#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
WDR91	29062	hgsc.bcm.edu	37	7	134870985	134870985	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr7:134870985G>T	ENST00000354475.4	-	15	2193	c.2162C>A	c.(2161-2163)aCt>aAt	p.T721N	WDR91_ENST00000344400.5_3'UTR|WDR91_ENST00000423565.1_Missense_Mutation_p.T686N	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	721								p.T721N(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						GTCCATGGCAGTGCTCCAGTC	0.612																																					p.T721N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2162A	7						.						93.0	77.0	83.0					7																	134870985		2203	4300	6503	134521525	SO:0001583	missense	29062	exon15			AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.2162C>A	7.37:g.134870985G>T	ENSP00000346466:p.Thr721Asn	Somatic		Capture	SOLID	Phase_I	134521525	NM_014149	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	ENST00000354475.4	37	CCDS34758.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.927505	0.92389	.	.	ENSG00000105875	ENST00000354475;ENST00000423565	T;T	0.59638	0.25;0.25	5.54	5.54	0.83059	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.051627	0.85682	D	0.000000	T	0.55162	0.1903	L	0.34521	1.04	0.80722	D	1	P	0.40970	0.734	B	0.43575	0.424	T	0.54925	-0.8220	10	0.44086	T	0.13	-15.2815	19.4831	0.95018	0.0:0.0:1.0:0.0	.	721	A4D1P6	WDR91_HUMAN	N	721;686	ENSP00000346466:T721N;ENSP00000392555:T686N	ENSP00000346466:T721N	T	-	2	0	WDR91	134521525	1.000000	0.71417	0.962000	0.40283	0.996000	0.88848	9.869000	0.99810	2.601000	0.87937	0.655000	0.94253	ACT		WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149	
NME8	51314	hgsc.bcm.edu	37	7	37936638	37936638	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr7:37936638G>A	ENST00000199447.4	+	17	2083	c.1711G>A	c.(1711-1713)Gcc>Acc	p.A571T	NME8_ENST00000440017.1_Missense_Mutation_p.A571T|EPDR1_ENST00000476620.1_Intron	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	571	NDK 3.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)	p.A571T(1)									AGCATCTAACGCCTATGAAGC	0.373																																					p.A571T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1711A	7						.						70.0	68.0	68.0					7																	37936638		2203	4300	6503	37903163	SO:0001583	missense	51314	exon17			AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.1711G>A	7.37:g.37936638G>A	ENSP00000199447:p.Ala571Thr	Somatic		Capture	SOLID	Phase_I	37903163	NM_016616	Q9NZH1	Missense_Mutation	SNP	ENST00000199447.4	37	CCDS5452.1	.	.	.	.	.	.	.	.	.	.	G	8.067	0.769491	0.15983	.	.	ENSG00000086288	ENST00000199447;ENST00000440017	T;T	0.42900	0.96;0.96	5.63	-11.3	0.00108	.	3.943990	0.00397	N	0.000051	T	0.17408	0.0418	N	0.11789	0.175	0.09310	N	1	B	0.16166	0.016	B	0.13407	0.009	T	0.09773	-1.0659	10	0.14656	T	0.56	8.25	4.2042	0.10481	0.4655:0.2303:0.2264:0.0777	.	571	Q8N427	TXND3_HUMAN	T	571	ENSP00000199447:A571T;ENSP00000397063:A571T	ENSP00000199447:A571T	A	+	1	0	TXNDC3	37903163	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.427000	0.01026	-3.095000	0.00246	-0.140000	0.14226	GCC		NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219946.1	NM_016616	
AMPH	273	hgsc.bcm.edu	37	7	38424500	38424500	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr7:38424500C>A	ENST00000356264.2	-	21	2222	c.2007G>T	c.(2005-2007)aaG>aaT	p.K669N	AMPH_ENST00000428293.2_Missense_Mutation_p.K627N|AMPH_ENST00000325590.5_Missense_Mutation_p.K627N	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	669	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)	p.K669N(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						AGTCTGATTCCTTCACTCCCA	0.463																																					p.K627N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1881T	7						.						105.0	99.0	101.0					7																	38424500		2203	4300	6503	38391025	SO:0001583	missense	273	exon20				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.2007G>T	7.37:g.38424500C>A	ENSP00000348602:p.Lys669Asn	Somatic		Capture	SOLID	Phase_I	38391025	NM_139316	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	37	CCDS5456.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.06|19.06	3.754714|3.754714	0.69648|0.69648	.|.	.|.	ENSG00000078053|ENSG00000078053	ENST00000441628|ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242	.|T;T;T	.|0.51817	.|0.69;0.69;0.69	5.56|5.56	5.56|5.56	0.83823|0.83823	.|Src homology-3 domain (3);Variant SH3 (1);	.|0.098017	.|0.64402	.|D	.|0.000001	.|T	.|0.54255	.|0.1847	L|L	0.31157|0.31157	0.91|0.91	0.50467|0.50467	D|D	0.999872|0.999872	.|P;D;D	.|0.89917	.|0.897;0.993;1.0	.|P;D;D	.|0.79784	.|0.624;0.932;0.993	.|T	.|0.56111	.|-0.8033	.|10	.|0.87932	.|D	.|0	-34.0271|-34.0271	10.1054|10.1054	0.42530|0.42530	0.0:0.8462:0.0:0.1538|0.0:0.8462:0.0:0.1538	.|.	.|627;669;557	.|P49418-2;P49418;Q8NFL4	.|.;AMPH_HUMAN;.	X|N	552|627;669;627;571	.|ENSP00000317441:K627N;ENSP00000348602:K669N;ENSP00000390734:K627N	.|ENSP00000317441:K627N	G|K	-|-	1|3	0|2	AMPH|AMPH	38391025|38391025	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	0.375000|0.375000	0.20518|0.20518	2.793000|2.793000	0.96121|0.96121	0.650000|0.650000	0.86243|0.86243	GGA|AAG		AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
ARHGEF5	7984	hgsc.bcm.edu	37	7	144062222	144062222	+	Silent	SNP	G	G	A	rs201478085		TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr7:144062222G>A	ENST00000056217.5	+	2	2634	c.2460G>A	c.(2458-2460)ccG>ccA	p.P820P	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	820					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P820P(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					CTGATTTGCCGCAGCCCCACC	0.607																																					p.P820P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2460A	7						.						2.0	3.0	3.0					7																	144062222		1307	2929	4236	143693155	SO:0001819	synonymous_variant	7984	exon2			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.2460G>A	7.37:g.144062222G>A		Somatic		Capture	SOLID	Phase_I	143693155	NM_005435	A6NNJ2|Q6ZML7	Silent	SNP	ENST00000056217.5	37	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.555218	0.00918	.	.	ENSG00000050327	ENST00000474817	.	.	.	3.89	-7.77	0.01227	.	.	.	.	.	T	0.16171	0.0389	.	.	.	0.19575	N	0.999965	.	.	.	.	.	.	T	0.16129	-1.0413	4	.	.	.	0.9342	2.0231	0.03513	0.2015:0.1496:0.4066:0.2422	.	.	.	.	H	74	.	.	R	+	2	0	ARHGEF5	143693155	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.255000	0.00538	-2.388000	0.00588	-1.365000	0.01206	CGC		ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435	
FLRT2	23768	hgsc.bcm.edu	37	14	86089197	86089197	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr14:86089197G>A	ENST00000330753.4	+	2	2106	c.1339G>A	c.(1339-1341)Gtg>Atg	p.V447M	FLRT2_ENST00000554746.1_Missense_Mutation_p.V447M	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	447	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)	p.V447M(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TCTCTTCACCGTGATGGCATA	0.493																																					p.V447M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1339A	14						.						82.0	75.0	78.0					14																	86089197		2203	4300	6503	85158950	SO:0001583	missense	23768	exon2			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1339G>A	14.37:g.86089197G>A	ENSP00000332879:p.Val447Met	Somatic		Capture	SOLID	Phase_I	85158950	NM_013231	A0AV84|B7ZLP3	Missense_Mutation	SNP	ENST00000330753.4	37	CCDS9877.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025691	0.35701	.	.	ENSG00000185070	ENST00000330753;ENST00000554746;ENST00000535800	T;T	0.59224	0.28;0.28	6.17	6.17	0.99709	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.66015	0.2747	N	0.21194	0.64	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.59263	-0.7487	10	0.24483	T	0.36	-19.394	20.8794	0.99867	0.0:0.0:1.0:0.0	.	447	O43155	FLRT2_HUMAN	M	447;447;100	ENSP00000332879:V447M;ENSP00000451050:V447M	ENSP00000332879:V447M	V	+	1	0	FLRT2	85158950	1.000000	0.71417	0.992000	0.48379	0.985000	0.73830	8.002000	0.88514	2.941000	0.99782	0.655000	0.94253	GTG		FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
FCGBP	8857	hgsc.bcm.edu	37	19	40419672	40419672	+	Missense_Mutation	SNP	C	C	T	rs138262646	byFrequency	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr19:40419672C>T	ENST00000221347.6	-	6	3329	c.3322G>A	c.(3322-3324)Gca>Aca	p.A1108T		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1108						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GTGGCCAGTGCGTCACACAGT	0.632													C|||	4	0.000798722	0.0	0.0	5008	,	,		15707	0.004		0.0	False		,,,				2504	0.0				p.A1108T												.	.	0			c.G3322A	19						.						68.0	68.0	68.0					19																	40419672		2203	4300	6503	45111512	SO:0001583	missense	8857	exon6			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.3322G>A	19.37:g.40419672C>T	ENSP00000221347:p.Ala1108Thr	None		Capture	SOLID	Phase_I	45111512	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	152	0.0695970695970696	50	0.1016260162601626	17	0.04696132596685083	35	0.06118881118881119	50	0.06596306068601583	C	11.53	1.666840	0.29604	.	.	ENSG00000090920	ENST00000221347	T	0.77358	-1.09	5.76	2.31	0.28768	Uncharacterised domain, cysteine-rich (2);	0.330046	0.27172	N	0.020591	T	0.04998	0.0134	L	0.56340	1.77	0.09310	N	1	P	0.42973	0.796	B	0.43331	0.416	T	0.28267	-1.0049	10	0.07030	T	0.85	.	7.4811	0.27406	0.0:0.6374:0.0:0.3626	.	1108	Q9Y6R7	FCGBP_HUMAN	T	1108	ENSP00000221347:A1108T	ENSP00000221347:A1108T	A	-	1	0	FCGBP	45111512	0.000000	0.05858	0.015000	0.15790	0.001000	0.01503	0.323000	0.19593	0.806000	0.34183	-0.224000	0.12420	GCA		FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
SPTBN4	57731	hgsc.bcm.edu	37	19	41081443	41081443	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr19:41081443G>A	ENST00000352632.3	+	36	7749	c.7663G>A	c.(7663-7665)Gga>Aga	p.G2555R	SPTBN4_ENST00000598249.1_Missense_Mutation_p.G2555R|SPTBN4_ENST00000392025.1_Missense_Mutation_p.G1298R|SHKBP1_ENST00000291842.5_5'Flank|SHKBP1_ENST00000600733.1_5'Flank|SPTBN4_ENST00000593816.1_3'UTR			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2555					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.G2555R(1)		breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GAGGGAAGGCGGAGATCGCAG	0.607																																					p.G2555R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7663A	19						.						47.0	35.0	39.0					19																	41081443		2203	4300	6503	45773283	SO:0001583	missense	57731	exon36			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.7663G>A	19.37:g.41081443G>A	ENSP00000263373:p.Gly2555Arg	Somatic		Capture	SOLID	Phase_I	45773283	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.811562	0.32053	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000392025	T;T	0.78003	-1.14;0.19	4.65	2.34	0.29019	.	0.423377	0.20877	U	0.084071	T	0.53029	0.1771	N	0.08118	0	0.80722	D	1	P;P	0.43633	0.813;0.63	B;B	0.33620	0.167;0.082	T	0.59920	-0.7363	10	0.87932	D	0	.	9.6554	0.39923	0.0845:0.1416:0.7739:0.0	.	1298;2555	C9JY79;Q9H254	.;SPTN4_HUMAN	R	2555;2555;1298	ENSP00000263373:G2555R;ENSP00000375879:G1298R	ENSP00000263373:G2555R	G	+	1	0	SPTBN4	45773283	1.000000	0.71417	0.366000	0.25914	0.165000	0.22458	4.667000	0.61561	1.079000	0.41038	0.462000	0.41574	GGA		SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
XKR6	286046	hgsc.bcm.edu	37	8	10782338	10782338	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr8:10782338T>G	ENST00000416569.2	-	2	793	c.767A>C	c.(766-768)tAt>tCt	p.Y256S	XKR6_ENST00000304437.2_5'UTR	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	256						integral component of membrane (GO:0016021)		p.Y256S(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		GGTGCGGATATACCTGCCCAG	0.562																																					p.Y256S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A767C	8						.						76.0	67.0	70.0					8																	10782338		2203	4300	6503	10819748	SO:0001583	missense	286046	exon2			BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.767A>C	8.37:g.10782338T>G	ENSP00000416707:p.Tyr256Ser	Somatic		Capture	SOLID	Phase_I	10819748	NM_173683	Q8TBA0	Missense_Mutation	SNP	ENST00000416569.2	37	CCDS5978.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	21.9|21.9	4.222307|4.222307	0.79464|0.79464	.|.	.|.	ENSG00000171044|ENSG00000171044	ENST00000382461|ENST00000416569	.|T	.|0.66280	.|-0.2	4.71|4.71	4.71|4.71	0.59529|0.59529	.|.	.|0.000000	.|0.64402	.|U	.|0.000014	T|T	0.74801|0.74801	0.3764|0.3764	M|M	0.83483|0.83483	2.645|2.645	0.80722|0.80722	D|D	1|1	.|D	.|0.57257	.|0.979	.|P	.|0.54759	.|0.76	T|T	0.79482|0.79482	-0.1785|-0.1785	5|10	.|0.62326	.|D	.|0.03	-53.9551|-53.9551	13.3644|13.3644	0.60676|0.60676	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|256	.|Q5GH73	.|XKR6_HUMAN	L|S	33|256	.|ENSP00000416707:Y256S	.|ENSP00000416707:Y256S	I|Y	-|-	1|2	0|0	XKR6|XKR6	10819748|10819748	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.794000|0.794000	0.44872|0.44872	7.856000|7.856000	0.86956|0.86956	1.751000|1.751000	0.51876|0.51876	0.375000|0.375000	0.23000|0.23000	ATA|TAT		XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383958.1	NM_173683	
DEFB105B	504180	hgsc.bcm.edu	37	8	7345253	7345253	+	Missense_Mutation	SNP	T	T	A	rs62639778		TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr8:7345253T>A	ENST00000335510.6	+	1	63	c.11T>A	c.(10-12)aTc>aAc	p.I4N	DEFB106B_ENST00000335479.2_5'Flank	NM_001040703.1	NP_001035793.1	Q8NG35	D105A_HUMAN	defensin, beta 105B	4					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.I4N(2)		large_intestine(1)|ovary(1)	2				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		ATGGCCCTGATCAGGAAGACA	0.368																																					p.I4N												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.T11A	8						.						1.0	1.0	1.0					8																	7345253		2	2	4	7332663	SO:0001583	missense	504180	exon1				CCDS34814.1	8p23.1	2011-03-29			ENSG00000186599	ENSG00000186599		"""Defensins, beta"""	29930	protein-coding gene	gene with protein product							Standard	NM_001040703		Approved			Q8NG35	OTTHUMG00000129315	ENST00000335510.6:c.11T>A	8.37:g.7345253T>A	ENSP00000335281:p.Ile4Asn	Somatic		Capture	SOLID	Phase_I	7332663	NM_152250	A1A581|Q8IZN8	Missense_Mutation	SNP	ENST00000335510.6	37	CCDS34814.1	169	0.07738095238095238	23	0.046747967479674794	32	0.08839779005524862	37	0.06468531468531469	77	0.10158311345646438	T	0.021	-1.419534	0.01136	.	.	ENSG00000186599	ENST00000335510	.	.	.	1.78	-0.235	0.13071	.	0.200540	0.24884	N	0.034828	T	0.00580	0.0019	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.04140	-1.0974	7	0.34782	T	0.22	-4.4727	2.368	0.04324	0.1947:0.0:0.4928:0.3125	.	4	Q8NG35	D105A_HUMAN	N	4	.	ENSP00000335281:I4N	I	+	2	0	DEFB105B	7332663	0.002000	0.14202	0.001000	0.08648	0.077000	0.17291	0.215000	0.17562	-0.079000	0.12707	0.248000	0.18094	ATC		DEFB105B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251447.2		
MTFR1	9650	hgsc.bcm.edu	37	8	66617083	66617083	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr8:66617083G>A	ENST00000262146.4	+	5	562	c.436G>A	c.(436-438)Gct>Act	p.A146T	MTFR1_ENST00000458689.2_Missense_Mutation_p.A113T|MTFR1_ENST00000517944.1_3'UTR	NM_014637.3	NP_055452.3	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1	146					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)		p.A146T(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|pancreas(1)|urinary_tract(1)	11			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			GAAGATTTGCGCTCTCGAAAA	0.498																																					p.A113T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G337A	8						.						40.0	41.0	41.0					8																	66617083		2203	4300	6503	66779637	SO:0001583	missense	9650	exon3				CCDS6182.1, CCDS55240.1	8q13.1	2012-11-30							29510	protein-coding gene	gene with protein product	"""likely ortholog of chicken chondrocyte protein with a poly proline region"""					7584026, 7584028, 15389597	Standard	NM_014637		Approved	CHPPR, KIAA0009, FAM54A2	uc003xvn.2	Q15390		ENST00000262146.4:c.436G>A	8.37:g.66617083G>A	ENSP00000262146:p.Ala146Thr	Somatic		Capture	SOLID	Phase_I	66779637	NM_001145838	E7EP84|Q6IB94|Q7Z669|Q86XH5|Q8IVD7	Missense_Mutation	SNP	ENST00000262146.4	37	CCDS6182.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880329	0.91740	.	.	ENSG00000066855	ENST00000518609;ENST00000262146;ENST00000458689	T;T	0.53640	0.61;0.61	5.39	5.39	0.77823	.	0.162808	0.53938	D	0.000043	T	0.75989	0.3925	M	0.90650	3.135	0.45791	D	0.998671	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.987;0.987	T	0.81206	-0.1038	10	0.72032	D	0.01	0.234	19.1642	0.93548	0.0:0.0:1.0:0.0	.	146;130;113;146	B4E3G8;E5RJS5;E7EP84;Q15390	.;.;.;MTFR1_HUMAN	T	130;146;113	ENSP00000262146:A146T;ENSP00000391502:A113T	ENSP00000262146:A146T	A	+	1	0	MTFR1	66779637	1.000000	0.71417	0.992000	0.48379	0.872000	0.50106	6.953000	0.75995	2.517000	0.84864	0.563000	0.77884	GCT		MTFR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378894.1	NM_014637	
TG	7038	hgsc.bcm.edu	37	8	133883696	133883696	+	Silent	SNP	C	C	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr8:133883696C>T	ENST00000220616.4	+	4	418	c.378C>T	c.(376-378)taC>taT	p.Y126Y	TG_ENST00000377869.1_Silent_p.Y126Y	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	126	Thyroglobulin type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.Y126Y(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CAGGGGACTACGCGCCTGTTC	0.552																																					p.Y126Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C378T	8						.						201.0	158.0	173.0					8																	133883696		2203	4300	6503	133952878	SO:0001819	synonymous_variant	7038	exon4			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.378C>T	8.37:g.133883696C>T		Somatic		Capture	SOLID	Phase_I	133952878	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Silent	SNP	ENST00000220616.4	37	CCDS34944.1																																																																																				TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
NOTCH2	4853	hgsc.bcm.edu	37	1	120572585	120572585	+	Silent	SNP	T	T	C			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr1:120572585T>C	ENST00000256646.2	-	2	318	c.99A>G	c.(97-99)gaA>gaG	p.E33E	NOTCH2_ENST00000602566.1_5'UTR	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	33	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.E33E(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTACACAGGGTTCATAGCCAT	0.363			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.E33E			Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A99G	1						.						2.0	2.0	2.0					1																	120572585		1213	2968	4181	120374108	SO:0001819	synonymous_variant	4853	exon2	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.99A>G	1.37:g.120572585T>C		Somatic		Capture	SOLID	Phase_I	120374108	NM_024408	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1																																																																																				NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
RNF2	6045	hgsc.bcm.edu	37	1	185062312	185062312	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr1:185062312A>C	ENST00000367510.3	+	4	656	c.368A>C	c.(367-369)cAt>cCt	p.H123P	RNF2_ENST00000367509.4_Intron	NM_007212.3	NP_009143.1	Q99496	RING2_HUMAN	ring finger protein 2	123	Interaction with HIP2.				anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.H123P(1)		breast(3)|endometrium(2)|large_intestine(4)|lung(3)|skin(2)	14		Breast(1374;0.000496)		Colorectal(1306;6.9e-08)|KIRC - Kidney renal clear cell carcinoma(1967;8.12e-06)		TATGAAGCTCATCAAGAGAGA	0.418																																					p.H123P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A368C	1						.						97.0	89.0	92.0					1																	185062312		2203	4300	6503	183328935	SO:0001583	missense	6045	exon4			BC012583, Y10571	CCDS1365.1	1q25.3	2013-01-09			ENSG00000121481	ENSG00000121481		"""RING-type (C3HC4) zinc fingers"""	10061	protein-coding gene	gene with protein product		608985				11513855	Standard	XM_005245413		Approved	BAP-1, BAP1, DING, HIPI3, RING1B, RING2	uc001grc.1	Q99496	OTTHUMG00000035391	ENST00000367510.3:c.368A>C	1.37:g.185062312A>C	ENSP00000356480:p.His123Pro	Somatic		Capture	SOLID	Phase_I	183328935	NM_007212	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000367510.3	37	CCDS1365.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.379227	0.82682	.	.	ENSG00000121481	ENST00000367510;ENST00000453650	T;T	0.21932	1.98;1.98	5.34	5.34	0.76211	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.43523	0.1251	M	0.67397	2.05	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	T	0.21793	-1.0235	10	0.36615	T	0.2	-23.2697	15.6141	0.76750	1.0:0.0:0.0:0.0	.	123	Q99496	RING2_HUMAN	P	123	ENSP00000356480:H123P;ENSP00000400722:H123P	ENSP00000356480:H123P	H	+	2	0	RNF2	183328935	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.690000	0.91272	2.135000	0.66039	0.528000	0.53228	CAT		RNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085793.1	NM_007212	
ASPM	259266	hgsc.bcm.edu	37	1	197101420	197101420	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr1:197101420G>C	ENST00000367409.4	-	7	2738	c.2482C>G	c.(2482-2484)Cta>Gta	p.L828V	ASPM_ENST00000294732.7_Missense_Mutation_p.L828V|ASPM_ENST00000367408.1_Missense_Mutation_p.L78V	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	828					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.L828V(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						CTTACCTCTAGACCAATTCGA	0.299																																					p.L828V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2482G	1						.						62.0	58.0	59.0					1																	197101420		2203	4300	6503	195368043	SO:0001583	missense	259266	exon7			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.2482C>G	1.37:g.197101420G>C	ENSP00000356379:p.Leu828Val	Somatic		Capture	SOLID	Phase_I	195368043	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.276050	0.59649	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408	T;T;T	0.59638	0.25;0.25;0.25	5.38	0.74	0.18330	Calponin homology domain (1);	0.000000	0.53938	D	0.000042	T	0.73814	0.3635	M	0.84948	2.725	0.51767	D	0.999938	D;D	0.89917	0.999;1.0	D;D	0.80764	0.994;0.988	T	0.74538	-0.3632	10	0.59425	D	0.04	.	10.1391	0.42725	0.3496:0.0:0.6504:0.0	.	828;828	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	V	828;828;78	ENSP00000356379:L828V;ENSP00000294732:L828V;ENSP00000356378:L78V	ENSP00000294732:L828V	L	-	1	2	ASPM	195368043	0.997000	0.39634	0.943000	0.38184	0.892000	0.51952	2.464000	0.45067	0.323000	0.23307	-0.225000	0.12378	CTA		ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
CCSAP	126731	hgsc.bcm.edu	37	1	229461147	229461147	+	Silent	SNP	T	T	G			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr1:229461147T>G	ENST00000366687.1	-	3	699	c.648A>C	c.(646-648)tcA>tcC	p.S216S	CCSAP_ENST00000284617.2_Silent_p.S216S|RP4-803J11.2_ENST00000418348.1_RNA|CCSAP_ENST00000483092.1_5'UTR|CCSAP_ENST00000366686.1_Silent_p.S102S			Q6IQ19	CCSAP_HUMAN	centriole, cilia and spindle-associated protein	216					multicellular organismal development (GO:0007275)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of embryonic development (GO:0045995)	axon (GO:0030424)|axoneme (GO:0005930)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cilium (GO:0005929)|spindle (GO:0005819)		p.S216S(1)									CTCGTAATGCTGATTCATGAA	0.418																																					p.S216S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A648C	1						.						109.0	98.0	101.0					1																	229461147		2203	4300	6503	227527770	SO:0001819	synonymous_variant	126731	exon4			BC071609	CCDS1577.1	1q42.13	2012-06-19	2012-06-19	2012-06-19	ENSG00000154429	ENSG00000154429			29578	protein-coding gene	gene with protein product	"""centriole and spindle-associated protein"""		"""chromosome 1 open reading frame 96"""	C1orf96		22493317	Standard	NM_145257		Approved	FLJ41471, CSAP	uc001htl.4	Q6IQ19	OTTHUMG00000037663	ENST00000366687.1:c.648A>C	1.37:g.229461147T>G		Somatic		Capture	SOLID	Phase_I	227527770	NM_145257	A8K5X2|Q6P9G2|Q6ZW85|Q8IXU1|Q96BM2	Silent	SNP	ENST00000366687.1	37	CCDS1577.1																																																																																				CCSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091839.1	NM_145257	
OR11L1	391189	hgsc.bcm.edu	37	1	248005088	248005088	+	Silent	SNP	C	C	A			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr1:248005088C>A	ENST00000355784.2	-	1	166	c.111G>T	c.(109-111)ctG>ctT	p.L37L		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	37						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L37L(2)		NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CTATAATGGTCAGGCAGTAGA	0.493																																					p.L37L												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G111T	1						.						71.0	62.0	65.0					1																	248005088		2203	4300	6503	246071711	SO:0001819	synonymous_variant	391189	exon1			AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.111G>T	1.37:g.248005088C>A		Somatic		Capture	SOLID	Phase_I	246071711	NM_001001959		Silent	SNP	ENST00000355784.2	37	CCDS31098.1																																																																																				OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096850.1	NM_001001959	
NAT10	55226	hgsc.bcm.edu	37	11	34162752	34162752	+	Silent	SNP	G	G	A			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr11:34162752G>A	ENST00000257829.3	+	25	2915	c.2709G>A	c.(2707-2709)gtG>gtA	p.V903V	NAT10_ENST00000527971.1_Intron|NAT10_ENST00000531159.2_Silent_p.V831V	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	903	Required for localization to the nucleolus and midbody.					membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)	p.V903V(1)		endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				GCAAAGTTGTGAAGGTAACCT	0.517																																					p.V831V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2493A	11						.						121.0	103.0	109.0					11																	34162752		2202	4298	6500	34119328	SO:0001819	synonymous_variant	55226	exon23			AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.2709G>A	11.37:g.34162752G>A		Somatic		Capture	SOLID	Phase_I	34119328	NM_001144030	B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Silent	SNP	ENST00000257829.3	37	CCDS7889.1																																																																																				NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388693.1	NM_024662	
C11orf63	79864	hgsc.bcm.edu	37	11	122775027	122775027	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr11:122775027C>T	ENST00000531316.1	+	2	831	c.739C>T	c.(739-741)Cgg>Tgg	p.R247W	C11orf63_ENST00000307257.6_Missense_Mutation_p.R247W|C11orf63_ENST00000227349.2_Missense_Mutation_p.R247W			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	247					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)			p.R247W(2)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		ACGTGGCCCTCGGCGAAGGAA	0.478																																					p.R247W												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C739T	11						.						124.0	120.0	121.0					11																	122775027		2202	4299	6501	122280237	SO:0001583	missense	79864	exon3			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.739C>T	11.37:g.122775027C>T	ENSP00000431669:p.Arg247Trp	Somatic		Capture	SOLID	Phase_I	122280237	NM_024806	A8K6G0|Q96GB5|Q9H5D6	Missense_Mutation	SNP	ENST00000531316.1	37	CCDS8438.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.951271	0.73787	.	.	ENSG00000109944	ENST00000307257;ENST00000227349;ENST00000531316	T;T	0.58060	0.36;0.36	5.74	3.86	0.44501	.	0.228726	0.31257	N	0.007973	T	0.66896	0.2836	M	0.68317	2.08	0.22896	N	0.998591	D;D	0.89917	1.0;1.0	D;D	0.80764	0.977;0.994	T	0.58538	-0.7619	10	0.72032	D	0.01	-18.223	9.2255	0.37405	0.1452:0.7818:0.0:0.073	.	247;247	Q6NUN7;Q6NUN7-2	CK063_HUMAN;.	W	247	ENSP00000227349:R247W;ENSP00000431669:R247W	ENSP00000227349:R247W	R	+	1	2	C11orf63	122280237	0.021000	0.18746	0.887000	0.34795	0.898000	0.52572	2.254000	0.43214	0.756000	0.33013	0.650000	0.86243	CGG		C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387511.1	NM_024806	
BTN3A3	10384	hgsc.bcm.edu	37	6	26451992	26451992	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr6:26451992G>T	ENST00000244519.2	+	11	1351	c.1108G>T	c.(1108-1110)Gat>Tat	p.D370Y	BTN3A3_ENST00000339789.4_Missense_Mutation_p.D328Y|BTN3A3_ENST00000361232.3_Missense_Mutation_p.D321Y	NM_006994.4	NP_008925.1	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3	370	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)		p.D370Y(1)		cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30						AGAGCCGCGGGATCTGCCAGA	0.542																																					p.D370Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1108T	6						.						94.0	101.0	99.0					6																	26451992		2203	4300	6503	26559971	SO:0001583	missense	10384	exon11			U90548	CCDS4611.1, CCDS4612.1, CCDS4612.2	6p22.1	2014-01-14			ENSG00000111801	ENSG00000111801		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1140	protein-coding gene	gene with protein product		613595				10354554, 9149941	Standard	NM_006994		Approved	BTF3, BTN3.3	uc003nhz.3	O00478	OTTHUMG00000014451	ENST00000244519.2:c.1108G>T	6.37:g.26451992G>T	ENSP00000244519:p.Asp370Tyr	Somatic		Capture	SOLID	Phase_I	26559971	NM_006994	B4DWI7|E9PCP5	Missense_Mutation	SNP	ENST00000244519.2	37	CCDS4611.1	.	.	.	.	.	.	.	.	.	.	G	9.198	1.027818	0.19512	.	.	ENSG00000111801	ENST00000244519;ENST00000339789;ENST00000361232;ENST00000490254	T;T;T;T	0.11495	2.77;2.77;2.77;2.77	2.95	-5.9	0.02275	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.05502	0.0145	L	0.53561	1.675	0.09310	N	1	B;D	0.55172	0.371;0.97	B;P	0.51101	0.214;0.659	T	0.01925	-1.1246	9	0.66056	D	0.02	.	6.8239	0.23872	0.5846:0.2489:0.1664:0.0	.	321;370	E9PCP5;O00478	.;BT3A3_HUMAN	Y	370;328;321;160	ENSP00000244519:D370Y;ENSP00000344968:D328Y;ENSP00000355238:D321Y;ENSP00000419736:D160Y	ENSP00000244519:D370Y	D	+	1	0	BTN3A3	26559971	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.942000	0.01541	-1.775000	0.01287	-0.463000	0.05309	GAT		BTN3A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040116.2	NM_006994	
FBXO39	162517	hgsc.bcm.edu	37	17	6683447	6683447	+	Missense_Mutation	SNP	G	G	A	rs150271375	byFrequency	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr17:6683447G>A	ENST00000321535.4	+	2	390	c.260G>A	c.(259-261)cGt>cAt	p.R87H		NM_153230.2	NP_694962.1	Q8N4B4	FBX39_HUMAN	F-box protein 39	87								p.R87H(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	26						AAGTTTGGTCGTTATCTGGAG	0.498													G|||	5	0.000998403	0.0	0.0	5008	,	,		21314	0.0		0.004	False		,,,				2504	0.001				p.R87H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G260A	17						.	G	HIS/ARG	0,4406		0,0,2203	154.0	148.0	150.0		260	2.3	1.0	17	dbSNP_134	150	16,8584	11.9+/-42.8	0,16,4284	yes	missense	FBXO39	NM_153230.2	29	0,16,6487	AA,AG,GG		0.186,0.0,0.123	possibly-damaging	87/443	6683447	16,12990	2203	4300	6503	6624171	SO:0001583	missense	162517	exon2			BC034782	CCDS11082.1	17p13.2	2014-01-21			ENSG00000177294	ENSG00000177294		"""F-boxes /  ""other"""""	28565	protein-coding gene	gene with protein product		609106				12477932	Standard	NM_153230		Approved	MGC35179, Fbx39, CT144	uc010vtg.2	Q8N4B4	OTTHUMG00000102062	ENST00000321535.4:c.260G>A	17.37:g.6683447G>A	ENSP00000321386:p.Arg87His	Somatic		Capture	SOLID	Phase_I	6624171	NM_153230		Missense_Mutation	SNP	ENST00000321535.4	37	CCDS11082.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	10.97	1.500867	0.26861	0.0	0.00186	ENSG00000177294	ENST00000321535	T	0.12569	2.67	5.41	2.26	0.28386	.	0.417082	0.21211	N	0.078303	T	0.07863	0.0197	N	0.24115	0.695	0.28915	N	0.892454	B	0.09022	0.002	B	0.06405	0.002	T	0.14952	-1.0454	10	0.46703	T	0.11	-4.5937	4.4591	0.11657	0.1826:0.0:0.6386:0.1788	.	87	Q8N4B4	FBX39_HUMAN	H	87	ENSP00000321386:R87H	ENSP00000321386:R87H	R	+	2	0	FBXO39	6624171	0.948000	0.32251	0.972000	0.41901	0.952000	0.60782	1.062000	0.30555	0.754000	0.32968	0.561000	0.74099	CGT		FBXO39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219866.2	NM_153230	
DNAH2	146754	hgsc.bcm.edu	37	17	7722684	7722684	+	Missense_Mutation	SNP	G	G	A	rs201154938		TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr17:7722684G>A	ENST00000572933.1	+	72	12433	c.10973G>A	c.(10972-10974)cGc>cAc	p.R3658H	DNAH2_ENST00000389173.2_Missense_Mutation_p.R3658H			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3658					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R3658H(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTGGAGGACCGCATTGACTAC	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		20163	0.001		0.0	False		,,,				2504	0.0				p.R3658H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G10973A	17						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	129.0	114.0	119.0		10973	4.0	1.0	17		119	0,8600		0,0,4300	no	missense	DNAH2	NM_020877.2	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	3658/4428	7722684	1,13005	2203	4300	6503	7663409	SO:0001583	missense	146754	exon71			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.10973G>A	17.37:g.7722684G>A	ENSP00000458355:p.Arg3658His	Somatic		Capture	SOLID	Phase_I	7663409	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	24.2	4.502178	0.85176	2.27E-4	0.0	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.76968	-1.06	4.02	4.02	0.46733	.	0.069670	0.56097	D	0.000021	D	0.89736	0.6801	M	0.91768	3.24	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.72338	0.977;0.918	D	0.92004	0.5613	10	0.62326	D	0.03	.	15.4308	0.75099	0.0:0.0:1.0:0.0	.	3619;3658	Q9P225-2;Q9P225	.;DYH2_HUMAN	H	3619;3658	ENSP00000373825:R3658H	ENSP00000353818:R3619H	R	+	2	0	DNAH2	7663409	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.879000	0.75572	2.228000	0.72767	0.561000	0.74099	CGC		DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
AKAP10	11216	hgsc.bcm.edu	37	17	19839632	19839632	+	Silent	SNP	A	A	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr17:19839632A>T	ENST00000225737.6	-	9	1591	c.1434T>A	c.(1432-1434)acT>acA	p.T478T	AKAP10_ENST00000395536.3_Silent_p.T478T	NM_007202.3	NP_009133.2	O43572	AKA10_HUMAN	A kinase (PRKA) anchor protein 10	478	RGS 2. {ECO:0000255|PROSITE- ProRule:PRU00171}.				blood coagulation (GO:0007596)|protein localization (GO:0008104)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)		p.T478T(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	21	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					GACGTAATGGAGTTGTGAAAC	0.418																																					p.T478T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1434A	17						.						109.0	93.0	99.0					17																	19839632		2203	4300	6503	19780224	SO:0001819	synonymous_variant	11216	exon9			AF037439	CCDS11214.1	17p11.1	2008-07-18			ENSG00000108599	ENSG00000108599		"""A-kinase anchor proteins"""	368	protein-coding gene	gene with protein product	"""dual-specificity A-kinase anchoring protein 2"", ""protein kinase A anchoring protein 10"", ""mitochondrial A kinase PPKA anchor protein 10"""	604694				9326583	Standard	NM_007202		Approved	D-AKAP2, PRKA10, MGC9414	uc002gwo.4	O43572	OTTHUMG00000059515	ENST00000225737.6:c.1434T>A	17.37:g.19839632A>T		Somatic		Capture	SOLID	Phase_I	19780224	NM_007202	B2R650|Q96AJ7	Silent	SNP	ENST00000225737.6	37	CCDS11214.1																																																																																				AKAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132380.2	NM_007202	
SALL3	27164	hgsc.bcm.edu	37	18	76757284	76757284	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr18:76757284C>T	ENST00000537592.2	+	3	3865	c.3865C>T	c.(3865-3867)Cgg>Tgg	p.R1289W	SALL3_ENST00000575389.2_Missense_Mutation_p.R1217W|SALL3_ENST00000536229.3_Missense_Mutation_p.R1084W	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	1289					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R1289W(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CCCATTCACGCGGTTTATCGA	0.567																																					p.R1289W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3865T	18						.						120.0	122.0	121.0					18																	76757284		2203	4300	6503	74858272	SO:0001583	missense	27164	exon3			AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.3865C>T	18.37:g.76757284C>T	ENSP00000441823:p.Arg1289Trp	Somatic		Capture	SOLID	Phase_I	74858272	NM_171999	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	.	.	.	.	.	.	.	.	.	.	C	2.485	-0.318834	0.05386	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.52057	0.68	5.52	-1.44	0.08856	.	0.000000	0.64402	D	0.000009	T	0.65637	0.2710	M	0.75447	2.3	0.37520	D	0.917508	D;D	0.89917	1.0;1.0	P;D	0.73708	0.894;0.981	T	0.72440	-0.4293	10	0.87932	D	0	-59.3933	16.8642	0.86025	0.4021:0.5979:0.0:0.0	.	949;1289	F5GXY4;Q9BXA9	.;SALL3_HUMAN	W	1289;1217;949	ENSP00000441823:R1289W	ENSP00000299466:R1289W	R	+	1	2	SALL3	74858272	0.926000	0.31397	0.021000	0.16686	0.122000	0.20287	2.177000	0.42509	-0.494000	0.06669	-1.014000	0.02459	CGG		SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
SATB1	6304	hgsc.bcm.edu	37	3	18436275	18436275	+	Silent	SNP	A	A	C			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr3:18436275A>C	ENST00000338745.6	-	7	2619	c.885T>G	c.(883-885)tcT>tcG	p.S295S	SATB1_ENST00000454909.2_Silent_p.S295S|TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000475083.1_5'Flank|SATB1_ENST00000417717.2_Silent_p.S295S	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	295					activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S295S(1)		NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						GTGTCCGGACAGAGGGCTGGC	0.582																																					p.S295S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T885G	3						.						104.0	94.0	97.0					3																	18436275		2203	4300	6503	18411279	SO:0001819	synonymous_variant	6304	exon7				CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.885T>G	3.37:g.18436275A>C		Somatic		Capture	SOLID	Phase_I	18411279	NM_002971	B3KXF1|C9JTR6|Q59EQ0	Silent	SNP	ENST00000338745.6	37	CCDS2631.1																																																																																				SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010	
NKTR	4820	hgsc.bcm.edu	37	3	42662951	42662951	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr3:42662951C>T	ENST00000232978.8	+	6	505	c.317C>T	c.(316-318)gCg>gTg	p.A106V	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	106	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.A106V(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		CATGACAGAGCGTTCCTTTTA	0.333																																					p.A106V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C317T	3						.						78.0	76.0	76.0					3																	42662951		2203	4299	6502	42637955	SO:0001583	missense	4820	exon6				CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.317C>T	3.37:g.42662951C>T	ENSP00000232978:p.Ala106Val	Somatic		Capture	SOLID	Phase_I	42637955	NM_005385		Missense_Mutation	SNP	ENST00000232978.8	37	CCDS2702.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.196916	0.79015	.	.	ENSG00000114857	ENST00000232978	T	0.44083	0.93	5.24	5.24	0.73138	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (3);Cyclophilin-like (1);	0.000000	0.85682	D	0.000000	T	0.61502	0.2352	L	0.49778	1.585	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63148	-0.6702	10	0.72032	D	0.01	-8.9333	19.163	0.93543	0.0:1.0:0.0:0.0	.	106	P30414	NKTR_HUMAN	V	106	ENSP00000232978:A106V	ENSP00000232978:A106V	A	+	2	0	NKTR	42637955	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.798000	0.55522	2.603000	0.88011	0.650000	0.86243	GCG		NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2	NM_005385	
ZNF197	10168	hgsc.bcm.edu	37	3	44672679	44672679	+	Silent	SNP	C	C	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr3:44672679C>T	ENST00000396058.1	+	2	683	c.516C>T	c.(514-516)gaC>gaT	p.D172D	RP11-944L7.4_ENST00000457331.1_RNA|ZNF197_ENST00000383745.2_Silent_p.D172D|ZNF197_ENST00000383744.4_Silent_p.D172D|ZNF197_ENST00000344387.4_Silent_p.D172D			O14709	ZN197_HUMAN	zinc finger protein 197	172					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D172D(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)	25				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		CTCCTACTGACCTAGTGGCAT	0.532																																					p.D172D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C516T	3						.						155.0	124.0	134.0					3																	44672679		2203	4300	6503	44647683	SO:0001819	synonymous_variant	10168	exon3			AF011573	CCDS2717.1, CCDS33743.1	3p21	2013-01-09	2003-10-07		ENSG00000186448	ENSG00000186448		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12988	protein-coding gene	gene with protein product			"""zinc finger protein 166"""	ZNF166		9380504, 8353497	Standard	XM_005264783		Approved	P18, D3S1363E, ZKSCAN9, ZSCAN41	uc003cnm.3	O14709	OTTHUMG00000133089	ENST00000396058.1:c.516C>T	3.37:g.44672679C>T		Somatic		Capture	SOLID	Phase_I	44647683	NM_001024855	B2RAH8|Q86VG0	Silent	SNP	ENST00000396058.1	37	CCDS2717.1																																																																																				ZNF197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256747.4	NM_006991	
KIF15	56992	hgsc.bcm.edu	37	3	44846551	44846551	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr3:44846551G>C	ENST00000326047.4	+	15	1869	c.1720G>C	c.(1720-1722)Gag>Cag	p.E574Q	KIF15_ENST00000425755.1_Missense_Mutation_p.E209Q	NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	574					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.E574Q(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		AGCTCAGAAAGAGCCATGTTT	0.358																																					p.E574Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1720C	3						.						69.0	70.0	69.0					3																	44846551		2203	4300	6503	44821555	SO:0001583	missense	56992	exon15			AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.1720G>C	3.37:g.44846551G>C	ENSP00000324020:p.Glu574Gln	Somatic		Capture	SOLID	Phase_I	44821555	NM_020242	Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	ENST00000326047.4	37	CCDS33744.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559347	0.65538	.	.	ENSG00000163808	ENST00000326047;ENST00000481166;ENST00000396031;ENST00000425755	T;T;T	0.79554	-0.36;-1.28;1.77	5.56	3.74	0.42951	.	0.120124	0.36778	N	0.002407	T	0.75576	0.3868	M	0.62723	1.935	0.37770	D	0.926657	B;B	0.25312	0.123;0.027	B;B	0.20577	0.03;0.025	T	0.71676	-0.4521	10	0.30078	T	0.28	.	11.4991	0.50426	0.0681:0.1258:0.8061:0.0	.	209;574	C9JKA9;Q9NS87	.;KIF15_HUMAN	Q	574;346;573;209	ENSP00000324020:E574Q;ENSP00000425499:E346Q;ENSP00000389982:E209Q	ENSP00000324020:E574Q	E	+	1	0	KIF15	44821555	0.717000	0.27966	0.028000	0.17463	0.880000	0.50808	2.203000	0.42752	0.798000	0.33994	0.585000	0.79938	GAG		KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343831.2		
CADM2	253559	hgsc.bcm.edu	37	3	85961556	85961556	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr3:85961556G>A	ENST00000407528.2	+	5	598	c.536G>A	c.(535-537)cGc>cAc	p.R179H	CADM2_ENST00000383699.3_Missense_Mutation_p.R188H|CADM2_ENST00000405615.2_Missense_Mutation_p.R181H	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	179	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.R188L(1)|p.R181L(1)|p.R181H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		GATGCAAATCGCAAGACATTC	0.393																																					p.R179H												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G536A	3						.						79.0	65.0	70.0					3																	85961556		2203	4300	6503	86044246	SO:0001583	missense	253559	exon5			AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.536G>A	3.37:g.85961556G>A	ENSP00000384575:p.Arg179His	Somatic		Capture	SOLID	Phase_I	86044246	NM_001167674	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	37	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.980045	0.92982	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	D;D;D	0.86097	-2.07;-2.07;-2.07	5.6	5.6	0.85130	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.048636	0.85682	D	0.000000	D	0.85292	0.5663	L	0.29908	0.895	0.52099	D	0.999946	P;D;D	0.57571	0.939;0.957;0.98	P;B;P	0.52109	0.52;0.439;0.69	D	0.86474	0.1787	10	0.59425	D	0.04	.	19.6138	0.95622	0.0:0.0:1.0:0.0	.	181;188;179	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	H	188;179;181	ENSP00000373200:R188H;ENSP00000384575:R179H;ENSP00000384193:R181H	ENSP00000373200:R188H	R	+	2	0	CADM2	86044246	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.261000	0.95576	2.640000	0.89533	0.591000	0.81541	CGC		CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184	
CLCN2	1181	hgsc.bcm.edu	37	3	184064426	184064426	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr3:184064426T>C	ENST00000265593.4	-	24	2836	c.2665A>G	c.(2665-2667)Agc>Ggc	p.S889G	CLCN2_ENST00000423355.2_3'UTR|CLCN2_ENST00000457512.1_Missense_Mutation_p.S860G|CLCN2_ENST00000434054.2_Missense_Mutation_p.S845G|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000344937.7_Missense_Mutation_p.S872G	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	889					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)	p.S889G(1)		breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	TCGGAAGGGCTGCCCTCCCGG	0.632																																					p.S889G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2665G	3						.						55.0	54.0	54.0					3																	184064426		2203	4300	6503	185547120	SO:0001583	missense	1181	exon24			S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.2665A>G	3.37:g.184064426T>C	ENSP00000265593:p.Ser889Gly	Somatic		Capture	SOLID	Phase_I	185547120	NM_004366	B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	ENST00000265593.4	37	CCDS3263.1	.	.	.	.	.	.	.	.	.	.	t	16.34	3.095104	0.56075	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.85258	-1.91;-1.85;-1.95;-1.96	5.37	5.37	0.77165	.	0.329744	0.35291	N	0.003314	T	0.78246	0.4253	L	0.44542	1.39	0.80722	D	1	B;B;B;B;B	0.24882	0.113;0.034;0.026;0.113;0.113	B;B;B;B;B	0.26310	0.031;0.031;0.068;0.031;0.031	T	0.72833	-0.4173	10	0.30078	T	0.28	-18.0498	7.8851	0.29646	0.0:0.0733:0.1393:0.7874	.	845;860;872;889;845	E9PBD9;E9PCD2;P51788-3;P51788;B4DZ58	.;.;.;CLCN2_HUMAN;.	G	889;872;845;860	ENSP00000265593:S889G;ENSP00000345056:S872G;ENSP00000400425:S845G;ENSP00000391928:S860G	ENSP00000265593:S889G	S	-	1	0	CLCN2	185547120	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.285000	0.51716	2.051000	0.60960	0.459000	0.35465	AGC		CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1		
CLSTN3	9746	hgsc.bcm.edu	37	12	7303561	7303561	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr12:7303561C>T	ENST00000266546.6	+	16	2879	c.2429C>T	c.(2428-2430)cCc>cTc	p.P810L	CLSTN3_ENST00000537408.1_Missense_Mutation_p.P822L	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	810					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.P810L(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						GTTGCCCACCCCAGCCACGTG	0.632																																					p.P810L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2429T	12						.						79.0	62.0	68.0					12																	7303561		2203	4300	6503	7194828	SO:0001583	missense	9746	exon16			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.2429C>T	12.37:g.7303561C>T	ENSP00000266546:p.Pro810Leu	Somatic		Capture	SOLID	Phase_I	7194828	NM_014718	D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	ENST00000266546.6	37	CCDS8575.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944594	0.73672	.	.	ENSG00000139182	ENST00000266546;ENST00000537408	T;T	0.38077	1.16;1.16	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.55737	0.1939	L	0.53249	1.67	0.80722	D	1	D;B	0.89917	1.0;0.431	D;B	0.83275	0.996;0.358	T	0.48801	-0.9003	10	0.33141	T	0.24	-29.8271	17.346	0.87309	0.0:1.0:0.0:0.0	.	822;810	Q5UE57;Q9BQT9	.;CSTN3_HUMAN	L	810;822	ENSP00000266546:P810L;ENSP00000440679:P822L	ENSP00000266546:P810L	P	+	2	0	CLSTN3	7194828	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.134000	0.77268	2.510000	0.84645	0.462000	0.41574	CCC		CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
GPR133	283383	hgsc.bcm.edu	37	12	131488747	131488747	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr12:131488747A>T	ENST00000261654.5	+	11	1720	c.1161A>T	c.(1159-1161)aaA>aaT	p.K387N	GPR133_ENST00000535015.1_Missense_Mutation_p.K419N|GPR133_ENST00000376682.4_Missense_Mutation_p.K73N	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	387					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.K387N(1)		NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CCGTGGCCAAAATCCTGCCCA	0.592																																					p.K387N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1161T	12						.						83.0	73.0	77.0					12																	131488747		2203	4300	6503	130054700	SO:0001583	missense	283383	exon11			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1161A>T	12.37:g.131488747A>T	ENSP00000261654:p.Lys387Asn	Somatic		Capture	SOLID	Phase_I	130054700	NM_198827	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	A	12.49	1.954723	0.34471	.	.	ENSG00000111452	ENST00000261654;ENST00000535015;ENST00000544673;ENST00000545900;ENST00000376682	T;T;T	0.55588	0.53;0.51;0.56	5.12	-2.37	0.06643	.	0.180091	0.47852	D	0.000212	T	0.45875	0.1364	L	0.58810	1.83	0.09310	N	1	P;P	0.50066	0.931;0.732	P;B	0.46629	0.522;0.35	T	0.46359	-0.9197	10	0.54805	T	0.06	.	6.3879	0.21572	0.3285:0.1608:0.5107:0.0	.	419;387	B7ZLF7;Q6QNK2	.;GP133_HUMAN	N	387;419;78;83;73	ENSP00000261654:K387N;ENSP00000444425:K419N;ENSP00000365872:K73N	ENSP00000261654:K387N	K	+	3	2	GPR133	130054700	0.026000	0.19158	0.000000	0.03702	0.001000	0.01503	0.676000	0.25247	-0.669000	0.05289	-0.678000	0.03780	AAA		GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
EPHA5	2044	hgsc.bcm.edu	37	4	66467410	66467410	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr4:66467410C>T	ENST00000273854.3	-	3	1459	c.859G>A	c.(859-861)Ggg>Agg	p.G287R	EPHA5_ENST00000511294.1_Missense_Mutation_p.G287R|EPHA5_ENST00000354839.4_Missense_Mutation_p.G287R|EPHA5_ENST00000432638.2_Missense_Mutation_p.G287R	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	287	Cys-rich.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.G287R(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						ATGCATTTCCCGATGGGCACC	0.532										TSP Lung(17;0.13)																											p.G287R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G859A	4						.						75.0	79.0	78.0					4																	66467410		2203	4300	6503	66150005	SO:0001583	missense	2044	exon3			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.859G>A	4.37:g.66467410C>T	ENSP00000273854:p.Gly287Arg	Somatic		Capture	SOLID	Phase_I	66150005	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.732651	0.89482	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.78364	1.35;-1.17;1.35;-0.96	5.93	5.93	0.95920	Tyrosine-protein kinase, receptor class V, conserved site (1);	0.000000	0.64402	D	0.000006	D	0.91556	0.7333	M	0.92412	3.305	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.989;1.0;0.995;1.0	D	0.92573	0.6068	10	0.87932	D	0	.	20.3409	0.98764	0.0:1.0:0.0:0.0	.	287;287;287;287	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	R	287	ENSP00000273854:G287R;ENSP00000389208:G287R;ENSP00000346899:G287R;ENSP00000427638:G287R	ENSP00000273854:G287R	G	-	1	0	EPHA5	66150005	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.818000	0.86416	2.814000	0.96858	0.655000	0.94253	GGG		EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
GALNTL6	442117	hgsc.bcm.edu	37	4	173730579	173730579	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr4:173730579G>T	ENST00000506823.1	+	6	1278	c.621G>T	c.(619-621)aaG>aaT	p.K207N	GALNTL6_ENST00000508122.1_Missense_Mutation_p.K190N	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	207	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.K207N(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						TTCGCACCAAGAAAAGAGAAG	0.478																																					p.K207N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G621T	4						.						102.0	95.0	98.0					4																	173730579		2203	4300	6503	173967154	SO:0001583	missense	442117	exon6				CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.621G>T	4.37:g.173730579G>T	ENSP00000423313:p.Lys207Asn	Somatic		Capture	SOLID	Phase_I	173967154	NM_001034845	Q2L4S6	Missense_Mutation	SNP	ENST00000506823.1	37	CCDS34104.1	.	.	.	.	.	.	.	.	.	.	G	18.59	3.655881	0.67586	.	.	ENSG00000174473	ENST00000506823;ENST00000404275;ENST00000508122	T;T	0.60040	0.22;0.22	5.45	5.45	0.79879	Glycosyl transferase, family 2 (1);	0.000000	0.64402	D	0.000006	T	0.65790	0.2725	L	0.46885	1.475	0.80722	D	1	D	0.56287	0.975	P	0.61940	0.896	T	0.61763	-0.6996	10	0.34782	T	0.22	.	12.9272	0.58266	0.0745:0.0:0.9255:0.0	.	207	Q49A17	GLTL6_HUMAN	N	207;207;190	ENSP00000423313:K207N;ENSP00000423827:K190N	ENSP00000385382:K207N	K	+	3	2	GALNTL6	173967154	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	5.632000	0.67819	2.720000	0.93068	0.491000	0.48974	AAG		GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845	
COL4A6	1288	hgsc.bcm.edu	37	X	107434698	107434698	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chrX:107434698G>A	ENST00000372216.4	-	19	1349	c.1249C>T	c.(1249-1251)Cgt>Tgt	p.R417C	COL4A6_ENST00000334504.7_Missense_Mutation_p.R416C|COL4A6_ENST00000394872.2_Missense_Mutation_p.R417C|COL4A6_ENST00000538570.1_Missense_Mutation_p.R416C|COL4A6_ENST00000545689.1_Missense_Mutation_p.R416C	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	417	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.R416C(3)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						ATTGTGGTACGGCCTGGGTTT	0.557									Alport syndrome with Diffuse Leiomyomatosis																												p.R416C	Melanoma(87;1895 1945 2589 7165)											.	.	3	Substitution - Missense(3)	endometrium(2)|large_intestine(1)	c.C1246T	X						.						139.0	124.0	129.0					X																	107434698		2203	4300	6503	107321354	SO:0001583	missense	1288	exon19	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.1249C>T	X.37:g.107434698G>A	ENSP00000361290:p.Arg417Cys	Somatic		Capture	SOLID	Phase_I	107321354	NM_033641	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	G	9.314	1.056425	0.19907	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.97016	-4.21;-4.21;-4.21;-3.35;-4.21	5.35	4.41	0.53225	.	0.992702	0.08170	N	0.987098	D	0.95271	0.8466	L	0.29908	0.895	0.41999	D	0.990889	D;D;D;D	0.71674	0.997;0.997;0.998;0.997	P;P;P;P	0.54815	0.648;0.648;0.761;0.648	D	0.91435	0.5169	10	0.51188	T	0.08	.	9.849	0.41046	0.0:0.0:0.6281:0.3718	.	416;416;417;416	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	C	417;416;417;416;416;416	ENSP00000361290:R417C;ENSP00000334733:R416C;ENSP00000378340:R417C;ENSP00000443707:R416C;ENSP00000445236:R416C	ENSP00000334733:R416C	R	-	1	0	COL4A6	107321354	0.981000	0.34729	0.839000	0.33178	0.464000	0.32679	3.019000	0.49635	2.562000	0.86427	0.600000	0.82982	CGT		COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
AFF2	2334	hgsc.bcm.edu	37	X	148037697	148037697	+	Silent	SNP	C	C	A			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chrX:148037697C>A	ENST00000370460.2	+	11	2601	c.2122C>A	c.(2122-2124)Cgg>Agg	p.R708R	AFF2_ENST00000342251.3_Silent_p.R675R|AFF2_ENST00000370457.5_Silent_p.R675R|AFF2_ENST00000286437.5_Silent_p.R349R	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	708					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.R708R(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GCCAAAGTCTCGGGAATTCAT	0.488																																					p.R708R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2122A	X						.						95.0	97.0	97.0					X																	148037697		2203	4300	6503	147845397	SO:0001819	synonymous_variant	2334	exon11			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2122C>A	X.37:g.148037697C>A		Somatic		Capture	SOLID	Phase_I	147845397	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	ENST00000370460.2	37	CCDS14684.1																																																																																				AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
XDH	7498	hgsc.bcm.edu	37	2	31602775	31602775	+	Silent	SNP	C	C	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr2:31602775C>T	ENST00000379416.3	-	13	1248	c.1200G>A	c.(1198-1200)ccG>ccA	p.P400P		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	400	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)	p.P400P(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	GTATCTCCTCCGGGCTCAGCA	0.527																																					p.P400P	Colon(66;682 1445 30109 40147)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1200A	2						.						113.0	111.0	112.0					2																	31602775		2203	4300	6503	31456279	SO:0001819	synonymous_variant	7498	exon13			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.1200G>A	2.37:g.31602775C>T		Somatic		Capture	SOLID	Phase_I	31456279	NM_000379	Q16681|Q16712|Q4PJ16	Silent	SNP	ENST00000379416.3	37	CCDS1775.1																																																																																				XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
GTF2A1L	11036	hgsc.bcm.edu	37	2	48896892	48896892	+	Missense_Mutation	SNP	G	G	A	rs199722656		TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr2:48896892G>A	ENST00000403751.3	+	7	1047	c.1010G>A	c.(1009-1011)cGg>cAg	p.R337Q	STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.R1041Q|GTF2A1L_ENST00000430487.2_Missense_Mutation_p.R303Q|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.R1041Q|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.R1041Q|STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.R994Q|LHCGR_ENST00000420913.3_5'Flank|STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.R1041Q	NM_006872.3	NP_006863.2	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like	337					cognition (GO:0050890)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.R1041Q(1)|p.R1041L(1)		lung(7)	7		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TTAAGCATTCGGGTTACTGAT	0.308																																					p.R337Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1010A	2						.						105.0	115.0	112.0					2																	48896892		2202	4300	6502	48750396	SO:0001583	missense	286749	exon7			AF106857	CCDS46281.1, CCDS54359.1	2p16.3	2007-08-02			ENSG00000242441	ENSG00000242441			30727	protein-coding gene	gene with protein product	"""TFIIA alpha/beta like factor"""	605358				10364255, 11889132, 16525715	Standard	NM_006872		Approved	ALF		Q9UNN4	OTTHUMG00000152038	ENST00000403751.3:c.1010G>A	2.37:g.48896892G>A	ENSP00000384597:p.Arg337Gln	Somatic		Capture	SOLID	Phase_I	48750396	NM_006872	B4DY14|Q53FD9|Q5D050	Missense_Mutation	SNP	ENST00000403751.3	37	CCDS46281.1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.515730	0.00975	.	.	ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000242441;ENSG00000242441	ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751;ENST00000394749;ENST00000430487;ENST00000403751	T;T;T;T;T	0.08458	3.09;3.13;3.09;3.09;3.3	4.94	-0.953	0.10362	.	0.932479	0.08994	N	0.863947	T	0.01800	0.0057	N	0.00525	-1.395	0.35773	D	0.821091	B;B;B;B;B	0.09022	0.002;0.0;0.0;0.002;0.0	B;B;B;B;B	0.06405	0.001;0.0;0.0;0.002;0.001	T	0.49826	-0.8898	10	0.07030	T	0.85	.	5.4866	0.16753	0.6296:0.1359:0.2345:0.0	.	303;994;1041;337;1041	Q9UNN4-2;A8MXJ1;B5MCF5;Q9UNN4;Q53S48	.;.;.;TF2AY_HUMAN;.	Q	1041;1041;1041;1041;994;336;303;337	ENSP00000385499:R1041Q;ENSP00000385701:R1041Q;ENSP00000378236:R1041Q;ENSP00000311493:R1041Q;ENSP00000378234:R994Q	ENSP00000384597:R337Q	R	+	2	0	STON1-GTF2A1L;GTF2A1L	48750396	0.015000	0.18098	0.064000	0.19789	0.055000	0.15305	0.363000	0.20301	-0.228000	0.09869	-0.459000	0.05422	CGG		GTF2A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323852.4	NM_006872	
NAGK	55577	hgsc.bcm.edu	37	2	71298850	71298850	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr2:71298850C>T	ENST00000244204.6	+	4	310	c.248C>T	c.(247-249)gCg>gTg	p.A83V	NAGK_ENST00000428360.2_3'UTR|NAGK_ENST00000443872.2_Intron|NAGK_ENST00000455662.2_Missense_Mutation_p.A129V|NAGK_ENST00000443938.2_Missense_Mutation_p.A83V|NAGK_ENST00000418807.3_Missense_Mutation_p.A32V			Q9UJ70	NAGK_HUMAN	N-acetylglucosamine kinase	83					carbohydrate phosphorylation (GO:0046835)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|N-acetylglucosamine kinase activity (GO:0045127)	p.A83V(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|urinary_tract(1)	18					N-Acetyl-D-glucosamine(DB00141)	CAGGAGGACGCGGGGAGGATC	0.632																																					p.A129V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C386T	2						.						48.0	42.0	44.0					2																	71298850		2203	4300	6503	71152358	SO:0001583	missense	55577	exon4			AJ242910	CCDS33220.1, CCDS33220.2	2p24.3-p24.1	2008-02-05			ENSG00000124357	ENSG00000124357	2.7.1.59		17174	protein-coding gene	gene with protein product		606828				10824116	Standard	NM_017567		Approved	GNK	uc002shp.4	Q9UJ70	OTTHUMG00000153239	ENST00000244204.6:c.248C>T	2.37:g.71298850C>T	ENSP00000244204:p.Ala83Val	Somatic		Capture	SOLID	Phase_I	71152358	NM_017567	B4DLZ5|Q53HD5|Q6IA84|Q9BS29|Q9BVP0|Q9NV37	Missense_Mutation	SNP	ENST00000244204.6	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.303135|5.303135	0.95601|0.95601	.|.	.|.	ENSG00000124357|ENSG00000124357	ENST00000244204;ENST00000455662;ENST00000418807|ENST00000443938	T;T;T|.	0.33216|.	1.42;1.42;1.42|.	4.75|4.75	4.75|4.75	0.60458|0.60458	ATPase, BadF/BadG/BcrA/BcrD type (1);|.	0.053194|.	0.85682|.	D|.	0.000000|.	T|T	0.62221|0.62221	0.2410|0.2410	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	P|.	0.54590|.	0.756|.	T|T	0.58329|0.58329	-0.7655|-0.7655	10|5	0.28530|.	T|.	0.3|.	-36.2913|-36.2913	15.6243|15.6243	0.76840|0.76840	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	83|.	Q9UJ70|.	NAGK_HUMAN|.	V|W	83;129;32|105	ENSP00000244204:A83V;ENSP00000389087:A129V;ENSP00000396070:A32V|.	ENSP00000244204:A83V|.	A|R	+|+	2|1	0|2	NAGK|NAGK	71152358|71152358	1.000000|1.000000	0.71417|0.71417	0.204000|0.204000	0.23530|0.23530	0.963000|0.963000	0.63663|0.63663	6.732000|6.732000	0.74790|0.74790	2.620000|2.620000	0.88729|0.88729	0.563000|0.563000	0.77884|0.77884	GCG|CGG		NAGK-032	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471889.1		
OBP2A	29991	hgsc.bcm.edu	37	9	138439763	138439763	+	Silent	SNP	C	C	T	rs533103497		TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr9:138439763C>T	ENST00000539850.1	+	4	350	c.324C>T	c.(322-324)gaC>gaT	p.D108D	OBP2A_ENST00000340780.3_Silent_p.D108D|OBP2A_ENST00000371776.1_Silent_p.D108D|OBP2A_ENST00000342114.4_Nonsense_Mutation_p.R64*			Q9NY56	OBP2A_HUMAN	odorant binding protein 2A	108					response to stimulus (GO:0050896)|sensory perception of chemical stimulus (GO:0007606)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)	p.D108D(3)		endometrium(1)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	11				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		CCGGGACGGACGACTACGTCT	0.612																																					p.D108D												.	.	3	Substitution - coding silent(3)	urinary_tract(1)|large_intestine(1)|endometrium(1)	c.C324T	9						.						60.0	54.0	56.0					9																	138439763		2203	4300	6503	137579584	SO:0001819	synonymous_variant	29991	exon4			AJ251029	CCDS6992.1	9q34	2014-01-22			ENSG00000122136	ENSG00000122136		"""Lipocalins"""	23380	protein-coding gene	gene with protein product		164320					Standard	NM_014582		Approved	hOBPIIa, OBP, LCN13	uc004cgb.3	Q9NY56	OTTHUMG00000020909	ENST00000539850.1:c.324C>T	9.37:g.138439763C>T		Somatic		Capture	SOLID	Phase_I	137579584	NM_014582	Q5T8A3|Q9NY50|Q9NY53|Q9NY54|Q9NY55	Silent	SNP	ENST00000539850.1	37	CCDS6992.1	.	.	.	.	.	.	.	.	.	.	c	12.49	1.953679	0.34471	.	.	ENSG00000122136	ENST00000342114	.	.	.	2.25	-1.04	0.10068	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-41.1138	0.8831	0.01238	0.2262:0.3671:0.2464:0.1602	.	.	.	.	X	64	.	ENSP00000340950:R64X	R	+	1	2	OBP2A	137579584	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	-0.586000	0.05787	-0.254000	0.09500	-0.513000	0.04457	CGA		OBP2A-006	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397904.1	NM_014582	
ASAH2B	653308	hgsc.bcm.edu	37	10	52504980	52504980	+	Silent	SNP	A	A	T			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr10:52504980A>T	ENST00000374006.1	+	3	170	c.105A>T	c.(103-105)ccA>ccT	p.P35P	ASAH2B_ENST00000374007.1_Silent_p.P30P|ASAH2B_ENST00000185907.9_Silent_p.P30P|ASAH2B_ENST00000483649.1_Intron	NM_001079516.1	NP_001072984.1	P0C7U1	ASA2B_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2B	35								p.P35P(1)		large_intestine(2)|lung(2)	4						ATAGAGCACCAAAAGGCAGAA	0.448																																					p.P35P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A105T	10						.						1.0	1.0	1.0					10																	52504980		235	399	634	52174986	SO:0001819	synonymous_variant	653308	exon3			BI553338	CCDS31203.1	10q11.23	2010-05-04			ENSG00000204147	ENSG00000204147			23456	protein-coding gene	gene with protein product		610987				17334805	Standard	NM_001079516		Approved	bA449O16.3, ASAH2L	uc001jjg.4	P0C7U1	OTTHUMG00000018239	ENST00000374006.1:c.105A>T	10.37:g.52504980A>T		Somatic		Capture	SOLID	Phase_I	52174986	NM_001079516	B7Z261	Silent	SNP	ENST00000374006.1	37	CCDS31203.1																																																																																				ASAH2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048084.1		
APC	324	hgsc.bcm.edu	37	5	112128143	112128143	+	Splice_Site	SNP	C	C	T	rs62619935		TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr5:112128143C>T	ENST00000457016.1	+	7	1026	c.646C>T	c.(646-648)Cga>Tga	p.R216*	APC_ENST00000257430.4_Splice_Site_p.R216*|APC_ENST00000508376.2_Splice_Site_p.R216*			P25054	APC_HUMAN	adenomatous polyposis coli	216	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R216*(12)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTTATTTTAGCGAAGAATAGC	0.323		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R216X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	12	Substitution - Nonsense(12)	large_intestine(12)	c.C646T	5	GRCh37	CM992133	APC	M	rs62619935	.						52.0	51.0	51.0					5																	112128143		2202	4300	6502	112156042	SO:0001630	splice_region_variant	324	exon8	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.646-1C>T	5.37:g.112128143C>T		Somatic		Capture	SOLID	Phase_I	112156042	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	39	7.466758	0.98302	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.19	2.99	0.34606	.	0.630262	0.16042	N	0.232387	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.2274	1.7088	0.02888	0.2899:0.3634:0.2259:0.1208	rs62619935	.	.	.	X	216	.	.	R	+	1	2	APC	112156042	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	0.662000	0.25038	1.304000	0.44892	-0.158000	0.13435	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	Nonsense_Mutation
OXCT1	5019	hgsc.bcm.edu	37	5	41861484	41861484	+	Silent	SNP	T	T	G			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr5:41861484T>G	ENST00000196371.5	-	3	370	c.210A>C	c.(208-210)ccA>ccC	p.P70P		NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	70					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)	p.P70P(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	TAAGATTCTCTGGAATTCCAC	0.353																																					p.P70P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A210C	5						.						110.0	113.0	112.0					5																	41861484		2203	4300	6503	41897241	SO:0001819	synonymous_variant	5019	exon3			U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.210A>C	5.37:g.41861484T>G		Somatic		Capture	SOLID	Phase_I	41897241	NM_000436	B2R5V2|B7Z528	Silent	SNP	ENST00000196371.5	37	CCDS3937.1																																																																																				OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2	NM_000436	
HCN1	348980	hgsc.bcm.edu	37	5	45645417	45645417	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr5:45645417T>C	ENST00000303230.4	-	2	776	c.719A>G	c.(718-720)gAa>gGa	p.E240G		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	240					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.E240G(1)		NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						CATTCCTTTTTCTACAATAAG	0.383																																					p.E240G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A719G	5						.						57.0	54.0	55.0					5																	45645417		2203	4300	6503	45681174	SO:0001583	missense	348980	exon2			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.719A>G	5.37:g.45645417T>C	ENSP00000307342:p.Glu240Gly	Somatic		Capture	SOLID	Phase_I	45681174	NM_021072		Missense_Mutation	SNP	ENST00000303230.4	37	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	T	15.91	2.971390	0.53614	.	.	ENSG00000164588	ENST00000303230	D	0.97209	-4.29	5.37	5.37	0.77165	Ion transport (1);	0.000000	0.64402	D	0.000013	D	0.93913	0.8052	N	0.25647	0.755	0.80722	D	1	B	0.14012	0.009	B	0.20577	0.03	D	0.91017	0.4854	10	0.46703	T	0.11	.	15.3658	0.74519	0.0:0.0:0.0:1.0	.	240	O60741	HCN1_HUMAN	G	240	ENSP00000307342:E240G	ENSP00000307342:E240G	E	-	2	0	HCN1	45681174	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.038000	0.60285	0.454000	0.30748	GAA		HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
TSSK1B	83942	hgsc.bcm.edu	37	5	112769998	112769998	+	Missense_Mutation	SNP	G	G	A	rs201103634		TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr5:112769998G>A	ENST00000390666.3	-	1	730	c.539C>T	c.(538-540)gCg>gTg	p.A180V	CTD-2201G3.1_ENST00000383058.4_RNA|CTD-2201G3.1_ENST00000416046.2_RNA|CTD-2201G3.1_ENST00000510381.2_RNA|MCC_ENST00000408903.3_Intron	NM_032028.3	NP_114417.1	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1B	180	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	cytoplasmic vesicle (GO:0031410)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.A180V(2)		large_intestine(8)|ovary(2)|skin(2)|stomach(1)	13		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		GGCCGCATACGCTGGTGACCC	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		20845	0.0		0.001	False		,,,				2504	0.0				p.A180V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C539T	5						.	G	,VAL/ALA	0,4404		0,0,2202	60.0	60.0	60.0		,539	1.2	1.0	5		60	1,8599	1.2+/-3.3	0,1,4299	yes	intron,missense	MCC,TSSK1B	NM_001085377.1,NM_032028.3	,64	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	,probably-damaging	,180/368	112769998	1,13003	2202	4300	6502	112797897	SO:0001583	missense	83942	exon1			AF348076	CCDS4112.1	5q22.2	2008-10-23	2007-01-30	2007-01-30	ENSG00000212122	ENSG00000212122			14968	protein-coding gene	gene with protein product		610709	"""serine/threonine kinase 22D (spermiogenesis associated)"", ""testis-specific serine kinase 1"""	STK22D, TSSK1		15044604	Standard	NM_032028		Approved	SPOGA4, FKSG81	uc003kqm.2	Q9BXA7	OTTHUMG00000128835	ENST00000390666.3:c.539C>T	5.37:g.112769998G>A	ENSP00000375081:p.Ala180Val	Somatic		Capture	SOLID	Phase_I	112797897	NM_032028	B2R8D9	Missense_Mutation	SNP	ENST00000390666.3	37	CCDS4112.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	14.02	2.410677	0.42715	0.0	1.16E-4	ENSG00000212122	ENST00000390666	T	0.65916	-0.18	1.24	1.24	0.21308	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.34178	U	0.004183	T	0.68842	0.3045	L	0.56396	1.775	0.26102	N	0.980808	D	0.89917	1.0	D	0.83275	0.996	T	0.56739	-0.7929	10	0.87932	D	0	.	4.526	0.11981	0.0:0.0:0.6231:0.3768	.	180	Q9BXA7	TSSK1_HUMAN	V	180	ENSP00000375081:A180V	ENSP00000375081:A180V	A	-	2	0	TSSK1B	112797897	0.082000	0.21442	0.953000	0.39169	0.460000	0.32559	2.124000	0.42006	0.635000	0.30488	0.313000	0.20887	GCG		TSSK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250774.2	NM_032028	
ADAMTS19	171019	hgsc.bcm.edu	37	5	129072866	129072866	+	Silent	SNP	A	A	G			TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00Z-01A-01W-A005-10	TCGA-AA-A00Z-10A-01W-A005-10	g.chr5:129072866A>G	ENST00000274487.4	+	23	3724	c.3579A>G	c.(3577-3579)gaA>gaG	p.E1193E	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	1193	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E1193E(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GCTGCTGTGAAACATGCAGGG	0.488																																					p.E1193E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3579G	5						.						89.0	75.0	80.0					5																	129072866		2203	4300	6503	129100765	SO:0001819	synonymous_variant	171019	exon23			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.3579A>G	5.37:g.129072866A>G		Somatic		Capture	SOLID	Phase_I	129100765	NM_133638		Silent	SNP	ENST00000274487.4	37	CCDS4146.1																																																																																				ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
