975475		2197	4300	6497	30882976	SO:0001583	missense	9739	exon6			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.700G>A	16.37:g.30975475G>A	ENSP00000262519:p.Val234Met	Somatic		Capture	SOLID	Phase_I	30882976	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	37	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.806610	0.31961	.	.	ENSG00000099381	ENST00000262519;ENST00000452917	D	0.94576	-3.46	5.68	4.71	0.59529	.	0.477763	0.19507	N	0.112596	D	0.89870	0.6840	L	0.32530	0.975	0.21147	N	0.999779	P	0.34462	0.454	B	0.37833	0.259	T	0.82137	-0.0606	10	0.41790	T	0.15	.	6.9591	0.24587	0.0968:0.2254:0.6778:0.0	.	234	O15047	SET1A_HUMAN	M	234	ENSP00000262519:V234M	ENSP00000262519:V234M	V	+	1	0	SETD1A	30882976	0.798000	0.28890	0.989000	0.46669	0.672000	0.39443	2.289000	0.43523	2.675000	0.91044	0.561000	0.74099	GTG		SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
ITGAD	3681	hgsc.bcm.edu	37	16	31414964	31414964	+	Silent	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:31414964G>T	ENST00000389202.2	+	7	751	c.702G>T	c.(700-702)gtG>gtT	p.V234V	RP11-120K18.2_ENST00000567545.1_RNA	NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	234	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.V234V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TCCTGACAGTGGTGTAAGCAA	0.627																																					p.V234V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G702T	16						.						89.0	74.0	79.0					16																	31414964		2197	4300	6497	31322465	SO:0001819	synonymous_variant	3681	exon7			U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.702G>T	16.37:g.31414964G>T		Somatic		Capture	SOLID	Phase_I	31322465	NM_005353	Q15575|Q15576	Silent	SNP	ENST00000389202.2	37	CCDS32438.1																																																																																				ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
CREBBP	1387	hgsc.bcm.edu	37	16	3808863	3808863	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:3808863C>A	ENST00000262367.5	-	17	4170	c.3361G>T	c.(3361-3363)Gga>Tga	p.G1121*	CREBBP_ENST00000382070.3_Nonsense_Mutation_p.G1083*	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1121	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.G1121*(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		ACTGGAATTCCGAGGAGCTGG	0.433			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.G1121X			Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G3361T	16						.						70.0	69.0	70.0					16																	3808863		2197	4300	6497	3748864	SO:0001587	stop_gained	1387	exon17			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3361G>T	16.37:g.3808863C>A	ENSP00000262367:p.Gly1121*	Somatic		Capture	SOLID	Phase_I	3748864	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Nonsense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	C	49	15.858863	0.99847	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	.	.	.	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-9.5453	18.7675	0.91879	0.0:1.0:0.0:0.0	.	.	.	.	X	1121;1151;1083	.	ENSP00000262367:G1121X	G	-	1	0	CREBBP	3748864	1.000000	0.71417	0.998000	0.56505	0.954000	0.61252	5.766000	0.68843	2.499000	0.84300	0.561000	0.74099	GGA		CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
SLC5A2	6524	hgsc.bcm.edu	37	16	31494527	31494527	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:31494527G>A	ENST00000330498.3	+	1	89	c.70G>A	c.(70-72)Gct>Act	p.A24T		NM_003041.3	NP_003032.1	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 2	24					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-affinity glucose:sodium symporter activity (GO:0005362)	p.A24T(1)		endometrium(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	25					Canagliflozin(DB08907)|Dapagliflozin(DB06292)	TGACAATCCTGCTGACATCCT	0.587																																					p.A24T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G70A	16						.						111.0	98.0	103.0					16																	31494527		2197	4300	6497	31402028	SO:0001583	missense	6524	exon1				CCDS10714.1	16p11.2	2013-05-22			ENSG00000140675	ENSG00000140675		"""Solute carriers"""	11037	protein-coding gene	gene with protein product		182381		SGLT2		8244402	Standard	NM_003041		Approved		uc002ecf.4	P31639	OTTHUMG00000176620	ENST00000330498.3:c.70G>A	16.37:g.31494527G>A	ENSP00000327943:p.Ala24Thr	Somatic		Capture	SOLID	Phase_I	31402028	NM_003041	A2RRD2	Missense_Mutation	SNP	ENST00000330498.3	37	CCDS10714.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025044	0.35701	.	.	ENSG00000140675	ENST00000330498;ENST00000419665	D;D	0.87256	-2.23;-2.11	5.14	3.19	0.36642	.	0.133346	0.49305	D	0.000147	D	0.82287	0.5004	L	0.54965	1.715	0.54753	D	0.99998	P	0.47191	0.891	B	0.42495	0.389	T	0.77294	-0.2641	10	0.30854	T	0.27	.	8.0977	0.30837	0.0835:0.0:0.7587:0.1578	.	24	P31639	SC5A2_HUMAN	T	24	ENSP00000327943:A24T;ENSP00000410601:A24T	ENSP00000327943:A24T	A	+	1	0	SLC5A2	31402028	1.000000	0.71417	0.683000	0.30040	0.010000	0.07245	5.220000	0.65267	0.760000	0.33108	-0.218000	0.12543	GCT		SLC5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255627.2		
SHCBP1	79801	hgsc.bcm.edu	37	16	46615797	46615797	+	Silent	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:46615797G>T	ENST00000303383.3	-	13	2129	c.1863C>A	c.(1861-1863)gcC>gcA	p.A621A		NM_024745.4	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	621					fibroblast growth factor receptor signaling pathway (GO:0008543)|regulation of neural precursor cell proliferation (GO:2000177)			p.A621A(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				TCTGTGTGGAGGCAGCAATTA	0.428																																					p.A621A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1863A	16						.						157.0	136.0	143.0					16																	46615797		2203	4300	6503	45173298	SO:0001819	synonymous_variant	79801	exon13			AK055931	CCDS10720.1	16q11	2008-02-05			ENSG00000171241	ENSG00000171241			29547	protein-coding gene	gene with protein product		611027				10086341	Standard	NM_024745		Approved	FLJ22009	uc002eec.4	Q8NEM2	OTTHUMG00000132540	ENST00000303383.3:c.1863C>A	16.37:g.46615797G>T		Somatic		Capture	SOLID	Phase_I	45173298	NM_024745	Q96N60|Q9BVS0|Q9H6P6	Silent	SNP	ENST00000303383.3	37	CCDS10720.1																																																																																				SHCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255740.1	NM_024745	
SALL1	6299	hgsc.bcm.edu	37	16	51173734	51173734	+	Missense_Mutation	SNP	T	T	C	rs372655572		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:51173734T>C	ENST00000251020.4	-	2	2432	c.2399A>G	c.(2398-2400)gAc>gGc	p.D800G	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.D703G|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	800					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D800G(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AGAGTAGCTGTCGGGGACTGG	0.507																																					p.D800G	GBM(103;1352 1446 1855 4775 8890)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2399G	16						.	T	GLY/ASP,GLY/ASP	0,4396		0,0,2198	104.0	110.0	108.0		2399,2108	5.3	0.8	16		108	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SALL1	NM_002968.2,NM_001127892.1	94,94	0,1,6497	CC,CT,TT		0.0116,0.0,0.0077	benign,benign	800/1325,703/1228	51173734	1,12995	2198	4300	6498	49731235	SO:0001583	missense	6299	exon2			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2399A>G	16.37:g.51173734T>C	ENSP00000251020:p.Asp800Gly	Somatic		Capture	SOLID	Phase_I	49731235	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	T	10.39	1.335644	0.24253	0.0	1.16E-4	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.07021	3.23;3.25	5.34	5.34	0.76211	.	0.240013	0.48767	D	0.000161	T	0.08088	0.0202	L	0.43152	1.355	0.80722	D	1	B	0.32717	0.381	B	0.26517	0.07	T	0.29610	-1.0006	10	0.15066	T	0.55	.	15.3571	0.74434	0.0:0.0:0.0:1.0	.	800	Q9NSC2	SALL1_HUMAN	G	800;703;764	ENSP00000251020:D800G;ENSP00000407914:D703G	ENSP00000251020:D800G	D	-	2	0	SALL1	49731235	1.000000	0.71417	0.837000	0.33122	0.004000	0.04260	8.040000	0.89188	2.031000	0.59945	0.372000	0.22366	GAC		SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
CDH16	1014	hgsc.bcm.edu	37	16	66950272	66950272	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:66950272C>T	ENST00000299752.4	-	4	383	c.190G>A	c.(190-192)Gca>Aca	p.A64T	CDH16_ENST00000570262.1_Intron|CDH16_ENST00000568632.1_Missense_Mutation_p.A64T|CDH16_ENST00000394055.3_Missense_Mutation_p.A64T|CDH16_ENST00000565796.1_Missense_Mutation_p.A64T	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	64	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.A64T(1)		endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		CCCTCAGTTGCCTTGCCTGAG	0.602																																					p.A64T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G190A	16						.						76.0	65.0	69.0					16																	66950272		2200	4300	6500	65507773	SO:0001583	missense	1014	exon4			AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.190G>A	16.37:g.66950272C>T	ENSP00000299752:p.Ala64Thr	Somatic		Capture	SOLID	Phase_I	65507773	NM_004062	B4DPA8|H3BPD3|Q6UW93	Missense_Mutation	SNP	ENST00000299752.4	37	CCDS10823.1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.993720	0.35131	.	.	ENSG00000166589	ENST00000394055;ENST00000299752	T;T	0.70399	-0.48;-0.48	4.49	1.48	0.22813	Cadherin (3);Cadherin-like (1);	0.451388	0.18778	N	0.131413	T	0.48077	0.1480	L	0.28192	0.835	0.09310	N	1	P;B;B	0.34724	0.465;0.335;0.335	B;B;B	0.28139	0.085;0.086;0.086	T	0.25950	-1.0117	10	0.25751	T	0.34	-3.3326	6.0524	0.19792	0.0:0.6802:0.0:0.3198	.	64;64;64	O75309-2;B2R7S8;O75309	.;.;CAD16_HUMAN	T	64	ENSP00000377619:A64T;ENSP00000299752:A64T	ENSP00000299752:A64T	A	-	1	0	CDH16	65507773	0.000000	0.05858	0.006000	0.13384	0.006000	0.05464	-0.003000	0.12901	0.643000	0.30638	-0.192000	0.12808	GCA		CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268839.2	NM_004062	
DHX38	9785	hgsc.bcm.edu	37	16	72137553	72137553	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:72137553C>G	ENST00000268482.3	+	13	2199	c.1690C>G	c.(1690-1692)Cag>Gag	p.Q564E	DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	564	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				TAAGACCACTCAGCTGACGCA	0.557																																					p.Q564E	Melanoma(97;711 1442 7855 13832 28836)											.	.	0			c.C1690G	16						.						124.0	99.0	107.0					16																	72137553		2198	4300	6498	70695054	SO:0001583	missense	9785	exon13			AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.1690C>G	16.37:g.72137553C>G	ENSP00000268482:p.Gln564Glu	Somatic		Capture	SOLID	Phase_I	70695054	NM_014003	B4DVG8|D3DWS7|O75212|Q96HN7	Missense_Mutation	SNP	ENST00000268482.3	37	CCDS10907.1	.	.	.	.	.	.	.	.	.	.	C	33	5.266099	0.95399	.	.	ENSG00000140829	ENST00000268482	D	0.85484	-1.99	5.8	5.8	0.92144	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96262	0.8781	H	0.99117	4.435	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.97667	1.0164	10	0.87932	D	0	.	20.063	0.97692	0.0:1.0:0.0:0.0	.	564	Q92620	PRP16_HUMAN	E	564	ENSP00000268482:Q564E	ENSP00000268482:Q564E	Q	+	1	0	DHX38	70695054	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.731000	0.84895	2.735000	0.93741	0.655000	0.94253	CAG		DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003	
PMFBP1	83449	hgsc.bcm.edu	37	16	72164462	72164462	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:72164462G>A	ENST00000237353.10	-	11	1868	c.1607C>T	c.(1606-1608)tCg>tTg	p.S536L	PMFBP1_ENST00000537465.1_Missense_Mutation_p.S541L|PMFBP1_ENST00000355636.6_Missense_Mutation_p.S391L	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	541						cytoplasm (GO:0005737)		p.S536L(1)		NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				CTCAGCCATCGAGGACTCCTT	0.577																																					p.S391L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1172T	16						.						93.0	90.0	91.0					16																	72164462		2198	4300	6498	70721963	SO:0001583	missense	83449	exon12			AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.1607C>T	16.37:g.72164462G>A	ENSP00000237353:p.Ser536Leu	Somatic		Capture	SOLID	Phase_I	70721963	NM_001160213	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000237353.10	37	CCDS32483.1	.	.	.	.	.	.	.	.	.	.	G	9.124	1.009775	0.19277	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000355636	T;T;T	0.10960	2.83;2.82;2.82	4.87	-9.43	0.00607	.	3.221300	0.01253	N	0.008936	T	0.05547	0.0146	N	0.05124	-0.11	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.17137	-1.0379	10	0.26408	T	0.33	19.1622	14.45	0.67379	0.1735:0.1152:0.7113:0.0	.	541;536;541	Q8TBY8;Q8TBY8-2;G3V1Q7	PMFBP_HUMAN;.;.	L	541;536;391	ENSP00000443817:S541L;ENSP00000237353:S536L;ENSP00000347854:S391L	ENSP00000237353:S536L	S	-	2	0	PMFBP1	70721963	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.671000	0.01954	-1.868000	0.01142	-1.124000	0.02001	TCG		PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293	
GRIN2A	2903	hgsc.bcm.edu	37	16	10031919	10031919	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:10031919C>T	ENST00000396573.2	-	4	1213	c.904G>A	c.(904-906)Gct>Act	p.A302T	GRIN2A_ENST00000535259.1_Missense_Mutation_p.A145T|GRIN2A_ENST00000404927.2_Missense_Mutation_p.A302T|GRIN2A_ENST00000330684.3_Missense_Mutation_p.A302T|GRIN2A_ENST00000566670.1_5'Flank|GRIN2A_ENST00000396575.2_Missense_Mutation_p.A302T|GRIN2A_ENST00000562109.1_Missense_Mutation_p.A302T	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	302					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.A302T(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GAAGATGCAGCGGTGGTTAGG	0.572																																					p.A302T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G904A	16						.						85.0	67.0	73.0					16																	10031919		2197	4300	6497	9939420	SO:0001583	missense	2903	exon3				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.904G>A	16.37:g.10031919C>T	ENSP00000379818:p.Ala302Thr	Somatic		Capture	SOLID	Phase_I	9939420	NM_001134408	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	c	20.3	3.973245	0.74246	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	D;D;D;D;D	0.94758	-3.51;-3.51;-3.51;-3.51;-3.51	5.2	5.2	0.72013	.	0.050416	0.85682	D	0.000000	D	0.97241	0.9098	M	0.80982	2.52	0.80722	D	1	D;D;D	0.89917	0.967;0.974;1.0	P;P;D	0.85130	0.523;0.655;0.997	D	0.97199	0.9863	9	.	.	.	.	18.0961	0.89490	0.0:1.0:0.0:0.0	.	145;302;302	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	T	302;302;145;302;302	ENSP00000379818:A302T;ENSP00000385872:A302T;ENSP00000441572:A145T;ENSP00000332549:A302T;ENSP00000379820:A302T	.	A	-	1	0	GRIN2A	9939420	1.000000	0.71417	0.134000	0.22075	0.204000	0.24138	7.665000	0.83852	2.582000	0.87167	0.561000	0.74099	GCT		GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
MON1B	22879	hgsc.bcm.edu	37	16	77228315	77228315	+	Missense_Mutation	SNP	C	C	T	rs11544785	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr16:77228315C>T	ENST00000248248.3	+	4	909	c.559C>T	c.(559-561)Cgg>Tgg	p.R187W	MON1B_ENST00000545553.1_Missense_Mutation_p.R41W|MON1B_ENST00000320859.6_Intron|MON1B_ENST00000439557.2_Missense_Mutation_p.R78W	NM_014940.2	NP_055755.1	Q7L1V2	MON1B_HUMAN	MON1 secretory trafficking family member B	187								p.R187W(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	17						AGCCCAGCTGCGGGGGGAGCT	0.597													C|||	5	0.000998403	0.0038	0.0	5008	,	,		19563	0.0		0.0	False		,,,				2504	0.0				p.R187W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C559T	16						.	C	TRP/ARG	15,4381	22.3+/-47.3	0,15,2183	90.0	91.0	90.0		559	4.3	1.0	16	dbSNP_120	90	0,8600		0,0,4300	yes	missense	MON1B	NM_014940.2	101	0,15,6483	TT,TC,CC		0.0,0.3412,0.1154	probably-damaging	187/548	77228315	15,12981	2198	4300	6498	75785816	SO:0001583	missense	22879	exon4			BC024277	CCDS10925.1, CCDS67082.1, CCDS67083.1	16q23.1	2013-08-21	2013-08-21		ENSG00000103111	ENSG00000103111			25020	protein-coding gene	gene with protein product		608954	"""MON1 homolog B (yeast)"""			10048485	Standard	NM_014940		Approved	SAND2, HSRG1, KIAA0872	uc002fez.3	Q7L1V2	OTTHUMG00000137618	ENST00000248248.3:c.559C>T	16.37:g.77228315C>T	ENSP00000248248:p.Arg187Trp	Somatic		Capture	SOLID	Phase_I	75785816	NM_014940	B4DDZ0|O94949	Missense_Mutation	SNP	ENST00000248248.3	37	CCDS10925.1	5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	C	19.84	3.901352	0.72754	0.003412	0.0	ENSG00000103111	ENST00000248248;ENST00000439557;ENST00000545553	.	.	.	4.29	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.79281	0.4419	M	0.89478	3.035	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79784	0.986;0.986;0.986;0.993	D	0.84725	0.0742	9	0.56958	D	0.05	.	15.0379	0.71764	0.0:1.0:0.0:0.0	rs11544785	41;78;67;187	B4DDZ0;E7EW32;Q6ZR87;Q7L1V2	.;.;.;MON1B_HUMAN	W	187;78;41	.	ENSP00000248248:R187W	R	+	1	2	MON1B	75785816	0.365000	0.25006	0.985000	0.45067	0.963000	0.63663	1.683000	0.37638	2.321000	0.78463	0.561000	0.74099	CGG		MON1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269036.2	NM_014940	
CDH2	1000	hgsc.bcm.edu	37	18	25543430	25543430	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr18:25543430T>A	ENST00000269141.3	-	15	2828	c.2405A>T	c.(2404-2406)aAg>aTg	p.K802M	AC015933.2_ENST00000423367.1_RNA|CDH2_ENST00000399380.3_Missense_Mutation_p.K771M	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	802					adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.K802M(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TCCCACAGGCTTGATGGCATC	0.552																																					p.K802M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2405T	18						.						89.0	71.0	77.0					18																	25543430		2203	4300	6503	23797428	SO:0001583	missense	1000	exon15			S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.2405A>T	18.37:g.25543430T>A	ENSP00000269141:p.Lys802Met	Somatic		Capture	SOLID	Phase_I	23797428	NM_001792	A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.441830	0.83993	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.60424	0.24;0.19	6.16	6.16	0.99307	Cadherin, cytoplasmic domain (1);	0.045025	0.85682	D	0.000000	T	0.75162	0.3812	M	0.67397	2.05	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.983	T	0.77267	-0.2651	10	0.87932	D	0	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	771;802	A8MWK3;P19022	.;CADH2_HUMAN	M	802;771	ENSP00000269141:K802M;ENSP00000382312:K771M	ENSP00000269141:K802M	K	-	2	0	CDH2	23797428	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.967000	0.70403	2.367000	0.80283	0.528000	0.53228	AAG		CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792	
SEC11C	90701	hgsc.bcm.edu	37	18	56816769	56816769	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr18:56816769G>A	ENST00000587834.1	+	2	584	c.112G>A	c.(112-114)Gcc>Acc	p.A38T	SEC11C_ENST00000588875.1_Missense_Mutation_p.A38T	NM_033280.2	NP_150596.1	Q9BY50	SC11C_HUMAN	SEC11 homolog C (S. cerevisiae)	38					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	serine-type peptidase activity (GO:0008236)	p.A38T(1)		endometrium(1)|large_intestine(4)|liver(2)|lung(2)	9		Colorectal(73;0.175)				TTTAAACTTCGCCATGATCGT	0.498																																					p.A38T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G112A	18						.						197.0	180.0	186.0					18																	56816769		2203	4300	6503	54967749	SO:0001583	missense	90701	exon2			AF212233	CCDS11970.1	18q21.32	2006-11-07	2006-11-07	2006-11-07	ENSG00000166562	ENSG00000166562			23400	protein-coding gene	gene with protein product			"""SEC11-like 3 (S. cerevisiae)"""	SEC11L3			Standard	NM_033280		Approved	SPC21, SPCS4C	uc002lht.3	Q9BY50	OTTHUMG00000132762	ENST00000587834.1:c.112G>A	18.37:g.56816769G>A	ENSP00000468633:p.Ala38Thr	Somatic		Capture	SOLID	Phase_I	54967749	NM_033280	B2RAA3	Missense_Mutation	SNP	ENST00000587834.1	37	CCDS11970.1	.	.	.	.	.	.	.	.	.	.	G	34	5.346971	0.95807	.	.	ENSG00000166562	ENST00000299714;ENST00000509791	.	.	.	5.75	5.75	0.90469	.	0.000000	0.64402	D	0.000002	T	0.54398	0.1856	M	0.62209	1.925	0.80722	D	1	P	0.42337	0.776	B	0.32090	0.14	T	0.60586	-0.7234	9	0.48119	T	0.1	-15.4483	19.5514	0.95322	0.0:0.0:1.0:0.0	.	38	Q9BY50	SC11C_HUMAN	T	38	.	ENSP00000299714:A38T	A	+	1	0	SEC11C	54967749	1.000000	0.71417	0.975000	0.42487	0.822000	0.46500	9.706000	0.98722	2.708000	0.92522	0.650000	0.86243	GCC		SEC11C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256134.2	NM_033280	
VPS4B	9525	hgsc.bcm.edu	37	18	61071019	61071019	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr18:61071019G>A	ENST00000238497.5	-	5	608	c.405C>T	c.(403-405)gaC>gaT	p.D135D	VPS4B_ENST00000591383.1_5'UTR	NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)	135					ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)	p.D135D(1)		breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						GTCCAGCAACGTCACTCCATT	0.348																																					p.D135D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C405T	18						.						77.0	70.0	72.0					18																	61071019		2202	4300	6502	59221999	SO:0001819	synonymous_variant	9525	exon5			AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.405C>T	18.37:g.61071019G>A		Somatic		Capture	SOLID	Phase_I	59221999	NM_004869	Q69HW4|Q9GZS7	Silent	SNP	ENST00000238497.5	37	CCDS11983.1																																																																																				VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256198.2	NM_004869	
LAMA1	284217	hgsc.bcm.edu	37	18	7044737	7044737	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr18:7044737G>A	ENST00000389658.3	-	7	1053	c.960C>T	c.(958-960)tcC>tcT	p.S320S		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	320	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.S320S(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ATGTATTGCCGGAGGACACGG	0.468																																					p.S320S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C960T	18						.						122.0	116.0	118.0					18																	7044737		2203	4300	6503	7034737	SO:0001819	synonymous_variant	284217	exon7			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.960C>T	18.37:g.7044737G>A		Somatic		Capture	SOLID	Phase_I	7034737	NM_005559		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																				LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
CDH7	1005	hgsc.bcm.edu	37	18	63491918	63491918	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr18:63491918G>T	ENST00000397968.2	+	6	1258	c.832G>T	c.(832-834)Gcc>Tcc	p.A278S	CDH7_ENST00000536984.2_Missense_Mutation_p.A278S|CDH7_ENST00000323011.3_Missense_Mutation_p.A278S	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	278	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A278S(1)		NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				ATTACCTGTAGCCTCAGTTGT	0.373																																					p.A278S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G832T	18						.						127.0	118.0	121.0					18																	63491918		2203	4300	6503	61642898	SO:0001583	missense	1005	exon6			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.832G>T	18.37:g.63491918G>T	ENSP00000381058:p.Ala278Ser	Somatic		Capture	SOLID	Phase_I	61642898	NM_004361	Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.672181	0.47781	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.37058	1.22;1.22;1.22	4.65	4.65	0.58169	Cadherin (3);Cadherin-like (1);	0.451193	0.21547	N	0.072800	T	0.22820	0.0551	N	0.04746	-0.17	0.41941	D	0.990616	B;B	0.11235	0.001;0.004	B;B	0.09377	0.004;0.003	T	0.07271	-1.0781	10	0.52906	T	0.07	.	17.9028	0.88910	0.0:0.0:1.0:0.0	.	278;278	F5H5X9;Q9ULB5	.;CADH7_HUMAN	S	278	ENSP00000319166:A278S;ENSP00000443030:A278S;ENSP00000381058:A278S	ENSP00000319166:A278S	A	+	1	0	CDH7	61642898	1.000000	0.71417	0.969000	0.41365	0.862000	0.49288	4.871000	0.63042	2.291000	0.77112	0.637000	0.83480	GCC		CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646	
PTPRM	5797	hgsc.bcm.edu	37	18	8379283	8379283	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr18:8379283T>G	ENST00000332175.8	+	26	4729	c.3692T>G	c.(3691-3693)tTc>tGc	p.F1231C	PTPRM_ENST00000580170.1_Missense_Mutation_p.F1244C|PTPRM_ENST00000400060.4_Missense_Mutation_p.F1245C|PTPRM_ENST00000400053.4_Missense_Mutation_p.F1169C|PTPRM_ENST00000444013.1_Missense_Mutation_p.F1018C	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1231	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.F1231C(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				TGCCTGCCCTTCCTCATCACC	0.617																																					p.F1231C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3692G	18						.						119.0	92.0	101.0					18																	8379283		2203	4300	6503	8369283	SO:0001583	missense	5797	exon26			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3692T>G	18.37:g.8379283T>G	ENSP00000331418:p.Phe1231Cys	Somatic		Capture	SOLID	Phase_I	8369283	NM_002845	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.590738	0.86851	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	D;D;D;D	0.83335	-1.71;-1.71;-1.71;-1.71	6.17	6.17	0.99709	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.86301	0.5900	L	0.41027	1.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.997	T	0.81636	-0.0843	10	0.09084	T	0.74	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	1018;1244;1231	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	C	1231;1245;1169;1018	ENSP00000331418:F1231C;ENSP00000382933:F1245C;ENSP00000382927:F1169C;ENSP00000387608:F1018C	ENSP00000331418:F1231C	F	+	2	0	PTPRM	8369283	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.371000	0.80710	0.533000	0.62120	TTC		PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
CNDP1	84735	hgsc.bcm.edu	37	18	72247391	72247391	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr18:72247391T>C	ENST00000358821.3	+	10	1421	c.1193T>C	c.(1192-1194)tTc>tCc	p.F398S	CNDP1_ENST00000582365.1_Missense_Mutation_p.F355S	NM_032649.5	NP_116038	Q96KN2	CNDP1_HUMAN	carnosine dipeptidase 1 (metallopeptidase M20 family)	398						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)	p.F398S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		GAAGATGTGTTCTCCAAAAGA	0.378																																					p.F398S	Melanoma(32;1029 1042 25286 38395 44237)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1193C	18						.						100.0	93.0	95.0					18																	72247391		2203	4300	6503	70398371	SO:0001583	missense	84735	exon10				CCDS12007.1	18q22.3	2014-07-14			ENSG00000150656	ENSG00000150656	3.4.13.20		20675	protein-coding gene	gene with protein product	"""carnosinase 1"", ""glutamate carboxypeptidase-like protein 2"""	609064				12473676	Standard	NM_032649		Approved	MGC10825, CN1, CPGL2, HsT2308	uc002llq.3	Q96KN2	OTTHUMG00000132852	ENST00000358821.3:c.1193T>C	18.37:g.72247391T>C	ENSP00000351682:p.Phe398Ser	Somatic		Capture	SOLID	Phase_I	70398371	NM_032649	Q14D40|Q17S05|Q2TBG0|Q6UWK2|Q9BT98	Missense_Mutation	SNP	ENST00000358821.3	37	CCDS12007.1	.	.	.	.	.	.	.	.	.	.	T	19.79	3.893358	0.72524	.	.	ENSG00000150656	ENST00000358821	T	0.56611	0.45	5.04	5.04	0.67666	Peptidase M20, dimerisation (1);	0.000000	0.85682	D	0.000000	T	0.77525	0.4143	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83180	-0.0089	10	0.87932	D	0	-26.0714	13.7864	0.63112	0.0:0.0:0.0:1.0	.	398	Q96KN2	CNDP1_HUMAN	S	398	ENSP00000351682:F398S	ENSP00000351682:F398S	F	+	2	0	CNDP1	70398371	1.000000	0.71417	0.984000	0.44739	0.629000	0.37895	6.678000	0.74508	1.899000	0.54978	0.460000	0.39030	TTC		CNDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256326.1	NM_032649	
BOC	91653	hgsc.bcm.edu	37	3	112998168	112998168	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:112998168G>A	ENST00000495514.1	+	12	2590	c.1886G>A	c.(1885-1887)cGt>cAt	p.R629H	BOC_ENST00000273395.4_Missense_Mutation_p.R630H|BOC_ENST00000355385.3_Missense_Mutation_p.R629H|BOC_ENST00000497495.1_3'UTR			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	629	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.R629H(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			TGGATTCCCCGTGGGAATGGT	0.592																																					p.R629H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1886A	3						.						81.0	78.0	79.0					3																	112998168		2203	4300	6503	114480858	SO:0001583	missense	91653	exon12			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.1886G>A	3.37:g.112998168G>A	ENSP00000418663:p.Arg629His	Somatic		Capture	SOLID	Phase_I	114480858	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.935845	0.92458	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.53640	0.61;0.61;0.61	5.55	5.55	0.83447	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.054322	0.85682	D	0.000000	T	0.65080	0.2657	L	0.53780	1.695	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.70487	0.947;0.969	T	0.60647	-0.7222	10	0.36615	T	0.2	.	19.4878	0.95037	0.0:0.0:1.0:0.0	.	630;629	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	H	629;630;629	ENSP00000418663:R629H;ENSP00000273395:R630H;ENSP00000347546:R629H	ENSP00000273395:R630H	R	+	2	0	BOC	114480858	1.000000	0.71417	0.978000	0.43139	0.599000	0.36880	9.221000	0.95188	2.596000	0.87737	0.563000	0.77884	CGT		BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
SPICE1	152185	hgsc.bcm.edu	37	3	113166940	113166940	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:113166940G>T	ENST00000295872.4	-	16	2630	c.2371C>A	c.(2371-2373)Cca>Aca	p.P791T		NM_144718.3	NP_653319.1	Q8N0Z3	SPICE_HUMAN	spindle and centriole associated protein 1	791					metaphase plate congression (GO:0051310)|regulation of centriole replication (GO:0046599)|spindle assembly involved in mitosis (GO:0090307)	centriole (GO:0005814)|centrosome (GO:0005813)|spindle (GO:0005819)		p.P791T(1)		NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(3)|large_intestine(9)|lung(10)|ovary(2)|skin(2)|urinary_tract(1)	33						GAGCTTTCTGGGGCTTCTGCT	0.318																																					p.P791T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2371A	3						.						120.0	126.0	124.0					3																	113166940		2203	4300	6503	114649630	SO:0001583	missense	152185	exon16			AY099107	CCDS2973.1	3q13.2	2010-09-01	2010-09-01	2010-09-01	ENSG00000163611	ENSG00000163611			25083	protein-coding gene	gene with protein product	"""spindle and centriole protein"""	613447	"""coiled-coil domain containing 52"""	CCDC52		20736305	Standard	NM_144718		Approved	SPICE	uc003eag.4	Q8N0Z3	OTTHUMG00000159261	ENST00000295872.4:c.2371C>A	3.37:g.113166940G>T	ENSP00000295872:p.Pro791Thr	Somatic		Capture	SOLID	Phase_I	114649630	NM_144718	D3DN72|Q8WUX6	Missense_Mutation	SNP	ENST00000295872.4	37	CCDS2973.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.143289	0.00332	.	.	ENSG00000163611	ENST00000295872	T	0.29917	1.55	5.76	0.562	0.17290	.	0.777535	0.12398	N	0.472418	T	0.15132	0.0365	L	0.31294	0.92	0.09310	N	1	B	0.20052	0.041	B	0.17433	0.018	T	0.34725	-0.9817	10	0.02654	T	1	-1.1084	4.3859	0.11316	0.2201:0.1082:0.5616:0.1101	.	791	Q8N0Z3	SPICE_HUMAN	T	791	ENSP00000295872:P791T	ENSP00000295872:P791T	P	-	1	0	SPICE1	114649630	0.933000	0.31639	0.143000	0.22291	0.248000	0.25809	-0.190000	0.09615	0.151000	0.19162	-0.797000	0.03246	CCA		SPICE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354177.2	NM_144718	
SIDT1	54847	hgsc.bcm.edu	37	3	113329873	113329873	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:113329873T>C	ENST00000264852.4	+	18	2465	c.1739T>C	c.(1738-1740)aTg>aCg	p.M580T	SIDT1_ENST00000393830.3_Missense_Mutation_p.M580T|SIDT1_ENST00000463226.1_3'UTR	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	580					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)	p.M580T(1)		breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						TTCATGTACATGATCGCTGGC	0.498																																					p.M580T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1739C	3						.						168.0	157.0	161.0					3																	113329873		2203	4300	6503	114812563	SO:0001583	missense	54847	exon18			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1739T>C	3.37:g.113329873T>C	ENSP00000264852:p.Met580Thr	Somatic		Capture	SOLID	Phase_I	114812563	NM_017699	Q17RR4	Missense_Mutation	SNP	ENST00000264852.4	37	CCDS2974.1	.	.	.	.	.	.	.	.	.	.	T	18.07	3.541225	0.65085	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.22945	1.93;1.93	5.79	5.79	0.91817	.	0.064003	0.64402	D	0.000003	T	0.40645	0.1125	M	0.77820	2.39	0.58432	D	0.999999	P;P	0.36412	0.552;0.464	B;B	0.42692	0.274;0.395	T	0.32534	-0.9903	10	0.54805	T	0.06	-13.4794	16.1333	0.81461	0.0:0.0:0.0:1.0	.	580;580	Q9NXL6-2;Q9NXL6	.;SIDT1_HUMAN	T	580	ENSP00000264852:M580T;ENSP00000377416:M580T	ENSP00000264852:M580T	M	+	2	0	SIDT1	114812563	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.967000	0.87967	2.203000	0.70933	0.523000	0.50628	ATG		SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317564.1	NM_017699	
PDIA5	10954	hgsc.bcm.edu	37	3	122829800	122829800	+	Missense_Mutation	SNP	C	C	T	rs374477364		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:122829800C>T	ENST00000316218.7	+	7	585	c.490C>T	c.(490-492)Cgg>Tgg	p.R164W		NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	164	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	oxidoreductase activity (GO:0016491)|protein disulfide isomerase activity (GO:0003756)	p.R164W(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)		GGACTTCAGACGGCTCCTGAA	0.532													C|||	1	0.000199681	0.0008	0.0	5008	,	,		12993	0.0		0.0	False		,,,				2504	0.0				p.R164W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C490T	3						.	C	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	148.0	151.0	150.0		490	5.4	1.0	3		150	0,8600		0,0,4300	no	missense	PDIA5	NM_006810.3	101	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	164/520	122829800	2,13004	2203	4300	6503	124312490	SO:0001583	missense	10954	exon7			AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	5.3.4.1	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""			7556671	Standard	NM_006810		Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.490C>T	3.37:g.122829800C>T	ENSP00000323313:p.Arg164Trp	Somatic		Capture	SOLID	Phase_I	124312490	NM_006810	D3DN95|Q9BV43	Missense_Mutation	SNP	ENST00000316218.7	37	CCDS3020.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.217179	0.79352	4.54E-4	0.0	ENSG00000065485	ENST00000316218	T	0.23552	1.9	5.39	5.39	0.77823	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.052880	0.85682	D	0.000000	T	0.48960	0.1529	M	0.73598	2.24	0.48511	D	0.999662	D	0.89917	1.0	D	0.73708	0.981	T	0.48864	-0.8997	10	0.87932	D	0	.	11.5678	0.50815	0.1778:0.8222:0.0:0.0	.	164	Q14554	PDIA5_HUMAN	W	164	ENSP00000323313:R164W	ENSP00000323313:R164W	R	+	1	2	PDIA5	124312490	1.000000	0.71417	0.999000	0.59377	0.933000	0.57130	3.597000	0.54031	2.804000	0.96469	0.655000	0.94253	CGG		PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356192.1	NM_006810	
KALRN	8997	hgsc.bcm.edu	37	3	124017729	124017729	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:124017729C>T	ENST00000240874.3	+	6	1212	c.1055C>T	c.(1054-1056)aCg>aTg	p.T352M	KALRN_ENST00000360013.3_Missense_Mutation_p.T352M|KALRN_ENST00000460856.1_Missense_Mutation_p.T352M	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	352					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T352M(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GACCTCCAGACGCAGCACAAT	0.557																																					p.T352M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1055T	3						.						168.0	151.0	157.0					3																	124017729		2203	4300	6503	125500419	SO:0001583	missense	8997	exon6			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.1055C>T	3.37:g.124017729C>T	ENSP00000240874:p.Thr352Met	Somatic		Capture	SOLID	Phase_I	125500419	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	37	CCDS3027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.6|27.6	4.849206|4.849206	0.91277|0.91277	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000354186|ENST00000460856;ENST00000240874;ENST00000360013	.|T;T;T	.|0.51817	.|0.69;0.69;0.69	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	.|0.130314	.|0.50627	.|D	.|0.000120	T|T	0.66944|0.66944	0.2841|0.2841	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.74674	.|0.977;0.984;0.961	T|T	0.67692|0.67692	-0.5605|-0.5605	5|10	.|0.72032	.|D	.|0.01	.|.	19.3855|19.3855	0.94554|0.94554	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|352;352;352	.|C9IZQ6;O60229;O60229-2	.|.;KALRN_HUMAN;.	C|M	330|352	.|ENSP00000418611:T352M;ENSP00000240874:T352M;ENSP00000353109:T352M	.|ENSP00000240874:T352M	R|T	+|+	1|2	0|0	KALRN|KALRN	125500419|125500419	1.000000|1.000000	0.71417|0.71417	0.977000|0.977000	0.42913|0.42913	0.999000|0.999000	0.98932|0.98932	7.609000|7.609000	0.82925|0.82925	2.808000|2.808000	0.96608|0.96608	0.655000|0.655000	0.94253|0.94253	CGC|ACG		KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
KALRN	8997	hgsc.bcm.edu	37	3	124209568	124209568	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:124209568G>T	ENST00000240874.3	+	30	4575	c.4418G>T	c.(4417-4419)gGg>gTg	p.G1473V	KALRN_ENST00000360013.3_Missense_Mutation_p.G1473V|KALRN_ENST00000460856.1_Missense_Mutation_p.G1464V	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1473	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G1473V(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GATGTGCAGGGGGAGTTGATT	0.562																																					p.G1473V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4418T	3						.						74.0	78.0	76.0					3																	124209568		2203	4300	6503	125692258	SO:0001583	missense	8997	exon30			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.4418G>T	3.37:g.124209568G>T	ENSP00000240874:p.Gly1473Val	Somatic		Capture	SOLID	Phase_I	125692258	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	37	CCDS3027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.2|26.2	4.713755|4.713755	0.89112|0.89112	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013|ENST00000354186	T;T;T|T	0.52983|0.53206	0.64;0.64;0.64|0.63	5.52|5.52	5.52|5.52	0.82312|0.82312	Pleckstrin homology-type (1);Pleckstrin homology domain (2);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.80737|0.80737	0.4680|0.4680	H|H	0.97131|0.97131	3.945|3.945	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;0.999;1.0|.	D|D	0.86491|0.86491	0.1797|0.1797	10|8	0.87932|0.87932	D|D	0|0	.|.	19.6361|19.6361	0.95733|0.95733	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1464;1473;1473|.	C9IZQ6;O60229;O60229-2|.	.;KALRN_HUMAN;.|.	V|W	1464;1473;1473|1442	ENSP00000418611:G1464V;ENSP00000240874:G1473V;ENSP00000353109:G1473V|ENSP00000346122:G1442W	ENSP00000240874:G1473V|ENSP00000346122:G1442W	G|G	+|+	2|1	0|0	KALRN|KALRN	125692258|125692258	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	9.657000|9.657000	0.98554|0.98554	2.878000|2.878000	0.98634|0.98634	0.650000|0.650000	0.86243|0.86243	GGG|GGG		KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
EEFSEC	60678	hgsc.bcm.edu	37	3	128060271	128060271	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:128060271C>G	ENST00000254730.6	+	5	1036	c.982C>G	c.(982-984)Ccc>Gcc	p.P328A	EEFSEC_ENST00000483569.1_3'UTR|EEFSEC_ENST00000483457.1_Missense_Mutation_p.P273A	NM_021937.3	NP_068756.2	P57772	SELB_HUMAN	eukaryotic elongation factor, selenocysteine-tRNA-specific	328					selenocysteine incorporation (GO:0001514)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)|translation elongation factor activity (GO:0003746)|tRNA binding (GO:0000049)	p.P328A(1)		NS(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)	25						TTTCCGGGGGCCCCTGCAAAC	0.567																																					p.P328A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C982G	3						.						67.0	66.0	66.0					3																	128060271		2203	4300	6503	129542961	SO:0001583	missense	60678	exon5				CCDS33849.1	3q21.3	2007-05-25			ENSG00000132394	ENSG00000132394			24614	protein-coding gene	gene with protein product	"""elongation factor for selenoprotein translation"""	607695				10970870, 15229221	Standard	XM_005247696		Approved	SELB, EFSEC	uc003eki.3	P57772	OTTHUMG00000159659	ENST00000254730.6:c.982C>G	3.37:g.128060271C>G	ENSP00000254730:p.Pro328Ala	Somatic		Capture	SOLID	Phase_I	129542961	NM_021937	Q96HZ6	Missense_Mutation	SNP	ENST00000254730.6	37	CCDS33849.1	.	.	.	.	.	.	.	.	.	.	C	1.156	-0.645215	0.03531	.	.	ENSG00000132394	ENST00000254730;ENST00000483457	T;T	0.53206	1.0;0.63	5.44	-1.09	0.09904	.	0.400442	0.30593	N	0.009296	T	0.12817	0.0311	N	0.02658	-0.545	0.22156	N	0.999323	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.14504	-1.0470	10	0.07813	T	0.8	-5.9407	0.6726	0.00861	0.1863:0.2273:0.2841:0.3023	.	273;328	C9J8T0;P57772	.;SELB_HUMAN	A	328;273	ENSP00000254730:P328A;ENSP00000417660:P273A	ENSP00000254730:P328A	P	+	1	0	EEFSEC	129542961	0.020000	0.18652	0.940000	0.37924	0.990000	0.78478	0.226000	0.17776	0.007000	0.14760	0.591000	0.81541	CCC		EEFSEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356738.2	NM_021937	
ACAD9	28976	hgsc.bcm.edu	37	3	128628953	128628953	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:128628953C>T	ENST00000308982.7	+	16	1734	c.1653C>T	c.(1651-1653)agC>agT	p.S551S	KIAA1257_ENST00000511438.1_3'UTR|RP11-723O4.6_ENST00000508239.1_3'UTR|ACAD9_ENST00000511526.1_3'UTR	NM_014049.4	NP_054768.2	Q9H845	ACAD9_HUMAN	acyl-CoA dehydrogenase family, member 9	551						dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.S551S(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	30						CGCGGGCCAGCCGCTCCATCC	0.622																																					p.S551S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1653T	3						.						43.0	40.0	41.0					3																	128628953		2203	4300	6503	130111643	SO:0001819	synonymous_variant	28976	exon16			AF078854	CCDS3053.1	3q21.3	2013-05-24	2010-04-30		ENSG00000177646	ENSG00000177646		"""Mitochondrial respiratory chain complex assembly factors"""	21497	protein-coding gene	gene with protein product		611103	"""acyl-Coenzyme A dehydrogenase family, member 9"""			12359260, 21057504, 20816094	Standard	NM_014049		Approved	NPD002, MGC14452	uc003ela.4	Q9H845	OTTHUMG00000159942	ENST00000308982.7:c.1653C>T	3.37:g.128628953C>T		Somatic		Capture	SOLID	Phase_I	130111643	NM_014049	D3DNB8|Q8WXX3	Silent	SNP	ENST00000308982.7	37	CCDS3053.1	.	.	.	.	.	.	.	.	.	.	C	6.127	0.391722	0.11581	.	.	ENSG00000177646	ENST00000406840	.	.	.	5.28	3.22	0.36961	.	.	.	.	.	T	0.48021	0.1477	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40098	-0.9581	4	.	.	.	.	4.6822	0.12741	0.0:0.6162:0.0:0.3838	.	.	.	.	S	28	.	.	P	+	1	0	ACAD9	130111643	1.000000	0.71417	0.998000	0.56505	0.433000	0.31745	1.167000	0.31847	1.216000	0.43427	0.563000	0.77884	CCG		ACAD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358405.1	NM_014049	
NUDT16	131870	hgsc.bcm.edu	37	3	131102042	131102042	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:131102042C>T	ENST00000521288.1	+	3	476	c.445C>T	c.(445-447)Cgg>Tgg	p.R149W	NUDT16_ENST00000537561.1_Missense_Mutation_p.R103W|NUDT16_ENST00000502852.1_3'UTR|NUDT16_ENST00000359850.3_Missense_Mutation_p.R116W|RP11-933H2.4_ENST00000502521.1_RNA			Q96DE0	NUD16_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 16	149	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				adenosine to inosine editing (GO:0006382)|dephosphorylation (GO:0016311)|dITP catabolic process (GO:0035863)|IDP catabolic process (GO:0046709)|mRNA catabolic process (GO:0006402)|negative regulation of rRNA processing (GO:2000233)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|snoRNA catabolic process (GO:0016077)|XDP catabolic process (GO:1901639)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cobalt ion binding (GO:0050897)|dIDP diphosphatase activity (GO:0097383)|dITP diphosphatase activity (GO:0035870)|GTP binding (GO:0005525)|inosine-diphosphatase activity (GO:0090450)|ITP binding (GO:1901641)|m7G(5')pppN diphosphatase activity (GO:0050072)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)|mRNA binding (GO:0003729)|nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|protein homodimerization activity (GO:0042803)|snoRNA binding (GO:0030515)|XTP binding (GO:1901640)	p.R116W(1)		large_intestine(1)|lung(6)	7						GTATACCCTGCGGGATGGTGT	0.572																																					p.R149W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C445T	3						.						111.0	105.0	107.0					3																	131102042		2203	4300	6503	132584732	SO:0001583	missense	131870	exon3			AK055827	CCDS3070.1, CCDS3070.2, CCDS54640.1, CCDS54641.1	3q21.3	2005-01-25						"""Nudix motif containing"""	26442	protein-coding gene	gene with protein product						12477932	Standard	NM_152395		Approved	FLJ31265	uc021xec.1	Q96DE0		ENST00000521288.1:c.445C>T	3.37:g.131102042C>T	ENSP00000429274:p.Arg149Trp	Somatic		Capture	SOLID	Phase_I	132584732	NM_152395	B4E3B4|E9PED4|F5GYJ1|Q96N82	Missense_Mutation	SNP	ENST00000521288.1	37	CCDS3070.2	.	.	.	.	.	.	.	.	.	.	C	17.55	3.418255	0.62622	.	.	ENSG00000198585	ENST00000537561;ENST00000359850;ENST00000521288	T;T;T	0.52057	0.68;0.68;0.68	3.04	2.14	0.27477	NUDIX hydrolase domain (1);NUDIX hydrolase domain-like (1);	0.494944	0.16549	N	0.209580	T	0.46870	0.1415	L	0.50333	1.59	0.42057	D	0.991149	D	0.71674	0.998	P	0.48677	0.586	T	0.50709	-0.8796	10	0.87932	D	0	-10.938	9.6089	0.39650	0.2099:0.7901:0.0:0.0	.	149	Q96DE0	NUD16_HUMAN	W	103;116;149	ENSP00000440230:R103W;ENSP00000352911:R116W;ENSP00000429274:R149W	ENSP00000352911:R116W	R	+	1	2	NUDT16	132584732	0.996000	0.38824	0.996000	0.52242	0.969000	0.65631	0.576000	0.23744	0.815000	0.34398	0.561000	0.74099	CGG		NUDT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356537.9	NM_152395	
TMEM108	66000	hgsc.bcm.edu	37	3	133114795	133114795	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:133114795C>T	ENST00000321871.6	+	6	1903	c.1693C>T	c.(1693-1695)Ctg>Ttg	p.L565L	TMEM108_ENST00000508711.1_Silent_p.L95L|TMEM108_ENST00000393130.3_Silent_p.L565L	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	565						integral component of membrane (GO:0016021)		p.L565L(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						TCAAGAAACACTGTTTGTGGG	0.448																																					p.L565L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1693T	3						.						122.0	115.0	117.0					3																	133114795		2203	4300	6503	134597485	SO:0001819	synonymous_variant	66000	exon6			AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.1693C>T	3.37:g.133114795C>T		Somatic		Capture	SOLID	Phase_I	134597485	NM_001136469	D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Silent	SNP	ENST00000321871.6	37	CCDS33858.1																																																																																				TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356907.2	NM_023943	
CLSTN2	64084	hgsc.bcm.edu	37	3	140282865	140282865	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:140282865G>T	ENST00000458420.3	+	16	2735	c.2545G>T	c.(2545-2547)Gcc>Tcc	p.A849S		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	849					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.A849S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						GTTTGTCGTGGCCATGGGTGT	0.542										HNSCC(16;0.037)																											p.A849S	GBM(45;858 913 3709 36904 37282)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2545T	3						.						260.0	217.0	232.0					3																	140282865		2203	4300	6503	141765555	SO:0001583	missense	64084	exon16			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2545G>T	3.37:g.140282865G>T	ENSP00000402460:p.Ala849Ser	Somatic		Capture	SOLID	Phase_I	141765555	NM_022131	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	G	11.54	1.668279	0.29604	.	.	ENSG00000158258	ENST00000458420	T	0.29655	1.56	5.63	4.76	0.60689	.	0.055575	0.85682	D	0.000000	T	0.24699	0.0599	L	0.50919	1.6	0.35127	D	0.767606	B	0.30406	0.278	B	0.24974	0.057	T	0.29305	-1.0016	9	.	.	.	-1.2918	8.6476	0.34016	0.172:0.0:0.828:0.0	.	849	Q9H4D0	CSTN2_HUMAN	S	849	ENSP00000402460:A849S	.	A	+	1	0	CLSTN2	141765555	1.000000	0.71417	1.000000	0.80357	0.001000	0.01503	3.492000	0.53259	1.387000	0.46486	-0.136000	0.14681	GCC		CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
PAQR9	344838	hgsc.bcm.edu	37	3	142681286	142681286	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:142681286C>T	ENST00000340634.3	-	1	892	c.893G>A	c.(892-894)cGc>cAc	p.R298H	RP11-372E1.6_ENST00000608349.1_RNA|RP11-372E1.6_ENST00000607937.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA|RP11-372E1.6_ENST00000497652.1_RNA|RP11-372E1.6_ENST00000598139.1_RNA|RP11-372E1.6_ENST00000493825.1_RNA|RP11-372E1.6_ENST00000594095.1_RNA|RP11-372E1.6_ENST00000478823.1_RNA|RP11-372E1.6_ENST00000595774.1_RNA|RP11-372E1.6_ENST00000598787.1_RNA|RP11-372E1.6_ENST00000608686.1_RNA|RP11-372E1.6_ENST00000593321.1_RNA	NM_198504.2	NP_940906.1	Q6ZVX9	PAQR9_HUMAN	progestin and adipoQ receptor family member IX	298						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R298H(1)		endometrium(2)|large_intestine(7)|lung(12)|prostate(1)	22						CGGCTGGATGCGCTCGGGGAT	0.577																																					p.R298H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G893A	3						.						62.0	64.0	63.0					3																	142681286		2203	4300	6503	144163976	SO:0001583	missense	344838	exon1			AY424287	CCDS3128.1	3q23	2008-05-02			ENSG00000188582	ENSG00000188582			30131	protein-coding gene	gene with protein product		614580					Standard	NM_198504		Approved	FLJ41938	uc003evg.3	Q6ZVX9	OTTHUMG00000159313	ENST00000340634.3:c.893G>A	3.37:g.142681286C>T	ENSP00000341564:p.Arg298His	Somatic		Capture	SOLID	Phase_I	144163976	NM_198504	Q147T6	Missense_Mutation	SNP	ENST00000340634.3	37	CCDS3128.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.991192	0.93106	.	.	ENSG00000188582	ENST00000340634	T	0.48201	0.82	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.73361	0.3577	M	0.82823	2.61	0.54753	D	0.999989	D	0.89917	1.0	D	0.87578	0.998	T	0.76462	-0.2950	10	0.72032	D	0.01	-38.9672	19.7096	0.96089	0.0:1.0:0.0:0.0	.	298	Q6ZVX9	PAQR9_HUMAN	H	298	ENSP00000341564:R298H	ENSP00000341564:R298H	R	-	2	0	PAQR9	144163976	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.903000	0.63272	2.652000	0.90054	0.655000	0.94253	CGC		PAQR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354538.1	NM_198504	
CPB1	1360	hgsc.bcm.edu	37	3	148563255	148563255	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:148563255C>T	ENST00000491148.1	+	10	1157	c.823C>T	c.(823-825)Cct>Tct	p.P275S	CPB1_ENST00000282957.4_Missense_Mutation_p.P275S			P15086	CBPB1_HUMAN	carboxypeptidase B1 (tissue)	275						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.P275S(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	38			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TTACTGTGGACCTGCCGCAGA	0.473																																					p.P275S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C823T	3						.						97.0	104.0	102.0					3																	148563255		2203	4300	6503	150045945	SO:0001583	missense	1360	exon9			AJ224866	CCDS33874.1	3q24	2012-02-10			ENSG00000153002	ENSG00000153002	3.4.17.2		2299	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase B"", ""tissue carboxypeptidase B"", ""protaminase"""	114852					Standard	XM_005247124		Approved		uc003ewl.3	P15086	OTTHUMG00000159520	ENST00000491148.1:c.823C>T	3.37:g.148563255C>T	ENSP00000417222:p.Pro275Ser	Somatic		Capture	SOLID	Phase_I	150045945	NM_001871	O60834|Q53XJ0|Q96BQ8	Missense_Mutation	SNP	ENST00000491148.1	37	CCDS33874.1	.	.	.	.	.	.	.	.	.	.	C	1.450	-0.565154	0.03939	.	.	ENSG00000153002	ENST00000491148;ENST00000282957	T;T	0.11604	2.76;2.76	5.69	-4.55	0.03441	Peptidase M14, carboxypeptidase A (2);	0.667704	0.16884	N	0.195584	T	0.04227	0.0117	N	0.10809	0.05	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.37753	-0.9692	10	0.24483	T	0.36	.	8.8404	0.35137	0.1916:0.1427:0.0:0.6657	.	275	P15086	CBPB1_HUMAN	S	275	ENSP00000417222:P275S;ENSP00000282957:P275S	ENSP00000282957:P275S	P	+	1	0	CPB1	150045945	0.000000	0.05858	0.009000	0.14445	0.096000	0.18686	-0.800000	0.04555	-0.684000	0.05183	-1.251000	0.01509	CCT		CPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355928.1	NM_001871	
SH3BP5	9467	hgsc.bcm.edu	37	3	15300442	15300442	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:15300442C>T	ENST00000383791.3	-	7	1005	c.785G>A	c.(784-786)cGc>cAc	p.R262H	SH3BP5_ENST00000253688.5_Missense_Mutation_p.R105H|SH3BP5_ENST00000408919.3_Missense_Mutation_p.R105H|SH3BP5-AS1_ENST00000420195.1_RNA|SH3BP5-AS1_ENST00000436602.1_RNA|SH3BP5-AS1_ENST00000413977.1_RNA|SH3BP5_ENST00000426925.1_Missense_Mutation_p.R105H	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)	262					intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)	p.R262H(1)		NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						GGCACTGGAGCGCCGCCGCTC	0.597																																					p.R105H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G314A	3						.						74.0	68.0	70.0					3																	15300442		2203	4300	6503	15275446	SO:0001583	missense	9467	exon7			AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.785G>A	3.37:g.15300442C>T	ENSP00000373301:p.Arg262His	Somatic		Capture	SOLID	Phase_I	15275446	NM_001018009	B3KQW6|Q5JWV9	Missense_Mutation	SNP	ENST00000383791.3	37	CCDS2625.2	.	.	.	.	.	.	.	.	.	.	C	17.53	3.413521	0.62511	.	.	ENSG00000131370	ENST00000383791;ENST00000426925;ENST00000253688;ENST00000408919;ENST00000366391	.	.	.	5.47	4.6	0.57074	.	0.050281	0.85682	D	0.000000	T	0.55178	0.1904	L	0.41961	1.31	0.50171	D	0.999852	B	0.23490	0.086	B	0.21151	0.033	T	0.55952	-0.8059	9	0.72032	D	0.01	-4.3348	13.8967	0.63775	0.0:0.9259:0.0:0.0741	.	262	O60239	3BP5_HUMAN	H	262;105;105;105;105	.	ENSP00000253688:R105H	R	-	2	0	SH3BP5	15275446	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	6.055000	0.71103	1.333000	0.45449	0.505000	0.49811	CGC		SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340740.2	NM_004844	
CPA3	1359	hgsc.bcm.edu	37	3	148599387	148599387	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:148599387A>G	ENST00000296046.3	+	7	707	c.655A>G	c.(655-657)Aat>Gat	p.N219D	RP11-680B3.2_ENST00000488190.1_RNA	NM_001870.2	NP_001861.2	P15088	CBPA3_HUMAN	carboxypeptidase A3 (mast cell)	219					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.N219D(1)		NS(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TCCTGTGTTCAATGTTGATGG	0.348																																					p.N219D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A655G	3						.						130.0	122.0	125.0					3																	148599387		2203	4300	6503	150082077	SO:0001583	missense	1359	exon7				CCDS3138.1	3q24	2012-02-10			ENSG00000163751	ENSG00000163751	3.4.17.1		2298	protein-coding gene	gene with protein product	"""mast cell carboxypeptidase A"", ""tissue carboxypeptidase A"""	114851					Standard	NM_001870		Approved		uc003ewm.3	P15088	OTTHUMG00000159526	ENST00000296046.3:c.655A>G	3.37:g.148599387A>G	ENSP00000296046:p.Asn219Asp	Somatic		Capture	SOLID	Phase_I	150082077	NM_001870	Q96E94	Missense_Mutation	SNP	ENST00000296046.3	37	CCDS3138.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.497334	0.85069	.	.	ENSG00000163751	ENST00000296046	T	0.71341	-0.56	5.06	5.06	0.68205	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	D	0.89371	0.6696	H	0.98005	4.125	0.58432	D	0.999999	D	0.69078	0.997	D	0.71656	0.974	D	0.92991	0.6415	10	0.87932	D	0	.	13.9293	0.63983	1.0:0.0:0.0:0.0	.	219	P15088	CBPA3_HUMAN	D	219	ENSP00000296046:N219D	ENSP00000296046:N219D	N	+	1	0	CPA3	150082077	1.000000	0.71417	0.963000	0.40424	0.987000	0.75469	7.533000	0.81994	2.111000	0.64477	0.533000	0.62120	AAT		CPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355974.1	NM_001870	
P2RY1	5028	hgsc.bcm.edu	37	3	152554205	152554205	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:152554205C>T	ENST00000305097.3	+	1	1470	c.634C>T	c.(634-636)Cga>Tga	p.R212*	RP11-38P22.2_ENST00000460407.1_lincRNA	NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	212					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)	p.R212*(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			CGAGTACCTGCGAAGTTATTT	0.512																																					p.R212X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C634T	3						.						169.0	154.0	159.0					3																	152554205		2203	4300	6503	154036895	SO:0001587	stop_gained	5028	exon1			U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.634C>T	3.37:g.152554205C>T	ENSP00000304767:p.Arg212*	Somatic		Capture	SOLID	Phase_I	154036895	NM_002563		Nonsense_Mutation	SNP	ENST00000305097.3	37	CCDS3169.1	.	.	.	.	.	.	.	.	.	.	C	44	11.252287	0.99537	.	.	ENSG00000169860	ENST00000305097	.	.	.	5.57	3.61	0.41365	.	0.071981	0.53938	D	0.000046	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	13.3084	0.60365	0.5161:0.4839:0.0:0.0	.	.	.	.	X	212	.	ENSP00000304767:R212X	R	+	1	2	P2RY1	154036895	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	2.417000	0.44653	1.274000	0.44362	0.655000	0.94253	CGA		P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563	
PLCH1	23007	hgsc.bcm.edu	37	3	155210588	155210588	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:155210588A>C	ENST00000340059.7	-	17	2200	c.2201T>G	c.(2200-2202)cTc>cGc	p.L734R	PLCH1_ENST00000334686.6_Missense_Mutation_p.L716R|PLCH1_ENST00000414191.1_Missense_Mutation_p.L716R|PLCH1_ENST00000460012.1_Missense_Mutation_p.L716R|PLCH1_ENST00000447496.2_Missense_Mutation_p.L734R|PLCH1_ENST00000494598.1_Missense_Mutation_p.L734R	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	734	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.L716R(1)		NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TTTCAGGATGAGCTGCTTTTT	0.463																																					p.L734R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2201G	3						.						180.0	149.0	159.0					3																	155210588		2203	4300	6503	156693282	SO:0001583	missense	23007	exon17			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.2201T>G	3.37:g.155210588A>C	ENSP00000345988:p.Leu734Arg	Somatic		Capture	SOLID	Phase_I	156693282	NM_001130960	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	37	CCDS46939.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.829758	0.91036	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19;1.19	5.95	5.95	0.96441	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.72961	0.3526	H	0.96547	3.84	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.997;0.998;0.984	T	0.82456	-0.0448	10	0.87932	D	0	.	16.4237	0.83790	1.0:0.0:0.0:0.0	.	716;734;734	Q4KWH8-2;Q4KWH8;Q4KWH8-3	.;PLCH1_HUMAN;.	R	734;716;734;734;716;716	ENSP00000419100:L734R;ENSP00000417502:L716R;ENSP00000402759:L734R;ENSP00000345988:L734R;ENSP00000335469:L716R;ENSP00000412977:L716R	ENSP00000335469:L716R	L	-	2	0	PLCH1	156693282	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.210000	0.95106	2.279000	0.76181	0.533000	0.62120	CTC		PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996	
PLCH1	23007	hgsc.bcm.edu	37	3	155311814	155311814	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:155311814C>T	ENST00000340059.7	-	3	349	c.350G>A	c.(349-351)cGc>cAc	p.R117H	PLCH1_ENST00000334686.6_Missense_Mutation_p.R99H|PLCH1_ENST00000414191.1_Missense_Mutation_p.R99H|PLCH1_ENST00000460012.1_Missense_Mutation_p.R99H|PLCH1_ENST00000447496.2_Missense_Mutation_p.R117H|PLCH1_ENST00000494598.1_Missense_Mutation_p.R117H	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	117	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.R99H(1)		NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GATCCAGGTGCGGGCCTCCTC	0.562																																					p.R117H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G350A	3						.						76.0	71.0	73.0					3																	155311814		2203	4300	6503	156794508	SO:0001583	missense	23007	exon3			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.350G>A	3.37:g.155311814C>T	ENSP00000345988:p.Arg117His	Somatic		Capture	SOLID	Phase_I	156794508	NM_001130960	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	37	CCDS46939.1	.	.	.	.	.	.	.	.	.	.	C	35	5.479869	0.96307	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08;-0.08	5.63	5.63	0.86233	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.64402	D	0.000001	T	0.79435	0.4445	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.995;0.993	T	0.80056	-0.1542	10	0.87932	D	0	.	20.0471	0.97613	0.0:1.0:0.0:0.0	.	99;117;117	Q4KWH8-2;Q4KWH8;Q4KWH8-3	.;PLCH1_HUMAN;.	H	117;99;117;117;99;99	ENSP00000419100:R117H;ENSP00000417502:R99H;ENSP00000402759:R117H;ENSP00000345988:R117H;ENSP00000335469:R99H;ENSP00000412977:R99H	ENSP00000335469:R99H	R	-	2	0	PLCH1	156794508	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.711000	0.84669	2.815000	0.96918	0.561000	0.74099	CGC		PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996	
KCNAB1	7881	hgsc.bcm.edu	37	3	156254498	156254498	+	Missense_Mutation	SNP	C	C	T	rs376655720	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:156254498C>T	ENST00000490337.1	+	14	1286	c.1222C>T	c.(1222-1224)Cgc>Tgc	p.R408C	KCNAB1_ENST00000389636.5_Missense_Mutation_p.R379C|KCNAB1_ENST00000302490.8_Missense_Mutation_p.R390C|KCNAB1_ENST00000471742.1_Missense_Mutation_p.R397C|KCNAB1_ENST00000497291.1_3'UTR|KCNAB1_ENST00000389634.5_Missense_Mutation_p.R361C	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	408					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)	p.R397C(1)|p.R390C(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TAACATACTGCGCAACAAGCC	0.438													C|||	3	0.000599042	0.0	0.0	5008	,	,		20625	0.0		0.0	False		,,,				2504	0.0031				p.R390C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1168T	3						.	C	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	170.0	148.0	155.0		1189,1168,1222	4.8	1.0	3		155	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	KCNAB1	NM_003471.3,NM_172159.3,NM_172160.2	180,180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	397/409,390/402,408/420	156254498	1,13005	2203	4300	6503	157737192	SO:0001583	missense	7881	exon14			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.1222C>T	3.37:g.156254498C>T	ENSP00000419952:p.Arg408Cys	Somatic		Capture	SOLID	Phase_I	157737192	NM_172159	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	ENST00000490337.1	37	CCDS3174.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.761018	0.69763	0.0	1.16E-4	ENSG00000169282	ENST00000490337;ENST00000389636;ENST00000471742;ENST00000302490;ENST00000389634	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.71	4.78	0.61160	NADP-dependent oxidoreductase domain (2);	0.151669	0.64402	D	0.000016	T	0.43700	0.1259	N	0.19112	0.55	0.53688	D	0.999977	P;P;P;P;P	0.52316	0.933;0.588;0.641;0.952;0.933	P;B;B;P;P	0.56788	0.806;0.087;0.141;0.707;0.806	T	0.43540	-0.9385	10	0.87932	D	0	-15.5209	13.5933	0.61971	0.0:0.6701:0.3299:0.0	.	379;361;390;397;408	B7Z8E5;F8W6W4;B3KPZ4;Q14722-3;Q14722	.;.;.;.;KCAB1_HUMAN	C	408;379;397;390;361	ENSP00000419952:R408C;ENSP00000374287:R379C;ENSP00000418956:R397C;ENSP00000305858:R390C;ENSP00000374285:R361C	ENSP00000305858:R390C	R	+	1	0	KCNAB1	157737192	1.000000	0.71417	0.988000	0.46212	0.822000	0.46500	5.343000	0.65976	2.694000	0.91930	0.585000	0.79938	CGC		KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471	
IQCJ-SCHIP1	100505385	hgsc.bcm.edu	37	3	159584013	159584013	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:159584013A>G	ENST00000460298.1	+	3	942	c.701A>G	c.(700-702)gAt>gGt	p.D234G	IQCJ-SCHIP1_ENST00000337808.6_Missense_Mutation_p.D274G|IQCJ-SCHIP1_ENST00000485419.1_Missense_Mutation_p.D350G|SCHIP1_ENST00000482804.1_Missense_Mutation_p.D47G|IQCJ-SCHIP1_ENST00000412423.2_Missense_Mutation_p.D261G|IQCJ-SCHIP1_ENST00000476809.1_Missense_Mutation_p.D323G|IQCJ-SCHIP1_ENST00000527095.1_Missense_Mutation_p.D42G|SCHIP1_ENST00000445224.2_Missense_Mutation_p.D31G					IQCJ-SCHIP1 readthrough									p.D274G(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(7)	12						TTCTTTGATGATGGCCCAGGA	0.413																																					p.D42G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A125G	3						.						126.0	137.0	133.0					3																	159584013		2203	4300	6503	161066707	SO:0001583	missense	29970	exon2				CCDS56289.1, CCDS56291.1	3q25.33	2011-03-24			ENSG00000250588	ENSG00000250588			38842	other	readthrough							Standard	NM_001197113		Approved		uc003fcq.2		OTTHUMG00000162426	ENST00000460298.1:c.701A>G	3.37:g.159584013A>G	ENSP00000417305:p.Asp234Gly	Somatic		Capture	SOLID	Phase_I	161066707	NM_001197108		Missense_Mutation	SNP	ENST00000460298.1	37		.	.	.	.	.	.	.	.	.	.	A	24.8	4.569174	0.86439	.	.	ENSG00000250588;ENSG00000250588;ENSG00000250588;ENSG00000250588;ENSG00000250588;ENSG00000250588;ENSG00000250588;ENSG00000151967;ENSG00000151967	ENST00000476809;ENST00000485419;ENST00000337808;ENST00000412423;ENST00000527095;ENST00000460298;ENST00000473061;ENST00000445224;ENST00000482804	T;T;T;T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.66489	0.2794	L	0.48642	1.525	0.51767	D	0.999938	D;D;D;D;D;D	0.89917	1.0;0.997;0.996;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.992;0.981;0.998;0.999;0.998	T	0.69161	-0.5218	10	0.72032	D	0.01	.	14.6094	0.68504	1.0:0.0:0.0:0.0	.	234;47;31;261;274;350	C9J366;C9JWG6;Q9P0W5-4;Q9P0W5-2;Q9P0W5;Q9P0W5-5	.;.;.;.;SCHI1_HUMAN;.	G	323;350;274;261;42;234;33;31;47	ENSP00000418692:D323G;ENSP00000420182:D350G;ENSP00000337239:D274G;ENSP00000400942:D261G;ENSP00000436076:D42G;ENSP00000417305:D234G;ENSP00000404860:D31G;ENSP00000419230:D47G	ENSP00000337239:D274G	D	+	2	0	SCHIP1;IQCJ-SCHIP1	161066707	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.154000	0.89641	2.084000	0.62774	0.477000	0.44152	GAT		IQCJ-SCHIP1-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000352558.2	NM_001197113	
BCHE	590	hgsc.bcm.edu	37	3	165548127	165548127	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:165548127A>C	ENST00000264381.3	-	2	861	c.695T>G	c.(694-696)gTt>gGt	p.V232G	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	232					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)	p.V232G(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	ATGCAGGCTAACTGAAGCTGC	0.438																																					p.V232G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T695G	3						.						86.0	90.0	88.0					3																	165548127		2203	4300	6503	167030821	SO:0001583	missense	590	exon2			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.695T>G	3.37:g.165548127A>C	ENSP00000264381:p.Val232Gly	Somatic		Capture	SOLID	Phase_I	167030821	NM_000055	A8K7P8	Missense_Mutation	SNP	ENST00000264381.3	37	CCDS3198.1	.	.	.	.	.	.	.	.	.	.	A	16.07	3.019224	0.54576	.	.	ENSG00000114200	ENST00000264381	D	0.96802	-4.13	5.71	5.71	0.89125	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	D	0.98940	0.9640	H	0.98388	4.22	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99364	1.0918	10	0.87932	D	0	.	15.1704	0.72869	1.0:0.0:0.0:0.0	.	232	P06276	CHLE_HUMAN	G	232	ENSP00000264381:V232G	ENSP00000264381:V232G	V	-	2	0	BCHE	167030821	1.000000	0.71417	0.885000	0.34714	0.801000	0.45260	7.452000	0.80683	2.180000	0.69256	0.533000	0.62120	GTT		BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1		
TBC1D5	9779	hgsc.bcm.edu	37	3	17279703	17279703	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:17279703G>A	ENST00000253692.7	-	17	3204	c.1540C>T	c.(1540-1542)Cag>Tag	p.Q514*	TBC1D5_ENST00000429383.4_Nonsense_Mutation_p.Q514*|TBC1D5_ENST00000414318.2_5'UTR|TBC1D5_ENST00000429924.2_Nonsense_Mutation_p.Q466*|TBC1D5_ENST00000446818.2_Nonsense_Mutation_p.Q514*	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	514						retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)	p.Q514*(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						AGCCTCTGCTGCTGCTGTTGC	0.478																																					p.Q514X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1540T	3						.						59.0	59.0	59.0					3																	17279703		2203	4300	6503	17254707	SO:0001587	stop_gained	9779	exon17			D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.1540C>T	3.37:g.17279703G>A	ENSP00000253692:p.Gln514*	Somatic		Capture	SOLID	Phase_I	17254707	NM_001134380	A6NP25|C9JP52	Nonsense_Mutation	SNP	ENST00000253692.7	37	CCDS33714.1	.	.	.	.	.	.	.	.	.	.	G	38	6.830028	0.97869	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818;ENST00000429924	.	.	.	5.47	5.47	0.80525	.	0.617484	0.17001	N	0.190894	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-14.6118	17.5005	0.87730	0.0:0.0:1.0:0.0	.	.	.	.	X	514;514;514;466	.	ENSP00000253692:Q514X	Q	-	1	0	TBC1D5	17254707	0.977000	0.34250	1.000000	0.80357	0.772000	0.43724	1.001000	0.29783	2.558000	0.86282	0.555000	0.69702	CAG		TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340301.3	NM_014744	
SERPINI2	5276	hgsc.bcm.edu	37	3	167184934	167184934	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:167184934T>C	ENST00000476257.1	-	4	685	c.387A>G	c.(385-387)gaA>gaG	p.E129E	SERPINI2_ENST00000264677.4_Silent_p.E129E|SERPINI2_ENST00000471111.1_Silent_p.E129E|SERPINI2_ENST00000465031.1_5'Flank|SERPINI2_ENST00000461846.1_Silent_p.E129E			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	129					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.E129E(1)		NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						TCTGAAAAAATTCCTTGTTGC	0.368																																					p.E129E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A387G	3						.						112.0	111.0	111.0					3																	167184934		2202	4300	6502	168667628	SO:0001819	synonymous_variant	5276	exon3			AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.387A>G	3.37:g.167184934T>C		Somatic		Capture	SOLID	Phase_I	168667628	NM_006217		Silent	SNP	ENST00000476257.1	37	CCDS3200.1																																																																																				SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350450.1	NM_006217	
FNDC3B	64778	hgsc.bcm.edu	37	3	172058903	172058903	+	Splice_Site	SNP	C	C	T	rs139658890	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:172058903C>T	ENST00000336824.4	+	17	1952	c.1853C>T	c.(1852-1854)gCg>gTg	p.A618V	FNDC3B_ENST00000416957.1_Splice_Site_p.A618V|FNDC3B_ENST00000415807.2_Splice_Site_p.A618V	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	618	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)	p.A618V(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TGTTTTACAGCGAATCAGTGG	0.433																																					p.A618V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1853T	3						.	C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	144.0	129.0	134.0		1853,1853	4.8	0.9	3	dbSNP_134	134	2,8598	2.2+/-6.3	0,2,4298	no	missense-near-splice,missense-near-splice	FNDC3B	NM_001135095.1,NM_022763.3	64,64	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign	618/1205,618/1205	172058903	2,13004	2203	4300	6503	173541597	SO:0001630	splice_region_variant	64778	exon17			AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.1853-1C>T	3.37:g.172058903C>T		Somatic		Capture	SOLID	Phase_I	173541597	NM_001135095	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Missense_Mutation	SNP	ENST00000336824.4	37	CCDS3217.1	.	.	.	.	.	.	.	.	.	.	C	11.70	1.717439	0.30413	0.0	2.33E-4	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957	T;T;T	0.57595	0.39;0.39;0.39	5.67	4.79	0.61399	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.260548	0.44285	D	0.000476	T	0.41351	0.1155	L	0.31526	0.94	0.80722	D	1	B	0.28291	0.206	B	0.25506	0.061	T	0.17349	-1.0372	9	.	.	.	.	16.5626	0.84570	0.0:0.8695:0.1305:0.0	.	618	Q53EP0	FND3B_HUMAN	V	618	ENSP00000411242:A618V;ENSP00000338523:A618V;ENSP00000389094:A618V	.	A	+	2	0	FNDC3B	173541597	0.991000	0.36638	0.865000	0.33974	0.537000	0.34900	2.875000	0.48491	1.350000	0.45770	0.655000	0.94253	GCG		FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	Missense_Mutation
PEX5L	51555	hgsc.bcm.edu	37	3	179525550	179525550	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:179525550C>T	ENST00000467460.1	-	14	1918	c.1588G>A	c.(1588-1590)Gcc>Acc	p.A530T	PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000472994.1_Missense_Mutation_p.A471T|PEX5L_ENST00000464614.1_Missense_Mutation_p.A422T|PEX5L_ENST00000468741.1_Missense_Mutation_p.A338T|PEX5L_ENST00000465751.1_Missense_Mutation_p.A506T|PEX5L_ENST00000263962.8_Missense_Mutation_p.A528T|PEX5L_ENST00000485199.1_Missense_Mutation_p.A495T|PEX5L_ENST00000476138.1_Missense_Mutation_p.A487T|PEX5L_ENST00000392649.3_Missense_Mutation_p.A422T	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	530					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)	p.A530T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			CGCGTATAGGCCTCCACGGCT	0.542																																					p.A530T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1588A	3						.						149.0	152.0	151.0					3																	179525550		2203	4300	6503	181008244	SO:0001583	missense	51555	exon14			AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.1588G>A	3.37:g.179525550C>T	ENSP00000419975:p.Ala530Thr	Somatic		Capture	SOLID	Phase_I	181008244	NM_016559	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Missense_Mutation	SNP	ENST00000467460.1	37	CCDS3236.1	.	.	.	.	.	.	.	.	.	.	C	35	5.535229	0.96460	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751	T;T;T;T;T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2	6.07	6.07	0.98685	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.81093	0.4751	M	0.86651	2.83	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;0.998;1.0;0.995;0.987;0.996	D;D;D;P;P;P	0.81914	0.995;0.995;0.991;0.833;0.772;0.896	T	0.82585	-0.0384	10	0.87932	D	0	-15.6948	20.6525	0.99598	0.0:1.0:0.0:0.0	.	471;506;422;528;495;530	E7EUZ0;E9PH97;E9PEC1;Q8IYB4-2;Q8IYB4-3;Q8IYB4	.;.;.;.;.;PEX5R_HUMAN	T	530;528;495;528;422;338;487;418;471;422;506	ENSP00000419975:A530T;ENSP00000263962:A528T;ENSP00000418440:A495T;ENSP00000376420:A422T;ENSP00000418665:A338T;ENSP00000420555:A487T;ENSP00000418054:A471T;ENSP00000417270:A422T;ENSP00000419348:A506T	ENSP00000263962:A528T	A	-	1	0	PEX5L	181008244	1.000000	0.71417	1.000000	0.80357	0.571000	0.35966	7.747000	0.85070	2.890000	0.99128	0.585000	0.79938	GCC		PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348577.1	NM_016559	
MCCC1	56922	hgsc.bcm.edu	37	3	182759396	182759396	+	Missense_Mutation	SNP	C	C	T	rs371219844		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:182759396C>T	ENST00000265594.4	-	11	1372	c.1226G>A	c.(1225-1227)cGa>cAa	p.R409Q	MCCC1_ENST00000539926.1_Missense_Mutation_p.R274Q|MCCC1_ENST00000492597.1_Missense_Mutation_p.R300Q	NM_020166.3	NP_064551.3	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-CoA carboxylase 1 (alpha)	409	Biotin carboxylation.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)	p.R409Q(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(17)|ovary(1)|pancreas(2)|prostate(1)|skin(2)	40	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	AGGGTCTGCTCGAGGAGTAGA	0.433																																					p.R409Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1226A	3						.						111.0	112.0	112.0					3																	182759396		2203	4300	6503	184242090	SO:0001583	missense	56922	exon11			AF310972	CCDS3241.1	3q27.1	2010-04-30	2010-04-30		ENSG00000078070	ENSG00000078070	6.4.1.4		6936	protein-coding gene	gene with protein product		609010	"""methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)"""			11170888	Standard	XR_241502		Approved	MCCA	uc003fle.3	Q96RQ3	OTTHUMG00000158355	ENST00000265594.4:c.1226G>A	3.37:g.182759396C>T	ENSP00000265594:p.Arg409Gln	Somatic		Capture	SOLID	Phase_I	184242090	NM_020166	Q59ES4|Q9H959|Q9NS97	Missense_Mutation	SNP	ENST00000265594.4	37	CCDS3241.1	.	.	.	.	.	.	.	.	.	.	C	2.071	-0.412991	0.04799	.	.	ENSG00000078070	ENST00000265594;ENST00000492597;ENST00000392616;ENST00000539926;ENST00000476176;ENST00000448585	D;D;D;D	0.95518	-3.73;-3.68;-3.55;-3.48	5.45	-10.9	0.00192	Rudiment single hybrid motif (1);ATP-grasp fold, subdomain 2 (1);Biotin carboxylation domain (1);Biotin carboxylase, C-terminal (2);	0.646180	0.16595	N	0.207574	T	0.78240	0.4252	N	0.01535	-0.81	0.09310	N	1	B;B;B	0.13145	0.003;0.007;0.002	B;B;B	0.09377	0.003;0.003;0.004	T	0.69602	-0.5101	10	0.12103	T	0.63	.	8.7765	0.34765	0.0571:0.2237:0.6347:0.0845	.	362;300;409	E9PG35;E9PHF7;Q96RQ3	.;.;MCCA_HUMAN	Q	409;300;259;274;362;362	ENSP00000265594:R409Q;ENSP00000419898:R300Q;ENSP00000441253:R274Q;ENSP00000420433:R362Q	ENSP00000265594:R409Q	R	-	2	0	MCCC1	184242090	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.323000	0.07997	-3.605000	0.00133	-2.630000	0.00154	CGA		MCCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350775.1	NM_020166	
MAP3K13	9175	hgsc.bcm.edu	37	3	185200169	185200169	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:185200169C>T	ENST00000265026.3	+	14	3160	c.2826C>T	c.(2824-2826)gaC>gaT	p.D942D	MAP3K13_ENST00000443863.1_Silent_p.D798D|MAP3K13_ENST00000424227.1_Silent_p.D942D|MAP3K13_ENST00000446828.1_Silent_p.D735D|TMEM41A_ENST00000475480.1_Intron|MAP3K13_ENST00000535426.1_Silent_p.D798D	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13									p.D942D(1)		NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			AAGAATCGGACTGTGACTCTT	0.423																																					p.D942D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2826T	3						.						208.0	187.0	194.0					3																	185200169		2203	4300	6503	186682863	SO:0001819	synonymous_variant	9175	exon14			BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.2826C>T	3.37:g.185200169C>T		Somatic		Capture	SOLID	Phase_I	186682863	NM_004721		Silent	SNP	ENST00000265026.3	37	CCDS3270.1																																																																																				MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345268.1	NM_004721	
RTP4	64108	hgsc.bcm.edu	37	3	187088995	187088995	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:187088995C>T	ENST00000259030.2	+	2	685	c.575C>T	c.(574-576)gCt>gTt	p.A192V		NM_022147.2	NP_071430.2	Q96DX8	RTP4_HUMAN	receptor (chemosensory) transporter protein 4	192					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|protein targeting to membrane (GO:0006612)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.A192V(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	all_cancers(143;4.66e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		GGAATTGGTGCTGTGTACCTC	0.522																																					p.A192V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C575T	3						.						83.0	67.0	72.0					3																	187088995		2203	4300	6503	188571689	SO:0001583	missense	64108	exon2			BC013161	CCDS33910.1	3q27.3	2014-02-20	2006-11-21		ENSG00000136514	ENSG00000136514		"""Receptor transporter proteins"""	23992	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 4"""	609350	"""receptor transporter protein 4"""			16271481, 15550249, 16720576	Standard	NM_022147		Approved	IFRG28, Z3CXXC4	uc003frm.3	Q96DX8	OTTHUMG00000156459	ENST00000259030.2:c.575C>T	3.37:g.187088995C>T	ENSP00000259030:p.Ala192Val	Somatic		Capture	SOLID	Phase_I	188571689	NM_022147	Q9H4F3	Missense_Mutation	SNP	ENST00000259030.2	37	CCDS33910.1	.	.	.	.	.	.	.	.	.	.	C	8.715	0.913070	0.17907	.	.	ENSG00000136514	ENST00000259030	T	0.18810	2.19	2.98	-0.921	0.10472	.	6.219380	0.00357	N	0.000024	T	0.09335	0.0230	N	0.08118	0	0.09310	N	1	B	0.27625	0.183	B	0.21708	0.036	T	0.11817	-1.0572	10	0.27785	T	0.31	0.0196	0.6049	0.00751	0.4487:0.2204:0.1283:0.2026	.	192	Q96DX8	RTP4_HUMAN	V	192	ENSP00000259030:A192V	ENSP00000259030:A192V	A	+	2	0	RTP4	188571689	0.017000	0.18338	0.000000	0.03702	0.000000	0.00434	0.750000	0.26334	-0.172000	0.10779	-1.797000	0.00622	GCT		RTP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344260.1	NM_022147	
LEPREL1	55214	hgsc.bcm.edu	37	3	189681832	189681832	+	Missense_Mutation	SNP	T	T	C	rs201191537		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:189681832T>C	ENST00000319332.5	-	14	2146	c.1949A>G	c.(1948-1950)aAc>aGc	p.N650S	LEPREL1_ENST00000427335.2_Missense_Mutation_p.N469S	NM_018192.3	NP_060662.2	Q8IVL5	P3H2_HUMAN	leprecan-like 1	650	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|peptidyl-proline hydroxylation (GO:0019511)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)	p.N650S(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(5)	41	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CCCATGAGGGTTCTCTCCTCC	0.453																																					p.N469S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1406G	3						.						105.0	100.0	101.0					3																	189681832		2203	4300	6503	191164526	SO:0001583	missense	55214	exon14				CCDS3294.1, CCDS46981.1	3q29	2014-01-28			ENSG00000090530	ENSG00000090530	1.14.11.7		19317	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 2"""	610341				15063763, 21885030	Standard	NM_018192		Approved	FLJ10718, MLAT4, P3H2	uc011bsk.2	Q8IVL5	OTTHUMG00000156312	ENST00000319332.5:c.1949A>G	3.37:g.189681832T>C	ENSP00000316881:p.Asn650Ser	Somatic		Capture	SOLID	Phase_I	191164526	NM_001134418	B3KPK0|B3KWI9|D3DNV8|Q9NVI2	Missense_Mutation	SNP	ENST00000319332.5	37	CCDS3294.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.874535	0.91664	.	.	ENSG00000090530	ENST00000319332;ENST00000427335	T;T	0.55588	0.51;0.51	5.91	5.91	0.95273	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.039662	0.85682	D	0.000000	T	0.71533	0.3351	M	0.72353	2.195	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72243	-0.4350	9	.	.	.	-27.1826	15.5295	0.75942	0.0:0.0:0.0:1.0	.	650	Q8IVL5	P3H2_HUMAN	S	650;469	ENSP00000316881:N650S;ENSP00000408947:N469S	.	N	-	2	0	LEPREL1	191164526	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.698000	0.84413	2.254000	0.74563	0.533000	0.62120	AAC		LEPREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343855.1	NM_018192	
LEPREL1	55214	hgsc.bcm.edu	37	3	189838081	189838081	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:189838081C>T	ENST00000319332.5	-	1	637	c.440G>A	c.(439-441)cGc>cAc	p.R147H	LEPREL1-AS1_ENST00000412203.1_RNA|LEPREL1_ENST00000427335.2_Intron	NM_018192.3	NP_060662.2	Q8IVL5	P3H2_HUMAN	leprecan-like 1	147					collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|peptidyl-proline hydroxylation (GO:0019511)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)	p.R147H(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(5)	41	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	GGGCACTCTGCGCTGGAAGTC	0.667																																					p.R147H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G440A	3						.						25.0	21.0	22.0					3																	189838081		2203	4299	6502	191320775	SO:0001583	missense	55214	exon1				CCDS3294.1, CCDS46981.1	3q29	2014-01-28			ENSG00000090530	ENSG00000090530	1.14.11.7		19317	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 2"""	610341				15063763, 21885030	Standard	NM_018192		Approved	FLJ10718, MLAT4, P3H2	uc011bsk.2	Q8IVL5	OTTHUMG00000156312	ENST00000319332.5:c.440G>A	3.37:g.189838081C>T	ENSP00000316881:p.Arg147His	Somatic		Capture	SOLID	Phase_I	191320775	NM_018192	B3KPK0|B3KWI9|D3DNV8|Q9NVI2	Missense_Mutation	SNP	ENST00000319332.5	37	CCDS3294.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.752808	0.89753	.	.	ENSG00000090530	ENST00000319332	T	0.56444	0.46	5.36	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.62171	0.2406	M	0.64170	1.965	0.80722	D	1	D	0.71674	0.998	P	0.58210	0.835	T	0.60885	-0.7174	9	.	.	.	-13.5387	11.6601	0.51341	0.0:0.9154:0.0:0.0846	.	147	Q8IVL5	P3H2_HUMAN	H	147	ENSP00000316881:R147H	.	R	-	2	0	LEPREL1	191320775	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	0.933000	0.28897	2.793000	0.96121	0.561000	0.74099	CGC		LEPREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343855.1	NM_018192	
TCTEX1D2	255758	hgsc.bcm.edu	37	3	196022888	196022888	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:196022888C>T	ENST00000325318.5	-	4	505	c.370G>A	c.(370-372)Gtt>Att	p.V124I	RP11-447L10.1_ENST00000431391.1_Intron	NM_152773.4	NP_689986.2	Q8WW35	TC1D2_HUMAN	Tctex1 domain containing 2	124								p.V124I(1)		breast(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)	7	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		TTCATGAAAACATCATGAGTA	0.383																																					p.V124I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G370A	3						.						117.0	109.0	111.0					3																	196022888		2203	4300	6503	197507285	SO:0001583	missense	255758	exon4			BC021177	CCDS33929.1	3q29	2010-07-19			ENSG00000213123	ENSG00000213123			28482	protein-coding gene	gene with protein product						12477932	Standard	NM_152773		Approved	MGC33212	uc003fwi.3	Q8WW35	OTTHUMG00000155672	ENST00000325318.5:c.370G>A	3.37:g.196022888C>T	ENSP00000324323:p.Val124Ile	Somatic		Capture	SOLID	Phase_I	197507285	NM_152773	A6NCN5	Missense_Mutation	SNP	ENST00000325318.5	37	CCDS33929.1	.	.	.	.	.	.	.	.	.	.	C	10.52	1.372395	0.24857	.	.	ENSG00000213123	ENST00000325318	T	0.30448	1.53	4.69	2.9	0.33743	.	0.120982	0.34245	U	0.004128	T	0.18425	0.0442	N	0.17631	0.505	0.41378	D	0.987535	B	0.14012	0.009	B	0.27608	0.081	T	0.06373	-1.0830	10	0.23891	T	0.37	-5.7767	7.4665	0.27324	0.0:0.8039:0.0:0.1961	.	124	Q8WW35	TC1D2_HUMAN	I	124	ENSP00000324323:V124I	ENSP00000324323:V124I	V	-	1	0	TCTEX1D2	197507285	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.966000	0.40481	0.700000	0.31782	0.655000	0.94253	GTT		TCTEX1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341166.1	NM_152773	
DLG1	1739	hgsc.bcm.edu	37	3	197023262	197023262	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:197023262G>A	ENST00000419354.1	-	3	392	c.106C>T	c.(106-108)Cgg>Tgg	p.R36W	MIR4797_ENST00000577559.1_RNA|DLG1_ENST00000392382.2_Missense_Mutation_p.R36W|DLG1_ENST00000448528.2_Missense_Mutation_p.R36W|DLG1_ENST00000450955.1_Missense_Mutation_p.R36W|DLG1_ENST00000346964.2_Missense_Mutation_p.R36W|DLG1-AS1_ENST00000430666.1_RNA|DLG1_ENST00000485409.1_5'UTR|DLG1_ENST00000357674.4_Missense_Mutation_p.R36W|DLG1_ENST00000422288.1_Missense_Mutation_p.R36W|DLG1-AS1_ENST00000414529.1_RNA|DLG1_ENST00000314062.3_Missense_Mutation_p.R36W			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	36	L27. {ECO:0000255|PROSITE- ProRule:PRU00365}.				actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)	p.R36W(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		TTAATAACCCGTTCTATGGAA	0.398																																					p.R36W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C106T	3						.						162.0	163.0	163.0					3																	197023262		2203	4300	6503	198507659	SO:0001583	missense	1739	exon3			U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.106C>T	3.37:g.197023262G>A	ENSP00000407531:p.Arg36Trp	Somatic		Capture	SOLID	Phase_I	198507659	NM_004087	A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	ENST00000419354.1	37	CCDS43194.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.162003	0.78226	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000422288;ENST00000448528;ENST00000392382;ENST00000450955;ENST00000456699;ENST00000392380;ENST00000419553;ENST00000436682;ENST00000412364	T;T;T;T;T;T;T;T;T;T;T	0.55760	2.14;2.04;2.05;2.16;2.05;2.16;2.07;2.04;0.5;0.5;0.5	5.09	4.21	0.49690	L27 (2);L27-1 (1);	0.065255	0.64402	D	0.000017	T	0.70290	0.3207	M	0.75777	2.31	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;1.0;1.0	D;P;D;D	0.85130	0.997;0.736;0.95;0.997	T	0.73770	-0.3878	10	0.66056	D	0.02	.	12.1765	0.54188	0.0855:0.0:0.9145:0.0	.	36;36;36;36	Q12959-4;Q12959-3;Q12959;Q12959-2	.;.;DLG1_HUMAN;.	W	36	ENSP00000345731:R36W;ENSP00000350303:R36W;ENSP00000321087:R36W;ENSP00000407531:R36W;ENSP00000413238:R36W;ENSP00000391732:R36W;ENSP00000376187:R36W;ENSP00000411278:R36W;ENSP00000396474:R36W;ENSP00000376185:R36W;ENSP00000414189:R36W	ENSP00000321087:R36W	R	-	1	2	DLG1	198507659	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.642000	0.37207	1.458000	0.47871	0.650000	0.86243	CGG		DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258170.2	NM_004087	
THUMPD3	25917	hgsc.bcm.edu	37	3	9422245	9422245	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:9422245T>G	ENST00000345094.3	+	7	1401	c.1067T>G	c.(1066-1068)gTg>gGg	p.V356G	THUMPD3_ENST00000452837.2_Missense_Mutation_p.V356G|SETD5-AS1_ENST00000468186.1_RNA|THUMPD3_ENST00000515662.2_Missense_Mutation_p.V356G	NM_001114092.1|NM_015453.2	NP_001107564.1|NP_056268.2	Q9BV44	THUM3_HUMAN	THUMP domain containing 3	356						cytoplasm (GO:0005737)|nucleolus (GO:0005730)	methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.V356G(1)		NS(1)|central_nervous_system(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	19	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.101)		CCACTGGCTGTGAATAGAGCA	0.348																																					p.V356G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1067G	3						.						110.0	108.0	108.0					3																	9422245		2203	4300	6503	9397245	SO:0001583	missense	25917	exon7			AL117483	CCDS2573.1	3p25.3	2004-06-04			ENSG00000134077	ENSG00000134077			24493	protein-coding gene	gene with protein product						12477932	Standard	NM_015453		Approved	DKFZP434F091	uc003brn.4	Q9BV44	OTTHUMG00000097031	ENST00000345094.3:c.1067T>G	3.37:g.9422245T>G	ENSP00000339532:p.Val356Gly	Somatic		Capture	SOLID	Phase_I	9397245	NM_015453	Q9H8V6|Q9NVC1|Q9UFS3	Missense_Mutation	SNP	ENST00000345094.3	37	CCDS2573.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.4|22.4	4.289152|4.289152	0.80914|0.80914	.|.	.|.	ENSG00000134077|ENSG00000134077	ENST00000452837;ENST00000345094;ENST00000515662|ENST00000441127	T;T;T|.	0.30448|.	1.53;1.53;1.53|.	5.55|5.55	5.55|5.55	0.83447|0.83447	Putative RNA methylase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.75744|.	0.3891|.	M|M	0.77616|0.77616	2.38|2.38	0.80722|0.80722	D|D	1|1	P|.	0.37176|.	0.586|.	P|.	0.51297|.	0.665|.	T|.	0.76958|.	-0.2766|.	10|.	0.66056|.	D|.	0.02|.	-24.5395|-24.5395	15.3585|15.3585	0.74448|0.74448	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	356|.	Q9BV44|.	THUM3_HUMAN|.	G|G	356|213	ENSP00000395893:V356G;ENSP00000339532:V356G;ENSP00000424064:V356G|.	ENSP00000339532:V356G|.	V|X	+|+	2|1	0|0	THUMPD3|THUMPD3	9397245|9397245	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	7.129000|7.129000	0.77225|0.77225	2.116000|2.116000	0.64780|0.64780	0.454000|0.454000	0.30748|0.30748	GTG|TGA		THUMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214127.1	NM_015453	
EMC3	55831	hgsc.bcm.edu	37	3	10015358	10015358	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:10015358G>A	ENST00000245046.2	-	5	906	c.448C>T	c.(448-450)Cct>Tct	p.P150S	EMC3_ENST00000497557.1_5'UTR|EMC3_ENST00000429759.1_Missense_Mutation_p.P188S	NM_018447.2	NP_060917.1	Q9P0I2	EMC3_HUMAN	ER membrane protein complex subunit 3	150						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)		p.P150S(1)									TGTAACATAGGCTTAAAACGG	0.393																																					p.P150S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C448T	3						.						130.0	126.0	127.0					3																	10015358		2203	4300	6503	9990358	SO:0001583	missense	55831	exon5			AF157321	CCDS2594.1	3p25.3	2012-05-23	2012-05-23	2012-05-23	ENSG00000125037	ENSG00000125037			23999	protein-coding gene	gene with protein product			"""transmembrane protein 111"""	TMEM111		19797678, 22119785	Standard	NM_018447		Approved		uc003bun.3	Q9P0I2	OTTHUMG00000128652	ENST00000245046.2:c.448C>T	3.37:g.10015358G>A	ENSP00000245046:p.Pro150Ser	Somatic		Capture	SOLID	Phase_I	9990358	NM_018447	B2R4Z9|Q53GH8|Q6ZMC2	Missense_Mutation	SNP	ENST00000245046.2	37	CCDS2594.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.477040	0.44044	.	.	ENSG00000125037	ENST00000245046;ENST00000429759	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.46580	0.1400	N	0.11560	0.145	0.80722	D	1	B;B	0.33022	0.154;0.394	B;P	0.45232	0.139;0.474	T	0.33979	-0.9847	9	0.02654	T	1	.	17.7344	0.88388	0.0:0.0:1.0:0.0	.	150;150	Q9P0I2-2;Q9P0I2	.;TM111_HUMAN	S	150;188	.	ENSP00000245046:P150S	P	-	1	0	TMEM111	9990358	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	9.837000	0.99465	2.797000	0.96272	0.561000	0.74099	CCT		EMC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250532.1	NM_018447	
OXSM	54995	hgsc.bcm.edu	37	3	25833145	25833145	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:25833145G>A	ENST00000280701.3	+	2	733	c.634G>A	c.(634-636)Gga>Aga	p.G212R	OXSM_ENST00000420173.2_Missense_Mutation_p.G212R|NGLY1_ENST00000417874.2_5'Flank|OXSM_ENST00000449808.1_Intron	NM_017897.2	NP_060367.1	Q9NWU1	OXSM_HUMAN	3-oxoacyl-ACP synthase, mitochondrial	212					acyl-CoA metabolic process (GO:0006637)|medium-chain fatty acid biosynthetic process (GO:0051792)|short-chain fatty acid biosynthetic process (GO:0051790)	mitochondrion (GO:0005739)	3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)	p.G212R(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						CTGTACCACAGGAGCTCATGC	0.463																																					p.G212R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G634A	3						.						101.0	99.0	100.0					3																	25833145		2203	4300	6503	25808149	SO:0001583	missense	54995	exon2			BC008202	CCDS2643.1, CCDS46780.1	3p24.2	2010-03-19			ENSG00000151093	ENSG00000151093	2.3.1.41		26063	protein-coding gene	gene with protein product	"""beta-ketoacyl synthase"""	610324				12477932	Standard	NM_017897		Approved	KS, FLJ20604, FASN2D	uc003cdn.3	Q9NWU1	OTTHUMG00000130477	ENST00000280701.3:c.634G>A	3.37:g.25833145G>A	ENSP00000280701:p.Gly212Arg	Somatic		Capture	SOLID	Phase_I	25808149	NM_017897		Missense_Mutation	SNP	ENST00000280701.3	37	CCDS2643.1	.	.	.	.	.	.	.	.	.	.	G	32	5.190489	0.94923	.	.	ENSG00000151093	ENST00000452098;ENST00000280701;ENST00000420173;ENST00000428266	.	.	.	6.16	6.16	0.99307	Beta-ketoacyl synthase, N-terminal (1);Thiolase-like, subgroup (1);Thiolase-like (1);	0.048141	0.85682	D	0.000000	D	0.91136	0.7209	H	0.98068	4.14	0.80722	D	1	D;D	0.89917	0.981;1.0	P;D	0.97110	0.762;1.0	D	0.93206	0.6596	9	0.87932	D	0	-23.4502	20.8598	0.99761	0.0:0.0:1.0:0.0	.	212;212	Q9NWU1-2;Q9NWU1	.;OXSM_HUMAN	R	212	.	ENSP00000280701:G212R	G	+	1	0	OXSM	25808149	1.000000	0.71417	0.964000	0.40570	0.996000	0.88848	9.827000	0.99397	2.937000	0.99478	0.650000	0.86243	GGA		OXSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252876.2	NM_017897	
TMPPE	643853	hgsc.bcm.edu	37	3	33134992	33134992	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:33134992C>A	ENST00000342462.4	-	2	886	c.696G>T	c.(694-696)atG>atT	p.M232I	TMPPE_ENST00000416695.2_Missense_Mutation_p.M95I|GLB1_ENST00000445488.2_Intron|GLB1_ENST00000307377.8_Intron|GLB1_ENST00000307363.5_Intron|GLB1_ENST00000399402.3_Intron	NM_001039770.2	NP_001034859.2	Q6ZT21	TMPPE_HUMAN	transmembrane protein with metallophosphoesterase domain	232						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.M232I(1)		breast(1)|large_intestine(5)|lung(6)|prostate(1)	13						GCACATTCACCATCCTCACAA	0.567																																					p.M95I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G285T	3						.						161.0	128.0	139.0					3																	33134992		2203	4300	6503	33109996	SO:0001583	missense	643853	exon2			AK126979	CCDS33732.1, CCDS46786.1	3p22.3	2014-02-12	2009-02-24		ENSG00000188167	ENSG00000188167			33865	protein-coding gene	gene with protein product							Standard	NM_001039770		Approved	FLJ45032	uc003cfk.2	Q6ZT21	OTTHUMG00000155779	ENST00000342462.4:c.696G>T	3.37:g.33134992C>A	ENSP00000343398:p.Met232Ile	Somatic		Capture	SOLID	Phase_I	33109996	NM_001136238	B2RNG5|Q6ZRG1	Missense_Mutation	SNP	ENST00000342462.4	37	CCDS33732.1	.	.	.	.	.	.	.	.	.	.	C	11.64	1.698852	0.30142	.	.	ENSG00000188167	ENST00000416695;ENST00000342462	D;D	0.83506	-1.73;-1.73	5.9	5.9	0.94986	Metallophosphoesterase domain (1);	0.063428	0.56097	D	0.000022	T	0.76076	0.3937	L	0.34521	1.04	0.40824	D	0.983536	B	0.28208	0.203	B	0.18263	0.021	T	0.72207	-0.4360	10	0.36615	T	0.2	-24.339	18.0498	0.89344	0.0:1.0:0.0:0.0	.	232	Q6ZT21	TMPPE_HUMAN	I	95;232	ENSP00000400715:M95I;ENSP00000343398:M232I	ENSP00000343398:M232I	M	-	3	0	TMPPE	33109996	1.000000	0.71417	1.000000	0.80357	0.554000	0.35429	4.398000	0.59697	2.808000	0.96608	0.650000	0.86243	ATG		TMPPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341566.1	NM_001039770	
UBP1	7342	hgsc.bcm.edu	37	3	33467165	33467165	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:33467165T>C	ENST00000283629.3	-	2	711	c.182A>G	c.(181-183)cAc>cGc	p.H61R	UBP1_ENST00000283628.5_Missense_Mutation_p.H61R|UBP1_ENST00000447368.2_Missense_Mutation_p.H61R	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a)	61					angiogenesis (GO:0001525)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.H61R(1)		breast(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|urinary_tract(2)	23						AAAGGGTGGGTGCTCTGTTTC	0.433																																					p.H61R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A182G	3						.						93.0	74.0	80.0					3																	33467165		2203	4300	6503	33442169	SO:0001583	missense	7342	exon3			AF198487	CCDS2659.1, CCDS46788.1	3p22.3	2004-03-02			ENSG00000153560	ENSG00000153560			12507	protein-coding gene	gene with protein product		609784				8114710	Standard	NM_014517		Approved	LBP-1a	uc010hga.3	Q9NZI7	OTTHUMG00000130749	ENST00000283629.3:c.182A>G	3.37:g.33467165T>C	ENSP00000283629:p.His61Arg	Somatic		Capture	SOLID	Phase_I	33442169	NM_001128161	Q68CT0|Q86Y57|Q9H8V0|Q9UD76|Q9UD78	Missense_Mutation	SNP	ENST00000283629.3	37	CCDS2659.1	.	.	.	.	.	.	.	.	.	.	T	9.837	1.190113	0.21954	.	.	ENSG00000153560	ENST00000283629;ENST00000447368;ENST00000283628;ENST00000456378	T;T;T;T	0.15834	2.39;2.39;2.39;2.39	5.92	5.92	0.95590	CP2 transcription factor (1);	0.200235	0.52532	D	0.000075	T	0.07098	0.0180	N	0.03608	-0.345	0.38310	D	0.943211	B;B	0.30439	0.279;0.001	B;B	0.28011	0.085;0.014	T	0.38394	-0.9663	10	0.10377	T	0.69	-10.6872	11.4528	0.50162	0.1343:0.0:0.0:0.8657	.	61;61	Q9NZI7-4;Q9NZI7	.;UBIP1_HUMAN	R	61	ENSP00000283629:H61R;ENSP00000395558:H61R;ENSP00000283628:H61R;ENSP00000401614:H61R	ENSP00000283628:H61R	H	-	2	0	UBP1	33442169	1.000000	0.71417	0.987000	0.45799	0.931000	0.56810	4.010000	0.57117	2.267000	0.75376	0.477000	0.44152	CAC		UBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253249.2	NM_014517	
PLCD1	5333	hgsc.bcm.edu	37	3	38051164	38051164	+	Missense_Mutation	SNP	G	G	A	rs115555466		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:38051164G>A	ENST00000334661.4	-	9	1648	c.1426C>T	c.(1426-1428)Cgt>Tgt	p.R476C	PLCD1_ENST00000463876.1_Missense_Mutation_p.R497C|PLCD1_ENST00000479619.1_5'Flank	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	476					angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)	p.R476C(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		TGCTGCACACGGCTCCTCACT	0.672													G|||	1	0.000199681	0.0	0.0	5008	,	,		12754	0.0		0.001	False		,,,				2504	0.0				p.R476C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1426T	3						.						75.0	56.0	62.0					3																	38051164		2203	4300	6503	38026168	SO:0001583	missense	5333	exon9				CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.1426C>T	3.37:g.38051164G>A	ENSP00000335600:p.Arg476Cys	Somatic		Capture	SOLID	Phase_I	38026168	NM_006225	B3KR14|Q86VN8	Missense_Mutation	SNP	ENST00000334661.4	37	CCDS2671.1	.	.	.	.	.	.	.	.	.	.	G	13.17	2.156374	0.38119	.	.	ENSG00000187091	ENST00000463876;ENST00000334661	T;T	0.63744	-0.06;-0.06	4.82	3.81	0.43845	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);	0.625117	0.15771	N	0.245403	T	0.36496	0.0969	N	0.08118	0	0.23769	N	0.996899	P;B	0.48911	0.917;0.002	B;B	0.38712	0.28;0.002	T	0.19289	-1.0310	10	0.56958	D	0.05	.	7.1286	0.25486	0.0:0.1332:0.464:0.4028	.	476;497	P51178;B3KR14	PLCD1_HUMAN;.	C	497;476	ENSP00000430344:R497C;ENSP00000335600:R476C	ENSP00000335600:R476C	R	-	1	0	PLCD1	38026168	0.000000	0.05858	0.976000	0.42696	0.858000	0.48976	0.028000	0.13644	2.395000	0.81488	0.555000	0.69702	CGT		PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253359.2		
SCN10A	6336	hgsc.bcm.edu	37	3	38753798	38753798	+	Missense_Mutation	SNP	C	C	T	rs147640811		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:38753798C>T	ENST00000449082.2	-	22	3942	c.3943G>A	c.(3943-3945)Gat>Aat	p.D1315N		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1315					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.D1315N(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	AACTCTCCATCGGTATAGTTG	0.463																																					p.D1315N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3943A	3						.	C	ASN/ASP	0,4406		0,0,2203	145.0	140.0	142.0		3943	-2.1	0.0	3	dbSNP_134	142	1,8599	1.2+/-3.3	0,1,4299	no	missense	SCN10A	NM_006514.2	23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	1315/1957	38753798	1,13005	2203	4300	6503	38728802	SO:0001583	missense	6336	exon22			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.3943G>A	3.37:g.38753798C>T	ENSP00000390600:p.Asp1315Asn	Somatic		Capture	SOLID	Phase_I	38728802	NM_006514	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	C	9.815	1.184182	0.21870	0.0	1.16E-4	ENSG00000185313	ENST00000449082	D	0.95885	-3.84	4.88	-2.1	0.07210	Ion transport (1);	1.717900	0.02712	N	0.112918	D	0.90177	0.6930	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.80264	-0.1455	10	0.27785	T	0.31	.	7.85	0.29448	0.0:0.4782:0.1374:0.3844	.	1315	Q9Y5Y9	SCNAA_HUMAN	N	1315	ENSP00000390600:D1315N	ENSP00000390600:D1315N	D	-	1	0	SCN10A	38728802	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.481000	0.06552	-0.188000	0.10499	-0.378000	0.06908	GAT		SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
SCN10A	6336	hgsc.bcm.edu	37	3	38812783	38812783	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:38812783C>T	ENST00000449082.2	-	4	585	c.586G>A	c.(586-588)Gtc>Atc	p.V196I		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	196					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.V196I(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	AGGGTAATGACGCTAAAATCC	0.458																																					p.V196I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G586A	3						.						169.0	161.0	163.0					3																	38812783		2203	4300	6503	38787787	SO:0001583	missense	6336	exon4			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.586G>A	3.37:g.38812783C>T	ENSP00000390600:p.Val196Ile	Somatic		Capture	SOLID	Phase_I	38787787	NM_006514	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.513523	0.85389	.	.	ENSG00000185313	ENST00000449082	D	0.98567	-5.0	5.15	5.15	0.70609	Ion transport (1);	0.061365	0.64402	D	0.000004	D	0.98429	0.9477	L	0.48935	1.535	0.49051	D	0.999744	D	0.89917	1.0	D	0.83275	0.996	D	0.99879	1.1109	10	0.87932	D	0	.	18.4138	0.90561	0.0:1.0:0.0:0.0	.	196	Q9Y5Y9	SCNAA_HUMAN	I	196	ENSP00000390600:V196I	ENSP00000390600:V196I	V	-	1	0	SCN10A	38787787	1.000000	0.71417	0.991000	0.47740	0.970000	0.65996	7.317000	0.79018	2.665000	0.90641	0.655000	0.94253	GTC		SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
ZNF621	285268	hgsc.bcm.edu	37	3	40573867	40573867	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:40573867T>C	ENST00000339296.5	+	5	1058	c.606T>C	c.(604-606)atT>atC	p.I202I	ZNF621_ENST00000310898.1_Intron|ZNF621_ENST00000431278.1_Silent_p.I91I|ZNF621_ENST00000403205.2_Silent_p.I202I|ZNF621_ENST00000490457.1_Intron	NM_198484.3	NP_940886.1	Q6ZSS3	ZN621_HUMAN	zinc finger protein 621	202					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I202I(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0515)|Kidney(284;0.0648)		AAAACCACATTGGAGAAGGGC	0.443																																					p.I202I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T606C	3						.						91.0	90.0	90.0					3																	40573867		2203	4300	6503	40548871	SO:0001819	synonymous_variant	285268	exon5			AK127181	CCDS2693.1, CCDS74920.1	3p21.33	2013-01-08			ENSG00000172888	ENSG00000172888		"""Zinc fingers, C2H2-type"", ""-"""	24787	protein-coding gene	gene with protein product							Standard	XM_005265079		Approved	FLJ45246	uc003ckm.2	Q6ZSS3	OTTHUMG00000131389	ENST00000339296.5:c.606T>C	3.37:g.40573867T>C		Somatic		Capture	SOLID	Phase_I	40548871	NM_001098414	Q14DC7|Q8TE91	Silent	SNP	ENST00000339296.5	37	CCDS2693.1																																																																																				ZNF621-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254178.2	NM_198484	
NKTR	4820	hgsc.bcm.edu	37	3	42685395	42685395	+	Splice_Site	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:42685395T>C	ENST00000232978.8	+	16	4389	c.4201T>C	c.(4201-4203)Tcc>Ccc	p.S1401P	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	1401					protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.S1401P(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		TTAAAGCAGGTCCTACACCTA	0.438																																					p.S1401P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4201C	3						.						131.0	103.0	112.0					3																	42685395		2203	4300	6503	42660399	SO:0001630	splice_region_variant	4820	exon16				CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.4200-1T>C	3.37:g.42685395T>C		Somatic		Capture	SOLID	Phase_I	42660399	NM_005385		Missense_Mutation	SNP	ENST00000232978.8	37	CCDS2702.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.038837	0.75617	.	.	ENSG00000114857	ENST00000232978	T	0.28895	1.59	5.52	5.52	0.82312	.	0.060056	0.64402	D	0.000001	T	0.56906	0.2017	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.61773	-0.6994	10	0.87932	D	0	-7.5144	15.6267	0.76863	0.0:0.0:0.0:1.0	.	1101;1401	Q6M1B8;P30414	.;NKTR_HUMAN	P	1401	ENSP00000232978:S1401P	ENSP00000232978:S1401P	S	+	1	0	NKTR	42660399	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.248000	0.78268	2.105000	0.64084	0.533000	0.62120	TCC		NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2	NM_005385	Missense_Mutation
LARS2	23395	hgsc.bcm.edu	37	3	45588986	45588986	+	Silent	SNP	G	G	T	rs550066510	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:45588986G>T	ENST00000415258.1	+	21	2817	c.2676G>T	c.(2674-2676)ccG>ccT	p.P892P	LARS2_ENST00000265537.3_Silent_p.P892P|LARS2_ENST00000414984.1_Silent_p.P849P			Q15031	SYLM_HUMAN	leucyl-tRNA synthetase 2, mitochondrial	892					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)	p.P892P(2)		endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)	TCCTTTCCCCGAGAACTGCCC	0.557																																					p.P892P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G2676T	3						.						116.0	113.0	114.0					3																	45588986		2203	4300	6503	45563990	SO:0001819	synonymous_variant	23395	exon22			AJ312685	CCDS2728.1	3p21.3	2012-10-26			ENSG00000011376	ENSG00000011376	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	17095	protein-coding gene	gene with protein product	"""leucine tRNA ligase 2, mitochondrial"""	604544				20194621, 15123417	Standard	NM_015340		Approved	KIAA0028, LEURS, MGC26121	uc003cop.1	Q15031	OTTHUMG00000133177	ENST00000415258.1:c.2676G>T	3.37:g.45588986G>T		Somatic		Capture	SOLID	Phase_I	45563990	NM_015340		Silent	SNP	ENST00000415258.1	37	CCDS2728.1																																																																																				LARS2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345001.1	NM_015340	
SLC6A20	54716	hgsc.bcm.edu	37	3	45812876	45812876	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:45812876G>A	ENST00000358525.4	-	6	883	c.768C>T	c.(766-768)ttC>ttT	p.F256F	SLC6A20_ENST00000456124.2_Silent_p.F256F|SLC6A20_ENST00000353278.4_Silent_p.F219F	NM_020208.3	NP_064593.1	Q9NP91	S6A20_HUMAN	solute carrier family 6 (proline IMINO transporter), member 20	256					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|glycine transport (GO:0015816)|ion transport (GO:0006811)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)	p.F256F(1)|p.F219F(1)		breast(1)|endometrium(1)|large_intestine(6)|ovary(2)|skin(2)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		TCAGGCTGCCGAAGCCCAGGC	0.572																																					p.F219F												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C657T	3						.						147.0	122.0	131.0					3																	45812876		2203	4300	6503	45787880	SO:0001819	synonymous_variant	54716	exon5			AF075260	CCDS2730.1, CCDS43077.1	3p21.6	2013-05-22			ENSG00000163817	ENSG00000163817		"""Solute carriers"""	30927	protein-coding gene	gene with protein product		605616				9932288, 11352561	Standard	NM_022405		Approved	XT3, Xtrp3	uc011bai.2	Q9NP91	OTTHUMG00000133446	ENST00000358525.4:c.768C>T	3.37:g.45812876G>A		Somatic		Capture	SOLID	Phase_I	45787880	NM_022405	A1A4F2|O75590|Q8TF10|Q9NPQ2|Q9NQ77	Silent	SNP	ENST00000358525.4	37	CCDS43077.1																																																																																				SLC6A20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257318.3	NM_020208	
SETD2	29072	hgsc.bcm.edu	37	3	47163598	47163598	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:47163598T>A	ENST00000409792.3	-	3	2570	c.2528A>T	c.(2527-2529)gAt>gTt	p.D843V		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	843					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.D843V(1)|p.D340V(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TTTTGAGTGATCTGTCAAATT	0.323			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.D843V			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2528T	3						.						51.0	54.0	53.0					3																	47163598		2203	4299	6502	47138602	SO:0001583	missense	29072	exon3			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.2528A>T	3.37:g.47163598T>A	ENSP00000386759:p.Asp843Val	Somatic		Capture	SOLID	Phase_I	47138602	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	T	12.20	1.866840	0.32977	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	D;T	0.90788	-2.73;1.17	5.18	5.18	0.71444	.	0.206525	0.33753	N	0.004588	D	0.88987	0.6587	N	0.19112	0.55	0.42842	D	0.994052	D;D	0.57899	0.981;0.981	P;P	0.55161	0.77;0.77	D	0.90871	0.4746	10	0.87932	D	0	.	13.7518	0.62912	0.0:0.0:0.0:1.0	.	843;843	F2Z317;Q9BYW2	.;SETD2_HUMAN	V	843;843;843;799	ENSP00000386759:D843V;ENSP00000416401:D799V	ENSP00000386759:D843V	D	-	2	0	SETD2	47138602	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	3.454000	0.52986	2.164000	0.68074	0.533000	0.62120	GAT		SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
DHX30	22907	hgsc.bcm.edu	37	3	47868904	47868904	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:47868904C>T	ENST00000445061.1	+	5	599	c.192C>T	c.(190-192)gcC>gcT	p.A64A	DHX30_ENST00000348968.4_Silent_p.A36A|DHX30_ENST00000457607.1_Silent_p.A92A|DHX30_ENST00000446256.2_Silent_p.A25A	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	64	DRBM.					cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.A64A(1)		endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		TTGGAAGAGCCCTCGGCATCT	0.413																																					p.A64A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C192T	3						.						99.0	97.0	98.0					3																	47868904		2203	4300	6503	47843908	SO:0001819	synonymous_variant	22907	exon5			AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.192C>T	3.37:g.47868904C>T		Somatic		Capture	SOLID	Phase_I	47843908	NM_138615	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Silent	SNP	ENST00000445061.1	37	CCDS2759.1																																																																																				DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615	
QARS	5859	hgsc.bcm.edu	37	3	49137410	49137410	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:49137410G>T	ENST00000306125.6	-	14	1616	c.1279C>A	c.(1279-1281)Cgc>Agc	p.R427S	QARS_ENST00000470225.1_5'Flank|QARS_ENST00000414533.1_Missense_Mutation_p.R416S			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	427					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)	p.R427S(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	TCCCCTGTGCGGTGGTGTGGT	0.592																																					p.R427S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1279A	3						.						126.0	119.0	122.0					3																	49137410		2203	4300	6503	49112414	SO:0001583	missense	5859	exon14			X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.1279C>A	3.37:g.49137410G>T	ENSP00000307567:p.Arg427Ser	Somatic		Capture	SOLID	Phase_I	49112414	NM_005051	B4DWJ2	Missense_Mutation	SNP	ENST00000306125.6	37	CCDS2788.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.644741	0.67358	.	.	ENSG00000172053	ENST00000306125;ENST00000414533	T;T	0.24350	1.86;1.86	5.79	5.79	0.91817	Glutamyl/glutaminyl-tRNA synthetase, class Ib, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.63733	0.2536	H	0.97023	3.925	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.67103	0.927;0.949	T	0.75377	-0.3339	10	0.87932	D	0	-18.6691	13.9016	0.63806	0.0736:0.0:0.9264:0.0	.	416;427	B4DWJ2;P47897	.;SYQ_HUMAN	S	427;416	ENSP00000307567:R427S;ENSP00000390015:R416S	ENSP00000307567:R427S	R	-	1	0	QARS	49112414	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	4.843000	0.62838	2.731000	0.93534	0.655000	0.94253	CGC		QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345689.2	NM_005051	
UBA7	7318	hgsc.bcm.edu	37	3	49848739	49848739	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:49848739C>T	ENST00000333486.3	-	9	1247	c.1089G>A	c.(1087-1089)atG>atA	p.M363I	UBA7_ENST00000494212.1_5'Flank	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	363	2 approximate repeats.			GVLSPMVAMLGAVAAQEVLKAISR -> RCLEPMVACWVSS CPGSAEGNLQ (in Ref. 1; AAA75388 and 2; AAG49557). {ECO:0000305}.	cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)	p.M363I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CTGCACCCAGCATGGCCACCA	0.597																																					p.M363I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1089A	3						.						121.0	102.0	109.0					3																	49848739		2203	4300	6503	49823743	SO:0001583	missense	7318	exon9			BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267	ENST00000333486.3:c.1089G>A	3.37:g.49848739C>T	ENSP00000333266:p.Met363Ile	Somatic		Capture	SOLID	Phase_I	49823743	NM_003335	Q9BRB2	Missense_Mutation	SNP	ENST00000333486.3	37	CCDS2805.1	.	.	.	.	.	.	.	.	.	.	C	9.101	1.004172	0.19199	.	.	ENSG00000182179	ENST00000333486	T	0.32023	1.47	5.76	-2.74	0.05932	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	1.010520	0.07901	N	0.972595	T	0.09379	0.0231	N	0.02379	-0.575	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24083	-1.0170	10	0.34782	T	0.22	0.3312	0.5062	0.00588	0.2301:0.326:0.1577:0.2862	.	363	P41226	UBA7_HUMAN	I	363	ENSP00000333266:M363I	ENSP00000333266:M363I	M	-	3	0	UBA7	49823743	0.000000	0.05858	0.021000	0.16686	0.373000	0.29922	-0.334000	0.07883	-0.192000	0.10432	0.462000	0.41574	ATG		UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	NM_003335	
GNAI2	2771	hgsc.bcm.edu	37	3	50293660	50293660	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:50293660C>T	ENST00000313601.6	+	5	885	c.501C>T	c.(499-501)gaC>gaT	p.D167D	GNAI2_ENST00000536647.1_Silent_p.D86D|GNAI2_ENST00000451956.1_Silent_p.D130D|GNAI2_ENST00000422163.1_Silent_p.D151D|GNAI2_ENST00000266027.5_Silent_p.D151D|GNAI2_ENST00000491100.1_3'UTR|GNAI2_ENST00000440628.1_Silent_p.D115D	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2	167					activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.D167D(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		CACAGAGTGACTACATCCCCA	0.592																																					p.D167D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C501T	3						.						121.0	88.0	99.0					3																	50293660		2202	4300	6502	50268664	SO:0001819	synonymous_variant	2771	exon5			X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.501C>T	3.37:g.50293660C>T		Somatic		Capture	SOLID	Phase_I	50268664	NM_002070	B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	Silent	SNP	ENST00000313601.6	37	CCDS2813.1																																																																																				GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346688.1	NM_002070	
GRM2	2912	hgsc.bcm.edu	37	3	51752069	51752069	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:51752069T>C	ENST00000395052.3	+	6	2794	c.2560T>C	c.(2560-2562)Ttt>Ctt	p.F854L	GRM2_ENST00000475478.1_3'UTR|GRM2_ENST00000442933.2_Missense_Mutation_p.F576L	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	854					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.F854L(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TGGCTCCCAGTTTGTCCCCAC	0.602																																					p.F236L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T706C	3						.						243.0	224.0	230.0					3																	51752069		2203	4300	6503	51727109	SO:0001583	missense	2912	exon4			L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.2560T>C	3.37:g.51752069T>C	ENSP00000378492:p.Phe854Leu	Somatic		Capture	SOLID	Phase_I	51727109	NM_001130063	B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	ENST00000395052.3	37	CCDS2834.1	.	.	.	.	.	.	.	.	.	.	T	10.47	1.358343	0.24598	.	.	ENSG00000164082	ENST00000395052;ENST00000442933	D;D	0.88818	-2.33;-2.43	4.56	3.34	0.38264	.	0.498628	0.19751	N	0.106889	T	0.76241	0.3960	N	0.14661	0.345	0.21184	N	0.999761	B	0.24533	0.105	B	0.15484	0.013	T	0.58476	-0.7630	10	0.12766	T	0.61	.	10.5928	0.45318	0.0:0.0808:0.0:0.9192	.	854	Q14416	GRM2_HUMAN	L	854;576	ENSP00000378492:F854L;ENSP00000408906:F576L	ENSP00000378492:F854L	F	+	1	0	GRM2	51727109	0.992000	0.36948	1.000000	0.80357	0.995000	0.86356	1.316000	0.33620	0.797000	0.33971	0.421000	0.28195	TTT		GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1		
ITIH1	3697	hgsc.bcm.edu	37	3	52817121	52817121	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:52817121G>A	ENST00000273283.2	+	9	1103	c.1079G>A	c.(1078-1080)cGg>cAg	p.R360Q	ITIH1_ENST00000540715.1_Missense_Mutation_p.R218Q|ITIH1_ENST00000542827.1_Missense_Mutation_p.R360Q|ITIH1_ENST00000537050.1_Missense_Mutation_p.R72Q	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	360	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.R360Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		GACTTTGTGCGGGGCTTTTCC	0.532																																					p.R218Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G653A	3						.						64.0	62.0	62.0					3																	52817121		2203	4300	6503	52792161	SO:0001583	missense	3697	exon7				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.1079G>A	3.37:g.52817121G>A	ENSP00000273283:p.Arg360Gln	Somatic		Capture	SOLID	Phase_I	52792161	NM_001166434	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	37	CCDS2864.1	.	.	.	.	.	.	.	.	.	.	G	3.537	-0.094419	0.07053	.	.	ENSG00000055957	ENST00000542827;ENST00000273283;ENST00000540715;ENST00000537050	T;T;T;T	0.78595	-1.19;-1.19;-1.19;1.97	5.37	-6.69	0.01772	von Willebrand factor, type A (3);	0.881934	0.10276	N	0.694128	T	0.53769	0.1817	N	0.08118	0	0.09310	N	1	B	0.18310	0.027	B	0.12156	0.007	T	0.48055	-0.9068	10	0.09590	T	0.72	-0.5929	17.1627	0.86808	0.2132:0.0:0.7868:0.0	.	360	P19827	ITIH1_HUMAN	Q	360;360;218;72	ENSP00000442584:R360Q;ENSP00000273283:R360Q;ENSP00000443973:R218Q;ENSP00000443847:R72Q	ENSP00000273283:R360Q	R	+	2	0	ITIH1	52792161	0.000000	0.05858	0.001000	0.08648	0.032000	0.12392	-0.823000	0.04443	-1.387000	0.02095	-0.312000	0.09012	CGG		ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	
PSMD6	9861	hgsc.bcm.edu	37	3	64005106	64005106	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:64005106C>T	ENST00000295901.4	-	3	503	c.363G>A	c.(361-363)ctG>ctA	p.L121L	PSMD6_ENST00000394431.2_Silent_p.L83L|PSMD6_ENST00000492933.1_Silent_p.L174L|PSMD6_ENST00000482510.1_Silent_p.L82L|RP11-245J9.6_ENST00000605919.1_RNA	NM_014814.1	NP_055629.1	Q15008	PSMD6_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 6	121					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATPase activity (GO:0016887)	p.L121L(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(1)|skin(1)	13		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000805)|Kidney(15;0.00188)|KIRC - Kidney renal clear cell carcinoma(15;0.00212)		GAAAGGCTGTCAGAGCTCCCT	0.418																																					p.L121L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G363A	3						.						75.0	76.0	76.0					3																	64005106		2203	4300	6503	63980146	SO:0001819	synonymous_variant	9861	exon3			AF215935	CCDS2901.1, CCDS63677.1, CCDS63678.1, CCDS63679.1	3p14.1	2008-05-22			ENSG00000163636	ENSG00000163636		"""Proteasome (prosome, macropain) subunits"""	9564	protein-coding gene	gene with protein product						10723133	Standard	NM_001271779		Approved	S10, p44S10, KIAA0107, Rpn7	uc003dmb.2	Q15008	OTTHUMG00000158765	ENST00000295901.4:c.363G>A	3.37:g.64005106C>T		Somatic		Capture	SOLID	Phase_I	63980146	NM_014814	A8K2E0|E9PHI9|Q6UV22	Silent	SNP	ENST00000295901.4	37	CCDS2901.1																																																																																				PSMD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352082.1	NM_014814	
PRICKLE2	166336	hgsc.bcm.edu	37	3	64184491	64184491	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:64184491G>A	ENST00000295902.6	-	2	698	c.113C>T	c.(112-114)gCc>gTc	p.A38V	PRICKLE2_ENST00000564377.1_Missense_Mutation_p.A94V|PRICKLE2-AS3_ENST00000473434.1_RNA	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	38	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.				establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.A38V(1)		breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		CGGGACCCAGGCATACTCTTC	0.517																																					p.A38V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C113T	3						.						145.0	109.0	121.0					3																	64184491		2203	4300	6503	64159531	SO:0001583	missense	166336	exon2			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.113C>T	3.37:g.64184491G>A	ENSP00000295902:p.Ala38Val	Somatic		Capture	SOLID	Phase_I	64159531	NM_198859	Q0VF44	Missense_Mutation	SNP	ENST00000295902.6	37	CCDS2902.1	.	.	.	.	.	.	.	.	.	.	G	36	5.952785	0.97139	.	.	ENSG00000163637	ENST00000295902;ENST00000498162	D;D	0.86956	-2.19;-2.19	5.69	5.69	0.88448	PET domain (2);	0.000000	0.64402	D	0.000002	D	0.92450	0.7603	M	0.75447	2.3	0.80722	D	1	P	0.36587	0.559	P	0.51297	0.665	D	0.92167	0.5740	10	0.72032	D	0.01	-29.8332	19.8075	0.96536	0.0:0.0:1.0:0.0	.	38	Q7Z3G6	PRIC2_HUMAN	V	38	ENSP00000295902:A38V;ENSP00000419951:A38V	ENSP00000295902:A38V	A	-	2	0	PRICKLE2	64159531	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	9.805000	0.99149	2.670000	0.90874	0.650000	0.86243	GCC		PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
EPHA3	2042	hgsc.bcm.edu	37	3	89259092	89259092	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:89259092A>C	ENST00000336596.2	+	3	461	c.236A>C	c.(235-237)aAc>aCc	p.N79T	EPHA3_ENST00000452448.2_Missense_Mutation_p.N79T|EPHA3_ENST00000494014.1_Missense_Mutation_p.N79T	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	79	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.N79T(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CACAGTCAAAACAATTGGCTG	0.453										TSP Lung(6;0.00050)																											p.N79T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A236C	3						.						76.0	74.0	75.0					3																	89259092		2203	4300	6503	89341782	SO:0001583	missense	2042	exon3			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.236A>C	3.37:g.89259092A>C	ENSP00000337451:p.Asn79Thr	Somatic		Capture	SOLID	Phase_I	89341782	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.073357	0.76415	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.11385	2.78;2.78;2.78	5.34	5.34	0.76211	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.38665	0.1049	M	0.87328	2.875	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.79108	0.992;0.989	T	0.39781	-0.9597	9	.	.	.	.	15.3238	0.74144	1.0:0.0:0.0:0.0	.	79;79	P29320;P29320-2	EPHA3_HUMAN;.	T	79	ENSP00000337451:N79T;ENSP00000399926:N79T;ENSP00000419190:N79T	.	N	+	2	0	EPHA3	89341782	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.339000	0.96797	2.020000	0.59435	0.460000	0.39030	AAC		EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
BDH1	622	hgsc.bcm.edu	37	3	197238876	197238876	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr3:197238876C>T	ENST00000392378.2	-	7	1232	c.922G>A	c.(922-924)Gcc>Acc	p.A308T	BDH1_ENST00000441275.1_Missense_Mutation_p.A221T|BDH1_ENST00000392379.1_Missense_Mutation_p.A308T|BDH1_ENST00000358186.2_Missense_Mutation_p.A308T	NM_004051.4	NP_004042.1	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1	308					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|response to cadmium ion (GO:0046686)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to growth hormone (GO:0060416)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|phospholipid binding (GO:0005543)	p.A308T(1)		endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)		GGGGTGGTGGCGGTCAGGGCG	0.562																																					p.A308T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G922A	3						.						174.0	150.0	158.0					3																	197238876		2203	4300	6503	198723273	SO:0001583	missense	622	exon7			M93107	CCDS3328.1	3q29	2011-09-14	2005-11-15	2005-11-15	ENSG00000161267	ENSG00000161267	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	1027	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 1"""	603063	"""3-hydroxybutyrate dehydrogenase (heart, mitochondrial)"""	BDH		1639787, 19027726	Standard	XM_005269352		Approved	SDR9C1	uc003fxs.3	Q02338	OTTHUMG00000155478	ENST00000392378.2:c.922G>A	3.37:g.197238876C>T	ENSP00000376183:p.Ala308Thr	Somatic		Capture	SOLID	Phase_I	198723273	NM_203315	D3DXC0|Q96ET1|Q9BRZ4	Missense_Mutation	SNP	ENST00000392378.2	37	CCDS3328.1	.	.	.	.	.	.	.	.	.	.	C	11.79	1.744091	0.30865	.	.	ENSG00000161267	ENST00000392378;ENST00000358186;ENST00000392379;ENST00000441275	D;D;D;D	0.93189	-3.18;-3.18;-3.18;-3.18	5.85	1.36	0.22044	NAD(P)-binding domain (1);	0.151978	0.64402	D	0.000010	D	0.92893	0.7739	M	0.84773	2.715	0.22034	N	0.999401	B	0.14012	0.009	B	0.09377	0.004	D	0.86406	0.1745	10	0.54805	T	0.06	.	14.6934	0.69103	0.4925:0.5075:0.0:0.0	.	308	Q02338	BDH_HUMAN	T	308;308;308;221	ENSP00000376183:A308T;ENSP00000350914:A308T;ENSP00000376184:A308T;ENSP00000411014:A221T	ENSP00000350914:A308T	A	-	1	0	BDH1	198723273	0.775000	0.28604	0.003000	0.11579	0.727000	0.41649	1.632000	0.37102	0.446000	0.26666	0.655000	0.94253	GCC		BDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340267.1	NM_004051	
CLEC12A	160364	hgsc.bcm.edu	37	12	10133292	10133292	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:10133292A>C	ENST00000304361.4	+	4	673	c.491A>C	c.(490-492)cAg>cCg	p.Q164P	CLEC12A_ENST00000355690.4_Missense_Mutation_p.Q174P|CLEC12A_ENST00000434319.2_Missense_Mutation_p.Q164P|CLEC12A_ENST00000350667.4_Missense_Mutation_p.Q131P	NM_138337.5|NM_201623.3	NP_612210.4|NP_963917.2	Q5QGZ9	CL12A_HUMAN	C-type lectin domain family 12, member A	164	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.Q164P(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	16						TGTGCTGCTCAGAATGCCAGC	0.453																																					p.Q164P	Melanoma(197;1487 2125 16611 22221 34855)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A491C	12						.						115.0	103.0	107.0					12																	10133292		2203	4300	6503	10024559	SO:0001583	missense	160364	exon4			AY498550	CCDS8608.1, CCDS8609.1, CCDS55803.1, CCDS73442.1	12p13.31	2010-08-17			ENSG00000172322	ENSG00000172322		"""C-type lectin domain containing"""	31713	protein-coding gene	gene with protein product		612088					Standard	NM_201623		Approved	CLL-1, MICL	uc001qwq.3	Q5QGZ9		ENST00000304361.4:c.491A>C	12.37:g.10133292A>C	ENSP00000302804:p.Gln164Pro	Somatic		Capture	SOLID	Phase_I	10024559	NM_138337	B2RA16|Q6P4H1|Q6RH77|Q6RH78|Q8TDQ6	Missense_Mutation	SNP	ENST00000304361.4	37	CCDS8608.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.097134	0.76870	.	.	ENSG00000172322	ENST00000355690;ENST00000396507;ENST00000304361;ENST00000434319;ENST00000350667;ENST00000396506	T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19	5.4	-1.76	0.08006	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.35799	0.0944	M	0.80616	2.505	0.09310	N	1	D;D;D	0.63880	0.989;0.993;0.991	P;P;P	0.61477	0.77;0.889;0.823	T	0.19844	-1.0293	9	0.33940	T	0.23	.	4.5853	0.12279	0.489:0.0:0.3633:0.1476	.	131;164;174	Q5QGZ9-4;Q5QGZ9;Q5QGZ9-1	.;CL12A_HUMAN;.	P	174;164;164;164;131;37	ENSP00000347916:Q174P;ENSP00000379764:Q164P;ENSP00000302804:Q164P;ENSP00000405244:Q164P;ENSP00000345448:Q131P	ENSP00000302804:Q164P	Q	+	2	0	CLEC12A	10024559	0.000000	0.05858	0.012000	0.15200	0.600000	0.36913	-0.259000	0.08721	-0.197000	0.10350	0.533000	0.62120	CAG		CLEC12A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399545.1	NM_138337	
TAS2R19	259294	hgsc.bcm.edu	37	12	11174598	11174598	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:11174598G>A	ENST00000390673.2	-	1	621	c.573C>T	c.(571-573)agC>agT	p.S191S	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176888.1	NP_795369.1	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	191					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S191S(1)		breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						AACATATTAGGCTCAGAGTAA	0.403																																					p.S191S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C573T	12						.						158.0	149.0	152.0					12																	11174598		2203	4300	6503	11065865	SO:0001819	synonymous_variant	259294	exon1			AX097730, AF494234	CCDS8640.1	12p13.2	2012-08-22			ENSG00000212124	ENSG00000212124		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19108	protein-coding gene	gene with protein product		613961	"""taste receptor, type 2, member 48"", ""taste receptor, type 2, member 23"""	TAS2R48, TAS2R23			Standard	NM_176888		Approved	T2R19, T2R23	uc010shj.2	P59542	OTTHUMG00000162687	ENST00000390673.2:c.573C>T	12.37:g.11174598G>A		Somatic		Capture	SOLID	Phase_I	11065865	NM_176888	Q3MIJ4|Q645X8	Silent	SNP	ENST00000390673.2	37	CCDS8640.1																																																																																				TAS2R19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370080.1	NM_176888	
ACACB	32	hgsc.bcm.edu	37	12	109696899	109696899	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:109696899C>T	ENST00000338432.7	+	47	6601	c.6482C>T	c.(6481-6483)tCc>tTc	p.S2161F	ACACB_ENST00000543201.1_Missense_Mutation_p.S827F|ACACB_ENST00000377854.5_Missense_Mutation_p.S2091F|ACACB_ENST00000377848.3_Missense_Mutation_p.S2161F			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	2161	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.S2161F(1)		NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	AGGGGGTTCTCCGGTGGCATG	0.577																																					p.S2161F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6482T	12						.						134.0	136.0	135.0					12																	109696899		2203	4300	6503	108181282	SO:0001583	missense	32	exon46			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.6482C>T	12.37:g.109696899C>T	ENSP00000341044:p.Ser2161Phe	Somatic		Capture	SOLID	Phase_I	108181282	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.193150	0.78902	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027;ENST00000543201	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.07	5.07	0.68467	Acetyl-coenzyme A carboxyltransferase, C-terminal (1);Carboxyl transferase (1);	0.000000	0.85682	D	0.000000	T	0.69387	0.3105	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79410	-0.1815	10	0.87932	D	0	.	19.3488	0.94376	0.0:1.0:0.0:0.0	.	2161	O00763	ACACB_HUMAN	F	2161;2161;2091;1392;827	ENSP00000341044:S2161F;ENSP00000367079:S2161F;ENSP00000367085:S2091F;ENSP00000444075:S827F	ENSP00000341044:S2161F	S	+	2	0	ACACB	108181282	1.000000	0.71417	0.963000	0.40424	0.712000	0.41017	7.669000	0.83911	2.758000	0.94735	0.561000	0.74099	TCC		ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
MED13L	23389	hgsc.bcm.edu	37	12	116401231	116401231	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:116401231T>C	ENST00000281928.3	-	30	6687	c.6481A>G	c.(6481-6483)Acc>Gcc	p.T2161A	RP11-493P1.2_ENST00000549725.1_RNA	NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	2161						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.T2161P(1)|p.T2161A(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TCCGACGTGGTTTTGGAGTCA	0.453																																					p.T2161A												MED13L,lung,NS,Substitution - Missense,0	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.A6481G	12						.						129.0	111.0	117.0					12																	116401231		2203	4300	6503	114885614	SO:0001583	missense	23389	exon30			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.6481A>G	12.37:g.116401231T>C	ENSP00000281928:p.Thr2161Ala	Somatic		Capture	SOLID	Phase_I	114885614	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	T	16.19	3.053165	0.55218	.	.	ENSG00000123066	ENST00000281928	T	0.73789	-0.78	6.17	6.17	0.99709	.	0.049095	0.85682	D	0.000000	T	0.70631	0.3246	N	0.19112	0.55	0.47341	D	0.999392	P	0.48162	0.906	P	0.52343	0.696	T	0.67063	-0.5765	10	0.17369	T	0.5	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	2161	Q71F56	MD13L_HUMAN	A	2161	ENSP00000281928:T2161A	ENSP00000281928:T2161A	T	-	1	0	MED13L	114885614	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	3.018000	0.49625	2.371000	0.80710	0.533000	0.62120	ACC		MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
HNF1A	6927	hgsc.bcm.edu	37	12	121426770	121426770	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:121426770T>C	ENST00000257555.6	+	2	687	c.461T>C	c.(460-462)aTg>aCg	p.M154T	HNF1A_ENST00000543427.1_Missense_Mutation_p.M37T|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000544413.1_Missense_Mutation_p.M154T|HNF1A_ENST00000402929.1_Missense_Mutation_p.M154T|HNF1A_ENST00000541395.1_Missense_Mutation_p.M154T|HNF1A_ENST00000400024.2_Missense_Mutation_p.M154T			P20823	HNF1A_HUMAN	HNF1 homeobox A	154					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.M154T(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GGCACTCCCATGAAGACGCAG	0.612									Hepatic Adenoma, Familial Clustering of																												p.M154T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T461C	12	GRCh37	CM082813|CM082814	HNF1A	M		.						146.0	112.0	124.0					12																	121426770		2203	4300	6503	119911153	SO:0001583	missense	6927	exon2	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.461T>C	12.37:g.121426770T>C	ENSP00000257555:p.Met154Thr	Somatic		Capture	SOLID	Phase_I	119911153	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	ENST00000257555.6	37	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.132290	0.77662	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543027;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D;D	0.99167	-5.51;-5.51;-5.51;-5.51	4.91	4.91	0.64330	Hepatocyte nuclear factor 1, N-terminal (1);Lambda repressor-like, DNA-binding (2);	0.000000	0.85682	D	0.000000	D	0.99146	0.9705	M	0.77486	2.375	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99556	1.0967	10	0.87932	D	0	-18.8909	13.7162	0.62697	0.0:0.0:0.0:1.0	.	154;154;154;154	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	T	154;154;154;154;154;154;37;154;154;154;154;154	ENSP00000257555:M154T;ENSP00000439721:M37T;ENSP00000443112:M154T;ENSP00000438804:M154T	ENSP00000257555:M154T	M	+	2	0	HNF1A	119911153	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.638000	0.83328	1.836000	0.53414	0.433000	0.28618	ATG		HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
OASL	8638	hgsc.bcm.edu	37	12	121476675	121476675	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:121476675G>T	ENST00000257570.5	-	1	370	c.100C>A	c.(100-102)Cta>Ata	p.L34I	OASL_ENST00000339275.5_Missense_Mutation_p.L34I	NM_003733.3	NP_003724.1	Q15646	OASL_HUMAN	2'-5'-oligoadenylate synthetase-like	34				HREWKEEVLDAVR -> TGVEGRGARRCA (in Ref. 2; AAD28541/AAD28542). {ECO:0000305}.	cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|transferase activity (GO:0016740)	p.L34I(1)		NS(1)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACAGCGTCTAGCACCTCTTCC	0.607																																					p.L34I	Colon(192;517 2041 31392 31913 39966)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C100A	12						.						73.0	55.0	61.0					12																	121476675		2203	4300	6503	119961058	SO:0001583	missense	8638	exon1			AF063611	CCDS9211.1, CCDS9212.1, CCDS73536.1	12q24.2	2008-08-05			ENSG00000135114	ENSG00000135114			8090	protein-coding gene	gene with protein product		603281				10087211	Standard	NM_003733		Approved	TRIP14, p59OASL	uc001tzj.2	Q15646	OTTHUMG00000154981	ENST00000257570.5:c.100C>A	12.37:g.121476675G>T	ENSP00000257570:p.Leu34Ile	Somatic		Capture	SOLID	Phase_I	119961058	NM_003733	B2RAZ2|I1YDD2|O75686|Q17R95|Q9Y6K6|Q9Y6K7	Missense_Mutation	SNP	ENST00000257570.5	37	CCDS9211.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.025215	0.54683	.	.	ENSG00000135114	ENST00000257570;ENST00000339275;ENST00000543677	T;T	0.08370	3.1;3.1	5.66	-1.62	0.08372	2-5-oligoadenylate synthetase, N-terminal (1);	1.015390	0.07896	N	0.971861	T	0.09686	0.0238	L	0.54323	1.7	0.09310	N	1	P;P	0.45986	0.866;0.87	P;B	0.45794	0.493;0.391	T	0.24261	-1.0165	10	0.48119	T	0.1	-27.597	2.2317	0.03998	0.1514:0.2363:0.4068:0.2055	.	34;34	Q15646-2;Q15646	.;OASL_HUMAN	I	34;34;26	ENSP00000257570:L34I;ENSP00000341125:L34I	ENSP00000257570:L34I	L	-	1	2	OASL	119961058	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	-0.042000	0.12063	-0.171000	0.10797	0.655000	0.94253	CTA		OASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337875.2	NM_003733	
RHOF	54509	hgsc.bcm.edu	37	12	122219081	122219081	+	Missense_Mutation	SNP	G	G	A	rs375240756		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:122219081G>A	ENST00000267205.2	-	3	872	c.244C>T	c.(244-246)Cgg>Tgg	p.R82W	RHOF_ENST00000537265.1_5'UTR|RHOF_ENST00000537171.1_Missense_Mutation_p.R82W|TMEM120B_ENST00000449592.2_3'UTR|TMEM120B_ENST00000538055.1_Intron	NM_019034.2	NP_061907.2	Q9HBH0	RHOF_HUMAN	ras homolog family member F (in filopodia)	82					actin filament organization (GO:0007015)|GTP catabolic process (GO:0006184)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R82W(1)		large_intestine(1)|lung(1)|ovary(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;4.38e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.223)		GGCCGCAGCCGGTCATAGTCT	0.612																																					p.R82W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C244T	12						.						93.0	89.0	90.0					12																	122219081		2203	4300	6503	120703464	SO:0001583	missense	54509	exon3			AK000254	CCDS9222.1	12q24.31	2013-09-23	2012-02-27	2004-03-24	ENSG00000139725	ENSG00000139725			15703	protein-coding gene	gene with protein product			"""ras homolog gene family, member F (in filopodia)"""	ARHF		11084341	Standard	NM_019034		Approved	FLJ20247, RIF	uc001ubb.3	Q9HBH0	OTTHUMG00000169077	ENST00000267205.2:c.244C>T	12.37:g.122219081G>A	ENSP00000267205:p.Arg82Trp	Somatic		Capture	SOLID	Phase_I	120703464	NM_019034	Q8WVB1|Q9NXH6	Missense_Mutation	SNP	ENST00000267205.2	37	CCDS9222.1	.	.	.	.	.	.	.	.	.	.	G	18.40	3.616094	0.66672	.	.	ENSG00000139725	ENST00000267205;ENST00000535560	T;T	0.78126	-1.15;-1.15	4.9	1.91	0.25777	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90366	0.6985	H	0.97635	4.045	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88200	0.2883	10	0.87932	D	0	.	7.5436	0.27753	0.0756:0.0:0.503:0.4214	.	82;82	Q9HBH0-2;Q9HBH0	.;RHOF_HUMAN	W	82	ENSP00000267205:R82W;ENSP00000440397:R82W	ENSP00000267205:R82W	R	-	1	2	RHOF	120703464	0.989000	0.36119	0.998000	0.56505	0.939000	0.58152	0.111000	0.15458	0.165000	0.19558	-0.266000	0.10368	CGG		RHOF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402165.1		
RSRC2	65117	hgsc.bcm.edu	37	12	122999723	122999723	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:122999723G>A	ENST00000331738.7	-	6	799	c.654C>T	c.(652-654)agC>agT	p.S218S	RSRC2_ENST00000354654.2_Silent_p.S170S|RSRC2_ENST00000392442.2_5'Flank	NM_023012.5	NP_075388.2	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2	218							poly(A) RNA binding (GO:0044822)	p.S218S(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|urinary_tract(2)	24	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		TTGGAGTCCGGCTTAAACTTC	0.388																																					p.S218S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C654T	12						.						219.0	213.0	215.0					12																	122999723		2203	4300	6503	121565676	SO:0001819	synonymous_variant	65117	exon6			AF161432	CCDS31920.1	12q24.31	2007-02-13			ENSG00000111011	ENSG00000111011			30559	protein-coding gene	gene with protein product						17203224	Standard	NM_023012		Approved	FLJ11021	uc001ucr.3	Q7L4I2	OTTHUMG00000167572	ENST00000331738.7:c.654C>T	12.37:g.122999723G>A		Somatic		Capture	SOLID	Phase_I	121565676	NM_023012	Q6N040|Q6NW16|Q9H864	Silent	SNP	ENST00000331738.7	37	CCDS31920.1																																																																																				RSRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395096.3	NM_023012	
KCNA1	3736	hgsc.bcm.edu	37	12	5020755	5020755	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:5020755C>T	ENST00000382545.3	+	2	1318	c.211C>T	c.(211-213)Cgc>Tgc	p.R71C	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	71					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.R71C(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	GAAACGCATGCGCTACTTCGA	0.632																																					p.R71C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C211T	12						.						64.0	65.0	65.0					12																	5020755		2203	4300	6503	4891016	SO:0001583	missense	3736	exon2			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.211C>T	12.37:g.5020755C>T	ENSP00000371985:p.Arg71Cys	Somatic		Capture	SOLID	Phase_I	4891016	NM_000217	A6NM83|Q3MIQ9	Missense_Mutation	SNP	ENST00000382545.3	37	CCDS8535.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.319702	0.60524	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	T	0.77358	-1.09	4.34	4.34	0.51931	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.88295	0.6398	M	0.88310	2.945	0.80722	D	1	D	0.65815	0.995	P	0.59948	0.866	D	0.90994	0.4837	10	0.87932	D	0	.	16.3898	0.83531	0.0:1.0:0.0:0.0	.	71	Q09470	KCNA1_HUMAN	C	71	ENSP00000371985:R71C	ENSP00000228858:R71C	R	+	1	0	KCNA1	4891016	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.003000	0.49505	2.410000	0.81850	0.650000	0.86243	CGC		KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217	
PDE3A	5139	hgsc.bcm.edu	37	12	20766564	20766564	+	Missense_Mutation	SNP	C	C	T	rs143792143		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:20766564C>T	ENST00000359062.3	+	3	1239	c.1199C>T	c.(1198-1200)tCg>tTg	p.S400L	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	400					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)	p.S400L(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	CCCGTCACTTCGCTCAGTGAA	0.488																																					p.S400L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1199T	12						.	C	LEU/SER	0,4406		0,0,2203	88.0	87.0	87.0		1199	4.0	0.9	12	dbSNP_134	87	2,8598	2.2+/-6.3	0,2,4298	no	missense	PDE3A	NM_000921.4	145	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	400/1142	20766564	2,13004	2203	4300	6503	20657831	SO:0001583	missense	5139	exon3				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1199C>T	12.37:g.20766564C>T	ENSP00000351957:p.Ser400Leu	Somatic		Capture	SOLID	Phase_I	20657831	NM_000921	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.012984	0.35511	0.0	2.33E-4	ENSG00000172572	ENST00000359062	T	0.62498	0.02	5.87	4.02	0.46733	.	2.213480	0.02024	N	0.048046	T	0.55577	0.1929	L	0.39898	1.24	0.31020	N	0.718196	B	0.33494	0.414	B	0.19666	0.026	T	0.52102	-0.8620	10	0.48119	T	0.1	.	11.7157	0.51653	0.0:0.8083:0.1252:0.0665	.	400	Q14432	PDE3A_HUMAN	L	400	ENSP00000351957:S400L	ENSP00000351957:S400L	S	+	2	0	PDE3A	20657831	0.856000	0.29760	0.907000	0.35723	0.492000	0.33523	1.545000	0.36169	1.610000	0.50200	0.655000	0.94253	TCG		PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
SLCO1C1	53919	hgsc.bcm.edu	37	12	20864373	20864373	+	Missense_Mutation	SNP	C	C	T	rs181627657		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:20864373C>T	ENST00000266509.2	+	5	826	c.458C>T	c.(457-459)cCg>cTg	p.P153L	SLCO1C1_ENST00000545604.1_Missense_Mutation_p.P153L|SLCO1C1_ENST00000381552.1_Missense_Mutation_p.P153L|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.P153L|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.P35L	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	153					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.P153L(1)		NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	AGCATCTCTCCGTGTCTCCTA	0.353													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19515	0.0		0.0	False		,,,				2504	0.0				p.P153L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C458T	12						.						140.0	135.0	137.0					12																	20864373		2203	4300	6503	20755640	SO:0001583	missense	53919	exon5			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.458C>T	12.37:g.20864373C>T	ENSP00000266509:p.Pro153Leu	Somatic		Capture	SOLID	Phase_I	20755640	NM_017435	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	ENST00000266509.2	37	CCDS8683.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	10.50	1.367369	0.24771	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.56776	1.16;0.44;1.16;1.16;1.16	4.41	4.41	0.53225	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.229512	0.26026	N	0.026784	T	0.49440	0.1557	N	0.04705	-0.18	0.58432	D	0.999999	D;D;B;B	0.89917	1.0;1.0;0.361;0.201	D;D;B;B	0.74674	0.973;0.984;0.252;0.076	T	0.49925	-0.8887	10	0.19590	T	0.45	.	15.3566	0.74431	0.0:1.0:0.0:0.0	.	35;153;153;153	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	L	153;153;153;153;35	ENSP00000444149:P153L;ENSP00000438665:P153L;ENSP00000266509:P153L;ENSP00000370964:P153L;ENSP00000444527:P35L	ENSP00000266509:P153L	P	+	2	0	SLCO1C1	20755640	1.000000	0.71417	0.979000	0.43373	0.990000	0.78478	3.491000	0.53252	2.270000	0.75569	0.655000	0.94253	CCG		SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435	
COL2A1	1280	hgsc.bcm.edu	37	12	48391963	48391963	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:48391963C>A	ENST00000380518.3	-	4	495	c.331G>T	c.(331-333)Gac>Tac	p.D111Y	COL2A1_ENST00000337299.6_Missense_Mutation_p.D42Y	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	111					axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.D111Y(1)|p.D42Y(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	TCCTTGATGTCTCCAGGTTCT	0.483																																					p.D42Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G124T	12						.						160.0	153.0	155.0					12																	48391963		2203	4300	6503	46678230	SO:0001583	missense	1280	exon3			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.331G>T	12.37:g.48391963C>A	ENSP00000369889:p.Asp111Tyr	Somatic		Capture	SOLID	Phase_I	46678230	NM_033150	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	37	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461995	0.63513	.	.	ENSG00000139219	ENST00000380518;ENST00000337299	D;D	0.93712	-3.27;-3.27	5.04	5.04	0.67666	.	.	.	.	.	D	0.93321	0.7871	L	0.49640	1.575	0.80722	D	1	D;D	0.61697	0.99;0.984	P;P	0.57548	0.823;0.75	D	0.90186	0.4246	9	0.02654	T	1	.	17.5346	0.87825	0.0:1.0:0.0:0.0	.	42;111	P02458-1;P02458	.;CO2A1_HUMAN	Y	111;42	ENSP00000369889:D111Y;ENSP00000338213:D42Y	ENSP00000338213:D42Y	D	-	1	0	COL2A1	46678230	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.385000	0.79763	2.531000	0.85337	0.555000	0.69702	GAC		COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	
KCNH3	23416	hgsc.bcm.edu	37	12	49937151	49937151	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:49937151G>A	ENST00000257981.6	+	5	933	c.673G>A	c.(673-675)Gcc>Acc	p.A225T	KCNH3_ENST00000550434.1_3'UTR	NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	225					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.A225T(1)		NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						GGCACTGAGAGCCACCTGGGA	0.602																																					p.A225T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G673A	12						.						53.0	46.0	48.0					12																	49937151		2203	4300	6503	48223418	SO:0001583	missense	23416	exon5			AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.673G>A	12.37:g.49937151G>A	ENSP00000257981:p.Ala225Thr	Somatic		Capture	SOLID	Phase_I	48223418	NM_012284	Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	37	CCDS8786.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.403020	0.83230	.	.	ENSG00000135519	ENST00000257981	D	0.97404	-4.37	4.56	4.56	0.56223	.	0.000000	0.46758	D	0.000276	D	0.94231	0.8148	L	0.33189	0.99	0.49798	D	0.999827	B	0.29378	0.243	B	0.33846	0.171	D	0.92291	0.5841	10	0.27785	T	0.31	.	15.2394	0.73455	0.0:0.0:1.0:0.0	.	225	Q9ULD8	KCNH3_HUMAN	T	225	ENSP00000257981:A225T	ENSP00000257981:A225T	A	+	1	0	KCNH3	48223418	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.657000	0.98554	2.559000	0.86315	0.655000	0.94253	GCC		KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	NM_012284	
KRT75	9119	hgsc.bcm.edu	37	12	52818351	52818351	+	Missense_Mutation	SNP	C	C	T	rs551243973		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:52818351C>T	ENST00000252245.5	-	9	1826	c.1606G>A	c.(1606-1608)Gtc>Atc	p.V536I	RP11-1020M18.10_ENST00000548135.1_RNA	NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	536	Tail.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.V536I(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		ACAAACTTGACGCTAGAACCA	0.597													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18502	0.0		0.0	False		,,,				2504	0.0				p.V536I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1606A	12						.						202.0	197.0	198.0					12																	52818351		2203	4300	6503	51104618	SO:0001583	missense	9119	exon9			Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.1606G>A	12.37:g.52818351C>T	ENSP00000252245:p.Val536Ile	Somatic		Capture	SOLID	Phase_I	51104618	NM_004693	B4DQU4|Q9NSA9	Missense_Mutation	SNP	ENST00000252245.5	37	CCDS8827.1	.	.	.	.	.	.	.	.	.	.	C	3.803	-0.041239	0.07452	.	.	ENSG00000170454	ENST00000252245	T	0.81163	-1.46	4.83	-1.48	0.08745	.	0.886311	0.09380	N	0.810056	T	0.53417	0.1795	N	0.04063	-0.285	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.34800	-0.9814	10	0.15066	T	0.55	.	4.2277	0.10589	0.1621:0.3623:0.0:0.4756	.	536	O95678	K2C75_HUMAN	I	536	ENSP00000252245:V536I	ENSP00000252245:V536I	V	-	1	0	KRT75	51104618	0.001000	0.12720	0.068000	0.19968	0.467000	0.32768	-0.635000	0.05471	-0.532000	0.06332	0.561000	0.74099	GTC		KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404968.1	NM_004693	
ITGA5	3678	hgsc.bcm.edu	37	12	54796792	54796792	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:54796792G>A	ENST00000293379.4	-	19	2218	c.1957C>T	c.(1957-1959)Cct>Tct	p.P653S	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	653					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)	p.P653S(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						TGCAGGTCAGGCACACAGATG	0.547																																					p.P653S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1957T	12						.						112.0	97.0	102.0					12																	54796792		2203	4300	6503	53083059	SO:0001583	missense	3678	exon19				CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.1957C>T	12.37:g.54796792G>A	ENSP00000293379:p.Pro653Ser	Somatic		Capture	SOLID	Phase_I	53083059	NM_002205	Q96HA5	Missense_Mutation	SNP	ENST00000293379.4	37	CCDS8880.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.735898	0.89482	.	.	ENSG00000161638	ENST00000293379	T	0.40225	1.04	4.94	4.94	0.65067	Integrin alpha-2 (1);	0.000000	0.85682	D	0.000000	T	0.68467	0.3004	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74520	-0.3638	10	0.87932	D	0	.	16.0315	0.80582	0.0:0.0:1.0:0.0	.	653	P08648	ITA5_HUMAN	S	653	ENSP00000293379:P653S	ENSP00000293379:P653S	P	-	1	0	ITGA5	53083059	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.405000	0.97313	2.478000	0.83669	0.555000	0.69702	CCT		ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1		
MMP19	4327	hgsc.bcm.edu	37	12	56232429	56232429	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:56232429G>T	ENST00000322569.4	-	6	947	c.856C>A	c.(856-858)Cca>Aca	p.P286T	MMP19_ENST00000547487.1_5'Flank|MMP19_ENST00000409200.3_Missense_Mutation_p.P204T|TMEM198B_ENST00000478241.1_RNA|MMP19_ENST00000394182.1_5'Flank|MMP19_ENST00000548629.1_Missense_Mutation_p.P263T	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19	286					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P286T(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	CAAGGGTCTGGCATGGGACTG	0.592																																					p.P286T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C856A	12						.						130.0	107.0	115.0					12																	56232429		2203	4300	6503	54518696	SO:0001583	missense	4327	exon6			X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216	ENST00000322569.4:c.856C>A	12.37:g.56232429G>T	ENSP00000313437:p.Pro286Thr	Somatic		Capture	SOLID	Phase_I	54518696	NM_002429	B4E030|O15278|O95606|Q99580	Missense_Mutation	SNP	ENST00000322569.4	37	CCDS8895.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.561266	0.86335	.	.	ENSG00000123342	ENST00000322569;ENST00000548629;ENST00000409200	T;T;T	0.66460	2.9;2.9;-0.21	5.71	5.71	0.89125	Hemopexin/matrixin (2);	0.052509	0.85682	D	0.000000	T	0.81997	0.4941	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74674	0.984;0.976	T	0.79921	-0.1599	10	0.31617	T	0.26	.	17.3591	0.87345	0.0:0.0:1.0:0.0	.	204;286	B4E030;Q99542	.;MMP19_HUMAN	T	286;263;204	ENSP00000313437:P286T;ENSP00000446979:P263T;ENSP00000386625:P204T	ENSP00000313437:P286T	P	-	1	0	MMP19	54518696	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.017000	0.88712	2.699000	0.92147	0.514000	0.50259	CCA		MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408023.1	NM_002429	
ESYT1	23344	hgsc.bcm.edu	37	12	56528164	56528164	+	Silent	SNP	G	G	A	rs79645834	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:56528164G>A	ENST00000394048.5	+	15	1848	c.1584G>A	c.(1582-1584)gcG>gcA	p.A528A	ESYT1_ENST00000541590.1_Silent_p.A538A|ESYT1_ENST00000267113.4_Silent_p.A538A	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	528	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.A528A(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						GGGAGGAAGCGTTCCGGTTCT	0.507													G|||	23	0.00459265	0.0008	0.0014	5008	,	,		19761	0.0		0.0189	False		,,,				2504	0.002				p.A528A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1584A	12						.	G	,	9,4397	16.8+/-37.8	0,9,2194	183.0	163.0	170.0		1614,1584	-3.4	1.0	12	dbSNP_131	170	101,8499	55.6+/-116.7	0,101,4199	no	coding-synonymous,coding-synonymous	ESYT1	NM_001184796.1,NM_015292.2	,	0,110,6393	AA,AG,GG		1.1744,0.2043,0.8458	,	538/1115,528/1105	56528164	110,12896	2203	4300	6503	54814431	SO:0001819	synonymous_variant	23344	exon15			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.1584G>A	12.37:g.56528164G>A		Somatic		Capture	SOLID	Phase_I	54814431	NM_015292	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Silent	SNP	ENST00000394048.5	37	CCDS8904.1																																																																																				ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292	
KIF5A	3798	hgsc.bcm.edu	37	12	57960978	57960978	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:57960978C>T	ENST00000455537.2	+	7	845	c.571C>T	c.(571-573)Cgt>Tgt	p.R191C	KIF5A_ENST00000286452.5_Missense_Mutation_p.R102C	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	191	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.|Microtubule-binding.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)	p.R191C(1)		breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						GAAATCAAATCGTCATGTGGC	0.507																																					p.R191C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C571T	12						.						163.0	153.0	156.0					12																	57960978		2203	4300	6503	56247245	SO:0001583	missense	3798	exon7			U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.571C>T	12.37:g.57960978C>T	ENSP00000408979:p.Arg191Cys	Somatic		Capture	SOLID	Phase_I	56247245	NM_004984	A6H8M5|Q4LE26	Missense_Mutation	SNP	ENST00000455537.2	37	CCDS8945.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987199	0.74589	.	.	ENSG00000155980	ENST00000455537;ENST00000286452	D;D	0.82433	-1.61;-1.61	4.48	3.51	0.40186	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.95332	0.8485	H	0.99906	4.925	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96360	0.9265	10	0.87932	D	0	.	13.4322	0.61062	0.1575:0.8425:0.0:0.0	.	102;191	B7Z2M7;Q12840	.;KIF5A_HUMAN	C	191;102	ENSP00000408979:R191C;ENSP00000286452:R102C	ENSP00000286452:R102C	R	+	1	0	KIF5A	56247245	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	2.710000	0.47169	2.481000	0.83766	0.453000	0.30009	CGT		KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984	
LRIG3	121227	hgsc.bcm.edu	37	12	59276712	59276712	+	Silent	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:59276712G>T	ENST00000320743.3	-	12	1705	c.1419C>A	c.(1417-1419)gcC>gcA	p.A473A	LRIG3_ENST00000379141.4_Silent_p.A413A	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	473	LRRCT.				otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A473A(1)	LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			GCTGAGGATGGGCACAACTGG	0.428			T	ROS1	NSCLC																																p.A473A			Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1419A	12						.						94.0	87.0	89.0					12																	59276712		2203	4300	6503	57562979	SO:0001819	synonymous_variant	121227	exon12			AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.1419C>A	12.37:g.59276712G>T		Somatic		Capture	SOLID	Phase_I	57562979	NM_153377	Q6UXL7|Q8NC72	Silent	SNP	ENST00000320743.3	37	CCDS8960.1																																																																																				LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
USP15	9958	hgsc.bcm.edu	37	12	62786926	62786926	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:62786926T>G	ENST00000280377.5	+	19	2572	c.2514T>G	c.(2512-2514)ttT>ttG	p.F838L	USP15_ENST00000353364.3_Missense_Mutation_p.F809L|USP15_ENST00000393654.3_Missense_Mutation_p.F813L	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	838	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.F809L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		TCAAGCGATTTTCTTACAGTC	0.368																																					p.F809L	Melanoma(181;615 2041 39364 49691 50001)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2427G	12						.						148.0	142.0	144.0					12																	62786926		2203	4300	6503	61073193	SO:0001583	missense	9958	exon18			AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.2514T>G	12.37:g.62786926T>G	ENSP00000280377:p.Phe838Leu	Somatic		Capture	SOLID	Phase_I	61073193	NM_006313	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Missense_Mutation	SNP	ENST00000280377.5	37	CCDS58251.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.471634	0.84533	.	.	ENSG00000135655	ENST00000353364;ENST00000280377;ENST00000393654;ENST00000549415	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.86	3.52	0.40303	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.049499	0.85682	D	0.000000	T	0.68357	0.2992	M	0.92880	3.355	0.50813	D	0.99989	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.70096	-0.4966	9	.	.	.	-13.3514	8.3069	0.32047	0.0:0.2135:0.0:0.7865	.	838;809	Q9Y4E8;Q9Y4E8-2	UBP15_HUMAN;.	L	809;838;813;40	ENSP00000258123:F809L;ENSP00000280377:F838L;ENSP00000377264:F813L;ENSP00000448372:F40L	.	F	+	3	2	USP15	61073193	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.213000	0.42844	0.489000	0.27749	0.533000	0.62120	TTT		USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407831.2	NM_006313	
TMTC2	160335	hgsc.bcm.edu	37	12	83324269	83324269	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:83324269G>A	ENST00000321196.3	+	4	2250	c.1543G>A	c.(1543-1545)Gcc>Acc	p.A515T	TMTC2_ENST00000548305.1_Missense_Mutation_p.A515T|TMTC2_ENST00000549919.1_Missense_Mutation_p.A509T	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	515					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.A515T(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						AGCTGAAAGCGCCTATAGAAA	0.413																																					p.A515T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1543A	12						.						142.0	130.0	134.0					12																	83324269		2203	4300	6503	81848400	SO:0001583	missense	160335	exon4			AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.1543G>A	12.37:g.83324269G>A	ENSP00000322300:p.Ala515Thr	Somatic		Capture	SOLID	Phase_I	81848400	NM_152588	B2RCU7|Q8N2K8	Missense_Mutation	SNP	ENST00000321196.3	37	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	G	33	5.264473	0.95399	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919;ENST00000546590	T;T;T	0.78364	-1.17;-0.12;-1.17	5.85	5.85	0.93711	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.094831	0.64402	D	0.000001	D	0.84451	0.5475	L	0.55743	1.74	0.80722	D	1	D;D;D	0.69078	0.993;0.963;0.997	P;P;P	0.62435	0.822;0.642;0.902	T	0.79752	-0.1671	10	0.23302	T	0.38	-5.4433	20.1766	0.98178	0.0:0.0:1.0:0.0	.	515;270;515	Q8N394;F8VRQ2;F8VSH2	TMTC2_HUMAN;.;.	T	515;515;509;270	ENSP00000322300:A515T;ENSP00000448292:A515T;ENSP00000447609:A509T	ENSP00000322300:A515T	A	+	1	0	TMTC2	81848400	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.318000	0.96334	2.772000	0.95346	0.655000	0.94253	GCC		TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588	
EP400	57634	hgsc.bcm.edu	37	12	132498042	132498042	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr12:132498042C>T	ENST00000333577.4	+	19	3836	c.3727C>T	c.(3727-3729)Cgt>Tgt	p.R1243C	EP400_ENST00000332482.4_Missense_Mutation_p.R1170C|EP400_ENST00000389562.2_Missense_Mutation_p.R1206C|EP400_ENST00000330386.6_Missense_Mutation_p.R1207C|EP400_ENST00000389561.2_Missense_Mutation_p.R1207C			Q96L91	EP400_HUMAN	E1A binding protein p400	1243	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Interactions with RUVBL1 and RUVBL2.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.R1206C(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CAGCCAACAACGTCTGCTTCT	0.562																																					p.R1206C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3616T	12						.						84.0	84.0	84.0					12																	132498042		2203	4300	6503	131063995	SO:0001583	missense	57634	exon18			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.3727C>T	12.37:g.132498042C>T	ENSP00000333602:p.Arg1243Cys	Somatic		Capture	SOLID	Phase_I	131063995	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	C	8.744	0.919772	0.17982	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296;ENST00000542457	D;D;D;D;D	0.95622	-3.76;-3.76;-3.76;-3.76;-3.76	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.98242	0.9418	M	0.92459	3.31	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.69824	0.966;0.966;0.966	D	0.99364	1.0918	10	0.72032	D	0.01	.	18.4948	0.90861	0.0:1.0:0.0:0.0	.	1207;1207;1206	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	C	1243;1207;1206;1170;1207;1207;1207	ENSP00000333602:R1243C;ENSP00000374212:R1207C;ENSP00000374213:R1206C;ENSP00000331737:R1170C;ENSP00000330620:R1207C	ENSP00000330620:R1207C	R	+	1	0	EP400	131063995	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	4.734000	0.62043	2.347000	0.79759	0.643000	0.83706	CGT		EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
NPAP1	23742	hgsc.bcm.edu	37	15	24923035	24923035	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:24923035C>A	ENST00000329468.2	+	1	2495	c.2021C>A	c.(2020-2022)cCt>cAt	p.P674H		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	674					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P674H(1)									CCCATCATTCCTCCTCCAGAC	0.517																																					p.P674H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2021A	15						.						180.0	162.0	168.0					15																	24923035		2203	4300	6503	22474128	SO:0001583	missense	23742	exon1			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2021C>A	15.37:g.24923035C>A	ENSP00000333735:p.Pro674His	Somatic		Capture	SOLID	Phase_I	22474128	NM_018958		Missense_Mutation	SNP	ENST00000329468.2	37	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	7.206	0.594395	0.13875	.	.	ENSG00000185823	ENST00000329468	T	0.07327	3.2	1.88	-3.77	0.04346	.	3.426830	0.00918	N	0.002547	T	0.04588	0.0125	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.39231	-0.9624	10	0.66056	D	0.02	.	4.6157	0.12424	0.5615:0.2445:0.194:0.0	.	674	Q9NZP6	CO002_HUMAN	H	674	ENSP00000333735:P674H	ENSP00000333735:P674H	P	+	2	0	C15orf2	22474128	0.001000	0.12720	0.000000	0.03702	0.192000	0.23643	0.311000	0.19380	-1.124000	0.02936	0.205000	0.17691	CCT		NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
HERC2	8924	hgsc.bcm.edu	37	15	28419674	28419674	+	Silent	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:28419674G>T	ENST00000261609.7	-	65	10032	c.9924C>A	c.(9922-9924)ggC>ggA	p.G3308G		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.G3308G(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TGATCTTCTGGCCTTCTAAGC	0.597																																					p.G3308G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C9924A	15						.						104.0	70.0	81.0					15																	28419674		2203	4300	6503	26093269	SO:0001819	synonymous_variant	8924	exon65			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.9924C>A	15.37:g.28419674G>T		Somatic		Capture	SOLID	Phase_I	26093269	NM_004667		Silent	SNP	ENST00000261609.7	37	CCDS10021.1																																																																																				HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
CGNL1	84952	hgsc.bcm.edu	37	15	57744481	57744481	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:57744481T>G	ENST00000281282.5	+	6	2126	c.2048T>G	c.(2047-2049)cTg>cGg	p.L683R		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	683						myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)	p.L683R(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		CGGAAGAATCTGGAGGAGTAA	0.493																																					p.L683R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2048G	15						.						62.0	62.0	62.0					15																	57744481		2192	4292	6484	55531773	SO:0001583	missense	84952	exon6			AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.2048T>G	15.37:g.57744481T>G	ENSP00000281282:p.Leu683Arg	Somatic		Capture	SOLID	Phase_I	55531773	NM_032866	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	ENST00000281282.5	37	CCDS10161.1	.	.	.	.	.	.	.	.	.	.	T	17.49	3.401489	0.62288	.	.	ENSG00000128849	ENST00000281282	T	0.39787	1.06	5.29	5.29	0.74685	.	0.000000	0.43110	D	0.000618	T	0.44973	0.1319	M	0.69823	2.125	0.42729	D	0.993709	B	0.28998	0.23	B	0.27715	0.082	T	0.44847	-0.9301	10	0.45353	T	0.12	-20.7169	15.5072	0.75750	0.0:0.0:0.0:1.0	.	683	Q0VF96	CGNL1_HUMAN	R	683	ENSP00000281282:L683R	ENSP00000281282:L683R	L	+	2	0	CGNL1	55531773	1.000000	0.71417	0.975000	0.42487	0.540000	0.34992	6.011000	0.70760	2.102000	0.63906	0.460000	0.39030	CTG		CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866	
TLN2	83660	hgsc.bcm.edu	37	15	62967499	62967499	+	Silent	SNP	C	C	T	rs138406599	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:62967499C>T	ENST00000561311.1	+	10	1166	c.936C>T	c.(934-936)ggC>ggT	p.G312G	TLN2_ENST00000306829.6_Silent_p.G312G			Q9Y4G6	TLN2_HUMAN	talin 2	312	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with PIP5K1C. {ECO:0000250}.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.G312G(1)		NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GCACATATGGCGTGTCCTTCT	0.502													C|||	9	0.00179712	0.0008	0.0014	5008	,	,		23571	0.0069		0.0	False		,,,				2504	0.0				p.G312G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C936T	15						.	C		1,4405	2.1+/-5.4	0,1,2202	174.0	126.0	142.0		936	-11.9	0.1	15	dbSNP_134	142	0,8600		0,0,4300	no	coding-synonymous	TLN2	NM_015059.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		312/2543	62967499	1,13005	2203	4300	6503	60754791	SO:0001819	synonymous_variant	83660	exon8			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.936C>T	15.37:g.62967499C>T		Somatic		Capture	SOLID	Phase_I	60754791	NM_015059	A6NLB8	Silent	SNP	ENST00000561311.1	37	CCDS32261.1																																																																																				TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
IGDCC4	57722	hgsc.bcm.edu	37	15	65682648	65682648	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:65682648C>T	ENST00000352385.2	-	13	2462	c.2253G>A	c.(2251-2253)ctG>ctA	p.L751L		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	751						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L751L(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GGGCTGGAGGCAGGGGTGGTC	0.488																																					p.L751L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2253A	15						.						74.0	63.0	67.0					15																	65682648		2201	4299	6500	63469701	SO:0001819	synonymous_variant	57722	exon13				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.2253G>A	15.37:g.65682648C>T		Somatic		Capture	SOLID	Phase_I	63469701	NM_020962	Q9HCE4	Silent	SNP	ENST00000352385.2	37	CCDS10206.1																																																																																				IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
MEGF11	84465	hgsc.bcm.edu	37	15	66223173	66223173	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:66223173T>C	ENST00000409699.2	-	11	1568	c.1396A>G	c.(1396-1398)Acc>Gcc	p.T466A	MEGF11_ENST00000360698.4_Missense_Mutation_p.T466A|MEGF11_ENST00000288745.3_Missense_Mutation_p.T391A|MEGF11_ENST00000395614.1_5'UTR|MEGF11_ENST00000395625.2_Missense_Mutation_p.T391A|MEGF11_ENST00000422354.1_Missense_Mutation_p.T466A			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	466	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T391A(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						TCCTTGCAGGTACAGGAGCCA	0.587																																					p.T466A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1396G	15						.						137.0	105.0	116.0					15																	66223173		2201	4299	6500	64010227	SO:0001583	missense	84465	exon11			AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.1396A>G	15.37:g.66223173T>C	ENSP00000386908:p.Thr466Ala	Somatic		Capture	SOLID	Phase_I	64010227	NM_032445	Q17R86|Q6UXS5|Q8ND91|Q96KG6	Missense_Mutation	SNP	ENST00000409699.2	37	CCDS10213.2	.	.	.	.	.	.	.	.	.	.	T	11.27	1.590367	0.28357	.	.	ENSG00000157890	ENST00000409699;ENST00000288745;ENST00000422354;ENST00000395625;ENST00000360698;ENST00000455812	T;T;T;T;T;T	0.32515	1.45;2.6;1.45;2.6;2.6;1.45	5.13	2.86	0.33363	EGF-like, laminin (2);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.163209	0.28527	U	0.015024	T	0.14570	0.0352	N	0.17901	0.54	0.32652	N	0.519192	B;B	0.11235	0.004;0.003	B;B	0.17979	0.02;0.003	T	0.16012	-1.0417	10	0.13108	T	0.6	.	3.4776	0.07590	0.228:0.2347:0.0:0.5374	.	466;391	A6BM72;A6BM72-2	MEG11_HUMAN;.	A	466;391;466;391;466;170	ENSP00000386908:T466A;ENSP00000288745:T391A;ENSP00000414475:T466A;ENSP00000378987:T391A;ENSP00000353919:T466A;ENSP00000401400:T170A	ENSP00000288745:T391A	T	-	1	0	MEGF11	64010227	0.570000	0.26651	1.000000	0.80357	0.972000	0.66771	-0.013000	0.12678	0.805000	0.34159	0.459000	0.35465	ACC		MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329307.2	NM_032445	
MYO9A	4649	hgsc.bcm.edu	37	15	72192145	72192145	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:72192145G>A	ENST00000356056.5	-	24	3825	c.3353C>T	c.(3352-3354)gCt>gTt	p.A1118V	MYO9A_ENST00000566885.1_Missense_Mutation_p.A738V|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000444904.1_Missense_Mutation_p.A1099V|MYO9A_ENST00000424560.1_Missense_Mutation_p.A1118V|MYO9A_ENST00000564571.1_Missense_Mutation_p.A1118V	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1118	IQ 4. {ECO:0000255|PROSITE- ProRule:PRU00116}.|Neck or regulatory domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)	p.A1118V(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GCAAATAGCAGCCATGTGCCT	0.453																																					p.A1118V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3353T	15						.						83.0	78.0	80.0					15																	72192145		2199	4297	6496	69979199	SO:0001583	missense	4649	exon24			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.3353C>T	15.37:g.72192145G>A	ENSP00000348349:p.Ala1118Val	Somatic		Capture	SOLID	Phase_I	69979199	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080259	0.76528	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904;ENST00000261864	T;T;T	0.77098	-1.07;-0.9;-0.9	5.51	5.51	0.81932	.	.	.	.	.	D	0.90147	0.6921	M	0.86502	2.82	0.80722	D	1	D;P;D	0.89917	1.0;0.534;1.0	D;B;D	0.97110	0.999;0.373;1.0	D	0.90904	0.4771	9	0.66056	D	0.02	.	19.7815	0.96417	0.0:0.0:1.0:0.0	.	1099;1099;1118	B2RTY4-2;B7WP69;B2RTY4	.;.;MYO9A_HUMAN	V	1118;1118;1099;1099	ENSP00000348349:A1118V;ENSP00000399162:A1118V;ENSP00000398250:A1099V	ENSP00000261864:A1099V	A	-	2	0	MYO9A	69979199	1.000000	0.71417	0.928000	0.36995	0.100000	0.18952	8.592000	0.90828	2.746000	0.94184	0.655000	0.94253	GCT		MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
MYO9A	4649	hgsc.bcm.edu	37	15	72300228	72300228	+	Missense_Mutation	SNP	C	C	T	rs377467034		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:72300228C>T	ENST00000356056.5	-	8	1791	c.1319G>A	c.(1318-1320)cGg>cAg	p.R440Q	MYO9A_ENST00000566885.1_Missense_Mutation_p.R35Q|RP11-390D11.1_ENST00000568391.1_RNA|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000444904.1_Missense_Mutation_p.R421Q|MYO9A_ENST00000424560.1_Missense_Mutation_p.R440Q|MYO9A_ENST00000564571.1_Missense_Mutation_p.R440Q	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	440	Myosin motor.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)	p.R440L(1)|p.R440Q(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GGAGTCATCCCGGTATGTCTT	0.343													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16596	0.0		0.0	False		,,,				2504	0.0				p.R440Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1319A	15						.	C	GLN/ARG	0,4398		0,0,2199	130.0	129.0	129.0		1319	4.2	1.0	15		129	1,8593	1.2+/-3.3	0,1,4296	no	missense	MYO9A	NM_006901.2	43	0,1,6495	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	440/2549	72300228	1,12991	2199	4297	6496	70087282	SO:0001583	missense	4649	exon8			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.1319G>A	15.37:g.72300228C>T	ENSP00000348349:p.Arg440Gln	Somatic		Capture	SOLID	Phase_I	70087282	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	C	32	5.116431	0.94385	0.0	1.16E-4	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904;ENST00000261864;ENST00000446448	D;D;D	0.86769	-2.17;-2.17;-2.17	5.17	4.23	0.50019	Myosin head, motor domain (2);	.	.	.	.	D	0.91147	0.7212	L	0.53729	1.69	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.999;0.927;0.976;0.98	D	0.90131	0.4206	9	0.36615	T	0.2	.	14.9153	0.70792	0.1447:0.8553:0.0:0.0	.	421;440;421;440	B2RTY4-2;B2RTY4-3;B7WP69;B2RTY4	.;.;.;MYO9A_HUMAN	Q	440;440;421;421;440	ENSP00000348349:R440Q;ENSP00000399162:R440Q;ENSP00000398250:R421Q	ENSP00000261864:R421Q	R	-	2	0	MYO9A	70087282	1.000000	0.71417	0.978000	0.43139	0.987000	0.75469	7.427000	0.80284	1.267000	0.44247	0.563000	0.77884	CGG		MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
NPTN	27020	hgsc.bcm.edu	37	15	73889372	73889372	+	Missense_Mutation	SNP	C	C	T	rs201731394		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:73889372C>T	ENST00000345330.4	-	2	627	c.430G>A	c.(430-432)Gtc>Atc	p.V144I	NPTN_ENST00000542234.1_Intron|NPTN_ENST00000564551.1_Intron|NPTN_ENST00000287226.8_Missense_Mutation_p.V144I|NPTN_ENST00000351217.6_Intron|NPTN_ENST00000563691.1_Missense_Mutation_p.V144I|NPTN_ENST00000562924.1_Intron|NPTN_ENST00000545878.1_Missense_Mutation_p.V144I	NM_001161363.1|NM_012428.3	NP_001154835.1|NP_036560.1	Q9Y639	NPTN_HUMAN	neuroplastin	144					homophilic cell adhesion (GO:0007156)|long-term synaptic potentiation (GO:0060291)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)	cell adhesion molecule binding (GO:0050839)|type 1 fibroblast growth factor receptor binding (GO:0005105)	p.V144I(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	13						CTCTGAAGGACGCTTATGGTG	0.537																																					p.V144I	Pancreas(101;1519 1568 9459 19537 41286)|Esophageal Squamous(143;1278 1787 35254 36835 44843)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G430A	15						.	C	ILE/VAL,,ILE/VAL,	0,4396		0,0,2198	91.0	43.0	60.0		430,,430,	4.8	1.0	15		60	1,8593	1.2+/-3.3	0,1,4296	no	missense,intron,missense,intron	NPTN	NM_001161363.1,NM_001161364.1,NM_012428.3,NM_017455.3	29,,29,	0,1,6494	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,,probably-damaging,	144/395,,144/399,	73889372	1,12989	2198	4297	6495	71676425	SO:0001583	missense	27020	exon2			AF035287	CCDS10249.1, CCDS10250.1, CCDS58379.1, CCDS58380.1	15q24.1	2013-01-29	2006-02-22	2006-02-22	ENSG00000156642	ENSG00000156642		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17867	protein-coding gene	gene with protein product		612820	"""stromal cell derived factor receptor 1"""	SDFR1		8619474, 9110174	Standard	NM_012428		Approved	SDR1, GP55, GP65, np65, np55	uc002avs.3	Q9Y639	OTTHUMG00000137586	ENST00000345330.4:c.430G>A	15.37:g.73889372C>T	ENSP00000290401:p.Val144Ile	Somatic		Capture	SOLID	Phase_I	71676425	NM_001161363	B2RAL7|B7Z4D3|B7ZLL2|Q17R52|Q59EJ9|Q6NVX7|Q9Y640	Missense_Mutation	SNP	ENST00000345330.4	37	CCDS10249.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.459103	0.43634	0.0	1.16E-4	ENSG00000156642	ENST00000345330;ENST00000545878;ENST00000287226	T;T;T	0.65549	0.0;0.07;-0.16	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.63046	0.2478	L	0.61387	1.9	0.80722	D	1	B;B	0.21309	0.054;0.032	B;B	0.20184	0.028;0.013	T	0.63972	-0.6516	10	0.72032	D	0.01	.	18.5078	0.90904	0.0:1.0:0.0:0.0	.	144;144	Q9Y639-5;Q9Y639	.;NPTN_HUMAN	I	144	ENSP00000290401:V144I;ENSP00000444548:V144I;ENSP00000287226:V144I	ENSP00000287226:V144I	V	-	1	0	NPTN	71676425	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.800000	0.69108	2.677000	0.91161	0.655000	0.94253	GTC		NPTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268980.1	NM_012428	
CYP1A1	1543	hgsc.bcm.edu	37	15	75012925	75012925	+	Missense_Mutation	SNP	C	C	T	rs28399429		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:75012925C>T	ENST00000379727.3	-	7	1642	c.1444G>A	c.(1444-1446)Gtg>Atg	p.V482M	CYP1A1_ENST00000567032.1_Missense_Mutation_p.V482M|CYP1A1_ENST00000395048.2_Missense_Mutation_p.V482M|CYP1A1_ENST00000395049.4_Missense_Mutation_p.V453M			P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 1	482			V -> M (in dbSNP:rs28399429). {ECO:0000269|PubMed:15469410}.		9-cis-retinoic acid biosynthetic process (GO:0042904)|aging (GO:0007568)|amine metabolic process (GO:0009308)|arachidonic acid metabolic process (GO:0019369)|camera-type eye development (GO:0043010)|cell proliferation (GO:0008283)|cellular lipid metabolic process (GO:0044255)|cellular response to organic cyclic compound (GO:0071407)|coumarin metabolic process (GO:0009804)|dibenzo-p-dioxin catabolic process (GO:0019341)|digestive tract development (GO:0048565)|drug metabolic process (GO:0017144)|embryo development ending in birth or egg hatching (GO:0009792)|epoxygenase P450 pathway (GO:0019373)|flavonoid metabolic process (GO:0009812)|hepatocyte differentiation (GO:0070365)|hydrogen peroxide biosynthetic process (GO:0050665)|insecticide metabolic process (GO:0017143)|maternal process involved in parturition (GO:0060137)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|response to antibiotic (GO:0046677)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to food (GO:0032094)|response to herbicide (GO:0009635)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to iron(III) ion (GO:0010041)|response to lipopolysaccharide (GO:0032496)|response to nematode (GO:0009624)|response to virus (GO:0009615)|response to vitamin A (GO:0033189)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|demethylase activity (GO:0032451)|flavonoid 3'-monooxygenase activity (GO:0016711)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on diphenols and related substances as donors (GO:0016679)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)|vitamin D 24-hydroxylase activity (GO:0070576)	p.V482M(2)		autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(7)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Acetaminophen(DB00316)|Albendazole(DB00518)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Caffeine(DB00201)|Carvedilol(DB01136)|Chloroquine(DB00608)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Clenbuterol(DB01407)|Clobetasol propionate(DB01013)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonidine(DB00575)|Clozapine(DB00363)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Dexamethasone(DB01234)|Dexmedetomidine(DB00633)|Diclofenac(DB00586)|Dicyclomine(DB00804)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Ethanol(DB00898)|Flunarizine(DB04841)|Fluorescein(DB00693)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Granisetron(DB00889)|Haloperidol(DB00502)|Isoprenaline(DB01064)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lorcaserin(DB04871)|Mebendazole(DB00643)|Melatonin(DB01065)|Menadione(DB00170)|Methoxsalen(DB00553)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitroprusside(DB00325)|Norfloxacin(DB01059)|Omeprazole(DB00338)|Ouabain(DB01092)|Oxaliplatin(DB00526)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Prazosin(DB00457)|Primaquine(DB01087)|Progesterone(DB00396)|Propofol(DB00818)|Propranolol(DB00571)|Pyridoxine(DB00165)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Riluzole(DB00740)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiabendazole(DB00730)|Ticlopidine(DB00208)|Toremifene(DB00539)|Tretinoin(DB00755)|Vitamin A(DB00162)|Warfarin(DB00682)	CCCAGTGGCACGCTGAATTCC	0.557									Endometrial Cancer, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia				C|||	1	0.000199681	0.0	0.0	5008	,	,		22312	0.0		0.0	False		,,,				2504	0.001				p.V482M												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G1444A	15						.	C	MET/VAL	0,4394		0,0,2197	116.0	99.0	105.0		1444	3.7	0.0	15	dbSNP_125	105	8,8584	6.4+/-24.3	0,8,4288	yes	missense	CYP1A1	NM_000499.3	21	0,8,6485	TT,TC,CC		0.0931,0.0,0.0616	probably-damaging	482/513	75012925	8,12978	2197	4296	6493	72799978	SO:0001583	missense	1543	exon7	Familial Cancer Database	;AIMAH, Cushing disease, Adrenal, Familial	BC023019	CCDS10268.1	15q24.1	2007-12-14	2003-01-14		ENSG00000140465	ENSG00000140465	1.14.14.1	"""Cytochrome P450s"""	2595	protein-coding gene	gene with protein product		108330	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1"""	CYP1		15128046	Standard	NM_000499		Approved	P450DX, P1-450, P450-C, CP11	uc002ayp.4	P04798	OTTHUMG00000142812	ENST00000379727.3:c.1444G>A	15.37:g.75012925C>T	ENSP00000369050:p.Val482Met	Somatic		Capture	SOLID	Phase_I	72799978	NM_000499	A4F3V9|A4F3W0|Q53G18	Missense_Mutation	SNP	ENST00000379727.3	37	CCDS10268.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.600752	0.28534	0.0	9.31E-4	ENSG00000140465	ENST00000379727;ENST00000395048;ENST00000395049;ENST00000268062	T;T;T	0.69685	-0.42;-0.42;-0.42	5.65	3.66	0.41972	.	0.574015	0.18844	N	0.129585	T	0.77082	0.4078	M	0.81112	2.525	0.09310	N	1	D;D	0.64830	0.993;0.994	D;P	0.65140	0.932;0.885	T	0.66598	-0.5883	10	0.56958	D	0.05	.	4.9382	0.13952	0.0:0.4554:0.2185:0.3262	rs28399429;rs61669924	453;482	E7EMT5;P04798	.;CP1A1_HUMAN	M	482;482;453;454	ENSP00000369050:V482M;ENSP00000378488:V482M;ENSP00000378489:V453M	ENSP00000268062:V454M	V	-	1	0	CYP1A1	72799978	0.000000	0.05858	0.002000	0.10522	0.013000	0.08279	0.079000	0.14782	0.647000	0.30713	0.655000	0.94253	GTG		CYP1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286396.1	NM_000499	
MORF4L1	10933	hgsc.bcm.edu	37	15	79165392	79165392	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:79165392C>T	ENST00000331268.5	+	1	237	c.33C>T	c.(31-33)ttC>ttT	p.F11F	MORF4L1_ENST00000379535.4_Intron|MORF4L1_ENST00000426013.2_Silent_p.F11F|MORF4L1_ENST00000558746.1_Silent_p.F11F|MORF4L1_ENST00000559345.1_5'UTR|MORF4L1_ENST00000561171.1_3'UTR|MORF4L1_ENST00000558502.1_5'UTR	NM_206839.2	NP_996670.1	Q9UBU8	MO4L1_HUMAN	mortality factor 4 like 1	11					cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|double-strand break repair via homologous recombination (GO:0000724)|histone deacetylation (GO:0016575)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|Sin3 complex (GO:0016580)	chromatin binding (GO:0003682)|protein N-terminus binding (GO:0047485)	p.F11F(1)		breast(1)|large_intestine(3)|lung(4)|prostate(1)|urinary_tract(1)	10						AGCCTAAATTCCAGGAGGGTG	0.627																																					p.F11F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C33T	15						.						33.0	28.0	30.0					15																	79165392		2073	4047	6120	76952447	SO:0001819	synonymous_variant	10933	exon1			AF100615	CCDS10307.1, CCDS32304.1, CCDS58393.1	15q25.1	2009-07-13			ENSG00000185787	ENSG00000185787			16989	protein-coding gene	gene with protein product	"""MORF-related gene on chromosome 15"", ""Esa1p-associated factor 3 homolog (S. cerevisiae)"""	607303				8619474, 9110174	Standard	NM_006791		Approved	MRG15, MORFRG15, HsT17725, Eaf3, MEAF3	uc002bel.4	Q9UBU8	OTTHUMG00000143865	ENST00000331268.5:c.33C>T	15.37:g.79165392C>T		Somatic		Capture	SOLID	Phase_I	76952447	NM_006791	B4DKN6|B7Z6R1|D3DW88|O95899|Q5QTS1|Q6NVX8|Q86YT7|Q9HBP6|Q9NSW5	Silent	SNP	ENST00000331268.5	37	CCDS10307.1																																																																																				MORF4L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000290131.4	NM_006791	
KIAA1024	23251	hgsc.bcm.edu	37	15	79748966	79748966	+	Silent	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:79748966G>T	ENST00000305428.3	+	2	552	c.477G>T	c.(475-477)cgG>cgT	p.R159R		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	159						integral component of membrane (GO:0016021)		p.R159R(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						CCAAGTGCCGGAAGATGGACT	0.572																																					p.R159R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G477T	15						.						69.0	73.0	71.0					15																	79748966		2196	4293	6489	77536021	SO:0001819	synonymous_variant	23251	exon2			AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.477G>T	15.37:g.79748966G>T		Somatic		Capture	SOLID	Phase_I	77536021	NM_015206	A7MD43	Silent	SNP	ENST00000305428.3	37	CCDS32306.1																																																																																				KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206	
KIAA1024	23251	hgsc.bcm.edu	37	15	79749917	79749917	+	Silent	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:79749917C>A	ENST00000305428.3	+	2	1503	c.1428C>A	c.(1426-1428)acC>acA	p.T476T		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	476						integral component of membrane (GO:0016021)		p.T476T(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						GCGTGGGCACCCAGACTGAGC	0.532																																					p.T476T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1428A	15						.						71.0	64.0	66.0					15																	79749917		2196	4293	6489	77536972	SO:0001819	synonymous_variant	23251	exon2			AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.1428C>A	15.37:g.79749917C>A		Somatic		Capture	SOLID	Phase_I	77536972	NM_015206	A7MD43	Silent	SNP	ENST00000305428.3	37	CCDS32306.1																																																																																				KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206	
ARNT2	9915	hgsc.bcm.edu	37	15	80872805	80872805	+	Missense_Mutation	SNP	C	C	T	rs202101392		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:80872805C>T	ENST00000303329.4	+	16	1832	c.1667C>T	c.(1666-1668)aCg>aTg	p.T556M	hsa-mir-5572_ENST00000583188.1_RNA|RP11-379K22.3_ENST00000603875.1_RNA|ARNT2_ENST00000533983.1_Missense_Mutation_p.T545M|ARNT2_ENST00000527771.1_Missense_Mutation_p.T545M	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	556					central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.T556M(2)		NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			TCTTCTTCCACGGGCCAGAAC	0.527																																					p.T556M												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C1667T	15						.						139.0	128.0	131.0					15																	80872805		2203	4300	6503	78659860	SO:0001583	missense	9915	exon16			AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.1667C>T	15.37:g.80872805C>T	ENSP00000307479:p.Thr556Met	Somatic		Capture	SOLID	Phase_I	78659860	NM_014862	B4DIS7|O15024|Q8IYC2	Missense_Mutation	SNP	ENST00000303329.4	37	CCDS32307.1	.	.	.	.	.	.	.	.	.	.	C	18.48	3.632324	0.67015	.	.	ENSG00000172379	ENST00000360062;ENST00000303329;ENST00000540859	T	0.52526	0.66	5.02	4.06	0.47325	.	0.203248	0.42548	D	0.000692	T	0.46639	0.1403	L	0.36672	1.1	0.26800	N	0.969229	D	0.62365	0.991	P	0.48704	0.587	T	0.44360	-0.9333	10	0.59425	D	0.04	.	14.9899	0.71377	0.0:0.8565:0.1435:0.0	.	556	Q9HBZ2	ARNT2_HUMAN	M	545;556;556	ENSP00000307479:T556M	ENSP00000307479:T556M	T	+	2	0	ARNT2	78659860	0.976000	0.34144	0.021000	0.16686	0.917000	0.54804	6.821000	0.75272	1.041000	0.40125	0.561000	0.74099	ACG		ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384389.2		
TTC23	64927	hgsc.bcm.edu	37	15	99762042	99762042	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr15:99762042G>A	ENST00000394132.2	-	6	1025	c.208C>T	c.(208-210)Cgt>Tgt	p.R70C	TTC23_ENST00000394135.3_Missense_Mutation_p.R70C|TTC23_ENST00000394136.1_Missense_Mutation_p.R70C|TTC23_ENST00000558613.1_Missense_Mutation_p.R70C|TTC23_ENST00000262074.4_Missense_Mutation_p.R70C|TTC23_ENST00000394129.2_Missense_Mutation_p.R70C|TTC23_ENST00000394130.1_Missense_Mutation_p.R70C|TTC23_ENST00000558663.1_Missense_Mutation_p.R70C			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	70								p.R70C(1)		endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			GCTACGCAACGCACAAGCTCA	0.433																																					p.R70C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C208T	15						.						115.0	94.0	101.0					15																	99762042		2197	4297	6494	97579565	SO:0001583	missense	64927	exon3				CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344	ENST00000394132.2:c.208C>T	15.37:g.99762042G>A	ENSP00000377690:p.Arg70Cys	Somatic		Capture	SOLID	Phase_I	97579565	NM_001040659	A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	Missense_Mutation	SNP	ENST00000394132.2	37	CCDS10379.2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.209424	0.79240	.	.	ENSG00000103852	ENST00000394132;ENST00000394136;ENST00000262074;ENST00000394135;ENST00000394130;ENST00000394129	T;T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97;0.96	5.39	5.39	0.77823	Tetratricopeptide-like helical (1);	0.068746	0.64402	D	0.000016	D	0.86556	0.5961	M	0.82823	2.61	0.51767	D	0.999939	D;D	0.89917	1.0;1.0	D;D	0.72075	0.963;0.976	D	0.88162	0.2858	10	0.87932	D	0	-7.6336	15.0132	0.71565	0.0:0.0:1.0:0.0	.	70;70	Q5W5X9-2;Q5W5X9	.;TTC23_HUMAN	C	70	ENSP00000377690:R70C;ENSP00000377693:R70C;ENSP00000262074:R70C;ENSP00000377692:R70C;ENSP00000377688:R70C;ENSP00000457901:R70C	ENSP00000262074:R70C	R	-	1	0	TTC23	97579565	0.991000	0.36638	0.555000	0.28281	0.991000	0.79684	3.793000	0.55484	2.674000	0.91012	0.655000	0.94253	CGT		TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303953.2	NM_022905	
BANK1	55024	hgsc.bcm.edu	37	4	102981485	102981485	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:102981485A>G	ENST00000322953.4	+	12	2361	c.2087A>G	c.(2086-2088)gAa>gGa	p.E696G	BANK1_ENST00000428908.1_Missense_Mutation_p.E563G|BANK1_ENST00000444316.2_Missense_Mutation_p.E666G|BANK1_ENST00000504592.1_Missense_Mutation_p.E681G|BANK1_ENST00000508653.1_Missense_Mutation_p.E563G	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	696					B cell activation (GO:0042113)			p.E696G(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TCTATGGATGAAGCTCTGGAG	0.453																																					p.E696G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2087G	4						.						96.0	101.0	99.0					4																	102981485		2203	4300	6503	103200508	SO:0001583	missense	55024	exon12			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.2087A>G	4.37:g.102981485A>G	ENSP00000320509:p.Glu696Gly	Somatic		Capture	SOLID	Phase_I	103200508	NM_017935	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	ENST00000322953.4	37	CCDS34038.1	.	.	.	.	.	.	.	.	.	.	A	19.22	3.785175	0.70222	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.38240	1.83;1.79;1.15;1.15;1.83	5.59	5.59	0.84812	.	0.193874	0.43747	D	0.000538	T	0.56171	0.1967	M	0.62723	1.935	0.34192	D	0.672185	P;D;D	0.89917	0.825;1.0;1.0	P;D;D	0.91635	0.842;0.998;0.999	T	0.69971	-0.5000	10	0.72032	D	0.01	.	12.1652	0.54125	1.0:0.0:0.0:0.0	.	563;696;681	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	G	681;696;563;563;666	ENSP00000421443:E681G;ENSP00000320509:E696G;ENSP00000412748:E563G;ENSP00000422314:E563G;ENSP00000388817:E666G	ENSP00000320509:E696G	E	+	2	0	BANK1	103200508	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	4.593000	0.61034	2.136000	0.66102	0.459000	0.35465	GAA		BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935	
CASP6	839	hgsc.bcm.edu	37	4	110612026	110612026	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:110612026A>G	ENST00000265164.2	-	6	700	c.623T>C	c.(622-624)aTg>aCg	p.M208T	CASP6_ENST00000510324.1_5'UTR|AC004067.5_ENST00000608733.1_RNA|CASP6_ENST00000352981.3_Missense_Mutation_p.M119T	NM_001226.3	NP_001217.2	P55212	CASP6_HUMAN	caspase 6, apoptosis-related cysteine peptidase	208					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|epithelial cell differentiation (GO:0030855)|proteolysis (GO:0006508)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|identical protein binding (GO:0042802)	p.M208T(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	8		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000171)		AGAGTAACACATGAGGAAGTC	0.448																																					p.M208T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T623C	4						.						195.0	168.0	177.0					4																	110612026		2203	4300	6503	110831475	SO:0001583	missense	839	exon6			U20536	CCDS3684.1, CCDS3685.1	4q25	2008-02-05	2005-08-17		ENSG00000138794	ENSG00000138794		"""Caspases"""	1507	protein-coding gene	gene with protein product		601532	"""caspase 6, apoptosis-related cysteine protease"""			8780721, 7796396	Standard	XM_005263271		Approved	MCH2	uc003hzn.1	P55212	OTTHUMG00000131914	ENST00000265164.2:c.623T>C	4.37:g.110612026A>G	ENSP00000265164:p.Met208Thr	Somatic		Capture	SOLID	Phase_I	110831475	NM_001226	Q9BQE7	Missense_Mutation	SNP	ENST00000265164.2	37	CCDS3684.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.108271	0.77096	.	.	ENSG00000138794	ENST00000352981;ENST00000265164	T;T	0.20881	2.04;2.04	5.48	5.48	0.80851	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	0.036092	0.85682	D	0.000000	T	0.25005	0.0607	L	0.51914	1.62	0.80722	D	1	B;B	0.32693	0.38;0.069	B;B	0.35550	0.205;0.158	T	0.03000	-1.1084	10	0.59425	D	0.04	.	15.6181	0.76784	1.0:0.0:0.0:0.0	.	119;208	P55212-2;P55212	.;CASP6_HUMAN	T	119;208	ENSP00000285333:M119T;ENSP00000265164:M208T	ENSP00000265164:M208T	M	-	2	0	CASP6	110831475	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.933000	0.92911	2.101000	0.63845	0.529000	0.55759	ATG		CASP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254866.1	NM_001226	
TRAM1L1	133022	hgsc.bcm.edu	37	4	118005626	118005626	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:118005626T>C	ENST00000310754.4	-	1	1110	c.924A>G	c.(922-924)caA>caG	p.Q308Q		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	308	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.Q308Q(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						TTACGTAGGCTTGGATCGTGC	0.443																																					p.Q308Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A924G	4						.						132.0	124.0	127.0					4																	118005626		2203	4300	6503	118225074	SO:0001819	synonymous_variant	133022	exon1			AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.924A>G	4.37:g.118005626T>C		Somatic		Capture	SOLID	Phase_I	118225074	NM_152402	Q8N2L7	Silent	SNP	ENST00000310754.4	37	CCDS3707.1																																																																																				TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256513.1	NM_152402	
NDST3	9348	hgsc.bcm.edu	37	4	119059263	119059263	+	Missense_Mutation	SNP	G	G	A	rs150758016	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:119059263G>A	ENST00000296499.5	+	5	1682	c.1279G>A	c.(1279-1281)Gtc>Atc	p.V427I	NDST3_ENST00000433996.2_Missense_Mutation_p.V346I	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	427	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.V427I(3)		NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						CCATTCGGGCGTCTACCCTGT	0.468																																					p.V427I												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G1279A	4						.	G	ILE/VAL	0,4406		0,0,2203	102.0	98.0	100.0		1279	5.4	1.0	4	dbSNP_134	100	2,8598	2.2+/-6.3	0,2,4298	no	missense	NDST3	NM_004784.2	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	427/874	119059263	2,13004	2203	4300	6503	119278711	SO:0001583	missense	9348	exon5			AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.1279G>A	4.37:g.119059263G>A	ENSP00000296499:p.Val427Ile	Somatic		Capture	SOLID	Phase_I	119278711	NM_004784	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	ENST00000296499.5	37	CCDS3708.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685475	0.88639	0.0	2.33E-4	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.53857	0.88;0.6	5.39	5.39	0.77823	.	0.114616	0.64402	D	0.000018	T	0.70272	0.3205	M	0.68317	2.08	0.43724	D	0.996204	D;D	0.62365	0.987;0.991	P;P	0.62885	0.826;0.908	T	0.71567	-0.4554	10	0.54805	T	0.06	.	19.1484	0.93477	0.0:0.0:1.0:0.0	.	346;427	B4DI67;O95803	.;NDST3_HUMAN	I	427;346	ENSP00000296499:V427I;ENSP00000396625:V346I	ENSP00000296499:V427I	V	+	1	0	NDST3	119278711	1.000000	0.71417	0.986000	0.45419	0.630000	0.37929	9.778000	0.99011	2.519000	0.84933	0.557000	0.71058	GTC		NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784	
SYNPO2	171024	hgsc.bcm.edu	37	4	119951694	119951694	+	Silent	SNP	G	G	A	rs376071163		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:119951694G>A	ENST00000429713.2	+	4	1946	c.1764G>A	c.(1762-1764)acG>acA	p.T588T	SYNPO2_ENST00000434046.2_Silent_p.T588T|SYNPO2_ENST00000307142.4_Silent_p.T588T|SYNPO2_ENST00000448416.2_Intron	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	588						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)	p.T588T(1)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TGAATAGAACGGCCAAACCCT	0.542																																					p.T588T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1764A	4						.	G	,,	1,4405	2.1+/-5.4	0,1,2202	103.0	95.0	98.0		1764,1764,1764	-9.6	0.4	4		98	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	SYNPO2	NM_001128933.1,NM_001128934.1,NM_133477.2	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	588/1094,588/1110,588/1262	119951694	1,13005	2203	4300	6503	120171142	SO:0001819	synonymous_variant	171024	exon4			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.1764G>A	4.37:g.119951694G>A		Somatic		Capture	SOLID	Phase_I	120171142	NM_133477	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Silent	SNP	ENST00000429713.2	37	CCDS47129.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.742882	0.00675	2.27E-4	0.0	ENSG00000172403	ENST00000504178	.	.	.	5.42	-9.63	0.00544	.	.	.	.	.	T	0.35128	0.0921	.	.	.	0.41931	D	0.990569	.	.	.	.	.	.	T	0.42882	-0.9425	4	.	.	.	-18.8661	3.7817	0.08683	0.497:0.2059:0.1779:0.1191	.	.	.	.	S	540	.	.	G	+	1	0	SYNPO2	120171142	0.000000	0.05858	0.383000	0.26132	0.014000	0.08584	-3.221000	0.00552	-1.579000	0.01646	-0.137000	0.14449	GGC		SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
SYNPO2	171024	hgsc.bcm.edu	37	4	119952098	119952098	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:119952098C>T	ENST00000429713.2	+	4	2350	c.2168C>T	c.(2167-2169)aCt>aTt	p.T723I	SYNPO2_ENST00000434046.2_Missense_Mutation_p.T723I|SYNPO2_ENST00000307142.4_Missense_Mutation_p.T723I|SYNPO2_ENST00000448416.2_Intron	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	723						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)	p.T723I(1)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AAACGGGGCACTGGAGCTGGA	0.483																																					p.T723I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2168T	4						.						63.0	68.0	66.0					4																	119952098		2203	4300	6503	120171546	SO:0001583	missense	171024	exon4			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.2168C>T	4.37:g.119952098C>T	ENSP00000395143:p.Thr723Ile	Somatic		Capture	SOLID	Phase_I	120171546	NM_133477	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000429713.2	37	CCDS47129.1	.	.	.	.	.	.	.	.	.	.	C	10.41	1.342105	0.24339	.	.	ENSG00000172403	ENST00000307142;ENST00000429713;ENST00000434046	T;T;T	0.08634	3.07;3.08;3.08	5.04	4.18	0.49190	.	0.777179	0.11932	N	0.515595	T	0.10723	0.0262	L	0.36672	1.1	0.80722	D	1	B;P;B;P	0.42203	0.242;0.773;0.242;0.664	B;B;B;B	0.42422	0.144;0.387;0.144;0.143	T	0.23332	-1.0191	9	.	.	.	-0.9113	15.2585	0.73603	0.0:0.8588:0.1412:0.0	.	723;723;723;723	B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6	.;.;.;SYNP2_HUMAN	I	723	ENSP00000306015:T723I;ENSP00000395143:T723I;ENSP00000390965:T723I	.	T	+	2	0	SYNPO2	120171546	0.309000	0.24518	0.057000	0.19452	0.718000	0.41266	3.836000	0.55813	1.078000	0.41014	0.655000	0.94253	ACT		SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
TRPC3	7222	hgsc.bcm.edu	37	4	122828683	122828683	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:122828683G>A	ENST00000379645.3	-	7	1905	c.1832C>T	c.(1831-1833)tCt>tTt	p.S611F	TRPC3_ENST00000513531.1_Missense_Mutation_p.S483F|TRPC3_ENST00000264811.5_Missense_Mutation_p.S538F	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	526					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.S538F(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						AAGGCCTTCAGATATAATCTG	0.443																																					p.S538F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1613T	4						.						69.0	69.0	69.0					4																	122828683		2203	4299	6502	123048133	SO:0001583	missense	7222	exon6			Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.1832C>T	4.37:g.122828683G>A	ENSP00000368966:p.Ser611Phe	Somatic		Capture	SOLID	Phase_I	123048133	NM_003305	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	37	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783638	0.90282	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	T;T;T	0.78481	-0.96;-1.16;-1.18	5.3	5.3	0.74995	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.90758	0.7099	M	0.91717	3.235	0.80722	D	1	P;D;D	0.76494	0.927;0.973;0.999	P;D;D	0.76575	0.881;0.943;0.988	D	0.92262	0.5818	10	0.59425	D	0.04	-16.5776	18.9622	0.92681	0.0:0.0:1.0:0.0	.	526;483;611	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	F	538;611;483	ENSP00000264811:S538F;ENSP00000368966:S611F;ENSP00000426899:S483F	ENSP00000264811:S538F	S	-	2	0	TRPC3	123048133	1.000000	0.71417	0.977000	0.42913	0.964000	0.63967	9.753000	0.98904	2.465000	0.83290	0.655000	0.94253	TCT		TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305	
ANKRD50	57182	hgsc.bcm.edu	37	4	125590865	125590865	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:125590865A>T	ENST00000504087.1	-	4	4604	c.3567T>A	c.(3565-3567)aaT>aaA	p.N1189K	ANKRD50_ENST00000515641.1_Missense_Mutation_p.N1010K	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	1189	Ser-rich.							p.N1189K(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						TCAAAGATGAATTTTTTGAGC	0.388																																					p.N1010K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3030A	4						.						90.0	92.0	92.0					4																	125590865		2203	4300	6503	125810315	SO:0001583	missense	57182	exon3			AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.3567T>A	4.37:g.125590865A>T	ENSP00000425658:p.Asn1189Lys	Somatic		Capture	SOLID	Phase_I	125810315	NM_001167882	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	37	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	A	15.42	2.827506	0.50845	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.68331	-0.32;-0.27	5.29	-2.8	0.05823	.	0.045739	0.85682	D	0.000000	T	0.36331	0.0963	N	0.08118	0	0.42186	D	0.991707	B	0.33694	0.421	B	0.27608	0.081	T	0.21109	-1.0255	10	0.10377	T	0.69	.	14.0408	0.64674	0.4979:0.0:0.5021:0.0	.	1189	Q9ULJ7	ANR50_HUMAN	K	1189;1010	ENSP00000425658:N1189K;ENSP00000425355:N1010K	ENSP00000425658:N1189K	N	-	3	2	ANKRD50	125810315	0.988000	0.35896	0.909000	0.35828	0.997000	0.91878	0.307000	0.19296	-0.658000	0.05366	0.459000	0.35465	AAT		ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	NM_020337	
FAT4	79633	hgsc.bcm.edu	37	4	126337730	126337730	+	Missense_Mutation	SNP	G	G	A	rs200719060		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:126337730G>A	ENST00000394329.3	+	6	6984	c.6971G>A	c.(6970-6972)cGg>cAg	p.R2324Q	FAT4_ENST00000335110.5_Missense_Mutation_p.R622Q	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2324	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R2324Q(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AGTCTGGATCGGGAAACAAAA	0.418													G|||	1	0.000199681	0.0	0.0	5008	,	,		19005	0.0		0.001	False		,,,				2504	0.0				p.R2324Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G6971A	4						.						236.0	229.0	231.0					4																	126337730		2203	4300	6503	126557180	SO:0001583	missense	79633	exon6			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.6971G>A	4.37:g.126337730G>A	ENSP00000377862:p.Arg2324Gln	Somatic		Capture	SOLID	Phase_I	126557180	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	21.7	4.189632	0.78789	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.01725	4.67;4.67	5.33	5.33	0.75918	Cadherin (4);Cadherin-like (1);	0.000000	0.32106	U	0.006577	T	0.13713	0.0332	M	0.89840	3.065	0.58432	D	0.999994	P;D	0.76494	0.608;0.999	B;D	0.68039	0.271;0.955	T	0.02424	-1.1161	10	0.38643	T	0.18	.	19.0466	0.93022	0.0:0.0:1.0:0.0	.	622;2324	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	Q	2324;622	ENSP00000377862:R2324Q;ENSP00000335169:R622Q	ENSP00000335169:R622Q	R	+	2	0	FAT4	126557180	1.000000	0.71417	0.989000	0.46669	0.080000	0.17528	9.657000	0.98554	2.493000	0.84123	0.637000	0.83480	CGG		FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
ZNF330	27309	hgsc.bcm.edu	37	4	142143642	142143642	+	Silent	SNP	A	A	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:142143642A>C	ENST00000262990.4	+	2	345	c.117A>C	c.(115-117)tcA>tcC	p.S39S	ZNF330_ENST00000421169.2_Missense_Mutation_p.Q3P	NM_014487.4	NP_055302.1	Q9Y3S2	ZN330_HUMAN	zinc finger protein 330	39						chromosome, centromeric region (GO:0000775)|midbody (GO:0030496)|nucleolus (GO:0005730)	metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.S39S(1)		kidney(1)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	14	all_hematologic(180;0.162)					GTAATGCCTCAATGGTATCAG	0.363																																					p.S39S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A117C	4						.						93.0	91.0	91.0					4																	142143642		2203	4300	6503	142363092	SO:0001819	synonymous_variant	27309	exon2			AJ006591	CCDS3754.1	4q31.21	2008-05-15			ENSG00000109445	ENSG00000109445		"""Zinc fingers, C2H2-type"""	15462	protein-coding gene	gene with protein product		609550				11528117, 10593942	Standard	NM_001292002		Approved	NOA36, HSA6591	uc003iiq.4	Q9Y3S2	OTTHUMG00000133413	ENST00000262990.4:c.117A>C	4.37:g.142143642A>C		Somatic		Capture	SOLID	Phase_I	142363092	NM_014487	B2RDA3	Silent	SNP	ENST00000262990.4	37	CCDS3754.1	.	.	.	.	.	.	.	.	.	.	A	14.23	2.474899	0.43942	.	.	ENSG00000109445	ENST00000421169	T	0.43294	0.95	5.75	1.79	0.24919	.	.	.	.	.	T	0.32102	0.0818	.	.	.	0.25864	N	0.983786	B	0.02656	0.0	B	0.01281	0.0	T	0.27606	-1.0069	8	0.87932	D	0	-3.3507	8.393	0.32540	0.5546:0.3794:0.066:0.0	.	3	E9PDK6	.	P	3	ENSP00000397397:Q3P	ENSP00000397397:Q3P	Q	+	2	0	ZNF330	142363092	0.480000	0.25933	0.995000	0.50966	0.809000	0.45718	-0.154000	0.10130	0.073000	0.16731	-0.386000	0.06593	CAA		ZNF330-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257271.2	NM_014487	
ZNF827	152485	hgsc.bcm.edu	37	4	146700559	146700559	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:146700559G>A	ENST00000508784.1	-	9	2715	c.2488C>T	c.(2488-2490)Cag>Tag	p.Q830*	ZNF827_ENST00000513320.1_Nonsense_Mutation_p.Q480*|ZNF827_ENST00000379448.4_Nonsense_Mutation_p.Q830*			Q17R98	ZN827_HUMAN	zinc finger protein 827	830					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q830*(2)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					GACAATGTCTGCTGTCGGCCA	0.507																																					p.Q830X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C2488T	4						.						100.0	87.0	92.0					4																	146700559		2203	4300	6503	146920009	SO:0001587	stop_gained	152485	exon9			AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.2488C>T	4.37:g.146700559G>A	ENSP00000421863:p.Gln830*	Somatic		Capture	SOLID	Phase_I	146920009	NM_178835	B7ZL52|Q7Z4S7|Q8N279	Nonsense_Mutation	SNP	ENST00000508784.1	37		.	.	.	.	.	.	.	.	.	.	G	43	9.883227	0.99286	.	.	ENSG00000151612	ENST00000508784;ENST00000513320;ENST00000379448;ENST00000281318;ENST00000440280	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-21.4793	19.9699	0.97282	0.0:0.0:1.0:0.0	.	.	.	.	X	830;480;830;829;480	.	ENSP00000281318:Q829X	Q	-	1	0	ZNF827	146920009	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.431000	0.97494	2.730000	0.93505	0.591000	0.81541	CAG		ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000364654.2	NM_178835	
POU4F2	5458	hgsc.bcm.edu	37	4	147561601	147561601	+	Missense_Mutation	SNP	G	G	A	rs369337694		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:147561601G>A	ENST00000281321.3	+	2	1119	c.871G>A	c.(871-873)Gtg>Atg	p.V291M	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	291	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.V291M(1)		NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					GATCCCCGGCGTGGGCTCGCT	0.617																																					p.V291M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G871A	4						.	G	MET/VAL	0,4406		0,0,2203	54.0	56.0	55.0		871	5.4	1.0	4		55	1,8599	1.2+/-3.3	0,1,4299	no	missense	POU4F2	NM_004575.2	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	291/410	147561601	1,13005	2203	4300	6503	147781051	SO:0001583	missense	5458	exon2			U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.871G>A	4.37:g.147561601G>A	ENSP00000281321:p.Val291Met	Somatic		Capture	SOLID	Phase_I	147781051	NM_004575	B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	ENST00000281321.3	37	CCDS34074.1	.	.	.	.	.	.	.	.	.	.	G	19.65	3.867822	0.72065	0.0	1.16E-4	ENSG00000151615	ENST00000281321	T	0.69175	-0.38	5.37	5.37	0.77165	POU-specific (3);Lambda repressor-like, DNA-binding (2);	0.000000	0.85682	D	0.000000	D	0.82995	0.5158	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84984	0.0890	10	0.87932	D	0	.	19.1135	0.93328	0.0:0.0:1.0:0.0	.	291	Q12837	PO4F2_HUMAN	M	291	ENSP00000281321:V291M	ENSP00000281321:V291M	V	+	1	0	POU4F2	147781051	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.841000	0.99482	2.528000	0.85240	0.561000	0.74099	GTG		POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575	
EDNRA	1909	hgsc.bcm.edu	37	4	148407006	148407006	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:148407006T>C	ENST00000324300.5	+	2	688	c.173T>C	c.(172-174)gTc>gCc	p.V58A	EDNRA_ENST00000339690.5_Missense_Mutation_p.V58A|EDNRA_ENST00000511804.1_Intron|EDNRA_ENST00000506066.1_Missense_Mutation_p.V58A|EDNRA_ENST00000358556.4_Missense_Mutation_p.V58A	NM_001957.3	NP_001948.1	P25101	EDNRA_HUMAN	endothelin receptor type A	58					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|glomerular filtration (GO:0003094)|glucose transport (GO:0015758)|head development (GO:0060322)|heart development (GO:0007507)|histamine secretion (GO:0001821)|in utero embryonic development (GO:0001701)|maternal process involved in parturition (GO:0060137)|metabolic process (GO:0008152)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP biosynthetic process (GO:0030818)|neural crest cell development (GO:0014032)|patterning of blood vessels (GO:0001569)|penile erection (GO:0043084)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of kidney development (GO:0090184)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of odontogenesis (GO:0042482)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|Rho protein signal transduction (GO:0007266)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|smooth muscle cell proliferation (GO:0048659)|smooth muscle contraction (GO:0006939)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	endothelin receptor activity (GO:0004962)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.V58A(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)	17	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Acetylsalicylic acid(DB00945)|Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	ACTAATTTGGTCCTACCCAGC	0.408																																					p.V58A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T173C	4						.						147.0	128.0	134.0					4																	148407006		2203	4300	6503	148626456	SO:0001583	missense	1909	exon2			D90348	CCDS3769.1, CCDS54810.1, CCDS58927.1	4q31.22	2013-09-20			ENSG00000151617	ENSG00000151617		"""GPCR / Class A : Endothelin receptors"""	3179	protein-coding gene	gene with protein product		131243				1659806	Standard	NM_001957		Approved		uc003iky.3	P25101	OTTHUMG00000161354	ENST00000324300.5:c.173T>C	4.37:g.148407006T>C	ENSP00000315011:p.Val58Ala	Somatic		Capture	SOLID	Phase_I	148626456	NM_001166055	B2R723|B4E2V6|B7Z9G6|D3DP03|E7ER36|O43441|Q16432|Q16433|Q8TBH2	Missense_Mutation	SNP	ENST00000324300.5	37	CCDS3769.1	.	.	.	.	.	.	.	.	.	.	T	2.423	-0.332715	0.05314	.	.	ENSG00000151617	ENST00000358556;ENST00000339690;ENST00000394047;ENST00000324300;ENST00000506066	T;T;T;T	0.81247	0.42;-1.47;-0.77;0.42	5.96	-0.203	0.13204	.	0.549745	0.18064	N	0.152850	T	0.49609	0.1567	N	0.01705	-0.755	0.21105	N	0.999788	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.42275	-0.9461	10	0.08381	T	0.77	-2.1245	9.4117	0.38496	0.0:0.237:0.0:0.763	.	58;58;58	P25101-4;P25101-2;P25101	.;.;EDNRA_HUMAN	A	58	ENSP00000351359:V58A;ENSP00000341556:V58A;ENSP00000315011:V58A;ENSP00000425281:V58A	ENSP00000315011:V58A	V	+	2	0	EDNRA	148626456	0.123000	0.22298	0.942000	0.38095	0.949000	0.60115	-0.299000	0.08254	0.014000	0.14944	-0.408000	0.06270	GTC		EDNRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364635.1		
DCHS2	54798	hgsc.bcm.edu	37	4	155156018	155156018	+	Silent	SNP	C	C	T	rs146840391		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:155156018C>T	ENST00000357232.4	-	25	8420	c.8421G>A	c.(8419-8421)ttG>ttA	p.L2807L		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2807					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L2807L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CAGGCATATGCAAATGTTCAT	0.403																																					p.L2807L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G8421A	4						.						126.0	130.0	129.0					4																	155156018		2203	4300	6503	155375468	SO:0001819	synonymous_variant	54798	exon25			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8421G>A	4.37:g.155156018C>T		Somatic		Capture	SOLID	Phase_I	155375468	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	37	CCDS3785.1																																																																																				DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
CTSO	1519	hgsc.bcm.edu	37	4	156849542	156849542	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:156849542T>G	ENST00000433477.3	-	7	946	c.877A>C	c.(877-879)Agt>Cgt	p.S293R		NM_001334.2	NP_001325.1	P43235	CATK_HUMAN	cathepsin O	300					bone resorption (GO:0045453)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|intramembranous ossification (GO:0001957)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|proteoglycan binding (GO:0043394)	p.S293R(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|prostate(1)	16	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.05)|Kidney(143;0.0627)|COAD - Colon adenocarcinoma(41;0.148)		CCCCAAGAACTTCCCCAGGAA	0.348																																					p.S293R	Pancreas(148;2303 2598 8989 35298)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A877C	4						.						106.0	98.0	101.0					4																	156849542		2203	4300	6503	157068992	SO:0001583	missense	1519	exon7			X77383	CCDS3794.1	4q32.1	2012-10-03			ENSG00000256043	ENSG00000256043		"""Cathepsins"""	2542	protein-coding gene	gene with protein product		600550		CTSO1		9790772	Standard	NM_001334		Approved		uc003ipg.3	P43234	OTTHUMG00000161942	ENST00000433477.3:c.877A>C	4.37:g.156849542T>G	ENSP00000414904:p.Ser293Arg	Somatic		Capture	SOLID	Phase_I	157068992	NM_001334	Q6FHS6	Missense_Mutation	SNP	ENST00000433477.3	37	CCDS3794.1	.	.	.	.	.	.	.	.	.	.	T	8.049	0.765484	0.15914	.	.	ENSG00000256043	ENST00000433477	T	0.31247	1.5	5.56	-0.299	0.12808	Peptidase C1A, papain C-terminal (2);	0.465751	0.23985	N	0.042635	T	0.22399	0.0540	L	0.39898	1.24	0.09310	N	1	B	0.18013	0.025	B	0.27076	0.076	T	0.20371	-1.0277	10	0.44086	T	0.13	.	7.418	0.27055	0.2062:0.0:0.4102:0.3836	.	293	P43234	CATO_HUMAN	R	293	ENSP00000414904:S293R	ENSP00000281527:S293R	S	-	1	0	CTSO	157068992	0.012000	0.17670	0.015000	0.15790	0.785000	0.44390	1.887000	0.39698	0.038000	0.15604	0.528000	0.53228	AGT		CTSO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366469.1	NM_001334	
FSTL5	56884	hgsc.bcm.edu	37	4	162306985	162306985	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:162306985T>C	ENST00000306100.5	-	16	2894	c.2458A>G	c.(2458-2460)Atc>Gtc	p.I820V	RP11-234O6.2_ENST00000508189.1_RNA|FSTL5_ENST00000427802.2_Missense_Mutation_p.I810V|FSTL5_ENST00000536695.1_Missense_Mutation_p.I819V|FSTL5_ENST00000379164.4_Missense_Mutation_p.I819V	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	820						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.I820V(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		CCATCTAGGATGAAGAGAGAG	0.433																																					p.I820V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2458G	4						.						180.0	168.0	172.0					4																	162306985		2203	4300	6503	162526435	SO:0001583	missense	56884	exon16			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.2458A>G	4.37:g.162306985T>C	ENSP00000305334:p.Ile820Val	Somatic		Capture	SOLID	Phase_I	162526435	NM_020116	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	T	12.86	2.063815	0.36373	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.21022	0.0506	L	0.31926	0.97	0.58432	D	0.999999	P;B;B	0.35745	0.518;0.056;0.155	B;B;B	0.37091	0.241;0.048;0.085	T	0.04103	-1.0977	10	0.11182	T	0.66	.	15.4073	0.74890	0.0:0.0:0.0:1.0	.	810;819;820	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	V	820;819;810;819	ENSP00000305334:I820V;ENSP00000368462:I819V;ENSP00000389270:I810V;ENSP00000440409:I819V	ENSP00000305334:I820V	I	-	1	0	FSTL5	162526435	1.000000	0.71417	0.947000	0.38551	0.683000	0.39861	3.965000	0.56788	2.237000	0.73441	0.533000	0.62120	ATC		FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
KLHL2	11275	hgsc.bcm.edu	37	4	166231874	166231874	+	Silent	SNP	C	C	T	rs151235861		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:166231874C>T	ENST00000226725.6	+	10	1468	c.1209C>T	c.(1207-1209)taC>taT	p.Y403Y	KLHL2_ENST00000506761.1_Silent_p.Y237Y|KLHL2_ENST00000514860.1_Silent_p.Y407Y|KLHL2_ENST00000538127.1_Silent_p.Y315Y|KLHL2_ENST00000421009.2_Silent_p.Y306Y|KLHL2_ENST00000509028.1_3'UTR	NM_007246.3	NP_009177.3	O95198	KLHL2_HUMAN	kelch-like family member 2	403					protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)	actin binding (GO:0003779)	p.Y403Y(1)		endometrium(3)|large_intestine(5)|lung(4)|prostate(1)|urinary_tract(1)	14	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		GATTATTATACGCTGTGGGAG	0.413													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18122	0.0		0.0	False		,,,				2504	0.0				p.Y407Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1221T	4						.	C	,,	1,4405	2.1+/-5.4	0,1,2202	241.0	247.0	245.0		1221,945,1209	-1.7	0.9	4	dbSNP_134	245	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	KLHL2	NM_001161521.1,NM_001161522.1,NM_007246.3	,,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,,	407/598,315/506,403/594	166231874	2,13004	2203	4300	6503	166451324	SO:0001819	synonymous_variant	11275	exon10			AF059569	CCDS34094.1, CCDS54815.1, CCDS54816.1	4q21.2	2013-01-30	2013-01-30		ENSG00000109466	ENSG00000109466		"""Kelch-like"", ""BTB/POZ domain containing"""	6353	protein-coding gene	gene with protein product	"""mayven"""	605774	"""kelch (Drosophila)-like 2 (Mayven)"", ""kelch-like 2, Mayven (Drosophila)"""			10397770, 16035103	Standard	NM_007246		Approved	MAV	uc011cjm.2	O95198	OTTHUMG00000161294	ENST00000226725.6:c.1209C>T	4.37:g.166231874C>T		Somatic		Capture	SOLID	Phase_I	166451324	NM_001161521	A6NCM7|B2RD18|B4DFH7|F5H6M3|Q8N484|Q8TBH5	Silent	SNP	ENST00000226725.6	37	CCDS34094.1																																																																																				KLHL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364439.1		
TLL1	7092	hgsc.bcm.edu	37	4	166981339	166981339	+	Splice_Site	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:166981339A>G	ENST00000061240.2	+	15	2653	c.2006A>G	c.(2005-2007)gAa>gGa	p.E669G	TLL1_ENST00000507499.1_Splice_Site_p.E692G	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	669	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E669G(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		GAAGGCAATGAAGTAAGTGAA	0.333																																					p.E669G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2006G	4						.						81.0	85.0	84.0					4																	166981339		2203	4300	6503	167200789	SO:0001630	splice_region_variant	7092	exon15			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2007+1A>G	4.37:g.166981339A>G		Somatic		Capture	SOLID	Phase_I	167200789	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.247171	0.80024	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	T;T	0.19669	2.13;2.13	5.56	5.56	0.83823	CUB (5);	0.000000	0.85682	U	0.000000	T	0.30947	0.0781	L	0.31664	0.95	0.80722	D	1	P;D	0.56287	0.952;0.975	P;P	0.58928	0.697;0.848	T	0.01757	-1.1280	10	0.39692	T	0.17	.	16.0051	0.80357	1.0:0.0:0.0:0.0	.	692;669	E9PD25;O43897	.;TLL1_HUMAN	G	669;692	ENSP00000061240:E669G;ENSP00000426082:E692G	ENSP00000061240:E669G	E	+	2	0	TLL1	167200789	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	9.235000	0.95353	2.232000	0.73038	0.482000	0.46254	GAA		TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		Missense_Mutation
C4orf27	54969	hgsc.bcm.edu	37	4	170652905	170652905	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:170652905A>G	ENST00000393381.2	-	7	934	c.859T>C	c.(859-861)Tat>Cat	p.Y287H		NM_017867.2	NP_060337.2	Q9NWY4	CD027_HUMAN	chromosome 4 open reading frame 27	287						nucleus (GO:0005634)		p.Y287H(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	12		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.018)|LUSC - Lung squamous cell carcinoma(193;0.116)		CCCATGCCATAATCACATTCA	0.448																																					p.Y287H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T859C	4						.						129.0	111.0	117.0					4																	170652905		2203	4300	6503	170889480	SO:0001583	missense	54969	exon7			BC010367	CCDS3813.1	4q33	2011-01-25			ENSG00000056050	ENSG00000056050			26051	protein-coding gene	gene with protein product						11230166	Standard	NM_017867		Approved	FLJ20534	uc003isl.4	Q9NWY4	OTTHUMG00000160960	ENST00000393381.2:c.859T>C	4.37:g.170652905A>G	ENSP00000406598:p.Tyr287His	Somatic		Capture	SOLID	Phase_I	170889480	NM_017867		Missense_Mutation	SNP	ENST00000393381.2	37	CCDS3813.1	.	.	.	.	.	.	.	.	.	.	A	14.65	2.599801	0.46318	.	.	ENSG00000056050	ENST00000393381	T	0.57436	0.4	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.75280	0.3828	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.80917	-0.1168	10	0.87932	D	0	-16.3834	14.481	0.67582	1.0:0.0:0.0:0.0	.	287	Q9NWY4	CD027_HUMAN	H	287	ENSP00000406598:Y287H	ENSP00000406598:Y287H	Y	-	1	0	C4orf27	170889480	1.000000	0.71417	0.992000	0.48379	0.061000	0.15899	8.662000	0.91130	1.897000	0.54924	0.334000	0.21626	TAT		C4orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363140.1	NM_017867	
DCTD	1635	hgsc.bcm.edu	37	4	183814255	183814255	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:183814255A>G	ENST00000438320.2	-	5	677	c.387T>C	c.(385-387)tcT>tcC	p.S129S	DCTD_ENST00000510370.1_Silent_p.S129S|DCTD_ENST00000357067.3_Silent_p.S140S	NM_001921.2	NP_001912.2	P32321	DCTD_HUMAN	dCMP deaminase	129					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	dCMP deaminase activity (GO:0004132)|zinc ion binding (GO:0008270)	p.S129S(1)		endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|urinary_tract(1)	18		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00666)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.202)		all cancers(43;1.65e-24)|Epithelial(43;3.44e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.39e-10)|Colorectal(24;4.69e-07)|COAD - Colon adenocarcinoma(29;7.07e-05)|STAD - Stomach adenocarcinoma(60;0.000118)|GBM - Glioblastoma multiforme(59;0.000472)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.0419)	Cytarabine(DB00987)	GGTATTTATCAGACATGAAAA	0.507																																					p.S129S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T387C	4						.						63.0	58.0	60.0					4																	183814255		2203	4300	6503	184051249	SO:0001819	synonymous_variant	1635	exon5			L12136	CCDS3831.1, CCDS34108.1	4q35.1	2008-08-01			ENSG00000129187	ENSG00000129187	3.5.4.12		2710	protein-coding gene	gene with protein product		607638					Standard	XM_005262778		Approved		uc003ivg.3	P32321	OTTHUMG00000160685	ENST00000438320.2:c.387T>C	4.37:g.183814255A>G		Somatic		Capture	SOLID	Phase_I	184051249	NM_001921	B2R836|D3DP49|D3DP50|Q5M7Z8|Q9BVD8	Silent	SNP	ENST00000438320.2	37	CCDS3831.1																																																																																				DCTD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361743.2		
PDLIM3	27295	hgsc.bcm.edu	37	4	186423605	186423605	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:186423605C>T	ENST00000284770.5	-	8	1011	c.938G>A	c.(937-939)cGg>cAg	p.R313Q	PDLIM3_ENST00000284771.6_Missense_Mutation_p.R265Q|PDLIM3_ENST00000284767.5_3'UTR	NM_014476.5	NP_055291.2	Q53GG5	PDLI3_HUMAN	PDZ and LIM domain 3	313	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin filament organization (GO:0007015)|heart development (GO:0007507)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of muscle (GO:0008307)|zinc ion binding (GO:0008270)	p.R313Q(1)		breast(2)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		all_lung(41;1.03e-13)|Lung NSC(41;2.49e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.00996)|Colorectal(36;0.0161)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.4e-10)|BRCA - Breast invasive adenocarcinoma(30;8.64e-05)|GBM - Glioblastoma multiforme(59;0.000167)|STAD - Stomach adenocarcinoma(60;0.000828)|LUSC - Lung squamous cell carcinoma(40;0.00984)|COAD - Colon adenocarcinoma(29;0.0115)|READ - Rectum adenocarcinoma(43;0.171)		CTCAGGGTGCCGGTACTTATC	0.507																																					p.R265Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G794A	4						.						110.0	99.0	103.0					4																	186423605		2203	4300	6503	186660599	SO:0001583	missense	27295	exon7			AF002280	CCDS3844.1, CCDS47172.1, CCDS75218.1, CCDS75219.1	4q35	2014-09-17			ENSG00000154553	ENSG00000154553			20767	protein-coding gene	gene with protein product		605889				10063829, 8828038	Standard	NM_014476		Approved	ALP	uc003ixw.4	Q53GG5	OTTHUMG00000160412	ENST00000284770.5:c.938G>A	4.37:g.186423605C>T	ENSP00000284770:p.Arg313Gln	Somatic		Capture	SOLID	Phase_I	186660599	NM_001114107	B2R866|O43590|O60439|O60440|Q8N6Y6|Q9BVP4	Missense_Mutation	SNP	ENST00000284770.5	37	CCDS3844.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.633619	0.87660	.	.	ENSG00000154553	ENST00000284770;ENST00000284771	D;D	0.87179	-2.22;-2.22	5.5	5.5	0.81552	Zinc finger, LIM-type (5);	0.049662	0.85682	D	0.000000	D	0.94208	0.8141	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.994;1.0	D	0.92943	0.6374	10	0.37606	T	0.19	-22.9219	19.7571	0.96298	0.0:1.0:0.0:0.0	.	265;313	Q53GG5-2;Q53GG5	.;PDLI3_HUMAN	Q	313;265	ENSP00000284770:R313Q;ENSP00000284771:R265Q	ENSP00000284770:R313Q	R	-	2	0	PDLIM3	186660599	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	4.928000	0.63447	2.758000	0.94735	0.561000	0.74099	CGG		PDLIM3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360499.2	NM_014476	
TMEM175	84286	hgsc.bcm.edu	37	4	947047	947047	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:947047A>G	ENST00000264771.4	+	8	717	c.532A>G	c.(532-534)Agg>Ggg	p.R178G	TMEM175_ENST00000508204.1_Missense_Mutation_p.R96G|TMEM175_ENST00000515740.1_Missense_Mutation_p.R62G|TMEM175_ENST00000504180.1_3'UTR	NM_032326.2	NP_115702.1	Q9BSA9	TM175_HUMAN	transmembrane protein 175	178						integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)		p.R178G(1)		NS(1)|endometrium(1)|large_intestine(2)|lung(6)|pancreas(1)|upper_aerodigestive_tract(3)	14			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CTCTGCCCACAGGGCTCTGTA	0.617																																					p.R178G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A532G	4						.						118.0	98.0	105.0					4																	947047		2203	4300	6503	937047	SO:0001583	missense	84286	exon8			BC005158	CCDS3341.1, CCDS75087.1, CCDS75088.1	4p16.3	2008-02-05			ENSG00000127419	ENSG00000127419			28709	protein-coding gene	gene with protein product						12477932	Standard	XM_005272301		Approved	MGC4618	uc003gbq.3	Q9BSA9	OTTHUMG00000118996	ENST00000264771.4:c.532A>G	4.37:g.947047A>G	ENSP00000264771:p.Arg178Gly	Somatic		Capture	SOLID	Phase_I	937047	NM_032326	D3DVN4|Q8ND13	Missense_Mutation	SNP	ENST00000264771.4	37	CCDS3341.1	.	.	.	.	.	.	.	.	.	.	a	6.310	0.425350	0.11987	.	.	ENSG00000127419	ENST00000264771;ENST00000514453;ENST00000515492;ENST00000359768;ENST00000509508;ENST00000515740;ENST00000508204;ENST00000510493	T;T;T;T	0.49720	1.34;0.77;1.43;0.8	4.71	0.771	0.18504	.	0.355002	0.26180	N	0.025868	T	0.35189	0.0923	L	0.51422	1.61	0.21950	N	0.999454	B;B;B	0.10296	0.0;0.0;0.003	B;B;B	0.08055	0.001;0.001;0.003	T	0.20672	-1.0268	10	0.41790	T	0.15	-29.3569	5.3084	0.15817	0.5109:0.388:0.1011:0.0	.	96;178;96	D6RBE5;Q9BSA9;B3KR27	.;TM175_HUMAN;.	G	178;165;96;96;84;62;96;96	ENSP00000264771:R178G;ENSP00000425181:R165G;ENSP00000427039:R62G;ENSP00000423669:R96G	ENSP00000264771:R178G	R	+	1	2	TMEM175	937047	0.940000	0.31905	0.054000	0.19295	0.003000	0.03518	2.352000	0.44080	-0.087000	0.12528	-0.388000	0.06559	AGG		TMEM175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239193.2	NM_032326	
STK32B	55351	hgsc.bcm.edu	37	4	5458595	5458595	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:5458595A>C	ENST00000282908.5	+	8	1150	c.728A>C	c.(727-729)gAg>gCg	p.E243A	STK32B_ENST00000508728.1_3'UTR|RN7SKP275_ENST00000364626.1_RNA|STK32B_ENST00000512636.1_Missense_Mutation_p.E166A|STK32B_ENST00000510398.1_Missense_Mutation_p.E196A	NM_018401.1	NP_060871.1			serine/threonine kinase 32B									p.E243A(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						TTCAAGGTGGAGCGTGTCCAC	0.577																																					p.E243A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A728C	4						.						109.0	82.0	91.0					4																	5458595		2203	4300	6503	5509496	SO:0001583	missense	55351	exon8			AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.728A>C	4.37:g.5458595A>C	ENSP00000282908:p.Glu243Ala	Somatic		Capture	SOLID	Phase_I	5509496	NM_018401		Missense_Mutation	SNP	ENST00000282908.5	37	CCDS3380.1	.	.	.	.	.	.	.	.	.	.	A	0.029	-1.351033	0.01256	.	.	ENSG00000152953	ENST00000282908;ENST00000512636;ENST00000510398	T;T;T	0.65178	-0.14;-0.14;-0.14	5.01	3.8	0.43715	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43416	U	0.000563	T	0.37919	0.1021	N	0.10809	0.05	0.46203	D	0.998925	B	0.14012	0.009	B	0.14023	0.01	T	0.12426	-1.0548	10	0.09084	T	0.74	.	11.0751	0.48027	0.844:0.156:0.0:0.0	.	243	Q9NY57	ST32B_HUMAN	A	243;166;196	ENSP00000282908:E243A;ENSP00000423209:E166A;ENSP00000420984:E196A	ENSP00000282908:E243A	E	+	2	0	STK32B	5509496	1.000000	0.71417	0.968000	0.41197	0.182000	0.23217	2.661000	0.46758	0.829000	0.34733	0.459000	0.35465	GAG		STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206854.4	NM_018401	
SLC2A9	56606	hgsc.bcm.edu	37	4	9836593	9836593	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:9836593T>C	ENST00000264784.3	-	11	1384	c.1331A>G	c.(1330-1332)cAa>cGa	p.Q444R	SLC2A9_ENST00000309065.3_Missense_Mutation_p.Q415R|SLC2A9_ENST00000506583.1_Missense_Mutation_p.Q415R	NM_020041.2	NP_064425.2	Q9NRM0	GTR9_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 9	444					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)|sugar:proton symporter activity (GO:0005351)	p.Q415R(1)|p.Q444R(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(1)	35					Losartan(DB00678)|Probenecid(DB01032)	CCGCTGAGATTGCTGGAAGAA	0.527																																					p.Q415R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1244G	4						.						83.0	74.0	77.0					4																	9836593		2203	4300	6503	9445691	SO:0001583	missense	56606	exon12			AF210317	CCDS3406.1, CCDS3407.1	4p16.1	2013-05-22			ENSG00000109667	ENSG00000109667		"""Solute carriers"""	13446	protein-coding gene	gene with protein product	"""urate voltage-driven efflux transporter 1"""	606142				10860667, 17710649	Standard	NM_020041		Approved	Glut9, GLUTX, URATv1	uc003gmc.3	Q9NRM0	OTTHUMG00000044263	ENST00000264784.3:c.1331A>G	4.37:g.9836593T>C	ENSP00000264784:p.Gln444Arg	Somatic		Capture	SOLID	Phase_I	9445691	NM_001001290	Q0VGC4|Q4W5D1|Q8WV30|Q96P00	Missense_Mutation	SNP	ENST00000264784.3	37	CCDS3407.1	.	.	.	.	.	.	.	.	.	.	T	15.05	2.718922	0.48622	.	.	ENSG00000109667	ENST00000506583;ENST00000264784;ENST00000309065	T;T;T	0.55760	0.5;0.5;0.5	5.39	4.18	0.49190	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.75347	0.3837	M	0.91196	3.185	0.38134	D	0.938243	D;D	0.89917	1.0;0.999	D;D	0.76575	0.979;0.988	T	0.80341	-0.1423	10	0.87932	D	0	.	9.8406	0.40996	0.1537:0.0:0.0:0.8463	.	415;444	Q9NRM0-2;Q9NRM0	.;GTR9_HUMAN	R	415;444;415	ENSP00000422209:Q415R;ENSP00000264784:Q444R;ENSP00000311383:Q415R	ENSP00000264784:Q444R	Q	-	2	0	SLC2A9	9445691	1.000000	0.71417	0.731000	0.30826	0.067000	0.16453	5.585000	0.67497	0.852000	0.35287	0.477000	0.44152	CAA		SLC2A9-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207055.1		
SLC34A2	10568	hgsc.bcm.edu	37	4	25672398	25672398	+	Silent	SNP	T	T	C	rs181267814		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:25672398T>C	ENST00000382051.3	+	8	920	c.870T>C	c.(868-870)gaT>gaC	p.D290D	SLC34A2_ENST00000503434.1_Silent_p.D289D|SLC34A2_ENST00000504570.1_Silent_p.D289D	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	290					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)	p.D290D(1)	SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				CAATGAACGATGAAAAAGCGA	0.418			T	ROS1	NSCLC								T|||	1	0.000199681	0.0	0.0	5008	,	,		20630	0.001		0.0	False		,,,				2504	0.0				p.D289D			Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T867C	4						.						74.0	67.0	70.0					4																	25672398		2203	4300	6503	25281496	SO:0001819	synonymous_variant	10568	exon8			AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.870T>C	4.37:g.25672398T>C		Somatic		Capture	SOLID	Phase_I	25281496	NM_001177999	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Silent	SNP	ENST00000382051.3	37	CCDS3435.1																																																																																				SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424	
RFC1	5981	hgsc.bcm.edu	37	4	39324981	39324981	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:39324981A>G	ENST00000381897.1	-	7	832	c.699T>C	c.(697-699)gaT>gaC	p.D233D	RFC1_ENST00000418436.1_5'UTR|RFC1_ENST00000349703.2_Silent_p.D233D	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	233					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)	p.D233D(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						TGGGTTCTTCATCCAACATGG	0.423																																					p.D233D	Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T699C	4						.						215.0	173.0	187.0					4																	39324981		2203	4300	6503	39001376	SO:0001819	synonymous_variant	5981	exon7			L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.699T>C	4.37:g.39324981A>G		Somatic		Capture	SOLID	Phase_I	39001376	NM_002913	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Silent	SNP	ENST00000381897.1	37	CCDS56329.1																																																																																				RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216808.1	NM_002913	
N4BP2	55728	hgsc.bcm.edu	37	4	40123356	40123356	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:40123356G>A	ENST00000261435.6	+	9	4041	c.3625G>A	c.(3625-3627)Gtc>Atc	p.V1209I		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	1209					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)	p.V1209I(1)		breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						AATGAGAGCTGTCACTCCTGA	0.438																																					p.V1209I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3625A	4						.						71.0	70.0	71.0					4																	40123356		2203	4300	6503	39799751	SO:0001583	missense	55728	exon9			AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.3625G>A	4.37:g.40123356G>A	ENSP00000261435:p.Val1209Ile	Somatic		Capture	SOLID	Phase_I	39799751	NM_018177	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	37	CCDS3457.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.011|0.011	-1.707340|-1.707340	0.00719|0.00719	.|.	.|.	ENSG00000078177|ENSG00000078177	ENST00000513269|ENST00000261435;ENST00000381804	.|T	.|0.16073	.|2.37	5.86|5.86	-5.92|-5.92	0.02261|0.02261	.|.	.|1.576480	.|0.03323	.|N	.|0.192248	T|T	0.04227|0.04227	0.0117|0.0117	N|N	0.00436|0.00436	-1.5|-1.5	0.09310|0.09310	N|N	1|1	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.04013	.|0.001;0.0	T|T	0.40478|0.40478	-0.9561|-0.9561	5|10	.|0.14656	.|T	.|0.56	1.1131|1.1131	10.483|10.483	0.44704|0.44704	0.2547:0.0:0.6173:0.128|0.2547:0.0:0.6173:0.128	.|.	.|1209;1209	.|Q86UW6-2;Q86UW6	.|.;N4BP2_HUMAN	Y|I	855|1209;1129	.|ENSP00000261435:V1209I	.|ENSP00000261435:V1209I	C|V	+|+	2|1	0|0	N4BP2|N4BP2	39799751|39799751	.|.	.|.	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	.|.	.|.	-1.071000|-1.071000	0.03145|0.03145	-0.471000|-0.471000	0.05019|0.05019	TGT|GTC		N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
ATP8A1	10396	hgsc.bcm.edu	37	4	42577654	42577654	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:42577654A>G	ENST00000381668.5	-	13	1422	c.1191T>C	c.(1189-1191)aaT>aaC	p.N397N	ATP8A1_ENST00000264449.10_Silent_p.N397N	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	397					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.N397N(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	CAAGTTCCTCATTCAGATTAG	0.358																																					p.N397N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1191C	4						.						169.0	173.0	172.0					4																	42577654		2203	4300	6503	42272411	SO:0001819	synonymous_variant	10396	exon13			AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.1191T>C	4.37:g.42577654A>G		Somatic		Capture	SOLID	Phase_I	42272411	NM_006095	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Silent	SNP	ENST00000381668.5	37	CCDS3466.1																																																																																				ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095	
KCTD8	386617	hgsc.bcm.edu	37	4	44177065	44177065	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:44177065T>C	ENST00000360029.3	-	2	1447	c.1164A>G	c.(1162-1164)acA>acG	p.T388T		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	388					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)		p.T388T(1)		central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						GGCGATCCAATGTTAAAGTGT	0.522										HNSCC(17;0.042)																											p.T388T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1164G	4						.						163.0	160.0	161.0					4																	44177065		2203	4300	6503	43871822	SO:0001819	synonymous_variant	386617	exon2			AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1164A>G	4.37:g.44177065T>C		Somatic		Capture	SOLID	Phase_I	43871822	NM_198353	A2RU39	Silent	SNP	ENST00000360029.3	37	CCDS3467.1	.	.	.	.	.	.	.	.	.	.	T	0.008	-1.868604	0.00547	.	.	ENSG00000183783	ENST00000515268	.	.	.	4.56	-9.11	0.00711	.	.	.	.	.	T	0.33731	0.0873	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38499	-0.9658	4	.	.	.	.	2.0288	0.03525	0.2843:0.2121:0.3702:0.1335	.	.	.	.	R	124	.	.	H	-	2	0	KCTD8	43871822	0.000000	0.05858	0.454000	0.27019	0.057000	0.15508	-2.712000	0.00817	-2.242000	0.00708	-1.159000	0.01794	CAT		KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
LNX1	84708	hgsc.bcm.edu	37	4	54347988	54347988	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:54347988G>A	ENST00000263925.7	-	7	1698	c.1384C>T	c.(1384-1386)Cgc>Tgc	p.R462C	FIP1L1_ENST00000507166.1_Intron|LNX1_ENST00000306888.2_Missense_Mutation_p.R366C	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	462	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R366C(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CGAACCTGGCGGGACACGACG	0.592																																					p.R462C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1384T	4						.						63.0	61.0	61.0					4																	54347988		2203	4300	6503	54042745	SO:0001583	missense	84708	exon7			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.1384C>T	4.37:g.54347988G>A	ENSP00000263925:p.Arg462Cys	Somatic		Capture	SOLID	Phase_I	54042745	NM_001126328	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Missense_Mutation	SNP	ENST00000263925.7	37	CCDS47057.1	.	.	.	.	.	.	.	.	.	.	G	16.29	3.080319	0.55753	.	.	ENSG00000072201	ENST00000306888;ENST00000538207;ENST00000263925	T;T	0.40756	1.02;1.02	4.91	4.91	0.64330	PDZ/DHR/GLGF (3);	0.000000	0.85682	D	0.000000	T	0.73418	0.3584	H	0.95043	3.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.98;0.999	T	0.81269	-0.1009	10	0.87932	D	0	.	13.2782	0.60200	0.0:0.0:0.8417:0.1583	.	462;366	Q8TBB1;Q8TBB1-2	LNX1_HUMAN;.	C	366;300;462	ENSP00000302879:R366C;ENSP00000263925:R462C	ENSP00000263925:R462C	R	-	1	0	LNX1	54042745	1.000000	0.71417	1.000000	0.80357	0.088000	0.18126	4.434000	0.59935	2.538000	0.85594	0.561000	0.74099	CGC		LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219934.2		
EPHA5	2044	hgsc.bcm.edu	37	4	66233079	66233079	+	Silent	SNP	C	C	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:66233079C>G	ENST00000273854.3	-	10	2520	c.1920G>C	c.(1918-1920)ggG>ggC	p.G640G	EPHA5_ENST00000511294.1_Silent_p.G641G|EPHA5_ENST00000354839.4_Silent_p.G618G|EPHA5_ENST00000432638.2_Silent_p.G477G	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	640					axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.G640G(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						GCTTACTGTGCCCATTATGAA	0.333										TSP Lung(17;0.13)																											p.G640G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1920C	4						.						106.0	92.0	97.0					4																	66233079		2203	4300	6503	65915674	SO:0001819	synonymous_variant	2044	exon10			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1920G>C	4.37:g.66233079C>G		Somatic		Capture	SOLID	Phase_I	65915674	NM_004439	Q7Z3F2	Silent	SNP	ENST00000273854.3	37	CCDS3513.1																																																																																				EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
EPHA5	2044	hgsc.bcm.edu	37	4	66361119	66361119	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:66361119T>C	ENST00000273854.3	-	4	1653	c.1053A>G	c.(1051-1053)acA>acG	p.T351T	EPHA5_ENST00000511294.1_Silent_p.T351T|EPHA5_ENST00000354839.4_Silent_p.T351T|EPHA5_ENST00000432638.2_Intron	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	351	Cys-rich.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.T351T(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TGCATGCCATTGTGGGTGGAT	0.448										TSP Lung(17;0.13)																											p.T351T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1053G	4						.						165.0	162.0	163.0					4																	66361119		2203	4300	6503	66043714	SO:0001819	synonymous_variant	2044	exon4			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1053A>G	4.37:g.66361119T>C		Somatic		Capture	SOLID	Phase_I	66043714	NM_004439	Q7Z3F2	Silent	SNP	ENST00000273854.3	37	CCDS3513.1																																																																																				EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
UGT2B4	7363	hgsc.bcm.edu	37	4	70361491	70361491	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:70361491G>T	ENST00000305107.6	-	1	135	c.89C>A	c.(88-90)cCc>cAc	p.P30H	UGT2B4_ENST00000381096.3_Intron|UGT2B4_ENST00000506580.1_5'UTR|UGT2B4_ENST00000512583.1_Missense_Mutation_p.P30H	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	30					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.P30H(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	GAATTCTGTGGGCCACACCAG	0.458																																					p.P30H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C89A	4						.						147.0	149.0	148.0					4																	70361491		2203	4300	6503	70396080	SO:0001583	missense	7363	exon1			BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.89C>A	4.37:g.70361491G>T	ENSP00000305221:p.Pro30His	Somatic		Capture	SOLID	Phase_I	70396080	NM_021139	A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Missense_Mutation	SNP	ENST00000305107.6	37	CCDS43234.1	.	.	.	.	.	.	.	.	.	.	G	9.343	1.063481	0.20067	.	.	ENSG00000156096	ENST00000512583;ENST00000305107;ENST00000510114	T;T;T	0.66815	-0.23;-0.23;-0.23	2.41	2.41	0.29592	.	0.225686	0.30329	U	0.009863	D	0.84343	0.5451	H	0.94964	3.605	0.50632	D	0.999887	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.98	D	0.86894	0.2050	10	0.72032	D	0.01	.	10.5565	0.45121	0.0:0.0:1.0:0.0	.	30;30	G5E9X8;P06133	.;UD2B4_HUMAN	H	30	ENSP00000421290:P30H;ENSP00000305221:P30H;ENSP00000421113:P30H	ENSP00000305221:P30H	P	-	2	0	UGT2B4	70396080	0.995000	0.38212	0.648000	0.29521	0.014000	0.08584	2.526000	0.45607	1.343000	0.45638	0.306000	0.20318	CCC		UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139	
NUP54	53371	hgsc.bcm.edu	37	4	77065315	77065315	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:77065315C>T	ENST00000264883.3	-	3	422	c.282G>A	c.(280-282)caG>caA	p.Q94Q	NUP54_ENST00000458189.2_5'UTR|NUP54_ENST00000514987.1_Intron|NUP54_ENST00000515460.1_5'UTR|NUP54_ENST00000342467.6_5'UTR	NM_017426.2	NP_059122.2	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa	94	9 X 2 AA repeats of F-G.|Poly-Gln.|Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein targeting (GO:0006605)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nucleocytoplasmic transporter activity (GO:0005487)	p.Q94Q(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(3)|skin(1)|stomach(1)	19						TTTGCTGCTGCTGCTGTGTAT	0.408																																					p.Q94Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G282A	4						.						205.0	205.0	205.0					4																	77065315		2203	4300	6503	77284339	SO:0001819	synonymous_variant	53371	exon3			AF157322	CCDS3576.1, CCDS63998.1	4q21.1	2008-07-03	2002-08-29		ENSG00000138750	ENSG00000138750			17359	protein-coding gene	gene with protein product		607607	"""nucleoporin 54kD"""			8707840	Standard	NM_017426		Approved		uc003hjs.3	Q7Z3B4	OTTHUMG00000130098	ENST00000264883.3:c.282G>A	4.37:g.77065315C>T		Somatic		Capture	SOLID	Phase_I	77284339	NM_017426	B2RCK7|B4DT35|Q96EA7|Q9NVL5|Q9P0I1	Silent	SNP	ENST00000264883.3	37	CCDS3576.1																																																																																				NUP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252402.3		
SCD5	79966	hgsc.bcm.edu	37	4	83582224	83582224	+	Intron	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:83582224C>A	ENST00000319540.4	-	3	889				SCD5_ENST00000273908.4_Missense_Mutation_p.Q192H	NM_001037582.2	NP_001032671.2	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5						fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)	p.Q192H(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	13		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				TCTGGATGTGCTGTGTACTGA	0.423																																					p.Q192H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G576T	4						.						147.0	151.0	150.0					4																	83582224		2203	4300	6503	83801248	SO:0001627	intron_variant	79966	exon4			AF389338	CCDS3595.1, CCDS34024.1	4q21.3	2013-01-25	2005-06-09	2005-06-09	ENSG00000145284	ENSG00000145284		"""Fatty acid desaturases"""	21088	protein-coding gene	gene with protein product		608370	"""stearoyl-CoA desaturase 4"""	SCD4		12477932	Standard	NM_024906		Approved	ACOD4, FLJ21032, FADS4, HSCD5	uc003hna.2	Q86SK9	OTTHUMG00000130293	ENST00000319540.4:c.569+19635G>T	4.37:g.83582224C>A		Somatic		Capture	SOLID	Phase_I	83801248	NM_024906	B2RPG0|Q4W5Q5|Q8NDS0|Q9H7D1	Missense_Mutation	SNP	ENST00000319540.4	37	CCDS34024.1	.	.	.	.	.	.	.	.	.	.	C	8.431	0.848702	0.17034	.	.	ENSG00000145284	ENST00000273908	T	0.13778	2.56	3.45	1.57	0.23409	.	.	.	.	.	T	0.09818	0.0241	.	.	.	0.09310	N	1	B	0.29955	0.263	B	0.26094	0.066	T	0.28202	-1.0051	8	0.87932	D	0	.	5.8233	0.18540	0.2242:0.5582:0.2176:0.0	.	192	Q86SK9-2	.	H	192	ENSP00000273908:Q192H	ENSP00000273908:Q192H	Q	-	3	2	SCD5	83801248	0.009000	0.17119	0.002000	0.10522	0.021000	0.10359	0.399000	0.20916	0.392000	0.25172	0.591000	0.81541	CAG		SCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252635.1	NM_024906	
WDFY3	23001	hgsc.bcm.edu	37	4	85626604	85626604	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:85626604T>G	ENST00000295888.4	-	54	8685	c.8278A>C	c.(8278-8280)Aca>Cca	p.T2760P	WDFY3_ENST00000322366.6_Missense_Mutation_p.T2743P	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2760	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.|Interaction with SQSTM1.|Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.T2760P(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CGTTCATCTGTTTGTGCTCCC	0.388																																					p.T2760P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A8278C	4						.						231.0	202.0	212.0					4																	85626604		2203	4300	6503	85845628	SO:0001583	missense	23001	exon54			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.8278A>C	4.37:g.85626604T>G	ENSP00000295888:p.Thr2760Pro	Somatic		Capture	SOLID	Phase_I	85845628	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.764905	0.90020	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000514711	T;T;T	0.64618	-0.11;-0.11;-0.11	5.64	5.64	0.86602	BEACH domain (4);	0.000000	0.85682	D	0.000000	D	0.82370	0.5022	M	0.91354	3.2	0.80722	D	1	D	0.69078	0.997	D	0.65874	0.939	D	0.85723	0.1326	10	0.54805	T	0.06	.	16.0238	0.80522	0.0:0.0:0.0:1.0	.	2760	Q8IZQ1	WDFY3_HUMAN	P	2743;2760;363	ENSP00000318466:T2743P;ENSP00000295888:T2760P;ENSP00000424987:T363P	ENSP00000295888:T2760P	T	-	1	0	WDFY3	85845628	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.778000	0.85637	2.367000	0.80283	0.528000	0.53228	ACA		WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
TSPAN5	10098	hgsc.bcm.edu	37	4	99403225	99403225	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:99403225T>C	ENST00000305798.3	-	4	783	c.381A>G	c.(379-381)atA>atG	p.I127M	TSPAN5_ENST00000505184.1_Missense_Mutation_p.I56M|TSPAN5_ENST00000509168.1_5'UTR	NM_005723.3	NP_005714.2	P62079	TSN5_HUMAN	tetraspanin 5	127					establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)	p.I127M(1)		kidney(2)|large_intestine(6)|lung(5)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;1.89e-07)		TGTTGTTGTTTATAAAGAAAT	0.378																																					p.I127M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A381G	4						.						132.0	136.0	134.0					4																	99403225		2203	4300	6503	99622248	SO:0001583	missense	10098	exon4				CCDS3646.1	4q22.3	2013-02-14	2005-03-21	2005-03-21	ENSG00000168785	ENSG00000168785		"""Tetraspanins"""	17753	protein-coding gene	gene with protein product		613136	"""transmembrane 4 superfamily member 9"""	TM4SF9			Standard	NM_005723		Approved	Tspan-5, NET-4	uc003hub.3	P62079	OTTHUMG00000131008	ENST00000305798.3:c.381A>G	4.37:g.99403225T>C	ENSP00000307701:p.Ile127Met	Somatic		Capture	SOLID	Phase_I	99622248	NM_005723	B2RDY2|O60628|O60746|Q6FHE5|Q9JLY1	Missense_Mutation	SNP	ENST00000305798.3	37	CCDS3646.1	.	.	.	.	.	.	.	.	.	.	T	17.49	3.403575	0.62288	.	.	ENSG00000168785	ENST00000305798;ENST00000505184;ENST00000515287;ENST00000511651	D;D;D;T	0.87412	-2.25;-2.25;-2.25;1.35	5.94	1.79	0.24919	Tetraspanin, EC2 domain (1);	0.000000	0.85682	D	0.000000	T	0.78059	0.4224	L	0.35723	1.085	0.58432	D	0.999998	B	0.33777	0.425	B	0.33196	0.159	T	0.70454	-0.4867	10	0.42905	T	0.14	.	6.9397	0.24486	0.2416:0.0:0.3471:0.4113	.	127	P62079	TSN5_HUMAN	M	127;56;56;56	ENSP00000307701:I127M;ENSP00000423916:I56M;ENSP00000423504:I56M;ENSP00000426248:I56M	ENSP00000307701:I127M	I	-	3	3	TSPAN5	99622248	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.005000	0.29834	0.443000	0.26582	0.528000	0.53228	ATA		TSPAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253641.2	NM_005723	
TLR3	7098	hgsc.bcm.edu	37	4	187000107	187000107	+	Silent	SNP	G	G	A	rs545122782	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr4:187000107G>A	ENST00000296795.3	+	3	659	c.555G>A	c.(553-555)gcG>gcA	p.A185A	TLR3_ENST00000504367.1_5'Flank	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	185					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.A185A(1)		breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		AAATTCAAGCGCTAAAAAGTG	0.313																																					p.A185A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G555A	4						.						39.0	44.0	42.0					4																	187000107		2202	4300	6502	187237101	SO:0001819	synonymous_variant	7098	exon3			U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.555G>A	4.37:g.187000107G>A		Somatic		Capture	SOLID	Phase_I	187237101	NM_003265	B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Silent	SNP	ENST00000296795.3	37	CCDS3846.1																																																																																				TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360313.4		
SERPINA7	6906	hgsc.bcm.edu	37	X	105277624	105277624	+	Missense_Mutation	SNP	A	A	C	rs267606303		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:105277624A>C	ENST00000327674.4	-	4	1450	c.1115T>G	c.(1114-1116)cTt>cGt	p.L372R	SERPINA7_ENST00000487487.1_5'Flank|SERPINA7_ENST00000372563.1_Missense_Mutation_p.L372R			P05543	THBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7	372					aging (GO:0007568)|negative regulation of endopeptidase activity (GO:0010951)|post-embryonic development (GO:0009791)|regulation of proteolysis (GO:0030162)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to peptide hormone (GO:0043434)|response to prostaglandin E (GO:0034695)|response to vitamin A (GO:0033189)|thyroid hormone transport (GO:0070327)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone binding (GO:0042562)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.L372R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|skin(3)	24					Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CTGATCCGAAAGTTCAACTTC	0.453																																					p.L372R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1115G	X						.						224.0	218.0	220.0					X																	105277624		2203	4300	6503	105164280	SO:0001583	missense	6906	exon5			M14091	CCDS14518.1	Xq21-q22	2014-02-18	2005-08-18		ENSG00000123561	ENSG00000123561		"""Serine (or cysteine) peptidase inhibitors"""	11583	protein-coding gene	gene with protein product	"""thyroxin-binding globulin"", ""thyroxine-binding globulin"", ""alpha-1 antiproteinase, antitrypsin"""	314200	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7"""	TBG		24172014	Standard	NM_000354		Approved		uc004eme.2	P05543	OTTHUMG00000022144	ENST00000327674.4:c.1115T>G	X.37:g.105277624A>C	ENSP00000329374:p.Leu372Arg	Somatic		Capture	SOLID	Phase_I	105164280	NM_000354	D3DUX1	Missense_Mutation	SNP	ENST00000327674.4	37	CCDS14518.1	.	.	.	.	.	.	.	.	.	.	A	11.86	1.765018	0.31228	.	.	ENSG00000123561	ENST00000327674;ENST00000372563	D;D	0.88354	-2.37;-2.37	4.9	3.74	0.42951	Serpin domain (3);	0.651463	0.14451	N	0.318818	D	0.87394	0.6166	L	0.35341	1.055	0.09310	N	1	P	0.41498	0.752	P	0.51550	0.673	T	0.78458	-0.2196	10	0.66056	D	0.02	.	7.4573	0.27274	0.8934:0.0:0.1066:0.0	.	372	P05543	THBG_HUMAN	R	372	ENSP00000329374:L372R;ENSP00000361644:L372R	ENSP00000329374:L372R	L	-	2	0	SERPINA7	105164280	0.001000	0.12720	0.001000	0.08648	0.050000	0.14768	0.679000	0.25291	0.805000	0.34159	0.481000	0.45027	CTT		SERPINA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057790.1	NM_000354	
IL13RA2	3598	hgsc.bcm.edu	37	X	114244112	114244112	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:114244112T>C	ENST00000371936.1	-	8	1073	c.824A>G	c.(823-825)gAg>gGg	p.E275G	IL13RA2_ENST00000243213.1_Missense_Mutation_p.E275G			Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2	275	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)	p.E275G(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	23						TTCTCTGATCTCAATTTCATA	0.348																																					p.E275G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A824G	X						.						79.0	68.0	72.0					X																	114244112		2203	4300	6503	114150368	SO:0001583	missense	3598	exon7			X95302	CCDS14565.1	Xq23	2014-01-21			ENSG00000123496	ENSG00000123496		"""Interleukins and interleukin receptors"", ""CD molecules"""	5975	protein-coding gene	gene with protein product	"""cancer/testis antigen 19"""	300130				8663118, 9083087	Standard	NM_000640		Approved	IL-13R, IL13BP, CD213a2, CT19	uc004epx.3	Q14627	OTTHUMG00000022229	ENST00000371936.1:c.824A>G	X.37:g.114244112T>C	ENSP00000361004:p.Glu275Gly	Somatic		Capture	SOLID	Phase_I	114150368	NM_000640	A8K7E2|O00667	Missense_Mutation	SNP	ENST00000371936.1	37	CCDS14565.1	.	.	.	.	.	.	.	.	.	.	T	5.543	0.285165	0.10513	.	.	ENSG00000123496	ENST00000371936;ENST00000243213	T;T	0.70164	-0.46;-0.46	5.35	-1.89	0.07689	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.525934	0.22595	N	0.058039	T	0.57051	0.2027	M	0.62723	1.935	0.09310	N	1	B;P	0.39748	0.361;0.686	B;B	0.40506	0.038;0.331	T	0.53158	-0.8478	10	0.59425	D	0.04	1.0992	5.0758	0.14630	0.476:0.0:0.2498:0.2742	.	275;275	D0EFR8;Q14627	.;I13R2_HUMAN	G	275	ENSP00000361004:E275G;ENSP00000243213:E275G	ENSP00000243213:E275G	E	-	2	0	IL13RA2	114150368	0.065000	0.20965	0.000000	0.03702	0.011000	0.07611	0.665000	0.25083	-0.608000	0.05731	-0.496000	0.04628	GAG		IL13RA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057966.1	NM_000640	
ARHGAP36	158763	hgsc.bcm.edu	37	X	130220355	130220355	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:130220355C>T	ENST00000276211.5	+	10	1679	c.1334C>T	c.(1333-1335)cCg>cTg	p.P445L	ARHGAP36_ENST00000370921.1_Missense_Mutation_p.P309L|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.P433L	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	445					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.P445L(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						AAGTCCAGCCCGGAAGCACTT	0.483																																					p.P445L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1334T	X						.						108.0	100.0	102.0					X																	130220355		2203	4300	6503	130048036	SO:0001583	missense	158763	exon10				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1334C>T	X.37:g.130220355C>T	ENSP00000276211:p.Pro445Leu	Somatic		Capture	SOLID	Phase_I	130048036	NM_144967	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380121	0.42207	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000412432;ENST00000370921	T;T;T;T	0.11821	2.75;2.74;2.75;2.83	4.69	4.69	0.59074	.	0.000000	0.44688	D	0.000432	T	0.16685	0.0401	N	0.08118	0	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.66847	0.947;0.947;0.886	T	0.12400	-1.0549	10	0.56958	D	0.05	.	11.8952	0.52652	0.0:1.0:0.0:0.0	.	414;433;445	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	L	445;433;414;309	ENSP00000276211:P445L;ENSP00000359960:P433L;ENSP00000408515:P414L;ENSP00000359959:P309L	ENSP00000276211:P445L	P	+	2	0	ARHGAP36	130048036	1.000000	0.71417	0.998000	0.56505	0.216000	0.24613	2.587000	0.46128	2.291000	0.77112	0.600000	0.82982	CCG		ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
GPC3	2719	hgsc.bcm.edu	37	X	133087215	133087215	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:133087215G>T	ENST00000370818.3	-	2	644	c.199C>A	c.(199-201)Cct>Act	p.P67T	GPC3_ENST00000394299.2_Missense_Mutation_p.P67T|GPC3_ENST00000543339.1_Intron	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	67					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)	p.P67T(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					GGGCCCTTAGGGAGACATACT	0.468			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																												p.P67T		yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C199A	X						.						248.0	204.0	219.0					X																	133087215		2203	4300	6503	132914881	SO:0001583	missense	2719	exon2	Familial Cancer Database	SGBS	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.199C>A	X.37:g.133087215G>T	ENSP00000359854:p.Pro67Thr	Somatic		Capture	SOLID	Phase_I	132914881	NM_001164618	C9JLE3|G3V1R0|Q2L880|Q2L882	Missense_Mutation	SNP	ENST00000370818.3	37	CCDS14638.1	.	.	.	.	.	.	.	.	.	.	G	1.562	-0.536548	0.04082	.	.	ENSG00000147257	ENST00000370818;ENST00000394299	T;T	0.61040	0.14;0.14	5.3	3.18	0.36537	.	0.410745	0.24693	N	0.036375	T	0.36054	0.0953	N	0.20685	0.6	0.80722	D	1	B;B;B	0.14012	0.004;0.009;0.005	B;B;B	0.20384	0.012;0.029;0.029	T	0.07986	-1.0744	10	0.16896	T	0.51	.	6.3511	0.21377	0.1891:0.0:0.6593:0.1516	.	67;67;67	B4DTD8;C9JLE3;P51654	.;.;GPC3_HUMAN	T	67	ENSP00000359854:P67T;ENSP00000377836:P67T	ENSP00000359854:P67T	P	-	1	0	GPC3	132914881	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.895000	0.48648	1.005000	0.39183	0.506000	0.49869	CCT		GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058356.1	NM_004484	
ARSH	347527	hgsc.bcm.edu	37	X	2928156	2928156	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:2928156G>A	ENST00000381130.2	+	2	178	c.178G>A	c.(178-180)Gct>Act	p.A60T		NM_001011719.1	NP_001011719.1	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	60					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.A60T(1)		breast(3)|endometrium(8)|kidney(2)|large_intestine(6)|lung(13)|skin(1)|stomach(1)	34		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				CCCAAGTCGGGCTGCCTTCCT	0.507																																					p.A60T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G178A	X						.						64.0	49.0	54.0					X																	2928156		2203	4300	6503	2938156	SO:0001583	missense	347527	exon2			AY875940	CCDS35198.1	Xp22.33	2013-02-14	2006-03-07		ENSG00000205667	ENSG00000205667		"""Arylsulfatase family"""	32488	protein-coding gene	gene with protein product		300586	"""arylsulfatase H"""			16174644	Standard	NM_001011719		Approved		uc011mhj.2	Q5FYA8	OTTHUMG00000159612	ENST00000381130.2:c.178G>A	X.37:g.2928156G>A	ENSP00000370522:p.Ala60Thr	Somatic		Capture	SOLID	Phase_I	2938156	NM_001011719		Missense_Mutation	SNP	ENST00000381130.2	37	CCDS35198.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.351162	0.41700	.	.	ENSG00000205667	ENST00000381130	D	0.94966	-3.57	3.58	1.73	0.24493	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase, conserved site (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.118294	0.56097	D	0.000023	D	0.95809	0.8636	M	0.85041	2.73	0.40080	D	0.976123	D	0.63880	0.993	P	0.57283	0.817	D	0.94006	0.7280	10	0.62326	D	0.03	.	8.008	0.30336	0.0956:0.1569:0.7475:0.0	.	60	Q5FYA8	ARSH_HUMAN	T	60	ENSP00000370522:A60T	ENSP00000370522:A60T	A	+	1	0	ARSH	2938156	1.000000	0.71417	0.013000	0.15412	0.020000	0.10135	3.943000	0.56621	0.073000	0.16731	-0.229000	0.12294	GCT		ARSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356489.1	NM_001011719	
MXRA5	25878	hgsc.bcm.edu	37	X	3228941	3228941	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:3228941C>T	ENST00000217939.6	-	7	7457	c.7303G>A	c.(7303-7305)Gtc>Atc	p.V2435I		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2435						extracellular vesicular exosome (GO:0070062)		p.V2435I(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGGACGTTGACGTGAATCCAC	0.567																																					p.V2435I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G7303A	X						.						108.0	60.0	76.0					X																	3228941		2203	4300	6503	3238941	SO:0001583	missense	25878	exon7			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.7303G>A	X.37:g.3228941C>T	ENSP00000217939:p.Val2435Ile	Somatic		Capture	SOLID	Phase_I	3238941	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.006097	0.35415	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.58652	0.32	3.54	3.54	0.40534	Immunoglobulin-like fold (1);	0.000000	0.34435	U	0.003971	T	0.66992	0.2846	L	0.49778	1.585	0.31649	N	0.64705	D	0.65815	0.995	P	0.62560	0.904	T	0.71813	-0.4479	10	0.41790	T	0.15	.	14.9813	0.71313	0.0:1.0:0.0:0.0	.	2435	Q9NR99	MXRA5_HUMAN	I	2435	ENSP00000217939:V2435I	ENSP00000217939:V2435I	V	-	1	0	MXRA5	3238941	0.990000	0.36364	0.005000	0.12908	0.010000	0.07245	3.017000	0.49615	1.406000	0.46857	0.597000	0.82753	GTC		MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
PCYT1B	9468	hgsc.bcm.edu	37	X	24580516	24580516	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:24580516G>A	ENST00000379144.2	-	8	1134	c.1004C>T	c.(1003-1005)tCg>tTg	p.S335L	PCYT1B_ENST00000379145.1_Missense_Mutation_p.S317L|PCYT1B_ENST00000356768.4_Intron	NM_004845.4	NP_004836.2	Q9Y5K3	PCY1B_HUMAN	phosphate cytidylyltransferase 1, choline, beta	335					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|ovarian follicle development (GO:0001541)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	choline-phosphate cytidylyltransferase activity (GO:0004105)	p.S335L(1)		breast(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	17					Choline(DB00122)	GAAGGTGGGCGATGGGGAGCG	0.617																																					p.S317L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C950T	X						.						59.0	49.0	53.0					X																	24580516		2203	4300	6503	24490437	SO:0001583	missense	9468	exon8			AF052510	CCDS14213.1, CCDS55391.1, CCDS55392.1	Xp22	2008-02-05	2005-09-05		ENSG00000102230	ENSG00000102230	2.7.7.15		8755	protein-coding gene	gene with protein product		604926	"""phosphate cytidylyltransferase 1, choline, beta isoform"""			9593753	Standard	NM_004845		Approved	CCT-beta, CTB	uc004dbi.3	Q9Y5K3	OTTHUMG00000021270	ENST00000379144.2:c.1004C>T	X.37:g.24580516G>A	ENSP00000368439:p.Ser335Leu	Somatic		Capture	SOLID	Phase_I	24490437	NM_001163264	A8IX00|B2RCX8|B4DK10|E9PD84|O60621|Q86XC9	Missense_Mutation	SNP	ENST00000379144.2	37	CCDS14213.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.975650	0.74360	.	.	ENSG00000102230	ENST00000379145;ENST00000379144	.	.	.	5.67	5.67	0.87782	.	0.132210	0.53938	D	0.000060	T	0.73102	0.3544	L	0.52573	1.65	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.61201	0.885;0.885	T	0.75657	-0.3242	9	0.87932	D	0	-11.6968	16.9558	0.86259	0.0:0.0:1.0:0.0	.	317;335	E9PD84;Q9Y5K3	.;PCY1B_HUMAN	L	317;335	.	ENSP00000368439:S335L	S	-	2	0	PCYT1B	24490437	1.000000	0.71417	0.411000	0.26484	0.910000	0.53928	9.065000	0.93941	2.382000	0.81193	0.544000	0.68410	TCG		PCYT1B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056103.1	NM_004845	
DMD	1756	hgsc.bcm.edu	37	X	32466753	32466753	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:32466753T>G	ENST00000357033.4	-	27	3812	c.3606A>C	c.(3604-3606)agA>agC	p.R1202S	DMD_ENST00000378677.2_Missense_Mutation_p.R1198S	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1202					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.R1197S(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTTCTTTAGCTCTCTGAAAAA	0.368																																					p.R1202S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3606C	X						.						84.0	77.0	79.0					X																	32466753		2201	4297	6498	32376674	SO:0001583	missense	1756	exon27			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3606A>C	X.37:g.32466753T>G	ENSP00000354923:p.Arg1202Ser	Somatic		Capture	SOLID	Phase_I	32376674	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	T	10.39	1.336745	0.24253	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.51817	0.69;0.69	4.66	2.15	0.27550	.	0.000000	0.36932	U	0.002323	T	0.25754	0.0627	N	0.20986	0.625	0.80722	D	1	B;B;B	0.12630	0.005;0.001;0.006	B;B;B	0.15484	0.007;0.009;0.013	T	0.05338	-1.0891	10	0.12103	T	0.63	.	5.8924	0.18921	0.151:0.0875:0.0:0.7615	.	1194;1202;1198	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	S	1194;1198;1202;1202;1079	ENSP00000367948:R1198S;ENSP00000354923:R1202S	ENSP00000354923:R1202S	R	-	3	2	DMD	32376674	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	1.281000	0.33214	1.627000	0.50400	0.345000	0.21793	AGA		DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
CDK16	5127	hgsc.bcm.edu	37	X	47085211	47085211	+	Silent	SNP	G	G	A	rs372258262		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:47085211G>A	ENST00000357227.4	+	7	1099	c.675G>A	c.(673-675)acG>acA	p.T225T	CDK16_ENST00000457458.2_Silent_p.T231T|CDK16_ENST00000518022.1_Silent_p.T225T|CDK16_ENST00000276052.6_Silent_p.T299T	NM_006201.4	NP_006192.1	Q00536	CDK16_HUMAN	cyclin-dependent kinase 16	225	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				exocytosis (GO:0006887)|growth hormone secretion (GO:0030252)|neuron projection development (GO:0031175)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|spermatogenesis (GO:0007283)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein serine/threonine kinase activity (GO:0004674)	p.T225T(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(3)	11						ACATCGTTACGCTACATGACA	0.562																																					p.T225T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G675A	X						.	G	,,	0,3835		0,0,1632,571	216.0	131.0	160.0		897,675,693	-11.1	0.6	X		160	1,6727		0,1,2427,1872	no	coding-synonymous,coding-synonymous,coding-synonymous	CDK16	NM_001170460.1,NM_006201.4,NM_033018.3	,,	0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095	,,	299/571,225/497,231/503	47085211	1,10562	2203	4300	6503	46970155	SO:0001819	synonymous_variant	5127	exon7				CCDS14276.1, CCDS48101.1, CCDS55408.1	Xp11	2011-11-08	2009-12-16	2009-12-16	ENSG00000102225	ENSG00000102225		"""Cyclin-dependent kinases"""	8749	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase"""	311550	"""PCTAIRE protein kinase 1"""	PCTK1		1437147, 19884882	Standard	NM_033018		Approved	PCTAIRE, PCTAIRE1, PCTGAIRE, FLJ16665	uc011mll.2	Q00536	OTTHUMG00000021438	ENST00000357227.4:c.675G>A	X.37:g.47085211G>A		Somatic		Capture	SOLID	Phase_I	46970155	NM_006201	A8K280|B7Z7C8|J3KN74|J3KQP7	Silent	SNP	ENST00000357227.4	37	CCDS14276.1																																																																																				CDK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056406.2	NM_006201	
ITIH6	347365	hgsc.bcm.edu	37	X	54776408	54776408	+	Missense_Mutation	SNP	G	G	C	rs377762816		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:54776408G>C	ENST00000218436.6	-	13	3891	c.3862C>G	c.(3862-3864)Cgc>Ggc	p.R1288G		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	1288					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R1288G(1)									GAAGCCCAGCGGGGCAGCAGC	0.587																																					p.R1288G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3862G	X						.						62.0	42.0	49.0					X																	54776408		2203	4300	6503	54793133	SO:0001583	missense	347365	exon13			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.3862C>G	X.37:g.54776408G>C	ENSP00000218436:p.Arg1288Gly	Somatic		Capture	SOLID	Phase_I	54793133	NM_198510	A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	G	7.255	0.604082	0.14002	.	.	ENSG00000102313	ENST00000218436	T	0.02472	4.28	3.28	0.442	0.16582	.	7.908350	0.01070	U	0.004818	T	0.02012	0.0063	N	0.08118	0	0.09310	N	1	B	0.17667	0.023	B	0.19946	0.027	T	0.43048	-0.9415	10	0.23302	T	0.38	.	4.7725	0.13162	0.1839:0.0:0.6318:0.1842	.	1288	Q6UXX5	ITH5L_HUMAN	G	1288	ENSP00000218436:R1288G	ENSP00000218436:R1288G	R	-	1	0	ITIH5L	54793133	0.042000	0.20092	0.413000	0.26509	0.862000	0.49288	0.384000	0.20668	0.126000	0.18424	0.284000	0.19432	CGC		ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510	
PJA1	64219	hgsc.bcm.edu	37	X	68382054	68382054	+	Missense_Mutation	SNP	C	C	T	rs140630019	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:68382054C>T	ENST00000361478.1	-	2	1405	c.1028G>A	c.(1027-1029)cGc>cAc	p.R343H	PJA1_ENST00000374583.1_Missense_Mutation_p.R343H|PJA1_ENST00000477231.1_5'Flank|PJA1_ENST00000374584.3_Missense_Mutation_p.R155H|PJA1_ENST00000374571.4_Missense_Mutation_p.R288H	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	343	Poly-Arg.				protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R155H(1)|p.R343H(1)		endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						GGCCATGGTGCGTCGTCGTCT	0.532																																					p.R288H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G863A	X						.		HIS/ARG,HIS/ARG,HIS/ARG	1,3834		0,0,1,1632,570	123.0	78.0	93.0		863,464,1028	-0.6	0.0	X	dbSNP_134	93	0,6728		0,0,0,2428,1872	no	missense,missense,missense	PJA1	NM_001032396.2,NM_022368.4,NM_145119.3	29,29,29	0,0,1,4060,2442	TT,TC,T,CC,C		0.0,0.0261,0.0095	probably-damaging,probably-damaging,probably-damaging	288/589,155/456,343/644	68382054	1,10562	2203	4300	6503	68298779	SO:0001583	missense	64219	exon2			AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.1028G>A	X.37:g.68382054C>T	ENSP00000355014:p.Arg343His	Somatic		Capture	SOLID	Phase_I	68298779	NM_001032396	A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Missense_Mutation	SNP	ENST00000361478.1	37	CCDS14393.1	.	.	.	.	.	.	.	.	.	.	c	11.97	1.797802	0.31777	2.61E-4	0.0	ENSG00000181191	ENST00000396010;ENST00000374584;ENST00000374583;ENST00000361478;ENST00000374571	T;T;T;T	0.05649	3.41;3.41;3.41;3.41	3.41	-0.552	0.11818	.	1.862440	0.03612	N	0.235019	T	0.13415	0.0325	L	0.44542	1.39	0.09310	N	1	D;D	0.71674	0.989;0.998	B;P	0.55785	0.379;0.784	T	0.28902	-1.0029	10	0.56958	D	0.05	-1.3413	8.1506	0.31139	0.0:0.5585:0.0:0.4415	.	343;155	Q8NG27;Q8NG27-2	PJA1_HUMAN;.	H	258;155;343;343;288	ENSP00000363712:R155H;ENSP00000363711:R343H;ENSP00000355014:R343H;ENSP00000363699:R288H	ENSP00000355014:R343H	R	-	2	0	PJA1	68298779	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.180000	0.16860	-0.551000	0.06175	-1.507000	0.00952	CGC		PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057031.2	NM_145119	
CXorf65	158830	hgsc.bcm.edu	37	X	70325892	70325892	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:70325892G>A	ENST00000374251.5	-	3	256	c.208C>T	c.(208-210)Cga>Tga	p.R70*		NM_001025265.2	NP_001020436.1	A6NEN9	CX065_HUMAN	chromosome X open reading frame 65	70								p.R70*(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)	10						TAGGTGCTTCGAGCTGTAAGG	0.458																																					p.R70X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C208T	X						.						179.0	135.0	150.0					X																	70325892		2203	4300	6503	70242617	SO:0001587	stop_gained	158830	exon3			BC144434	CCDS35324.1	Xq13.1	2009-03-06			ENSG00000204165	ENSG00000204165			33713	protein-coding gene	gene with protein product							Standard	NM_001025265		Approved		uc011mpo.2	A6NEN9	OTTHUMG00000021785	ENST00000374251.5:c.208C>T	X.37:g.70325892G>A	ENSP00000363369:p.Arg70*	Somatic		Capture	SOLID	Phase_I	70242617	NM_001025265		Nonsense_Mutation	SNP	ENST00000374251.5	37	CCDS35324.1	.	.	.	.	.	.	.	.	.	.	G	31	5.085054	0.94100	.	.	ENSG00000204165	ENST00000374251;ENST00000438526	.	.	.	4.87	3.94	0.45596	.	0.364656	0.25086	N	0.033255	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.4989	8.6551	0.34058	0.0:0.0:0.6807:0.3193	.	.	.	.	X	70	.	ENSP00000363369:R70X	R	-	1	2	CXorf65	70242617	0.939000	0.31865	0.998000	0.56505	0.881000	0.50899	1.474000	0.35398	2.259000	0.74868	0.529000	0.55759	CGA		CXorf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057089.2	NM_001025265	
KLHL4	56062	hgsc.bcm.edu	37	X	86773066	86773066	+	Missense_Mutation	SNP	G	G	A	rs200498506		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:86773066G>A	ENST00000373119.4	+	1	315	c.170G>A	c.(169-171)cGg>cAg	p.R57Q	KLHL4_ENST00000373114.4_Missense_Mutation_p.R57Q	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	57						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R57Q(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						AGCCACTCTCGGGACAGAAAC	0.542																																					p.R57Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G170A	X						.						76.0	64.0	68.0					X																	86773066		2203	4300	6503	86659722	SO:0001583	missense	56062	exon1			AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.170G>A	X.37:g.86773066G>A	ENSP00000362211:p.Arg57Gln	Somatic		Capture	SOLID	Phase_I	86659722	NM_057162	B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.693581	0.30052	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.75938	-0.98;-0.94	5.05	3.23	0.37069	.	0.696895	0.13004	N	0.421452	T	0.63850	0.2546	L	0.40543	1.245	0.49051	D	0.999745	B;B	0.18310	0.006;0.027	B;B	0.15870	0.004;0.014	T	0.52741	-0.8535	10	0.30854	T	0.27	.	9.1394	0.36894	0.1871:0.0:0.8129:0.0	.	57;57	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	Q	57	ENSP00000362211:R57Q;ENSP00000362206:R57Q	ENSP00000362206:R57Q	R	+	2	0	KLHL4	86659722	1.000000	0.71417	0.866000	0.34008	0.855000	0.48748	5.636000	0.67848	0.481000	0.27557	0.513000	0.50165	CGG		KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1		
USP26	83844	hgsc.bcm.edu	37	X	132160413	132160414	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	TT	TT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:132160413_132160414delTT	ENST00000511190.1	-	6	2304_2305	c.1835_1836delAA	c.(1834-1836)aaafs	p.K612fs	USP26_ENST00000370832.1_Frame_Shift_Del_p.K612fs|USP26_ENST00000406273.1_Frame_Shift_Del_p.K612fs	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	612	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.K611fs*4(1)|p.K612fs*6(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					CTGTCTGGCCTTTTTTTTGTTC	0.411																																					p.612_612del	NSCLC(104;342 1621 36940 47097 52632)											.	.	2	Deletion - Frameshift(2)	urinary_tract(1)|large_intestine(1)	c.1835_1836del	X						.																																			131988080	SO:0001589	frameshift_variant	83844	exon1			AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.1835_1836delAA	X.37:g.132160419_132160420delTT	ENSP00000423390:p.Lys612fs	Somatic		Capture	SOLID	Phase_I	131988079	NM_031907	B9WRT6|Q5H9H4	Frame_Shift_Del	DEL	ENST00000511190.1	37	CCDS14635.1																																																																																				USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907	
AFF2	2334	hgsc.bcm.edu	37	X	148035227	148035227	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chrX:148035227T>C	ENST00000370460.2	+	10	1994	c.1515T>C	c.(1513-1515)acT>acC	p.T505T	AFF2_ENST00000286437.5_Silent_p.T146T|AFF2_ENST00000370457.5_Silent_p.T472T|AFF2_ENST00000342251.3_Silent_p.T472T	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	505					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.T505T(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GTAGCACCACTGACAGCGAAT	0.602																																					p.T505T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1515C	X						.						131.0	121.0	124.0					X																	148035227		2203	4300	6503	147842927	SO:0001819	synonymous_variant	2334	exon10			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1515T>C	X.37:g.148035227T>C		Somatic		Capture	SOLID	Phase_I	147842927	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	ENST00000370460.2	37	CCDS14684.1																																																																																				AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
ATP6V1C2	245973	hgsc.bcm.edu	37	2	10904526	10904526	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:10904526T>C	ENST00000272238.4	+	5	462	c.353T>C	c.(352-354)gTg>gCg	p.V118A	ATP6V1C2_ENST00000381661.3_Missense_Mutation_p.V118A	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	118					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)	p.V118A(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		CAGCCGCTCGTGAGTGTGGTG	0.527																																					p.V118A	NSCLC(188;1042 2136 10807 16813 47705)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T353C	2						.						133.0	120.0	125.0					2																	10904526		2203	4300	6503	10821977	SO:0001583	missense	245973	exon5			AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.353T>C	2.37:g.10904526T>C	ENSP00000272238:p.Val118Ala	Somatic		Capture	SOLID	Phase_I	10821977	NM_001039362	Q96EL8	Missense_Mutation	SNP	ENST00000272238.4	37	CCDS42653.1	.	.	.	.	.	.	.	.	.	.	T	8.565	0.878627	0.17395	.	.	ENSG00000143882	ENST00000272238;ENST00000381661	T;T	0.40756	1.02;1.02	5.71	1.9	0.25705	.	0.415587	0.24229	N	0.040376	T	0.21347	0.0514	N	0.13140	0.3	0.20403	N	0.999909	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.13926	-1.0491	10	0.54805	T	0.06	-9.111	3.8543	0.08968	0.3627:0.1483:0.0:0.489	.	118;118	Q8NEY4-2;Q8NEY4	.;VATC2_HUMAN	A	118	ENSP00000272238:V118A;ENSP00000371077:V118A	ENSP00000272238:V118A	V	+	2	0	ATP6V1C2	10821977	1.000000	0.71417	0.598000	0.28837	0.791000	0.44710	2.710000	0.47169	0.080000	0.16959	0.533000	0.62120	GTG		ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323555.1	NM_144583	
ST6GAL2	84620	hgsc.bcm.edu	37	2	107450557	107450557	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:107450557C>T	ENST00000409382.3	-	3	1599	c.989G>A	c.(988-990)gGt>gAt	p.G330D	ST6GAL2_ENST00000361686.4_Missense_Mutation_p.G330D|ST6GAL2_ENST00000409087.3_Missense_Mutation_p.G330D|AC016994.2_ENST00000425419.1_RNA	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	330					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)	p.G330D(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						TTTCTCATAACCACGTGTAGG	0.378																																					p.G330D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G989A	2						.						197.0	190.0	193.0					2																	107450557		2203	4300	6503	106816989	SO:0001583	missense	84620	exon3			AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.989G>A	2.37:g.107450557C>T	ENSP00000386942:p.Gly330Asp	Somatic		Capture	SOLID	Phase_I	106816989	NM_001142351	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	ENST00000409382.3	37	CCDS2073.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530481	0.85706	.	.	ENSG00000144057	ENST00000361686;ENST00000409382;ENST00000409087	T;T;T	0.36520	1.25;1.25;1.25	6.03	6.03	0.97812	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);	0.093026	0.85682	D	0.000000	T	0.63355	0.2504	M	0.89095	3.005	0.80722	D	1	D;D	0.69078	0.997;0.972	D;P	0.65010	0.931;0.877	T	0.68857	-0.5298	10	0.72032	D	0.01	-25.6013	12.7996	0.57578	0.0:0.9262:0.0:0.0738	.	330;330	Q96JF0-2;Q96JF0	.;SIAT2_HUMAN	D	330	ENSP00000355273:G330D;ENSP00000386942:G330D;ENSP00000387332:G330D	ENSP00000355273:G330D	G	-	2	0	ST6GAL2	106816989	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.111000	0.57838	2.861000	0.98227	0.655000	0.94253	GGT		ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528	
TMEM177	80775	hgsc.bcm.edu	37	2	120438801	120438801	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:120438801A>G	ENST00000424086.1	+	2	845	c.372A>G	c.(370-372)atA>atG	p.I124M	TMEM177_ENST00000401466.1_Missense_Mutation_p.I124M|TMEM177_ENST00000272521.6_Missense_Mutation_p.I124M|TMEM177_ENST00000496203.1_Intron|TMEM177_ENST00000409951.1_Intron	NM_001105198.1	NP_001098668.1	Q53S58	TM177_HUMAN	transmembrane protein 177	124						integral component of membrane (GO:0016021)		p.I124M(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	13	Colorectal(110;0.196)					CCGTGGTCATACATGGGCATA	0.607																																					p.I124M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A372G	2						.						159.0	177.0	171.0					2																	120438801		2203	4300	6503	120155271	SO:0001583	missense	80775	exon2			BC004404	CCDS2128.1	2q14.2	2008-02-05			ENSG00000144120	ENSG00000144120			28143	protein-coding gene	gene with protein product						12477932	Standard	NM_001105198		Approved	MGC10993	uc002tmc.1	Q53S58	OTTHUMG00000153312	ENST00000424086.1:c.372A>G	2.37:g.120438801A>G	ENSP00000402661:p.Ile124Met	Somatic		Capture	SOLID	Phase_I	120155271	NM_001105199	Q9BT20	Missense_Mutation	SNP	ENST00000424086.1	37	CCDS2128.1	.	.	.	.	.	.	.	.	.	.	A	11.40	1.626272	0.28978	.	.	ENSG00000144120	ENST00000401466;ENST00000424086;ENST00000272521;ENST00000415646	T;T;T	0.52057	0.68;0.68;0.68	4.48	-7.89	0.01174	.	0.295044	0.36932	N	0.002328	T	0.42040	0.1185	L	0.60455	1.87	0.23381	N	0.997792	P	0.41131	0.739	P	0.48400	0.576	T	0.46148	-0.9212	10	0.87932	D	0	-0.2297	7.0305	0.24965	0.1722:0.6259:0.085:0.1168	.	124	Q53S58	TM177_HUMAN	M	124	ENSP00000385966:I124M;ENSP00000402661:I124M;ENSP00000272521:I124M	ENSP00000272521:I124M	I	+	3	3	TMEM177	120155271	0.023000	0.18921	0.015000	0.15790	0.009000	0.06853	-0.905000	0.04075	-1.047000	0.03242	0.448000	0.29417	ATA		TMEM177-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330673.1	NM_030577	
CCNT2	905	hgsc.bcm.edu	37	2	135676436	135676436	+	Silent	SNP	C	C	T	rs370795827		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:135676436C>T	ENST00000264157.5	+	1	42	c.12C>T	c.(10-12)ggC>ggT	p.G4G	AC016725.4_ENST00000428857.1_RNA|CCNT2_ENST00000537343.1_5'UTR|AC016725.4_ENST00000392929.2_RNA|AC016725.4_ENST00000413962.1_RNA|CCNT2_ENST00000295238.6_Silent_p.G4G|AC016725.4_ENST00000537615.1_RNA	NM_001241.3|NM_058241.2	NP_001232.1|NP_490595.1	O60583	CCNT2_HUMAN	cyclin T2	4					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G4G(1)		endometrium(2)|kidney(3)|large_intestine(10)|lung(6)|ovary(2)|prostate(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.107)		TGGCGTCGGGCCGTGGAGCTT	0.687																																					p.G4G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C12T	2						.	C	,	1,4405	2.1+/-5.4	0,1,2202	72.0	88.0	83.0		12,12	5.2	1.0	2		83	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	CCNT2	NM_001241.3,NM_058241.2	,	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	,	4/664,4/731	135676436	1,13003	2203	4299	6502	135392906	SO:0001819	synonymous_variant	905	exon1			AF048731	CCDS2174.1, CCDS2175.1	2q21.3	2010-11-15			ENSG00000082258	ENSG00000082258			1600	protein-coding gene	gene with protein product		603862				9499409, 10465067	Standard	NM_001241		Approved		uc002tuc.2	O60583	OTTHUMG00000131712	ENST00000264157.5:c.12C>T	2.37:g.135676436C>T		Somatic		Capture	SOLID	Phase_I	135392906	NM_058241	A8KA48|D3DP73|D3DP74|O60582|Q29R66|Q53SR4|Q5I1Y0	Silent	SNP	ENST00000264157.5	37	CCDS2174.1																																																																																				CCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254629.1	NM_058241	
MAP3K19	80122	hgsc.bcm.edu	37	2	135743549	135743549	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:135743549A>G	ENST00000375845.3	-	7	2923	c.2893T>C	c.(2893-2895)Ttg>Ctg	p.L965L	MAP3K19_ENST00000375844.3_Intron|MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000392915.1_Silent_p.L982L|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000358371.4_Silent_p.L852L	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	965							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.L317L(1)|p.L965L(1)									TCATCTGTCAATTCTTCATTA	0.323																																					p.L965L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T2893C	2						.						62.0	62.0	62.0					2																	135743549		2203	4297	6500	135460019	SO:0001819	synonymous_variant	80122	exon7			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.2893T>C	2.37:g.135743549A>G		Somatic		Capture	SOLID	Phase_I	135460019	NM_025052	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Silent	SNP	ENST00000375845.3	37	CCDS2176.2																																																																																				MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	
DARS	1615	hgsc.bcm.edu	37	2	136673811	136673811	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:136673811T>G	ENST00000264161.4	-	11	1306	c.1091A>C	c.(1090-1092)gAt>gCt	p.D364A	DARS_ENST00000537273.1_Missense_Mutation_p.D264A	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	364					aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.D364A(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	ATCGTCTTCATCTCCCATTTC	0.418																																					p.D364A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1091C	2						.						124.0	117.0	120.0					2																	136673811		2203	4300	6503	136390281	SO:0001583	missense	1615	exon11			J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.1091A>C	2.37:g.136673811T>G	ENSP00000264161:p.Asp364Ala	Somatic		Capture	SOLID	Phase_I	136390281	NM_001349	A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Missense_Mutation	SNP	ENST00000264161.4	37	CCDS2180.1	.	.	.	.	.	.	.	.	.	.	T	16.24	3.068380	0.55539	.	.	ENSG00000115866	ENST00000264161;ENST00000422708;ENST00000537273	T;D;T	0.83992	0.87;-1.79;0.87	5.43	5.43	0.79202	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.000000	0.85682	D	0.000000	D	0.85383	0.5684	M	0.66439	2.03	0.80722	D	1	B	0.33964	0.434	B	0.42771	0.397	D	0.84835	0.0804	10	0.44086	T	0.13	-13.1756	15.7866	0.78310	0.0:0.0:0.0:1.0	.	364	P14868	SYDC_HUMAN	A	364;78;264	ENSP00000264161:D364A;ENSP00000387508:D78A;ENSP00000444192:D264A	ENSP00000264161:D364A	D	-	2	0	DARS	136390281	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.751000	0.85126	2.180000	0.69256	0.528000	0.53228	GAT		DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254660.5	NM_001349	
PKP4	8502	hgsc.bcm.edu	37	2	159526422	159526422	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:159526422C>T	ENST00000389759.3	+	17	3031	c.2919C>T	c.(2917-2919)ggC>ggT	p.G973G	AC005042.4_ENST00000342892.4_RNA|PKP4_ENST00000389757.3_Silent_p.G973G	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	973					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)		p.G973G(1)		breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						AAGGCAGGGGCGACAGGCAAG	0.527										HNSCC(62;0.18)																											p.G973G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2919T	2						.						37.0	35.0	35.0					2																	159526422		2202	4300	6502	159234668	SO:0001819	synonymous_variant	8502	exon17			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.2919C>T	2.37:g.159526422C>T		Somatic		Capture	SOLID	Phase_I	159234668	NM_003628	Q86W91	Silent	SNP	ENST00000389759.3	37	CCDS33305.1																																																																																				PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		
PLA2R1	22925	hgsc.bcm.edu	37	2	160901507	160901507	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:160901507C>A	ENST00000283243.7	-	2	477	c.271G>T	c.(271-273)Ggc>Tgc	p.G91C	PLA2R1_ENST00000392771.1_Missense_Mutation_p.G91C	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	91	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)	p.G91C(1)	PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						AAATTCAGGCCCAGGCAACCA	0.507																																					p.G91C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G271T	2						.						66.0	62.0	63.0					2																	160901507		2203	4300	6503	160609753	SO:0001583	missense	22925	exon2			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.271G>T	2.37:g.160901507C>A	ENSP00000283243:p.Gly91Cys	Somatic		Capture	SOLID	Phase_I	160609753	NM_007366	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	37	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928745	0.92389	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.34472	1.36;1.36	6.07	6.07	0.98685	Ricin B-related lectin (1);Ricin B lectin (2);	0.000000	0.85682	D	0.000000	T	0.67757	0.2927	M	0.85945	2.785	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.70249	-0.4924	10	0.87932	D	0	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	91;91;91	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	C	91	ENSP00000283243:G91C;ENSP00000376524:G91C	ENSP00000283243:G91C	G	-	1	0	PLA2R1	160609753	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.088000	0.76901	2.884000	0.98904	0.655000	0.94253	GGC		PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
PPIG	9360	hgsc.bcm.edu	37	2	170493564	170493564	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:170493564G>T	ENST00000260970.3	+	14	2016	c.1796G>T	c.(1795-1797)aGg>aTg	p.R599M	PPIG_ENST00000409714.3_Missense_Mutation_p.R584M|PPIG_ENST00000448752.2_Missense_Mutation_p.R599M	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	599	Arg/Ser-rich (RS domain).				protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)	p.R599M(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	CAGGAATACAGGAGAAGAGGA	0.498																																					p.R599M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1796T	2						.						131.0	126.0	128.0					2																	170493564		2203	4300	6503	170201810	SO:0001583	missense	9360	exon14			X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.1796G>T	2.37:g.170493564G>T	ENSP00000260970:p.Arg599Met	Somatic		Capture	SOLID	Phase_I	170201810	NM_004792	D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Missense_Mutation	SNP	ENST00000260970.3	37	CCDS2235.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.727144	0.48833	.	.	ENSG00000138398	ENST00000260970;ENST00000409714;ENST00000448752	T;T;T	0.17691	2.26;2.26;2.26	5.51	5.51	0.81932	.	0.155212	0.56097	D	0.000030	T	0.20536	0.0494	N	0.24115	0.695	0.32424	N	0.549012	D;D;D	0.56521	0.976;0.976;0.976	P;P;P	0.53809	0.735;0.735;0.735	T	0.08186	-1.0734	10	0.66056	D	0.02	-16.7445	12.7122	0.57096	0.0754:0.0:0.9246:0.0	.	584;584;599	E9PG73;Q2NKQ6;Q13427	.;.;PPIG_HUMAN	M	599;584;599	ENSP00000260970:R599M;ENSP00000386245:R584M;ENSP00000407083:R599M	ENSP00000260970:R599M	R	+	2	0	PPIG	170201810	1.000000	0.71417	0.996000	0.52242	0.938000	0.57974	1.851000	0.39338	2.572000	0.86782	0.591000	0.81541	AGG		PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255264.2		
TTN	7273	hgsc.bcm.edu	37	2	179612778	179612778	+	Intron	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:179612778T>G	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.E4783D|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E4783D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGTGCATTCTTCTTCCATTT	0.443																																					p.E4783D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A14349C	2						.						66.0	61.0	63.0					2																	179612778		2203	4300	6503	179321023	SO:0001627	intron_variant	7273	exon46			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+5072A>C	2.37:g.179612778T>G		Somatic		Capture	SOLID	Phase_I	179321023	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	14.95	2.688612	0.48097	.	.	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.59638	0.25	6.05	0.776	0.18532	.	.	.	.	.	T	0.34832	0.0911	N	0.21448	0.665	0.80722	D	1	B	0.12630	0.006	B	0.13407	0.009	T	0.08432	-1.0722	9	0.33940	T	0.23	.	2.0938	0.03663	0.1137:0.1987:0.1246:0.563	.	4783	Q8WZ42-6	.	D	4783;97	ENSP00000354117:E4783D	ENSP00000304714:E97D	E	-	3	2	TTN	179321023	0.049000	0.20398	0.065000	0.19835	0.211000	0.24417	-0.165000	0.09968	-0.082000	0.12640	0.528000	0.53228	GAA		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179666974	179666974	+	Silent	SNP	G	G	A	rs528853682	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:179666974G>A	ENST00000591111.1	-	3	410	c.186C>T	c.(184-186)cgC>cgT	p.R62R	TTN_ENST00000360870.5_Silent_p.R62R|TTN_ENST00000359218.5_Silent_p.R62R|TTN_ENST00000460472.2_Silent_p.R62R|TTN_ENST00000589042.1_Silent_p.R62R|TTN_ENST00000342992.6_Silent_p.R62R|TTN_ENST00000342175.6_Silent_p.R62R			Q8WZ42	TITIN_HUMAN	titin	32674	Ig-like 1.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R62R(5)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAGTTTAGCGCGGCCATCGC	0.542													G|||	2	0.000399361	0.0015	0.0	5008	,	,		6738	0.0		0.0	False		,,,				2504	0.0				p.R62R												.	.	5	Substitution - coding silent(5)	large_intestine(5)	c.C186T	2						.						118.0	105.0	109.0					2																	179666974		2203	4300	6503	179375219	SO:0001819	synonymous_variant	7273	exon3			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.186C>T	2.37:g.179666974G>A		Somatic		Capture	SOLID	Phase_I	179375219	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NT5C1B	93034	hgsc.bcm.edu	37	2	18766019	18766019	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:18766019G>A	ENST00000359846.2	-	5	741	c.664C>T	c.(664-666)Cgg>Tgg	p.R222W	RNU6-1215P_ENST00000384441.1_RNA|NT5C1B_ENST00000460052.1_5'Flank|NT5C1B-RDH14_ENST00000532967.1_Missense_Mutation_p.R222W|NT5C1B_ENST00000304081.4_Missense_Mutation_p.R162W|NT5C1B_ENST00000600945.1_Missense_Mutation_p.R222W	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	222					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.R222W(1)		endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				CGGATTTCCCGCACGATGCCT	0.687																																					p.R162W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C484T	2						.						26.0	28.0	27.0					2																	18766019		2202	4296	6498	18629500	SO:0001583	missense	93034	exon4			AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.664C>T	2.37:g.18766019G>A	ENSP00000352904:p.Arg222Trp	Somatic		Capture	SOLID	Phase_I	18629500	NM_033253	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Missense_Mutation	SNP	ENST00000359846.2	37	CCDS33150.1	.	.	.	.	.	.	.	.	.	.	G	18.54	3.646397	0.67358	.	.	ENSG00000250741;ENSG00000250741;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000444297;ENST00000304081;ENST00000359846	D	0.91351	-2.83	3.82	3.82	0.43975	.	0.196209	0.24174	N	0.040876	D	0.89972	0.6870	L	0.29908	0.895	0.09310	N	1	D;D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.99;0.995;0.999;0.998;0.999	P;P;P;P;P;P;P;P;P	0.59288	0.8;0.8;0.72;0.8;0.454;0.736;0.855;0.72;0.855	T	0.83150	-0.0104	10	0.72032	D	0.01	-1.6389	11.9322	0.52853	0.0:0.0:1.0:0.0	.	205;239;162;205;164;14;162;222;222	E7EXB7;B4DZ86;B4DXQ9;B4DXZ9;C9J2C7;Q96P26-3;Q96P26-2;Q96P26;Q96P26-4	.;.;.;.;.;.;.;5NT1B_HUMAN;.	W	222;164;162;222	ENSP00000412639:R164W	ENSP00000305979:R162W	R	-	1	2	NT5C1B-RDH14;NT5C1B	18629500	0.032000	0.19561	0.010000	0.14722	0.051000	0.14879	0.954000	0.29175	2.072000	0.62099	0.462000	0.41574	CGG		NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323822.1		
NEUROD1	4760	hgsc.bcm.edu	37	2	182543231	182543231	+	Silent	SNP	C	C	T	rs375774931		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:182543231C>T	ENST00000295108.3	-	2	814	c.357G>A	c.(355-357)gcG>gcA	p.A119A	NEUROD1_ENST00000496876.1_Intron|CERKL_ENST00000479558.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	119	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.A119A(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TGTCTAGCGCCGCGTTCAGTC	0.542																																					p.A119A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G357A	2						.	C		0,4406		0,0,2203	83.0	77.0	79.0		357	-5.7	0.9	2		79	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NEUROD1	NM_002500.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		119/357	182543231	1,13005	2203	4300	6503	182251476	SO:0001819	synonymous_variant	4760	exon2			U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.357G>A	2.37:g.182543231C>T		Somatic		Capture	SOLID	Phase_I	182251476	NM_002500	B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Silent	SNP	ENST00000295108.3	37	CCDS2283.1																																																																																				NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500	
WDR75	84128	hgsc.bcm.edu	37	2	190315636	190315636	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:190315636C>G	ENST00000314761.4	+	3	284	c.224C>G	c.(223-225)tCt>tGt	p.S75C		NM_032168.1	NP_115544.1	Q8IWA0	WDR75_HUMAN	WD repeat domain 75	75						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S75C(1)		breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00105)|Epithelial(96;0.0129)|all cancers(119;0.0456)			TAGCTGTATTCTTGTTCCCTT	0.284																																					p.S75C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C224G	2						.						184.0	185.0	185.0					2																	190315636		2203	4300	6503	190023881	SO:0001583	missense	84128	exon3			AK091546	CCDS2298.1	2q32.2	2013-01-09			ENSG00000115368	ENSG00000115368		"""WD repeat domain containing"""	25725	protein-coding gene	gene with protein product	"""UTP17, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_032168		Approved	FLJ12519, NET16, UTP17	uc002uql.1	Q8IWA0	OTTHUMG00000132660	ENST00000314761.4:c.224C>G	2.37:g.190315636C>G	ENSP00000314193:p.Ser75Cys	Somatic		Capture	SOLID	Phase_I	190023881	NM_032168	Q96J10|Q9H8U8|Q9H9U5|Q9H9V8|Q9UIX2	Missense_Mutation	SNP	ENST00000314761.4	37	CCDS2298.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.504412	0.85176	.	.	ENSG00000115368	ENST00000314761	T	0.72394	-0.65	5.66	5.66	0.87406	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.87740	0.6253	M	0.91717	3.235	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.995	D	0.90018	0.4126	10	0.87932	D	0	-18.9099	17.5147	0.87770	0.0:1.0:0.0:0.0	.	75;75	A8K330;Q8IWA0	.;WDR75_HUMAN	C	75	ENSP00000314193:S75C	ENSP00000314193:S75C	S	+	2	0	WDR75	190023881	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.649000	0.74364	2.661000	0.90470	0.655000	0.94253	TCT		WDR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255913.1	NM_032168	
SDPR	8436	hgsc.bcm.edu	37	2	192711322	192711322	+	Silent	SNP	C	C	T	rs115841058	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:192711322C>T	ENST00000304141.4	-	1	659	c.330G>A	c.(328-330)acG>acA	p.T110T	AC098617.1_ENST00000424116.2_RNA	NM_004657.5	NP_004648.1			serum deprivation response									p.T110T(1)		NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			GCTTGCTCACCGTGTTGCTGG	0.602													C|||	21	0.00419329	0.0159	0.0	5008	,	,		20156	0.0		0.0	False		,,,				2504	0.0				p.T110T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G330A	2						.	C		41,4365	44.6+/-78.6	1,39,2163	90.0	80.0	83.0		330	-4.7	1.0	2	dbSNP_132	83	0,8600		0,0,4300	no	coding-synonymous	SDPR	NM_004657.5		1,39,6463	TT,TC,CC		0.0,0.9305,0.3152		110/426	192711322	41,12965	2203	4300	6503	192419567	SO:0001819	synonymous_variant	8436	exon1			AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.330G>A	2.37:g.192711322C>T		Somatic		Capture	SOLID	Phase_I	192419567	NM_004657		Silent	SNP	ENST00000304141.4	37	CCDS2313.1																																																																																				SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334791.2	NM_004657	
BMPR2	659	hgsc.bcm.edu	37	2	203397351	203397351	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:203397351C>A	ENST00000374580.4	+	9	1711	c.1172C>A	c.(1171-1173)gCt>gAt	p.A391D	BMPR2_ENST00000374574.2_Missense_Mutation_p.A391D	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	391	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.A391D(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						CTAGAAGGAGCTGTGAACTTG	0.388																																					p.A391D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1172A	2						.						114.0	113.0	113.0					2																	203397351		2203	4300	6503	203105596	SO:0001583	missense	659	exon9			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.1172C>A	2.37:g.203397351C>A	ENSP00000363708:p.Ala391Asp	Somatic		Capture	SOLID	Phase_I	203105596	NM_001204	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Missense_Mutation	SNP	ENST00000374580.4	37	CCDS33361.1	.	.	.	.	.	.	.	.	.	.	C	35	5.483958	0.96307	.	.	ENSG00000204217	ENST00000374580;ENST00000374574	D;D	0.93426	-3.22;-3.22	5.52	5.52	0.82312	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.090102	0.85682	D	0.000000	D	0.95881	0.8659	L	0.59967	1.855	0.80722	D	1	D;D	0.71674	0.996;0.998	P;D	0.66497	0.846;0.944	D	0.95924	0.8933	10	0.87932	D	0	.	19.785	0.96433	0.0:1.0:0.0:0.0	.	391;391	Q13161;Q13873	.;BMPR2_HUMAN	D	391	ENSP00000363708:A391D;ENSP00000363702:A391D	ENSP00000363702:A391D	A	+	2	0	BMPR2	203105596	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.557000	0.82243	2.761000	0.94854	0.655000	0.94253	GCT		BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257743.1	NM_001204	
MDH1B	130752	hgsc.bcm.edu	37	2	207621681	207621681	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:207621681T>G	ENST00000374412.3	-	4	629	c.354A>C	c.(352-354)aaA>aaC	p.K118N	MDH1B_ENST00000454776.2_Missense_Mutation_p.K118N|MDH1B_ENST00000392214.2_Missense_Mutation_p.K118N|MDH1B_ENST00000449792.1_Missense_Mutation_p.K20N	NM_001039845.1|NM_001282940.1	NP_001034934.1|NP_001269869.1	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	118					carbohydrate metabolic process (GO:0005975)|malate metabolic process (GO:0006108)|tricarboxylic acid cycle (GO:0006099)		malate dehydrogenase activity (GO:0016615)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)	p.K118N(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(14)|ovary(4)|stomach(1)	34				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		CCTCCTGCTCTTTTTCTATAT	0.438																																					p.K118N	Pancreas(76;29 1355 28675 37177 51207)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A354C	2						.						109.0	100.0	103.0					2																	207621681		2203	4300	6503	207329926	SO:0001583	missense	130752	exon4				CCDS33365.1, CCDS63102.1	2q33.3	2008-05-27			ENSG00000138400	ENSG00000138400			17836	protein-coding gene	gene with protein product							Standard	NM_001039845		Approved	FLJ25341, RP11-95H11	uc002vbs.3	Q5I0G3	OTTHUMG00000132918	ENST00000374412.3:c.354A>C	2.37:g.207621681T>G	ENSP00000363533:p.Lys118Asn	Somatic		Capture	SOLID	Phase_I	207329926	NM_001039845	A8K8M1|Q53TK9|Q8IV51	Missense_Mutation	SNP	ENST00000374412.3	37	CCDS33365.1	.	.	.	.	.	.	.	.	.	.	T	9.675	1.147823	0.21288	.	.	ENSG00000138400	ENST00000374412;ENST00000449792;ENST00000454776;ENST00000392214	T;T;T;T	0.60299	0.2;0.92;0.2;0.2	6.08	-0.803	0.10886	.	0.757625	0.13380	N	0.392241	T	0.42086	0.1187	L	0.57536	1.79	0.09310	N	1	P;P	0.40050	0.7;0.565	B;B	0.38020	0.263;0.135	T	0.25779	-1.0122	10	0.27082	T	0.32	-14.2786	0.1455	0.00088	0.2287:0.2346:0.2098:0.327	.	118;118	Q5I0G3-2;Q5I0G3	.;MDH1B_HUMAN	N	118;20;118;118	ENSP00000363533:K118N;ENSP00000416577:K20N;ENSP00000389916:K118N;ENSP00000376049:K118N	ENSP00000363533:K118N	K	-	3	2	MDH1B	207329926	0.840000	0.29493	0.200000	0.23457	0.647000	0.38526	0.455000	0.21843	0.184000	0.20083	0.533000	0.62120	AAA		MDH1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256429.2	NM_001039845	
MYL1	4632	hgsc.bcm.edu	37	2	211163184	211163184	+	Silent	SNP	A	A	G	rs145306902		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:211163184A>G	ENST00000352451.3	-	3	411	c.264T>C	c.(262-264)aaT>aaC	p.N88N	MYL1_ENST00000496436.1_5'UTR|MYL1_ENST00000341685.4_Silent_p.N44N	NM_079420.2	NP_524144.1	P05976	MYL1_HUMAN	myosin, light chain 1, alkali; skeletal, fast	88					cardiac muscle contraction (GO:0060048)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|sarcomere (GO:0030017)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)	p.N88N(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	16				Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)		TGACCTCTGCATTGGTGGGAT	0.478																																					p.N44N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T132C	2						.	A	,	0,4406		0,0,2203	164.0	153.0	157.0		264,132	2.9	1.0	2	dbSNP_134	157	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	MYL1	NM_079420.2,NM_079422.2	,	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	,	88/195,44/151	211163184	1,13005	2203	4300	6503	210871429	SO:0001819	synonymous_variant	4632	exon3				CCDS2390.1, CCDS2391.1	2q33-q34	2013-01-10	2006-09-29		ENSG00000168530	ENSG00000168530		"""Myosins / Light chain"", ""EF-hand domain containing"""	7582	protein-coding gene	gene with protein product		160780	"""myosin, light polypeptide 1, alkali; skeletal, fast"""			2304459, 3422212	Standard	NM_079422		Approved		uc002vec.3	P05976	OTTHUMG00000132992	ENST00000352451.3:c.264T>C	2.37:g.211163184A>G		Somatic		Capture	SOLID	Phase_I	210871429	NM_079422	B2R4N6|B2R4T6|P06741|Q6IBD5	Silent	SNP	ENST00000352451.3	37	CCDS2390.1																																																																																				MYL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256566.2	NM_079420	
ABCA12	26154	hgsc.bcm.edu	37	2	215840684	215840684	+	Silent	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:215840684T>G	ENST00000272895.7	-	34	5425	c.5206A>C	c.(5206-5208)Agg>Cgg	p.R1736R	ABCA12_ENST00000389661.4_Silent_p.R1418R	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1736					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.R1736R(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TGGTGGAACCTCTTGATGAGT	0.478																																					p.R1736R	Ovarian(66;664 1488 5121 34295)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A5206C	2						.						162.0	144.0	150.0					2																	215840684		2203	4300	6503	215548929	SO:0001819	synonymous_variant	26154	exon34			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.5206A>C	2.37:g.215840684T>G		Somatic		Capture	SOLID	Phase_I	215548929	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	ENST00000272895.7	37	CCDS33372.1																																																																																				ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
IGFBP5	3488	hgsc.bcm.edu	37	2	217542884	217542884	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Visver			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:217542884G>A	ENST00000233813.4	-	3	1387	c.638C>T	c.(637-639)gCt>gTt	p.A213V		NM_000599.3	NP_000590.1	P24593	IBP5_HUMAN	insulin-like growth factor binding protein 5	213	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cellular protein metabolic process (GO:0044267)|cellular response to cAMP (GO:0071320)|cellular response to organic cyclic compound (GO:0071407)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hair follicle morphogenesis (GO:0031069)|intracellular signal transduction (GO:0035556)|mammary gland involution (GO:0060056)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|striated muscle cell differentiation (GO:0051146)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|insulin-like growth factor binding protein complex (GO:0016942)	insulin-like growth factor I binding (GO:0031994)	p.A213V(1)		endometrium(1)|large_intestine(3)|lung(1)	5		Renal(323;0.0822)		Epithelial(149;2.1e-06)|all cancers(144;0.000165)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGGTACACAGCACGGGGCAC	0.612																																					p.A213V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C638T	2						.						80.0	77.0	78.0					2																	217542884		2203	4300	6503	217251129	SO:0001583	missense	3488	exon3				CCDS2405.1	2q35	2014-09-16			ENSG00000115461	ENSG00000115461			5474	protein-coding gene	gene with protein product		146734				7511611	Standard	NM_000599		Approved		uc002vgj.4	P24593	OTTHUMG00000133058	ENST00000233813.4:c.638C>T	2.37:g.217542884G>A	ENSP00000233813:p.Ala213Val	Somatic		Capture	SOLID	Phase_I	217251129	NM_000599	Q5U0A3	Missense_Mutation	SNP	ENST00000233813.4	37	CCDS2405.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.372923	0.82573	.	.	ENSG00000115461	ENST00000233813	T	0.63580	-0.05	4.75	4.75	0.60458	Thyroglobulin type-1 (4);	0.114561	0.64402	D	0.000014	T	0.57799	0.2078	L	0.43598	1.365	0.58432	D	0.99999	B	0.29936	0.262	B	0.32677	0.15	T	0.59059	-0.7525	10	0.45353	T	0.12	-25.9935	16.9232	0.86168	0.0:0.0:1.0:0.0	.	213	P24593	IBP5_HUMAN	V	213	ENSP00000233813:A213V	ENSP00000233813:A213V	A	-	2	0	IGFBP5	217251129	1.000000	0.71417	0.805000	0.32314	0.970000	0.65996	7.542000	0.82095	2.451000	0.82905	0.561000	0.74099	GCT		IGFBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256674.2	NM_000599	
TMBIM1	64114	hgsc.bcm.edu	37	2	219143777	219143777	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:219143777C>T	ENST00000444881.1	-	6	1131	c.406G>A	c.(406-408)Gtc>Atc	p.V136I	TMBIM1_ENST00000445635.1_5'UTR|PNKD_ENST00000273077.4_Intron|TMBIM1_ENST00000396809.2_Missense_Mutation_p.V136I|PNKD_ENST00000472650.1_Intron|TMBIM1_ENST00000258412.3_Missense_Mutation_p.V136I			Q969X1	LFG3_HUMAN	transmembrane BAX inhibitor motif containing 1	136					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of Fas signaling pathway (GO:1902045)|negative regulation of metalloenzyme activity (GO:0048553)|positive regulation of blood vessel remodeling (GO:2000504)	endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	death receptor binding (GO:0005123)	p.V136I(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(2)	9		Renal(207;0.0474)		Epithelial(149;8.56e-07)|all cancers(144;0.000154)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACGTAGTAGACAGCCACATTT	0.602																																					p.V136I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G406A	2						.						141.0	122.0	128.0					2																	219143777		2203	4300	6503	218852021	SO:0001583	missense	64114	exon5			BN000408	CCDS2412.1	2q35	2010-03-18			ENSG00000135926	ENSG00000135926			23410	protein-coding gene	gene with protein product		610364				12477932	Standard	NM_022152		Approved	PP1201, RECS1, LFG3	uc002vhp.1	Q969X1	OTTHUMG00000133105	ENST00000444881.1:c.406G>A	2.37:g.219143777C>T	ENSP00000409738:p.Val136Ile	Somatic		Capture	SOLID	Phase_I	218852021	NM_022152	B3KQY6|Q8N1R3|Q8TAM3|Q96K13	Missense_Mutation	SNP	ENST00000444881.1	37	CCDS2412.1	.	.	.	.	.	.	.	.	.	.	C	9.133	1.011998	0.19277	.	.	ENSG00000135926	ENST00000258412;ENST00000444881;ENST00000396809;ENST00000543441;ENST00000429501;ENST00000425694;ENST00000418569	T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.94;1.52;1.49	5.14	1.31	0.21738	.	0.240894	0.41500	N	0.000873	T	0.26991	0.0661	L	0.28054	0.825	0.45662	D	0.99858	B;B	0.23442	0.058;0.085	B;B	0.28139	0.07;0.086	T	0.04796	-1.0926	10	0.17832	T	0.49	-21.0539	10.0803	0.42386	0.0:0.647:0.0:0.353	.	74;136	B4DNZ1;Q969X1	.;TMBI1_HUMAN	I	136;136;136;74;136;136;136	ENSP00000258412:V136I;ENSP00000409738:V136I;ENSP00000380025:V136I;ENSP00000399987:V136I;ENSP00000399345:V136I;ENSP00000406744:V136I	ENSP00000258412:V136I	V	-	1	0	TMBIM1	218852021	0.005000	0.15991	0.076000	0.20297	0.316000	0.28119	0.022000	0.13511	0.352000	0.24053	-0.140000	0.14226	GTC		TMBIM1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338559.1	NM_022152	
STK36	27148	hgsc.bcm.edu	37	2	219562257	219562257	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:219562257T>A	ENST00000295709.3	+	24	3112	c.2833T>A	c.(2833-2835)Tcc>Acc	p.S945T	STK36_ENST00000392106.2_Missense_Mutation_p.S924T|STK36_ENST00000440309.1_Missense_Mutation_p.S945T|STK36_ENST00000392105.3_Missense_Mutation_p.S924T	NM_015690.4	NP_056505.2			serine/threonine kinase 36									p.S945T(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		GAGCTGCCTGTCCCAGCATGG	0.562																																					p.S945T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2833A	2						.						76.0	69.0	71.0					2																	219562257		2203	4300	6503	219270501	SO:0001583	missense	27148	exon24			AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.2833T>A	2.37:g.219562257T>A	ENSP00000295709:p.Ser945Thr	Somatic		Capture	SOLID	Phase_I	219270501	NM_015690		Missense_Mutation	SNP	ENST00000295709.3	37	CCDS2421.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.252|7.252	0.603485|0.603485	0.14002|0.14002	.|.	.|.	ENSG00000163482|ENSG00000163482	ENST00000431040|ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309	.|T;T;T;T	.|0.69561	.|-0.41;-0.4;-0.41;-0.41	5.24|5.24	2.7|2.7	0.31948|0.31948	.|.	.|0.377447	.|0.19688	.|N	.|0.108342	.|T	.|0.38453	.|0.1041	N|N	0.14661|0.14661	0.345|0.345	0.25355|0.25355	N|N	0.988838|0.988838	.|B;B;B	.|0.34015	.|0.435;0.138;0.085	.|B;B;B	.|0.32677	.|0.15;0.027;0.012	.|T	.|0.32903	.|-0.9889	.|10	.|0.06236	.|T	.|0.91	-9.2723|-9.2723	5.1514|5.1514	0.15011|0.15011	0.2244:0.0:0.2722:0.5033|0.2244:0.0:0.2722:0.5033	.|.	.|924;924;945	.|A8MU99;Q9NRP7-2;Q9NRP7	.|.;.;STK36_HUMAN	X|T	137|945;924;924;945	.|ENSP00000295709:S945T;ENSP00000375955:S924T;ENSP00000375954:S924T;ENSP00000394095:S945T	.|ENSP00000295709:S945T	C|S	+|+	3|1	2|0	STK36|STK36	219270501|219270501	0.991000|0.991000	0.36638|0.36638	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	0.823000|0.823000	0.27366|0.27366	0.998000|0.998000	0.38996|0.38996	-0.291000|-0.291000	0.09656|0.09656	TGT|TCC		STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2		
NHEJ1	79840	hgsc.bcm.edu	37	2	219942828	219942828	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:219942828T>G	ENST00000356853.5	-	6	822	c.689A>C	c.(688-690)cAg>cCg	p.Q230P	NHEJ1_ENST00000483627.1_5'UTR|NHEJ1_ENST00000409720.1_Missense_Mutation_p.Q230P	NM_024782.2	NP_079058.1	Q9H9Q4	NHEJ1_HUMAN	nonhomologous end-joining factor 1	230					B cell differentiation (GO:0030183)|central nervous system development (GO:0007417)|DNA recombination (GO:0006310)|double-strand break repair via nonhomologous end joining (GO:0006303)|positive regulation of ligase activity (GO:0051351)|response to ionizing radiation (GO:0010212)|T cell differentiation (GO:0030217)	nonhomologous end joining complex (GO:0070419)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Q230P(1)		kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	12		Renal(207;0.0915)		Epithelial(149;2.15e-06)|all cancers(144;0.000339)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0112)		TTGATGCTTCTGTCCCACTTG	0.488								Non-homologous end-joining																													p.Q230P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A689C	2						.						137.0	109.0	118.0					2																	219942828		2203	4300	6503	219651072	SO:0001583	missense	79840	exon6			AJ972687	CCDS2432.1	2q35	2014-09-17			ENSG00000187736	ENSG00000187736			25737	protein-coding gene	gene with protein product		611290				16439204, 16439205	Standard	NM_024782		Approved	Cernunnos, XLF, FLJ12610	uc002vjp.4	Q9H9Q4	OTTHUMG00000133127	ENST00000356853.5:c.689A>C	2.37:g.219942828T>G	ENSP00000349313:p.Gln230Pro	Somatic		Capture	SOLID	Phase_I	219651072	NM_024782	B8ZZA4|Q4ZFW7|Q6IA64|Q96JS9	Missense_Mutation	SNP	ENST00000356853.5	37	CCDS2432.1	.	.	.	.	.	.	.	.	.	.	T	11.36	1.615833	0.28801	.	.	ENSG00000187736	ENST00000409720;ENST00000356853;ENST00000426304	T;T;T	0.61392	0.11;0.22;0.42	5.04	1.19	0.21007	.	0.398845	0.22779	U	0.055753	T	0.39253	0.1071	L	0.45581	1.43	0.80722	D	1	P	0.42010	0.768	B	0.36030	0.216	T	0.11227	-1.0596	10	0.27785	T	0.31	-15.208	3.3135	0.07025	0.1697:0.2532:0.0:0.5771	.	230	Q9H9Q4	NHEJ1_HUMAN	P	230;230;150	ENSP00000387290:Q230P;ENSP00000349313:Q230P;ENSP00000394896:Q150P	ENSP00000349313:Q230P	Q	-	2	0	NHEJ1	219651072	0.733000	0.28132	0.891000	0.34965	0.894000	0.52154	-0.030000	0.12308	0.372000	0.24591	0.533000	0.62120	CAG		NHEJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256817.2	NM_024782	
SERPINE2	5270	hgsc.bcm.edu	37	2	224847477	224847477	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:224847477T>C	ENST00000258405.4	-	6	1148	c.906A>G	c.(904-906)acA>acG	p.T302T	SERPINE2_ENST00000447280.2_Silent_p.T314T|SERPINE2_ENST00000409304.1_Silent_p.T302T|SERPINE2_ENST00000409840.3_Silent_p.T302T	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	302					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.T302T(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CCTTCAAATCTGTTTGTGCTA	0.353																																					p.T314T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A942G	2						.						67.0	69.0	69.0					2																	224847477		2203	4300	6503	224555721	SO:0001819	synonymous_variant	5270	exon6			M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.906A>G	2.37:g.224847477T>C		Somatic		Capture	SOLID	Phase_I	224555721	NM_001136530	B2R6A4|B4DIF2|Q53S15|Q5D0C4	Silent	SNP	ENST00000258405.4	37	CCDS2460.1																																																																																				SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256865.2	NM_006216	
SERPINE2	5270	hgsc.bcm.edu	37	2	224856577	224856577	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:224856577C>T	ENST00000258405.4	-	4	870	c.628G>A	c.(628-630)Gcc>Acc	p.A210T	SERPINE2_ENST00000447280.2_Missense_Mutation_p.A222T|SERPINE2_ENST00000409304.1_Missense_Mutation_p.A210T|SERPINE2_ENST00000409840.3_Missense_Mutation_p.A210T	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	210					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.A210T(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TTCCCGTCGGCTGCCACGAAA	0.547																																					p.A222T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G664A	2						.						157.0	116.0	130.0					2																	224856577		2203	4300	6503	224564821	SO:0001583	missense	5270	exon4			M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.628G>A	2.37:g.224856577C>T	ENSP00000258405:p.Ala210Thr	Somatic		Capture	SOLID	Phase_I	224564821	NM_001136530	B2R6A4|B4DIF2|Q53S15|Q5D0C4	Missense_Mutation	SNP	ENST00000258405.4	37	CCDS2460.1	.	.	.	.	.	.	.	.	.	.	C	10.93	1.491367	0.26774	.	.	ENSG00000135919	ENST00000409304;ENST00000258405;ENST00000409840;ENST00000447280;ENST00000432738	T;T;T;T;T	0.73897	2.02;-0.79;2.02;2.02;2.02	5.8	4.91	0.64330	Serpin domain (3);	0.357723	0.32357	N	0.006211	T	0.66973	0.2844	N	0.17312	0.475	0.09310	N	1	P;P	0.36837	0.571;0.571	P;B	0.45577	0.486;0.27	T	0.63274	-0.6674	10	0.59425	D	0.04	.	11.8023	0.52135	0.1385:0.7283:0.1331:0.0	.	222;210	B4DIF2;P07093	.;GDN_HUMAN	T	210;210;210;222;210	ENSP00000386412:A210T;ENSP00000258405:A210T;ENSP00000386969:A210T;ENSP00000415786:A222T;ENSP00000408452:A210T	ENSP00000258405:A210T	A	-	1	0	SERPINE2	224564821	0.542000	0.26426	0.004000	0.12327	0.007000	0.05969	2.928000	0.48908	1.428000	0.47296	-0.188000	0.12872	GCC		SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256865.2	NM_006216	
IRS1	3667	hgsc.bcm.edu	37	2	227661345	227661345	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:227661345C>T	ENST00000305123.5	-	1	3130	c.2110G>A	c.(2110-2112)Ggg>Agg	p.G704R	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	704					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.G704R(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		TGGTGGCCCCCTACCCCGTTT	0.597											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G704R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2110A	2						.						94.0	99.0	97.0					2																	227661345		2203	4300	6503	227369589	SO:0001583	missense	3667	exon1				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.2110G>A	2.37:g.227661345C>T	ENSP00000304895:p.Gly704Arg	Somatic	2321	Capture	SOLID	Phase_I	227369589	NM_005544		Missense_Mutation	SNP	ENST00000305123.5	37	CCDS2463.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.318680	0.40996	.	.	ENSG00000169047	ENST00000305123	T	0.60672	0.17	4.75	3.87	0.44632	.	0.112154	0.39615	N	0.001314	T	0.43722	0.1260	N	0.22421	0.69	0.25075	N	0.990967	P	0.41313	0.745	B	0.43575	0.424	T	0.23511	-1.0186	10	0.27082	T	0.32	-5.5378	9.0464	0.36349	0.0:0.8295:0.0:0.1705	.	704	P35568	IRS1_HUMAN	R	704	ENSP00000304895:G704R	ENSP00000304895:G704R	G	-	1	0	IRS1	227369589	0.012000	0.17670	0.399000	0.26333	0.429000	0.31625	1.154000	0.31688	1.222000	0.43521	0.561000	0.74099	GGG		IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544	
CHRNG	1146	hgsc.bcm.edu	37	2	233404477	233404477	+	Missense_Mutation	SNP	C	C	T	rs200661257	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:233404477C>T	ENST00000389494.3	+	1	41	c.20C>T	c.(19-21)cCg>cTg	p.P7L	CHRNG_ENST00000389492.3_Missense_Mutation_p.P7L	NM_005199.4	NP_005190.4	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma (muscle)	7					muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)	p.P7L(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)	Galantamine(DB00674)	GGCCAGGGGCCGCTGCTCCTC	0.647													C|||	3	0.000599042	0.0	0.0	5008	,	,		16855	0.002		0.001	False		,,,				2504	0.0				p.P7L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C20T	2						.						84.0	100.0	94.0					2																	233404477		2203	4300	6503	233112721	SO:0001583	missense	1146	exon1			X01715	CCDS33400.1	2q37.1	2012-10-02	2012-02-07		ENSG00000196811	ENSG00000196811		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1967	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, gamma (muscle)"""	100730	"""cholinergic receptor, nicotinic, gamma"""	ACHRG			Standard	NM_005199		Approved		uc002vsx.1	P07510	OTTHUMG00000153327	ENST00000389494.3:c.20C>T	2.37:g.233404477C>T	ENSP00000374145:p.Pro7Leu	Somatic		Capture	SOLID	Phase_I	233112721	NM_005199	B3KWM8|Q14DU4|Q53RG2	Missense_Mutation	SNP	ENST00000389494.3	37	CCDS33400.1	2	9.157509157509158E-4	0	0.0	0	0.0	1	0.0017482517482517483	1	0.0013192612137203166	C	0.876	-0.730403	0.03135	.	.	ENSG00000196811	ENST00000389494;ENST00000541596;ENST00000389492	T;D	0.83992	-1.26;-1.79	3.8	-5.57	0.02521	.	0.376195	0.19560	N	0.111353	T	0.52869	0.1761	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.54516	-0.8282	10	0.07644	T	0.81	.	4.2224	0.10565	0.0998:0.2685:0.0992:0.5325	.	7;7	Q14DU4;P07510	.;ACHG_HUMAN	L	7	ENSP00000374145:P7L;ENSP00000374143:P7L	ENSP00000374143:P7L	P	+	2	0	CHRNG	233112721	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.718000	0.00384	-1.644000	0.01517	-1.264000	0.01445	CCG		CHRNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330743.1	NM_005199	
AGAP1	116987	hgsc.bcm.edu	37	2	236839495	236839495	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:236839495C>T	ENST00000304032.8	+	12	1991	c.1411C>T	c.(1411-1413)Cgc>Tgc	p.R471C	AGAP1_ENST00000409538.1_Intron|AGAP1_ENST00000336665.5_Intron|AGAP1_ENST00000428334.2_Missense_Mutation_p.R310C	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	471	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)	p.R471C(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						CATGCACCAGCGCTCCTACTC	0.587																																					p.R471C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1411T	2						.						75.0	63.0	67.0					2																	236839495		2203	4300	6503	236504234	SO:0001583	missense	116987	exon12			AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.1411C>T	2.37:g.236839495C>T	ENSP00000307634:p.Arg471Cys	Somatic		Capture	SOLID	Phase_I	236504234	NM_001037131	B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	ENST00000304032.8	37	CCDS33408.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.95|16.95	3.262707|3.262707	0.59431|0.59431	.|.	.|.	ENSG00000157985|ENSG00000157985	ENST00000448025|ENST00000304032;ENST00000428334	.|T;T	.|0.80033	.|-1.33;-1.33	5.36|5.36	5.36|5.36	0.76844|0.76844	.|Pleckstrin homology domain (3);	.|0.363985	.|0.24615	.|N	.|0.037009	D|D	0.87569|0.87569	0.6210|0.6210	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	D|D	0.86999|0.86999	0.2115|0.2115	5|10	.|0.49607	.|T	.|0.09	.|.	13.9761|13.9761	0.64275|0.64275	0.1517:0.8483:0.0:0.0|0.1517:0.8483:0.0:0.0	.|.	.|471	.|Q9UPQ3	.|AGAP1_HUMAN	V|C	104|471;310	.|ENSP00000307634:R471C;ENSP00000411824:R310C	.|ENSP00000307634:R471C	A|R	+|+	2|1	0|0	AGAP1|AGAP1	236504234|236504234	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.960000|0.960000	0.62799|0.62799	4.449000|4.449000	0.60034|0.60034	2.676000|2.676000	0.91093|0.91093	0.655000|0.655000	0.94253|0.94253	GCG|CGC		AGAP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257076.2	NM_014914	
ACKR3	57007	hgsc.bcm.edu	37	2	237489831	237489831	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:237489831G>A	ENST00000272928.3	+	2	1033	c.723G>A	c.(721-723)gcG>gcA	p.A241A		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	241					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)	p.A241A(1)									CCATCTCGGCGTCCAGTGACC	0.592																																					p.A241A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G723A	2						.						100.0	84.0	89.0					2																	237489831		2203	4300	6503	237154570	SO:0001819	synonymous_variant	57007	exon2			BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.723G>A	2.37:g.237489831G>A		Somatic		Capture	SOLID	Phase_I	237154570	NM_020311	A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Silent	SNP	ENST00000272928.3	37	CCDS2516.1																																																																																				ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257079.2	NM_020311	
NDUFA10	4705	hgsc.bcm.edu	37	2	240960717	240960717	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:240960717A>G	ENST00000252711.2	-	3	457	c.357T>C	c.(355-357)gaT>gaC	p.D119D	NDUFA10_ENST00000404554.1_Silent_p.D119D|NDUFA10_ENST00000307300.4_Silent_p.D119D|NDUFA10_ENST00000407129.3_Silent_p.D119D	NM_004544.3	NP_004535.1	O95299	NDUAA_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa	119					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|nucleoside kinase activity (GO:0019206)	p.D119D(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)	16		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)		TTCTCGGATCATCGTAAAATT	0.512											OREG0015348	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D119D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T357C	2						.						113.0	107.0	109.0					2																	240960717		2203	4300	6503	240609390	SO:0001819	synonymous_variant	4705	exon3			AF087661	CCDS2531.1	2q37.3	2011-07-04	2002-08-29		ENSG00000130414	ENSG00000130414		"""Mitochondrial respiratory chain complex / Complex I"""	7684	protein-coding gene	gene with protein product	"""complex I 42kDa subunit"""	603835	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10 (42kD)"""			9878551	Standard	NM_004544		Approved	CI-42k	uc002vyn.3	O95299	OTTHUMG00000133350	ENST00000252711.2:c.357T>C	2.37:g.240960717A>G		Somatic	2423	Capture	SOLID	Phase_I	240609390	NM_004544	Q8WXC9	Silent	SNP	ENST00000252711.2	37	CCDS2531.1																																																																																				NDUFA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257180.2	NM_004544	
COLEC11	78989	hgsc.bcm.edu	37	2	3660935	3660935	+	Silent	SNP	C	C	T	rs62107197	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:3660935C>T	ENST00000349077.4	+	3	268	c.165C>T	c.(163-165)ccC>ccT	p.P55P	COLEC11_ENST00000418971.2_Silent_p.P69P|COLEC11_ENST00000487365.1_Intron|COLEC11_ENST00000236693.7_Missense_Mutation_p.P26L|COLEC11_ENST00000404205.1_Intron|COLEC11_ENST00000402922.1_Silent_p.P29P|COLEC11_ENST00000403096.3_Silent_p.P29P|COLEC11_ENST00000382062.2_Silent_p.P55P|COLEC11_ENST00000402794.1_Intron	NM_024027.4	NP_076932.1	Q9BWP8	COL11_HUMAN	collectin sub-family member 11	55					developmental process (GO:0032502)|multicellular organismal development (GO:0007275)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)	mannose binding (GO:0005537)	p.P26L(1)|p.P69P(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|soft_tissue(1)	22	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		AAGGCGCCCCCGGACGGCCTG	0.622																																					p.P26L												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(2)	c.C77T	2						.	A	,LEU/PRO	1,4377		0,1,2188	26.0	28.0	27.0		165,77	-0.9	1.0	2	dbSNP_129	27	6,8588		0,6,4291	yes	coding-synonymous,missense	COLEC11	NM_024027.3,NM_199235.1	,98	0,7,6479	TT,TC,CC		0.0698,0.0228,0.054	,	55/272,26/269	3660935	7,12965	2189	4297	6486	3638810	SO:0001819	synonymous_variant	78989	exon3			BC000078	CCDS1649.1, CCDS1650.1, CCDS58689.1, CCDS58690.1, CCDS58691.1, CCDS58692.1, CCDS58693.1, CCDS58694.1	2p25.3	2014-09-17			ENSG00000118004	ENSG00000118004		"""Collectins"""	17213	protein-coding gene	gene with protein product	"""Collectin K1"""	612502					Standard	NM_024027		Approved	MGC3279, CL-K1	uc031rnn.1	Q9BWP8	OTTHUMG00000090304	ENST00000349077.4:c.165C>T	2.37:g.3660935C>T		Somatic		Capture	SOLID	Phase_I	3638810	NM_199235	A1IGE4|A1IGE5|A1IGE6|A7VJJ2|A7VJJ3|A7VJJ4|A7VJJ5|B2R9M5|B4E1G0|J3KQY9|Q5CZ85|Q7Z6N1	Missense_Mutation	SNP	ENST00000349077.4	37	CCDS1649.1	.	.	.	.	.	.	.	.	.	.	A	18.82	3.705946	0.68615	2.28E-4	6.98E-4	ENSG00000118004	ENST00000236693	T	0.04234	3.67	4.62	-0.909	0.10514	.	0.104490	0.64402	D	0.000003	T	0.04137	0.0115	.	.	.	0.80722	D	1	B	0.25743	0.133	B	0.19666	0.026	T	0.39563	-0.9608	9	0.66056	D	0.02	-0.3101	7.9488	0.30001	0.4066:0.4685:0.125:0.0	rs62107197	26	Q9BWP8-9	.	L	26	ENSP00000236693:P26L	ENSP00000236693:P26L	P	+	2	0	COLEC11	3638810	0.662000	0.27439	0.995000	0.50966	0.986000	0.74619	-0.340000	0.07821	-0.399000	0.07668	-0.363000	0.07495	CCG		COLEC11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206666.1	NM_024027	
NCOA1	8648	hgsc.bcm.edu	37	2	24930023	24930023	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:24930023A>G	ENST00000406961.1	+	13	2336	c.1684A>G	c.(1684-1686)Agg>Ggg	p.R562G	NCOA1_ENST00000538539.1_Missense_Mutation_p.R562G|NCOA1_ENST00000395856.3_Missense_Mutation_p.R562G|NCOA1_ENST00000407230.1_Missense_Mutation_p.R411G|NCOA1_ENST00000288599.5_Missense_Mutation_p.R562G|NCOA1_ENST00000348332.3_Missense_Mutation_p.R562G|NCOA1_ENST00000405141.1_Missense_Mutation_p.R562G			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	562	Interaction with STAT3.|Ser-rich.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)	p.R562G(2)	PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCAGTCCTCAGGCAGATGAG	0.393			T	PAX3	alveolar rhadomyosarcoma																																p.R562G			Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1684G	2						.						56.0	58.0	58.0					2																	24930023		2202	4300	6502	24783527	SO:0001583	missense	8648	exon11			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.1684A>G	2.37:g.24930023A>G	ENSP00000385216:p.Arg562Gly	Somatic		Capture	SOLID	Phase_I	24783527	NM_003743	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	ENST00000406961.1	37	CCDS1712.1	.	.	.	.	.	.	.	.	.	.	A	17.13	3.310162	0.60414	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.02472	4.38;4.38;4.28;4.38;4.38;4.38;4.38	5.74	0.223	0.15292	.	0.105878	0.64402	D	0.000006	T	0.09730	0.0239	L	0.53249	1.67	0.41193	D	0.986315	D;D;D;D	0.67145	0.996;0.985;0.996;0.982	P;P;P;P	0.61874	0.895;0.637;0.895;0.715	T	0.01496	-1.1340	10	0.72032	D	0.01	.	16.7775	0.85555	0.3389:0.6611:0.0:0.0	.	562;562;562;411	Q15788-3;Q15788;Q15788-2;B5MCN7	.;NCOA1_HUMAN;.;.	G	562;562;411;562;562;562;562	ENSP00000385216:R562G;ENSP00000385097:R562G;ENSP00000385195:R411G;ENSP00000444039:R562G;ENSP00000320940:R562G;ENSP00000288599:R562G;ENSP00000379197:R562G	ENSP00000288599:R562G	R	+	1	2	NCOA1	24783527	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	0.833000	0.27504	0.089000	0.17243	0.533000	0.62120	AGG		NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223	
ADCY3	109	hgsc.bcm.edu	37	2	25059816	25059816	+	Silent	SNP	C	C	T	rs148014908		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:25059816C>T	ENST00000260600.5	-	8	2483	c.1632G>A	c.(1630-1632)acG>acA	p.T544T	ADCY3_ENST00000405392.1_Silent_p.T177T	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	544					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.T544T(1)		NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GCTTCTCCGACGTGGACCCAC	0.637																																					p.T544T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1632A	2						.	C		1,4405	4.2+/-10.8	0,1,2202	55.0	50.0	52.0		1632	-10.8	0.0	2	dbSNP_134	52	0,8600		0,0,4300	no	coding-synonymous	ADCY3	NM_004036.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		544/1145	25059816	1,13005	2203	4300	6503	24913320	SO:0001819	synonymous_variant	109	exon8			AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.1632G>A	2.37:g.25059816C>T		Somatic		Capture	SOLID	Phase_I	24913320	NM_004036	B3KT86|Q53T54|Q9UDB1	Silent	SNP	ENST00000260600.5	37	CCDS1715.1																																																																																				ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2		
DPYSL5	56896	hgsc.bcm.edu	37	2	27167550	27167550	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:27167550C>T	ENST00000288699.6	+	12	1625	c.1467C>T	c.(1465-1467)cgC>cgT	p.R489R	DPYSL5_ENST00000401478.1_Silent_p.R489R	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	489					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.R489R(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGTGGACCGCACTCCCTACC	0.562																																					p.R489R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1467T	2						.						84.0	79.0	81.0					2																	27167550		2203	4300	6503	27021054	SO:0001819	synonymous_variant	56896	exon12			AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.1467C>T	2.37:g.27167550C>T		Somatic		Capture	SOLID	Phase_I	27021054	NM_020134	Q8TCL6|Q9NQC4|Q9NRY9	Silent	SNP	ENST00000288699.6	37	CCDS1730.1																																																																																				DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	NM_020134	
TRIM54	57159	hgsc.bcm.edu	37	2	27521547	27521547	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:27521547G>A	ENST00000380075.2	+	2	621	c.281G>A	c.(280-282)gGc>gAc	p.G94D	TRIM54_ENST00000296098.4_Missense_Mutation_p.G94D	NM_187841.2	NP_912730.2	Q9BYV2	TRI54_HUMAN	tripartite motif containing 54	94					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|negative regulation of microtubule depolymerization (GO:0007026)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.G78D(1)		cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTGTCTACGGCCTGCAGCGA	0.572																																					p.G94D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G281A	2						.						86.0	67.0	73.0					2																	27521547		2203	4300	6503	27375051	SO:0001583	missense	57159	exon2			AJ291714	CCDS1745.2, CCDS1746.2	2p23.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000138100	ENSG00000138100		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16008	protein-coding gene	gene with protein product		606474	"""ring finger protein 30"", ""tripartite motif-containing 54"""	RNF30		11243782	Standard	NM_032546		Approved	MURF, MURF-3	uc002rjn.3	Q9BYV2	OTTHUMG00000097078	ENST00000380075.2:c.281G>A	2.37:g.27521547G>A	ENSP00000369415:p.Gly94Asp	Somatic		Capture	SOLID	Phase_I	27375051	NM_032546	A5D8T7|Q53SY4|Q9BYV3	Missense_Mutation	SNP	ENST00000380075.2	37	CCDS1746.2	.	.	.	.	.	.	.	.	.	.	G	31	5.102330	0.94245	.	.	ENSG00000138100	ENST00000380075;ENST00000296098	T;T	0.52295	0.93;0.67	5.34	5.34	0.76211	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.72653	0.3487	M	0.86953	2.85	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.74674	0.96;0.984	T	0.77210	-0.2671	10	0.59425	D	0.04	-24.2369	16.5279	0.84336	0.0:0.0:1.0:0.0	.	94;94	Q9BYV2;Q9BYV2-2	TRI54_HUMAN;.	D	94	ENSP00000369415:G94D;ENSP00000296098:G94D	ENSP00000296098:G94D	G	+	2	0	TRIM54	27375051	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.790000	0.99075	2.498000	0.84270	0.511000	0.50034	GGC		TRIM54-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214199.2	NM_187841	
GTF3C2	2976	hgsc.bcm.edu	37	2	27560202	27560202	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:27560202C>T	ENST00000359541.2	-	7	1465	c.1036G>A	c.(1036-1038)Gct>Act	p.A346T	AC109828.1_ENST00000588707.1_RNA|AC109828.1_ENST00000585645.1_RNA|AC109828.1_ENST00000589853.1_RNA|AC109828.1_ENST00000585326.1_RNA|AC109828.1_ENST00000587586.1_RNA|AC109828.1_ENST00000608473.1_RNA|AC109828.1_ENST00000590383.1_RNA|GTF3C2_ENST00000264720.3_Missense_Mutation_p.A346T|AC109828.1_ENST00000592265.1_RNA|AC109828.1_ENST00000589232.1_RNA|AC109828.1_ENST00000416453.2_RNA|AC109828.1_ENST00000590754.1_RNA			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa	346					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)		p.A346T(2)		central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGTAGGGAGCGGCCTCACTG	0.502																																					p.A346T												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G1036A	2						.						47.0	43.0	44.0					2																	27560202		2203	4300	6503	27413706	SO:0001583	missense	2976	exon7			D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.1036G>A	2.37:g.27560202C>T	ENSP00000352536:p.Ala346Thr	Somatic		Capture	SOLID	Phase_I	27413706	NM_001035521	D6W557|Q16632|Q9BWI7	Missense_Mutation	SNP	ENST00000359541.2	37	CCDS1749.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701990	0.88924	.	.	ENSG00000115207	ENST00000359541;ENST00000264720	T;T	0.73681	-0.77;-0.77	5.8	5.8	0.92144	.	0.053230	0.64402	D	0.000001	T	0.77857	0.4193	L	0.27053	0.805	0.39677	D	0.970845	D;D;D	0.89917	1.0;0.999;1.0	D;P;D	0.74674	0.984;0.874;0.959	T	0.73310	-0.4023	10	0.18710	T	0.47	-13.0757	17.5632	0.87912	0.0:1.0:0.0:0.0	.	346;346;346	Q8WUA4-2;Q8WUA4;Q53QN0	.;TF3C2_HUMAN;.	T	346	ENSP00000352536:A346T;ENSP00000264720:A346T	ENSP00000264720:A346T	A	-	1	0	GTF3C2	27413706	1.000000	0.71417	0.999000	0.59377	0.659000	0.38960	5.379000	0.66196	2.758000	0.94735	0.563000	0.77884	GCT		GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215028.2		
IFT172	26160	hgsc.bcm.edu	37	2	27676351	27676351	+	Missense_Mutation	SNP	C	C	T	rs147394910	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:27676351C>T	ENST00000260570.3	-	35	3954	c.3851G>A	c.(3850-3852)cGa>cAa	p.R1284Q		NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	1284					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)		p.R1284Q(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					CTCCCAGTGTCGAGCTTGTTC	0.587													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19424	0.0		0.0	False		,,,				2504	0.0				p.R1284Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3851A	2						.	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	71.0	64.0	66.0		3851	4.4	0.8	2	dbSNP_134	66	3,8597	3.0+/-9.4	0,3,4297	yes	missense	IFT172	NM_015662.1	43	0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308	benign	1284/1750	27676351	4,13002	2203	4300	6503	27529855	SO:0001583	missense	26160	exon35			AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.3851G>A	2.37:g.27676351C>T	ENSP00000260570:p.Arg1284Gln	Somatic		Capture	SOLID	Phase_I	27529855	NM_015662	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Missense_Mutation	SNP	ENST00000260570.3	37	CCDS1755.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	14.19	2.461362	0.43736	2.27E-4	3.49E-4	ENSG00000138002	ENST00000260570	T	0.75704	-0.96	5.26	4.38	0.52667	.	0.201186	0.41823	N	0.000803	T	0.57961	0.2089	N	0.20986	0.625	0.80722	D	1	B	0.31383	0.321	B	0.22601	0.04	T	0.56214	-0.8016	10	0.35671	T	0.21	-3.8801	12.3328	0.55049	0.0:0.917:0.0:0.083	.	1284	Q9UG01	IF172_HUMAN	Q	1284	ENSP00000260570:R1284Q	ENSP00000260570:R1284Q	R	-	2	0	IFT172	27529855	0.828000	0.29307	0.834000	0.33040	0.679000	0.39708	1.667000	0.37471	1.221000	0.43506	0.313000	0.20887	CGA		IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250213.2	NM_015662	
GALNT14	79623	hgsc.bcm.edu	37	2	31154991	31154991	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:31154991A>C	ENST00000349752.5	-	10	1640	c.1001T>G	c.(1000-1002)gTc>gGc	p.V334G	GALNT14_ENST00000324589.5_Missense_Mutation_p.V339G|GALNT14_ENST00000486564.1_5'UTR|GALNT14_ENST00000356174.3_Missense_Mutation_p.V301G|GALNT14_ENST00000420311.2_Missense_Mutation_p.V299G|GALNT14_ENST00000406653.1_Missense_Mutation_p.V314G	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	334	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					CTTCCGGAAGACGTGCCCCAC	0.592																																					p.V334G												.	.	0			c.T1001G	2						.						97.0	90.0	92.0					2																	31154991		2203	4300	6503	31008495	SO:0001583	missense	79623	exon10			AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.1001T>G	2.37:g.31154991A>C	ENSP00000288988:p.Val334Gly	Somatic		Capture	SOLID	Phase_I	31008495	NM_024572	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	A	26.5	4.740094	0.89573	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.84316	0.5445	H	0.94925	3.6	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.998;1.0;1.0;1.0	D	0.88980	0.3407	10	0.87932	D	0	.	14.6772	0.68989	1.0:0.0:0.0:0.0	.	299;301;339;334;314	F5H263;Q96FL9-2;Q96FL9-3;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	G	334;339;314;301;299;301	ENSP00000288988:V334G;ENSP00000314500:V339G;ENSP00000385435:V314G;ENSP00000348497:V301G;ENSP00000415514:V299G;ENSP00000406399:V301G	ENSP00000314500:V339G	V	-	2	0	GALNT14	31008495	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.339000	0.96797	1.877000	0.54381	0.459000	0.35465	GTC		GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572	
XDH	7498	hgsc.bcm.edu	37	2	31609339	31609339	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:31609339A>G	ENST00000379416.3	-	9	782	c.734T>C	c.(733-735)cTg>cCg	p.L245P	XDH_ENST00000491727.1_5'UTR	NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	245	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)	p.L245P(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	GAGGTCCAGCAGCTCCTTGAG	0.607																																					p.L245P	Colon(66;682 1445 30109 40147)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T734C	2						.						122.0	101.0	108.0					2																	31609339		2203	4300	6503	31462843	SO:0001583	missense	7498	exon9			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.734T>C	2.37:g.31609339A>G	ENSP00000368727:p.Leu245Pro	Somatic		Capture	SOLID	Phase_I	31462843	NM_000379	Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	ENST00000379416.3	37	CCDS1775.1	.	.	.	.	.	.	.	.	.	.	A	16.03	3.007142	0.54361	.	.	ENSG00000158125	ENST00000379416	T	0.27890	1.64	5.9	5.9	0.94986	FAD-binding, type 2, subdomain 1 (1);FAD-binding, type 2 (2);Xanthine dehydrogenase, small subunit (1);Molybdopterin dehydrogenase, FAD-binding (1);	0.202153	0.44688	D	0.000430	T	0.67804	0.2932	H	0.95679	3.705	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.78414	-0.2213	10	0.87932	D	0	.	15.3563	0.74428	1.0:0.0:0.0:0.0	.	245	P47989	XDH_HUMAN	P	245	ENSP00000368727:L245P	ENSP00000368727:L245P	L	-	2	0	XDH	31462843	1.000000	0.71417	1.000000	0.80357	0.055000	0.15305	7.203000	0.77864	2.268000	0.75426	0.519000	0.50382	CTG		XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
RMDN2	151393	hgsc.bcm.edu	37	2	38179273	38179273	+	Intron	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:38179273T>C	ENST00000406384.1	+	3	646				RMDN2_ENST00000402091.3_Silent_p.F305F|RMDN2_ENST00000407257.1_Silent_p.F305F|RMDN2_ENST00000354545.2_Intron|RMDN2-AS1_ENST00000414365.2_RNA|RMDN2_ENST00000417700.2_Intron|RMDN2_ENST00000234195.3_Silent_p.F305F	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)											CAGGCCTGTTTGAAGATGAAG	0.378																																					p.F305F												.	.	0			c.T915C	2						.						73.0	77.0	76.0					2																	38179273		2202	4296	6498	38032777	SO:0001627	intron_variant	151393	exon2			AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.453-21910T>C	2.37:g.38179273T>C		Somatic		Capture	SOLID	Phase_I	38032777	NM_144713	A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Silent	SNP	ENST00000406384.1	37	CCDS54351.1																																																																																				RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325577.1	NM_144713	
SLC8A1	6546	hgsc.bcm.edu	37	2	40657254	40657254	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:40657254T>G	ENST00000403092.1	-	2	200	c.167A>C	c.(166-168)aAg>aCg	p.K56T	SLC8A1_ENST00000542756.1_Missense_Mutation_p.K56T|SLC8A1_ENST00000408028.2_Missense_Mutation_p.K56T|SLC8A1_ENST00000406785.2_Missense_Mutation_p.K56T|SLC8A1_ENST00000405901.3_Missense_Mutation_p.K56T|SLC8A1_ENST00000406391.2_Missense_Mutation_p.K56T|SLC8A1_ENST00000402441.1_Missense_Mutation_p.K56T|SLC8A1_ENST00000405269.1_Missense_Mutation_p.K56T|SLC8A1_ENST00000542024.1_Missense_Mutation_p.K56T|SLC8A1_ENST00000332839.4_Missense_Mutation_p.K56T			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	56					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.K56T(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CACCCCTTTCTTACAGTAATA	0.418																																					p.K56T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A167C	2						.						124.0	123.0	124.0					2																	40657254		2203	4300	6503	40510758	SO:0001583	missense	6546	exon1				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.167A>C	2.37:g.40657254T>G	ENSP00000384763:p.Lys56Thr	Somatic		Capture	SOLID	Phase_I	40510758	NM_001112800	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	T	10.57	1.387597	0.25031	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000542640;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024;ENST00000455476;ENST00000448531;ENST00000417271	T;T;T;T;T;T;T;T;T;T	0.29142	1.59;1.62;1.62;1.62;1.59;1.59;1.62;1.58;1.59;1.59	6.04	6.04	0.98038	.	0.378221	0.33127	N	0.005255	T	0.43500	0.1250	L	0.28504	0.86	0.46279	D	0.998962	B;D;B;B;B	0.61080	0.218;0.989;0.051;0.065;0.017	B;D;B;B;B	0.70487	0.056;0.969;0.023;0.049;0.007	T	0.32955	-0.9887	10	0.54805	T	0.06	.	14.5406	0.67990	0.0:0.0:0.0:1.0	.	56;56;56;56;56	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	T	56	ENSP00000383886:K56T;ENSP00000440727:K56T;ENSP00000384763:K56T;ENSP00000385678:K56T;ENSP00000385188:K56T;ENSP00000385535:K56T;ENSP00000332931:K56T;ENSP00000384908:K56T;ENSP00000385811:K56T;ENSP00000443515:K56T	ENSP00000332931:K56T	K	-	2	0	SLC8A1	40510758	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.918000	0.63376	2.317000	0.78254	0.460000	0.39030	AAG		SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
ABCG8	64241	hgsc.bcm.edu	37	2	44102301	44102301	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:44102301C>T	ENST00000272286.2	+	11	1595	c.1505C>T	c.(1504-1506)cCg>cTg	p.P502L		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	502	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)	p.P502L(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	GGGGAGCTTCCGGAGCACTGT	0.552																																					p.P502L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1505T	2						.						76.0	73.0	74.0					2																	44102301		2203	4300	6503	43955805	SO:0001583	missense	64241	exon11			AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.1505C>T	2.37:g.44102301C>T	ENSP00000272286:p.Pro502Leu	Somatic		Capture	SOLID	Phase_I	43955805	NM_022437	Q53QN8	Missense_Mutation	SNP	ENST00000272286.2	37	CCDS1815.1	.	.	.	.	.	.	.	.	.	.	C	19.23	3.788115	0.70337	.	.	ENSG00000143921	ENST00000272286	T	0.74947	-0.89	4.62	4.62	0.57501	ABC-2 type transporter (1);	0.000000	0.85682	D	0.000000	D	0.86024	0.5834	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.88291	0.2943	10	0.87932	D	0	.	17.4715	0.87647	0.0:1.0:0.0:0.0	.	501;502	Q9H221-2;Q9H221	.;ABCG8_HUMAN	L	502	ENSP00000272286:P502L	ENSP00000272286:P502L	P	+	2	0	ABCG8	43955805	1.000000	0.71417	0.911000	0.35937	0.524000	0.34500	7.275000	0.78548	2.117000	0.64856	0.467000	0.42956	CCG		ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1	NM_022437	
LRPPRC	10128	hgsc.bcm.edu	37	2	44161915	44161915	+	Silent	SNP	G	G	A	rs376938606		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:44161915G>A	ENST00000260665.7	-	24	2664	c.2607C>T	c.(2605-2607)ggC>ggT	p.G869G		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	869					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.G869G(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GATCAGTCTCGCCTTTCTCTA	0.363																																					p.G869G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2607T	2						.	G		0,4406		0,0,2203	124.0	119.0	121.0		2607	0.2	1.0	2		121	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LRPPRC	NM_133259.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		869/1395	44161915	1,13005	2203	4300	6503	44015419	SO:0001819	synonymous_variant	10128	exon24			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.2607C>T	2.37:g.44161915G>A		Somatic		Capture	SOLID	Phase_I	44015419	NM_133259	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Silent	SNP	ENST00000260665.7	37	CCDS33189.1																																																																																				LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	
MSH6	2956	hgsc.bcm.edu	37	2	48026580	48026580	+	Silent	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:48026580T>G	ENST00000234420.5	+	4	1610	c.1458T>G	c.(1456-1458)acT>acG	p.T486T	FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000538136.1_Silent_p.T184T|MSH6_ENST00000540021.1_Silent_p.T356T	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	486					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)|p.T486T(1)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TGGAACAGACTGAGACTCCAG	0.468			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.T486T		yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	.	3	Whole gene deletion(2)|Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)	c.T1458G	2						.						89.0	82.0	85.0					2																	48026580		2203	4300	6503	47880084	SO:0001819	synonymous_variant	2956	exon4	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.1458T>G	2.37:g.48026580T>G		Somatic		Capture	SOLID	Phase_I	47880084	NM_000179	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Silent	SNP	ENST00000234420.5	37	CCDS1836.1																																																																																				MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
REL	5966	hgsc.bcm.edu	37	2	61147240	61147240	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:61147240T>C	ENST00000295025.8	+	8	1238	c.918T>C	c.(916-918)gaT>gaC	p.D306D	REL_ENST00000394479.3_Silent_p.D306D	NM_002908.2	NP_002899.1	Q04864	REL_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog	306					cytokine production (GO:0001816)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of neuron death (GO:1901215)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D306D(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(3)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	16	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)			TGTGCCAGGATCACGGTAAGA	0.289			A		Hodgkin Lymphoma																																p.D306D			Dom	yes		2	2p13-p12	5966	v-rel reticuloendotheliosis viral oncogene homolog (avian)		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T918C	2						.						76.0	77.0	77.0					2																	61147240		2203	4300	6503	61000744	SO:0001819	synonymous_variant	5966	exon8			M11595	CCDS1864.1, CCDS74515.1	2p13-p12	2013-07-09	2013-07-09		ENSG00000162924	ENSG00000162924			9954	protein-coding gene	gene with protein product		164910				1577270	Standard	XM_005264470		Approved	I-Rel, c-Rel	uc002sam.1	Q04864	OTTHUMG00000129418	ENST00000295025.8:c.918T>C	2.37:g.61147240T>C		Somatic		Capture	SOLID	Phase_I	61000744	NM_002908	Q17RU2|Q2PNZ7|Q6LDY0	Silent	SNP	ENST00000295025.8	37	CCDS1864.1																																																																																				REL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251576.3	NM_002908	
WDR92	116143	hgsc.bcm.edu	37	2	68358522	68358522	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:68358522C>T	ENST00000295121.6	-	8	1038	c.922G>A	c.(922-924)Gca>Aca	p.A308T	RP11-474G23.1_ENST00000406334.3_3'UTR|WDR92_ENST00000492039.2_5'UTR	NM_138458.3	NP_612467.1	Q96MX6	WDR92_HUMAN	WD repeat domain 92	308					apoptotic process (GO:0006915)|histone lysine methylation (GO:0034968)		methylated histone binding (GO:0035064)	p.A308T(1)		endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|stomach(1)	12						ACAGAACCTGCGACTCCCATT	0.433																																					p.A308T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G922A	2						.						114.0	107.0	109.0					2																	68358522		2203	4300	6503	68212026	SO:0001583	missense	116143	exon8			AK056303	CCDS1884.1, CCDS58712.1	2p14	2013-01-09			ENSG00000243667	ENSG00000243667		"""WD repeat domain containing"""	25176	protein-coding gene	gene with protein product		610729				16487927	Standard	NM_138458		Approved	FLJ31741, Monad	uc002see.2	Q96MX6	OTTHUMG00000152561	ENST00000295121.6:c.922G>A	2.37:g.68358522C>T	ENSP00000295121:p.Ala308Thr	Somatic		Capture	SOLID	Phase_I	68212026	NM_138458	Q96CR6	Missense_Mutation	SNP	ENST00000295121.6	37	CCDS1884.1	.	.	.	.	.	.	.	.	.	.	C	17.41	3.381506	0.61845	.	.	ENSG00000243667	ENST00000295121	D	0.89939	-2.59	5.77	4.9	0.64082	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.64402	D	0.000008	D	0.87803	0.6269	M	0.76574	2.34	0.80722	D	1	B	0.15719	0.014	B	0.06405	0.002	D	0.84272	0.0489	10	0.33940	T	0.23	.	13.3085	0.60365	0.0:0.9269:0.0:0.0731	.	308	Q96MX6	WDR92_HUMAN	T	308	ENSP00000295121:A308T	ENSP00000295121:A308T	A	-	1	0	WDR92	68212026	1.000000	0.71417	0.218000	0.23776	0.975000	0.68041	7.445000	0.80570	1.582000	0.49881	0.585000	0.79938	GCA		WDR92-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251754.2	NM_138458	
APLF	200558	hgsc.bcm.edu	37	2	68765235	68765235	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:68765235G>C	ENST00000303795.4	+	7	1207	c.1036G>C	c.(1036-1038)Gag>Cag	p.E346Q	APLF_ENST00000471727.1_3'UTR	NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	346					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.E346Q(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						GTCTCATTCTGAGTCCAGCTC	0.458																																					p.E346Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1036C	2						.						89.0	82.0	84.0					2																	68765235		2203	4300	6503	68618739	SO:0001583	missense	200558	exon7			BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.1036G>C	2.37:g.68765235G>C	ENSP00000307004:p.Glu346Gln	Somatic		Capture	SOLID	Phase_I	68618739	NM_173545	A8K476|Q53P47|Q53PB9|Q53QU0	Missense_Mutation	SNP	ENST00000303795.4	37	CCDS1888.1	.	.	.	.	.	.	.	.	.	.	.	12.73	2.026304	0.35701	.	.	ENSG00000169621	ENST00000303795	T	0.26518	1.73	5.39	2.62	0.31277	.	0.410867	0.27266	N	0.020155	T	0.23210	0.0561	M	0.67953	2.075	0.09310	N	1	B	0.24186	0.099	B	0.21151	0.033	T	0.20438	-1.0275	10	0.41790	T	0.15	.	5.4084	0.16335	0.2369:0.1471:0.616:0.0	.	346	Q8IW19	APLF_HUMAN	Q	346	ENSP00000307004:E346Q	ENSP00000307004:E346Q	E	+	1	0	APLF	68618739	0.043000	0.20138	0.023000	0.16930	0.179000	0.23085	0.237000	0.17985	0.263000	0.21812	0.557000	0.71058	GAG		APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251759.1	NM_173545	
PROKR1	10887	hgsc.bcm.edu	37	2	68882119	68882119	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:68882119C>T	ENST00000303786.3	+	3	1013	c.593C>T	c.(592-594)gCc>gTc	p.A198V	PROKR1_ENST00000394342.2_Missense_Mutation_p.A198V			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	198					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)	p.A198V(1)		endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						ATCCCTTCCGCCTACTTCACC	0.567																																					p.A198V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C593T	2						.						172.0	145.0	155.0					2																	68882119		2203	4300	6503	68735623	SO:0001583	missense	10887	exon2			AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.593C>T	2.37:g.68882119C>T	ENSP00000303775:p.Ala198Val	Somatic		Capture	SOLID	Phase_I	68735623	NM_138964	A5JUU2|Q53QT9|Q8NFJ7	Missense_Mutation	SNP	ENST00000303786.3	37	CCDS1889.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.893394	0.91889	.	.	ENSG00000169618	ENST00000303786;ENST00000394342	T;T	0.36340	1.26;1.26	4.59	4.59	0.56863	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.51312	0.1667	L	0.50919	1.6	0.80722	D	1	D	0.54601	0.967	D	0.64687	0.928	T	0.34976	-0.9807	10	0.35671	T	0.21	.	15.7018	0.77547	0.0:1.0:0.0:0.0	.	198	Q8TCW9	PKR1_HUMAN	V	198	ENSP00000303775:A198V;ENSP00000377874:A198V	ENSP00000303775:A198V	A	+	2	0	PROKR1	68735623	1.000000	0.71417	0.998000	0.56505	0.951000	0.60555	7.374000	0.79633	2.837000	0.97791	0.655000	0.94253	GCC		PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251760.2		
ZNF638	27332	hgsc.bcm.edu	37	2	71654287	71654287	+	Missense_Mutation	SNP	C	C	T	rs140596491		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:71654287C>T	ENST00000409544.1	+	24	5918	c.5288C>T	c.(5287-5289)gCg>gTg	p.A1763V	ZNF638_ENST00000355812.3_3'UTR|ZNF638_ENST00000409407.1_Missense_Mutation_p.A703V|ZNF638_ENST00000264447.4_Missense_Mutation_p.A1763V	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1763					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.A1763V(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						GACTCTCTGGCGGATTTTAAC	0.358													C|||	1	0.000199681	0.0	0.0	5008	,	,		19784	0.0		0.0	False		,,,				2504	0.001				p.A1763V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5288T	2						.	C	VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	105.0	111.0	109.0		5288,5288	3.8	1.0	2	dbSNP_134	109	0,8600		0,0,4300	no	missense,missense	ZNF638	NM_001014972.1,NM_014497.3	64,64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	1763/1979,1763/1979	71654287	1,13005	2203	4300	6503	71507795	SO:0001583	missense	27332	exon24			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.5288C>T	2.37:g.71654287C>T	ENSP00000386433:p.Ala1763Val	Somatic		Capture	SOLID	Phase_I	71507795	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.800074	0.70567	2.27E-4	0.0	ENSG00000075292	ENST00000264447;ENST00000409544;ENST00000409407	T;T;T	0.37915	1.17;1.17;1.55	5.71	3.8	0.43715	.	0.125120	0.36482	N	0.002571	T	0.20861	0.0502	N	0.24115	0.695	0.80722	D	1	B;B	0.31640	0.333;0.225	B;B	0.26614	0.071;0.032	T	0.05852	-1.0860	10	0.33940	T	0.23	-8.9066	8.193	0.31379	0.1572:0.7597:0.0:0.083	.	1763;1763	Q14966-3;Q14966	.;ZN638_HUMAN	V	1763;1763;703	ENSP00000264447:A1763V;ENSP00000386433:A1763V;ENSP00000386813:A703V	ENSP00000264447:A1763V	A	+	2	0	ZNF638	71507795	0.966000	0.33281	0.999000	0.59377	0.954000	0.61252	1.792000	0.38754	1.401000	0.46761	0.655000	0.94253	GCG		ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
ZNF638	27332	hgsc.bcm.edu	37	2	71655744	71655744	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:71655744A>G	ENST00000409544.1	+	25	6243	c.5613A>G	c.(5611-5613)gaA>gaG	p.E1871E	ZNF638_ENST00000355812.3_3'UTR|ZNF638_ENST00000409407.1_Silent_p.E811E|ZNF638_ENST00000264447.4_Silent_p.E1871E	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1871					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.E1871E(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TTGTGACAGAACCAGCAAAAG	0.398																																					p.E1871E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A5613G	2						.						118.0	123.0	121.0					2																	71655744		2203	4300	6503	71509252	SO:0001819	synonymous_variant	27332	exon25			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.5613A>G	2.37:g.71655744A>G		Somatic		Capture	SOLID	Phase_I	71509252	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Silent	SNP	ENST00000409544.1	37	CCDS1917.1																																																																																				ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
M1AP	130951	hgsc.bcm.edu	37	2	74789442	74789442	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:74789442G>A	ENST00000290536.5	-	8	1299	c.1183C>T	c.(1183-1185)Ctg>Ttg	p.L395L	M1AP_ENST00000536235.1_Silent_p.L395L|M1AP_ENST00000464686.1_5'UTR|M1AP_ENST00000358434.2_Intron|M1AP_ENST00000409585.1_Silent_p.L395L	NM_001281296.1|NM_138804.3	NP_001268225.1|NP_620159.2	Q8TC57	M1AP_HUMAN	meiosis 1 associated protein	395					cell differentiation (GO:0030154)|chromatin assembly (GO:0031497)|female gamete generation (GO:0007292)|male meiosis chromosome separation (GO:0051308)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.L395L(1)									TTTACCAGCAGTGTGAGGGAG	0.587																																					p.L395L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1183T	2						.						219.0	182.0	194.0					2																	74789442		2203	4300	6503	74642950	SO:0001819	synonymous_variant	130951	exon8				CCDS33229.1, CCDS62941.1	2p13.1	2013-02-05	2013-02-05	2013-01-16	ENSG00000159374	ENSG00000159374			25183	protein-coding gene	gene with protein product	"""meiosis 1 arresting protein"", ""spermatogenesis associated 37"""		"""chromosome 2 open reading frame 65"""	C2orf65		16881047, 23269666	Standard	NM_138804		Approved	D6Mm5e, SPATA37	uc002smy.3	Q8TC57	OTTHUMG00000152918	ENST00000290536.5:c.1183C>T	2.37:g.74789442G>A		Somatic		Capture	SOLID	Phase_I	74642950	NM_138804	B7Z6E7|E9PGG8|Q6ZP30|Q96L07	Silent	SNP	ENST00000290536.5	37	CCDS33229.1																																																																																				M1AP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328569.1	NM_138804	
SEMA4F	10505	hgsc.bcm.edu	37	2	74901790	74901790	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:74901790T>G	ENST00000357877.2	+	8	1137	c.988T>G	c.(988-990)Ttt>Gtt	p.F330V	SEMA4F_ENST00000339773.5_Missense_Mutation_p.F175V	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	330	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)	p.F330V(1)		biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						TTATGGCATCTTTTCTTCCCA	0.577																																					p.F330V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T988G	2						.						145.0	140.0	142.0					2																	74901790		2203	4300	6503	74755298	SO:0001583	missense	10505	exon8			AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.988T>G	2.37:g.74901790T>G	ENSP00000350547:p.Phe330Val	Somatic		Capture	SOLID	Phase_I	74755298	NM_004263	Q542Y7|Q9NS35	Missense_Mutation	SNP	ENST00000357877.2	37	CCDS1955.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.075040	0.76415	.	.	ENSG00000135622	ENST00000357877;ENST00000339773;ENST00000453930	T;T;T	0.66280	-0.2;-0.2;-0.2	5.33	5.33	0.75918	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	D	0.83022	0.5164	M	0.92738	3.34	0.53688	D	0.99997	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.87100	0.2178	10	0.87932	D	0	.	13.2471	0.60029	0.0:0.0:0.0:1.0	.	175;330	O95754-2;O95754	.;SEM4F_HUMAN	V	330;175;175	ENSP00000350547:F330V;ENSP00000342675:F175V;ENSP00000409141:F175V	ENSP00000342675:F175V	F	+	1	0	SEMA4F	74755298	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.886000	0.69743	2.025000	0.59659	0.240000	0.17902	TTT		SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252214.2	NM_004263	
NCAPH	23397	hgsc.bcm.edu	37	2	97033085	97033085	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:97033085C>T	ENST00000240423.4	+	15	2015	c.1972C>T	c.(1972-1974)Ctc>Ttc	p.L658F	NCAPH_ENST00000455200.1_Missense_Mutation_p.L647F|NCAPH_ENST00000427946.1_Missense_Mutation_p.L522F	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	658					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)		p.L658F(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				GCTGACAGCGCTCTCCGGAAA	0.488																																					p.L658F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1972T	2						.						86.0	83.0	84.0					2																	97033085		2203	4300	6503	96396812	SO:0001583	missense	23397	exon15			BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.1972C>T	2.37:g.97033085C>T	ENSP00000240423:p.Leu658Phe	Somatic		Capture	SOLID	Phase_I	96396812	NM_015341	B4E189|Q8TB87	Missense_Mutation	SNP	ENST00000240423.4	37	CCDS2021.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.264|5.264	0.234184|0.234184	0.09969|0.09969	.|.	.|.	ENSG00000121152|ENSG00000121152	ENST00000435349|ENST00000240423;ENST00000427946;ENST00000455200	T|T;T;T	0.43294|0.41758	0.95|0.99;0.99;0.99	5.76|5.76	-6.71|-6.71	0.01760|0.01760	.|.	.|0.968278	.|0.08595	.|N	.|0.922454	T|T	0.10637|0.10637	0.0260|0.0260	N|N	0.00926|0.00926	-1.1|-1.1	0.09310|0.09310	N|N	1|1	.|B;B	.|0.06786	.|0.001;0.001	.|B;B	.|0.08055	.|0.003;0.002	T|T	0.16541|0.16541	-1.0399|-1.0399	7|10	0.35671|0.52906	T|T	0.21|0.07	1.795|1.795	0.9937|0.9937	0.01462|0.01462	0.3931:0.2215:0.1:0.2854|0.3931:0.2215:0.1:0.2854	.|.	.|634;658	.|B4DRG7;Q15003	.|.;CND2_HUMAN	V|F	98|658;522;647	ENSP00000415162:A98V|ENSP00000240423:L658F;ENSP00000400774:L522F;ENSP00000407308:L647F	ENSP00000415162:A98V|ENSP00000240423:L658F	A|L	+|+	2|1	0|0	NCAPH|NCAPH	96396812|96396812	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.025000|0.025000	0.11179|0.11179	-1.882000|-1.882000	0.01624|0.01624	-0.760000|-0.760000	0.04677|0.04677	-1.284000|-1.284000	0.01376|0.01376	GCT|CTC		NCAPH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252842.2	NM_015341	
CNGA3	1261	hgsc.bcm.edu	37	2	99013495	99013495	+	Missense_Mutation	SNP	C	C	T	rs200819699	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:99013495C>T	ENST00000272602.2	+	7	1901	c.1862C>T	c.(1861-1863)gCg>gTg	p.A621V	CNGA3_ENST00000436404.2_Missense_Mutation_p.A603V|CNGA3_ENST00000409937.1_Missense_Mutation_p.A625V|CNGA3_ENST00000393504.1_Missense_Mutation_p.A621V			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	621					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.A621V(2)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						AGGGCGGGCGCGGACCCCAAG	0.622													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18471	0.0		0.0	False		,,,				2504	0.0				p.A621V												.	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.C1862T	2	GRCh37	CM071619	CNGA3	M		.						32.0	31.0	31.0					2																	99013495		2203	4300	6503	98379927	SO:0001583	missense	1261	exon8			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1862C>T	2.37:g.99013495C>T	ENSP00000272602:p.Ala621Val	Somatic		Capture	SOLID	Phase_I	98379927	NM_001298	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	37	CCDS2034.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	9.023	0.985433	0.18889	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.97731	-4.4;-4.33;-4.4;-4.51	5.24	0.00536	0.14062	.	0.466873	0.24854	N	0.035067	D	0.92675	0.7672	L	0.29908	0.895	0.09310	N	0.999999	B;B;B	0.18461	0.011;0.008;0.028	B;B;B	0.13407	0.006;0.009;0.009	D	0.85101	0.0957	10	0.36615	T	0.2	.	5.513	0.16890	0.2371:0.5537:0.0:0.2092	.	625;603;621	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	V	621;603;621;625	ENSP00000377140:A621V;ENSP00000410070:A603V;ENSP00000272602:A621V;ENSP00000386761:A625V	ENSP00000272602:A621V	A	+	2	0	CNGA3	98379927	0.000000	0.05858	0.011000	0.14972	0.565000	0.35776	-0.517000	0.06275	0.047000	0.15862	-0.309000	0.09137	GCG		CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	
KANSL1L	151050	hgsc.bcm.edu	37	2	210993781	210993784	+	Frame_Shift_Del	DEL	TGTC	TGTC	-			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	TGTC	TGTC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:210993781_210993784delTGTC	ENST00000281772.9	-	3	1464_1467	c.1201_1204delGACA	c.(1201-1206)gacattfs	p.DI401fs	KANSL1L_ENST00000418791.1_Frame_Shift_Del_p.DI401fs|KANSL1L_ENST00000457374.1_Frame_Shift_Del_p.DI401fs|KANSL1L_ENST00000452086.1_Frame_Shift_Del_p.DI401fs	NM_152519.2	NP_689732.2	A0AUZ9	KAL1L_HUMAN	KAT8 regulatory NSL complex subunit 1-like	401				D -> G (in Ref. 1; BAB71308). {ECO:0000305}.		histone acetyltransferase complex (GO:0000123)		p.D401fs*11(1)									TGCCTGTGAATGTCTGTTAGTTGT	0.402																																					p.401_402del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1201_1204del	2						.																																			210702029	SO:0001589	frameshift_variant	151050	exon3			AK074441	CCDS33370.1	2q34	2012-02-20	2012-02-20	2012-02-20	ENSG00000144445	ENSG00000144445			26310	protein-coding gene	gene with protein product	"""KIAA1267-like"""	613833	"""chromosome 2 open reading frame 67"""	C2orf67		12477932	Standard	NM_152519		Approved	FLJ23861, FLJ32349, MSL1v2, KIAA1267L	uc002vds.3	A0AUZ9	OTTHUMG00000154697	ENST00000281772.9:c.1201_1204delGACA	2.37:g.210993781_210993784delTGTC	ENSP00000281772:p.Asp401fs	Somatic		Capture	SOLID	Phase_I	210702026	NM_152519	B7ZLN1|I6L9A8|Q53TV8|Q53TW3|Q6IS05|Q8TCI1|Q96MI0|Q9UFC3	Frame_Shift_Del	DEL	ENST00000281772.9	37	CCDS33370.1																																																																																				KANSL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336633.3	NM_152519	
ANO7	50636	hgsc.bcm.edu	37	2	242148795	242148795	+	Silent	SNP	C	C	T	rs148991441		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr2:242148795C>T	ENST00000274979.8	+	12	1438	c.1335C>T	c.(1333-1335)agC>agT	p.S445S	ANO7_ENST00000402430.3_Silent_p.S444S	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	445					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)	p.S445S(1)		NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						AGCGGAAGAGCGCCACGCTGG	0.672													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15426	0.0		0.0	False		,,,				2504	0.0				p.S445S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1335T	2						.	C		3,4387		0,3,2192	41.0	31.0	34.0		1335	-1.2	0.1	2	dbSNP_134	34	0,8584		0,0,4292	no	coding-synonymous	ANO7	NM_001001891.3		0,3,6484	TT,TC,CC		0.0,0.0683,0.0231		445/934	242148795	3,12971	2195	4292	6487	241797468	SO:0001819	synonymous_variant	50636	exon12			AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1335C>T	2.37:g.242148795C>T		Somatic		Capture	SOLID	Phase_I	241797468	NM_001001891	Q6IWH6	Silent	SNP	ENST00000274979.8	37	CCDS33423.1																																																																																				ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891	
TMEM246	84302	hgsc.bcm.edu	37	9	104238303	104238303	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:104238303T>C	ENST00000374851.1	-	4	2219	c.1072A>G	c.(1072-1074)Aag>Gag	p.K358E	TMEM246_ENST00000374848.3_Missense_Mutation_p.K358E|RP11-490D19.6_ENST00000425734.1_RNA|TMEM246_ENST00000374847.1_Missense_Mutation_p.K358E|RP11-490D19.6_ENST00000450109.1_RNA|RP11-490D19.6_ENST00000424154.1_RNA|RP11-490D19.6_ENST00000431507.1_RNA			Q9BRR3	TM246_HUMAN	transmembrane protein 246	358						integral component of membrane (GO:0016021)		p.K358E(1)									CCAAAGCCCTTGTGGCAGTAC	0.607																																					p.K358E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1072G	9						.						70.0	65.0	67.0					9																	104238303		2203	4300	6503	103278124	SO:0001583	missense	84302	exon2			BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.1072A>G	9.37:g.104238303T>C	ENSP00000363984:p.Lys358Glu	Somatic		Capture	SOLID	Phase_I	103278124	NM_032342	Q49AQ4	Missense_Mutation	SNP	ENST00000374851.1	37	CCDS6757.1	.	.	.	.	.	.	.	.	.	.	T	6.809	0.518350	0.13005	.	.	ENSG00000165152	ENST00000374848;ENST00000374847;ENST00000374851	.	.	.	5.7	-2.9	0.05648	.	0.672304	0.15701	N	0.248937	T	0.14700	0.0355	N	0.22421	0.69	0.22389	N	0.999146	B	0.11235	0.004	B	0.14023	0.01	T	0.32079	-0.9920	9	0.05721	T	0.95	-6.7602	4.1815	0.10378	0.1049:0.195:0.4981:0.202	.	358	Q9BRR3	CI125_HUMAN	E	358	.	ENSP00000363980:K358E	K	-	1	0	C9orf125	103278124	0.152000	0.22762	0.994000	0.49952	0.987000	0.75469	0.561000	0.23515	-0.143000	0.11334	0.460000	0.39030	AAG		TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053444.1	NM_032342	
ABCA1	19	hgsc.bcm.edu	37	9	107578558	107578558	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:107578558G>A	ENST00000374736.3	-	25	3998	c.3604C>T	c.(3604-3606)Cat>Tat	p.H1202Y		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1202					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.H1202Y(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GTCAGCTCATGCCCTATGTCT	0.512																																					p.H1202Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3604T	9						.						103.0	102.0	102.0					9																	107578558		2203	4300	6503	106618379	SO:0001583	missense	19	exon25			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.3604C>T	9.37:g.107578558G>A	ENSP00000363868:p.His1202Tyr	Somatic		Capture	SOLID	Phase_I	106618379	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	G	31	5.068352	0.93950	.	.	ENSG00000165029	ENST00000374736	D	0.86297	-2.1	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.90058	0.6895	L	0.48174	1.505	0.80722	D	1	D	0.61080	0.989	P	0.56788	0.806	D	0.89748	0.3938	10	0.49607	T	0.09	.	19.5118	0.95144	0.0:0.0:1.0:0.0	.	1202	O95477	ABCA1_HUMAN	Y	1202	ENSP00000363868:H1202Y	ENSP00000363868:H1202Y	H	-	1	0	ABCA1	106618379	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.869000	0.99810	2.616000	0.88540	0.561000	0.74099	CAT		ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
TNC	3371	hgsc.bcm.edu	37	9	117803272	117803272	+	Silent	SNP	G	G	A	rs140585326		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:117803272G>A	ENST00000350763.4	-	19	5751	c.5340C>T	c.(5338-5340)atC>atT	p.I1780I	TNC_ENST00000423613.2_Silent_p.I1507I|TNC_ENST00000542877.1_Silent_p.I1417I|TNC_ENST00000535648.1_Silent_p.I1325I|TNC_ENST00000340094.3_Silent_p.I1416I|TNC_ENST00000537320.1_Silent_p.I1143I|TNC_ENST00000345230.3_Silent_p.I1143I|TNC_ENST00000341037.4_Silent_p.I1598I|TNC_ENST00000346706.3_Silent_p.I1234I	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1780	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.I1780I(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						CCTTCATGGCGATGATGCTGA	0.507																																					p.I1780I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5340T	9						.	G		0,4406		0,0,2203	201.0	167.0	178.0		5340	-3.3	0.3	9	dbSNP_134	178	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	TNC	NM_002160.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		1780/2202	117803272	2,13004	2203	4300	6503	116843093	SO:0001819	synonymous_variant	3371	exon19				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5340C>T	9.37:g.117803272G>A		Somatic		Capture	SOLID	Phase_I	116843093	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Silent	SNP	ENST00000350763.4	37	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	G	7.300	0.612852	0.14066	0.0	2.33E-4	ENSG00000041982	ENST00000544972	.	.	.	6.08	-3.3	0.05003	.	.	.	.	.	T	0.40886	0.1135	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30268	-0.9984	4	.	.	.	.	2.9459	0.05846	0.2585:0.0887:0.4719:0.1809	.	.	.	.	C	343	.	.	R	-	1	0	TNC	116843093	0.897000	0.30589	0.257000	0.24404	0.620000	0.37586	-0.044000	0.12023	-1.032000	0.03304	-0.937000	0.02696	CGC		TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
PAPPA	5069	hgsc.bcm.edu	37	9	119097235	119097235	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:119097235A>G	ENST00000328252.3	+	13	3862	c.3493A>G	c.(3493-3495)Agc>Ggc	p.S1165G	PAPPA_ENST00000534838.1_Missense_Mutation_p.S203G	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1165					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.S1165G(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						GGTACGTGTGAGCTTCAGTTC	0.612																																					p.S1165G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3493G	9						.						116.0	95.0	102.0					9																	119097235		2203	4300	6503	118137056	SO:0001583	missense	5069	exon13				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3493A>G	9.37:g.119097235A>G	ENSP00000330658:p.Ser1165Gly	Somatic		Capture	SOLID	Phase_I	118137056	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	A	17.84	3.488879	0.64074	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	T;T	0.03889	4.55;3.77	5.86	4.69	0.59074	.	0.134744	0.85682	D	0.000000	T	0.06508	0.0167	L	0.60455	1.87	0.46011	D	0.998814	P;P	0.45078	0.493;0.85	B;B	0.36959	0.099;0.237	T	0.27872	-1.0061	10	0.44086	T	0.13	-27.067	12.3137	0.54944	0.8731:0.0:0.0:0.1269	.	203;1165	F5GZ19;Q13219	.;PAPP1_HUMAN	G	1165;203	ENSP00000330658:S1165G;ENSP00000441461:S203G	ENSP00000330658:S1165G	S	+	1	0	PAPPA	118137056	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.923000	0.92808	1.003000	0.39130	0.533000	0.62120	AGC		PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
BRINP1	1620	hgsc.bcm.edu	37	9	121971107	121971107	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:121971107C>T	ENST00000265922.3	-	7	1496	c.1035G>A	c.(1033-1035)ctG>ctA	p.L345L	BRINP1_ENST00000482797.1_5'UTR	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	345					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)		p.L345L(1)									TGGCACTCTGCAGGAGCTTGT	0.577																																					p.L345L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1035A	9						.						161.0	137.0	145.0					9																	121971107		2203	4300	6503	121010928	SO:0001819	synonymous_variant	1620	exon7			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1035G>A	9.37:g.121971107C>T		Somatic		Capture	SOLID	Phase_I	121010928	NM_014618	Q6IPV6|Q6P1A0|Q8WU22	Silent	SNP	ENST00000265922.3	37	CCDS6822.1																																																																																				BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618	
DAB2IP	153090	hgsc.bcm.edu	37	9	124530826	124530826	+	Missense_Mutation	SNP	G	G	A	rs200519908		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:124530826G>A	ENST00000408936.3	+	10	1995	c.1813G>A	c.(1813-1815)Gcc>Acc	p.A605T	DAB2IP_ENST00000309989.1_Missense_Mutation_p.A481T|DAB2IP_ENST00000259371.2_Missense_Mutation_p.A577T			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	605					activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)	p.A481T(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						CTCCAATACAGCCGGCTTCGA	0.602																																					p.A577T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1729A	9						.						98.0	94.0	95.0					9																	124530826		2203	4300	6503	123570647	SO:0001583	missense	153090	exon10			AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.1813G>A	9.37:g.124530826G>A	ENSP00000386183:p.Ala605Thr	Somatic		Capture	SOLID	Phase_I	123570647	NM_032552	A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Missense_Mutation	SNP	ENST00000408936.3	37		.	.	.	.	.	.	.	.	.	.	G	17.59	3.427839	0.62733	.	.	ENSG00000136848	ENST00000259371;ENST00000408936;ENST00000373782;ENST00000309989	T;T;T;T	0.16457	2.34;2.34;2.34;2.34	4.82	3.92	0.45320	Rho GTPase activation protein (1);Ras GTPase-activating protein (1);	0.000000	0.85682	D	0.000000	T	0.25306	0.0615	N	0.25485	0.75	0.58432	D	0.999994	D;B	0.63880	0.993;0.094	D;B	0.74674	0.984;0.171	T	0.02031	-1.1226	10	0.23302	T	0.38	.	12.4499	0.55671	0.0817:0.0:0.9183:0.0	.	605;577	Q5VWQ8;G3XA90	DAB2P_HUMAN;.	T	577;605;514;481	ENSP00000259371:A577T;ENSP00000386183:A605T;ENSP00000362887:A514T;ENSP00000310827:A481T	ENSP00000259371:A577T	A	+	1	0	DAB2IP	123570647	1.000000	0.71417	0.051000	0.19133	0.834000	0.47266	4.749000	0.62155	1.162000	0.42619	0.557000	0.71058	GCC		DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317857.1	NM_032552	
SPTAN1	6709	hgsc.bcm.edu	37	9	131351167	131351167	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:131351167G>A	ENST00000372731.4	+	21	3061	c.2951G>A	c.(2950-2952)cGa>cAa	p.R984Q	SPTAN1_ENST00000372739.3_Missense_Mutation_p.R984Q|SPTAN1_ENST00000358161.5_Missense_Mutation_p.R984Q	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	984	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R984Q(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						AAGAGTCCCCGAGAGGTCACC	0.527																																					p.R984Q	NSCLC(120;833 1744 2558 35612 37579)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2951A	9						.						145.0	112.0	123.0					9																	131351167		2203	4300	6503	130390988	SO:0001583	missense	6709	exon21			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.2951G>A	9.37:g.131351167G>A	ENSP00000361816:p.Arg984Gln	Somatic		Capture	SOLID	Phase_I	130390988	NM_001195532	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.786404	0.90367	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.29397	1.57;1.57;1.57	5.51	5.51	0.81932	Src homology-3 domain (5);Spectrin alpha chain, SH3 domain (1);	0.000000	0.85682	D	0.000000	T	0.41305	0.1153	N	0.13327	0.33	0.80722	D	1	D;D;D;D;D	0.89917	0.997;0.997;1.0;0.997;0.997	D;D;D;D;D	0.91635	0.968;0.968;0.999;0.947;0.968	T	0.45512	-0.9256	10	0.59425	D	0.04	.	18.3985	0.90507	0.0:0.0:1.0:0.0	.	984;984;984;984;984	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	Q	984	ENSP00000350882:R984Q;ENSP00000361816:R984Q;ENSP00000361824:R984Q	ENSP00000350882:R984Q	R	+	2	0	SPTAN1	130390988	1.000000	0.71417	0.964000	0.40570	0.962000	0.63368	9.182000	0.94881	2.583000	0.87209	0.655000	0.94253	CGA		SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
NUP214	8021	hgsc.bcm.edu	37	9	134073834	134073834	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:134073834C>T	ENST00000359428.5	+	29	5097	c.4953C>T	c.(4951-4953)gcC>gcT	p.A1651A	NUP214_ENST00000411637.2_Silent_p.A1641A|NUP214_ENST00000483497.2_Silent_p.A477A|NUP214_ENST00000451030.1_Silent_p.A1652A			P35658	NU214_HUMAN	nucleoporin 214kDa	1651	11 X 3 AA approximate repeats.|11 X 5 AA approximate repeats.|18 X 4 AA approximate repeats.|Pro/Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)	p.A1651A(1)		NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		CTCCTGCTGCCAGTTCTAGCT	0.602			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.A1651A	Pancreas(4;24 48 25510 30394 32571)		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4953T	9						.						129.0	105.0	113.0					9																	134073834		2203	4300	6503	133063655	SO:0001819	synonymous_variant	8021	exon29			X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.4953C>T	9.37:g.134073834C>T		Somatic		Capture	SOLID	Phase_I	133063655	NM_005085	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Silent	SNP	ENST00000359428.5	37	CCDS6940.1																																																																																				NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
TSC1	7248	hgsc.bcm.edu	37	9	135801106	135801106	+	Silent	SNP	G	G	A	rs397514809		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:135801106G>A	ENST00000298552.3	-	5	452	c.231C>T	c.(229-231)aaC>aaT	p.N77N	TSC1_ENST00000403810.1_Silent_p.N77N|TSC1_ENST00000475903.1_5'UTR|TSC1_ENST00000440111.2_Silent_p.N77N|TSC1_ENST00000545250.1_Intron	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	77					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.N77N(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		CCACATATTCGTTAATCCTGT	0.443			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.N77N		yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C231T	9						.						85.0	78.0	81.0					9																	135801106		2203	4300	6503	134790927	SO:0001819	synonymous_variant	7248	exon5	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.231C>T	9.37:g.135801106G>A		Somatic		Capture	SOLID	Phase_I	134790927	NM_001162426	B7Z897|Q5VVN5	Silent	SNP	ENST00000298552.3	37	CCDS6956.1																																																																																				TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
DBH	1621	hgsc.bcm.edu	37	9	136507510	136507510	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:136507510T>C	ENST00000393056.2	+	3	680	c.668T>C	c.(667-669)aTc>aCc	p.I223T		NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	223					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)	p.I223T(1)		central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	AATATCCAGATCCCCAGCCAG	0.592																																					p.I223T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T668C	9						.						63.0	59.0	60.0					9																	136507510		2203	4300	6503	135497331	SO:0001583	missense	1621	exon3			X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.668T>C	9.37:g.136507510T>C	ENSP00000376776:p.Ile223Thr	Somatic		Capture	SOLID	Phase_I	135497331	NM_000787	Q5T381|Q96AG2	Missense_Mutation	SNP	ENST00000393056.2	37	CCDS6977.2	.	.	.	.	.	.	.	.	.	.	T	15.23	2.771336	0.49680	.	.	ENSG00000123454	ENST00000393056;ENST00000371880;ENST00000263611	T;T	0.31769	1.48;1.48	4.67	4.67	0.58626	Copper type II, ascorbate-dependent monooxygenase, N-terminal (2);PHM/PNGase F domain (1);	0.098967	0.64402	D	0.000002	T	0.56140	0.1965	M	0.86178	2.8	0.58432	D	0.999999	P	0.50272	0.933	P	0.59825	0.864	T	0.64795	-0.6323	10	0.87932	D	0	-24.3784	14.3997	0.67034	0.0:0.0:0.0:1.0	.	223	P09172	DOPO_HUMAN	T	223;160;160	ENSP00000376776:I223T;ENSP00000263611:I160T	ENSP00000263611:I160T	I	+	2	0	DBH	135497331	1.000000	0.71417	0.603000	0.28903	0.008000	0.06430	7.428000	0.80296	1.871000	0.54225	0.402000	0.26972	ATC		DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054929.2	NM_000787	
DMRT1	1761	hgsc.bcm.edu	37	9	846983	846983	+	Silent	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:846983C>A	ENST00000382276.3	+	2	527	c.378C>A	c.(376-378)gcC>gcA	p.A126A	DMRT1_ENST00000569227.1_5'UTR	NM_021951.2	NP_068770.2	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor 1	126					cell morphogenesis (GO:0000902)|germ cell migration (GO:0008354)|intracellular signal transduction (GO:0035556)|male germ cell proliferation (GO:0002176)|male sex determination (GO:0030238)|male sex differentiation (GO:0046661)|negative regulation of meiosis (GO:0045835)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oocyte development (GO:0048599)|positive regulation of male gonad development (GO:2000020)|positive regulation of meiosis I (GO:0060903)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of nodal signaling pathway (GO:1900107)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A126A(1)		large_intestine(2)|lung(10)|ovary(1)	13		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		GGCAGCAGGCCCAGGAGGAGG	0.572																																					p.A126A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C378A	9						.						96.0	90.0	92.0					9																	846983		2203	4300	6503	836983	SO:0001819	synonymous_variant	1761	exon2			AF130728	CCDS6442.1	9p24.3	2014-01-21			ENSG00000137090	ENSG00000137090			2934	protein-coding gene	gene with protein product	"""DM domain expressed in testis 1"""	602424				9490411, 10332030	Standard	XM_006716732		Approved	DMT1, CT154	uc003zgv.3	Q9Y5R6	OTTHUMG00000019435	ENST00000382276.3:c.378C>A	9.37:g.846983C>A		Somatic		Capture	SOLID	Phase_I	836983	NM_021951	B2R913|Q6T1H8|Q6T1H9|Q8IW77	Silent	SNP	ENST00000382276.3	37	CCDS6442.1																																																																																				DMRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051489.2	NM_021951	
NFX1	4799	hgsc.bcm.edu	37	9	33319053	33319053	+	Missense_Mutation	SNP	C	C	T	rs146305609		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:33319053C>T	ENST00000379540.3	+	9	1896	c.1834C>T	c.(1834-1836)Cgg>Tgg	p.R612W	NFX1_ENST00000318524.6_Missense_Mutation_p.R612W|NFX1_ENST00000379521.4_Missense_Mutation_p.R612W	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	612					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R612W(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		AAGTAGTAGTCGGAAAACATG	0.537																																					p.R612W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1834T	9						.	C	TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	80.0	80.0	80.0		1834,1834,1834	5.7	1.0	9	dbSNP_134	80	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	NFX1	NM_002504.4,NM_147133.2,NM_147134.2	101,101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	612/1121,612/1025,612/834	33319053	1,13005	2203	4300	6503	33309053	SO:0001583	missense	4799	exon9			U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.1834C>T	9.37:g.33319053C>T	ENSP00000368856:p.Arg612Trp	Somatic		Capture	SOLID	Phase_I	33309053	NM_147134	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	ENST00000379540.3	37	CCDS6538.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.297217	0.81025	0.0	1.16E-4	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000536210;ENST00000318524	T;T;T	0.54279	0.58;0.58;0.58	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.76435	0.3987	M	0.85462	2.755	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.952;1.0;0.985	T	0.79780	-0.1659	10	0.87932	D	0	-5.2871	17.3883	0.87423	0.0:1.0:0.0:0.0	.	612;496;612;612;612	F5GXD0;A0JLR2;Q12986;Q12986-2;Q12986-3	.;.;NFX1_HUMAN;.;.	W	612	ENSP00000368856:R612W;ENSP00000368836:R612W;ENSP00000317695:R612W	ENSP00000317695:R612W	R	+	1	2	NFX1	33309053	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	5.418000	0.66429	2.695000	0.91970	0.650000	0.86243	CGG		NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052069.1		
UBE2R2	54926	hgsc.bcm.edu	37	9	33923265	33923265	+	IGR	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:33923265C>T	ENST00000263228.3	+	0	4075				UBAP2_ENST00000539807.1_Missense_Mutation_p.A730T|UBAP2_ENST00000379235.1_Missense_Mutation_p.A214T|UBAP2_ENST00000360802.1_Missense_Mutation_p.A975T|UBAP2_ENST00000449054.1_Missense_Mutation_p.A975T|UBAP2_ENST00000379238.1_Missense_Mutation_p.A975T|UBAP2_ENST00000379239.4_Missense_Mutation_p.A708T	NM_017811.3	NP_060281.2	Q712K3	UB2R2_HUMAN	ubiquitin-conjugating enzyme E2R 2						protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.A975T(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			LUSC - Lung squamous cell carcinoma(29;0.0176)	GBM - Glioblastoma multiforme(74;0.188)		TCTCCTGCTGCTGTCCCCTGG	0.552																																					p.A975T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2923A	9						.						118.0	112.0	114.0					9																	33923265		2203	4300	6503	33913265	SO:0001628	intergenic_variant	55833	exon26			AK000426	CCDS6546.1	9p11.2	2008-02-05			ENSG00000107341	ENSG00000107341		"""Ubiquitin-conjugating enzymes E2"""	19907	protein-coding gene	gene with protein product		612506				12037680	Standard	XM_005251496		Approved	UBC3B, CDC34B, FLJ20419, MGC10481	uc003ztm.3	Q712K3	OTTHUMG00000019797		9.37:g.33923265C>T		Somatic		Capture	SOLID	Phase_I	33913265	NM_018449	D3DRL5|Q9NX64	Missense_Mutation	SNP	ENST00000263228.3	37	CCDS6546.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.605009	0.87157	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379235;ENST00000379239;ENST00000539807;ENST00000351580	T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56	6.06	6.06	0.98353	.	0.047442	0.85682	D	0.000000	T	0.53384	0.1793	L	0.56769	1.78	0.80722	D	1	D;D;D;D	0.67145	0.996;0.996;0.996;0.993	D;D;D;P	0.63877	0.919;0.919;0.919;0.831	T	0.46359	-0.9197	10	0.59425	D	0.04	-14.4853	20.6208	0.99490	0.0:1.0:0.0:0.0	.	730;708;884;975	F5H2U4;A6NCA8;F5H2C8;Q5T6F2	.;.;.;UBAP2_HUMAN	T	975;975;975;884;214;708;730;409	ENSP00000368540:A975T;ENSP00000416932:A975T;ENSP00000354039:A975T;ENSP00000368537:A214T;ENSP00000368541:A708T;ENSP00000439329:A730T	ENSP00000259602:A409T	A	-	1	0	UBAP2	33913265	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.346000	0.79347	2.882000	0.98803	0.655000	0.94253	GCA		UBE2R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052118.1	NM_017811	
FRMPD1	22844	hgsc.bcm.edu	37	9	37729787	37729787	+	Silent	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:37729787C>A	ENST00000539465.1	+	8	1268	c.675C>A	c.(673-675)gcC>gcA	p.A225A	FRMPD1_ENST00000377765.3_Silent_p.A225A|FRMPD1_ENST00000536622.1_Silent_p.A47A|RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000541302.1_Silent_p.A94A			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	225	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.		A -> V (in dbSNP:rs1359590).			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.A225A(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		TTGCACTGGCCCTGGAAGAGC	0.567																																					p.A225A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C675A	9						.						120.0	98.0	105.0					9																	37729787		2203	4300	6503	37719787	SO:0001819	synonymous_variant	22844	exon8			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.675C>A	9.37:g.37729787C>A		Somatic		Capture	SOLID	Phase_I	37719787	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Silent	SNP	ENST00000539465.1	37	CCDS6612.1																																																																																				FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
TJP2	9414	hgsc.bcm.edu	37	9	71863051	71863051	+	Missense_Mutation	SNP	G	G	A	rs139276234	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:71863051G>A	ENST00000377245.4	+	19	2999	c.2791G>A	c.(2791-2793)Gcc>Acc	p.A931T	TJP2_ENST00000453658.2_Missense_Mutation_p.A908T|TJP2_ENST00000265384.7_Missense_Mutation_p.A931T|TJP2_ENST00000539225.1_Missense_Mutation_p.A962T|TJP2_ENST00000535702.1_Missense_Mutation_p.A935T|TJP2_ENST00000348208.4_Missense_Mutation_p.A931T	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	931					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)	p.A931T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						TGAAGGAGGCGCCTACACTGA	0.622													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17960	0.0		0.0	False		,,,				2504	0.0				p.A931T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2791A	9						.	G	THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	3,4403	6.2+/-15.9	0,3,2200	53.0	50.0	51.0		2722,2803,2884,2791,2791,2791	6.2	1.0	9	dbSNP_134	51	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense	TJP2	NM_001170414.1,NM_001170415.1,NM_001170416.1,NM_001170630.1,NM_004817.3,NM_201629.3	58,58,58,58,58,58	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	908/1021,935/1158,962/1222,931/994,931/1191,931/1044	71863051	3,13003	2203	4300	6503	71052871	SO:0001583	missense	9414	exon19			L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.2791G>A	9.37:g.71863051G>A	ENSP00000366453:p.Ala931Thr	Somatic		Capture	SOLID	Phase_I	71052871	NM_201629	A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Missense_Mutation	SNP	ENST00000377245.4	37	CCDS6627.1	.	.	.	.	.	.	.	.	.	.	G	33	5.197873	0.94997	6.81E-4	0.0	ENSG00000119139	ENST00000453658;ENST00000377245;ENST00000348208;ENST00000265384;ENST00000535702;ENST00000539225	T;T;T;T;T;T	0.13657	2.62;2.57;2.61;2.61;2.59;2.62	6.16	6.16	0.99307	.	0.114813	0.64402	D	0.000014	T	0.30355	0.0762	L	0.49455	1.56	0.45439	D	0.998417	D;P;P;D;P;P	0.69078	0.997;0.719;0.873;0.973;0.896;0.801	P;B;B;B;B;B	0.57009	0.811;0.287;0.105;0.314;0.16;0.108	T	0.00036	-1.2256	10	0.54805	T	0.06	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	962;935;908;931;931;931	F5H301;F5H886;B7Z2R3;Q9UDY2-2;Q9UDY2;Q9UDY2-5	.;.;.;.;ZO2_HUMAN;.	T	908;931;931;931;935;962	ENSP00000392178:A908T;ENSP00000366453:A931T;ENSP00000345893:A931T;ENSP00000265384:A931T;ENSP00000442090:A935T;ENSP00000438262:A962T	ENSP00000265384:A931T	A	+	1	0	TJP2	71052871	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	3.443000	0.52907	2.937000	0.99478	0.650000	0.86243	GCC		TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052572.2	NM_201629	
TRPM3	80036	hgsc.bcm.edu	37	9	73235036	73235036	+	Silent	SNP	G	G	A	rs551873170		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:73235036G>A	ENST00000377111.2	-	15	2292	c.2049C>T	c.(2047-2049)aaC>aaT	p.N683N	TRPM3_ENST00000408909.2_Silent_p.N542N|TRPM3_ENST00000377110.3_Silent_p.N683N|TRPM3_ENST00000360823.2_Silent_p.N545N|TRPM3_ENST00000357533.2_Silent_p.N687N|TRPM3_ENST00000377106.1_Silent_p.N555N|TRPM3_ENST00000396285.1_Silent_p.N530N|TRPM3_ENST00000423814.3_Silent_p.N710N|TRPM3_ENST00000396292.4_Silent_p.N555N|TRPM3_ENST00000396280.5_Silent_p.N532N|TRPM3_ENST00000358082.3_Silent_p.N545N|TRPM3_ENST00000377105.1_Silent_p.N542N	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	708					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.N555N(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						CAACCATGTCGTTCTCAGAGG	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		21161	0.0		0.0	False		,,,				2504	0.001				p.N683N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2049T	9						.						77.0	73.0	74.0					9																	73235036		2203	4300	6503	72424856	SO:0001819	synonymous_variant	80036	exon15			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.2049C>T	9.37:g.73235036G>A		Somatic		Capture	SOLID	Phase_I	72424856	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	ENST00000377111.2	37		.	.	.	.	.	.	.	.	.	.	G	7.278	0.608602	0.14002	.	.	ENSG00000083067	ENST00000396280	.	.	.	6.07	-11.0	0.00169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-27.7322	23.2151	0.99981	0.8496:0.0:0.1504:0.0	.	.	.	.	X	532	.	.	R	-	1	2	TRPM3	72424856	0.032000	0.19561	0.238000	0.24106	0.942000	0.58702	-0.463000	0.06696	-2.320000	0.00642	-0.781000	0.03364	CGA		TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
TRPM6	140803	hgsc.bcm.edu	37	9	77397705	77397705	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:77397705C>T	ENST00000360774.1	-	22	3221	c.2984G>A	c.(2983-2985)cGc>cAc	p.R995H	TRPM6_ENST00000361255.3_Missense_Mutation_p.R990H|TRPM6_ENST00000449912.2_Missense_Mutation_p.R990H|TRPM6_ENST00000451710.3_Missense_Mutation_p.R995H|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.R995H|TRPM6_ENST00000376872.3_Intron	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	995					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.R995H(2)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GATGGCCTTGCGTGCCACTCC	0.448																																					p.R990H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2969A	9						.						124.0	105.0	111.0					9																	77397705		2203	4300	6503	76587525	SO:0001583	missense	140803	exon22			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.2984G>A	9.37:g.77397705C>T	ENSP00000354006:p.Arg995His	Somatic		Capture	SOLID	Phase_I	76587525	NM_001177310	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	C	34	5.348060	0.95807	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.11495	2.77;2.77;2.77;2.77;2.77	5.71	5.71	0.89125	Ion transport (1);	0.000000	0.85682	D	0.000000	T	0.45256	0.1333	M	0.91612	3.225	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.997;0.998;0.914	T	0.54516	-0.8282	10	0.87932	D	0	.	19.8632	0.96793	0.0:1.0:0.0:0.0	.	658;995;990	F5H7D1;Q9BX84;Q9BX84-3	.;TRPM6_HUMAN;.	H	995;995;990;990;995;658;658	ENSP00000354006:R995H;ENSP00000407341:R995H;ENSP00000396672:R990H;ENSP00000354962:R990H;ENSP00000366060:R995H	ENSP00000309693:R658H	R	-	2	0	TRPM6	76587525	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.771000	0.85420	2.704000	0.92352	0.561000	0.74099	CGC		TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
SLC28A3	64078	hgsc.bcm.edu	37	9	86903070	86903070	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:86903070T>C	ENST00000376238.4	-	12	1222	c.1173A>G	c.(1171-1173)acA>acG	p.T391T	RP11-380F14.2_ENST00000419815.1_RNA|SLC28A3_ENST00000537648.1_Silent_p.T322T	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	391					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)	p.T391T(1)		endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	TAACTGACGCTGTTAACAAGT	0.453																																					p.T391T	Ovarian(106;425 1539 34835 42413 43572)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1173G	9						.						138.0	140.0	140.0					9																	86903070		2203	4300	6503	86092890	SO:0001819	synonymous_variant	64078	exon13			AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.1173A>G	9.37:g.86903070T>C		Somatic		Capture	SOLID	Phase_I	86092890	NM_022127	A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Silent	SNP	ENST00000376238.4	37	CCDS6670.1																																																																																				SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052874.1	NM_022127	
COL5A1	1289	hgsc.bcm.edu	37	9	137623968	137623968	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr9:137623968G>A	ENST00000371817.3	+	9	1798	c.1384G>A	c.(1384-1386)Gag>Aag	p.E462K		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	462	Interrupted collagenous region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.E462K(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		AGCGATTATCGAGCCGGTGAG	0.582																																					p.E462K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1384A	9						.						108.0	94.0	99.0					9																	137623968		2203	4300	6503	136763789	SO:0001583	missense	1289	exon9			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.1384G>A	9.37:g.137623968G>A	ENSP00000360882:p.Glu462Lys	Somatic		Capture	SOLID	Phase_I	136763789	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449332	0.63178	.	.	ENSG00000130635	ENST00000371817	D	0.88818	-2.43	4.53	4.53	0.55603	.	0.000000	0.85682	U	0.000000	D	0.93533	0.7936	M	0.71206	2.165	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	D	0.94308	0.7543	10	0.66056	D	0.02	.	16.2528	0.82494	0.0:0.0:1.0:0.0	.	462	P20908	CO5A1_HUMAN	K	462	ENSP00000360882:E462K	ENSP00000360882:E462K	E	+	1	0	COL5A1	136763789	1.000000	0.71417	0.964000	0.40570	0.178000	0.23041	8.712000	0.91403	2.044000	0.60594	0.462000	0.41574	GAG		COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
NALCN	259232	hgsc.bcm.edu	37	13	101776978	101776978	+	Missense_Mutation	SNP	C	C	T	rs201135494		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:101776978C>T	ENST00000251127.6	-	18	2254	c.2173G>A	c.(2173-2175)Gca>Aca	p.A725T		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	725					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.A725T(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTAGTGACTGCGGTCTCCTTT	0.328																																					p.A725T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2173A	13						.	C	THR/ALA	0,4406		0,0,2203	137.0	130.0	132.0		2173	6.1	0.9	13		132	1,8599	1.2+/-3.3	0,1,4299	no	missense	NALCN	NM_052867.2	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	725/1739	101776978	1,13005	2203	4300	6503	100574979	SO:0001583	missense	259232	exon18			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2173G>A	13.37:g.101776978C>T	ENSP00000251127:p.Ala725Thr	Somatic		Capture	SOLID	Phase_I	100574979	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.930462	0.52866	0.0	1.16E-4	ENSG00000102452	ENST00000251127	D	0.97575	-4.44	6.07	6.07	0.98685	.	0.047636	0.85682	D	0.000000	D	0.92371	0.7579	N	0.11560	0.145	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	D	0.87688	0.2552	10	0.25751	T	0.34	.	17.5761	0.87949	0.0:1.0:0.0:0.0	.	725	Q8IZF0	NALCN_HUMAN	T	725	ENSP00000251127:A725T	ENSP00000251127:A725T	A	-	1	0	NALCN	100574979	0.998000	0.40836	0.950000	0.38849	0.970000	0.65996	4.017000	0.57167	2.885000	0.99019	0.655000	0.94253	GCA		NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
NALCN	259232	hgsc.bcm.edu	37	13	101890260	101890260	+	Missense_Mutation	SNP	A	A	G	rs371662809		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:101890260A>G	ENST00000251127.6	-	12	1361	c.1280T>C	c.(1279-1281)gTa>gCa	p.V427A	NALCN_ENST00000376196.3_Missense_Mutation_p.V427A|NALCN_ENST00000470333.1_5'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	427					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.V427A(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ATCAAAAAGTACTGTAAAAGC	0.303																																					p.V427A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1280C	13						.	A	ALA/VAL	0,4406		0,0,2203	89.0	96.0	93.0		1280	5.2	0.1	13		93	2,8596	2.2+/-6.3	0,2,4297	no	missense	NALCN	NM_052867.2	64	0,2,6500	GG,GA,AA		0.0233,0.0,0.0154	benign	427/1739	101890260	2,13002	2203	4299	6502	100688261	SO:0001583	missense	259232	exon12			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1280T>C	13.37:g.101890260A>G	ENSP00000251127:p.Val427Ala	Somatic		Capture	SOLID	Phase_I	100688261	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	A	12.62	1.992632	0.35131	0.0	2.33E-4	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.98455	-4.94;-4.94	5.24	5.24	0.73138	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.96642	0.8904	N	0.16368	0.405	0.80722	D	1	P;P;B	0.49447	0.87;0.924;0.019	P;P;B	0.52598	0.703;0.604;0.077	D	0.97515	1.0069	10	0.56958	D	0.05	.	15.4116	0.74929	1.0:0.0:0.0:0.0	.	427;427;427	F2Z323;B3KSZ6;Q8IZF0	.;.;NALCN_HUMAN	A	427	ENSP00000251127:V427A;ENSP00000365367:V427A	ENSP00000251127:V427A	V	-	2	0	NALCN	100688261	1.000000	0.71417	0.146000	0.22360	0.615000	0.37417	8.904000	0.92590	2.096000	0.63516	0.402000	0.26972	GTA		NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
MYO16	23026	hgsc.bcm.edu	37	13	109550475	109550475	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:109550475A>G	ENST00000357550.2	+	14	1746	c.1705A>G	c.(1705-1707)Acc>Gcc	p.T569A	MYO16_ENST00000457511.2_Missense_Mutation_p.T81A|MYO16_ENST00000251041.5_Missense_Mutation_p.T569A|MYO16_ENST00000356711.2_Missense_Mutation_p.T569A	NM_001198950.1	NP_001185879.1			myosin XVI									p.T569A(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			ACAACAGCTAACCGGAGGTAA	0.468																																					p.T591A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1771G	13						.						125.0	107.0	113.0					13																	109550475		2203	4300	6503	108348476	SO:0001583	missense	23026	exon15				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.1705A>G	13.37:g.109550475A>G	ENSP00000350160:p.Thr569Ala	Somatic		Capture	SOLID	Phase_I	108348476	NM_001198950		Missense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	A	4.217	0.039170	0.08148	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857;ENST00000457511	D;D;D;D	0.86627	-2.15;-2.15;-2.15;-2.15	5.2	4.03	0.46877	Myosin head, motor domain (2);	0.172475	0.27113	U	0.020866	T	0.73674	0.3617	N	0.16307	0.4	0.09310	N	0.999991	B;B;B	0.22800	0.061;0.012;0.075	B;B;B	0.26310	0.045;0.01;0.068	T	0.58098	-0.7696	9	.	.	.	.	4.8123	0.13349	0.7468:0.0:0.0885:0.1648	.	81;569;569	F8W883;Q9Y6X6-2;Q9Y6X6	.;.;MYO16_HUMAN	A	569;569;569;569;357;81	ENSP00000349145:T569A;ENSP00000350160:T569A;ENSP00000251041:T569A;ENSP00000401633:T81A	.	T	+	1	0	MYO16	108348476	0.002000	0.14202	0.546000	0.28166	0.187000	0.23431	1.018000	0.30002	0.937000	0.37394	0.460000	0.39030	ACC		MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
ARHGEF7	8874	hgsc.bcm.edu	37	13	111944621	111944621	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:111944621A>G	ENST00000375741.2	+	20	2604	c.2354A>G	c.(2353-2355)tAc>tGc	p.Y785C	ARHGEF7_ENST00000426073.2_Intron|ARHGEF7_ENST00000375739.2_Missense_Mutation_p.Y735C|ARHGEF7_ENST00000370623.3_Intron|ARHGEF7_ENST00000317133.5_Missense_Mutation_p.Y764C|ARHGEF7_ENST00000218789.5_Missense_Mutation_p.Y607C|ARHGEF7_ENST00000375736.4_Intron|ARHGEF7_ENST00000478679.1_Missense_Mutation_p.Y529C|ARHGEF7_ENST00000375737.5_Intron|ARHGEF7_ENST00000375723.1_Missense_Mutation_p.Y607C	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	785					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Y764C(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GCCCATAGTTACAGAATGGGT	0.463																																					p.Y735C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2204G	13						.						137.0	129.0	132.0					13																	111944621		2203	4300	6503	110742622	SO:0001583	missense	8874	exon18			D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.2354A>G	13.37:g.111944621A>G	ENSP00000364893:p.Tyr785Cys	Somatic		Capture	SOLID	Phase_I	110742622	NM_001113512	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Missense_Mutation	SNP	ENST00000375741.2	37	CCDS45068.1	.	.	.	.	.	.	.	.	.	.	A	19.58	3.854539	0.71719	.	.	ENSG00000102606	ENST00000317133;ENST00000375741;ENST00000375739;ENST00000218789;ENST00000375723;ENST00000478679	T;T;T;T;T;T	0.67698	0.35;0.34;0.35;0.48;0.32;-0.28	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000001	T	0.66327	0.2778	N	0.08118	0	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.87578	0.996;0.998;0.998;0.997;0.911	T	0.71199	-0.4663	10	0.39692	T	0.17	.	15.3704	0.74557	1.0:0.0:0.0:0.0	.	529;607;735;785;764	E9PDQ5;Q14155-6;Q14155-2;Q14155;Q14155-3	.;.;.;ARHG7_HUMAN;.	C	764;785;735;607;607;529	ENSP00000325994:Y764C;ENSP00000364893:Y785C;ENSP00000364891:Y735C;ENSP00000218789:Y607C;ENSP00000364875:Y607C;ENSP00000417596:Y529C	ENSP00000218789:Y607C	Y	+	2	0	ARHGEF7	110742622	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.430000	0.90283	2.032000	0.59987	0.533000	0.62120	TAC		ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511	
SACS	26278	hgsc.bcm.edu	37	13	23915582	23915582	+	Silent	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:23915582A>G	ENST00000382292.3	-	9	2706	c.2433T>C	c.(2431-2433)ggT>ggC	p.G811G	SACS_ENST00000402364.1_Silent_p.G61G|SACS_ENST00000382298.3_Silent_p.G811G			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	811					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.G664G(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CACATGTCTGACCTTCCTCTA	0.373																																					p.G811G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2433C	13						.						95.0	95.0	95.0					13																	23915582		2203	4300	6503	22813582	SO:0001819	synonymous_variant	26278	exon10			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.2433T>C	13.37:g.23915582A>G		Somatic		Capture	SOLID	Phase_I	22813582	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	A	1.124	-0.654490	0.03480	.	.	ENSG00000151835	ENST00000455470	.	.	.	6.05	-9.64	0.00541	.	.	.	.	.	.	.	.	.	.	.	0.24679	N	0.993378	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.4492	0.38717	0.3307:0.2688:0.4005:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SACS	22813582	0.096000	0.21769	0.489000	0.27452	0.538000	0.34931	0.085000	0.14912	-1.537000	0.01736	-1.090000	0.02178	.		SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
SPATA13	221178	hgsc.bcm.edu	37	13	24823940	24823940	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:24823940G>T	ENST00000382095.4	+	2	511	c.104G>T	c.(103-105)gGg>gTg	p.G35V	SPATA13_ENST00000424834.2_Missense_Mutation_p.G660V|SPATA13-AS1_ENST00000430733.1_RNA|RP11-307N16.6_ENST00000382141.4_Intron|SPATA13_ENST00000382108.3_Missense_Mutation_p.G660V	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	35					cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.G35V(1)		breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		AGCTTGTATGGGACCAACCAG	0.577																																					p.G660V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1979T	13						.						86.0	69.0	75.0					13																	24823940		2203	4294	6497	23721940	SO:0001583	missense	221178	exon3			AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.104G>T	13.37:g.24823940G>T	ENSP00000371527:p.Gly35Val	Somatic		Capture	SOLID	Phase_I	23721940	NM_001166271	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	ENST00000382095.4	37	CCDS9305.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.14|16.14	3.040218|3.040218	0.55003|0.55003	.|.	.|.	ENSG00000182957|ENSG00000182957	ENST00000382108;ENST00000382095|ENST00000424834	T;T|.	0.34072|.	1.38;1.38|.	5.76|5.76	4.86|4.86	0.63082|0.63082	.|.	0.223550|.	0.39210|.	N|.	0.001440|.	T|T	0.51244|0.51244	0.1663|0.1663	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	P|.	0.35077|.	0.483|.	B|.	0.33392|.	0.163|.	T|T	0.42766|0.42766	-0.9432|-0.9432	10|5	0.56958|.	D|.	0.05|.	.|.	14.0624|14.0624	0.64808|0.64808	0.0:0.2717:0.7283:0.0|0.0:0.2717:0.7283:0.0	.|.	35|.	Q96N96|.	SPT13_HUMAN|.	V|C	660;35|697	ENSP00000371542:G660V;ENSP00000371527:G35V|.	ENSP00000371527:G35V|.	G|W	+|+	2|3	0|0	SPATA13|SPATA13	23721940|23721940	0.998000|0.998000	0.40836|0.40836	0.971000|0.971000	0.41717|0.41717	0.374000|0.374000	0.29953|0.29953	3.008000|3.008000	0.49544|0.49544	2.728000|2.728000	0.93425|0.93425	0.462000|0.462000	0.41574|0.41574	GGG|TGG		SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044180.2	NM_153023	
PARP4	143	hgsc.bcm.edu	37	13	25044059	25044059	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:25044059G>A	ENST00000381989.3	-	16	2124	c.2019C>T	c.(2017-2019)ttC>ttT	p.F673F		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	673	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TCCCATTGATGAAGGCTTCGA	0.448																																					p.F673F												.	.	0			c.C2019T	13						.						93.0	71.0	78.0					13																	25044059		2203	4300	6503	23942059	SO:0001819	synonymous_variant	143	exon16			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.2019C>T	13.37:g.25044059G>A		Somatic		Capture	SOLID	Phase_I	23942059	NM_006437	O75903|Q14682|Q5QNZ9|Q9H1M6	Silent	SNP	ENST00000381989.3	37	CCDS9307.1																																																																																				PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	
RXFP2	122042	hgsc.bcm.edu	37	13	32371491	32371491	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:32371491A>C	ENST00000298386.2	+	17	2011	c.1940A>C	c.(1939-1941)gAt>gCt	p.D647A	RXFP2_ENST00000380314.1_Missense_Mutation_p.D623A	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	647					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)	p.D647A(1)		cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		GTGTTCTCTGATGCCATCTGC	0.403																																					p.D623A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1868C	13						.						221.0	213.0	216.0					13																	32371491		2203	4300	6503	31269491	SO:0001583	missense	122042	exon16			AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.1940A>C	13.37:g.32371491A>C	ENSP00000298386:p.Asp647Ala	Somatic		Capture	SOLID	Phase_I	31269491	NM_001166058	B1ALE9|Q3KU23	Missense_Mutation	SNP	ENST00000298386.2	37	CCDS9342.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.350196	0.82132	.	.	ENSG00000133105	ENST00000380314;ENST00000298386	T;T	0.36878	1.23;1.23	5.66	5.66	0.87406	GPCR, rhodopsin-like superfamily (1);	0.093559	0.64402	D	0.000001	T	0.64757	0.2627	M	0.88450	2.955	0.80722	D	1	D;D	0.57899	0.981;0.981	D;D	0.63192	0.912;0.912	T	0.72414	-0.4301	10	0.72032	D	0.01	.	15.8843	0.79232	1.0:0.0:0.0:0.0	.	623;647	Q3KU23;Q8WXD0	.;RXFP2_HUMAN	A	623;647	ENSP00000369670:D623A;ENSP00000298386:D647A	ENSP00000298386:D647A	D	+	2	0	RXFP2	31269491	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.753000	0.91637	2.164000	0.68074	0.533000	0.62120	GAT		RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044399.1	NM_130806	
AKAP11	11215	hgsc.bcm.edu	37	13	42877914	42877914	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:42877914G>A	ENST00000025301.2	+	8	5207	c.5032G>A	c.(5032-5034)Gga>Aga	p.G1678R		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1678					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)	p.G1678R(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		CAGTGGGATCGGACAGGAGGG	0.512																																					p.G1678R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5032A	13						.						38.0	36.0	36.0					13																	42877914		2202	4299	6501	41775914	SO:0001583	missense	11215	exon8			AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.5032G>A	13.37:g.42877914G>A	ENSP00000025301:p.Gly1678Arg	Somatic		Capture	SOLID	Phase_I	41775914	NM_016248	O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	37	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	G	19.35	3.811657	0.70797	.	.	ENSG00000023516	ENST00000025301	T	0.57752	0.38	5.67	5.67	0.87782	.	0.061511	0.64402	D	0.000005	T	0.73814	0.3635	M	0.72894	2.215	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.75575	-0.3270	10	0.87932	D	0	.	19.7784	0.96405	0.0:0.0:1.0:0.0	.	1678	Q9UKA4	AKA11_HUMAN	R	1678	ENSP00000025301:G1678R	ENSP00000025301:G1678R	G	+	1	0	AKAP11	41775914	1.000000	0.71417	0.991000	0.47740	0.888000	0.51559	7.599000	0.82757	2.658000	0.90341	0.591000	0.81541	GGA		AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
GPALPP1	55425	hgsc.bcm.edu	37	13	45589160	45589160	+	Missense_Mutation	SNP	C	C	T	rs181252018	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:45589160C>T	ENST00000379151.4	+	5	585	c.482C>T	c.(481-483)aCg>aTg	p.T161M	RP11-321C24.1_ENST00000437748.2_lincRNA|GPALPP1_ENST00000361121.2_Missense_Mutation_p.T161M|GPALPP1_ENST00000357537.3_5'UTR	NM_018559.2	NP_061029.2	Q8IXQ4	GPAM1_HUMAN	GPALPP motifs containing 1	161								p.T161M(1)									TATAATGTAACGACAGAGTTT	0.328																																					p.T161M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C482T	13						.						73.0	75.0	74.0					13																	45589160		2203	4300	6503	44487160	SO:0001583	missense	55425	exon5			AB051491	CCDS9394.1	13q14.12	2013-08-13	2013-08-12	2013-08-12	ENSG00000133114	ENSG00000133114			20298	protein-coding gene	gene with protein product			"""KIAA1704"""	KIAA1704		11214970	Standard	NM_018559		Approved	bA245H20.2, AD029, LSR7	uc001uzq.3	Q8IXQ4	OTTHUMG00000016841	ENST00000379151.4:c.482C>T	13.37:g.45589160C>T	ENSP00000368447:p.Thr161Met	Somatic		Capture	SOLID	Phase_I	44487160	NM_018559	A8K8X8|Q05BX8|Q05D87|Q5T3Z3|Q5T3Z5|Q9C0F9|Q9H2R0|Q9P0W6	Missense_Mutation	SNP	ENST00000379151.4	37	CCDS9394.1	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	C	21.0	4.081400	0.76528	.	.	ENSG00000133114	ENST00000379151;ENST00000361121	.	.	.	5.9	5.9	0.94986	.	0.257041	0.46758	D	0.000264	T	0.43831	0.1265	L	0.51422	1.61	0.30666	N	0.753852	D;D	0.67145	0.966;0.996	P;P	0.47162	0.451;0.54	T	0.52931	-0.8509	9	0.45353	T	0.12	-1.3073	19.2671	0.93993	0.0:1.0:0.0:0.0	.	12;161	Q8IXQ4-2;Q8IXQ4	.;K1704_HUMAN	M	161	.	ENSP00000355211:T161M	T	+	2	0	KIAA1704	44487160	0.948000	0.32251	0.010000	0.14722	0.890000	0.51754	7.027000	0.76463	2.788000	0.95919	0.650000	0.86243	ACG		GPALPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044749.2	NM_018559	
COG3	83548	hgsc.bcm.edu	37	13	46070352	46070352	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:46070352G>A	ENST00000349995.5	+	13	1505	c.1393G>A	c.(1393-1395)Gtc>Atc	p.V465I	COG3_ENST00000465942.1_3'UTR	NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	465					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)	p.V465I(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		GGAGCGGCTCGTCTACCGAAC	0.468																																					p.V465I	Ovarian(150;1048 1859 18083 21577 42700)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1393A	13						.						84.0	81.0	82.0					13																	46070352		2203	4300	6503	44968353	SO:0001583	missense	83548	exon13			AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.1393G>A	13.37:g.46070352G>A	ENSP00000258654:p.Val465Ile	Somatic		Capture	SOLID	Phase_I	44968353	NM_031431	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	ENST00000349995.5	37	CCDS9398.1	.	.	.	.	.	.	.	.	.	.	G	32	5.149945	0.94645	.	.	ENSG00000136152	ENST00000349995	T	0.41065	1.01	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.54806	0.1881	L	0.38953	1.18	0.80722	D	1	D;D	0.89917	0.991;1.0	P;D	0.76575	0.629;0.988	T	0.33929	-0.9849	10	0.16420	T	0.52	-11.8228	19.4443	0.94840	0.0:0.0:1.0:0.0	.	302;465	B4E2F3;Q96JB2	.;COG3_HUMAN	I	465	ENSP00000258654:V465I	ENSP00000258654:V465I	V	+	1	0	COG3	44968353	1.000000	0.71417	0.946000	0.38457	0.566000	0.35808	9.869000	0.99810	2.847000	0.97988	0.591000	0.81541	GTC		COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		
LCP1	3936	hgsc.bcm.edu	37	13	46727011	46727011	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:46727011C>A	ENST00000398576.2	-	10	1031	c.643G>T	c.(643-645)Gac>Tac	p.D215Y	LCP1_ENST00000323076.2_Missense_Mutation_p.D215Y			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	215	Actin-binding 1.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)	p.D215Y(1)		breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		TCCTTCAGGTCCTCAGCCCCT	0.478			T	BCL6	NHL																																p.D215Y			Dom	yes		13	13q14.1-q14.3	3936	lymphocyte cytosolic protein 1 (L-plastin)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G643T	13						.						90.0	79.0	83.0					13																	46727011		2203	4300	6503	45625012	SO:0001583	missense	3936	exon7			M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.643G>T	13.37:g.46727011C>A	ENSP00000381581:p.Asp215Tyr	Somatic		Capture	SOLID	Phase_I	45625012	NM_002298	B2R613|B4DUA0|Q5TBN4	Missense_Mutation	SNP	ENST00000398576.2	37	CCDS9403.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.261440	0.80358	.	.	ENSG00000136167	ENST00000323076;ENST00000398576;ENST00000416500	D;D;D	0.97598	-4.45;-4.45;-4.45	5.51	4.67	0.58626	Actinin-type, actin-binding, conserved site (1);Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.98887	0.9623	H	0.96518	3.835	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99278	1.0895	10	0.87932	D	0	-32.5822	13.3855	0.60793	0.0:0.9245:0.0:0.0755	.	215	P13796	PLSL_HUMAN	Y	215	ENSP00000315757:D215Y;ENSP00000381581:D215Y;ENSP00000408052:D215Y	ENSP00000315757:D215Y	D	-	1	0	LCP1	45625012	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	1.323000	0.45263	0.591000	0.81541	GAC		LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044800.3	NM_002298	
FNDC3A	22862	hgsc.bcm.edu	37	13	49772119	49772119	+	Splice_Site	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:49772119C>A	ENST00000492622.2	+	22	2797	c.2492C>A	c.(2491-2493)gCt>gAt	p.A831D	FNDC3A_ENST00000541916.1_Splice_Site_p.A831D|FNDC3A_ENST00000398316.3_Splice_Site_p.A775D	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	831	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)	p.A831D(1)		endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		AATTTGTAGGCTCTGAGTGTT	0.433																																					p.A831D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2492A	13						.						69.0	69.0	69.0					13																	49772119		2203	4300	6503	48670120	SO:0001630	splice_region_variant	22862	exon22			AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.2491-1C>A	13.37:g.49772119C>A		Somatic		Capture	SOLID	Phase_I	48670120	NM_001079673	B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	ENST00000492622.2	37	CCDS41886.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.223327	0.58668	.	.	ENSG00000102531	ENST00000492622;ENST00000337156;ENST00000541916;ENST00000398316	T;T;T	0.77098	-1.07;-1.07;-1.07	5.88	5.04	0.67666	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	D	0.92424	0.7595	H	0.97415	4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.95128	0.8252	10	0.87932	D	0	-22.7208	16.2667	0.82588	0.0:0.8675:0.1325:0.0	.	775;831	Q9Y2H6-2;Q9Y2H6	.;FND3A_HUMAN	D	831;767;831;775	ENSP00000417257:A831D;ENSP00000441831:A831D;ENSP00000381362:A775D	ENSP00000338579:A767D	A	+	2	0	FNDC3A	48670120	1.000000	0.71417	1.000000	0.80357	0.571000	0.35966	7.076000	0.76806	1.477000	0.48234	0.650000	0.86243	GCT		FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	NM_014923	Missense_Mutation
CDADC1	81602	hgsc.bcm.edu	37	13	49854764	49854764	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:49854764A>G	ENST00000251108.6	+	8	1453	c.1340A>G	c.(1339-1341)gAt>gGt	p.D447G	CDADC1_ENST00000444959.1_Missense_Mutation_p.D249G	NM_001193478.1|NM_030911.3	NP_001180407.1|NP_112173.1	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1	447							hydrolase activity (GO:0016787)|zinc ion binding (GO:0008270)	p.D447G(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	16		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		GGAGATGTAGATGTTGGAAAA	0.383																																					p.D447G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1340G	13						.						122.0	116.0	118.0					13																	49854764		2203	4300	6503	48752765	SO:0001583	missense	81602	exon8			AY027525	CCDS9415.1	13q14.11	2008-02-05			ENSG00000102543	ENSG00000102543			20299	protein-coding gene	gene with protein product							Standard	NM_001193478		Approved	NYD-SP15	uc001vcu.3	Q9BWV3	OTTHUMG00000016913	ENST00000251108.6:c.1340A>G	13.37:g.49854764A>G	ENSP00000251108:p.Asp447Gly	Somatic		Capture	SOLID	Phase_I	48752765	NM_030911	Q49A08|Q4G119|Q5TAW9|Q7Z764|Q9NT36	Missense_Mutation	SNP	ENST00000251108.6	37	CCDS9415.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.643769	0.87859	.	.	ENSG00000102543	ENST00000251108;ENST00000444959	T;T	0.48836	0.8;0.8	5.77	5.77	0.91146	Cytidine deaminase-like (1);	0.000000	0.85682	D	0.000000	T	0.58906	0.2155	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.61187	-0.7113	10	0.62326	D	0.03	-24.3184	15.5753	0.76373	1.0:0.0:0.0:0.0	.	447	Q9BWV3	CDAC1_HUMAN	G	447;249	ENSP00000251108:D447G;ENSP00000407226:D249G	ENSP00000251108:D447G	D	+	2	0	CDADC1	48752765	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.452000	0.90346	2.326000	0.78906	0.533000	0.62120	GAT		CDADC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044902.2	NM_030911	
PCDH17	27253	hgsc.bcm.edu	37	13	58299162	58299162	+	Silent	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:58299162T>C	ENST00000377918.3	+	4	3240	c.3214T>C	c.(3214-3216)Ttg>Ctg	p.L1072L		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	1072					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L1072V(2)|p.L1072L(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CAGTCAGTACTTGCCCACTGA	0.532																																					p.L1072L	Melanoma(72;952 1291 1619 12849 33676)											.	.	3	Substitution - Missense(2)|Substitution - coding silent(1)	prostate(1)|large_intestine(1)|lung(1)	c.T3214C	13						.						107.0	103.0	104.0					13																	58299162		2203	4300	6503	57197163	SO:0001819	synonymous_variant	27253	exon4			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.3214T>C	13.37:g.58299162T>C		Somatic		Capture	SOLID	Phase_I	57197163	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	ENST00000377918.3	37	CCDS31986.1																																																																																				PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
MYCBP2	23077	hgsc.bcm.edu	37	13	77626011	77626011	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:77626011G>A	ENST00000544440.2	-	81	13593	c.13576C>T	c.(13576-13578)Cgg>Tgg	p.R4526W	MYCBP2_ENST00000357337.6_Missense_Mutation_p.R4526W|MYCBP2_ENST00000407578.2_Missense_Mutation_p.R4564W					MYC binding protein 2, E3 ubiquitin protein ligase									p.R4564W(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TCATCTCCCCGTCCAGCCTCA	0.458																																					p.R4564W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C13690T	13						.						78.0	75.0	76.0					13																	77626011		2203	4300	6503	76524012	SO:0001583	missense	23077	exon81			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.13576C>T	13.37:g.77626011G>A	ENSP00000444596:p.Arg4526Trp	Somatic		Capture	SOLID	Phase_I	76524012	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.7|22.7	4.327439|4.327439	0.81690|0.81690	.|.	.|.	ENSG00000005810|ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440|ENST00000429715	T;T;T|.	0.28666|.	1.6;1.6;1.6|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	0.122142|.	0.56097|.	D|.	0.000024|.	T|T	0.54983|0.54983	0.1892|0.1892	N|N	0.19112|0.19112	0.55|0.55	0.39294|0.39294	D|D	0.964798|0.964798	B|.	0.29909|.	0.261|.	B|.	0.11329|.	0.006|.	T|T	0.51521|0.51521	-0.8695|-0.8695	10|5	0.66056|.	D|.	0.02|.	.|.	19.8309|19.8309	0.96634|0.96634	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	4526|.	O75592|.	MYCB2_HUMAN|.	W|M	4526;4564;4526|946	ENSP00000349892:R4526W;ENSP00000384288:R4564W;ENSP00000444596:R4526W|.	ENSP00000349892:R4526W|.	R|T	-|-	1|2	2|0	MYCBP2|MYCBP2	76524012|76524012	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	9.180000|9.180000	0.94867|0.94867	2.681000|2.681000	0.91329|0.91329	0.650000|0.650000	0.86243|0.86243	CGG|ACG		MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
SLITRK5	26050	hgsc.bcm.edu	37	13	88328251	88328251	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:88328251C>T	ENST00000325089.6	+	2	827	c.608C>T	c.(607-609)aCg>aTg	p.T203M	SLITRK5_ENST00000400028.3_Intron	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	203					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.T203M(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GTGCCCTTAACGCACTTGGAC	0.493																																					p.T203M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C608T	13						.						76.0	78.0	77.0					13																	88328251		2203	4300	6503	87126252	SO:0001583	missense	26050	exon2			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.608C>T	13.37:g.88328251C>T	ENSP00000366283:p.Thr203Met	Somatic		Capture	SOLID	Phase_I	87126252	NM_015567	B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	C	15.69	2.909017	0.52439	.	.	ENSG00000165300	ENST00000325089	T	0.54866	0.55	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.72374	0.3452	M	0.69523	2.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70699	-0.4800	9	.	.	.	-10.2245	17.7344	0.88388	0.0:1.0:0.0:0.0	.	203	O94991	SLIK5_HUMAN	M	203	ENSP00000366283:T203M	.	T	+	2	0	SLITRK5	87126252	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.999000	0.70665	2.797000	0.96272	0.561000	0.74099	ACG		SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
CLDN10	9071	hgsc.bcm.edu	37	13	96212393	96212393	+	Missense_Mutation	SNP	A	A	G	rs34449921	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:96212393A>G	ENST00000299339.2	+	2	257	c.228A>G	c.(226-228)atA>atG	p.I76M	CLDN10_ENST00000376855.1_5'Flank|CLDN10_ENST00000376873.3_Missense_Mutation_p.I74M	NM_006984.4	NP_008915.1	P78369	CLD10_HUMAN	claudin 10	76					calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|ion transport (GO:0006811)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.I74M(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			CAGGTTATATACAGGCATGTA	0.438																																					p.I76M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A228G	13						.						126.0	110.0	116.0					13																	96212393		2203	4300	6503	95010394	SO:0001583	missense	9071	exon2			U89916	CCDS9475.1, CCDS9476.1	13q31-q34	2008-07-18			ENSG00000134873	ENSG00000134873		"""Claudins"""	2033	protein-coding gene	gene with protein product						18025272	Standard	NM_182848		Approved	OSP-L, CPETRL3	uc001vmh.2	P78369	OTTHUMG00000017217	ENST00000299339.2:c.228A>G	13.37:g.96212393A>G	ENSP00000299339:p.Ile76Met	Somatic		Capture	SOLID	Phase_I	95010394	NM_006984	Q6IBF9|Q96N78	Missense_Mutation	SNP	ENST00000299339.2	37	CCDS9476.1	.	.	.	.	.	.	.	.	.	.	C	34	5.334566	0.95758	.	.	ENSG00000134873	ENST00000376873;ENST00000299339	D;D	0.89196	-2.48;-2.48	5.75	4.04	0.47022	.	0.000000	0.85682	D	0.000000	D	0.92103	0.7497	M	0.72353	2.195	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.83275	0.992;0.992;0.996	D	0.89565	0.3809	10	0.66056	D	0.02	.	4.8336	0.13453	0.2613:0.5415:0.0:0.1972	.	76;76;74	Q6IBF9;P78369;Q96N78	.;CLD10_HUMAN;.	M	74;76	ENSP00000366069:I74M;ENSP00000299339:I76M	ENSP00000299339:I76M	I	+	3	3	CLDN10	95010394	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.057000	0.30492	0.370000	0.24538	-0.127000	0.14921	ATA		CLDN10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045484.1	NM_006984	
ATP11A	23250	hgsc.bcm.edu	37	13	113439565	113439565	+	Silent	SNP	G	G	A	rs201361256	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr13:113439565G>A	ENST00000487903.1	+	2	244	c.156G>A	c.(154-156)tcG>tcA	p.S52S	ATP11A_ENST00000283558.8_Silent_p.S52S|ATP11A_ENST00000375645.3_Silent_p.S52S|ATP11A_ENST00000375630.2_Silent_p.S52S			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	52					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.S52S(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				GGATCGTCTCGTCCAAGGTAA	0.562													G|||	2	0.000399361	0.0008	0.0	5008	,	,		19379	0.0		0.0	False		,,,				2504	0.001				p.S52S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G156A	13						.						149.0	138.0	142.0					13																	113439565		2203	4300	6503	112487566	SO:0001819	synonymous_variant	23250	exon2			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.156G>A	13.37:g.113439565G>A		Somatic		Capture	SOLID	Phase_I	112487566	NM_015205	Q5VXT2	Silent	SNP	ENST00000487903.1	37	CCDS32011.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	4.333	0.061246	0.08339	.	.	ENSG00000068650	ENST00000418678	.	.	.	4.84	-1.15	0.09709	.	.	.	.	.	T	0.42086	0.1187	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24225	-1.0166	4	.	.	.	.	2.8946	0.05687	0.1159:0.5095:0.1164:0.2582	.	.	.	.	H	27	.	.	R	+	2	0	ATP11A	112487566	0.976000	0.34144	0.959000	0.39883	0.314000	0.28054	0.072000	0.14617	-0.257000	0.09459	-0.763000	0.03452	CGT		ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205	
CPN1	1369	hgsc.bcm.edu	37	10	101808630	101808630	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:101808630T>G	ENST00000370418.3	-	8	1366	c.1115A>C	c.(1114-1116)gAc>gCc	p.D372A		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	372					response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.D372A(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		ATCACCATGGTCACCTGAAAG	0.438																																					p.D372A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1115C	10						.						105.0	93.0	97.0					10																	101808630		2203	4300	6503	101798620	SO:0001583	missense	1369	exon8			X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.1115A>C	10.37:g.101808630T>G	ENSP00000359446:p.Asp372Ala	Somatic		Capture	SOLID	Phase_I	101798620	NM_001308	B1AP59	Missense_Mutation	SNP	ENST00000370418.3	37	CCDS7486.1	.	.	.	.	.	.	.	.	.	.	T	9.888	1.203431	0.22121	.	.	ENSG00000120054	ENST00000370418;ENST00000441382	T;T	0.37411	1.2;1.2	5.5	5.5	0.81552	Peptidase M14, carboxypeptidase A (1);Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	1.049870	0.07330	N	0.879098	T	0.15435	0.0372	N	0.01668	-0.77	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14643	-1.0465	10	0.11485	T	0.65	-12.0255	9.9579	0.41678	0.1516:0.0:0.0:0.8484	.	372	P15169	CBPN_HUMAN	A	372;169	ENSP00000359446:D372A;ENSP00000410895:D169A	ENSP00000359446:D372A	D	-	2	0	CPN1	101798620	0.133000	0.22466	0.744000	0.31058	0.816000	0.46133	0.445000	0.21677	2.097000	0.63578	0.524000	0.50904	GAC		CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049828.1	NM_001308	
SEMA4G	57715	hgsc.bcm.edu	37	10	102743211	102743211	+	Missense_Mutation	SNP	G	G	A	rs374200198		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:102743211G>A	ENST00000370250.4	+	14	2213	c.1840G>A	c.(1840-1842)Gtg>Atg	p.V614M	RP11-108L7.4_ENST00000447344.1_RNA|SEMA4G_ENST00000210633.3_Missense_Mutation_p.V619M|SEMA4G_ENST00000517724.1_Intron|MRPL43_ENST00000493646.1_5'Flank|MRPL43_ENST00000370242.4_Intron|MRPL43_ENST00000299179.5_Intron|MRPL43_ENST00000370241.3_Intron|MRPL43_ENST00000318325.2_Intron|MRPL43_ENST00000342071.1_Intron	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G	614	Ig-like C2-type.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.V619M(1)		breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		CCGTGTGGGCGTGGACGGGCT	0.632																																					p.V619M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1855A	10						.		,MET/VAL,,,	0,4406		0,0,2203	80.0	57.0	65.0		,1855,,,	5.4	1.0	10		65	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense,intron,intron,intron	SEMA4G,MRPL43	NM_001203244.1,NM_017893.3,NM_176792.2,NM_176793.1,NM_176794.1	,21,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,possibly-damaging,,,	,619/844,,,	102743211	1,13005	2203	4300	6503	102733201	SO:0001583	missense	57715	exon14			AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.1840G>A	10.37:g.102743211G>A	ENSP00000359270:p.Val614Met	Somatic		Capture	SOLID	Phase_I	102733201	NM_017893	A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Missense_Mutation	SNP	ENST00000370250.4	37		.	.	.	.	.	.	.	.	.	.	g	21.0	4.084178	0.76642	0.0	1.16E-4	ENSG00000095539	ENST00000370250;ENST00000210633	T;T	0.10005	2.92;2.92	5.36	5.36	0.76844	.	0.113473	0.64402	D	0.000010	T	0.24736	0.0600	L	0.44542	1.39	0.40506	D	0.980696	D	0.53745	0.962	P	0.61328	0.887	T	0.00331	-1.1811	10	0.46703	T	0.11	.	18.0891	0.89468	0.0:0.0:1.0:0.0	.	619	Q9NTN9-2	.	M	614;619	ENSP00000359270:V614M;ENSP00000210633:V619M	ENSP00000210633:V619M	V	+	1	0	SEMA4G	102733201	1.000000	0.71417	0.966000	0.40874	0.965000	0.64279	6.923000	0.75817	2.530000	0.85305	0.550000	0.68814	GTG		SEMA4G-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049920.2		
GBF1	8729	hgsc.bcm.edu	37	10	104018768	104018768	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:104018768C>T	ENST00000369983.3	+	2	333	c.73C>T	c.(73-75)Cga>Tga	p.R25*	AL160011.1_ENST00000516180.2_RNA	NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	25					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.R25*(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		ACGAAATGCCCGATGGAGCAC	0.413																																					p.R25X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C73T	10						.						113.0	121.0	118.0					10																	104018768		2203	4300	6503	104008758	SO:0001587	stop_gained	8729	exon2			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.73C>T	10.37:g.104018768C>T	ENSP00000359000:p.Arg25*	Somatic		Capture	SOLID	Phase_I	104008758	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Nonsense_Mutation	SNP	ENST00000369983.3	37	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	C	37	6.350710	0.97498	.	.	ENSG00000107862	ENST00000369983	.	.	.	5.95	2.74	0.32292	.	0.160714	0.39083	N	0.001465	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.6822	16.7212	0.85410	0.4156:0.5843:0.0:0.0	.	.	.	.	X	25	.	ENSP00000359000:R25X	R	+	1	2	GBF1	104008758	0.937000	0.31787	1.000000	0.80357	0.996000	0.88848	1.794000	0.38774	0.820000	0.34516	-0.169000	0.13324	CGA		GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
PSD	5662	hgsc.bcm.edu	37	10	104164357	104164357	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:104164357C>T	ENST00000020673.5	-	15	3209	c.2683G>A	c.(2683-2685)Gcc>Acc	p.A895T	PSD_ENST00000406432.1_Missense_Mutation_p.A895T	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	895					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)	p.A895T(1)|p.A680T(1)		breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		AGGCGGGTGGCAGCGCTGGGC	0.617																																					p.A895T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2683A	10						.						60.0	58.0	59.0					10																	104164357		2203	4300	6503	104154347	SO:0001583	missense	5662	exon15			X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.2683G>A	10.37:g.104164357C>T	ENSP00000020673:p.Ala895Thr	Somatic		Capture	SOLID	Phase_I	104154347	NM_002779	B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	ENST00000020673.5	37	CCDS31272.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.578084	0.28180	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.17691	2.26;2.26	5.06	5.06	0.68205	.	0.502377	0.22324	N	0.061543	T	0.06462	0.0166	N	0.11064	0.09	0.34201	D	0.673162	B;B;B	0.19935	0.012;0.04;0.003	B;B;B	0.19148	0.024;0.024;0.01	T	0.29305	-1.0016	10	0.02654	T	1	.	4.7711	0.13157	0.1949:0.6419:0.0:0.1632	.	895;798;516	A5PKW4;Q86YI3;A5PKW4-2	PSD1_HUMAN;.;.	T	895;798;895	ENSP00000020673:A895T;ENSP00000384830:A895T	ENSP00000020673:A895T	A	-	1	0	PSD	104154347	0.770000	0.28543	1.000000	0.80357	0.997000	0.91878	1.135000	0.31454	2.627000	0.88993	0.555000	0.69702	GCC		PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2		
IDI1	3422	hgsc.bcm.edu	37	10	1088638	1088638	+	Silent	SNP	G	G	A	rs199527508	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:1088638G>A	ENST00000381344.3	-	4	637	c.471C>T	c.(469-471)gaC>gaT	p.D157D	IDI1_ENST00000491735.1_5'UTR|IDI2-AS1_ENST00000428780.2_RNA|IDI2-AS1_ENST00000420381.1_RNA|RNU7-163P_ENST00000459467.1_RNA|IDI2-AS1_ENST00000536039.1_RNA|IDI2-AS1_ENST00000437374.1_RNA	NM_004508.2	NP_004499.2	Q13907	IDI1_HUMAN	isopentenyl-diphosphate delta isomerase 1	100	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				cholesterol biosynthetic process (GO:0006695)|dimethylallyl diphosphate biosynthetic process (GO:0050992)|isoprenoid biosynthetic process (GO:0008299)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|isopentenyl-diphosphate delta-isomerase activity (GO:0004452)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)	p.D157D(1)		large_intestine(3)|lung(2)|prostate(1)	6		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.221)	Epithelial(11;0.0972)		CTCCAAGGGCGTCACTTTCCT	0.473													G|||	2	0.000399361	0.0	0.0	5008	,	,		14034	0.002		0.0	False		,,,				2504	0.0				p.D157D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C471T	10						.						109.0	96.0	101.0					10																	1088638		2203	4300	6503	1078638	SO:0001819	synonymous_variant	3422	exon4			BC006999	CCDS7056.1	10p15.3	2003-11-12	2005-07-25		ENSG00000067064	ENSG00000067064	5.3.3.2		5387	protein-coding gene	gene with protein product	"""IPP isomerase"""	604055	"""isopentenyl-diphosphate delta isomerase"""			8020941	Standard	NM_004508		Approved		uc001iga.3	Q13907	OTTHUMG00000017536	ENST00000381344.3:c.471C>T	10.37:g.1088638G>A		Somatic		Capture	SOLID	Phase_I	1078638	NM_004508	B4E155|Q32Q13|Q53GQ6|Q86U81|Q8WUX8|Q96IZ4|Q9BQ74	Silent	SNP	ENST00000381344.3	37	CCDS7056.1																																																																																				IDI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046409.2	NM_004508	
TAF5	6877	hgsc.bcm.edu	37	10	105147060	105147060	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:105147060T>G	ENST00000369839.3	+	9	1981	c.1958T>G	c.(1957-1959)cTc>cGc	p.L653R	TAF5_ENST00000351396.4_Missense_Mutation_p.L598R	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	653					chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.L653R(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		ACTGTGCGGCTCTGGGACGTC	0.418																																					p.L653R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1958G	10						.						93.0	94.0	94.0					10																	105147060		2203	4300	6503	105137050	SO:0001583	missense	6877	exon9			X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.1958T>G	10.37:g.105147060T>G	ENSP00000358854:p.Leu653Arg	Somatic		Capture	SOLID	Phase_I	105137050	NM_006951	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	.	.	.	.	.	.	.	.	.	.	T	13.03	2.114492	0.37339	.	.	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.67345	-0.26;-0.26	5.52	5.52	0.82312	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.060325	0.64402	D	0.000006	D	0.84311	0.5444	M	0.92122	3.275	0.80722	D	1	P;D	0.58970	0.95;0.984	P;P	0.60541	0.735;0.876	D	0.88471	0.3062	10	0.87932	D	0	-7.2676	15.6404	0.76997	0.0:0.0:0.0:1.0	.	598;653	Q15542-2;Q15542	.;TAF5_HUMAN	R	653;598	ENSP00000358854:L653R;ENSP00000311024:L598R	ENSP00000311024:L598R	L	+	2	0	TAF5	105137050	1.000000	0.71417	1.000000	0.80357	0.013000	0.08279	7.685000	0.84117	2.081000	0.62600	0.477000	0.44152	CTC		TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1		
KIAA1598	57698	hgsc.bcm.edu	37	10	118687338	118687338	+	Silent	SNP	T	T	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:118687338T>A	ENST00000355371.4	-	11	1574	c.1077A>T	c.(1075-1077)ccA>ccT	p.P359P	KIAA1598_ENST00000392901.4_Silent_p.P299P|KIAA1598_ENST00000392903.2_Silent_p.P359P|KIAA1598_ENST00000497044.1_5'UTR|KIAA1598_ENST00000260777.10_Silent_p.P359P	NM_001127211.2|NM_001258298.1|NM_001258299.1	NP_001120683.1|NP_001245227.1|NP_001245228.1	A0MZ66	SHOT1_HUMAN	KIAA1598	359	Pro-rich.				axon guidance (GO:0007411)|regulation of establishment of cell polarity (GO:2000114)|regulation of neuron migration (GO:2001222)	axonal growth cone (GO:0044295)		p.P359P(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)	10				all cancers(201;0.00494)		gaagtggtggtggaggaggag	0.493																																					p.P359P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1077T	10						.						201.0	195.0	197.0					10																	118687338		2203	4300	6503	118677328	SO:0001819	synonymous_variant	57698	exon11			BC022348	CCDS31293.1, CCDS44482.1, CCDS58097.1, CCDS73207.1, CCDS73208.1	10q26.12	2007-01-30			ENSG00000187164	ENSG00000187164			29319	protein-coding gene	gene with protein product		611171				10997877, 17030985	Standard	NM_001127211		Approved	shootin1, shootin-1	uc009xyw.4	A0MZ66	OTTHUMG00000019114	ENST00000355371.4:c.1077A>T	10.37:g.118687338T>A		Somatic		Capture	SOLID	Phase_I	118677328	NM_018330	A8MYU7|B3KRD3|B3KRH2|B3KTE0|B3KTJ7|B3KTJ8|B4E3U1|B7Z7Z9|Q68DG1|Q6PIM5|Q9HCH4|Q9NUV0	Silent	SNP	ENST00000355371.4	37	CCDS44482.1																																																																																				KIAA1598-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018330	
PDZD8	118987	hgsc.bcm.edu	37	10	119078418	119078418	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:119078418C>T	ENST00000334464.5	-	3	1302	c.1063G>A	c.(1063-1065)Gtt>Att	p.V355I		NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	355					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)	p.V355I(1)		kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		TCTTCCCAAACACTACTGCTT	0.328																																					p.V355I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1063A	10						.						117.0	115.0	115.0					10																	119078418		2203	4299	6502	119068408	SO:0001583	missense	118987	exon3			AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.1063G>A	10.37:g.119078418C>T	ENSP00000334642:p.Val355Ile	Somatic		Capture	SOLID	Phase_I	119068408	NM_173791	Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	37	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	C	5.075	0.199427	0.09652	.	.	ENSG00000165650	ENST00000334464	D	0.85339	-1.97	5.38	3.49	0.39957	.	0.231260	0.36444	N	0.002588	T	0.71022	0.3291	N	0.16478	0.41	0.28122	N	0.930553	B	0.22276	0.067	B	0.12837	0.008	T	0.59445	-0.7453	10	0.23891	T	0.37	-6.8018	10.2032	0.43097	0.0:0.7856:0.138:0.0764	.	355	Q8NEN9	PDZD8_HUMAN	I	355	ENSP00000334642:V355I	ENSP00000334642:V355I	V	-	1	0	PDZD8	119068408	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	1.789000	0.38724	1.405000	0.46838	0.650000	0.86243	GTT		PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791	
NANOS1	340719	hgsc.bcm.edu	37	10	120795718	120795718	+	IGR	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:120795718G>T	ENST00000425699.1	+	0	4627				EIF3A_ENST00000369144.3_Missense_Mutation_p.R1328S|EIF3A_ENST00000541549.1_Missense_Mutation_p.R1294S	NM_199461.2	NP_955631.1	Q8WY41	NANO1_HUMAN	nanos homolog 1 (Drosophila)						cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.R1328C(1)|p.R1328S(1)		lung(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0193)		GGAACTCGACGAGGAGGGTCC	0.448																																					p.R1328S												.	.	2	Substitution - Missense(2)	large_intestine(1)|skin(1)	c.C3982A	10						.						68.0	69.0	69.0					10																	120795718		2203	4300	6503	120785708	SO:0001628	intergenic_variant	8661	exon22			AF275269	CCDS7607.1	10q26.13	2003-12-01			ENSG00000188613	ENSG00000188613			23044	protein-coding gene	gene with protein product		608226				12690449	Standard	NM_199461		Approved	NOS1	uc009xzf.1	Q8WY41	OTTHUMG00000019141		10.37:g.120795718G>T		Somatic		Capture	SOLID	Phase_I	120785708	NM_003750		Missense_Mutation	SNP	ENST00000425699.1	37	CCDS7607.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.569514	0.28003	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.30714	1.52;1.56	5.83	4.92	0.64577	.	0.180353	0.26407	N	0.024550	T	0.31040	0.0784	L	0.47716	1.5	0.47308	D	0.999387	B	0.06786	0.001	B	0.08055	0.003	T	0.05533	-1.0879	10	0.56958	D	0.05	-13.1551	16.2897	0.82742	0.0:0.0:0.8665:0.1335	.	1328	Q14152	EIF3A_HUMAN	S	1328;1294	ENSP00000358140:R1328S;ENSP00000438178:R1294S	ENSP00000358140:R1328S	R	-	1	0	EIF3A	120785708	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.440000	0.90311	1.436000	0.47453	0.655000	0.94253	CGT		NANOS1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000110794.1		
SEC23IP	11196	hgsc.bcm.edu	37	10	121663700	121663700	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:121663700G>A	ENST00000369075.3	+	4	1084	c.1012G>A	c.(1012-1014)Gcc>Acc	p.A338T	SEC23IP_ENST00000543134.1_Missense_Mutation_p.A127T	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	338	Interaction with SEC23A.				acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.A338T(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		AGAGGAGCCAGCCGAAGTGAG	0.517																																					p.A338T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1012A	10						.						91.0	91.0	91.0					10																	121663700		2203	4300	6503	121653690	SO:0001583	missense	11196	exon4			AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.1012G>A	10.37:g.121663700G>A	ENSP00000358071:p.Ala338Thr	Somatic		Capture	SOLID	Phase_I	121653690	NM_007190	D3DRD2|Q8IXH5|Q9BUK5	Missense_Mutation	SNP	ENST00000369075.3	37	CCDS7618.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.300|8.300	0.819744|0.819744	0.16678|0.16678	.|.	.|.	ENSG00000107651|ENSG00000107651	ENST00000369075;ENST00000543134;ENST00000446561|ENST00000442952	T;T;T|.	0.29397|.	1.57;1.57;1.57|.	5.33|5.33	-2.77|-2.77	0.05877|0.05877	.|.	0.544124|.	0.21800|.	N|.	0.068925|.	T|T	0.07369|0.07369	0.0186|0.0186	N|N	0.00778|0.00778	-1.195|-1.195	0.09310|0.09310	N|N	1|1	B;B|.	0.06786|.	0.001;0.0|.	B;B|.	0.08055|.	0.003;0.001|.	T|T	0.38735|0.38735	-0.9647|-0.9647	10|5	0.20046|.	T|.	0.44|.	-2.4129|-2.4129	5.5764|5.5764	0.17225|0.17225	0.4781:0.0:0.2995:0.2224|0.4781:0.0:0.2995:0.2224	.|.	127;338|.	F5H0L8;Q9Y6Y8|.	.;S23IP_HUMAN|.	T|N	338;127;72|103	ENSP00000358071:A338T;ENSP00000438773:A127T;ENSP00000396906:A72T|.	ENSP00000358071:A338T|.	A|S	+|+	1|2	0|0	SEC23IP|SEC23IP	121653690|121653690	0.077000|0.077000	0.21312|0.21312	0.000000|0.000000	0.03702|0.03702	0.301000|0.301000	0.27625|0.27625	0.512000|0.512000	0.22755|0.22755	-0.168000|-0.168000	0.10853|0.10853	0.563000|0.563000	0.77884|0.77884	GCC|AGC		SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050688.1		
UROS	7390	hgsc.bcm.edu	37	10	127484732	127484732	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:127484732C>T	ENST00000368797.4	-	8	725	c.501G>A	c.(499-501)gtG>gtA	p.V167V	UROS_ENST00000368786.1_Silent_p.V167V|UROS_ENST00000462490.1_5'UTR	NM_000375.2	NP_000366.1	P10746	HEM4_HUMAN	uroporphyrinogen III synthase	167					cellular response to amine stimulus (GO:0071418)|cellular response to arsenic-containing substance (GO:0071243)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to antibiotic (GO:0046677)|small molecule metabolic process (GO:0044281)|uroporphyrinogen III biosynthetic process (GO:0006780)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|uroporphyrinogen-III synthase activity (GO:0004852)	p.V167V(1)		endometrium(2)|large_intestine(2)|lung(2)|skin(1)	7		all_lung(145;0.00756)|Lung NSC(174;0.0116)|Colorectal(57;0.0855)|all_neural(114;0.0937)|Breast(234;0.203)				CTGTCTGATACACAGTTATGC	0.552																																					p.V167V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G501A	10						.						270.0	233.0	245.0					10																	127484732		2203	4300	6503	127474722	SO:0001819	synonymous_variant	7390	exon8			J03824	CCDS7648.1	10q25.2-q26.3	2008-07-31	2008-07-31		ENSG00000188690	ENSG00000188690	4.2.1.75		12592	protein-coding gene	gene with protein product	"""congenital erythropoietic porphyria"""	606938				2037278	Standard	NM_000375		Approved		uc001lix.4	P10746	OTTHUMG00000019236	ENST00000368797.4:c.501G>A	10.37:g.127484732C>T		Somatic		Capture	SOLID	Phase_I	127474722	NM_000375	B2RC13|D3DRF7|Q9H2T1	Silent	SNP	ENST00000368797.4	37	CCDS7648.1																																																																																				UROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050929.1	NM_000375	
BCCIP	56647	hgsc.bcm.edu	37	10	127516163	127516163	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:127516163A>T	ENST00000278100.6	+	3	289	c.277A>T	c.(277-279)Aca>Tca	p.T93S	BCCIP_ENST00000478798.1_3'UTR|BCCIP_ENST00000299130.3_Missense_Mutation_p.T93S|BCCIP_ENST00000429863.2_Missense_Mutation_p.T93S|BCCIP_ENST00000368759.5_Missense_Mutation_p.T93S	NM_078468.2	NP_510868.1	Q9P287	BCCIP_HUMAN	BRCA2 and CDKN1A interacting protein	93	Interaction with BRCA2.				cell cycle (GO:0007049)|DNA repair (GO:0006281)|neuroendocrine cell differentiation (GO:0061101)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nucleus (GO:0005634)	kinase regulator activity (GO:0019207)|poly(A) RNA binding (GO:0044822)	p.T93S(1)		breast(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)	8		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TGCAGAACTAACAGATCTCTT	0.308																																					p.T93S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A277T	10						.						107.0	112.0	110.0					10																	127516163		2203	4300	6503	127506153	SO:0001583	missense	56647	exon3			AB040451	CCDS7649.1, CCDS7650.1, CCDS7651.1	10q26.2	2008-05-14	2001-11-29		ENSG00000107949	ENSG00000107949			978	protein-coding gene	gene with protein product		611883	"""BRCA2 and CDKN1A-interacting protein"""			11313963, 10878006	Standard	NM_016567		Approved	BCCIPalpha, TOK-1	uc001ljd.4	Q9P287	OTTHUMG00000019237	ENST00000278100.6:c.277A>T	10.37:g.127516163A>T	ENSP00000278100:p.Thr93Ser	Somatic		Capture	SOLID	Phase_I	127506153	NM_016567	B3KP45|Q8ND15|Q96GC4|Q9P288	Missense_Mutation	SNP	ENST00000278100.6	37	CCDS7651.1	.	.	.	.	.	.	.	.	.	.	A	18.91	3.723571	0.68959	.	.	ENSG00000107949	ENST00000278100;ENST00000299130;ENST00000368759;ENST00000429863;ENST00000392718	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.57	1.82	0.25136	.	0.150238	0.64402	D	0.000015	T	0.42854	0.1221	L	0.54908	1.71	0.50313	D	0.999861	B;P;P;P;P	0.51653	0.437;0.861;0.909;0.947;0.932	B;P;P;P;P	0.48524	0.288;0.562;0.58;0.481;0.541	T	0.37430	-0.9706	10	0.72032	D	0.01	-33.4748	9.7417	0.40422	0.7973:0.0:0.2027:0.0	.	93;93;93;93;93	B4E318;B4DUS0;Q9P287-2;Q9P287-4;Q9P287	.;.;.;.;BCCIP_HUMAN	S	93	ENSP00000278100:T93S;ENSP00000299130:T93S;ENSP00000357748:T93S;ENSP00000394758:T93S	ENSP00000278100:T93S	T	+	1	0	BCCIP	127506153	0.997000	0.39634	0.062000	0.19696	0.985000	0.73830	3.290000	0.51755	0.372000	0.24591	0.533000	0.62120	ACA		BCCIP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050941.1		
PHYH	5264	hgsc.bcm.edu	37	10	13336482	13336482	+	Silent	SNP	C	C	T	rs373346799		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:13336482C>T	ENST00000263038.4	-	4	418	c.360G>A	c.(358-360)aaG>aaA	p.K120K	PHYH_ENST00000396913.2_Silent_p.K20K|PHYH_ENST00000396920.3_Silent_p.K101K	NM_006214.3	NP_006205.1	O14832	PAHX_HUMAN	phytanoyl-CoA 2-hydroxylase	120					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|isoprenoid metabolic process (GO:0006720)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|electron carrier activity (GO:0009055)|L-ascorbic acid binding (GO:0031418)|metal ion binding (GO:0046872)|phytanoyl-CoA dioxygenase activity (GO:0048244)	p.K120K(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	25		Ovarian(717;0.0448)			Antihemophilic Factor(DB00025)|Vitamin C(DB00126)	AATCCTGGACCTTCGTGATCA	0.458																																					p.K20K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G60A	10						.						156.0	126.0	136.0					10																	13336482		2203	4300	6503	13376488	SO:0001819	synonymous_variant	5264	exon3				CCDS7097.1, CCDS41489.1	10p13	2010-04-27	2006-01-09		ENSG00000107537	ENSG00000107537	1.14.11.18		8940	protein-coding gene	gene with protein product	"""Refsum disease"", ""phytanoyl-CoA dioxygenase"""	602026	"""phytanoyl-CoA hydroxylase (Refsum disease)"", ""phytanoyl-CoA hydroxylase"""			9326939	Standard	XM_005252469		Approved	PAHX, RD, PHYH1	uc001imf.3	O14832	OTTHUMG00000017693	ENST00000263038.4:c.360G>A	10.37:g.13336482C>T		Somatic		Capture	SOLID	Phase_I	13376488	NM_001037537	A8MTS8|B1ALH5	Silent	SNP	ENST00000263038.4	37	CCDS7097.1																																																																																				PHYH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046845.2		
MKI67	4288	hgsc.bcm.edu	37	10	129913269	129913269	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:129913269C>T	ENST00000368654.3	-	7	1778	c.1403G>A	c.(1402-1404)gGc>gAc	p.G468D	MKI67_ENST00000484853.1_5'Flank|MKI67_ENST00000368653.3_Intron	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	468					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.G468D(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				AGCTGTAGTGCCCAATTTCTC	0.398																																					p.G468D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1403A	10						.						146.0	144.0	144.0					10																	129913269		2203	4300	6503	129803259	SO:0001583	missense	4288	exon7			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.1403G>A	10.37:g.129913269C>T	ENSP00000357643:p.Gly468Asp	Somatic		Capture	SOLID	Phase_I	129803259	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	C	9.274	1.046505	0.19748	.	.	ENSG00000148773	ENST00000368654;ENST00000537609	T	0.02032	4.49	4.0	-3.62	0.04543	.	0.709283	0.12901	N	0.429824	T	0.01800	0.0057	L	0.29908	0.895	0.09310	N	1	B	0.13145	0.007	B	0.15052	0.012	T	0.39251	-0.9623	10	0.87932	D	0	.	6.0959	0.20021	0.0:0.4462:0.2131:0.3406	.	468	P46013	KI67_HUMAN	D	468	ENSP00000357643:G468D	ENSP00000357643:G468D	G	-	2	0	MKI67	129803259	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	0.003000	0.13083	-1.291000	0.02368	-0.797000	0.03246	GGC		MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
TUBGCP2	10844	hgsc.bcm.edu	37	10	135112977	135112977	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:135112977A>G	ENST00000252936.3	-	3	449	c.410T>C	c.(409-411)cTg>cCg	p.L137P	TUBGCP2_ENST00000368563.2_Missense_Mutation_p.L137P|TUBGCP2_ENST00000470829.1_5'UTR|TUBGCP2_ENST00000543663.1_Missense_Mutation_p.L137P|TUBGCP2_ENST00000417178.2_Missense_Mutation_p.L7P			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	137					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)		p.L137P(1)		breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		CTGCTTCCTCAGTTCCTCAAG	0.627																																					p.L137P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T410C	10						.						65.0	55.0	58.0					10																	135112977		2203	4300	6503	134962967	SO:0001583	missense	10844	exon4			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.410T>C	10.37:g.135112977A>G	ENSP00000252936:p.Leu137Pro	Somatic		Capture	SOLID	Phase_I	134962967	NM_006659	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	ENST00000252936.3	37	CCDS7676.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.810228	0.90707	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000543663	T;T;T;T	0.40476	2.24;1.73;2.24;1.03	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.60612	0.2282	M	0.64404	1.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.996;1.0	T	0.57997	-0.7714	10	0.33141	T	0.24	-18.8358	14.6016	0.68445	1.0:0.0:0.0:0.0	.	137;137;137	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	P	137;7;137;137	ENSP00000252936:L137P;ENSP00000395666:L7P;ENSP00000357551:L137P;ENSP00000446093:L137P	ENSP00000252936:L137P	L	-	2	0	TUBGCP2	134962967	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.956000	0.93066	2.192000	0.70111	0.533000	0.62120	CTG		TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1		
PRKCQ	5588	hgsc.bcm.edu	37	10	6527141	6527141	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:6527141G>A	ENST00000263125.5	-	10	1090	c.991C>T	c.(991-993)Cca>Tca	p.P331S	PRKCQ_ENST00000397176.2_Missense_Mutation_p.P331S|PRKCQ_ENST00000539722.1_Missense_Mutation_p.P206S	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	331					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)	p.P331S(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	GGTAAACATGGCGGCCTTGCT	0.463																																					p.P331S	Ovarian(50;572 1126 10530 25349 30594)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C991T	10						.						181.0	175.0	177.0					10																	6527141		2203	4300	6503	6567147	SO:0001583	missense	5588	exon10			L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.991C>T	10.37:g.6527141G>A	ENSP00000263125:p.Pro331Ser	Somatic		Capture	SOLID	Phase_I	6567147	NM_006257	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	ENST00000263125.5	37	CCDS7079.1	.	.	.	.	.	.	.	.	.	.	.	6.958	0.546641	0.13312	.	.	ENSG00000065675	ENST00000263125;ENST00000397176;ENST00000539722	T;T;T	0.68479	-0.33;-0.3;-0.33	5.22	5.22	0.72569	.	0.591053	0.19533	N	0.111992	T	0.52386	0.1731	L	0.32530	0.975	0.09310	N	1	B;B;B;B	0.18610	0.001;0.029;0.003;0.012	B;B;B;B	0.14023	0.002;0.01;0.008;0.01	T	0.29427	-1.0012	10	0.14252	T	0.57	.	11.7894	0.52061	0.0808:0.0:0.9192:0.0	.	206;103;331;331	B4DF52;Q5JUN8;Q04759-2;Q04759	.;.;.;KPCT_HUMAN	S	331;331;206	ENSP00000263125:P331S;ENSP00000380361:P331S;ENSP00000441752:P206S	ENSP00000263125:P331S	P	-	1	0	PRKCQ	6567147	0.998000	0.40836	0.046000	0.18839	0.002000	0.02628	6.125000	0.71627	2.595000	0.87683	0.655000	0.94253	CCA		PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257	
ST8SIA6	338596	hgsc.bcm.edu	37	10	17363016	17363016	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:17363016A>G	ENST00000377602.4	-	8	1132	c.1058T>C	c.(1057-1059)aTa>aCa	p.I353T		NM_001004470.1	NP_001004470.1	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6	353					carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycolipid biosynthetic process (GO:0009247)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked glycosylation (GO:0006493)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)	p.I353T(1)		endometrium(3)|kidney(3)|large_intestine(4)|liver(1)|lung(24)|ovary(1)|skin(1)	37						GCTGACAGGTATGTCTTCTAC	0.438																																					p.I353T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1058C	10						.						227.0	213.0	218.0					10																	17363016		2203	4300	6503	17403022	SO:0001583	missense	338596	exon8				CCDS31158.1	10p13	2013-03-01	2005-02-07	2005-02-07	ENSG00000148488	ENSG00000148488		"""Sialyltransferases"""	23317	protein-coding gene	gene with protein product	"""ST8Sia VI"""	610139	"""sialyltransferase 8F (alpha-2, 8-sialyltransferase)"""	SIAT8F		11980897	Standard	XR_242697		Approved		uc001ipd.3	P61647	OTTHUMG00000017748	ENST00000377602.4:c.1058T>C	10.37:g.17363016A>G	ENSP00000366827:p.Ile353Thr	Somatic		Capture	SOLID	Phase_I	17403022	NM_001004470	B0YJ97|B9EH72|Q5VZH4	Missense_Mutation	SNP	ENST00000377602.4	37	CCDS31158.1	.	.	.	.	.	.	.	.	.	.	a	0.015	-1.550401	0.00926	.	.	ENSG00000148488	ENST00000377602	T	0.28069	1.63	5.48	-7.65	0.01281	.	1.292700	0.04488	N	0.378925	T	0.07143	0.0181	N	0.00648	-1.295	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31833	-0.9929	10	0.07990	T	0.79	-15.7808	7.8668	0.29541	0.535:0.0:0.1729:0.2921	.	353	P61647	SIA8F_HUMAN	T	353	ENSP00000366827:I353T	ENSP00000366827:I353T	I	-	2	0	ST8SIA6	17403022	0.000000	0.05858	0.000000	0.03702	0.395000	0.30598	-0.436000	0.06922	-1.411000	0.02032	-0.785000	0.03343	ATA		ST8SIA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047036.1	NM_001004470	
ACBD5	91452	hgsc.bcm.edu	37	10	27497275	27497275	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:27497275C>T	ENST00000375888.1	-	10	1395	c.1331G>A	c.(1330-1332)aGc>aAc	p.S444N	ACBD5_ENST00000375901.1_Missense_Mutation_p.S326N|ACBD5_ENST00000375897.3_Missense_Mutation_p.S258N|ACBD5_ENST00000476758.1_5'UTR|ACBD5_ENST00000396271.3_Missense_Mutation_p.S435N|ACBD5_ENST00000375905.4_Missense_Mutation_p.S400N			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5	444					peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)	p.S400N(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						CTCATTGAGGCTGCCTCGGGA	0.587																																					p.S435N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1304A	10						.						106.0	97.0	100.0					10																	27497275		2203	4300	6503	27537281	SO:0001583	missense	91452	exon10			AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.1331G>A	10.37:g.27497275C>T	ENSP00000365049:p.Ser444Asn	Somatic		Capture	SOLID	Phase_I	27537281	NM_145698	B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Missense_Mutation	SNP	ENST00000375888.1	37		.	.	.	.	.	.	.	.	.	.	C	15.00	2.703892	0.48412	.	.	ENSG00000107897	ENST00000375889;ENST00000396271;ENST00000375905;ENST00000375901;ENST00000375897;ENST00000375888	T;T;T;T;T	0.32988	2.43;2.18;1.43;1.44;2.45	5.63	4.72	0.59763	.	0.108033	0.85682	D	0.000000	T	0.31199	0.0789	L	0.55990	1.75	0.43628	D	0.996013	P;B;B;B	0.45176	0.852;0.2;0.055;0.055	B;B;B;B	0.38755	0.281;0.077;0.015;0.026	T	0.10753	-1.0616	10	0.40728	T	0.16	-7.0163	16.9201	0.86162	0.0:0.8718:0.1282:0.0	.	435;258;433;444	Q5T8D3-3;B7Z2A7;B7Z2R7;Q5T8D3	.;.;.;ACBD5_HUMAN	N	441;435;400;326;258;444	ENSP00000379568:S435N;ENSP00000365070:S400N;ENSP00000365066:S326N;ENSP00000365062:S258N;ENSP00000365049:S444N	ENSP00000365049:S444N	S	-	2	0	ACBD5	27537281	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	1.605000	0.36815	1.497000	0.48584	0.585000	0.79938	AGC		ACBD5-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000047314.1	NM_145698	
CCDC7	79741	hgsc.bcm.edu	37	10	32806901	32806901	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:32806901G>A	ENST00000362006.5	+	11	1444	c.901G>A	c.(901-903)Gct>Act	p.A301T	CCDC7_ENST00000539197.1_3'UTR|CCDC7_ENST00000535327.1_3'UTR|CCDC7_ENST00000277657.6_Missense_Mutation_p.A301T|CCDC7_ENST00000537047.1_3'UTR	NM_145023.4	NP_659460.3	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7	301								p.A301T(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)	14		Breast(68;0.000207)|Prostate(175;0.0107)				TTTGTTAGATGCTGTAAGTAT	0.264																																					p.A301T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G901A	10						.						119.0	120.0	120.0					10																	32806901		2203	4291	6494	32846907	SO:0001583	missense	221016	exon11			BC022020	CCDS7173.1	10p11.23	2013-12-13			ENSG00000216937	ENSG00000216937			26533	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 68"""	C10orf68		12477932	Standard	NM_024688		Approved	FLJ32762, FLJ13031	uc001iwk.3	Q96M83	OTTHUMG00000150517	ENST00000362006.5:c.901G>A	10.37:g.32806901G>A	ENSP00000355078:p.Ala301Thr	Somatic		Capture	SOLID	Phase_I	32846907	NM_145023	Q5VW55|Q8IVQ0|Q8NEQ0	Missense_Mutation	SNP	ENST00000362006.5	37	CCDS7173.1	.	.	.	.	.	.	.	.	.	.	G	9.177	1.022567	0.19433	.	.	ENSG00000216937	ENST00000277657;ENST00000362006	T;T	0.32753	1.44;1.44	4.7	1.35	0.21983	.	.	.	.	.	T	0.16854	0.0405	L	0.32530	0.975	0.80722	D	1	P	0.40332	0.713	B	0.36464	0.225	T	0.09079	-1.0691	9	0.24483	T	0.36	-21.9551	3.4922	0.07642	0.2614:0.0:0.5487:0.1899	.	301	Q96M83	CCDC7_HUMAN	T	301	ENSP00000277657:A301T;ENSP00000355078:A301T	ENSP00000277657:A301T	A	+	1	0	CCDC7	32846907	0.942000	0.31987	0.741000	0.31004	0.110000	0.19582	0.094000	0.15107	0.133000	0.18654	0.637000	0.83480	GCT		CCDC7-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047490.1	NM_145023	
ZNF32	7580	hgsc.bcm.edu	37	10	44140122	44140122	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:44140122C>A	ENST00000395797.1	-	3	386	c.198G>T	c.(196-198)caG>caT	p.Q66H	ZNF32_ENST00000485351.1_5'UTR|ZNF32_ENST00000374433.2_Missense_Mutation_p.Q66H|ZNF32-AS3_ENST00000458063.1_RNA|ZNF32-AS1_ENST00000453284.1_RNA|ZNF32-AS2_ENST00000418966.1_RNA	NM_001005368.1	NP_001005368.1	P17041	ZNF32_HUMAN	zinc finger protein 32	66					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q66H(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	14		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)		Lung(62;0.179)		GTGAATCTTCCTGTAGTGTCT	0.453																																					p.Q66H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G198T	10						.						132.0	133.0	132.0					10																	44140122		2203	4300	6503	43460128	SO:0001583	missense	7580	exon3			U69645	CCDS7206.1	10q22-q25	2013-01-08	2006-05-11		ENSG00000169740	ENSG00000169740		"""Zinc fingers, C2H2-type"""	13095	protein-coding gene	gene with protein product		194539	"""zinc finger protein 32 (KOX 30)"""				Standard	XM_005271822		Approved	KOX30	uc001jbc.3	P17041	OTTHUMG00000018043	ENST00000395797.1:c.198G>T	10.37:g.44140122C>A	ENSP00000379143:p.Gln66His	Somatic		Capture	SOLID	Phase_I	43460128	NM_006973	Q92951	Missense_Mutation	SNP	ENST00000395797.1	37	CCDS7206.1	.	.	.	.	.	.	.	.	.	.	C	10.78	1.447615	0.26074	.	.	ENSG00000169740	ENST00000374433;ENST00000395797	T;T	0.07908	3.15;3.15	4.52	1.57	0.23409	.	0.174724	0.27886	N	0.017448	T	0.03739	0.0106	N	0.08118	0	0.33287	D	0.563028	B	0.02656	0.0	B	0.01281	0.0	T	0.17379	-1.0371	10	0.49607	T	0.09	-0.2957	5.3203	0.15878	0.408:0.4932:0.0:0.0988	.	66	P17041	ZNF32_HUMAN	H	66	ENSP00000363556:Q66H;ENSP00000379143:Q66H	ENSP00000363556:Q66H	Q	-	3	2	ZNF32	43460128	0.000000	0.05858	0.978000	0.43139	0.739000	0.42172	-0.599000	0.05700	0.357000	0.24183	0.655000	0.94253	CAG		ZNF32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047723.1	NM_006973	
FRMPD2	143162	hgsc.bcm.edu	37	10	49400806	49400806	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:49400806C>A	ENST00000374201.3	-	16	2388	c.2086G>T	c.(2086-2088)Gga>Tga	p.G696*	FRMPD2_ENST00000407470.4_Nonsense_Mutation_p.G664*|FRMPD2_ENST00000305531.3_Nonsense_Mutation_p.G671*	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	696					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)	p.G696*(1)		NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		AGCAGGCCTCCTGCAGCACCC	0.537																																					p.G696X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2086T	10						.						100.0	80.0	87.0					10																	49400806		2203	4300	6503	49070812	SO:0001587	stop_gained	143162	exon16			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2086G>T	10.37:g.49400806C>A	ENSP00000363317:p.Gly696*	Somatic		Capture	SOLID	Phase_I	49070812	NM_001018071	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Nonsense_Mutation	SNP	ENST00000374201.3	37	CCDS31195.1	.	.	.	.	.	.	.	.	.	.	C	39	7.560514	0.98358	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	.	.	.	4.86	3.01	0.34805	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	8.8081	0.34950	0.0:0.8249:0.0:0.1751	.	.	.	.	X	696;671;664	.	ENSP00000307079:G671X	G	-	1	0	FRMPD2	49070812	0.095000	0.21747	0.145000	0.22337	0.015000	0.08874	3.044000	0.49830	0.582000	0.29556	0.655000	0.94253	GGA		FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428	
CSTF2T	23283	hgsc.bcm.edu	37	10	53457653	53457653	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:53457653T>C	ENST00000331173.4	-	1	1702	c.1657A>G	c.(1657-1659)Aag>Gag	p.K553E	PRKG1_ENST00000373985.1_Intron|PRKG1_ENST00000401604.2_Intron|PRKG1_ENST00000373980.4_Intron	NM_015235.2	NP_056050.1	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant	553	Gly-rich.			K -> R (in Ref. 6; AAH28239). {ECO:0000305}.	mRNA processing (GO:0006397)	intracellular (GO:0005622)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.K553E(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		ccaccttgcttgcttgccccc	0.542																																					p.K553E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1657G	10						.						170.0	122.0	138.0					10																	53457653		2203	4300	6503	53127659	SO:0001583	missense	23283	exon1			AB014589	CCDS7245.1	10q11	2013-02-12			ENSG00000177613	ENSG00000177613		"""RNA binding motif (RRM) containing"""	17086	protein-coding gene	gene with protein product		611968				12408968, 11113135	Standard	NM_015235		Approved	DKFZp434C1013, KIAA0689, CstF-64T	uc001jjp.3	Q9H0L4	OTTHUMG00000018246	ENST00000331173.4:c.1657A>G	10.37:g.53457653T>C	ENSP00000332444:p.Lys553Glu	Somatic		Capture	SOLID	Phase_I	53127659	NM_015235	B2RAR9|O75174|Q53HK6|Q7LGE8|Q8N6T1	Missense_Mutation	SNP	ENST00000331173.4	37	CCDS7245.1	.	.	.	.	.	.	.	.	.	.	T	7.588	0.670089	0.14776	.	.	ENSG00000177613	ENST00000331173	T	0.20463	2.07	4.12	4.12	0.48240	.	0.717261	0.13259	N	0.401395	T	0.09642	0.0237	N	0.08118	0	0.25356	N	0.988823	B	0.15930	0.015	B	0.14023	0.01	T	0.16689	-1.0394	10	0.02654	T	1	-21.5917	11.7471	0.51825	0.0:0.0:0.0:1.0	.	553	Q9H0L4	CSTFT_HUMAN	E	553	ENSP00000332444:K553E	ENSP00000332444:K553E	K	-	1	0	CSTF2T	53127659	0.921000	0.31238	0.997000	0.53966	0.623000	0.37688	2.924000	0.48876	2.102000	0.63906	0.533000	0.62120	AAG		CSTF2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048097.1	NM_015235	
LRRTM3	347731	hgsc.bcm.edu	37	10	68687228	68687228	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:68687228T>C	ENST00000361320.4	+	2	1132	c.554T>C	c.(553-555)cTt>cCt	p.L185P	CTNNA3_ENST00000373744.4_Intron|CTNNA3_ENST00000433211.2_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	185					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.L185P(2)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						AACCTGGAACTTTTGGACCTG	0.483																																					p.L185P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T554C	10						.						75.0	80.0	78.0					10																	68687228		2203	4300	6503	68357234	SO:0001583	missense	347731	exon2			BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.554T>C	10.37:g.68687228T>C	ENSP00000355187:p.Leu185Pro	Somatic		Capture	SOLID	Phase_I	68357234	NM_178011	A8K2A3|Q2NKX7|Q6N0A3	Missense_Mutation	SNP	ENST00000361320.4	37	CCDS7270.1	.	.	.	.	.	.	.	.	.	.	T	14.91	2.677737	0.47886	.	.	ENSG00000198739	ENST00000361320;ENST00000373722	T	0.58060	0.36	5.42	5.42	0.78866	.	0.000000	0.53938	D	0.000043	T	0.66268	0.2772	M	0.75150	2.29	0.80722	D	1	D;P	0.55385	0.971;0.94	P;P	0.56163	0.793;0.689	T	0.67086	-0.5759	10	0.37606	T	0.19	.	14.4454	0.67345	0.0:0.0:0.0:1.0	.	185;185	Q86VH5;Q86VH5-2	LRRT3_HUMAN;.	P	185	ENSP00000355187:L185P	ENSP00000355187:L185P	L	+	2	0	LRRTM3	68357234	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.053000	0.61076	0.528000	0.53228	CTT		LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048277.2	NM_178011	
HK1	3098	hgsc.bcm.edu	37	10	71103654	71103654	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:71103654G>T	ENST00000359426.6	+	2	239	c.135G>T	c.(133-135)aaG>aaT	p.K45N	HK1_ENST00000360289.2_Missense_Mutation_p.K33N|HK1_ENST00000404387.2_Missense_Mutation_p.K49N|HK1_ENST00000494253.1_3'UTR|HK1_ENST00000298649.3_Missense_Mutation_p.K44N|HK1_ENST00000448642.2_Missense_Mutation_p.K80N	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	45	Hexokinase type-1 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)	p.K49N(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						GCTTCAGGAAGGAGATGAAGA	0.483																																					p.K49N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G147T	10						.						128.0	121.0	124.0					10																	71103654		2203	4300	6503	70773660	SO:0001583	missense	3098	exon5			M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.135G>T	10.37:g.71103654G>T	ENSP00000352398:p.Lys45Asn	Somatic		Capture	SOLID	Phase_I	70773660	NM_033498	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	37	CCDS7292.1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.926985	0.34002	.	.	ENSG00000156515	ENST00000450646;ENST00000360289;ENST00000448642;ENST00000421088;ENST00000404387;ENST00000436817;ENST00000298649;ENST00000359426;ENST00000405407	T;T;T;T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48;0.48;0.48;0.48	5.31	-0.576	0.11731	Hexokinase, N-terminal (1);	0.450948	0.26166	N	0.025946	T	0.30198	0.0757	N	0.25060	0.705	0.44918	D	0.997937	B;B;B;B;B	0.15719	0.0;0.001;0.003;0.0;0.014	B;B;B;B;B	0.16722	0.006;0.003;0.016;0.002;0.005	T	0.02736	-1.1117	10	0.31617	T	0.26	-2.4038	4.614	0.12417	0.3568:0.0:0.4024:0.2407	.	45;44;80;49;33	P19367;P19367-2;E7ENR4;P19367-3;P19367-4	HXK1_HUMAN;.;.;.;.	N	49;33;80;33;49;44;44;45;45	ENSP00000409761:K49N;ENSP00000353433:K33N;ENSP00000402103:K80N;ENSP00000398316:K33N;ENSP00000384774:K49N;ENSP00000415949:K44N;ENSP00000298649:K44N;ENSP00000352398:K45N	ENSP00000298649:K44N	K	+	3	2	HK1	70773660	0.950000	0.32346	0.945000	0.38365	0.695000	0.40330	0.349000	0.20055	-0.013000	0.14199	-0.182000	0.12963	AAG		HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188	
KAT6B	23522	hgsc.bcm.edu	37	10	76788806	76788806	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:76788806C>T	ENST00000287239.4	+	18	4713	c.4224C>T	c.(4222-4224)caC>caT	p.H1408H	KAT6B_ENST00000372725.1_Silent_p.H1116H|KAT6B_ENST00000372711.1_Silent_p.H1225H|KAT6B_ENST00000372714.1_Silent_p.H1116H|KAT6B_ENST00000372724.1_Silent_p.H1116H	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1408					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.H1408H(1)									TGGATGATCACGAAGAGGAGG	0.488																																					p.H1408H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4224T	10						.						88.0	89.0	89.0					10																	76788806		2203	4300	6503	76458812	SO:0001819	synonymous_variant	23522	exon18			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.4224C>T	10.37:g.76788806C>T		Somatic		Capture	SOLID	Phase_I	76458812	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Silent	SNP	ENST00000287239.4	37	CCDS7345.1																																																																																				KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
KCNMA1	3778	hgsc.bcm.edu	37	10	78832866	78832866	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:78832866A>G	ENST00000286628.8	-	14	1737	c.1738T>C	c.(1738-1740)Tca>Cca	p.S580P	KCNMA1_ENST00000286627.5_Missense_Mutation_p.S580P|KCNMA1_ENST00000372443.1_Missense_Mutation_p.S580P|KCNMA1_ENST00000484507.1_5'UTR|KCNMA1_ENST00000404857.1_Missense_Mutation_p.S580P|KCNMA1_ENST00000404771.3_Missense_Mutation_p.S580P|KCNMA1_ENST00000406533.3_Missense_Mutation_p.S580P|KCNMA1_ENST00000354353.5_Missense_Mutation_p.S580P|KCNMA1_ENST00000372440.1_Missense_Mutation_p.S580P	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	580					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.S580P(1)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	TTTATGAATGACCTCATGGAG	0.493																																					p.S580P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1738C	10						.						105.0	86.0	93.0					10																	78832866		2203	4300	6503	78502872	SO:0001583	missense	3778	exon14			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.1738T>C	10.37:g.78832866A>G	ENSP00000286628:p.Ser580Pro	Somatic		Capture	SOLID	Phase_I	78502872	NM_001161353	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	ENST00000286628.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.68|16.68	3.190390|3.190390	0.58017|0.58017	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708|ENST00000372421;ENST00000434208;ENST00000450795	T;T;T;T;T;T;T;T;T|.	0.47869|.	0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83|.	5.87|5.87	5.87|5.87	0.94306|0.94306	Potassium channel, calcium-activated, BK, alpha subunit (1);|.	0.126682|.	0.56097|.	D|.	0.000037|.	T|T	0.75752|0.75752	0.3892|0.3892	M|M	0.75615|0.75615	2.305|2.305	0.80722|0.80722	D|D	1|1	D;P;B;D;D;D;D;D|.	0.89917|.	0.999;0.61;0.002;1.0;0.985;0.997;0.997;0.988|.	D;B;B;D;P;D;P;P|.	0.79108|.	0.933;0.409;0.011;0.992;0.812;0.969;0.889;0.903|.	T|T	0.75994|0.75994	-0.3121|-0.3121	10|5	0.87932|.	D|.	0|.	-7.0872|-7.0872	16.2806|16.2806	0.82678|0.82678	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	580;580;580;580;580;362;580;580|.	Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;F8WA96;Q5SVJ7|.	.;.;.;KCMA1_HUMAN;.;.;.;.|.	P|A	580;517;515;554;517;580;580;554;580;580;580;362|568;258;72	ENSP00000361517:S580P;ENSP00000361485:S517P;ENSP00000361514:S515P;ENSP00000396608:S554P;ENSP00000361520:S580P;ENSP00000286627:S580P;ENSP00000385552:S580P;ENSP00000346321:S580P;ENSP00000385806:S580P|.	ENSP00000286627:S580P|.	S|V	-|-	1|2	0|0	KCNMA1|KCNMA1	78502872|78502872	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.339000|9.339000	0.96797|0.96797	2.248000|2.248000	0.74166|0.74166	0.533000|0.533000	0.62120|0.62120	TCA|GTC		KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
CCSER2	54462	hgsc.bcm.edu	37	10	86185539	86185539	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:86185539G>A	ENST00000224756.8	+	5	1943	c.1758G>A	c.(1756-1758)caG>caA	p.Q586Q	CCSER2_ENST00000372088.2_Silent_p.Q586Q|CCSER2_ENST00000543283.1_Silent_p.Q13Q|CCSER2_ENST00000494144.1_3'UTR	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2	586					microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)		p.Q586Q(1)									ATGTTCGGCAGCCTCAGGAAG	0.468																																					p.Q586Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1758A	10						.						101.0	91.0	94.0					10																	86185539		2203	4300	6503	86175519	SO:0001819	synonymous_variant	54462	exon5				CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.1758G>A	10.37:g.86185539G>A		Somatic		Capture	SOLID	Phase_I	86175519	NM_018999	B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	Silent	SNP	ENST00000224756.8	37	CCDS31235.1																																																																																				CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049132.2	NM_018999	
HECTD2	143279	hgsc.bcm.edu	37	10	93272103	93272103	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:93272103A>G	ENST00000298068.5	+	21	2387	c.2293A>G	c.(2293-2295)Att>Gtt	p.I765V	HECTD2_ENST00000536715.1_Missense_Mutation_p.I354V|HECTD2_ENST00000446394.1_Missense_Mutation_p.I769V|HECTD2_ENST00000371667.1_Missense_Mutation_p.I415V	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	765	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.I765V(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						GAAATTGATCATTGGAATTTC	0.368																																					p.I765V	NSCLC(12;376 469 1699 39910 41417)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2293G	10						.						108.0	119.0	115.0					10																	93272103		2203	4300	6503	93262083	SO:0001583	missense	143279	exon21			AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.2293A>G	10.37:g.93272103A>G	ENSP00000298068:p.Ile765Val	Somatic		Capture	SOLID	Phase_I	93262083	NM_182765	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Missense_Mutation	SNP	ENST00000298068.5	37	CCDS7414.1	.	.	.	.	.	.	.	.	.	.	A	14.06	2.423716	0.43020	.	.	ENSG00000165338	ENST00000446394;ENST00000298068;ENST00000536715;ENST00000371667	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	5.62	5.62	0.85841	HECT (4);	0.000000	0.85682	D	0.000000	T	0.63663	0.2530	L	0.50333	1.59	0.58432	D	0.99999	B;D	0.61697	0.27;0.99	B;P	0.60473	0.18;0.875	T	0.60642	-0.7223	10	0.31617	T	0.26	.	15.8239	0.78683	1.0:0.0:0.0:0.0	.	769;765	E7ERR3;Q5U5R9	.;HECD2_HUMAN	V	769;765;354;415	ENSP00000401023:I769V;ENSP00000298068:I765V;ENSP00000439687:I354V;ENSP00000360731:I415V	ENSP00000298068:I765V	I	+	1	0	HECTD2	93262083	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.019000	0.88732	2.134000	0.65973	0.455000	0.32223	ATT		HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098620.1		
ALDH18A1	5832	hgsc.bcm.edu	37	10	97376279	97376279	+	Silent	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:97376279G>T	ENST00000371224.2	-	13	1697	c.1560C>A	c.(1558-1560)acC>acA	p.T520T	ALDH18A1_ENST00000371221.3_Silent_p.T518T	NM_002860.3	NP_002851.2	P54886	P5CS_HUMAN	aldehyde dehydrogenase 18 family, member A1	520	Gamma-glutamyl phosphate reductase.				cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|glutamate metabolic process (GO:0006536)|L-proline biosynthetic process (GO:0055129)|ornithine biosynthetic process (GO:0006592)|proline biosynthetic process (GO:0006561)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate 5-kinase activity (GO:0004349)|glutamate-5-semialdehyde dehydrogenase activity (GO:0004350)|poly(A) RNA binding (GO:0044822)	p.T520T(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(9)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)		GAGCCTCCTGGGTCAGGAGGT	0.572																																					p.T518T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1554A	10						.						73.0	55.0	61.0					10																	97376279		2203	4299	6502	97366269	SO:0001819	synonymous_variant	5832	exon13			X94453	CCDS7443.1, CCDS31257.1	10q24.3-q24.6	2004-08-12	2004-08-12	2004-08-12	ENSG00000059573	ENSG00000059573		"""Aldehyde dehydrogenases"""	9722	protein-coding gene	gene with protein product		138250	"""pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase)"""	GSAS, PYCS		8921385	Standard	XM_006717933		Approved	P5CS	uc001kkz.3	P54886	OTTHUMG00000018815	ENST00000371224.2:c.1560C>A	10.37:g.97376279G>T		Somatic		Capture	SOLID	Phase_I	97366269	NM_001017423	B2R5Q4|B7Z350|B7Z5X8|B7ZLP1|D3DR44|O95952|Q3KQU2|Q5T566|Q5T567|Q9UM72	Silent	SNP	ENST00000371224.2	37	CCDS7443.1																																																																																				ALDH18A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049552.1	NM_002860	
TLL2	7093	hgsc.bcm.edu	37	10	98145872	98145872	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:98145872C>T	ENST00000357947.3	-	15	2178	c.1953G>A	c.(1951-1953)gtG>gtA	p.V651V		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	651	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V651V(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GAGCGGGGGCCACCACCTGCC	0.517																																					p.V651V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1953A	10						.						108.0	103.0	105.0					10																	98145872		2203	4300	6503	98135862	SO:0001819	synonymous_variant	7093	exon15			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1953G>A	10.37:g.98145872C>T		Somatic		Capture	SOLID	Phase_I	98135862	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Silent	SNP	ENST00000357947.3	37	CCDS7449.1																																																																																				TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
ARHGAP19	84986	hgsc.bcm.edu	37	10	99003824	99003824	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:99003824C>T	ENST00000358531.4	-	8	1114	c.1086G>A	c.(1084-1086)caG>caA	p.Q362Q	ARHGAP19_ENST00000487035.1_5'UTR|ARHGAP19-SLIT1_ENST00000358308.3_Silent_p.Q333Q|ARHGAP19-SLIT1_ENST00000316676.8_Silent_p.Q362Q|ARHGAP19_ENST00000355366.5_Silent_p.Q353Q|ARHGAP19_ENST00000371027.1_Silent_p.Q353Q|ARHGAP19-SLIT1_ENST00000453547.2_Silent_p.Q362Q	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19	362					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.Q362Q(1)|p.Q181Q(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		GGGTCTCCTCCTGGTGAGGGC	0.478																																					p.Q362Q												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1086A	10						.						135.0	125.0	128.0					10																	99003824		2203	4300	6503	98993814	SO:0001819	synonymous_variant	84986	exon8			AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.1086G>A	10.37:g.99003824C>T		Somatic		Capture	SOLID	Phase_I	98993814	NM_032900	A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	Silent	SNP	ENST00000358531.4	37	CCDS7454.2																																																																																				ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049647.2	NM_032900	
MTG1	92170	hgsc.bcm.edu	37	10	135233540	135233540	+	Silent	SNP	C	C	T	rs563010493		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr10:135233540C>T	ENST00000317502.6	+	11	926	c.876C>T	c.(874-876)aaC>aaT	p.N292N	RP11-108K14.8_ENST00000468317.2_Silent_p.N297N|MTG1_ENST00000477902.2_Silent_p.N251N	NM_138384.2	NP_612393.2	Q9BT17	MTG1_HUMAN	mitochondrial ribosome-associated GTPase 1	292					GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)		GTAACGTGAACATTATTCAGC	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		1278	0.0		0.0	False		,,,				2504	0.0				p.N292N												.	.	0			c.C876T	10						.						119.0	89.0	99.0					10																	135233540		2203	4300	6503	135083530	SO:0001819	synonymous_variant	92170	exon11				CCDS31320.1	10q26.3	2013-05-24	2013-05-24	2006-01-09	ENSG00000148824	ENSG00000148824			32159	protein-coding gene	gene with protein product			"""GTP-binding protein 7"", ""GTP-binding protein 7 (putative)"", ""mitochondrial GTPase 1 homolog (S. cerevisiae)"""	GTPBP7		12808030, 23396448	Standard	NM_138384		Approved		uc001lnd.3	Q9BT17	OTTHUMG00000166564	ENST00000317502.6:c.876C>T	10.37:g.135233540C>T		Somatic		Capture	SOLID	Phase_I	135083530	NM_138384	Q5VWX8|Q6PIY9|Q8IYJ4|Q8NC48|Q9BVU8	Silent	SNP	ENST00000317502.6	37	CCDS31320.1																																																																																				MTG1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051166.1	NM_138384	
PAM	5066	hgsc.bcm.edu	37	5	102364672	102364672	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:102364672G>T	ENST00000438793.3	+	25	3295	c.2825G>T	c.(2824-2826)aGc>aTc	p.S942I	PAM_ENST00000346918.2_Missense_Mutation_p.S856I|PAM_ENST00000304400.7_Missense_Mutation_p.S943I|PAM_ENST00000348126.2_Missense_Mutation_p.S835I|PAM_ENST00000455264.2_Missense_Mutation_p.S874I|PAM_ENST00000274392.9_Missense_Mutation_p.S844I|PAM_ENST00000379787.4_Missense_Mutation_p.S304I	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	942	Interaction with RASSF9. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)	p.S943I(1)|p.S874I(1)		endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	GACCGGCTTAGCACTGAGGGC	0.478																																					p.S856I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2567T	5						.						131.0	121.0	125.0					5																	102364672		2203	4300	6503	102392571	SO:0001583	missense	5066	exon23			AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.2825G>T	5.37:g.102364672G>T	ENSP00000396493:p.Ser942Ile	Somatic		Capture	SOLID	Phase_I	102392571	NM_138822	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	ENST00000438793.3	37	CCDS54885.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	25.8|25.8|25.8	4.671387|4.671387|4.671387	0.88348|0.88348|0.88348	.|.|.	.|.|.	ENSG00000145730|ENSG00000145730|ENSG00000145730	ENST00000504691|ENST00000438793;ENST00000346918;ENST00000348126;ENST00000379787;ENST00000304400;ENST00000274392;ENST00000455264|ENST00000379799	.|T;T;T;T;T;T;T|.	.|0.70282|.	.|0.61;0.35;0.47;0.08;0.41;-0.47;0.03|.	6.03|6.03|6.03	6.03|6.03|6.03	0.97812|0.97812|0.97812	.|.|.	.|0.036490|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|.	0.66005|0.66005|.	0.2746|0.2746|.	L|L|L	0.34521|0.34521|0.34521	1.04|1.04|1.04	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D;D;D;D;D;D|.	.|0.89917|.	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	.|D;D;D;D;D;D;D|.	.|0.91635|.	.|0.999;0.998;0.999;0.997;0.997;0.999;0.992|.	T|T|.	0.58306|0.58306|.	-0.7659|-0.7659|.	5|10|.	.|0.87932|.	.|D|.	.|0|.	.|.|.	20.5568|20.5568|20.5568	0.99304|0.99304|0.99304	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|844;304;942;856;874;943;835|.	.|F8WE90;A6NMH0;P19021;P19021-4;P19021-3;P19021-5;P19021-2|.	.|.;.;AMD_HUMAN;.;.;.;.|.	S|I|Y	219|942;856;835;304;943;844;874|647	.|ENSP00000396493:S942I;ENSP00000282992:S856I;ENSP00000314638:S835I;ENSP00000369113:S304I;ENSP00000306100:S943I;ENSP00000274392:S844I;ENSP00000403461:S874I|.	.|ENSP00000274392:S844I|.	A|S|X	+|+|+	1|2|3	0|0|2	PAM|PAM|PAM	102392571|102392571|102392571	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.998000|0.998000|0.998000	0.56505|0.56505|0.56505	0.916000|0.916000|0.916000	0.54674|0.54674|0.54674	6.222000|6.222000|6.222000	0.72249|0.72249|0.72249	2.861000|2.861000|2.861000	0.98227|0.98227|0.98227	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GCA|AGC|TAG		PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
PPIP5K2	23262	hgsc.bcm.edu	37	5	102508914	102508914	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:102508914C>A	ENST00000358359.3	+	20	2851	c.2342C>A	c.(2341-2343)cCt>cAt	p.P781H	PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000321521.9_Missense_Mutation_p.P781H|PPIP5K2_ENST00000414217.1_Missense_Mutation_p.P781H	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	781					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)	p.P781H(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TACTGTACTCCTCTGGTTAGA	0.348																																					p.P781H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2342A	5						.						77.0	81.0	80.0					5																	102508914		2203	4300	6503	102536813	SO:0001583	missense	23262	exon19			AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.2342C>A	5.37:g.102508914C>A	ENSP00000351126:p.Pro781His	Somatic		Capture	SOLID	Phase_I	102536813	NM_015216	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	37		.	.	.	.	.	.	.	.	.	.	C	28.0	4.882890	0.91740	.	.	ENSG00000145725	ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217;ENST00000509597	T;T;T;T	0.34859	1.34;1.34;1.34;1.34	5.48	5.48	0.80851	.	0.000000	0.64402	D	0.000001	T	0.69797	0.3151	M	0.91140	3.18	0.80722	D	1	P;D;P	0.89917	0.931;1.0;0.754	P;D;P	0.77557	0.807;0.99;0.752	T	0.76974	-0.2760	10	0.72032	D	0.01	.	19.3591	0.94428	0.0:1.0:0.0:0.0	.	781;781;781	E9PGM8;O43314-2;O43314	.;.;VIP2_HUMAN	H	781;781;781;781;55	ENSP00000313070:P781H;ENSP00000351126:P781H;ENSP00000416016:P781H;ENSP00000424948:P55H	ENSP00000313070:P781H	P	+	2	0	PPIP5K2	102536813	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.734000	0.84928	2.572000	0.86782	0.650000	0.86243	CCT		PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216	
LVRN	206338	hgsc.bcm.edu	37	5	115350988	115350988	+	Silent	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:115350988C>T	ENST00000357872.4	+	17	2614	c.2490C>T	c.(2488-2490)ggC>ggT	p.G830G	AQPEP_ENST00000515454.1_3'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		830						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G830G(1)									TATGTTATGGCATTGCCTTGG	0.299																																					p.G830G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2490T	5						.						116.0	120.0	118.0					5																	115350988		2202	4300	6502	115378887	SO:0001819	synonymous_variant	206338	exon17																														ENST00000357872.4:c.2490C>T	5.37:g.115350988C>T		Somatic		Capture	SOLID	Phase_I	115378887	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Silent	SNP	ENST00000357872.4	37	CCDS4124.1																																																																																				AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
DMXL1	1657	hgsc.bcm.edu	37	5	118469319	118469319	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:118469319C>A	ENST00000311085.8	+	12	1780	c.1700C>A	c.(1699-1701)tCt>tAt	p.S567Y	DMXL1_ENST00000539542.1_Missense_Mutation_p.S567Y	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	567								p.S567Y(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		CAAAAACCTTCTGGCCTCACC	0.373																																					p.S567Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1700A	5						.						106.0	109.0	108.0					5																	118469319		2202	4300	6502	118497218	SO:0001583	missense	1657	exon12			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.1700C>A	5.37:g.118469319C>A	ENSP00000309690:p.Ser567Tyr	Somatic		Capture	SOLID	Phase_I	118497218	NM_005509		Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.601119	0.28534	.	.	ENSG00000172869	ENST00000503802;ENST00000311085;ENST00000539542	T;T;T	0.24151	1.87;2.85;2.84	5.43	4.5	0.54988	WD40 repeat-like-containing domain (1);	0.212753	0.49916	D	0.000139	T	0.27384	0.0672	L	0.39898	1.24	0.29356	N	0.865025	P;B	0.35050	0.482;0.35	B;B	0.39840	0.311;0.109	T	0.20405	-1.0276	10	0.56958	D	0.05	-11.7687	15.6189	0.76790	0.0:0.8624:0.1376:0.0	.	567;567	F5H269;Q9Y485	.;DMXL1_HUMAN	Y	567	ENSP00000427692:S567Y;ENSP00000309690:S567Y;ENSP00000439479:S567Y	ENSP00000309690:S567Y	S	+	2	0	DMXL1	118497218	0.033000	0.19621	0.977000	0.42913	0.977000	0.68977	3.009000	0.49552	2.562000	0.86427	0.591000	0.81541	TCT		DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
DMXL1	1657	hgsc.bcm.edu	37	5	118485815	118485815	+	Silent	SNP	G	G	A	rs147904610	byFrequency	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:118485815G>A	ENST00000311085.8	+	18	4373	c.4293G>A	c.(4291-4293)acG>acA	p.T1431T	DMXL1_ENST00000539542.1_Silent_p.T1431T	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1431								p.T1431T(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		ATGAGAGTACGTTAAGTAAAT	0.338													C|||	2	0.000399361	0.0	0.0014	5008	,	,		21135	0.0		0.001	False		,,,				2504	0.0				p.T1431T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4293A	5						.	C		0,4404		0,0,2202	77.0	77.0	77.0		4293	-0.7	0.3	5	dbSNP_134	77	20,8578		0,20,4279	no	coding-synonymous	DMXL1	NM_005509.4		0,20,6481	AA,AG,GG		0.2326,0.0,0.1538		1431/3028	118485815	20,12982	2202	4299	6501	118513714	SO:0001819	synonymous_variant	1657	exon18			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.4293G>A	5.37:g.118485815G>A		Somatic		Capture	SOLID	Phase_I	118513714	NM_005509		Silent	SNP	ENST00000311085.8	37	CCDS4125.1																																																																																				DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
MEGF10	84466	hgsc.bcm.edu	37	5	126776530	126776530	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:126776530C>T	ENST00000274473.6	+	19	2600	c.2333C>T	c.(2332-2334)aCt>aTt	p.T778I	MEGF10_ENST00000503335.2_Missense_Mutation_p.T778I	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	778	EGF-like 14. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.T778I(1)		breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		ACTTGCCGCACTGGATTCATG	0.473																																					p.T778I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2333T	5						.						148.0	133.0	138.0					5																	126776530		2203	4300	6503	126804429	SO:0001583	missense	84466	exon19			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.2333C>T	5.37:g.126776530C>T	ENSP00000274473:p.Thr778Ile	Somatic		Capture	SOLID	Phase_I	126804429	NM_032446	Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	37	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843250	0.71488	.	.	ENSG00000145794	ENST00000503335;ENST00000274473	T;T	0.15718	2.4;2.4	6.03	6.03	0.97812	EGF-like, laminin (2);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.067064	0.64402	D	0.000019	T	0.39358	0.1075	L	0.45470	1.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.01341	-1.1380	10	0.54805	T	0.06	-15.1744	20.5753	0.99366	0.0:1.0:0.0:0.0	.	778	Q96KG7	MEG10_HUMAN	I	778	ENSP00000423354:T778I;ENSP00000274473:T778I	ENSP00000274473:T778I	T	+	2	0	MEGF10	126804429	1.000000	0.71417	0.974000	0.42286	0.378000	0.30076	4.882000	0.63121	2.868000	0.98415	0.557000	0.71058	ACT		MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446	
KIF3A	11127	hgsc.bcm.edu	37	5	132038599	132038599	+	Missense_Mutation	SNP	C	C	T	rs572090360		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:132038599C>T	ENST00000378746.4	-	11	1762	c.1544G>A	c.(1543-1545)cGc>cAc	p.R515H	KIF3A_ENST00000378735.1_Missense_Mutation_p.R518H|KIF3A_ENST00000403231.1_Missense_Mutation_p.R542H|KIF3A_ENST00000487055.1_5'UTR|AC004237.1_ENST00000431165.1_RNA	NM_007054.5	NP_008985.3	Q9Y496	KIF3A_HUMAN	kinesin family member 3A	515					anterior/posterior pattern specification (GO:0009952)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|organelle organization (GO:0006996)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of receptor-mediated endocytosis (GO:0048260)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|spectrin binding (GO:0030507)	p.R515H(1)		endometrium(1)|kidney(4)|large_intestine(8)|lung(3)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	25		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AAGTTCTCTGCGAAGTTGCTC	0.388																																					p.R515H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1544A	5						.						227.0	225.0	226.0					5																	132038599		2203	4300	6503	132066498	SO:0001583	missense	11127	exon11			AF041853	CCDS34235.1, CCDS75295.1, CCDS75296.1	5q31	2012-08-01			ENSG00000131437	ENSG00000131437		"""Kinesins"""	6319	protein-coding gene	gene with protein product	"""kinesin family protein 3A"""	604683				1054846	Standard	XM_005271868		Approved	FLA10, KLP-20	uc003kxo.3	Q9Y496	OTTHUMG00000059725	ENST00000378746.4:c.1544G>A	5.37:g.132038599C>T	ENSP00000368020:p.Arg515His	Somatic		Capture	SOLID	Phase_I	132066498	NM_007054	A8MSW9|Q59EN1|Q86XE9|Q9Y6V4	Missense_Mutation	SNP	ENST00000378746.4	37	CCDS34235.1	.	.	.	.	.	.	.	.	.	.	C	17.14	3.312539	0.60414	.	.	ENSG00000131437	ENST00000378746;ENST00000378735;ENST00000541316;ENST00000450441;ENST00000403231	T;T;T;T	0.09723	2.95;2.95;2.95;2.95	6.17	6.17	0.99709	.	0.050791	0.85682	D	0.000000	T	0.16300	0.0392	L	0.54323	1.7	0.80722	D	1	B;B;B;B	0.13145	0.007;0.004;0.004;0.007	B;B;B;B	0.06405	0.002;0.002;0.002;0.002	T	0.01894	-1.1252	10	0.51188	T	0.08	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	542;542;515;541	E9PES4;B4DHG8;Q9Y496;Q2UVF2	.;.;KIF3A_HUMAN;.	H	515;518;542;43;542	ENSP00000368020:R515H;ENSP00000368009:R518H;ENSP00000405619:R43H;ENSP00000385808:R542H	ENSP00000368009:R518H	R	-	2	0	KIF3A	132066498	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.023000	0.70848	2.941000	0.99782	0.655000	0.94253	CGC		KIF3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132788.3	NM_007054	
JADE2	23338	hgsc.bcm.edu	37	5	133887866	133887866	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:133887866C>T	ENST00000402835.1	+	4	533	c.278C>T	c.(277-279)gCc>gTc	p.A93V	PHF15_ENST00000282605.4_Missense_Mutation_p.A93V|PHF15_ENST00000395003.1_Missense_Mutation_p.A93V|PHF15_ENST00000361895.2_Missense_Mutation_p.A93V														p.A93V(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CAGGTGCCTGCCGGGGCAGAG	0.637																																					p.A93V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C278T	5						.						44.0	41.0	42.0					5																	133887866		2203	4300	6503	133915765	SO:0001583	missense	23338	exon4																														ENST00000402835.1:c.278C>T	5.37:g.133887866C>T	ENSP00000384671:p.Ala93Val	Somatic		Capture	SOLID	Phase_I	133915765	NM_015288		Missense_Mutation	SNP	ENST00000402835.1	37		.	.	.	.	.	.	.	.	.	.	C	9.253	1.041272	0.19669	.	.	ENSG00000043143	ENST00000512386;ENST00000413974;ENST00000448712;ENST00000282605;ENST00000361895;ENST00000432594;ENST00000402835;ENST00000395003;ENST00000431355	T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0	4.98	4.98	0.66077	Enhancer of polycomb-like, N-terminal (1);	0.055536	0.64402	D	0.000001	T	0.35653	0.0939	L	0.33710	1.025	0.58432	D	0.999993	B;B;B;B;B	0.23591	0.088;0.033;0.088;0.056;0.088	B;B;B;B;B	0.34180	0.177;0.059;0.177;0.048;0.177	T	0.11324	-1.0592	10	0.02654	T	1	.	18.8174	0.92081	0.0:1.0:0.0:0.0	.	93;93;93;93;109	Q9NQC1;B5MBX1;D3DQA3;Q9NQC1-3;B3KPL2	JADE2_HUMAN;.;.;.;.	V	93;93;109;93;93;93;93;93;93	ENSP00000422991:A93V;ENSP00000282605:A93V;ENSP00000354425:A93V;ENSP00000384671:A93V;ENSP00000378451:A93V;ENSP00000406189:A93V	ENSP00000282605:A93V	A	+	2	0	PHF15	133915765	0.960000	0.32886	0.454000	0.27019	0.915000	0.54546	2.259000	0.43259	2.746000	0.94184	0.655000	0.94253	GCC		PHF15-007	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000318543.1		
CTNNA1	1495	hgsc.bcm.edu	37	5	138269505	138269505	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:138269505G>A	ENST00000302763.7	+	18	2538	c.2448G>A	c.(2446-2448)atG>atA	p.M816I	CTNNA1_ENST00000540387.1_Missense_Mutation_p.M446I|CTNNA1_ENST00000355078.5_Missense_Mutation_p.M713I|CTNNA1_ENST00000518825.1_Missense_Mutation_p.C840Y	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	816					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)	p.M816I(1)		NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			ACAGCGCCATGTCCCTGATCC	0.582																																					p.M816I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2448A	5						.						81.0	63.0	69.0					5																	138269505		2203	4300	6503	138297404	SO:0001583	missense	1495	exon18			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.2448G>A	5.37:g.138269505G>A	ENSP00000304669:p.Met816Ile	Somatic		Capture	SOLID	Phase_I	138297404	NM_001903	Q12795|Q8N1C0	Missense_Mutation	SNP	ENST00000302763.7	37	CCDS34243.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.65|16.65	3.181590|3.181590	0.57800|0.57800	.|.	.|.	ENSG00000044115|ENSG00000044115	ENST00000518825|ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000540387;ENST00000520520	T|T;T;T;T	0.27256|0.53857	1.68|0.6;0.6;0.6;0.6	4.65|4.65	4.65|4.65	0.58169|0.58169	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.49966|0.49966	0.1588|0.1588	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	B|P;B	0.22414|0.37731	0.069|0.607;0.254	B|B;B	0.24155|0.36766	0.051|0.232;0.158	T|T	0.57877|0.57877	-0.7735|-0.7735	9|10	0.87932|0.62326	D|D	0|0.03	-21.0359|-21.0359	17.3153|17.3153	0.87221|0.87221	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	840|693;816	G3XAM7|B4DKT9;P35221	.|.;CTNA1_HUMAN	Y|I	840|713;816;839;801;446;46	ENSP00000427821:C840Y|ENSP00000347190:M713I;ENSP00000304669:M816I;ENSP00000438476:M446I;ENSP00000430076:M46I	ENSP00000427821:C840Y|ENSP00000304669:M816I	C|M	+|+	2|3	0|0	CTNNA1|CTNNA1	138297404|138297404	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.533000|5.533000	0.67160|0.67160	2.406000|2.406000	0.81754|0.81754	0.561000|0.561000	0.74099|0.74099	TGT|ATG		CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903	
PCDHAC2	56134	hgsc.bcm.edu	37	5	140347768	140347768	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:140347768T>G	ENST00000289269.5	+	1	1949	c.1417T>G	c.(1417-1419)Tcc>Gcc	p.S473A	PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	473	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S473A(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGGAGGACTCCTATTCCAT	0.498																																					p.S473A	Melanoma(190;638 2083 3390 11909 52360)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1417G	5						.						151.0	149.0	150.0					5																	140347768		2203	4300	6503	140327952	SO:0001583	missense	56134	exon1			AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1417T>G	5.37:g.140347768T>G	ENSP00000289269:p.Ser473Ala	Somatic		Capture	SOLID	Phase_I	140327952	NM_018899	Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	ENST00000289269.5	37	CCDS4242.1	.	.	.	.	.	.	.	.	.	.	T	2.662	-0.279575	0.05642	.	.	ENSG00000243232	ENST00000289269	T	0.61040	0.14	6.02	3.47	0.39725	Cadherin (3);Cadherin-like (1);	0.000000	0.41001	D	0.000970	T	0.44993	0.1320	L	0.48362	1.52	0.30063	N	0.810756	B;B	0.16166	0.016;0.002	B;B	0.17979	0.02;0.004	T	0.30765	-0.9967	10	0.15952	T	0.53	.	9.2036	0.37275	0.0987:0.0:0.1895:0.7118	.	473;473	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	A	473	ENSP00000289269:S473A	ENSP00000289269:S473A	S	+	1	0	PCDHAC2	140327952	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	-0.230000	0.09083	2.311000	0.77944	0.533000	0.62120	TCC		PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251802.2	NM_018899	
PCDHB6	56130	hgsc.bcm.edu	37	5	140530018	140530018	+	Silent	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:140530018G>A	ENST00000231136.1	+	1	180	c.180G>A	c.(178-180)tcG>tcA	p.S60S	PCDHB6_ENST00000543635.1_Intron	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	60	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S60S(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCTGGCTTCGCGGGGCGCTC	0.512																																					p.S60S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G180A	5						.						82.0	92.0	88.0					5																	140530018		2203	4300	6503	140510202	SO:0001819	synonymous_variant	56130	exon1			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.180G>A	5.37:g.140530018G>A		Somatic		Capture	SOLID	Phase_I	140510202	NM_018939	B2R8R9	Silent	SNP	ENST00000231136.1	37	CCDS4248.1																																																																																				PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
PCDH1	5097	hgsc.bcm.edu	37	5	141244327	141244327	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:141244327T>G	ENST00000394536.3	-	3	1708	c.1569A>C	c.(1567-1569)gaA>gaC	p.E523D	PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000536585.1_Missense_Mutation_p.E501D|PCDH1_ENST00000287008.3_Missense_Mutation_p.E523D|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000456271.1_Missense_Mutation_p.E511D	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	523	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E523D(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		CAGCAATCACTTCACCAGGCT	0.547																																					p.E523D	Ovarian(132;1609 1739 4190 14731 45037)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1569C	5						.						98.0	87.0	91.0					5																	141244327		2203	4300	6503	141224511	SO:0001583	missense	5097	exon3			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.1569A>C	5.37:g.141244327T>G	ENSP00000378043:p.Glu523Asp	Somatic		Capture	SOLID	Phase_I	141224511	NM_032420	Q8IUP2	Missense_Mutation	SNP	ENST00000394536.3	37	CCDS43375.1	.	.	.	.	.	.	.	.	.	.	t	4.393	0.072538	0.08436	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.52057	0.68;4.66;4.66;4.66;4.66	5.75	-0.627	0.11541	Cadherin (4);Cadherin-like (1);	0.120476	0.36932	N	0.002329	T	0.18425	0.0442	N	0.05592	-0.015	0.38792	D	0.955019	B;B	0.11235	0.003;0.004	B;B	0.17722	0.019;0.012	T	0.04090	-1.0978	10	0.18710	T	0.47	.	1.725	0.02920	0.1349:0.3377:0.1553:0.372	.	523;523	Q08174;Q08174-2	PCDH1_HUMAN;.	D	523;523;511;534;501	ENSP00000287008:E523D;ENSP00000378043:E523D;ENSP00000403497:E511D;ENSP00000350122:E534D;ENSP00000438825:E501D	ENSP00000287008:E523D	E	-	3	2	PCDH1	141224511	0.041000	0.20044	1.000000	0.80357	0.894000	0.52154	-0.123000	0.10611	0.145000	0.18977	0.449000	0.29647	GAA		PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420	
FAT2	2196	hgsc.bcm.edu	37	5	150905459	150905459	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:150905459C>G	ENST00000261800.5	-	17	10388	c.10376G>C	c.(10375-10377)gGc>gCc	p.G3459A		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3459	Cadherin 31. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G3459A(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTAGGGGGGGCCATTCTCTGG	0.577																																					p.G3459A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G10376C	5						.						55.0	53.0	54.0					5																	150905459		2203	4300	6503	150885652	SO:0001583	missense	2196	exon17			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.10376G>C	5.37:g.150905459C>G	ENSP00000261800:p.Gly3459Ala	Somatic		Capture	SOLID	Phase_I	150885652	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.3|28.3	4.905382|4.905382	0.92107|0.92107	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000261800|ENST00000520200	T|.	0.50813|.	0.73|.	5.09|5.09	5.09|5.09	0.68999|0.68999	Cadherin (4);Cadherin-like (1);|.	0.000000|.	0.64402|.	D|.	0.000003|.	T|T	0.75903|0.75903	0.3913|0.3913	M|M	0.73217|0.73217	2.22|2.22	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.75554|0.75554	-0.3277|-0.3277	10|5	0.41790|.	T|.	0.15|.	.|.	18.8668|18.8668	0.92294|0.92294	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	3459;650|.	Q9NYQ8;E9PDJ8|.	FAT2_HUMAN;.|.	A|C	3459|317	ENSP00000261800:G3459A|.	ENSP00000261800:G3459A|.	G|W	-|-	2|3	0|0	FAT2|FAT2	150885652|150885652	1.000000|1.000000	0.71417|0.71417	0.981000|0.981000	0.43875|0.43875	0.983000|0.983000	0.72400|0.72400	7.382000|7.382000	0.79729|0.79729	2.529000|2.529000	0.85273|0.85273	0.544000|0.544000	0.68410|0.68410	GGC|TGG		FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
SPARC	6678	hgsc.bcm.edu	37	5	151043671	151043671	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:151043671G>A	ENST00000231061.4	-	9	1173	c.860C>T	c.(859-861)gCc>gTc	p.A287V	SPARC_ENST00000537849.1_5'Flank	NM_003118.3	NP_003109.1	P09486	SPRC_HUMAN	secreted protein, acidic, cysteine-rich (osteonectin)	287	EF-hand.				blood coagulation (GO:0007596)|bone development (GO:0060348)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|inner ear development (GO:0048839)|lung development (GO:0030324)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|regulation of cell morphogenesis (GO:0022604)|response to cadmium ion (GO:0046686)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to gravity (GO:0009629)|response to L-ascorbic acid (GO:0033591)|response to lead ion (GO:0010288)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nuclear matrix (GO:0016363)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|platelet alpha granule membrane (GO:0031092)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)	p.A287V(1)		central_nervous_system(3)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)		GAAGCAGCCGGCCCACTCATC	0.582																																					p.A287V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C860T	5						.						113.0	102.0	106.0					5																	151043671		2203	4300	6503	151023864	SO:0001583	missense	6678	exon9				CCDS4318.1	5q31-q33	2012-10-02			ENSG00000113140	ENSG00000113140			11219	protein-coding gene	gene with protein product	"""cysteine-rich protein"", ""osteonectin"""	182120		ON		2838412, 3410046	Standard	NM_003118		Approved		uc003lui.4	P09486	OTTHUMG00000130122	ENST00000231061.4:c.860C>T	5.37:g.151043671G>A	ENSP00000231061:p.Ala287Val	Somatic		Capture	SOLID	Phase_I	151023864	NM_003118	D3DQH9|Q6IBK4	Missense_Mutation	SNP	ENST00000231061.4	37	CCDS4318.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.015513	0.93404	.	.	ENSG00000113140	ENST00000231061	T	0.23552	1.9	5.44	5.44	0.79542	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.40448	0.1117	M	0.66506	2.035	0.80722	D	1	D	0.59357	0.985	P	0.51453	0.67	T	0.31308	-0.9948	10	0.72032	D	0.01	-25.873	15.6099	0.76707	0.0:0.1377:0.8623:0.0	.	287	P09486	SPRC_HUMAN	V	287	ENSP00000231061:A287V	ENSP00000231061:A287V	A	-	2	0	SPARC	151023864	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	5.073000	0.64395	2.550000	0.86006	0.462000	0.41574	GCC		SPARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252430.1	NM_003118	
GRIA1	2890	hgsc.bcm.edu	37	5	153054091	153054091	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:153054091A>G	ENST00000285900.5	+	6	1074	c.731A>G	c.(730-732)aAg>aGg	p.K244R	GRIA1_ENST00000521843.2_Missense_Mutation_p.K175R|GRIA1_ENST00000340592.5_Missense_Mutation_p.K244R|GRIA1_ENST00000448073.4_Missense_Mutation_p.K254R|GRIA1_ENST00000518783.1_Missense_Mutation_p.K254R|GRIA1_ENST00000518142.1_Missense_Mutation_p.K164R	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	244					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.K244R(1)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	AACAAATTCAAGGAGAGTGGC	0.473																																					p.K244R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A731G	5						.						211.0	217.0	215.0					5																	153054091		2203	4300	6503	153034284	SO:0001583	missense	2890	exon6				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.731A>G	5.37:g.153054091A>G	ENSP00000285900:p.Lys244Arg	Somatic		Capture	SOLID	Phase_I	153034284	NM_001114183	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	A	4.139	0.024205	0.08006	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99;1.99;1.99	5.56	5.56	0.83823	Extracellular ligand-binding receptor (1);	0.098891	0.64402	D	0.000002	T	0.06962	0.0177	N	0.02225	-0.63	0.45150	D	0.998165	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.06405	0.001;0.001;0.002;0.001;0.0;0.001	T	0.20672	-1.0268	10	0.02654	T	1	.	9.2827	0.37737	0.9113:0.0:0.0887:0.0	.	254;254;164;254;244;244	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	R	244;244;164;198;244;175;175;254;254	ENSP00000285900:K244R;ENSP00000427920:K164R;ENSP00000339343:K244R;ENSP00000427864:K175R;ENSP00000442108:K175R;ENSP00000428994:K254R;ENSP00000415569:K254R	ENSP00000285900:K244R	K	+	2	0	GRIA1	153034284	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	1.403000	0.34612	2.107000	0.64212	0.533000	0.62120	AAG		GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
LARP1	23367	hgsc.bcm.edu	37	5	154188055	154188055	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:154188055T>C	ENST00000336314.4	+	16	2528	c.2504T>C	c.(2503-2505)aTg>aCg	p.M835T		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	912					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)	p.M912T(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCTCAGGAGATGAACACACTC	0.512																																					p.M835T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2504C	5						.						93.0	88.0	90.0					5																	154188055		2203	4300	6503	154168248	SO:0001583	missense	23367	exon16			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.2504T>C	5.37:g.154188055T>C	ENSP00000336721:p.Met835Thr	Somatic		Capture	SOLID	Phase_I	154168248	NM_015315	O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	ENST00000336314.4	37	CCDS4328.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.491303	0.84962	.	.	ENSG00000155506	ENST00000336314	T	0.54866	0.55	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.74596	0.3737	M	0.83692	2.655	0.80722	D	1	D;P	0.53462	0.96;0.953	P;D	0.66716	0.885;0.946	T	0.78102	-0.2335	10	0.66056	D	0.02	-20.4433	16.3668	0.83335	0.0:0.0:0.0:1.0	.	912;835	Q6PKG0;Q6PKG0-3	LARP1_HUMAN;.	T	835	ENSP00000336721:M835T	ENSP00000336721:M835T	M	+	2	0	LARP1	154168248	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.842000	0.86851	2.268000	0.75426	0.454000	0.30748	ATG		LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1	NM_033551	
SLU7	10569	hgsc.bcm.edu	37	5	159842274	159842274	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:159842274T>C	ENST00000297151.4	-	2	415	c.28A>G	c.(28-30)Aat>Gat	p.N10D		NM_006425.4	NP_006416.3	O95391	SLU7_HUMAN	SLU7 splicing factor homolog (S. cerevisiae)	10					alternative mRNA splicing, via spliceosome (GO:0000380)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)	pre-mRNA 3'-splice site binding (GO:0030628)|second spliceosomal transesterification activity (GO:0000386)|zinc ion binding (GO:0008270)	p.N10D(1)		endometrium(4)|kidney(5)|large_intestine(4)|lung(6)|ovary(1)	20	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGTGCAGCATTAACTGCATCT	0.443																																					p.N10D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A28G	5						.						116.0	113.0	114.0					5																	159842274		2203	4300	6503	159774852	SO:0001583	missense	10569	exon2			AF101074	CCDS4352.1	5q33.3	2010-04-13			ENSG00000164609	ENSG00000164609			16939	protein-coding gene	gene with protein product	zinc knuckle motif containing	605974				10197984, 15728250	Standard	NM_006425		Approved	9G8	uc003lyg.3	O95391	OTTHUMG00000130324	ENST00000297151.4:c.28A>G	5.37:g.159842274T>C	ENSP00000297151:p.Asn10Asp	Somatic		Capture	SOLID	Phase_I	159774852	NM_006425	D3DQK2|Q3LUJ0|Q3LUJ1|Q6RXQ5|Q96FM9	Missense_Mutation	SNP	ENST00000297151.4	37	CCDS4352.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.741848	0.49151	.	.	ENSG00000164609	ENST00000297151;ENST00000521826;ENST00000519349;ENST00000520664	T;T;T	0.43294	1.57;0.96;0.95	5.44	4.29	0.51040	.	0.617024	0.19040	N	0.124314	T	0.29458	0.0734	N	0.22421	0.69	0.09310	N	1	B	0.23937	0.094	B	0.23852	0.049	T	0.20140	-1.0284	10	0.51188	T	0.08	.	10.7182	0.46026	0.0:0.0742:0.0:0.9258	.	10	O95391	SLU7_HUMAN	D	10	ENSP00000297151:N10D;ENSP00000428943:N10D;ENSP00000429990:N10D	ENSP00000297151:N10D	N	-	1	0	SLU7	159774852	0.018000	0.18449	0.996000	0.52242	0.927000	0.56198	2.000000	0.40816	2.071000	0.62044	0.528000	0.53228	AAT		SLU7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252673.1	NM_006425	
FBXW11	23291	hgsc.bcm.edu	37	5	171305052	171305052	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:171305052G>A	ENST00000265094.5	-	7	1008	c.871C>T	c.(871-873)Cgt>Tgt	p.R291C	FBXW11_ENST00000522891.1_5'UTR|FBXW11_ENST00000393802.2_Missense_Mutation_p.R257C|FBXW11_ENST00000425623.2_Missense_Mutation_p.R259C|FBXW11_ENST00000296933.6_Missense_Mutation_p.R278C	NM_012300.2	NP_036432.2	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11	291					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.R291C(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	21	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ACAATGACACGCTCATCATAC	0.438																																					p.R257C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C769T	5						.						120.0	103.0	109.0					5																	171305052		2203	4300	6503	171237657	SO:0001583	missense	23291	exon6			AB014596	CCDS34289.1, CCDS47340.1, CCDS47341.1	5q35.1	2013-01-09	2007-02-08	2004-06-16	ENSG00000072803	ENSG00000072803		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13607	protein-coding gene	gene with protein product		605651	"""F-box and WD-40 domain protein 1B"", ""F-box and WD-40 domain protein 11"""	FBXW1B		10531035, 10694485	Standard	NM_033644		Approved	KIAA0696, Fbw1b, BTRCP2, BTRC2, Hos, Fbw11	uc003mbm.1	Q9UKB1	OTTHUMG00000163267	ENST00000265094.5:c.871C>T	5.37:g.171305052G>A	ENSP00000265094:p.Arg291Cys	Somatic		Capture	SOLID	Phase_I	171237657	NM_033645	B2RC98|Q9P2S8|Q9P2S9|Q9Y4C6	Missense_Mutation	SNP	ENST00000265094.5	37	CCDS34289.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.203434	0.79127	.	.	ENSG00000072803	ENST00000296933;ENST00000265094;ENST00000393802;ENST00000425623	T;T;T;T	0.60171	0.21;2.13;0.21;0.21	5.22	4.22	0.49857	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.69860	0.3158	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.89917	0.995;0.998;1.0;0.993	P;P;D;B	0.65987	0.746;0.789;0.94;0.416	T	0.72427	-0.4297	10	0.87932	D	0	-14.1017	10.7947	0.46453	0.0:0.0:0.6081:0.3919	.	259;257;291;278	B4DH70;Q9UKB1-2;Q9UKB1;Q9UKB1-3	.;.;FBW1B_HUMAN;.	C	278;291;257;259	ENSP00000296933:R278C;ENSP00000265094:R291C;ENSP00000377391:R257C;ENSP00000444929:R259C	ENSP00000265094:R291C	R	-	1	0	FBXW11	171237657	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	4.586000	0.60984	2.596000	0.87737	0.579000	0.79373	CGT		FBXW11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372382.1	NM_012300	
SH3PXD2B	285590	hgsc.bcm.edu	37	5	171773247	171773247	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:171773247G>A	ENST00000311601.5	-	12	1251	c.1081C>T	c.(1081-1083)Ccg>Tcg	p.P361S	SH3PXD2B_ENST00000519643.1_Missense_Mutation_p.P361S	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	361					adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)	p.P361S(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGCGGCTTCGGCAGGTTGAGG	0.597																																					p.P361S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1081T	5						.						189.0	182.0	184.0					5																	171773247		2203	4300	6503	171705852	SO:0001583	missense	285590	exon12			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.1081C>T	5.37:g.171773247G>A	ENSP00000309714:p.Pro361Ser	Somatic		Capture	SOLID	Phase_I	171705852	NM_001017995	B6F0V2|Q9P2Q1	Missense_Mutation	SNP	ENST00000311601.5	37	CCDS34291.1	.	.	.	.	.	.	.	.	.	.	G	18.21	3.573051	0.65765	.	.	ENSG00000174705	ENST00000519643;ENST00000311601	T;T	0.67171	-0.25;1.49	5.31	5.31	0.75309	Src homology-3 domain (1);	0.000000	0.85682	D	0.000000	T	0.81004	0.4733	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.82884	-0.0236	10	0.72032	D	0.01	-18.0031	16.4653	0.84077	0.0:0.0:1.0:0.0	.	361	A1X283	SPD2B_HUMAN	S	361	ENSP00000430890:P361S;ENSP00000309714:P361S	ENSP00000309714:P361S	P	-	1	0	SH3PXD2B	171705852	1.000000	0.71417	1.000000	0.80357	0.207000	0.24258	9.341000	0.97041	2.490000	0.84030	0.455000	0.32223	CCG		SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372449.1	NM_017963	
CDH9	1007	hgsc.bcm.edu	37	5	26906184	26906184	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:26906184T>C	ENST00000231021.4	-	5	867	c.695A>G	c.(694-696)tAc>tGc	p.Y232C		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	232	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y232C(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						AACAACCTGGTACTGCTCTCT	0.428																																					p.Y232C	Melanoma(8;187 585 15745 40864 52829)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A695G	5						.						244.0	215.0	225.0					5																	26906184		2203	4300	6503	26941941	SO:0001583	missense	1007	exon5			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.695A>G	5.37:g.26906184T>C	ENSP00000231021:p.Tyr232Cys	Somatic		Capture	SOLID	Phase_I	26941941	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.379208	0.82682	.	.	ENSG00000113100	ENST00000231021	T	0.69561	-0.41	5.6	5.6	0.85130	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.86690	0.5993	H	0.95574	3.69	0.58432	D	0.999999	D	0.76494	0.999	D	0.73380	0.98	D	0.90560	0.4515	9	.	.	.	.	14.8925	0.70620	0.0:0.0:0.0:1.0	.	232	Q9ULB4	CADH9_HUMAN	C	232	ENSP00000231021:Y232C	.	Y	-	2	0	CDH9	26941941	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.970000	0.88000	2.260000	0.74910	0.528000	0.53228	TAC		CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
C6	729	hgsc.bcm.edu	37	5	41181494	41181494	+	Silent	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:41181494G>T	ENST00000263413.3	-	7	1158	c.894C>A	c.(892-894)gcC>gcA	p.A298A	C6_ENST00000475349.1_5'UTR|C6_ENST00000337836.5_Silent_p.A298A	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	298	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.A298A(1)		central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CTTGTTTGAAGGCAGAATTAT	0.353																																					p.A298A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C894A	5						.						99.0	103.0	102.0					5																	41181494		2202	4300	6502	41217251	SO:0001819	synonymous_variant	729	exon7			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.894C>A	5.37:g.41181494G>T		Somatic		Capture	SOLID	Phase_I	41217251	NM_000065		Silent	SNP	ENST00000263413.3	37	CCDS3936.1																																																																																				C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
GHR	2690	hgsc.bcm.edu	37	5	42689025	42689025	+	Missense_Mutation	SNP	G	G	A	rs373412197		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:42689025G>A	ENST00000230882.4	+	4	360	c.170G>A	c.(169-171)cGt>cAt	p.R57H	GHR_ENST00000537449.1_Intron|GHR_ENST00000357703.3_Missense_Mutation_p.R35H	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	57					2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)	p.R57H(1)		NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	ACCAAGTGCCGTTCACCTGAG	0.443																																					p.R57H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G170A	5						.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	277.0	257.0	263.0		170,191,170,170,170,170,170,170,170,104,170,170	5.7	1.0	5		263	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	GHR	NM_000163.4,NM_001242399.2,NM_001242400.2,NM_001242401.3,NM_001242402.2,NM_001242403.2,NM_001242404.2,NM_001242405.2,NM_001242406.2,NM_001242460.1,NM_001242461.1,NM_001242462.1	29,29,29,29,29,29,29,29,29,29,29,29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	57/639,64/646,57/639,57/639,57/639,57/639,57/639,57/639,57/639,35/617,57/298,57/296	42689025	2,13004	2203	4300	6503	42724782	SO:0001583	missense	2690	exon4				CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.170G>A	5.37:g.42689025G>A	ENSP00000230882:p.Arg57His	Somatic		Capture	SOLID	Phase_I	42724782	NM_000163	Q9HCX2	Missense_Mutation	SNP	ENST00000230882.4	37	CCDS3940.1	.	.	.	.	.	.	.	.	.	.	G	31	5.066847	0.93898	2.27E-4	1.16E-4	ENSG00000112964	ENST00000230882;ENST00000357703;ENST00000356276	D;D	0.84516	-1.86;-1.86	5.66	5.66	0.87406	Fibronectin, type III (1);Growth hormone/erythropoietin receptor, ligand binding (1);Immunoglobulin-like fold (1);	0.169693	0.49916	D	0.000136	D	0.94069	0.8099	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94373	0.7597	10	0.59425	D	0.04	-12.2239	19.3529	0.94398	0.0:0.0:1.0:0.0	.	57	P10912	GHR_HUMAN	H	57;35;57	ENSP00000230882:R57H;ENSP00000350335:R35H	ENSP00000230882:R57H	R	+	2	0	GHR	42724782	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.024000	0.70857	2.657000	0.90304	0.655000	0.94253	CGT		GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211605.2	NM_000163	
FST	10468	hgsc.bcm.edu	37	5	52778830	52778830	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:52778830A>G	ENST00000256759.3	+	2	589	c.206A>G	c.(205-207)gAc>gGc	p.D69G	FST_ENST00000396947.3_Missense_Mutation_p.D69G	NM_013409.2	NP_037541.1	P19883	FST_HUMAN	follistatin	69	TB.				BMP signaling pathway (GO:0030509)|female gonad development (GO:0008585)|gamete generation (GO:0007276)|hair follicle morphogenesis (GO:0031069)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinocyte proliferation (GO:0043616)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|positive regulation of hair follicle development (GO:0051798)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	activin binding (GO:0048185)|signal transducer activity (GO:0004871)	p.D69G(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|urinary_tract(1)	15		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				ACCGAGGAGGACGTGAATGAC	0.587											OREG0016608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D69G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A206G	5						.						70.0	69.0	69.0					5																	52778830		2203	4300	6503	52814587	SO:0001583	missense	10468	exon2			M19481	CCDS3959.1, CCDS43315.1	5q11.2	2008-02-05			ENSG00000134363	ENSG00000134363			3971	protein-coding gene	gene with protein product		136470				10411917, 3380788	Standard	NM_006350		Approved	FS	uc003jpd.3	P19883	OTTHUMG00000131183	ENST00000256759.3:c.206A>G	5.37:g.52778830A>G	ENSP00000256759:p.Asp69Gly	Somatic	987	Capture	SOLID	Phase_I	52814587	NM_013409	B5BU94|Q9BTH0	Missense_Mutation	SNP	ENST00000256759.3	37	CCDS3959.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.667838	0.88348	.	.	ENSG00000134363	ENST00000256759;ENST00000511025;ENST00000396947	D;D	0.82711	-1.64;-1.64	4.94	4.94	0.65067	TGF-beta binding (1);	0.000000	0.85682	D	0.000000	D	0.89107	0.6621	M	0.72894	2.215	0.80722	D	1	D	0.61697	0.99	P	0.62089	0.898	D	0.90412	0.4410	10	0.72032	D	0.01	-21.1654	14.5939	0.68392	1.0:0.0:0.0:0.0	.	69	P19883	FST_HUMAN	G	69	ENSP00000256759:D69G;ENSP00000380151:D69G	ENSP00000256759:D69G	D	+	2	0	FST	52814587	1.000000	0.71417	0.994000	0.49952	0.898000	0.52572	8.672000	0.91181	1.865000	0.54081	0.402000	0.26972	GAC		FST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253906.1	NM_013409	
ACTBL2	345651	hgsc.bcm.edu	37	5	56778356	56778356	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:56778356T>C	ENST00000423391.1	-	1	280	c.179A>G	c.(178-180)cAg>cGg	p.Q60R	CTD-2023N9.1_ENST00000506106.1_RNA|AC025470.1_ENST00000584598.1_RNA	NM_001017992.3	NP_001017992.1	Q562R1	ACTBL_HUMAN	actin, beta-like 2	60						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.Q60R(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(3)|pancreas(1)|prostate(2)	28		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)		TCTCTTGCTCTGAGCCTCATC	0.562																																					p.Q60R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A179G	5						.						103.0	79.0	87.0					5																	56778356		2203	4300	6503	56814113	SO:0001583	missense	345651	exon1				CCDS34163.1	5q11.2	2014-08-08			ENSG00000169067	ENSG00000169067			17780	protein-coding gene	gene with protein product		614835					Standard	NM_001017992		Approved	DKFZp686D0972	uc003jrm.3	Q562R1	OTTHUMG00000162330	ENST00000423391.1:c.179A>G	5.37:g.56778356T>C	ENSP00000416706:p.Gln60Arg	Somatic		Capture	SOLID	Phase_I	56814113	NM_001017992	B2RPJ1|Q562R2|Q562S9|Q562X8	Missense_Mutation	SNP	ENST00000423391.1	37	CCDS34163.1	.	.	.	.	.	.	.	.	.	.	T	12.30	1.895516	0.33442	.	.	ENSG00000169067	ENST00000423391	D	0.94613	-3.47	4.78	4.78	0.61160	Actin, conserved site (1);	0.000000	0.64402	D	0.000008	D	0.97402	0.9150	H	0.96970	3.915	0.44862	D	0.997872	B	0.24426	0.103	B	0.43413	0.419	D	0.97779	1.0231	10	0.87932	D	0	.	12.3009	0.54874	0.0:0.0:0.0:1.0	.	60	Q562R1	ACTBL_HUMAN	R	60	ENSP00000416706:Q60R	ENSP00000416706:Q60R	Q	-	2	0	ACTBL2	56814113	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	7.861000	0.87004	2.002000	0.58637	0.460000	0.39030	CAG		ACTBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368579.1	NM_001017992	
RAB3C	115827	hgsc.bcm.edu	37	5	57913496	57913496	+	Silent	SNP	C	C	T	rs554866418		TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:57913496C>T	ENST00000282878.4	+	2	220	c.51C>T	c.(49-51)taC>taT	p.Y17Y		NM_138453.2	NP_612462.1	Q96E17	RAB3C_HUMAN	RAB3C, member RAS oncogene family	17					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.Y17Y(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)	21		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)		ATGCCAGGTACGGCCAGAAAG	0.403													T|||	1	0.000199681	0.0	0.0	5008	,	,		20678	0.0		0.0	False		,,,				2504	0.001				p.Y17Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C51T	5						.						73.0	69.0	70.0					5																	57913496		2203	4300	6503	57949253	SO:0001819	synonymous_variant	115827	exon2			AY026936	CCDS3976.1	5q13	2008-02-05			ENSG00000152932	ENSG00000152932		"""RAB, member RAS oncogene"""	30269	protein-coding gene	gene with protein product		612829				12296628	Standard	NM_138453		Approved		uc003jrp.3	Q96E17	OTTHUMG00000097053	ENST00000282878.4:c.51C>T	5.37:g.57913496C>T		Somatic		Capture	SOLID	Phase_I	57949253	NM_138453		Silent	SNP	ENST00000282878.4	37	CCDS3976.1																																																																																				RAB3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214156.2	NM_138453	
SLC30A5	64924	hgsc.bcm.edu	37	5	68411796	68411796	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:68411796C>T	ENST00000396591.3	+	9	1437	c.827C>T	c.(826-828)aCg>aTg	p.T276M	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	276					cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)	p.T276M(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		CCTTTTGCAACGGTTATCTTT	0.343																																					p.T276M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C827T	5						.						177.0	164.0	169.0					5																	68411796		2203	4300	6503	68447552	SO:0001583	missense	64924	exon9			AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.827C>T	5.37:g.68411796C>T	ENSP00000379836:p.Thr276Met	Somatic		Capture	SOLID	Phase_I	68447552	NM_022902	B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Missense_Mutation	SNP	ENST00000396591.3	37	CCDS3996.1	.	.	.	.	.	.	.	.	.	.	C	10.91	1.484297	0.26598	.	.	ENSG00000145740	ENST00000396591	T	0.64260	-0.09	5.68	4.77	0.60923	.	0.080818	0.85682	N	0.000000	T	0.39410	0.1077	N	0.11560	0.145	0.80722	D	1	B;B;B	0.30851	0.043;0.008;0.297	B;B;B	0.16289	0.002;0.003;0.015	T	0.29852	-0.9998	10	0.32370	T	0.25	.	13.1802	0.59649	0.0:0.9178:0.0:0.0822	.	105;105;276	Q9H9X0;Q8TAD4-2;Q8TAD4	.;.;ZNT5_HUMAN	M	276	ENSP00000379836:T276M	ENSP00000379836:T276M	T	+	2	0	SLC30A5	68447552	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.847000	0.62867	1.458000	0.47871	0.585000	0.79938	ACG		SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254017.2		
MARVELD2	153562	hgsc.bcm.edu	37	5	68715960	68715960	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:68715960G>T	ENST00000325631.5	+	2	822	c.748G>T	c.(748-750)Ggc>Tgc	p.G250C	MARVELD2_ENST00000413223.2_Intron	NM_001038603.2|NM_001244734.1	NP_001033692.2|NP_001231663.1	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2	250	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell-cell junction organization (GO:0045216)|establishment of endothelial barrier (GO:0061028)|sensory perception of sound (GO:0007605)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)		p.G250C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(4)|skin(1)|urinary_tract(1)	15		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		TTACTACACTGGCCCTAAGAC	0.473																																					p.G250C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G748T	5						.						209.0	186.0	194.0					5																	68715960		2203	4300	6503	68751716	SO:0001583	missense	153562	exon2			AK055094	CCDS34175.1, CCDS58956.1	5q13.1	2007-05-01	2004-07-12	2004-07-14	ENSG00000152939	ENSG00000152939			26401	protein-coding gene	gene with protein product	"""tricellulin"""	610572	"""MARVEL (membrane-associating) domain containing 2"", ""deafness, autosomal recessive 49"""	MRVLDC2, DFNB49		17186462	Standard	NM_001038603		Approved	FLJ30532, TRIC	uc003jwq.3	Q8N4S9	OTTHUMG00000162512	ENST00000325631.5:c.748G>T	5.37:g.68715960G>T	ENSP00000323264:p.Gly250Cys	Somatic		Capture	SOLID	Phase_I	68751716	NM_001038603	A1BQX0|A1BQX1|A8KA97|Q96NM9	Missense_Mutation	SNP	ENST00000325631.5	37	CCDS34175.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.442101	0.83993	.	.	ENSG00000152939	ENST00000325631;ENST00000282886;ENST00000454295;ENST00000512803	T;T;T	0.25912	1.77;1.77;1.77	5.12	5.12	0.69794	Marvel (1);MARVEL-like domain (1);	0.000000	0.85682	D	0.000000	T	0.54013	0.1832	M	0.79475	2.455	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.59606	-0.7423	10	0.87932	D	0	-35.9207	17.3328	0.87271	0.0:0.0:1.0:0.0	.	250;250;250	Q8N4S9-3;Q8N4S9-2;Q8N4S9	.;.;MALD2_HUMAN	C	250	ENSP00000323264:G250C;ENSP00000396244:G250C;ENSP00000423490:G250C	ENSP00000282886:G250C	G	+	1	0	MARVELD2	68751716	1.000000	0.71417	0.979000	0.43373	0.972000	0.66771	9.698000	0.98700	2.384000	0.81235	0.561000	0.74099	GGC		MARVELD2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369583.1	NM_144724	
IQGAP2	10788	hgsc.bcm.edu	37	5	75993836	75993836	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:75993836C>T	ENST00000274364.6	+	33	4528	c.4231C>T	c.(4231-4233)Cgt>Tgt	p.R1411C	CTD-2384B11.2_ENST00000507514.1_RNA|IQGAP2_ENST00000502745.1_Missense_Mutation_p.R907C|IQGAP2_ENST00000396234.3_Missense_Mutation_p.R907C|IQGAP2_ENST00000379730.3_Missense_Mutation_p.R913C	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1411					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)	p.R1411C(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AAGAATCTATCGTAAGCTTCG	0.353																																					p.R1411C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4231T	5						.						63.0	61.0	62.0					5																	75993836		2203	4300	6503	76029592	SO:0001583	missense	10788	exon33			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.4231C>T	5.37:g.75993836C>T	ENSP00000274364:p.Arg1411Cys	Somatic		Capture	SOLID	Phase_I	76029592	NM_006633	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.677760	0.68042	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000505766;ENST00000396234;ENST00000502745	T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58	5.55	4.68	0.58851	RasGAP protein, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.76335	0.3973	M	0.91872	3.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.81129	-0.1073	10	0.87932	D	0	-9.2726	11.284	0.49212	0.1758:0.7085:0.1157:0.0	.	913;907;1411	F5H7S7;Q13576-2;Q13576	.;.;IQGA2_HUMAN	C	1411;913;1361;907;907	ENSP00000274364:R1411C;ENSP00000442313:R913C;ENSP00000421097:R1361C;ENSP00000379535:R907C;ENSP00000426027:R907C	ENSP00000274364:R1411C	R	+	1	0	IQGAP2	76029592	1.000000	0.71417	0.978000	0.43139	0.986000	0.74619	3.145000	0.50623	1.459000	0.47892	-0.182000	0.12963	CGT		IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
PAPD4	167153	hgsc.bcm.edu	37	5	78964790	78964790	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:78964790A>G	ENST00000296783.3	+	13	1446	c.1147A>G	c.(1147-1149)Aat>Gat	p.N383D	PAPD4_ENST00000453514.1_Missense_Mutation_p.N383D|PAPD4_ENST00000423041.2_Missense_Mutation_p.N379D|PAPD4_ENST00000504233.1_Missense_Mutation_p.N340D|PAPD4_ENST00000428308.2_Missense_Mutation_p.N383D			Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	383					hematopoietic progenitor cell differentiation (GO:0002244)|histone mRNA catabolic process (GO:0071044)|mRNA processing (GO:0006397)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|nuclear RNA-directed RNA polymerase complex (GO:0031380)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)	p.N383D(1)		biliary_tract(1)|breast(2)|endometrium(4)|kidney(3)|large_intestine(9)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		CCTCTCAAAGAATGAATCAAA	0.363																																					p.N383D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1147G	5						.						171.0	171.0	171.0					5																	78964790		2203	4300	6503	79000546	SO:0001583	missense	167153	exon12			AL833136	CCDS4048.1, CCDS75265.1, CCDS75266.1	5q14.1	2014-03-21			ENSG00000164329	ENSG00000164329			26776	protein-coding gene	gene with protein product	"""TUTase2"""	614121				12477932	Standard	NM_173797		Approved	FLJ38499, GLD2, TUT2	uc003kgb.2	Q6PIY7	OTTHUMG00000108163	ENST00000296783.3:c.1147A>G	5.37:g.78964790A>G	ENSP00000296783:p.Asn383Asp	Somatic		Capture	SOLID	Phase_I	79000546	NM_001114394	Q86WZ2|Q8N927	Missense_Mutation	SNP	ENST00000296783.3	37	CCDS4048.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.967391	0.74131	.	.	ENSG00000164329	ENST00000453514;ENST00000423041;ENST00000504233;ENST00000428308;ENST00000296783	T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3	5.5	5.5	0.81552	.	0.142736	0.64402	D	0.000008	T	0.75867	0.3908	M	0.77820	2.39	0.58432	D	0.999995	D;P;B	0.76494	0.999;0.862;0.115	D;P;B	0.69307	0.963;0.746;0.138	T	0.79453	-0.1797	10	0.87932	D	0	-18.2836	15.767	0.78135	1.0:0.0:0.0:0.0	.	383;379;340	Q6PIY7;Q6PIY7-2;D6RAF2	GLD2_HUMAN;.;.	D	383;379;340;383;383	ENSP00000397563:N383D;ENSP00000393412:N379D;ENSP00000421966:N340D;ENSP00000396861:N383D;ENSP00000296783:N383D	ENSP00000296783:N383D	N	+	1	0	PAPD4	79000546	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.005000	0.76323	2.299000	0.77371	0.528000	0.53228	AAT		PAPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226967.1	NM_173797	
ZFYVE16	9765	hgsc.bcm.edu	37	5	79744097	79744097	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:79744097G>A	ENST00000338008.5	+	7	3157	c.2977G>A	c.(2977-2979)Gct>Act	p.A993T	ZFYVE16_ENST00000505560.1_Missense_Mutation_p.A993T|ZFYVE16_ENST00000510158.1_Missense_Mutation_p.A993T	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	993					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)	p.A993T(1)		breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		TTTACCTATTGCTAGTATTTC	0.363																																					p.A993T	Melanoma(150;1452 1854 16018 17851 37292)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2977A	5						.						94.0	90.0	91.0					5																	79744097		2203	4300	6503	79779853	SO:0001583	missense	9765	exon8			AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.2977G>A	5.37:g.79744097G>A	ENSP00000337159:p.Ala993Thr	Somatic		Capture	SOLID	Phase_I	79779853	NM_001105251	O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Missense_Mutation	SNP	ENST00000338008.5	37	CCDS4050.1	.	.	.	.	.	.	.	.	.	.	G	8.021	0.759616	0.15846	.	.	ENSG00000039319	ENST00000338008;ENST00000510158;ENST00000505560	T;T;T	0.41400	1.0;1.0;1.0	5.76	2.86	0.33363	.	0.353495	0.24265	N	0.040047	T	0.34424	0.0897	M	0.63428	1.95	0.09310	N	1	B	0.21381	0.055	B	0.12837	0.008	T	0.24870	-1.0148	10	0.41790	T	0.15	-11.4821	4.9563	0.14041	0.1735:0.0:0.6585:0.168	.	993	Q7Z3T8	ZFY16_HUMAN	T	993	ENSP00000337159:A993T;ENSP00000423663:A993T;ENSP00000426848:A993T	ENSP00000337159:A993T	A	+	1	0	ZFYVE16	79779853	0.645000	0.27286	0.098000	0.21074	0.119000	0.20118	0.731000	0.26058	0.897000	0.36392	0.650000	0.86243	GCT		ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226982.2	NM_014733	
VCAN	1462	hgsc.bcm.edu	37	5	82836737	82836737	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:82836737T>C	ENST00000265077.3	+	8	8480	c.7915T>C	c.(7915-7917)Tct>Cct	p.S2639P	VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000343200.5_Missense_Mutation_p.S1652P|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000512590.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2639	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.S2639P(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	ATTTGAGGGCTCTGCTGATGT	0.413																																					p.S1652P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4954C	5						.						108.0	108.0	108.0					5																	82836737		2203	4300	6503	82872493	SO:0001583	missense	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.7915T>C	5.37:g.82836737T>C	ENSP00000265077:p.Ser2639Pro	Somatic		Capture	SOLID	Phase_I	82872493	NM_001164097	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	T	16.06	3.014540	0.54468	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.52754	0.65;0.65	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000007	T	0.67496	0.2899	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.988	T	0.68416	-0.5414	10	0.48119	T	0.1	.	14.5842	0.68312	0.0:0.0:0.0:1.0	.	1652;2639	P13611-2;P13611	.;CSPG2_HUMAN	P	2639;1652	ENSP00000265077:S2639P;ENSP00000340062:S1652P	ENSP00000265077:S2639P	S	+	1	0	VCAN	82872493	1.000000	0.71417	0.976000	0.42696	0.237000	0.25408	3.765000	0.55272	2.263000	0.75096	0.379000	0.24179	TCT		VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
ERAP1	51752	hgsc.bcm.edu	37	5	96117438	96117438	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:96117438T>A	ENST00000443439.2	-	16	2472	c.2406A>T	c.(2404-2406)gaA>gaT	p.E802D	ERAP1_ENST00000514604.1_5'UTR|ERAP1_ENST00000296754.3_Missense_Mutation_p.E802D	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	802					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)	p.E802D(1)		endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		AGAGGGCAAATTCAATTTGGC	0.413																																					p.E802D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2406T	5						.						152.0	156.0	155.0					5																	96117438		2203	4300	6503	96143194	SO:0001583	missense	51752	exon16			AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.2406A>T	5.37:g.96117438T>A	ENSP00000406304:p.Glu802Asp	Somatic		Capture	SOLID	Phase_I	96143194	NM_001040458	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Missense_Mutation	SNP	ENST00000443439.2	37	CCDS47250.1	.	.	.	.	.	.	.	.	.	.	T	15.54	2.864466	0.51482	.	.	ENSG00000164307	ENST00000296754;ENST00000443439;ENST00000414384	T;T	0.05447	3.44;3.44	6.07	4.92	0.64577	.	0.369602	0.32608	N	0.005878	T	0.09818	0.0241	L	0.57536	1.79	0.30149	N	0.80324	B;P;P	0.38745	0.167;0.645;0.592	B;B;B	0.40825	0.253;0.341;0.23	T	0.03166	-1.1065	10	0.33141	T	0.24	.	11.8483	0.52397	0.0:0.0684:0.0:0.9316	.	802;802;802	A8K6H1;Q9NZ08;Q9NZ08-2	.;ERAP1_HUMAN;.	D	802	ENSP00000296754:E802D;ENSP00000406304:E802D	ENSP00000296754:E802D	E	-	3	2	ERAP1	96143194	1.000000	0.71417	1.000000	0.80357	0.562000	0.35680	3.606000	0.54095	1.125000	0.41998	0.533000	0.62120	GAA		ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370699.1	NM_016442	
CREBRF	153222	hgsc.bcm.edu	37	5	172513546	172513546	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00E-01A-01W-A005-10	TCGA-AA-A00E-10A-01W-A005-10	g.chr5:172513546C>T	ENST00000296953.2	+	3	371	c.52C>T	c.(52-54)Cga>Tga	p.R18*	CREBRF_ENST00000520420.1_Nonsense_Mutation_p.R18*|CREBRF_ENST00000522692.1_Nonsense_Mutation_p.R18*|CREBRF_ENST00000540014.1_Nonsense_Mutation_p.R18*	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor	18					negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R18*(1)									GGATGCCTTTCGAAGCCACAC	0.403																																					p.R18X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C52T	5						.						139.0	131.0	134.0					5																	172513546		2203	4300	6503	172446152	SO:0001587	stop_gained	153222	exon3			AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.52C>T	5.37:g.172513546C>T	ENSP00000296953:p.Arg18*	Somatic		Capture	SOLID	Phase_I	172446152	NM_001168393	B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Nonsense_Mutation	SNP	ENST00000296953.2	37	CCDS34293.1	.	.	.	.	.	.	.	.	.	.	C	40	8.135394	0.98670	.	.	ENSG00000164463	ENST00000522692;ENST00000296953;ENST00000540014;ENST00000520420;ENST00000523161;ENST00000538538;ENST00000393776	.	.	.	5.87	5.87	0.94306	.	0.063954	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	.	.	.	X	18	.	ENSP00000296953:R18X	R	+	1	2	C5orf41	172446152	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.495000	0.66912	2.941000	0.99782	0.655000	0.94253	CGA		CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372667.1	NM_153607	
