#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AFAP1L2	84632	broad.mit.edu	37	10	116057007	116057007	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr10:116057007G>C	ENST00000304129.4	-	17	2308	c.2279C>G	c.(2278-2280)aCc>aGc	p.T760S	AFAP1L2_ENST00000369271.3_Missense_Mutation_p.T760S|AFAP1L2_ENST00000491814.1_5'UTR|AFAP1L2_ENST00000545353.1_Missense_Mutation_p.T813S			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2	760					inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)	p.T760S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		CAGGTGGGTGGTGTCCACGGT	0.642																																					p.T760S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2279G	10						.						53.0	45.0	48.0					10																	116057007		2203	4300	6503	116046997	SO:0001583	missense	84632	exon17			BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.2279C>G	10.37:g.116057007G>C	ENSP00000303042:p.Thr760Ser	Somatic		Capture	Illumina HiSeq	Phase_I	116046997	NM_001001936	A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	Missense_Mutation	SNP	ENST00000304129.4	37	CCDS31286.1	.	.	.	.	.	.	.	.	.	.	G	12.59	1.983733	0.35036	.	.	ENSG00000169129	ENST00000369271;ENST00000304129;ENST00000392974;ENST00000545353	T;T;T	0.14266	2.52;2.59;2.58	5.39	5.39	0.77823	.	0.053269	0.85682	D	0.000000	T	0.13970	0.0338	L	0.28192	0.835	0.40018	D	0.975374	P;P;P;B;P;B	0.46784	0.708;0.884;0.763;0.328;0.472;0.341	B;B;P;B;B;B	0.45474	0.269;0.411;0.482;0.155;0.136;0.064	T	0.10337	-1.0634	10	0.21540	T	0.41	-32.4467	17.4007	0.87459	0.0:0.0:1.0:0.0	.	813;326;282;788;760;760	F5GZE1;B7Z363;Q8N4X5-3;Q8N4X5-4;Q8N4X5-2;Q8N4X5	.;.;.;.;.;AF1L2_HUMAN	S	760;760;787;813	ENSP00000358276:T760S;ENSP00000303042:T760S;ENSP00000444511:T813S	ENSP00000303042:T760S	T	-	2	0	AFAP1L2	116046997	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.985000	0.76193	2.536000	0.85505	0.556000	0.70494	ACC		AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050462.1	NM_032550	
CTBP2	1488	broad.mit.edu	37	10	126714720	126714720	+	Intron	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr10:126714720G>A	ENST00000337195.5	-	3	458				CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000309035.6_Missense_Mutation_p.P537S|CTBP2_ENST00000531469.1_Intron|CTBP2_ENST00000411419.2_Intron	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)	p.P537S(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		TTCTGGTACGGTGAGTGAGGC	0.677																																					p.P537S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1609T	10						.						78.0	79.0	79.0					10																	126714720		2203	4300	6503	126704710	SO:0001627	intron_variant	1488	exon1			AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+12845C>T	10.37:g.126714720G>A		Somatic		Capture	Illumina HiSeq	Phase_I	126704710	NM_022802	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Missense_Mutation	SNP	ENST00000337195.5	37	CCDS7643.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.637153	0.29157	.	.	ENSG00000175029	ENST00000309035	D	0.82984	-1.67	5.29	1.43	0.22495	.	1.506000	0.04226	N	0.334389	T	0.77170	0.4091	.	.	.	0.23445	N	0.997663	B	0.15930	0.015	B	0.16289	0.015	T	0.61496	-0.7051	9	0.52906	T	0.07	.	9.8811	0.41233	0.2747:0.0:0.7253:0.0	.	537	P56545-2	.	S	537	ENSP00000311825:P537S	ENSP00000311825:P537S	P	-	1	0	CTBP2	126704710	0.991000	0.36638	0.003000	0.11579	0.856000	0.48823	2.152000	0.42272	0.075000	0.16796	0.591000	0.81541	CCG		CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914	
KIAA1462	57608	broad.mit.edu	37	10	30316485	30316485	+	Silent	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr10:30316485C>T	ENST00000375377.1	-	3	2693	c.2592G>A	c.(2590-2592)gcG>gcA	p.A864A		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	864					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)		p.A864A(1)		breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						GCTGCGGCTCCGCCTCACTCT	0.572																																					p.A864A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2592A	10						.						49.0	55.0	53.0					10																	30316485		2142	4260	6402	30356491	SO:0001819	synonymous_variant	57608	exon3			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.2592G>A	10.37:g.30316485C>T		Somatic		Capture	Illumina HiSeq	Phase_I	30356491	NM_020848	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Silent	SNP	ENST00000375377.1	37	CCDS41500.1																																																																																				KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848	
SLC18A3	6572	broad.mit.edu	37	10	50819714	50819714	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr10:50819714C>T	ENST00000374115.3	+	1	1368	c.928C>T	c.(928-930)Ccc>Tcc	p.P310S	CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000455728.2_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000337653.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	310					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)	p.P310S(1)		endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						CTTCCTCGAACCCACCATTGC	0.637																																					p.P310S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C928T	10						.						75.0	72.0	73.0					10																	50819714		2203	4300	6503	50489720	SO:0001583	missense	6572	exon1			BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.928C>T	10.37:g.50819714C>T	ENSP00000363229:p.Pro310Ser	Somatic		Capture	Illumina HiSeq	Phase_I	50489720	NM_003055	B2R7S1	Missense_Mutation	SNP	ENST00000374115.3	37	CCDS7231.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.077951	0.76528	.	.	ENSG00000187714	ENST00000374115	T	0.56103	0.48	5.25	5.25	0.73442	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	U	0.000001	T	0.78910	0.4358	M	0.89658	3.05	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83699	0.0181	10	0.87932	D	0	-1.7633	18.8486	0.92218	0.0:1.0:0.0:0.0	.	310	Q16572	VACHT_HUMAN	S	310	ENSP00000363229:P310S	ENSP00000363229:P310S	P	+	1	0	SLC18A3	50489720	1.000000	0.71417	1.000000	0.80357	0.626000	0.37791	6.060000	0.71141	2.469000	0.83416	0.561000	0.74099	CCC		SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	NM_003055	
OIT3	170392	broad.mit.edu	37	10	74684316	74684316	+	Silent	SNP	C	C	T	rs536250413		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr10:74684316C>T	ENST00000334011.5	+	7	1499	c.1281C>T	c.(1279-1281)agC>agT	p.S427S		NM_152635.1	NP_689848.1	Q8WWZ8	OIT3_HUMAN	oncoprotein induced transcript 3	427	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.S427S(1)		autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)	35	Prostate(51;0.0198)					TGCACGTGAGCGGCTTGGAAA	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		19372	0.0		0.0	False		,,,				2504	0.001				p.S427S	Colon(7;19 345 13446 17537)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1281T	10						.						94.0	83.0	87.0					10																	74684316		2203	4300	6503	74354322	SO:0001819	synonymous_variant	170392	exon7				CCDS7318.1	10q22.2-q22.3	2004-04-21			ENSG00000138315	ENSG00000138315			29953	protein-coding gene	gene with protein product		609330				12975309, 12939600	Standard	NM_152635		Approved	LZP, FLJ39116	uc001jte.1	Q8WWZ8	OTTHUMG00000018444	ENST00000334011.5:c.1281C>T	10.37:g.74684316C>T		Somatic		Capture	Illumina HiSeq	Phase_I	74354322	NM_152635	A0AVP3|Q8N1M8	Silent	SNP	ENST00000334011.5	37	CCDS7318.1																																																																																				OIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048596.1	NM_152635	
KCNMA1	3778	broad.mit.edu	37	10	78649241	78649241	+	Silent	SNP	A	A	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr10:78649241A>T	ENST00000286628.8	-	27	3428	c.3429T>A	c.(3427-3429)gcT>gcA	p.A1143A	KCNMA1_ENST00000404857.1_Silent_p.A1126A|KCNMA1_ENST00000372443.1_Silent_p.A1112A|KCNMA1_ENST00000286627.5_Silent_p.A1085A|KCNMA1_ENST00000354353.5_Silent_p.A1146A|RP11-443A13.5_ENST00000429850.2_RNA|KCNMA1_ENST00000404771.3_Silent_p.A1143A|RP11-443A13.5_ENST00000595702.1_RNA|KCNMA1_ENST00000406533.3_Silent_p.A1147A|RP11-443A13.5_ENST00000458661.2_RNA|RP11-443A13.5_ENST00000609102.1_RNA|KCNMA1_ENST00000372440.1_Silent_p.A1085A	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	1143					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.A1085A(1)|p.A1147A(1)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	TGCTGAGGTGAGCATCTCTCA	0.448																																					p.A1126A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T3378A	10						.						90.0	88.0	89.0					10																	78649241		2203	4300	6503	78319247	SO:0001819	synonymous_variant	3778	exon27			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.3429T>A	10.37:g.78649241A>T		Somatic		Capture	Illumina HiSeq	Phase_I	78319247	NM_001161353	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Silent	SNP	ENST00000286628.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.85|10.85	1.465725|1.465725	0.26335|0.26335	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372421;ENST00000434208	.|.	.|.	.|.	6.17|6.17	3.07|3.07	0.35406|0.35406	.|.	.|.	.|.	.|.	.|.	T|T	0.47040|0.47040	0.1424|0.1424	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.30387|0.30387	-0.9980|-0.9980	4|4	.|.	.|.	.|.	-11.9652|-11.9652	3.8325|3.8325	0.08880|0.08880	0.2697:0.0:0.4289:0.3014|0.2697:0.0:0.4289:0.3014	.|.	.|.	.|.	.|.	H|T	1036|1074;793	.|.	.|.	L|S	-|-	2|1	0|0	KCNMA1|KCNMA1	78319247|78319247	0.992000|0.992000	0.36948|0.36948	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	0.208000|0.208000	0.17415|0.17415	0.325000|0.325000	0.23359|0.23359	-0.132000|-0.132000	0.14878|0.14878	CTC|TCA		KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
KCNMA1	3778	broad.mit.edu	37	10	78704708	78704708	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr10:78704708G>A	ENST00000286628.8	-	23	2724	c.2725C>T	c.(2725-2727)Cgg>Tgg	p.R909W	RP11-443A13.5_ENST00000600782.1_RNA|KCNMA1_ENST00000404857.1_Missense_Mutation_p.R892W|KCNMA1_ENST00000372443.1_Missense_Mutation_p.R851W|RP11-443A13.5_ENST00000426234.1_RNA|KCNMA1_ENST00000286627.5_Missense_Mutation_p.R851W|RP11-443A13.5_ENST00000598613.1_RNA|KCNMA1_ENST00000354353.5_Missense_Mutation_p.R912W|RP11-443A13.5_ENST00000608791.1_RNA|KCNMA1_ENST00000404771.3_Missense_Mutation_p.R909W|KCNMA1_ENST00000406533.3_Missense_Mutation_p.R913W|RP11-443A13.5_ENST00000458661.2_RNA|KCNMA1_ENST00000372440.1_Missense_Mutation_p.R851W	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	909					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.R851W(1)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	AAATCAGCCCGACTTAATGGC	0.453																																					p.R892W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2674T	10						.						110.0	91.0	97.0					10																	78704708		2203	4300	6503	78374714	SO:0001583	missense	3778	exon23			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2725C>T	10.37:g.78704708G>A	ENSP00000286628:p.Arg909Trp	Somatic		Capture	Illumina HiSeq	Phase_I	78374714	NM_001161353	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	ENST00000286628.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.9|24.9	4.581303|4.581303	0.86748|0.86748	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708|ENST00000372421;ENST00000434208	T;T;T;T;T;T;T;T;T|T	0.49720|0.45668	0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77|0.89	5.74|5.74	5.74|5.74	0.90152|0.90152	NAD(P)-binding domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.64724|0.64724	0.2624|0.2624	M|M	0.75615|0.75615	2.305|2.305	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D;D|.	0.97110|.	0.999;0.973;0.992;1.0;0.994;0.982;0.992;0.995|.	T|T	0.66152|0.66152	-0.5995|-0.5995	10|7	0.87932|0.66056	D|D	0|0.02	-11.3635|-11.3635	19.9196|19.9196	0.97082|0.97082	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	880;854;892;909;851;662;912;851|.	Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;F8WA96;Q5SVJ7|.	.;.;.;KCMA1_HUMAN;.;.;.;.|.	W|L	851;788;844;883;846;851;851;883;913;912;892;662|839;558	ENSP00000361517:R851W;ENSP00000361485:R788W;ENSP00000361514:R844W;ENSP00000396608:R883W;ENSP00000361520:R851W;ENSP00000286627:R851W;ENSP00000385552:R913W;ENSP00000346321:R912W;ENSP00000385806:R892W|ENSP00000402150:S558L	ENSP00000286627:R851W|ENSP00000361498:S839L	R|S	-|-	1|2	2|0	KCNMA1|KCNMA1	78374714|78374714	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.825000|7.825000	0.86693|0.86693	2.708000|2.708000	0.92522|0.92522	0.650000|0.650000	0.86243|0.86243	CGG|TCG		KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
GLRX3	10539	broad.mit.edu	37	10	131973136	131973136	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr10:131973136A>G	ENST00000368644.1	+	9	852	c.830A>G	c.(829-831)gAa>gGa	p.E277G	GLRX3_ENST00000331244.5_Missense_Mutation_p.E277G	NM_001199868.1	NP_001186797.1	O76003	GLRX3_HUMAN	glutaredoxin 3	277	Glutaredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00686}.				cell redox homeostasis (GO:0045454)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|regulation of the force of heart contraction (GO:0002026)	extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	electron carrier activity (GO:0009055)|iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein disulfide oxidoreductase activity (GO:0015035)	p.E277G(2)		endometrium(1)|large_intestine(5)|lung(7)	13		all_cancers(35;9.59e-07)|all_epithelial(44;1.48e-06)|Lung NSC(174;0.00566)|all_lung(145;0.00949)|Colorectal(57;0.142)|all_neural(114;0.16)|Breast(234;0.173)|Glioma(114;0.222)		OV - Ovarian serous cystadenocarcinoma(35;0.00218)		TGCAGTGTTGAATATGAAACA	0.318																																					p.E277G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A830G	10						.						193.0	184.0	187.0					10																	131973136		2203	4300	6503	131863126	SO:0001583	missense	10539	exon9			AJ010841	CCDS7661.1	10q26	2009-05-29	2007-08-16	2007-08-16	ENSG00000108010	ENSG00000108010			15987	protein-coding gene	gene with protein product	"""glutaredoxin 4"""	612754	"""thioredoxin-like 2"""	TXNL2		10636891, 11124703	Standard	NM_006541		Approved	PICOT, bA500G10.4, GRX3, GLRX4, GRX4	uc001lkm.2	O76003	OTTHUMG00000019267	ENST00000368644.1:c.830A>G	10.37:g.131973136A>G	ENSP00000357633:p.Glu277Gly	Somatic		Capture	Illumina HiSeq	Phase_I	131863126	NM_001199868	B3KMP7|B3KMQ5|D3DRG2|Q5JV01|Q96CE0|Q9P1B0|Q9P1B1	Missense_Mutation	SNP	ENST00000368644.1	37	CCDS7661.1	.	.	.	.	.	.	.	.	.	.	A	10.70	1.424157	0.25639	.	.	ENSG00000108010	ENST00000331244;ENST00000368644	T;T	0.33216	1.42;1.42	4.07	4.07	0.47477	Glutaredoxin (2);Thioredoxin-like fold (2);	0.390358	0.24165	N	0.040946	T	0.34019	0.0883	M	0.77103	2.36	0.39916	D	0.974096	B	0.02656	0.0	B	0.08055	0.003	T	0.21449	-1.0245	10	0.27785	T	0.31	-12.6646	12.0194	0.53333	1.0:0.0:0.0:0.0	.	277	O76003	GLRX3_HUMAN	G	277	ENSP00000330836:E277G;ENSP00000357633:E277G	ENSP00000330836:E277G	E	+	2	0	GLRX3	131863126	1.000000	0.71417	0.999000	0.59377	0.644000	0.38419	5.110000	0.64622	1.718000	0.51419	0.459000	0.35465	GAA		GLRX3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051021.1	NM_006541	
SIK3	23387	broad.mit.edu	37	11	116767012	116767012	+	Silent	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr11:116767012G>A	ENST00000292055.4	-	6	683	c.648C>T	c.(646-648)cgC>cgT	p.R216R	SIK3_ENST00000375300.1_Silent_p.R274R|SIK3_ENST00000542607.1_Silent_p.R216R|SIK3_ENST00000446921.2_Silent_p.R274R|SIK3_ENST00000434315.2_Silent_p.R115R|SIK3_ENST00000375288.1_5'UTR	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	216	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.R274R(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						CACTCAGCACGCGGGCCCGCA	0.527																																					p.R216R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C648T	11						.						108.0	104.0	105.0					11																	116767012		2201	4296	6497	116272222	SO:0001819	synonymous_variant	23387	exon6			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.648C>T	11.37:g.116767012G>A		Somatic		Capture	Illumina HiSeq	Phase_I	116272222	NM_025164	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Silent	SNP	ENST00000292055.4	37	CCDS8379.1	.	.	.	.	.	.	.	.	.	.	G	9.460	1.092780	0.20471	.	.	ENSG00000160584	ENST00000445177;ENST00000446921;ENST00000413553	T;T	0.67523	-0.27;-0.27	5.49	-3.69	0.04450	.	0.000000	0.38111	U	0.001819	T	0.62429	0.2427	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58691	-0.7592	7	0.72032	D	0.01	.	3.1398	0.06452	0.2101:0.2149:0.4249:0.1501	.	.	.	.	C	268;239;177	ENSP00000391295:R268C;ENSP00000414347:R177C	ENSP00000414347:R177C	R	-	1	0	SIK3	116272222	0.003000	0.15002	0.974000	0.42286	0.975000	0.68041	-1.407000	0.02488	-0.644000	0.05465	-1.274000	0.01402	CGT		SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_025164	
MUC5B	727897	broad.mit.edu	37	11	1256378	1256378	+	Silent	SNP	C	C	T	rs546384509		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr11:1256378C>T	ENST00000529681.1	+	22	2752	c.2694C>T	c.(2692-2694)taC>taT	p.Y898Y	MUC5B_ENST00000447027.1_Silent_p.Y901Y	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	898	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.|VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.Y901Y(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCGTGGCCTACGGGGATGGCC	0.652													c|||	1	0.000199681	0.0	0.0	5008	,	,		14475	0.0		0.0	False		,,,				2504	0.001				p.Y898Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2694T	11						.						56.0	65.0	62.0					11																	1256378		2110	4215	6325	1212954	SO:0001819	synonymous_variant	727897	exon22			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2694C>T	11.37:g.1256378C>T		Somatic		Capture	Illumina HiSeq	Phase_I	1212954	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																				MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
OR56B1	387748	broad.mit.edu	37	11	5757993	5757993	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr11:5757993G>T	ENST00000317121.3	+	1	313	c.247G>T	c.(247-249)Gcc>Tcc	p.A83S	TRIM5_ENST00000380027.1_Intron	NM_001005180.2	NP_001005180.1	Q8NGI3	O56B1_HUMAN	olfactory receptor, family 56, subfamily B, member 1	83						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A83S(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.086)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.184)		CATGGGTCTGGCCACTACTAT	0.463																																					p.A83S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G247T	11						.						193.0	168.0	176.0					11																	5757993		2201	4297	6498	5714569	SO:0001583	missense	387748	exon1			BK004386	CCDS31395.1	11p15.4	2012-08-09		2004-03-10	ENSG00000181023	ENSG00000181023		"""GPCR / Class A : Olfactory receptors"""	15245	protein-coding gene	gene with protein product				OR56B1P			Standard	NM_001005180		Approved		uc001mbt.2	Q8NGI3	OTTHUMG00000066891	ENST00000317121.3:c.247G>T	11.37:g.5757993G>T	ENSP00000322939:p.Ala83Ser	Somatic		Capture	Illumina HiSeq	Phase_I	5714569	NM_001005180	B2RNY6|B3KV42|Q6IF76	Missense_Mutation	SNP	ENST00000317121.3	37	CCDS31395.1	.	.	.	.	.	.	.	.	.	.	G	0.691	-0.794588	0.02862	.	.	ENSG00000181023	ENST00000317121	T	0.00444	7.4	5.91	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.339260	0.21241	U	0.077820	T	0.00144	0.0004	N	0.01284	-0.91	0.24585	N	0.993858	B	0.25719	0.132	B	0.27608	0.081	T	0.42327	-0.9458	10	0.02654	T	1	-9.9782	6.987	0.24733	0.0848:0.0:0.7418:0.1734	.	83	Q8NGI3	O56B1_HUMAN	S	83	ENSP00000322939:A83S	ENSP00000322939:A83S	A	+	1	0	OR56B1	5714569	0.000000	0.05858	0.999000	0.59377	0.534000	0.34807	0.108000	0.15396	2.801000	0.96364	0.655000	0.94253	GCC		OR56B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143354.1	NM_001005180	
RAPSN	5913	broad.mit.edu	37	11	47469685	47469685	+	Silent	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr11:47469685G>A	ENST00000298854.2	-	2	423	c.210C>T	c.(208-210)atC>atT	p.I70I	RAPSN_ENST00000529341.1_Silent_p.I70I|RAPSN_ENST00000352508.3_Silent_p.I70I|RAPSN_ENST00000524487.1_Silent_p.I70I	NM_005055.4	NP_005046.2	Q13702	RAPSN_HUMAN	receptor-associated protein of the synapse	70					positive regulation of neuron apoptotic process (GO:0043525)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)	acetylcholine receptor binding (GO:0033130)|zinc ion binding (GO:0008270)	p.I70I(1)		endometrium(1)|large_intestine(3)|lung(6)|ovary(2)	12						GGGCCGTGTCGATCTGGACCA	0.622																																					p.I70I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C210T	11						.						57.0	46.0	50.0					11																	47469685		2201	4297	6498	47426261	SO:0001819	synonymous_variant	5913	exon2				CCDS7936.1, CCDS7937.1	11p11.2	2009-04-28	2007-02-23		ENSG00000165917	ENSG00000165917		"""RING-type (C3HC4) zinc fingers"""	9863	protein-coding gene	gene with protein product	"""rapsyn"""	601592	"""receptor-associated protein of the synapse, 43kD"""			8812503	Standard	NM_005055		Approved	RNF205, CMS1D, CMS1E	uc001nfi.2	Q13702	OTTHUMG00000166891	ENST00000298854.2:c.210C>T	11.37:g.47469685G>A		Somatic		Capture	Illumina HiSeq	Phase_I	47426261	NM_005055	Q8TDF3|Q9BTD9	Silent	SNP	ENST00000298854.2	37	CCDS7936.1																																																																																				RAPSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391726.1		
PPFIA1	8500	broad.mit.edu	37	11	70221130	70221130	+	Silent	SNP	G	G	A	rs373783497		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr11:70221130G>A	ENST00000253925.7	+	24	3461	c.3246G>A	c.(3244-3246)ctG>ctA	p.L1082L	AP000487.5_ENST00000530690.1_RNA|PPFIA1_ENST00000530548.1_3'UTR|AP000487.5_ENST00000500185.2_RNA|PPFIA1_ENST00000389547.3_Silent_p.L1082L	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	1082	SAM 3. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)	p.L1082L(1)		breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			GAGCACTTCTGGCCTTAGATG	0.478													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16116	0.0		0.0	False		,,,				2504	0.0				p.L1082L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3246A	11						.	G	,	1,4399	2.1+/-5.4	0,1,2199	121.0	100.0	107.0		3246,3246	4.8	1.0	11		107	0,8588		0,0,4294	no	coding-synonymous,coding-synonymous	PPFIA1	NM_003626.2,NM_177423.1	,	0,1,6493	AA,AG,GG		0.0,0.0227,0.0077	,	1082/1203,1082/1186	70221130	1,12987	2200	4294	6494	69898778	SO:0001819	synonymous_variant	8500	exon24			U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.3246G>A	11.37:g.70221130G>A		Somatic		Capture	Illumina HiSeq	Phase_I	69898778	NM_003626	A6NLE3|Q13135|Q14567|Q8N4I2	Silent	SNP	ENST00000253925.7	37	CCDS31627.1																																																																																				PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626	
C2CD3	26005	broad.mit.edu	37	11	73825562	73825562	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr11:73825562C>T	ENST00000334126.7	-	10	1823	c.1597G>A	c.(1597-1599)Gcc>Acc	p.A533T	C2CD3_ENST00000313663.7_Missense_Mutation_p.A533T			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	533					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)		p.A533T(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					CCCAAAAGGGCCAGTCTATCC	0.453																																					p.A533T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1597A	11						.						172.0	142.0	152.0					11																	73825562		2200	4293	6493	73503210	SO:0001583	missense	26005	exon10			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.1597G>A	11.37:g.73825562C>T	ENSP00000334379:p.Ala533Thr	Somatic		Capture	Illumina HiSeq	Phase_I	73503210	NM_015531	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37		.	.	.	.	.	.	.	.	.	.	C	26.7	4.758357	0.89843	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681	T;T	0.08896	3.04;3.08	6.16	6.16	0.99307	.	0.114970	0.64402	D	0.000011	T	0.26048	0.0635	L	0.54323	1.7	0.44067	D	0.996819	D;D	0.89917	0.993;1.0	D;D	0.91635	0.928;0.999	T	0.00304	-1.1832	10	0.20519	T	0.43	-15.6754	20.4549	0.99139	0.0:1.0:0.0:0.0	.	533;533	Q4AC94;Q4AC94-1	C2CD3_HUMAN;.	T	533	ENSP00000334379:A533T;ENSP00000323339:A533T	ENSP00000323339:A533T	A	-	1	0	C2CD3	73503210	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.130000	0.42064	2.937000	0.99478	0.650000	0.86243	GCC		C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	
RNF169	254225	broad.mit.edu	37	11	74546664	74546664	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr11:74546664C>T	ENST00000299563.4	+	6	1029	c.1016C>T	c.(1015-1017)tCg>tTg	p.S339L		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	339					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)	p.S339L(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						CGCTGCGTCTCGGCCCCTGAC	0.498																																					p.S339L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1016T	11						.						99.0	102.0	101.0					11																	74546664		2009	4173	6182	74224312	SO:0001583	missense	254225	exon6			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.1016C>T	11.37:g.74546664C>T	ENSP00000299563:p.Ser339Leu	Somatic		Capture	Illumina HiSeq	Phase_I	74224312	NM_001098638	Q6N015	Missense_Mutation	SNP	ENST00000299563.4	37	CCDS41691.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700110	0.88924	.	.	ENSG00000166439	ENST00000299563	T	0.66280	-0.2	6.05	6.05	0.98169	.	0.079871	0.64402	D	0.000004	T	0.78233	0.4251	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.76244	-0.3030	10	0.46703	T	0.11	-14.6363	18.0951	0.89487	0.0:1.0:0.0:0.0	.	339	Q8NCN4	RN169_HUMAN	L	339	ENSP00000299563:S339L	ENSP00000299563:S339L	S	+	2	0	RNF169	74224312	1.000000	0.71417	0.992000	0.48379	0.957000	0.61999	7.240000	0.78192	2.878000	0.98634	0.650000	0.86243	TCG		RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384741.1	XM_495886	
TRIM49	57093	broad.mit.edu	37	11	89531783	89531783	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr11:89531783G>T	ENST00000329758.1	-	8	1202	c.874C>A	c.(874-876)Cat>Aat	p.H292N	TRIM49_ENST00000532501.2_Missense_Mutation_p.H215N	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	292	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.H292N(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TCTTCATGATGCAGAGTAATA	0.318																																					p.H292N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C874A	11						.						26.0	35.0	32.0					11																	89531783		2152	4295	6447	89171431	SO:0001583	missense	57093	exon8			AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.874C>A	11.37:g.89531783G>T	ENSP00000327604:p.His292Asn	Somatic		Capture	Illumina HiSeq	Phase_I	89171431	NM_020358	A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	ENST00000329758.1	37	CCDS8287.1	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.731399	0.00687	.	.	ENSG00000168930	ENST00000329758;ENST00000532501	T	0.59083	0.29	0.539	-1.05	0.10036	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.38639	0.1048	L	0.32530	0.975	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19257	-1.0311	7	.	.	.	.	.	.	.	.	292	P0CI25	TRI49_HUMAN	N	292;215	ENSP00000327604:H292N	.	H	-	1	0	TRIM49	89171431	0.000000	0.05858	0.003000	0.11579	0.018000	0.09664	0.056000	0.14256	-0.364000	0.08088	0.194000	0.17425	CAT		TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395435.1	NM_020358	
MCAM	4162	broad.mit.edu	37	11	119183068	119183068	+	Missense_Mutation	SNP	C	C	T	rs140965114	byFrequency	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr11:119183068C>T	ENST00000264036.4	-	8	946	c.932G>A	c.(931-933)cGg>cAg	p.R311Q	MCAM_ENST00000392814.1_Missense_Mutation_p.R260Q|MCAM_ENST00000530144.2_5'Flank	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	311	Ig-like C2-type 1.				anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R311Q(1)		breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		GTGTTCCTTCCGGGCAGGCTC	0.587													C|||	2	0.000399361	0.0	0.0014	5008	,	,		18268	0.001		0.0	False		,,,				2504	0.0				p.R311Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G932A	11						.						88.0	81.0	84.0					11																	119183068		2199	4295	6494	118688278	SO:0001583	missense	4162	exon8			X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.932G>A	11.37:g.119183068C>T	ENSP00000264036:p.Arg311Gln	Somatic		Capture	Illumina HiSeq	Phase_I	118688278	NM_006500	O95812|Q59E86|Q6PHR3|Q6ZTR2	Missense_Mutation	SNP	ENST00000264036.4	37	CCDS31690.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	0.099	-1.154749	0.01700	.	.	ENSG00000076706	ENST00000264036;ENST00000392814	T;T	0.11385	2.78;2.78	4.78	-9.56	0.00566	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.06005	0.0156	N	0.16368	0.405	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.44221	-0.9342	9	0.12103	T	0.63	-0.4956	17.9296	0.88992	0.0:0.6508:0.0:0.3492	.	311	P43121	MUC18_HUMAN	Q	311;260	ENSP00000264036:R311Q;ENSP00000376561:R260Q	ENSP00000264036:R311Q	R	-	2	0	MCAM	118688278	0.000000	0.05858	0.012000	0.15200	0.152000	0.21847	-1.138000	0.03216	-2.274000	0.00680	-2.069000	0.00389	CGG		MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2		
MMAB	326625	broad.mit.edu	37	12	109998860	109998860	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr12:109998860C>T	ENST00000545712.2	-	7	962	c.569G>A	c.(568-570)cGc>cAc	p.R190H	MMAB_ENST00000540016.1_Missense_Mutation_p.R138H|MMAB_ENST00000266839.5_Missense_Mutation_p.R99H	NM_052845.3	NP_443077.1	Q96EY8	MMAB_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblB type	190					cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|cob(I)yrinic acid a,c-diamide adenosyltransferase activity (GO:0008817)	p.R190H(1)		cervix(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTCGGCCCGGCGGCACACGGC	0.657																																					p.R190H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G569A	12	GRCh37	CM061118	MMAB	M		.						38.0	39.0	39.0					12																	109998860		2203	4299	6502	108483243	SO:0001583	missense	326625	exon7			AF550404	CCDS9131.1	12q24	2014-07-18	2005-07-11		ENSG00000139428	ENSG00000139428			19331	protein-coding gene	gene with protein product	"""ATP:cob(I)alamin adenosyltransferase"", ""cilia and flagella associated protein 23"""	607568	"""methylmalonic aciduria (cobalamin deficiency) type B"""			12471062, 12514191	Standard	NM_052845		Approved	cblB, CFAP23	uc001tou.3	Q96EY8	OTTHUMG00000169255	ENST00000545712.2:c.569G>A	12.37:g.109998860C>T	ENSP00000445920:p.Arg190His	Somatic		Capture	Illumina HiSeq	Phase_I	108483243	NM_052845	C5HU05|Q9BSH0	Missense_Mutation	SNP	ENST00000545712.2	37	CCDS9131.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.413213	0.83449	.	.	ENSG00000139428	ENST00000545712;ENST00000266839	D;D	0.98732	-5.1;-5.1	4.91	4.91	0.64330	Adenosylcobalamin biosynthesis, ATP:cob(I)alamin adenosyltransferase, PduO-type, N-terminal (2);Adenosylcobalamin biosynthesis, ATP:cob(I)alamin adenosyltransferase-like (2);Adenosylcobalamin biosynthesis, ATP:cob(I)alamin adenosyltransferase, EutT/PduO type (1);	0.000000	0.85682	D	0.000000	D	0.99545	0.9837	H	0.99357	4.53	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	D	0.97672	1.0167	10	0.87932	D	0	-25.5206	15.4029	0.74855	0.0:1.0:0.0:0.0	.	99;190;190	B4DHP4;B2R6J3;Q96EY8	.;.;MMAB_HUMAN	H	190;99	ENSP00000445920:R190H;ENSP00000266839:R99H	ENSP00000266839:R99H	R	-	2	0	MMAB	108483243	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	5.791000	0.69045	2.545000	0.85829	0.650000	0.86243	CGC		MMAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403128.2		
KRT76	51350	broad.mit.edu	37	12	53164972	53164972	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr12:53164972G>T	ENST00000332411.2	-	7	1348	c.1295C>A	c.(1294-1296)gCt>gAt	p.A432D		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	432	Coil 2.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.A432D(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						ACGCTGCTCAGCCTCTGCAAT	0.522																																					p.A432D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1295A	12						.						126.0	112.0	117.0					12																	53164972		2203	4300	6503	51451239	SO:0001583	missense	51350	exon7			M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.1295C>A	12.37:g.53164972G>T	ENSP00000330101:p.Ala432Asp	Somatic		Capture	Illumina HiSeq	Phase_I	51451239	NM_015848	B4DRR3|Q7Z795	Missense_Mutation	SNP	ENST00000332411.2	37	CCDS8838.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.919233	0.92249	.	.	ENSG00000185069	ENST00000332411	D	0.82803	-1.65	5.13	5.13	0.70059	Filament (1);	0.000000	0.46145	D	0.000308	D	0.92548	0.7633	M	0.87328	2.875	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93335	0.6704	10	0.87932	D	0	.	19.4674	0.94948	0.0:0.0:1.0:0.0	.	432	Q01546	K22O_HUMAN	D	432	ENSP00000330101:A432D	ENSP00000330101:A432D	A	-	2	0	KRT76	51451239	1.000000	0.71417	0.988000	0.46212	0.832000	0.47134	9.866000	0.99616	2.768000	0.95171	0.655000	0.94253	GCT		KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405928.1	NM_015848	
HMGA2	8091	broad.mit.edu	37	12	66308849	66308849	+	Intron	SNP	T	T	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr12:66308849T>A	ENST00000403681.2	+	4	1389				HMGA2_ENST00000536545.1_3'UTR|HMGA2_ENST00000354636.3_Missense_Mutation_p.L87Q|HMGA2_ENST00000393577.3_Intron|AC090673.2_ENST00000601398.1_Intron|HMGA2_ENST00000541363.1_Intron	NM_003483.4	NP_003474.1	P52926	HMGA2_HUMAN	high mobility group AT-hook 2						adrenal gland development (GO:0030325)|base-excision repair (GO:0006284)|cell proliferation in forebrain (GO:0021846)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|chromatin organization (GO:0006325)|chromosome breakage (GO:0031052)|chromosome condensation (GO:0030261)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA damage response, detection of DNA damage (GO:0042769)|endodermal cell differentiation (GO:0035987)|epithelial to mesenchymal transition (GO:0001837)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|heterochromatin assembly (GO:0031507)|histone H2A-S139 phosphorylation (GO:0035978)|male gonad development (GO:0008584)|mesenchymal cell differentiation (GO:0048762)|mesodermal cell differentiation (GO:0048333)|mesodermal-endodermal cell signaling (GO:0003131)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|multicellular organismal development (GO:0007275)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of DNA binding (GO:0043392)|negative regulation of double-strand break repair via nonhomologous end joining (GO:2001033)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|oncogene-induced cell senescence (GO:0090402)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of cellular response to X-ray (GO:2000685)|positive regulation of cellular senescence (GO:2000774)|positive regulation of gene expression (GO:0010628)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle process (GO:0010564)|regulation of cellular response to drug (GO:2001038)|regulation of growth hormone secretion (GO:0060123)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|senescence-associated heterochromatin focus assembly (GO:0035986)|signal transduction (GO:0007165)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|senescence-associated heterochromatin focus (GO:0035985)|SMAD protein complex (GO:0071141)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|AT DNA binding (GO:0003680)|C2H2 zinc finger domain binding (GO:0070742)|cAMP response element binding (GO:0035497)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|DNA-dependent protein kinase activity (GO:0004677)|MH1 domain binding (GO:0035501)|MH2 domain binding (GO:0035500)|nucleosomal DNA binding (GO:0031492)|regulatory region DNA binding (GO:0000975)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)	p.L87Q(1)	HMGA2/RAD51B(11)|HMGA2/CCNB1IP1(2)|HMGA2/WIF1_ENST00000286574(14)|HMGA2/ALDH2_ENST00000261733(2)|HMGA2/EBF1(2)|HMGA2/LHFP(2)|HMGA2/NFIB_ENST00000397581(8)|HMGA2/LPP(161)|HMGA2/FHIT_ENST00000476844(4)|HMGA2/COX6C(2)	lung(2)	2	all_cancers(1;5.78e-46)		GBM - Glioblastoma multiforme(1;0.00179)|LUSC - Lung squamous cell carcinoma(43;0.156)	GBM - Glioblastoma multiforme(28;0.0386)		GACAATCTACTACCAAGAACC	0.418			T	""" LHFP, RAD51L1, LPP, COX6C, CMKOR1, NFIB, ALDH2, CCNB1IP1, EBF1, WIF1, FHIT"""	"""lipoma, leiomyoma, pleiomorphic salivary gland adenoma"""																																p.L87Q			Dom	yes		12	12q15	8091	high mobility group AT-hook 2 (HMGIC)		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T260A	12						.						194.0	179.0	184.0					12																	66308849		2203	4300	6503	64595116	SO:0001627	intron_variant	8091	exon4			U28754	CCDS31854.1, CCDS44936.1, CCDS73491.1, CCDS73492.1	12q15	2011-07-01	2002-07-25	2002-07-26	ENSG00000149948	ENSG00000149948		"""High-mobility group / Canonical"""	5009	protein-coding gene	gene with protein product		600698	"""high-mobility group (nonhistone chromosomal) protein isoform I-C"""	HMGIC		8824803, 9003504	Standard	XM_006719620		Approved	BABL, LIPO	uc001ssx.3	P52926	OTTHUMG00000168936	ENST00000403681.2:c.250-36314T>A	12.37:g.66308849T>A		Somatic		Capture	Illumina HiSeq	Phase_I	64595116	NM_003484	E7EP85|E7EWA2|Q1M182|Q1M185|Q1M186|Q1M187|Q1M188	Missense_Mutation	SNP	ENST00000403681.2	37	CCDS44936.1	.	.	.	.	.	.	.	.	.	.	T	9.720	1.159518	0.21454	.	.	ENSG00000149948	ENST00000354636	.	.	.	3.24	0.721	0.18219	.	.	.	.	.	T	0.23171	0.0560	.	.	.	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.22417	-1.0217	6	.	.	.	.	5.9418	0.19198	0.4246:0.0:0.0:0.5754	.	87	Q1M182	.	Q	87	.	.	L	+	2	0	HMGA2	64595116	0.000000	0.05858	0.001000	0.08648	0.125000	0.20455	-0.381000	0.07417	0.141000	0.18875	0.379000	0.24179	CTA		HMGA2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401654.1	NM_003483	
MYF5	4617	broad.mit.edu	37	12	81111095	81111095	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr12:81111095C>T	ENST00000228644.3	+	1	405	c.253C>T	c.(253-255)Cgg>Tgg	p.R85W		NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5	85	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)	p.R85W(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						CATGGATCGGCGGAAGGCAGC	0.627																																					p.R85W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C253T	12						.						39.0	36.0	37.0					12																	81111095		2201	4298	6499	79635226	SO:0001583	missense	4617	exon1				CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.253C>T	12.37:g.81111095C>T	ENSP00000228644:p.Arg85Trp	Somatic		Capture	Illumina HiSeq	Phase_I	79635226	NM_005593	Q6ISR9	Missense_Mutation	SNP	ENST00000228644.3	37	CCDS9020.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752573	0.69533	.	.	ENSG00000111049	ENST00000228644	D	0.99176	-5.52	6.06	0.672	0.17935	Myogenic basic muscle-specific protein (1);Helix-loop-helix DNA-binding (4);	0.000000	0.85682	D	0.000000	D	0.99566	0.9844	H	0.98466	4.24	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98609	1.0662	10	0.87932	D	0	-4.7119	17.0216	0.86435	0.67:0.33:0.0:0.0	.	85	P13349	MYF5_HUMAN	W	85	ENSP00000228644:R85W	ENSP00000228644:R85W	R	+	1	2	MYF5	79635226	0.001000	0.12720	0.996000	0.52242	0.994000	0.84299	-0.522000	0.06237	0.114000	0.18032	-0.152000	0.13540	CGG		MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407757.1	NM_005593	
CCER1	196477	broad.mit.edu	37	12	91348043	91348043	+	Silent	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr12:91348043C>T	ENST00000358859.2	-	1	910	c.477G>A	c.(475-477)ccG>ccA	p.P159P	CCER1_ENST00000548187.1_Intron	NM_152638.2	NP_689851.1	Q8TC90	CCER1_HUMAN	coiled-coil glutamate-rich protein 1	159								p.P159P(3)									GCGGGCTCCGCGGGTAGGAGT	0.706																																					p.P159P												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G477A	12						.						21.0	24.0	23.0					12																	91348043		2198	4295	6493	89872174	SO:0001819	synonymous_variant	196477	exon1			BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651			28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12		17967063	Standard	NM_152638		Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000358859.2:c.477G>A	12.37:g.91348043C>T		Somatic		Capture	Illumina HiSeq	Phase_I	89872174	NM_152638	Q8TC47	Silent	SNP	ENST00000358859.2	37	CCDS9036.1																																																																																				CCER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407142.2	NM_152638	
DNAH10	196385	broad.mit.edu	37	12	124330608	124330608	+	Silent	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr12:124330608G>A	ENST00000409039.3	+	31	5392	c.5367G>A	c.(5365-5367)acG>acA	p.T1789T		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1789	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T1789T(1)|p.T381T(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GCCAGTGCACGGGAACCTTTG	0.592																																					p.T1789T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G5367A	12						.						75.0	80.0	78.0					12																	124330608		1993	4159	6152	122896561	SO:0001819	synonymous_variant	196385	exon31			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.5367G>A	12.37:g.124330608G>A		Somatic		Capture	Illumina HiSeq	Phase_I	122896561	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	CCDS9255.2																																																																																				DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
NBEA	26960	broad.mit.edu	37	13	35806653	35806653	+	Silent	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr13:35806653G>A	ENST00000400445.3	+	34	6207	c.5673G>A	c.(5671-5673)gcG>gcA	p.A1891A	NBEA_ENST00000310336.4_Silent_p.A1891A|NBEA_ENST00000379939.2_Silent_p.A1888A|NBEA_ENST00000540320.1_Silent_p.A1891A	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1891					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.A1891A(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TTGAAAGAGCGTTAGAAAAAG	0.313																																					p.A1891A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5673A	13						.						57.0	50.0	52.0					13																	35806653		1784	4006	5790	34704653	SO:0001819	synonymous_variant	26960	exon34			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.5673G>A	13.37:g.35806653G>A		Somatic		Capture	Illumina HiSeq	Phase_I	34704653	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	ENST00000400445.3	37	CCDS45026.1																																																																																				NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
POTEB2	100287399	broad.mit.edu	37	15	21071386	21071386	+	Silent	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr15:21071386G>A	ENST00000454856.4	-	1	257	c.225C>T	c.(223-225)agC>agT	p.S75S		NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2	75								p.S75S(1)									TGCTCTTGCCGCTCCCCCTGC	0.582																																					p.S112S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C336T	15						.						1.0	1.0	1.0					15																	21071386		39	320	359	19335965	SO:0001819	synonymous_variant	339010	exon1				CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829	ENST00000454856.4:c.225C>T	15.37:g.21071386G>A		Somatic		Capture	Illumina HiSeq	Phase_I	19335965	NM_207355		Silent	SNP	ENST00000454856.4	37	CCDS59248.1																																																																																				POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471435.1		
HERC2	8924	broad.mit.edu	37	15	28419592	28419592	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr15:28419592C>T	ENST00000261609.7	-	65	10114	c.10006G>A	c.(10006-10008)Gag>Aag	p.E3336K		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.E3336K(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AGGACGGGCTCGTGGACAGAG	0.522																																					p.E3336K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G10006A	15						.																																			26093187	SO:0001583	missense	8924	exon65			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.10006G>A	15.37:g.28419592C>T	ENSP00000261609:p.Glu3336Lys	Somatic		Capture	Illumina HiSeq	Phase_I	26093187	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659957	0.67586	.	.	ENSG00000128731	ENST00000261609	T	0.41065	1.01	5.72	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.61999	0.2392	M	0.70275	2.135	0.58432	D	0.999999	D	0.89917	1.0	D	0.73708	0.981	T	0.62238	-0.6896	10	0.37606	T	0.19	.	14.4954	0.67683	0.0:0.9296:0.0:0.0704	.	3336	O95714	HERC2_HUMAN	K	3336	ENSP00000261609:E3336K	ENSP00000261609:E3336K	E	-	1	0	HERC2	26093187	1.000000	0.71417	0.774000	0.31636	0.120000	0.20174	6.066000	0.71185	1.424000	0.47217	0.591000	0.81541	GAG		HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
TRPM7	54822	broad.mit.edu	37	15	50903411	50903411	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr15:50903411G>A	ENST00000313478.7	-	17	2440	c.2159C>T	c.(2158-2160)aCc>aTc	p.T720I	TRPM7_ENST00000560955.1_Missense_Mutation_p.T720I	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	720			T -> S (in a breast infiltrating ductal carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.T720S(1)|p.T720I(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		CTTAAGGCAGGTTGAATTACT	0.398																																					p.T720I												TRPM7,breast,NS,Substitution - Missense,0 	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.C2159T	15						.						142.0	127.0	132.0					15																	50903411		1836	4099	5935	48690703	SO:0001583	missense	54822	exon17			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.2159C>T	15.37:g.50903411G>A	ENSP00000320239:p.Thr720Ile	Somatic		Capture	Illumina HiSeq	Phase_I	48690703	NM_017672	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	37	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.826068	0.90955	.	.	ENSG00000092439	ENST00000313478	T	0.73047	-0.71	5.73	5.73	0.89815	.	0.048146	0.85682	N	0.000000	D	0.87826	0.6275	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.89527	0.3782	10	0.87932	D	0	-10.402	19.8961	0.96958	0.0:0.0:1.0:0.0	.	720	Q96QT4	TRPM7_HUMAN	I	720	ENSP00000320239:T720I	ENSP00000320239:T720I	T	-	2	0	TRPM7	48690703	1.000000	0.71417	0.948000	0.38648	0.859000	0.49053	9.869000	0.99810	2.699000	0.92147	0.655000	0.94253	ACC		TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	
GRAMD2	196996	broad.mit.edu	37	15	72458996	72458996	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr15:72458996T>C	ENST00000309731.7	-	7	533	c.520A>G	c.(520-522)Agg>Ggg	p.R174G	GRAMD2_ENST00000564184.1_5'UTR	NM_001012642.2	NP_001012660.1	Q8IUY3	GRAM2_HUMAN	GRAM domain containing 2	174						integral component of membrane (GO:0016021)		p.R174G(1)		cervix(2)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	13						CAGACTCTCCTCAGCAGGTCA	0.552																																					p.R174G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A520G	15						.						80.0	73.0	75.0					15																	72458996		2199	4297	6496	70246050	SO:0001583	missense	196996	exon7			AK002016	CCDS32283.1	15q23	2006-11-29	2005-11-03	2005-11-03					27287	protein-coding gene	gene with protein product						12477932	Standard	NM_001012642		Approved		uc002atq.3	Q8IUY3		ENST00000309731.7:c.520A>G	15.37:g.72458996T>C	ENSP00000311657:p.Arg174Gly	Somatic		Capture	Illumina HiSeq	Phase_I	70246050	NM_001012642	B3KT68	Missense_Mutation	SNP	ENST00000309731.7	37	CCDS32283.1	.	.	.	.	.	.	.	.	.	.	T	19.14	3.770196	0.69992	.	.	ENSG00000175318	ENST00000309731	T	0.34667	1.35	5.45	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.50480	0.1618	L	0.55481	1.735	0.49582	D	0.999805	D	0.89917	1.0	D	0.87578	0.998	T	0.39482	-0.9612	10	0.23302	T	0.38	.	10.647	0.45626	0.0:0.0:0.3071:0.6929	.	174	Q8IUY3	GRAM2_HUMAN	G	174	ENSP00000311657:R174G	ENSP00000311657:R174G	R	-	1	2	GRAMD2	70246050	0.991000	0.36638	1.000000	0.80357	0.987000	0.75469	1.226000	0.32563	0.889000	0.36185	-0.466000	0.05196	AGG		GRAMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420040.1	NM_001012642	
SALL1	6299	broad.mit.edu	37	16	51173899	51173899	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr16:51173899G>A	ENST00000251020.4	-	2	2267	c.2234C>T	c.(2233-2235)aCg>aTg	p.T745M	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.T648M|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	745					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T745M(2)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ATTCCCTTTCGTGGTGAAAGC	0.547																																					p.T745M	GBM(103;1352 1446 1855 4775 8890)											.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C2234T	16						.						61.0	63.0	62.0					16																	51173899		2198	4300	6498	49731400	SO:0001583	missense	6299	exon2			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2234C>T	16.37:g.51173899G>A	ENSP00000251020:p.Thr745Met	Somatic		Capture	Illumina HiSeq	Phase_I	49731400	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476370	0.44044	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.23147	1.92;1.92	5.3	5.3	0.74995	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.51856	0.1699	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.44559	-0.9320	10	0.34782	T	0.22	.	19.0235	0.92923	0.0:0.0:1.0:0.0	.	745	Q9NSC2	SALL1_HUMAN	M	745;648;709	ENSP00000251020:T745M;ENSP00000407914:T648M	ENSP00000251020:T745M	T	-	2	0	SALL1	49731400	1.000000	0.71417	0.994000	0.49952	0.221000	0.24807	9.869000	0.99810	2.490000	0.84030	0.454000	0.30748	ACG		SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
NUP88	4927	broad.mit.edu	37	17	5323535	5323535	+	5'Flank	SNP	C	C	T	rs3026147	byFrequency	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr17:5323535C>T	ENST00000573584.1	-	0	0				RPAIN_ENST00000327154.6_Missense_Mutation_p.A2V|RPAIN_ENST00000381208.5_Missense_Mutation_p.A2V|RPAIN_ENST00000574003.1_Missense_Mutation_p.A2V|RPAIN_ENST00000536255.2_Missense_Mutation_p.A2V|RPAIN_ENST00000381209.3_Missense_Mutation_p.A2V|RPAIN_ENST00000405578.4_Missense_Mutation_p.A2V	NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.A2E(1)|p.A2V(1)		endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						GAGGAGATGGCGGAGTCGTTG	0.632																																					p.A2V												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C5T	17						.						41.0	38.0	39.0					17																	5323535		2203	4300	6503	5264259	SO:0001631	upstream_gene_variant	84268	exon1			Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453		17.37:g.5323535C>T	Exception_encountered	Somatic		Capture	Illumina HiSeq	Phase_I	5264259	NM_001160244	D3DTM2|Q9BWE5	Missense_Mutation	SNP	ENST00000573584.1	37	CCDS11070.1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682932	0.68157	.	.	ENSG00000129197	ENST00000381209;ENST00000381208;ENST00000539417;ENST00000536255;ENST00000405578;ENST00000540734;ENST00000327154	T;T;T;T;T;T	0.52057	0.8;0.7;0.76;0.78;0.68;0.76	5.53	5.53	0.82687	.	0.444001	0.24361	N	0.039200	T	0.57666	0.2069	M	0.62723	1.935	0.25989	N	0.982272	D;D;P;D;P;P	0.69078	0.972;0.997;0.931;0.997;0.931;0.931	P;P;P;P;P;P	0.55011	0.552;0.766;0.454;0.766;0.454;0.454	T	0.56932	-0.7897	10	0.72032	D	0.01	-15.7891	11.8317	0.52299	0.1743:0.8257:0.0:0.0	.	2;2;2;2;2;2	F5GYE1;F5H3Q7;E9PES3;Q86UA6-6;E9PDG9;Q86UA6	.;.;.;.;.;RIP_HUMAN	V	2	ENSP00000370606:A2V;ENSP00000370605:A2V;ENSP00000446453:A2V;ENSP00000439939:A2V;ENSP00000385814:A2V;ENSP00000315069:A2V	ENSP00000315069:A2V	A	+	2	0	RPAIN	5264259	0.978000	0.34361	0.962000	0.40283	0.046000	0.14306	3.149000	0.50655	2.879000	0.98667	0.650000	0.86243	GCG		NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216918.3	NM_002532	
TBC1D28	254272	broad.mit.edu	37	17	18539849	18539849	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr17:18539849C>T	ENST00000345096.4	-	9	1258	c.559G>A	c.(559-561)Ggg>Agg	p.G187R	TBC1D28_ENST00000405044.1_Missense_Mutation_p.G187R			Q2M2D7	TBC28_HUMAN	TBC1 domain family, member 28	187	Rab-GAP TBC.						Rab GTPase activator activity (GO:0005097)	p.G187R(1)		breast(1)|large_intestine(5)|lung(2)|ovary(1)	9						TATCGCTGCCCGGGAATACTC	0.488																																					p.G187R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G559A	17						.						137.0	132.0	134.0					17																	18539849		1886	4127	6013	18480574	SO:0001583	missense	254272	exon10				CCDS42273.1	17p11.2	2008-10-27			ENSG00000189375	ENSG00000189375			26858	protein-coding gene	gene with protein product							Standard	NM_001039397		Approved	FLJ40244	uc002gud.2	Q2M2D7	OTTHUMG00000059054	ENST00000345096.4:c.559G>A	17.37:g.18539849C>T	ENSP00000339973:p.Gly187Arg	Somatic		Capture	Illumina HiSeq	Phase_I	18480574	NM_001039397	Q2M2E1	Missense_Mutation	SNP	ENST00000345096.4	37	CCDS42273.1	.	.	.	.	.	.	.	.	.	.	N	3.290	-0.145063	0.06627	.	.	ENSG00000189375	ENST00000345096;ENST00000405044	.	.	.	0.583	-0.65	0.11457	.	0.062472	0.64402	U	0.000008	T	0.39145	0.1067	L	0.29908	0.895	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.21518	-1.0243	8	0.72032	D	0.01	.	.	.	.	.	187	Q2M2D7	TBC28_HUMAN	R	187	.	ENSP00000339973:G187R	G	-	1	0	TBC1D28	18480574	0.015000	0.18098	0.011000	0.14972	0.044000	0.14063	0.064000	0.14437	-0.248000	0.09583	-0.403000	0.06358	GGG		TBC1D28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130672.2	NM_001039397	
CTC1	80169	broad.mit.edu	37	17	8135383	8135383	+	Silent	SNP	G	G	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr17:8135383G>T	ENST00000315684.8	-	13	2230	c.2223C>A	c.(2221-2223)ctC>ctA	p.L741L		NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	741					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)	p.L741L(1)		NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						TACGCTTCATGAGGGCCTCCT	0.597																																					p.L741L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2223A	17						.						23.0	25.0	24.0					17																	8135383		1892	4106	5998	8076108	SO:0001819	synonymous_variant	80169	exon13			AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.2223C>A	17.37:g.8135383G>T		Somatic		Capture	Illumina HiSeq	Phase_I	8076108	NM_025099	B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Silent	SNP	ENST00000315684.8	37	CCDS42259.1																																																																																				CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1	NM_025099	
GNA13	10672	broad.mit.edu	37	17	63049767	63049767	+	Silent	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr17:63049767C>T	ENST00000439174.2	-	2	608	c.363G>A	c.(361-363)aaG>aaA	p.K121K	RP11-583F2.5_ENST00000581796.1_RNA|GNA13_ENST00000541118.1_Silent_p.K26K	NM_006572.4	NP_006563.2	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein), alpha 13	121					activation of phospholipase D activity (GO:0031584)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|in utero embryonic development (GO:0001701)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 1 angiotensin receptor binding (GO:0031702)	p.K121K(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(14)|kidney(2)|large_intestine(4)|lung(6)|urinary_tract(1)	34						ACGACATCATCTTATCTCCAT	0.448																																					p.K121K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G363A	17						.						151.0	147.0	148.0					17																	63049767		2203	4300	6503	60480229	SO:0001819	synonymous_variant	10672	exon2			L22075	CCDS11661.1, CCDS62302.1	17q24.1	2014-09-04			ENSG00000120063	ENSG00000120063			4381	protein-coding gene	gene with protein product		604406				7791744	Standard	NM_006572		Approved	G13, MGC46138	uc002jfc.3	Q14344	OTTHUMG00000179316	ENST00000439174.2:c.363G>A	17.37:g.63049767C>T		Somatic		Capture	Illumina HiSeq	Phase_I	60480229	NM_006572	B2R977|B7Z7R0|F5H1G8|Q8TD70	Silent	SNP	ENST00000439174.2	37	CCDS11661.1																																																																																				GNA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445720.1	NM_006572	
DLGAP1	9229	broad.mit.edu	37	18	3814212	3814212	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr18:3814212C>T	ENST00000315677.3	-	5	1614	c.1019G>A	c.(1018-1020)cGa>cAa	p.R340Q	DLGAP1_ENST00000400155.1_Missense_Mutation_p.R46Q|DLGAP1_ENST00000478161.1_5'UTR|DLGAP1_ENST00000400145.2_Missense_Mutation_p.R38Q|DLGAP1_ENST00000400147.2_Missense_Mutation_p.R38Q|DLGAP1_ENST00000581699.1_Missense_Mutation_p.R46Q|snoU13_ENST00000459060.1_RNA|DLGAP1_ENST00000400149.3_Missense_Mutation_p.R48Q|DLGAP1_ENST00000515196.2_Missense_Mutation_p.R340Q|DLGAP1_ENST00000539435.1_Missense_Mutation_p.R38Q|DLGAP1_ENST00000584874.1_Missense_Mutation_p.R340Q|DLGAP1_ENST00000534970.1_Missense_Mutation_p.R52Q|DLGAP1_ENST00000400150.3_Missense_Mutation_p.R46Q|DLGAP1_ENST00000581527.1_Missense_Mutation_p.R340Q	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	340					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)		p.R340Q(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				CCGCATTCTTCGGCATGGAAT	0.448																																					p.R38Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G113A	18						.						130.0	121.0	124.0					18																	3814212		2203	4300	6503	3804212	SO:0001583	missense	9229	exon2			AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.1019G>A	18.37:g.3814212C>T	ENSP00000316377:p.Arg340Gln	Somatic		Capture	Illumina HiSeq	Phase_I	3804212	NM_001003809	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	37	CCDS11836.1	.	.	.	.	.	.	.	.	.	.	C	36	5.614492	0.96649	.	.	ENSG00000170579	ENST00000315677;ENST00000400147;ENST00000400150;ENST00000400149;ENST00000400155;ENST00000534970;ENST00000539435;ENST00000400145;ENST00000515196	T;T;T;T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.59838	0.2223	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.995;1.0;1.0;0.995;0.997	D;D;P;D;P;D;D;P;D	0.85130	0.992;0.992;0.899;0.994;0.838;0.997;0.996;0.754;0.922	T	0.59284	-0.7483	10	0.66056	D	0.02	-11.3595	20.422	0.99049	0.0:1.0:0.0:0.0	.	340;52;26;46;38;340;38;340;38	B7Z9Y4;B7Z2H2;B7Z2J5;A8MWN8;B7Z2I2;Q6IS01;O14490-3;O14490;O14490-2	.;.;.;.;.;.;.;DLGP1_HUMAN;.	Q	340;38;46;48;46;52;38;38;340	ENSP00000316377:R340Q;ENSP00000383011:R38Q;ENSP00000383014:R46Q;ENSP00000383013:R48Q;ENSP00000383019:R46Q;ENSP00000437817:R52Q;ENSP00000446312:R38Q;ENSP00000383010:R38Q;ENSP00000445973:R340Q	ENSP00000316377:R340Q	R	-	2	0	DLGAP1	3804212	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.726000	0.84824	2.832000	0.97577	0.655000	0.94253	CGA		DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4		
SMAD2	4087	broad.mit.edu	37	18	45374881	45374881	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr18:45374881C>T	ENST00000402690.2	-	8	1356	c.962G>A	c.(961-963)cGa>cAa	p.R321Q	SMAD2_ENST00000586040.1_Missense_Mutation_p.R291Q|SMAD2_ENST00000591214.1_Missense_Mutation_p.R291Q|SMAD2_ENST00000262160.6_Missense_Mutation_p.R321Q|SMAD2_ENST00000356825.4_Missense_Mutation_p.R291Q	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	321	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)	p.R321Q(2)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						CGTGGCATTTCGGTTAACATT	0.398																																					p.R291Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G872A	18						.						125.0	117.0	120.0					18																	45374881		2203	4300	6503	43628879	SO:0001583	missense	4087	exon7			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.962G>A	18.37:g.45374881C>T	ENSP00000384449:p.Arg321Gln	Somatic		Capture	Illumina HiSeq	Phase_I	43628879	NM_001135937		Missense_Mutation	SNP	ENST00000402690.2	37	CCDS11934.1	.	.	.	.	.	.	.	.	.	.	C	36	5.786143	0.96937	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	D;D;D	0.98296	-4.85;-4.85;-4.85	5.81	5.81	0.92471	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99263	0.9743	M	0.92833	3.35	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.974;1.0	D	0.99146	1.0857	10	0.87932	D	0	.	20.0912	0.97820	0.0:1.0:0.0:0.0	.	291;291;321	B7Z5N5;Q15796-2;Q15796	.;.;SMAD2_HUMAN	Q	321;291;321	ENSP00000262160:R321Q;ENSP00000349282:R291Q;ENSP00000384449:R321Q	ENSP00000262160:R321Q	R	-	2	0	SMAD2	43628879	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.746000	0.94184	0.591000	0.81541	CGA		SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450571.1	NM_005901	
ZNF429	353088	broad.mit.edu	37	19	21720030	21720030	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr19:21720030C>A	ENST00000358491.4	+	4	1383	c.1175C>A	c.(1174-1176)aCt>aAt	p.T392N	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	392					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T392N(1)		endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						AAAATTCATACTGGAGAGGAA	0.373																																					p.T392N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1175A	19						.						41.0	47.0	45.0					19																	21720030		2004	4201	6205	21511870	SO:0001583	missense	353088	exon4			AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.1175C>A	19.37:g.21720030C>A	ENSP00000351280:p.Thr392Asn	Somatic		Capture	Illumina HiSeq	Phase_I	21511870	NM_001001415	A6NLV7|Q9BZE6	Missense_Mutation	SNP	ENST00000358491.4	37	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	12.24	1.877277	0.33162	.	.	ENSG00000197013	ENST00000358491	T	0.26067	1.76	0.185	0.185	0.15096	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38401	0.1039	L	0.55743	1.74	0.32836	D	0.504727	D	0.63046	0.992	D	0.64410	0.925	T	0.50608	-0.8808	9	0.72032	D	0.01	.	7.9548	0.30035	0.0:0.9999:0.0:1.0E-4	.	392	Q86V71	ZN429_HUMAN	N	392	ENSP00000351280:T392N	ENSP00000351280:T392N	T	+	2	0	ZNF429	21511870	0.002000	0.14202	0.059000	0.19551	0.059000	0.15707	0.365000	0.20348	0.293000	0.22520	0.298000	0.19748	ACT		ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1	NM_001001415	
ZNF793	390927	broad.mit.edu	37	19	38028479	38028479	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr19:38028479G>A	ENST00000587143.1	+	6	1154	c.919G>A	c.(919-921)Gga>Aga	p.G307R	ZNF793_ENST00000542455.1_Missense_Mutation_p.G307R|ZNF793_ENST00000588578.1_3'UTR|ZNF793_ENST00000445217.1_Missense_Mutation_p.G307R|ZNF793_ENST00000589319.1_Intron			Q6ZN11	ZN793_HUMAN	zinc finger protein 793	307					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G307R(1)		kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AACACACACAGGAGAGAGACC	0.458																																					p.G307R	Melanoma(44;400 1431 1499 19093)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G919A	19						.						76.0	85.0	82.0					19																	38028479		2178	4286	6464	42720319	SO:0001583	missense	390927	exon8			AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.919G>A	19.37:g.38028479G>A	ENSP00000468605:p.Gly307Arg	Somatic		Capture	Illumina HiSeq	Phase_I	42720319	NM_001013659	E9PGN4|Q7Z3Q9	Missense_Mutation	SNP	ENST00000587143.1	37	CCDS46062.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.975066	0.74360	.	.	ENSG00000188227	ENST00000542455;ENST00000418827;ENST00000445217;ENST00000322299	T;T	0.26223	1.75;1.75	4.11	3.07	0.35406	.	0.000000	0.36519	N	0.002556	T	0.45736	0.1357	M	0.67700	2.07	0.39309	D	0.965035	D	0.76494	0.999	D	0.78314	0.991	T	0.49615	-0.8921	10	0.87932	D	0	.	10.7668	0.46299	0.0967:0.0:0.9033:0.0	.	307	E9PGN4	.	R	307;307;307;306	ENSP00000444355:G307R;ENSP00000396402:G307R	ENSP00000318811:G306R	G	+	1	0	ZNF793	42720319	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	4.360000	0.59455	1.054000	0.40438	0.637000	0.83480	GGA		ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458621.1	NM_001013659	
PAPL	390928	broad.mit.edu	37	19	39600716	39600716	+	Silent	SNP	C	C	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr19:39600716C>A	ENST00000331256.5	+	13	1549	c.1275C>A	c.(1273-1275)gtC>gtA	p.V425V	PAPL_ENST00000594229.1_3'UTR	NM_001004318.2	NP_001004318.2	Q6ZNF0	PAPL_HUMAN		425						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)|metal ion binding (GO:0046872)	p.V425V(1)									TAGATGATGTCTGGGTGGTGA	0.567											OREG0025457	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V425V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1275A	19						.						302.0	270.0	281.0					19																	39600716		2203	4300	6503	44292556	SO:0001819	synonymous_variant	390928	exon13																														ENST00000331256.5:c.1275C>A	19.37:g.39600716C>A		Somatic	887	Capture	Illumina HiSeq	Phase_I	44292556	NM_001004318	B2RN68	Silent	SNP	ENST00000331256.5	37	CCDS33018.1																																																																																				PAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463810.1		
VRK3	51231	broad.mit.edu	37	19	50493019	50493020	+	Missense_Mutation	DNP	CC	CC	AA	rs61745859	byFrequency	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	CC	CC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr19:50493019_50493020CC>AA	ENST00000599538.1	-	11	1636_1637	c.972_973GG>TT	c.(970-975)ttGGca>ttTTca	p.324_325LA>FS	VRK3_ENST00000594948.1_Missense_Mutation_p.324_325LA>FS|VRK3_ENST00000443401.2_Missense_Mutation_p.93_94LA>FS|VRK3_ENST00000594092.1_Missense_Mutation_p.324_325LA>FS|VRK3_ENST00000601912.1_Missense_Mutation_p.274_275LA>FS|VRK3_ENST00000316763.3_Missense_Mutation_p.324_325LA>FS|VRK3_ENST00000601341.1_Missense_Mutation_p.274_275LA>FS|VRK3_ENST00000593919.1_Missense_Mutation_p.324_325LA>FS|VRK3_ENST00000377011.2_Missense_Mutation_p.274_275LA>FS|VRK3_ENST00000424804.2_5'UTR			Q8IV63	VRK3_HUMAN	vaccinia related kinase 3	324	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.L324>?(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)|stomach(2)|urinary_tract(1)	23		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		CCATAGCCTGCCAAAGTCACCT	0.530																																					.	Pancreas(6;90 181 4352 12603 17050 34726 35237 44094)											.	.	1	Complex(1)	large_intestine(1)	c.822_823TT	19						.																																			55184832	SO:0001583	missense	51231	exon10			AB031052	CCDS12791.1, CCDS33076.1	19q13.33	2011-01-14			ENSG00000105053	ENSG00000105053			18996	protein-coding gene	gene with protein product							Standard	XM_005258971		Approved		uc002prh.1	Q8IV63		ENST00000599538.1:c.972_973delinsAA	19.37:g.50493019_50493020delinsAA	ENSP00000469880:p.L324_A325delinsFS	Somatic		Capture	Illumina HiSeq	Phase_I	55184831	NM_001025778	A6NEG5|A8KA53|Q502Y2|Q9P2V8	Missense_Mutation	DNP	ENST00000599538.1	37	CCDS12791.1																																																																																				VRK3-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464815.1	NM_016440	
NLRP12	91662	broad.mit.edu	37	19	54304502	54304502	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr19:54304502G>A	ENST00000324134.6	-	7	2903	c.2735C>T	c.(2734-2736)aCg>aTg	p.T912M	NLRP12_ENST00000345770.5_Missense_Mutation_p.T913M|NLRP12_ENST00000391772.1_Intron|NLRP12_ENST00000391773.1_Missense_Mutation_p.T913M|NLRP12_ENST00000354278.3_Intron|NLRP12_ENST00000351894.4_Intron|NLRP12_ENST00000391775.3_Missense_Mutation_p.T912M|NLRP12_ENST00000535162.1_Missense_Mutation_p.T912M	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	912					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.T912M(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GAGCTTGCACGTGGGATGCCT	0.627																																					p.T912M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2735T	19						.						66.0	62.0	63.0					19																	54304502		2203	4300	6503	58996314	SO:0001583	missense	91662	exon7			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.2735C>T	19.37:g.54304502G>A	ENSP00000319377:p.Thr912Met	Somatic		Capture	Illumina HiSeq	Phase_I	58996314	NM_144687	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	G	10.25	1.298977	0.23650	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000358661;ENST00000391775;ENST00000391773;ENST00000345770	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.45	-4.61	0.03380	.	0.885835	0.09284	N	0.823342	T	0.33731	0.0873	L	0.38175	1.15	0.09310	N	1	B;B;B;B	0.13145	0.003;0.007;0.007;0.004	B;B;B;B	0.10450	0.005;0.003;0.003;0.003	T	0.23868	-1.0176	10	0.48119	T	0.1	.	9.5993	0.39593	0.095:0.066:0.6525:0.1865	.	195;912;912;912	P59046-5;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	M	912;912;195;912;913;913	ENSP00000319377:T912M;ENSP00000438030:T912M;ENSP00000375655:T912M;ENSP00000375653:T913M	ENSP00000319377:T912M	T	-	2	0	NLRP12	58996314	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.248000	0.08854	-1.288000	0.02378	-1.150000	0.01838	ACG		NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
LILRA6	79168	broad.mit.edu	37	19	54744308	54744308	+	Missense_Mutation	SNP	C	C	T	rs201828111		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr19:54744308C>T	ENST00000396365.2	-	6	1139	c.1100G>A	c.(1099-1101)cGt>cAt	p.R367H	LILRA6_ENST00000245621.5_Missense_Mutation_p.R367H|LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000440558.2_Intron|LILRA6_ENST00000419410.2_Missense_Mutation_p.R367H|LILRA6_ENST00000270464.5_Intron|LILRA6_ENST00000391735.3_3'UTR	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	367	Ig-like C2-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.R367H(2)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGATCTCAGACGCAGTGGGGG	0.557																																					p.R367H												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.G1100A	19						.	C	HIS/ARG	0,4406		0,0,2203	61.0	91.0	81.0		1100	-3.7	0.0	19		81	1,8591	1.2+/-3.3	0,1,4295	no	missense	LILRA6	NM_024318.2	29	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077		367/482	54744308	1,12997	2203	4296	6499	59436120	SO:0001583	missense	79168	exon6			AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.1100G>A	19.37:g.54744308C>T	ENSP00000379651:p.Arg367His	Somatic		Capture	Illumina HiSeq	Phase_I	59436120	NM_024318		Missense_Mutation	SNP	ENST00000396365.2	37	CCDS42610.1	.	.	.	.	.	.	.	.	.	.	C	1.340	-0.594330	0.03771	0.0	1.16E-4	ENSG00000244482	ENST00000419410;ENST00000421123;ENST00000396365;ENST00000245621	T;T;T	0.03035	4.07;4.07;4.07	1.86	-3.72	0.04411	Immunoglobulin subtype (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.700449	0.12216	N	0.488788	T	0.02688	0.0081	L	0.41710	1.295	0.09310	N	0.999999	B;D;B	0.63046	0.121;0.992;0.178	B;B;B	0.40565	0.021;0.333;0.106	T	0.21724	-1.0237	10	0.27785	T	0.31	.	5.6296	0.17504	0.177:0.5877:0.0:0.2353	.	367;367;367	C9JFH3;Q6PI73;D3YTC4	.;LIRA6_HUMAN;.	H	367	ENSP00000411227:R367H;ENSP00000379651:R367H;ENSP00000245621:R367H	ENSP00000245621:R367H	R	-	2	0	LILRA6	59436120	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-5.497000	0.00118	-1.995000	0.00971	-1.373000	0.01185	CGT		LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318	
ZNF71	58491	broad.mit.edu	37	19	57132799	57132799	+	Silent	SNP	G	G	A	rs200880506		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr19:57132799G>A	ENST00000328070.6	+	3	378	c.144G>A	c.(142-144)ccG>ccA	p.P48P		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	48					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P48P(1)		endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		CAGAGAGGCCGCGGGGAGATG	0.617																																					p.P48P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G144A	19						.	G		0,4406		0,0,2203	34.0	35.0	34.0		144	-0.4	0.0	19		34	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZNF71	NM_021216.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		48/490	57132799	1,13005	2203	4300	6503	61824611	SO:0001819	synonymous_variant	58491	exon3			X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.144G>A	19.37:g.57132799G>A		Somatic		Capture	Illumina HiSeq	Phase_I	61824611	NM_021216	Q15919|Q9UC09|Q9UQD3	Silent	SNP	ENST00000328070.6	37	CCDS12947.1																																																																																				ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459798.2	NM_021216	
MUC16	94025	broad.mit.edu	37	19	9059933	9059933	+	Silent	SNP	C	C	T	rs372068481		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr19:9059933C>T	ENST00000397910.4	-	3	27716	c.27513G>A	c.(27511-27513)tcG>tcA	p.S9171S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9173	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S4804S(1)|p.S9171S(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCACAGGAAGCGAAGAAGAGT	0.507																																					p.S9171S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G27513A	19						.	A		0,4088		0,0,2044	90.0	86.0	87.0		27513	-4.3	0.0	19		87	1,8411		0,1,4205	no	coding-synonymous	MUC16	NM_024690.2		0,1,6249	TT,TC,CC		0.0119,0.0,0.0080		9171/14508	9059933	1,12499	2044	4206	6250	8920933	SO:0001819	synonymous_variant	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.27513G>A	19.37:g.9059933C>T		Somatic		Capture	Illumina HiSeq	Phase_I	8920933	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF211	10520	broad.mit.edu	37	19	58152733	58152733	+	Silent	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr19:58152733C>T	ENST00000347302.3	+	3	1058	c.879C>T	c.(877-879)ttC>ttT	p.F293F	ZNF211_ENST00000544273.1_Silent_p.F305F|ZNF211_ENST00000254182.7_Silent_p.F284F|ZNF211_ENST00000299871.5_Silent_p.F358F|ZNF211_ENST00000541801.1_Silent_p.F284F|ZNF211_ENST00000391703.3_Silent_p.F232F|ZNF211_ENST00000240731.4_Silent_p.F306F|ZNF211_ENST00000420680.1_Silent_p.F297F	NM_198855.2	NP_942152.1	Q13398	ZN211_HUMAN	zinc finger protein 211	293					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F306F(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GTGGAAAATTCTTTACCTACT	0.408																																					p.F293F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C879T	19						.						93.0	88.0	90.0					19																	58152733		2203	4300	6503	62844545	SO:0001819	synonymous_variant	10520	exon3			U38904	CCDS12956.1, CCDS12957.1, CCDS58686.1, CCDS58687.1, CCDS58688.1, CCDS74468.1	19q13.4	2013-01-08			ENSG00000121417	ENSG00000121417		"""Zinc fingers, C2H2-type"", ""-"""	13003	protein-coding gene	gene with protein product		601856				7633419, 9096115	Standard	NM_006385		Approved	ZNF-25, CH2H2-25	uc031rng.1	Q13398	OTTHUMG00000168012	ENST00000347302.3:c.879C>T	19.37:g.58152733C>T		Somatic		Capture	Illumina HiSeq	Phase_I	62844545	NM_198855	B4DH10|B4DLC9|B4E3C9|B9ZVS7|B9ZVW1|F8WDV2|Q05BQ7|Q2TAL7|Q59EG4|Q59G36|Q5EBL6	Silent	SNP	ENST00000347302.3	37	CCDS12957.1	.	.	.	.	.	.	.	.	.	.	C	5.300	0.240739	0.10077	.	.	ENSG00000121417	ENST00000407202	.	.	.	3.67	-2.87	0.05700	.	.	.	.	.	T	0.47173	0.1431	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	T	0.38436	-0.9661	4	.	.	.	.	4.5045	0.11881	0.1491:0.396:0.0:0.455	.	.	.	.	F	297	.	.	L	+	1	0	ZNF211	62844545	0.000000	0.05858	0.000000	0.03702	0.957000	0.61999	-1.529000	0.02223	-0.538000	0.06281	-1.129000	0.01985	CTT		ZNF211-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397502.1		
ELF3	1999	broad.mit.edu	37	1	201981851	201981852	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:201981851_201981852insC	ENST00000359651.3	+	4	3754_3755	c.562_563insC	c.(562-564)gccfs	p.A188fs	RP11-465N4.4_ENST00000419190.1_RNA|RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367284.5_Frame_Shift_Ins_p.A188fs|ELF3_ENST00000367283.3_Frame_Shift_Ins_p.A188fs					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						TGGCGCAGGAGCCCCCTCCCCT	0.668																																					p.A188fs												.	.	0			c.562_563insC	1						.																																			200248475	SO:0001589	frameshift_variant	1999	exon5			AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.567dupC	1.37:g.201981856_201981856dupC	ENSP00000352673:p.Ala188fs	None		Capture	Illumina HiSeq	Phase_I	200248474	NM_001114309		Frame_Shift_Ins	INS	ENST00000359651.3	37	CCDS1419.1																																																																																				ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
MTHFR	4524	broad.mit.edu	37	1	11854077	11854077	+	Silent	SNP	G	G	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:11854077G>T	ENST00000376592.1	-	8	1545	c.1417C>A	c.(1417-1419)Cgg>Agg	p.R473R	MTHFR_ENST00000376590.3_Silent_p.R473R|MTHFR_ENST00000376585.1_Silent_p.R514R|MTHFR_ENST00000376583.3_Silent_p.R514R			P42898	MTHR_HUMAN	methylenetetrahydrofolate reductase (NAD(P)H)	473					blood circulation (GO:0008015)|cellular amino acid metabolic process (GO:0006520)|folic acid metabolic process (GO:0046655)|homocysteine metabolic process (GO:0050667)|methionine biosynthetic process (GO:0009086)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to vitamin B2 (GO:0033274)|S-adenosylmethionine metabolic process (GO:0046500)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|neuron projection (GO:0043005)	flavin adenine dinucleotide binding (GO:0050660)|methylenetetrahydrofolate reductase (NAD(P)H) activity (GO:0004489)|modified amino acid binding (GO:0072341)|NADP binding (GO:0050661)	p.R473R(1)		NS(4)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Fluorouracil(DB00544)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Riboflavin(DB00140)|Tetrahydrofolic acid(DB00116)	CGGTTCACCCGCAGCAGCTCC	0.672																																					p.R473R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1417A	1						.						84.0	88.0	87.0					1																	11854077		2203	4300	6503	11776664	SO:0001819	synonymous_variant	4524	exon9			BC053509	CCDS137.1	1p36.3	2014-09-17	2010-05-04		ENSG00000177000	ENSG00000177000	1.5.1.20		7436	protein-coding gene	gene with protein product		607093	"""5,10-methylenetetrahydrofolate reductase (NADPH)"""			7920641	Standard	NM_005957		Approved		uc001atc.2	P42898	OTTHUMG00000002277	ENST00000376592.1:c.1417C>A	1.37:g.11854077G>T		Somatic		Capture	Illumina HiSeq	Phase_I	11776664	NM_005957	B2R7A6|Q5SNW6|Q5SNW9|Q7Z6M6|Q8IU73|Q9UQR2	Silent	SNP	ENST00000376592.1	37	CCDS137.1																																																																																				MTHFR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006538.1	NM_005957	
AADACL4	343066	broad.mit.edu	37	1	12711208	12711208	+	Missense_Mutation	SNP	G	G	A	rs370456693	byFrequency	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:12711208G>A	ENST00000376221.1	+	2	235	c.235G>A	c.(235-237)Gtg>Atg	p.V79M		NM_001013630.1	NP_001013652.1	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	79						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)	p.V79M(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)	17	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		ACATGATAGCGTGAGAATTAA	0.478													G|||	2	0.000399361	0.0015	0.0	5008	,	,		18852	0.0		0.0	False		,,,				2504	0.0				p.V79M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G235A	1						.	G	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	100.0	98.0	99.0		235	-10.1	0.0	1		99	1,8599	1.2+/-3.3	0,1,4299	no	missense	AADACL4	NM_001013630.1	21	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	79/408	12711208	2,13004	2203	4300	6503	12633795	SO:0001583	missense	343066	exon2				CCDS30590.1	1p36.21	2010-12-14			ENSG00000204518	ENSG00000204518			32038	protein-coding gene	gene with protein product							Standard	XM_006710608		Approved	OTTHUMG00000001889	uc001auf.3	Q5VUY2	OTTHUMG00000001889	ENST00000376221.1:c.235G>A	1.37:g.12711208G>A	ENSP00000365395:p.Val79Met	Somatic		Capture	Illumina HiSeq	Phase_I	12633795	NM_001013630		Missense_Mutation	SNP	ENST00000376221.1	37	CCDS30590.1	.	.	.	.	.	.	.	.	.	.	G	2.154	-0.393774	0.04899	2.27E-4	1.16E-4	ENSG00000204518	ENST00000376221	T	0.04603	3.59	5.03	-10.1	0.00402	.	2.295600	0.01736	N	0.029121	T	0.02494	0.0076	N	0.14661	0.345	0.09310	N	1	B	0.15473	0.013	B	0.12156	0.007	T	0.29792	-1.0000	10	0.36615	T	0.2	1.1384	1.9717	0.03407	0.3533:0.3175:0.1537:0.1755	.	79	Q5VUY2	ADCL4_HUMAN	M	79	ENSP00000365395:V79M	ENSP00000365395:V79M	V	+	1	0	AADACL4	12633795	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-7.554000	0.00034	-4.583000	0.00041	-2.034000	0.00421	GTG		AADACL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005328.1	NM_001013630	
NRAS	4893	broad.mit.edu	37	1	115258748	115258748	+	Missense_Mutation	SNP	C	C	A	rs121913250		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:115258748C>A	ENST00000369535.4	-	2	287	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	CSDE1_ENST00000483407.1_5'Flank	NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	12			G -> C (in leukemia). {ECO:0000269|PubMed:2998510}.|G -> D (in KNEN). {ECO:0000269|PubMed:22499344}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12S(133)|p.G12C(81)|p.G12R(18)|p.G12N(2)|p.G12P(1)|p.G12Y(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCAACACCACCTGCTCCAACC	0.493	G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(P31FUJ_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.G12C			Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,+1 	.	236	Substitution - Missense(236)	haematopoietic_and_lymphoid_tissue(149)|skin(29)|upper_aerodigestive_tract(21)|large_intestine(13)|thyroid(8)|prostate(6)|lung(4)|soft_tissue(2)|urinary_tract(1)|NS(1)|kidney(1)|pancreas(1)	c.G34T	1						.						203.0	181.0	189.0					1																	115258748		2203	4300	6503	115060271	SO:0001583	missense	4893	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.34G>T	1.37:g.115258748C>A	ENSP00000358548:p.Gly12Cys	Somatic		Capture	Illumina HiSeq	Phase_I	115060271	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	C	33	5.208516	0.95069	.	.	ENSG00000213281	ENST00000369535	T	0.79141	-1.24	5.58	5.58	0.84498	Small GTP-binding protein domain (1);	0.000000	0.56097	U	0.000025	D	0.85826	0.5787	M	0.89904	3.07	0.80722	D	1	P	0.39480	0.675	P	0.49276	0.605	D	0.87171	0.2221	10	0.72032	D	0.01	.	19.3769	0.94514	0.0:1.0:0.0:0.0	.	12	P01111	RASN_HUMAN	C	12	ENSP00000358548:G12C	ENSP00000358548:G12C	G	-	1	0	NRAS	115060271	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.906000	0.99361	0.655000	0.94253	GGT		NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
TCHH	7062	broad.mit.edu	37	1	152083639	152083639	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:152083639A>T	ENST00000368804.1	-	2	2053	c.2054T>A	c.(2053-2055)cTa>cAa	p.L685Q		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	685					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.L685Q(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCTCAGCTAGCTCCTGCTC	0.642																																					p.L685Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2054A	1						.						51.0	59.0	57.0					1																	152083639		2051	4193	6244	150350263	SO:0001583	missense	7062	exon2			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.2054T>A	1.37:g.152083639A>T	ENSP00000357794:p.Leu685Gln	Somatic		Capture	Illumina HiSeq	Phase_I	150350263	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	a	11.97	1.796371	0.31777	.	.	ENSG00000159450	ENST00000368804	T	0.11063	2.81	4.53	-0.702	0.11265	.	.	.	.	.	T	0.03871	0.0109	L	0.27053	0.805	0.09310	N	1	D	0.65815	0.995	P	0.59221	0.854	T	0.23547	-1.0185	9	0.13108	T	0.6	-6.3705	4.0573	0.09823	0.4356:0.363:0.2014:0.0	.	685	Q07283	TRHY_HUMAN	Q	685	ENSP00000357794:L685Q	ENSP00000357794:L685Q	L	-	2	0	TCHH	150350263	0.030000	0.19436	0.000000	0.03702	0.500000	0.33767	-0.237000	0.08990	0.007000	0.14760	0.375000	0.23000	CTA		TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
TMEM51	55092	broad.mit.edu	37	1	15541833	15541833	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:15541833A>T	ENST00000428417.1	+	2	696	c.250A>T	c.(250-252)Agt>Tgt	p.S84C	TMEM51_ENST00000434578.2_Missense_Mutation_p.S84C|TMEM51_ENST00000400796.3_Missense_Mutation_p.S84C|TMEM51_ENST00000376008.2_Missense_Mutation_p.S84C|TMEM51_ENST00000376014.3_Missense_Mutation_p.S84C	NM_001136217.1	NP_001129689.1	Q9NW97	TMM51_HUMAN	transmembrane protein 51	84						integral component of membrane (GO:0016021)		p.S84C(1)		breast(1)|central_nervous_system(1)|cervix(3)|large_intestine(2)|lung(5)|prostate(2)	14		Renal(390;0.00145)|Breast(348;0.00186)|Colorectal(325;0.00215)|all_lung(284;0.00459)|Lung NSC(340;0.0104)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;2.07e-06)|COAD - Colon adenocarcinoma(227;7.14e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000175)|KIRC - Kidney renal clear cell carcinoma(229;0.00141)|STAD - Stomach adenocarcinoma(313;0.00644)|READ - Rectum adenocarcinoma(331;0.0751)		TATCTGCCTGAGTATCAGGGA	0.642																																					p.S84C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A250T	1						.						73.0	65.0	68.0					1																	15541833		2203	4300	6503	15414420	SO:0001583	missense	55092	exon3			AK098467	CCDS154.1	1p36.21	2008-02-05	2005-05-22	2005-05-22	ENSG00000171729	ENSG00000171729			25488	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 72"""	C1orf72		12477932	Standard	NM_018022		Approved	FLJ10199	uc001avx.3	Q9NW97	OTTHUMG00000002046	ENST00000428417.1:c.250A>T	1.37:g.15541833A>T	ENSP00000394899:p.Ser84Cys	Somatic		Capture	Illumina HiSeq	Phase_I	15414420	NM_001136216	A8K819	Missense_Mutation	SNP	ENST00000428417.1	37	CCDS154.1	.	.	.	.	.	.	.	.	.	.	A	18.17	3.564018	0.65651	.	.	ENSG00000171729	ENST00000428417;ENST00000376014;ENST00000451326;ENST00000434578;ENST00000400796;ENST00000376008;ENST00000303840	T;T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3;1.3	5.43	5.43	0.79202	.	0.082825	0.85682	D	0.000000	T	0.38692	0.1050	M	0.61703	1.905	0.37427	D	0.913864	B;B	0.27700	0.186;0.065	B;B	0.26517	0.07;0.049	T	0.46020	-0.9221	10	0.66056	D	0.02	-29.7707	14.659	0.68855	1.0:0.0:0.0:0.0	.	84;84	Q9BSA0;Q9NW97	.;TMM51_HUMAN	C	84	ENSP00000394899:S84C;ENSP00000365182:S84C;ENSP00000412298:S84C;ENSP00000409665:S84C;ENSP00000383600:S84C;ENSP00000365176:S84C	ENSP00000303666:S84C	S	+	1	0	TMEM51	15414420	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.715000	0.47210	2.073000	0.62155	0.533000	0.62120	AGT		TMEM51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005699.3	NM_018022	
FLG	2312	broad.mit.edu	37	1	152284559	152284559	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:152284559C>A	ENST00000368799.1	-	3	2838	c.2803G>T	c.(2803-2805)Ggg>Tgg	p.G935W	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	935	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.G935W(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCCTGGACCCCTCTGATTGT	0.572									Ichthyosis																												p.G935W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2803T	1						.						325.0	300.0	309.0					1																	152284559		2203	4300	6503	150551183	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2803G>T	1.37:g.152284559C>A	ENSP00000357789:p.Gly935Trp	Somatic		Capture	Illumina HiSeq	Phase_I	150551183	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	3.326	-0.137714	0.06711	.	.	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.01787	4.64	2.81	0.827	0.18835	.	.	.	.	.	T	0.02649	0.0080	M	0.78916	2.43	0.09310	N	1	D	0.71674	0.998	D	0.63793	0.918	T	0.36939	-0.9727	9	0.72032	D	0.01	.	4.6164	0.12428	0.0:0.6682:0.0:0.3318	.	935	P20930	FILA_HUMAN	W	935;142	ENSP00000357789:G935W	ENSP00000357789:G935W	G	-	1	0	FLG	150551183	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.628000	0.24522	-0.007000	0.14345	0.473000	0.43528	GGG		FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FAM131C	348487	broad.mit.edu	37	1	16386065	16386065	+	Silent	SNP	T	T	A	rs61769893	byFrequency	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:16386065T>A	ENST00000375662.4	-	6	669	c.486A>T	c.(484-486)acA>acT	p.T162T	FAM131C_ENST00000494078.1_5'UTR	NM_182623.2	NP_872429.2	Q96AQ9	F131C_HUMAN	family with sequence similarity 131, member C	162								p.T162T(1)		large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		AAGCGCTCAGTGTGGCCTCTG	0.662																																					p.T162T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A486T	1						.						24.0	23.0	24.0					1																	16386065		1844	4061	5905	16258652	SO:0001819	synonymous_variant	348487	exon6				CCDS41270.1	1p36.13	2008-02-05	2007-03-20	2007-03-20	ENSG00000185519	ENSG00000185519			26717	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 117"""	C1orf117		12477932	Standard	NM_182623		Approved	FLJ36766	uc001axz.4	Q96AQ9	OTTHUMG00000009525	ENST00000375662.4:c.486A>T	1.37:g.16386065T>A		Somatic		Capture	Illumina HiSeq	Phase_I	16258652	NM_182623	Q5T5Q5|Q8N3X3|Q8N9P9	Silent	SNP	ENST00000375662.4	37	CCDS41270.1																																																																																				FAM131C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026319.1	NM_182623	
OR6N1	128372	broad.mit.edu	37	1	158736012	158736012	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:158736012G>T	ENST00000335094.2	-	1	480	c.461C>A	c.(460-462)gCt>gAt	p.A154D		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A154D(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					TACTGGCCCAGCCAAGCCTCC	0.527																																					p.A154D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C461A	1						.						41.0	46.0	44.0					1																	158736012		2203	4300	6503	157002636	SO:0001583	missense	128372	exon1			BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.461C>A	1.37:g.158736012G>T	ENSP00000335535:p.Ala154Asp	Somatic		Capture	Illumina HiSeq	Phase_I	157002636	NM_001005185	Q5VUU8|Q96R35	Missense_Mutation	SNP	ENST00000335094.2	37	CCDS30905.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124196	0.56613	.	.	ENSG00000197403	ENST00000335094	T	0.39229	1.09	4.89	3.96	0.45880	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46145	D	0.000313	T	0.36413	0.0966	L	0.59967	1.855	0.09310	N	1	D	0.62365	0.991	P	0.57468	0.821	T	0.17806	-1.0357	10	0.66056	D	0.02	-12.2754	7.9356	0.29929	0.0863:0.1644:0.7493:0.0	.	154	Q8NGY5	OR6N1_HUMAN	D	154	ENSP00000335535:A154D	ENSP00000335535:A154D	A	-	2	0	OR6N1	157002636	0.000000	0.05858	0.997000	0.53966	0.971000	0.66376	0.763000	0.26517	1.244000	0.43870	-0.175000	0.13238	GCT		OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059067.1	NM_001005185	
LRRC52	440699	broad.mit.edu	37	1	165514019	165514019	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:165514019G>T	ENST00000294818.1	+	1	776	c.486G>T	c.(484-486)ttG>ttT	p.L162F	RP11-280O1.2_ENST00000438275.1_RNA|RP11-280O1.2_ENST00000416424.1_RNA|RP11-280O1.2_ENST00000421273.1_RNA	NM_001005214.3	NP_001005214.2	Q8N7C0	LRC52_HUMAN	leucine rich repeat containing 52	162					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L162F(1)		NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)	18	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					ATACCGGCTTGCAGACCCTGG	0.517																																					p.L162F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G486T	1						.						161.0	160.0	160.0					1																	165514019		2203	4300	6503	163780643	SO:0001583	missense	440699	exon1			AK098677	CCDS30930.1	1q23.3	2008-02-05			ENSG00000162763	ENSG00000162763			32156	protein-coding gene	gene with protein product		615218					Standard	NM_001005214		Approved	FLJ25811	uc001gde.2	Q8N7C0	OTTHUMG00000034625	ENST00000294818.1:c.486G>T	1.37:g.165514019G>T	ENSP00000294818:p.Leu162Phe	Somatic		Capture	Illumina HiSeq	Phase_I	163780643	NM_001005214	A2RUN7|Q5T9K5	Missense_Mutation	SNP	ENST00000294818.1	37	CCDS30930.1	.	.	.	.	.	.	.	.	.	.	G	17.40	3.379410	0.61845	.	.	ENSG00000162763	ENST00000294818	T	0.03689	3.84	5.39	3.48	0.39840	.	0.069593	0.56097	D	0.000025	T	0.07503	0.0189	M	0.78285	2.405	0.37765	D	0.926457	D	0.60575	0.988	D	0.68039	0.955	T	0.03212	-1.1060	9	0.87932	D	0	.	7.9944	0.30258	0.0842:0.0:0.7558:0.16	.	162	Q8N7C0	LRC52_HUMAN	F	162	ENSP00000294818:L162F	ENSP00000294818:L162F	L	+	3	2	LRRC52	163780643	1.000000	0.71417	0.997000	0.53966	0.813000	0.45954	2.716000	0.47219	0.617000	0.30160	0.563000	0.77884	TTG		LRRC52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083793.1	NM_001005214	
PAPPA2	60676	broad.mit.edu	37	1	176563698	176563698	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:176563698G>C	ENST00000367662.3	+	3	2122	c.958G>C	c.(958-960)Ggc>Cgc	p.G320R	PAPPA2_ENST00000367661.3_Missense_Mutation_p.G320R	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	320					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G320R(1)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CAGTGACAAAGGCTGGGCCCT	0.532																																					p.G320R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G958C	1						.						47.0	46.0	46.0					1																	176563698		1935	4141	6076	174830321	SO:0001583	missense	60676	exon3			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.958G>C	1.37:g.176563698G>C	ENSP00000356634:p.Gly320Arg	Somatic		Capture	Illumina HiSeq	Phase_I	174830321	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470375	0.84533	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.77098	-1.07;-1.07	5.45	5.45	0.79879	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.054326	0.85682	D	0.000000	D	0.87521	0.6198	M	0.71206	2.165	0.80722	D	1	D;D	0.69078	0.997;0.996	D;P	0.68353	0.957;0.905	D	0.88542	0.3110	10	0.87932	D	0	-24.2897	18.8948	0.92419	0.0:0.0:1.0:0.0	.	320;320	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	R	320	ENSP00000356634:G320R;ENSP00000356633:G320R	ENSP00000356633:G320R	G	+	1	0	PAPPA2	174830321	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.689000	0.98673	2.555000	0.86185	0.650000	0.86243	GGC		PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
HMCN1	83872	broad.mit.edu	37	1	186141190	186141190	+	Silent	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:186141190C>T	ENST00000271588.4	+	102	15970	c.15741C>T	c.(15739-15741)aaC>aaT	p.N5247N	HMCN1_ENST00000367492.2_Silent_p.N5247N	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5247	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.N5247N(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ACTGTAAGAACACCCGTGGTG	0.393																																					p.N5247N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C15741T	1						.						148.0	135.0	140.0					1																	186141190		2203	4300	6503	184407813	SO:0001819	synonymous_variant	83872	exon102			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.15741C>T	1.37:g.186141190C>T		Somatic		Capture	Illumina HiSeq	Phase_I	184407813	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	CCDS30956.1																																																																																				HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
IL10	3586	broad.mit.edu	37	1	206944309	206944309	+	Silent	SNP	C	C	T	rs560908141		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:206944309C>T	ENST00000423557.1	-	3	379	c.321G>A	c.(319-321)gcG>gcA	p.A107A	IL10_ENST00000471071.1_5'UTR	NM_000572.2	NP_000563.1	P22301	IL10_HUMAN	interleukin 10	107					B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to lipopolysaccharide (GO:0071222)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|defense response to bacterium (GO:0042742)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|leukocyte chemotaxis (GO:0030595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of chronic inflammatory response to antigenic stimulus (GO:0002875)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interferon-alpha biosynthetic process (GO:0045355)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of myeloid dendritic cell activation (GO:0030886)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor biosynthetic process (GO:0032800)|regulation of gene expression (GO:0010468)|regulation of isotype switching (GO:0045191)|regulation of sensory perception of pain (GO:0051930)|response to activity (GO:0014823)|response to carbon monoxide (GO:0034465)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to inactivity (GO:0014854)|response to insulin (GO:0032868)|response to molecule of bacterial origin (GO:0002237)|type 2 immune response (GO:0042092)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-10 receptor binding (GO:0005141)	p.A107A(2)		endometrium(1)|large_intestine(6)|lung(4)|prostate(1)	12	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			AGTTCACATGCGCCTTGATGT	0.542													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20207	0.0		0.0	False		,,,				2504	0.0				p.A107A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G321A	1						.						153.0	144.0	147.0					1																	206944309		2203	4300	6503	205010932	SO:0001819	synonymous_variant	3586	exon3			M57627	CCDS1467.1	1q31-q32	2011-07-14			ENSG00000136634	ENSG00000136634		"""Interleukins and interleukin receptors"""	5962	protein-coding gene	gene with protein product	"""cytokine synthesis inhibitory factor"", ""T-cell growth inhibitory factor"""	124092				9162098	Standard	NM_000572		Approved	CSIF, TGIF, IL10A, IL-10	uc001hen.1	P22301	OTTHUMG00000036386	ENST00000423557.1:c.321G>A	1.37:g.206944309C>T		Somatic		Capture	Illumina HiSeq	Phase_I	205010932	NM_000572		Silent	SNP	ENST00000423557.1	37	CCDS1467.1																																																																																				IL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088564.3	NM_000572	
SLC35F3	148641	broad.mit.edu	37	1	234367364	234367364	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:234367364A>C	ENST00000366617.3	+	2	506	c.278A>C	c.(277-279)aAg>aCg	p.K93T	SLC35F3_ENST00000366618.3_Missense_Mutation_p.K162T			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	93					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)		p.K162T(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			ACCTTCAGGAAGTTCGACGCG	0.597																																					p.K162T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A485C	1						.						172.0	148.0	156.0					1																	234367364		2203	4300	6503	232433987	SO:0001583	missense	148641	exon3				CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.278A>C	1.37:g.234367364A>C	ENSP00000355576:p.Lys93Thr	Somatic		Capture	Illumina HiSeq	Phase_I	232433987	NM_173508	Q5TDD6|Q8N9C9	Missense_Mutation	SNP	ENST00000366617.3	37		.	.	.	.	.	.	.	.	.	.	A	9.223	1.033847	0.19590	.	.	ENSG00000183780	ENST00000366618;ENST00000366617	T;T	0.45276	0.9;0.9	4.71	-2.9	0.05648	.	0.460556	0.23674	N	0.045685	T	0.20170	0.0485	L	0.28274	0.84	0.27321	N	0.957037	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.07693	-1.0759	10	0.25106	T	0.35	0.6454	3.333	0.07091	0.2738:0.4672:0.1449:0.114	.	93;162	Q8IY50;Q8IY50-2	S35F3_HUMAN;.	T	162;93	ENSP00000355577:K162T;ENSP00000355576:K93T	ENSP00000355576:K93T	K	+	2	0	SLC35F3	232433987	0.984000	0.35163	0.073000	0.20177	0.886000	0.51366	1.216000	0.32443	-0.762000	0.04664	-0.326000	0.08463	AAG		SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000128322.1	NM_173508	
EIF2B3	8891	broad.mit.edu	37	1	45363050	45363050	+	Silent	SNP	G	G	A	rs139526549	byFrequency	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:45363050G>A	ENST00000360403.2	-	6	759	c.633C>T	c.(631-633)atC>atT	p.I211I	EIF2B3_ENST00000372183.3_Silent_p.I211I	NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa	211					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)	p.I211I(1)		endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					GGAAATCCACGATGTATTTTT	0.353													G|||	35	0.00698882	0.0	0.0	5008	,	,		18279	0.0		0.0	False		,,,				2504	0.0358				p.I211I	Colon(26;357 658 2581 11857 12657)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C633T	1						.	G	,	0,4406		0,0,2203	74.0	71.0	72.0		633,633	-4.4	1.0	1	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	EIF2B3	NM_001166588.1,NM_020365.3	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	211/413,211/453	45363050	1,13005	2203	4300	6503	45135637	SO:0001819	synonymous_variant	8891	exon6			AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585	ENST00000360403.2:c.633C>T	1.37:g.45363050G>A		Somatic		Capture	Illumina HiSeq	Phase_I	45135637	NM_001166588	B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Silent	SNP	ENST00000360403.2	37	CCDS517.1	.	.	.	.	.	.	.	.	.	.	G	3.538	-0.094266	0.07053	0.0	1.16E-4	ENSG00000070785	ENST00000439363	.	.	.	5.01	-4.43	0.03568	.	.	.	.	.	T	0.48223	0.1488	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49194	-0.8965	4	.	.	.	-6.4698	6.4106	0.21688	0.2836:0.3811:0.3354:0.0	.	.	.	.	L	32	.	.	S	-	2	0	EIF2B3	45135637	0.222000	0.23652	0.970000	0.41538	0.371000	0.29859	-0.665000	0.05286	-0.328000	0.08539	-0.670000	0.03821	TCG		EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023724.1	NM_020365	
HECTD3	79654	broad.mit.edu	37	1	45475895	45475895	+	Missense_Mutation	SNP	C	C	T	rs113744661		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:45475895C>T	ENST00000372172.4	-	3	672	c.601G>A	c.(601-603)Gca>Aca	p.A201T	UROD_ENST00000246337.4_5'Flank|HECTD3_ENST00000372168.3_5'Flank	NM_024602.5	NP_078878.3	Q5T447	HECD3_HUMAN	HECT domain containing E3 ubiquitin protein ligase 3	201					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.A201T(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|stomach(1)	28	Acute lymphoblastic leukemia(166;0.155)					ACAGCTTCTGCGTATGCCTCT	0.587													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18511	0.0		0.0	False		,,,				2504	0.0				p.A201T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G601A	1						.	C	THR/ALA	3,4185		0,3,2091	132.0	135.0	134.0		601	1.8	0.2	1	dbSNP_132	134	0,8442		0,0,4221	no	missense	HECTD3	NM_024602.5	58	0,3,6312	TT,TC,CC		0.0,0.0716,0.0238	benign	201/862	45475895	3,12627	2094	4221	6315	45248482	SO:0001583	missense	79654	exon3			BC019105	CCDS41318.1	1p34.1	2012-02-23	2012-02-23		ENSG00000126107	ENSG00000126107			26117	protein-coding gene	gene with protein product			"""HECT domain containing 3"""			12477932	Standard	NM_024602		Approved	FLJ21156	uc009vxk.3	Q5T447	OTTHUMG00000008587	ENST00000372172.4:c.601G>A	1.37:g.45475895C>T	ENSP00000361245:p.Ala201Thr	Somatic		Capture	Illumina HiSeq	Phase_I	45248482	NM_024602	B3KPV7|B3KRH4|Q5T448|Q9H783	Missense_Mutation	SNP	ENST00000372172.4	37	CCDS41318.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.454256	0.26161	7.16E-4	0.0	ENSG00000126107	ENST00000372172	T	0.58506	0.33	4.13	1.82	0.25136	Galactose-binding domain-like (1);	0.651897	0.14941	N	0.289528	T	0.28134	0.0694	N	0.03608	-0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.03898	-1.0994	10	0.19590	T	0.45	.	6.5283	0.22312	0.0:0.472:0.0:0.528	.	201	Q5T447	HECD3_HUMAN	T	201	ENSP00000361245:A201T	ENSP00000361245:A201T	A	-	1	0	HECTD3	45248482	0.906000	0.30813	0.200000	0.23457	0.885000	0.51271	0.579000	0.23788	0.275000	0.22094	-0.302000	0.09304	GCA		HECTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023734.1	NM_024602	
GLIS1	148979	broad.mit.edu	37	1	53990555	53990555	+	Silent	SNP	C	C	T	rs148036745		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:53990555C>T	ENST00000312233.2	-	5	1529	c.963G>A	c.(961-963)ccG>ccA	p.P321P		NM_147193.2	NP_671726.2			GLIS family zinc finger 1									p.P321P(1)		endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						GACAGGCGTACGGCTTCTGTA	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		18476	0.0		0.0	False		,,,				2504	0.001				p.P321P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G963A	1						.	C		3,4403	6.2+/-15.9	0,3,2200	142.0	120.0	127.0		963	-8.4	0.4	1	dbSNP_134	127	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	GLIS1	NM_147193.2		0,5,6498	TT,TC,CC		0.0233,0.0681,0.0384		321/621	53990555	5,13001	2203	4300	6503	53763143	SO:0001819	synonymous_variant	148979	exon5			AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.963G>A	1.37:g.53990555C>T		Somatic		Capture	Illumina HiSeq	Phase_I	53763143	NM_147193		Silent	SNP	ENST00000312233.2	37	CCDS582.1																																																																																				GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022109.1	NM_147193	
C8B	732	broad.mit.edu	37	1	57406637	57406637	+	Missense_Mutation	SNP	C	C	T	rs199592536	byFrequency	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:57406637C>T	ENST00000371237.4	-	9	1349	c.1283G>A	c.(1282-1284)cGa>cAa	p.R428Q	C8B_ENST00000543257.1_Missense_Mutation_p.R376Q|C8B_ENST00000535057.1_Missense_Mutation_p.R366Q	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	428	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)		p.R428Q(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						TGCCCCTCCTCGTACCAGGAC	0.587													C|||	2	0.000399361	0.0	0.0	5008	,	,		17421	0.0		0.0	False		,,,				2504	0.002				p.R428Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1283A	1						.						160.0	114.0	130.0					1																	57406637		2203	4300	6503	57179225	SO:0001583	missense	732	exon9			M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.1283G>A	1.37:g.57406637C>T	ENSP00000360281:p.Arg428Gln	Somatic		Capture	Illumina HiSeq	Phase_I	57179225	NM_000066	A1L4K7	Missense_Mutation	SNP	ENST00000371237.4	37	CCDS30730.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962852	0.92791	.	.	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	D;D;D	0.85013	-1.93;-1.93;-1.93	5.36	5.36	0.76844	Membrane attack complex component/perforin (MACPF) domain (3);	0.055575	0.64402	D	0.000002	D	0.92596	0.7648	M	0.83953	2.67	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.989;0.989;0.993	D	0.90365	0.4376	10	0.24483	T	0.36	-10.452	19.4436	0.94836	0.0:1.0:0.0:0.0	.	376;366;428	F5H7G1;F5GY80;P07358	.;.;CO8B_HUMAN	Q	428;376;366	ENSP00000360281:R428Q;ENSP00000442548:R376Q;ENSP00000440113:R366Q	ENSP00000360281:R428Q	R	-	2	0	C8B	57179225	0.851000	0.29673	0.976000	0.42696	0.971000	0.66376	2.285000	0.43487	2.652000	0.90054	0.655000	0.94253	CGA		C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2		
ZNF672	79894	broad.mit.edu	37	1	249142142	249142142	+	Silent	SNP	G	G	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr1:249142142G>T	ENST00000306562.3	+	4	1415	c.669G>T	c.(667-669)ggG>ggT	p.G223G		NM_024836.1	NP_079112.1	Q499Z4	ZN672_HUMAN	zinc finger protein 672	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G223G(1)		endometrium(2)|kidney(2)|large_intestine(1)	5	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			CGCACTCGGGGGAGAAACCCT	0.662																																					p.G223G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G669T	1						.						10.0	10.0	10.0					1																	249142142		2195	4289	6484	247108765	SO:0001819	synonymous_variant	79894	exon4			AK027476	CCDS1638.1	1q44	2013-01-08			ENSG00000171161	ENSG00000171161		"""Zinc fingers, C2H2-type"""	26179	protein-coding gene	gene with protein product	"""hypothetical protein FLJ22301"""					12477932	Standard	NM_024836		Approved	FLJ22301	uc001iex.3	Q499Z4	OTTHUMG00000040377	ENST00000306562.3:c.669G>T	1.37:g.249142142G>T		Somatic		Capture	Illumina HiSeq	Phase_I	247108765	NM_024836	Q96H65|Q96IM3|Q9H6G5	Silent	SNP	ENST00000306562.3	37	CCDS1638.1																																																																																				ZNF672-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097125.2	NM_024836	
SYNDIG1	79953	broad.mit.edu	37	20	24565629	24565629	+	Splice_Site	SNP	G	G	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr20:24565629G>T	ENST00000376862.3	+	3	1251	c.618G>T	c.(616-618)gaG>gaT	p.E206D	SYNDIG1_ENST00000482637.1_3'UTR	NM_024893.1	NP_079169.1	Q9H7V2	SYNG1_HUMAN	synapse differentiation inducing 1	206					intracellular protein transport (GO:0006886)|positive regulation of synapse assembly (GO:0051965)|response to biotic stimulus (GO:0009607)|synaptic vesicle clustering (GO:0097091)	cell body (GO:0044297)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	glutamate receptor binding (GO:0035254)|protein homodimerization activity (GO:0042803)	p.E206D(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	24						TGTCCCATGAGGTAAGGCCTC	0.622																																					p.E206D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G618T	20						.						130.0	118.0	122.0					20																	24565629		2203	4300	6503	24513629	SO:0001630	splice_region_variant	79953	exon3			AK024282	CCDS13164.1	20p11.21	2011-06-30	2011-06-30	2011-06-30	ENSG00000101463	ENSG00000101463			15885	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 5"", ""synapse differentiation induced gene 1"""	614311	"""chromosome 20 open reading frame 39"", ""transmembrane protein 90B"""	C20orf39, TMEM90B		20152115	Standard	NM_024893		Approved	FLJ14220, IFITMD5, SynDIG1	uc002wtw.1	Q9H7V2	OTTHUMG00000032104	ENST00000376862.3:c.618+1G>T	20.37:g.24565629G>T		Somatic		Capture	Illumina HiSeq	Phase_I	24513629	NM_024893	Q6IA30|Q9H514	Missense_Mutation	SNP	ENST00000376862.3	37	CCDS13164.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.650584	0.87958	.	.	ENSG00000101463	ENST00000376862	D	0.86097	-2.07	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	D	0.84247	0.5430	N	0.14661	0.345	0.80722	D	1	D	0.71674	0.998	D	0.67103	0.949	D	0.84616	0.0681	10	0.38643	T	0.18	-28.624	13.7016	0.62613	0.0:0.0:1.0:0.0	.	206	Q9H7V2	SYNG1_HUMAN	D	206	ENSP00000366058:E206D	ENSP00000366058:E206D	E	+	3	2	SYNDIG1	24513629	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	9.639000	0.98448	2.300000	0.77407	0.561000	0.74099	GAG		SYNDIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078376.1	NM_024893	Missense_Mutation
DDX27	55661	broad.mit.edu	37	20	47851526	47851526	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr20:47851526A>G	ENST00000371764.4	+	12	1430	c.1421A>G	c.(1420-1422)aAg>aGg	p.K474R	DDX27_ENST00000484427.1_3'UTR	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	474	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.K474R(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			CAAACCAAGAAGCAGGCCCAC	0.592																																					p.K474R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1421G	20						.						97.0	80.0	86.0					20																	47851526		2203	4300	6503	47284933	SO:0001583	missense	55661	exon12			AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.1421A>G	20.37:g.47851526A>G	ENSP00000360828:p.Lys474Arg	Somatic		Capture	Illumina HiSeq	Phase_I	47284933	NM_017895	A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	Missense_Mutation	SNP	ENST00000371764.4	37	CCDS13416.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.169638	0.78452	.	.	ENSG00000124228	ENST00000371764	T	0.01527	4.8	5.57	5.57	0.84162	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.02193	0.0068	N	0.26092	0.79	0.80722	D	1	P	0.34462	0.454	B	0.36885	0.235	T	0.65425	-0.6171	10	0.44086	T	0.13	-30.6545	13.694	0.62567	1.0:0.0:0.0:0.0	.	474	Q96GQ7	DDX27_HUMAN	R	474	ENSP00000360828:K474R	ENSP00000360828:K474R	K	+	2	0	DDX27	47284933	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	8.737000	0.91562	2.126000	0.65437	0.533000	0.62120	AAG		DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080485.1		
TRPM2	7226	broad.mit.edu	37	21	45819312	45819313	+	Frame_Shift_Ins	INS	-	-	G	rs374724852		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr21:45819312_45819313insG	ENST00000397928.1	+	14	2641_2642	c.2196_2197insG	c.(2197-2199)gggfs	p.G733fs	TRPM2_ENST00000300481.9_Frame_Shift_Ins_p.G713fs|TRPM2_ENST00000300482.5_Frame_Shift_Ins_p.G733fs|TRPM2_ENST00000397932.2_Frame_Shift_Ins_p.G733fs|TRPM2_ENST00000498430.1_3'UTR	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	733					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						TTGTGTCTCACGGGGGCATCCA	0.634																																					p.H732fs												.	.	0			c.2196_2197insG	21						.																																			44643741	SO:0001589	frameshift_variant	7226	exon14			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2201dupG	21.37:g.45819317_45819317dupG	ENSP00000381023:p.Gly733fs	None		Capture	Illumina HiSeq	Phase_I	44643740	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Frame_Shift_Ins	INS	ENST00000397928.1	37	CCDS13710.1																																																																																				TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
GABPA	2551	broad.mit.edu	37	21	27136964	27136964	+	Silent	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr21:27136964C>T	ENST00000354828.3	+	9	1529	c.1002C>T	c.(1000-1002)gaC>gaT	p.D334D	GABPA_ENST00000400075.3_Silent_p.D334D	NM_001197297.1	NP_001184226.1	Q06546	GABPA_HUMAN	GA binding protein transcription factor, alpha subunit 60kDa	334					cell differentiation (GO:0030154)|in utero embryonic development (GO:0001701)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.D334D(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	24						CTGATAAGGACGCTCGAGACT	0.398																																					p.D334D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1002T	21						.						118.0	106.0	110.0					21																	27136964		2203	4299	6502	26058835	SO:0001819	synonymous_variant	2551	exon9				CCDS13575.1	21q21-q22.1	2008-07-31	2002-08-29		ENSG00000154727	ENSG00000154727			4071	protein-coding gene	gene with protein product	"""human nuclear respiratory factor-2 subunit alpha"", ""nuclear respiratory factor 2 alpha subunit"""	600609	"""GA-binding protein transcription factor, alpha subunit (60kD)"""			8441384	Standard	NM_002040		Approved	E4TF1A, NFT2, NRF2, E4TF1-60, NRF2A	uc002yly.4	Q06546	OTTHUMG00000078443	ENST00000354828.3:c.1002C>T	21.37:g.27136964C>T		Somatic		Capture	Illumina HiSeq	Phase_I	26058835	NM_001197297	Q12939	Silent	SNP	ENST00000354828.3	37	CCDS13575.1																																																																																				GABPA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171365.1	NM_002040	
GRIK1	2897	broad.mit.edu	37	21	30927396	30927396	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr21:30927396G>A	ENST00000399907.1	-	16	2995	c.2584C>T	c.(2584-2586)Cgg>Tgg	p.R862W	GRIK1_ENST00000309434.7_Missense_Mutation_p.R864W|GRIK1_ENST00000389125.3_Missense_Mutation_p.R847W|GRIK1_ENST00000535441.1_Missense_Mutation_p.R864W|GRIK1_ENST00000399914.1_Missense_Mutation_p.R847W|GRIK1_ENST00000399909.1_Missense_Mutation_p.R847W|GRIK1_ENST00000327783.4_Missense_Mutation_p.R862W|GRIK1_ENST00000389124.2_Missense_Mutation_p.R862W|GRIK1_ENST00000399913.1_Missense_Mutation_p.R862W	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	862			R -> Q. {ECO:0000269|PubMed:11702055}.		adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.R847W(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	TTATTCTTCCGTGATTTGTAT	0.393																																					p.R847W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2539T	21						.						66.0	66.0	66.0					21																	30927396		2203	4300	6503	29849267	SO:0001583	missense	2897	exon15				CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.2584C>T	21.37:g.30927396G>A	ENSP00000382791:p.Arg862Trp	Somatic		Capture	Illumina HiSeq	Phase_I	29849267	NM_175611	Q13001|Q86SU9	Missense_Mutation	SNP	ENST00000399907.1	37	CCDS42913.1	.	.	.	.	.	.	.	.	.	.	G	19.07	3.756531	0.69648	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	T;T;T;T;T;T;T;T;T	0.16324	2.35;2.42;2.4;2.36;2.41;2.35;2.36;2.4;2.38	5.1	4.16	0.48862	.	0.096519	0.64402	D	0.000003	T	0.19406	0.0466	N	0.08118	0	0.58432	D	0.999998	D;D;D;D	0.76494	0.998;0.999;0.998;0.999	P;P;D;D	0.66497	0.88;0.88;0.915;0.944	T	0.13072	-1.0523	10	0.87932	D	0	.	10.889	0.46984	0.0:0.0:0.51:0.49	.	847;862;862;847	E7EPY9;E9PD61;P39086;P39086-2	.;.;GRIK1_HUMAN;.	W	862;847;862;847;864;723;862;862;847;864	ENSP00000327687:R862W;ENSP00000373777:R847W;ENSP00000382797:R862W;ENSP00000382798:R847W;ENSP00000446326:R864W;ENSP00000373776:R862W;ENSP00000382791:R862W;ENSP00000382793:R847W;ENSP00000311646:R864W	ENSP00000311646:R864W	R	-	1	2	GRIK1	29849267	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.189000	0.42621	1.418000	0.47098	0.650000	0.86243	CGG		GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1		
KCNE2	9992	broad.mit.edu	37	21	35743074	35743074	+	Silent	SNP	A	A	G			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr21:35743074A>G	ENST00000290310.3	+	2	437	c.297A>G	c.(295-297)caA>caG	p.Q99Q	AP000320.6_ENST00000440403.1_RNA	NM_172201.1	NP_751951.1	Q9Y6J6	KCNE2_HUMAN	potassium voltage-gated channel, Isk-related family, member 2	99					aging (GO:0007568)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular protein localization (GO:0034613)|cellular response to drug (GO:0035690)|membrane repolarization (GO:0086009)|membrane repolarization during action potential (GO:0086011)|positive regulation of proteasomal protein catabolic process (GO:1901800)|potassium ion export (GO:0071435)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of cyclic nucleotide-gated ion channel activity (GO:1902159)|regulation of delayed rectifier potassium channel activity (GO:1902259)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of inward rectifier potassium channel activity (GO:1901979)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|tongue development (GO:0043586)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)	p.Q99Q(1)		endometrium(1)|large_intestine(1)	2						ACAAGAGCCAAATCTTGAATC	0.493																																					p.Q99Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A297G	21						.						67.0	61.0	63.0					21																	35743074		2203	4300	6503	34664944	SO:0001819	synonymous_variant	9992	exon2			AF071002	CCDS13635.1	21q22.1	2014-09-17			ENSG00000159197	ENSG00000159197		"""Potassium channels"""	6242	protein-coding gene	gene with protein product		603796				10219239	Standard	NM_172201		Approved	MiRP1, LQT6	uc002ytt.1	Q9Y6J6	OTTHUMG00000086189	ENST00000290310.3:c.297A>G	21.37:g.35743074A>G		Somatic		Capture	Illumina HiSeq	Phase_I	34664944	NM_172201	A5H1P3|D3DSF8|Q52LJ5	Silent	SNP	ENST00000290310.3	37	CCDS13635.1																																																																																				KCNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194068.2		
GGT1	2678	broad.mit.edu	37	22	25010828	25010828	+	Missense_Mutation	SNP	G	G	A	rs77018131		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr22:25010828G>A	ENST00000400382.1	+	6	1005	c.250G>A	c.(250-252)Ggc>Agc	p.G84S	GGT1_ENST00000406383.2_Missense_Mutation_p.G84S|GGT1_ENST00000400380.1_Missense_Mutation_p.G84S|GGT1_ENST00000400383.1_Missense_Mutation_p.G84S|GGT1_ENST00000248923.4_Missense_Mutation_p.G84S			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	84					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.G84S(1)		breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	CCACAGCATGGGCATCGGGGG	0.642													a|||	1	0.000199681	0.0	0.0	5008	,	,		13761	0.0		0.0	False		,,,				2504	0.001				p.G84S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G250A	22						.						37.0	39.0	38.0					22																	25010828		2020	4166	6186	23340828	SO:0001583	missense	2678	exon6			M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.250G>A	22.37:g.25010828G>A	ENSP00000383232:p.Gly84Ser	Somatic		Capture	Illumina HiSeq	Phase_I	23340828	NM_013430	Q08247|Q14404|Q8TBS1|Q9UMK1	Missense_Mutation	SNP	ENST00000400382.1	37	CCDS42992.1	.	.	.	.	.	.	.	.	.	.	.	26.4	4.730880	0.89390	.	.	ENSG00000100031	ENST00000248923;ENST00000411974;ENST00000412658;ENST00000419133;ENST00000400382;ENST00000452551;ENST00000400383;ENST00000400380;ENST00000455483;ENST00000430289;ENST00000447416;ENST00000432867;ENST00000451366;ENST00000406383;ENST00000428855	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.02;2.02;2.02;2.02;2.02;2.02;2.02;2.02;2.02;2.02;2.02	3.89	3.89	0.44902	.	0.000000	0.85682	D	0.000000	T	0.56992	0.2023	H	0.94771	3.58	0.58432	D	0.999996	P	0.44986	0.847	D	0.63877	0.919	T	0.70680	-0.4805	10	0.72032	D	0.01	-22.8757	15.7009	0.77541	0.0:0.0:1.0:0.0	.	84	P19440	GGT1_HUMAN	S	84	ENSP00000248923:G84S;ENSP00000389935:G84S;ENSP00000393537:G84S;ENSP00000395271:G84S;ENSP00000383232:G84S;ENSP00000415553:G84S;ENSP00000383233:G84S;ENSP00000383231:G84S;ENSP00000415024:G84S;ENSP00000417044:G84S;ENSP00000400621:G84S;ENSP00000398589:G84S;ENSP00000387796:G84S;ENSP00000385975:G84S;ENSP00000415068:G84S	ENSP00000248923:G84S	G	+	1	0	GGT1	23340828	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	7.412000	0.80091	2.100000	0.63781	0.555000	0.69702	GGC		GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250797.1	NM_013430	
MPPED1	758	broad.mit.edu	37	22	43831000	43831000	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr22:43831000C>T	ENST00000417669.2	+	3	715	c.271C>T	c.(271-273)Cgc>Tgc	p.R91C	MPPED1_ENST00000542779.1_Missense_Mutation_p.R91C|MPPED1_ENST00000538182.1_Missense_Mutation_p.R124C|MPPED1_ENST00000414469.2_5'UTR|MPPED1_ENST00000439548.1_Intron|MPPED1_ENST00000443721.1_Missense_Mutation_p.R91C			O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1	91							hydrolase activity (GO:0016787)	p.R91C(1)		endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|skin(1)	13		all_neural(38;0.0244)|Ovarian(80;0.0694)				AGGCTACACCCGCTTCGTCTG	0.652																																					p.R91C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C271T	22						.						111.0	128.0	123.0					22																	43831000		2153	4243	6396	42160944	SO:0001583	missense	758	exon3			U84894	CCDS46723.1	22q13.2	2013-09-20	2005-10-10	2005-10-10	ENSG00000186732	ENSG00000186732			1306	protein-coding gene	gene with protein product		602112	"""chromosome 22 open reading frame 1"""	C22orf1		9266672, 10591208	Standard	NM_001044370		Approved	239AB, FAM1A	uc011apv.2	O15442	OTTHUMG00000150566	ENST00000417669.2:c.271C>T	22.37:g.43831000C>T	ENSP00000388137:p.Arg91Cys	Somatic		Capture	Illumina HiSeq	Phase_I	42160944	NM_001044370	A8K159|B7Z2S9|Q8N361	Missense_Mutation	SNP	ENST00000417669.2	37	CCDS46723.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.736760	0.89482	.	.	ENSG00000186732	ENST00000417669;ENST00000334209;ENST00000443721;ENST00000545165;ENST00000542779;ENST00000538182	T;T;T;T;T	0.61040	0.6;0.14;0.6;0.6;0.6	4.81	4.81	0.61882	.	0.107321	0.64402	D	0.000009	D	0.84524	0.5491	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	D	0.90314	0.4339	10	0.87932	D	0	-38.4983	18.2639	0.90046	0.0:1.0:0.0:0.0	.	124;91	B7Z2S9;O15442	.;MPPD1_HUMAN	C	91;91;91;69;91;124	ENSP00000388137:R91C;ENSP00000335568:R91C;ENSP00000400686:R91C;ENSP00000444532:R91C;ENSP00000438335:R124C	ENSP00000335568:R91C	R	+	1	0	MPPED1	42160944	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	5.514000	0.67043	2.374000	0.81015	0.561000	0.74099	CGC		MPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318938.2	NM_001044370	
KIAA1644	85352	broad.mit.edu	37	22	44681447	44681447	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr22:44681447G>A	ENST00000381176.4	-	4	592	c.460C>T	c.(460-462)Cgg>Tgg	p.R154W		NM_001099294.1	NP_001092764.1	Q3SXP7	K1644_HUMAN	KIAA1644	154						integral component of membrane (GO:0016021)		p.R154W(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)				CGAGGGGCCCGAGCGGGGTTC	0.687																																					p.R154W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C460T	22						.						43.0	47.0	46.0					22																	44681447		1887	4120	6007	43012780	SO:0001583	missense	85352	exon4			AB051431	CCDS43025.1	22q13	2009-02-06	2009-02-06		ENSG00000138944	ENSG00000138944			29335	protein-coding gene	gene with protein product						11258795	Standard	NM_001099294		Approved		uc003bet.2	Q3SXP7	OTTHUMG00000030991	ENST00000381176.4:c.460C>T	22.37:g.44681447G>A	ENSP00000370568:p.Arg154Trp	Somatic		Capture	Illumina HiSeq	Phase_I	43012780	NM_001099294	A6NHP0|A9Z1Z0|Q3SXP8|Q5JZ71|Q9BYB5	Missense_Mutation	SNP	ENST00000381176.4	37	CCDS43025.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953160	0.34471	.	.	ENSG00000138944	ENST00000381176	.	.	.	4.28	3.24	0.37175	.	0.651810	0.13564	N	0.378521	T	0.29817	0.0745	N	0.08118	0	0.33797	D	0.626183	D	0.64830	0.994	P	0.47744	0.556	T	0.43893	-0.9363	8	0.87932	D	0	-14.4147	10.899	0.47040	0.0:0.0:0.7996:0.2004	.	154	Q3SXP7	K1644_HUMAN	W	154	.	ENSP00000370568:R154W	R	-	1	2	KIAA1644	43012780	1.000000	0.71417	0.947000	0.38551	0.264000	0.26372	2.294000	0.43567	0.889000	0.36185	0.561000	0.74099	CGG		KIAA1644-006	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075879.2	NM_001099294	
NCKAP5	344148	broad.mit.edu	37	2	133538712	133538712	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr2:133538712A>T	ENST00000409261.1	-	15	5335	c.4962T>A	c.(4960-4962)tgT>tgA	p.C1654*	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000473859.1_5'UTR|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Nonsense_Mutation_p.C1654*	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1654								p.C1654*(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TGCCGATGAGACAGGAGCCCT	0.458																																					p.C1654X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T4962A	2						.						103.0	106.0	105.0					2																	133538712		1921	4127	6048	133255182	SO:0001587	stop_gained	344148	exon15			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.4962T>A	2.37:g.133538712A>T	ENSP00000387128:p.Cys1654*	Somatic		Capture	Illumina HiSeq	Phase_I	133255182	NM_207363	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Nonsense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	A	46	12.241856	0.99649	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	.	.	.	5.35	4.19	0.49359	.	0.268177	0.19706	U	0.107936	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	9.7654	0.40557	0.9223:0.0:0.0777:0.0	.	.	.	.	X	1654	.	ENSP00000380603:C1654X	C	-	3	2	NCKAP5	133255182	1.000000	0.71417	0.522000	0.27862	0.297000	0.27493	2.874000	0.48483	1.042000	0.40150	0.533000	0.62120	TGT		NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
NCKAP5	344148	broad.mit.edu	37	2	133543239	133543239	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr2:133543239C>A	ENST00000409261.1	-	14	1518	c.1145G>T	c.(1144-1146)aGt>aTt	p.S382I	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.S382I	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	382	Ser-rich.							p.S382I(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						AGCAAAGCCACTTGGGAGCGA	0.398																																					p.S382I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1145T	2						.						71.0	64.0	66.0					2																	133543239		1861	4101	5962	133259709	SO:0001583	missense	344148	exon14			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.1145G>T	2.37:g.133543239C>A	ENSP00000387128:p.Ser382Ile	Somatic		Capture	Illumina HiSeq	Phase_I	133259709	NM_207363	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909820	0.72983	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.20598	2.06;2.06	5.15	5.15	0.70609	.	0.000000	0.40064	U	0.001198	T	0.30727	0.0774	L	0.32530	0.975	0.80722	D	1	D	0.59767	0.986	P	0.55391	0.775	T	0.02202	-1.1196	10	0.87932	D	0	.	16.9761	0.86313	0.0:1.0:0.0:0.0	.	382	O14513	NCKP5_HUMAN	I	382	ENSP00000387128:S382I;ENSP00000380603:S382I	ENSP00000380603:S382I	S	-	2	0	NCKAP5	133259709	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.540000	0.53611	2.670000	0.90874	0.650000	0.86243	AGT		NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
TTN	7273	broad.mit.edu	37	2	179409072	179409072	+	Missense_Mutation	SNP	T	T	A	rs369087584		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr2:179409072T>A	ENST00000591111.1	-	295	91185	c.90961A>T	c.(90961-90963)Aat>Tat	p.N30321Y	TTN_ENST00000342992.6_Missense_Mutation_p.N29394Y|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.N23089Y|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.N31962Y|TTN_ENST00000359218.5_Missense_Mutation_p.N23022Y|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000456053.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.N22897Y|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30321	Fibronectin type-III 121. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.N22897Y(1)|p.N29392Y(1)|p.N23089Y(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTGTGGCATTGGTATGCACT	0.458																																					p.P22896P												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.A68688T	2						.						132.0	120.0	123.0					2																	179409072		1961	4153	6114	179117318	SO:0001583	missense	7273	exon173			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.90961A>T	2.37:g.179409072T>A	ENSP00000465570:p.Asn30321Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	179117318	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	13.77	2.336373	0.41398	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	6.17	6.17	0.99709	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.48259	0.1490	L	0.31578	0.945	0.09310	N	0.999999	B;B;B;B	0.30793	0.295;0.295;0.295;0.196	B;B;B;B	0.34452	0.104;0.104;0.183;0.183	T	0.51865	-0.8651	9	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	22897;23022;23089;30321	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Y	29394;22897;23089;23022;22894	ENSP00000343764:N29394Y;ENSP00000434586:N22897Y;ENSP00000340554:N23089Y;ENSP00000352154:N23022Y	ENSP00000340554:N23089Y	N	-	1	0	TTN	179117318	1.000000	0.71417	0.995000	0.50966	0.852000	0.48524	5.160000	0.64929	2.371000	0.80710	0.533000	0.62120	AAT		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DNAH7	56171	broad.mit.edu	37	2	196759937	196759937	+	Silent	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr2:196759937C>T	ENST00000312428.6	-	30	4759	c.4659G>A	c.(4657-4659)tcG>tcA	p.S1553S		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1553					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.S1553S(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GAAACAAATCCGAAGTAATTC	0.313																																					p.S1553S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4659A	2						.						57.0	51.0	52.0					2																	196759937		1803	4070	5873	196468182	SO:0001819	synonymous_variant	56171	exon30			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.4659G>A	2.37:g.196759937C>T		Somatic		Capture	Illumina HiSeq	Phase_I	196468182	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	CCDS42794.1																																																																																				DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
WDR43	23160	broad.mit.edu	37	2	29135514	29135514	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr2:29135514A>G	ENST00000407426.3	+	4	600	c.544A>G	c.(544-546)Atg>Gtg	p.M182V	SNORD92_ENST00000585078.1_RNA	NM_015131.1	NP_055946.1	Q15061	WDR43_HUMAN	WD repeat domain 43	182						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.M225V(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	20	Acute lymphoblastic leukemia(172;0.155)					AGATGGAAAGATGTTGCTTTC	0.378																																					p.M182V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A544G	2						.						130.0	124.0	126.0					2																	29135514		1863	4101	5964	28989018	SO:0001583	missense	23160	exon4			D87716	CCDS46251.1	2p23.3	2013-01-09			ENSG00000163811	ENSG00000163811		"""WD repeat domain containing"""	28945	protein-coding gene	gene with protein product	"""UTP5, small subunit (SSU) processome component, homolog (yeast)"""					7584026, 7584028, 17699751	Standard	NM_015131		Approved	KIAA0007, NET12, UTP5	uc002rmo.2	Q15061	OTTHUMG00000152015	ENST00000407426.3:c.544A>G	2.37:g.29135514A>G	ENSP00000384302:p.Met182Val	Somatic		Capture	Illumina HiSeq	Phase_I	28989018	NM_015131	Q15395|Q92577	Missense_Mutation	SNP	ENST00000407426.3	37	CCDS46251.1	.	.	.	.	.	.	.	.	.	.	A	15.27	2.782380	0.49891	.	.	ENSG00000163811	ENST00000407426;ENST00000440983;ENST00000296126	T;T	0.58506	0.33;0.33	5.81	5.81	0.92471	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.040265	0.85682	D	0.000000	T	0.41373	0.1156	N	0.11756	0.17	0.41614	D	0.988926	B	0.25206	0.12	B	0.24006	0.05	T	0.30060	-0.9991	10	0.28530	T	0.3	-20.3857	16.1756	0.81847	1.0:0.0:0.0:0.0	.	182	Q15061	WDR43_HUMAN	V	182;93;1	ENSP00000384302:M182V;ENSP00000415355:M93V	ENSP00000296126:M1V	M	+	1	0	WDR43	28989018	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.229000	0.58625	2.213000	0.71641	0.528000	0.53228	ATG		WDR43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324865.1	XM_087089	
NRXN1	9378	broad.mit.edu	37	2	50779872	50779872	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr2:50779872C>A	ENST00000406316.2	-	9	3088	c.1612G>T	c.(1612-1614)Gtg>Ttg	p.V538L	NRXN1_ENST00000401669.2_Missense_Mutation_p.V538L|NRXN1_ENST00000402717.3_Missense_Mutation_p.V530L|NRXN1_ENST00000405472.3_Missense_Mutation_p.V530L|NRXN1_ENST00000404971.1_Missense_Mutation_p.V578L|NRXN1_ENST00000406859.3_Missense_Mutation_p.V538L|NRXN1_ENST00000331040.5_5'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	538	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.V579L(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AAGAAGTCCACCTTTATCATC	0.438																																					p.V578L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1732T	2						.						172.0	160.0	164.0					2																	50779872		1925	4125	6050	50633376	SO:0001583	missense	9378	exon10			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.1612G>T	2.37:g.50779872C>A	ENSP00000384311:p.Val538Leu	Somatic		Capture	Illumina HiSeq	Phase_I	50633376	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	33	5.207825	0.95033	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.85839	0.5790	M	0.77820	2.39	0.46954	D	0.999269	D;P;P	0.54964	0.969;0.72;0.772	P;B;P	0.54629	0.757;0.217;0.542	D	0.83369	0.0006	10	0.32370	T	0.25	.	20.3495	0.98807	0.0:1.0:0.0:0.0	.	578;538;530	Q9ULB1-3;F8WB18;A7E294	.;.;.	L	578;538;530;538;579;530;538	ENSP00000385142:V578L;ENSP00000384311:V538L;ENSP00000434015:V530L;ENSP00000385017:V538L;ENSP00000385434:V530L;ENSP00000385681:V538L	ENSP00000385017:V538L	V	-	1	0	NRXN1	50633376	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	7.818000	0.86416	2.814000	0.96858	0.591000	0.81541	GTG		NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
ACTR2	10097	broad.mit.edu	37	2	65480927	65480927	+	Missense_Mutation	SNP	G	G	A	rs17851188		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr2:65480927G>A	ENST00000260641.5	+	5	671	c.514G>A	c.(514-516)Ggc>Agc	p.G172S	ACTR2_ENST00000377982.4_Missense_Mutation_p.G177S|ACTR2_ENST00000542850.1_Missense_Mutation_p.G117S	NM_005722.3	NP_005713.1	P61160	ARP2_HUMAN	ARP2 actin-related protein 2 homolog (yeast)	172				G -> S (in Ref. 6; AAH14546). {ECO:0000305}.	Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium assembly (GO:0042384)|cytoplasmic transport (GO:0016482)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|spindle localization (GO:0051653)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)	p.G172S(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)	12						AGTATATGAAGGCTTTTCTCT	0.398																																					p.G177S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G529A	2						.						163.0	151.0	155.0					2																	65480927		2203	4300	6503	65334431	SO:0001583	missense	10097	exon6			AF006082	CCDS1881.1, CCDS46307.1	2p14	2008-05-20	2001-11-28		ENSG00000138071	ENSG00000138071			169	protein-coding gene	gene with protein product		604221	"""ARP2 (actin-related protein 2, yeast) homolog"""			9230079	Standard	NM_001005386		Approved	ARP2	uc002sdp.3	P61160	OTTHUMG00000129540	ENST00000260641.5:c.514G>A	2.37:g.65480927G>A	ENSP00000260641:p.Gly172Ser	Somatic		Capture	Illumina HiSeq	Phase_I	65334431	NM_001005386	B2RCP5|D6W5F4|E9PF41|O15142|Q96C82	Missense_Mutation	SNP	ENST00000260641.5	37	CCDS1881.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362800	0.82353	.	.	ENSG00000138071	ENST00000260641;ENST00000542850;ENST00000377982;ENST00000535303	D;D;D	0.97598	-4.45;-4.45;-4.45	5.95	5.95	0.96441	.	0.057176	0.64402	U	0.000001	D	0.97346	0.9132	M	0.79926	2.475	0.80722	D	1	P;B;B	0.40602	0.723;0.419;0.419	B;P;P	0.44772	0.381;0.46;0.46	D	0.96435	0.9322	10	0.30854	T	0.27	-8.1296	20.3886	0.98946	0.0:0.0:1.0:0.0	rs17851188	117;172;177	F5H6T1;P61160;E9PF41	.;ARP2_HUMAN;.	S	172;117;177;117	ENSP00000260641:G172S;ENSP00000437383:G117S;ENSP00000367220:G177S	ENSP00000260641:G172S	G	+	1	0	ACTR2	65334431	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.766000	0.98957	2.810000	0.96702	0.650000	0.86243	GGC		ACTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251730.1	NM_001005386	
TEX261	113419	broad.mit.edu	37	2	71219083	71219083	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr2:71219083C>T	ENST00000272438.4	-	3	368	c.181G>A	c.(181-183)Gtc>Atc	p.V61I	TEX261_ENST00000466731.1_5'UTR|AC007040.6_ENST00000416229.1_RNA|AC007040.11_ENST00000606025.1_Missense_Mutation_p.V61I|AC007040.6_ENST00000601923.1_RNA	NM_144582.2	NP_653183.2	Q6UWH6	TX261_HUMAN	testis expressed 261	61						integral component of membrane (GO:0016021)		p.V61I(1)		NS(1)|breast(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						CGCTCAAAGACGTAGAGGCCA	0.562																																					p.V61I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G181A	2						.						121.0	93.0	103.0					2																	71219083		2203	4300	6503	71072591	SO:0001583	missense	113419	exon3			AL832385	CCDS1914.1	2p13.3	2013-09-24	2007-03-13		ENSG00000144043	ENSG00000144043			30712	protein-coding gene	gene with protein product			"""testis expressed sequence 261"""			9464256	Standard	NM_144582		Approved	MGC32043, TEG-261	uc002shn.3	Q6UWH6	OTTHUMG00000129708	ENST00000272438.4:c.181G>A	2.37:g.71219083C>T	ENSP00000272438:p.Val61Ile	Somatic		Capture	Illumina HiSeq	Phase_I	71072591	NM_144582	A1A587|D6W5G9|Q8WUJ5	Missense_Mutation	SNP	ENST00000272438.4	37	CCDS1914.1	.	.	.	.	.	.	.	.	.	.	C	6.084	0.383702	0.11524	.	.	ENSG00000144043	ENST00000272438	.	.	.	4.71	0.931	0.19460	.	0.361089	0.26103	N	0.026326	T	0.13415	0.0325	N	0.05280	-0.08	0.25677	N	0.985839	B	0.06786	0.001	B	0.08055	0.003	T	0.25328	-1.0135	9	0.14252	T	0.57	-7.5132	5.4481	0.16548	0.1428:0.6012:0.0:0.256	.	61	Q6UWH6	TX261_HUMAN	I	61	.	ENSP00000272438:V61I	V	-	1	0	TEX261	71072591	0.998000	0.40836	0.981000	0.43875	0.699000	0.40488	0.467000	0.22035	-0.008000	0.14320	-1.728000	0.00702	GTC		TEX261-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251916.1	NM_144582	
ACVR2A	92	broad.mit.edu	37	2	148684718	148684718	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr2:148684718delG	ENST00000241416.7	+	11	2053	c.1417delG	c.(1417-1419)ggafs	p.G473fs	ACVR2A_ENST00000404590.1_Frame_Shift_Del_p.G473fs|ACVR2A_ENST00000535787.1_Frame_Shift_Del_p.G365fs|ACVR2A_ENST00000495775.1_3'UTR	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	473	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.G473fs*3(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		GTTATCAGCTGGATGTGTAGG	0.413																																					p.G473fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1417delG	2						.						125.0	114.0	118.0					2																	148684718		2203	4300	6503	148401188	SO:0001589	frameshift_variant	92	exon11				CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1417delG	2.37:g.148684718delG	ENSP00000241416:p.Gly473fs	Somatic		Capture	Illumina HiSeq	Phase_I	148401188	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Frame_Shift_Del	DEL	ENST00000241416.7	37	CCDS33301.1																																																																																				ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
EPHA4	2043	broad.mit.edu	37	2	222365799	222365799	+	Missense_Mutation	SNP	G	G	A	rs537081277		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr2:222365799G>A	ENST00000281821.2	-	4	958	c.917C>T	c.(916-918)tCg>tTg	p.S306L	EPHA4_ENST00000392071.4_Missense_Mutation_p.S255L|EPHA4_ENST00000409854.1_Missense_Mutation_p.S306L|EPHA4_ENST00000409938.1_Missense_Mutation_p.S306L	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	306	Cys-rich.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)	p.S306L(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		ACAGGTGCACGAGGTGGCTCC	0.542													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18936	0.0		0.0	False		,,,				2504	0.0				p.S306L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C917T	2						.						126.0	109.0	115.0					2																	222365799		2203	4300	6503	222074043	SO:0001583	missense	2043	exon4			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.917C>T	2.37:g.222365799G>A	ENSP00000281821:p.Ser306Leu	Somatic		Capture	Illumina HiSeq	Phase_I	222074043	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	37	CCDS2447.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.47|15.47	2.844289|2.844289	0.51164|0.51164	.|.	.|.	ENSG00000116106|ENSG00000116106	ENST00000441679|ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	.|T;T;T;T	.|0.62498	.|0.02;0.02;0.02;0.02	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.52468|0.52468	0.1736|0.1736	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	.|P	.|0.37612	.|0.602	.|B	.|0.24155	.|0.051	T|T	0.53697|0.53697	-0.8402|-0.8402	5|10	.|0.10111	.|T	.|0.7	.|.	20.6439|20.6439	0.99570|0.99570	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|306	.|P54764	.|EPHA4_HUMAN	C|L	43|306;306;306;255	.|ENSP00000281821:S306L;ENSP00000386276:S306L;ENSP00000386829:S306L;ENSP00000375923:S255L	.|ENSP00000281821:S306L	R|S	-|-	1|2	0|0	EPHA4|EPHA4	222074043|222074043	1.000000|1.000000	0.71417|0.71417	0.976000|0.976000	0.42696|0.42696	0.987000|0.987000	0.75469|0.75469	7.648000|7.648000	0.83479|0.83479	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	CGT|TCG		EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
MORC1	27136	broad.mit.edu	37	3	108698424	108698424	+	Silent	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr3:108698424C>T	ENST00000483760.1	-	23	2395	c.2352G>A	c.(2350-2352)tcG>tcA	p.S784S	MORC1_ENST00000232603.5_Silent_p.S805S					MORC family CW-type zinc finger 1									p.S805S(1)		breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						AAGACGCTGGCGAAGAAGCAA	0.418																																					p.S805S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2415A	3						.						114.0	111.0	112.0					3																	108698424		2203	4300	6503	110181114	SO:0001819	synonymous_variant	27136	exon24			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.2352G>A	3.37:g.108698424C>T		Somatic		Capture	Illumina HiSeq	Phase_I	110181114	NM_014429		Silent	SNP	ENST00000483760.1	37																																																																																					MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1		
PLA1A	51365	broad.mit.edu	37	3	119331875	119331875	+	Missense_Mutation	SNP	G	G	A	rs527318106		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr3:119331875G>A	ENST00000273371.4	+	5	646	c.574G>A	c.(574-576)Gct>Act	p.A192T	PLA1A_ENST00000494440.1_Missense_Mutation_p.A176T|PLA1A_ENST00000495992.1_Missense_Mutation_p.A176T|PLA1A_ENST00000488919.1_Missense_Mutation_p.A19T	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	192					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)	p.A192T(1)		NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CCTGGACCCCGCTGGACCTGA	0.587																																					p.A192T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G574A	3						.						51.0	40.0	44.0					3																	119331875		2203	4300	6503	120814565	SO:0001583	missense	51365	exon5			AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.574G>A	3.37:g.119331875G>A	ENSP00000273371:p.Ala192Thr	Somatic		Capture	Illumina HiSeq	Phase_I	120814565	NM_015900	B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Missense_Mutation	SNP	ENST00000273371.4	37	CCDS2991.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.644634	0.87859	.	.	ENSG00000144837	ENST00000273371;ENST00000488919;ENST00000495992;ENST00000494440;ENST00000475963	D;D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09;-3.09	6.06	6.06	0.98353	Lipase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96938	0.9000	M	0.90198	3.095	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97130	0.9817	10	0.87932	D	0	-19.1769	18.4126	0.90557	0.0:0.0:1.0:0.0	.	176;192	Q53H76-3;Q53H76	.;PLA1A_HUMAN	T	192;19;176;176;58	ENSP00000273371:A192T;ENSP00000420625:A19T;ENSP00000417326:A176T;ENSP00000418793:A176T;ENSP00000417295:A58T	ENSP00000273371:A192T	A	+	1	0	PLA1A	120814565	1.000000	0.71417	0.986000	0.45419	0.443000	0.32047	8.933000	0.92911	2.879000	0.98667	0.650000	0.86243	GCT		PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355252.2		
RAF1	5894	broad.mit.edu	37	3	12645699	12645699	+	Missense_Mutation	SNP	G	G	A	rs80338796		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr3:12645699G>A	ENST00000251849.4	-	7	1209	c.770C>T	c.(769-771)tCg>tTg	p.S257L	RAF1_ENST00000442415.2_Missense_Mutation_p.S257L|RAF1_ENST00000542177.1_Missense_Mutation_p.S176L|RAF1_ENST00000534997.1_Missense_Mutation_p.S42L	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	257			S -> L (in NS5 and LEOPARD2; shows in vitro greater kinase activity and enhanced ERK activation than wild-type). {ECO:0000269|PubMed:17603482, ECO:0000269|PubMed:17603483}.		activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S257L(3)|p.S257W(1)	ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	TGTGGATGTCGACCTCTGCCT	0.527			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																												p.S257L			Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	.	.	4	Substitution - Missense(4)	large_intestine(3)|lung(1)	c.C770T	3	GRCh37	CM073301	RAF1	M	rs80338796	.						157.0	138.0	145.0					3																	12645699		2203	4300	6503	12620699	SO:0001583	missense	5894	exon7	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.770C>T	3.37:g.12645699G>A	ENSP00000251849:p.Ser257Leu	Somatic		Capture	Illumina HiSeq	Phase_I	12620699	NM_002880	B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	ENST00000251849.4	37	CCDS2612.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523633	0.85600	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000534997;ENST00000542177	T;T;T;T;T	0.77358	-1.07;-1.09;-1.01;-0.96;-1.05	5.73	5.73	0.89815	.	0.108329	0.64402	D	0.000003	T	0.81173	0.4767	M	0.81802	2.56	0.80722	A	1	P;P;B	0.48230	0.907;0.746;0.337	B;B;B	0.40741	0.339;0.226;0.117	D	0.85183	0.1005	9	0.87932	D	0	.	20.2602	0.98440	0.0:0.0:1.0:0.0	.	176;42;257	B4E0X2;B4E1N6;P04049	.;.;RAF1_HUMAN	L	257;257;136;42;176	ENSP00000251849:S257L;ENSP00000401888:S257L;ENSP00000398591:S136L;ENSP00000441186:S42L;ENSP00000443567:S176L	ENSP00000251849:S257L	S	-	2	0	RAF1	12620699	1.000000	0.71417	0.974000	0.42286	0.322000	0.28314	9.807000	0.99171	2.861000	0.98227	0.655000	0.94253	TCG		RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252015.2	NM_002880	
MUC13	56667	broad.mit.edu	37	3	124627133	124627133	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr3:124627133A>C	ENST00000311075.3	-	11	1435	c.1397T>G	c.(1396-1398)cTa>cGa	p.L466R		NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	467					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)	p.L466R(1)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						CCGCAGTTTTAGATTTTGAAA	0.428																																					p.L466R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1397G	3						.						95.0	90.0	92.0					3																	124627133		2203	4300	6503	126109823	SO:0001583	missense	56667	exon11			AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.1397T>G	3.37:g.124627133A>C	ENSP00000312235:p.Leu466Arg	Somatic		Capture	Illumina HiSeq	Phase_I	126109823	NM_033049	Q6UWD9|Q9NXT5	Missense_Mutation	SNP	ENST00000311075.3	37		.	.	.	.	.	.	.	.	.	.	A	14.92	2.680641	0.47886	.	.	ENSG00000173702	ENST00000311075	T	0.18174	2.23	4.18	4.18	0.49190	.	0.673556	0.12456	N	0.467291	T	0.34048	0.0884	L	0.59436	1.845	0.09310	N	1	D	0.76494	0.999	D	0.66196	0.942	T	0.06215	-1.0839	10	0.48119	T	0.1	-6.8653	9.9211	0.41464	1.0:0.0:0.0:0.0	.	466	Q9H3R2	MUC13_HUMAN	R	466	ENSP00000312235:L466R	ENSP00000312235:L466R	L	-	2	0	MUC13	126109823	0.021000	0.18746	0.003000	0.11579	0.014000	0.08584	3.851000	0.55926	2.119000	0.64992	0.533000	0.62120	CTA		MUC13-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000355714.1	NM_033049	
BCHE	590	broad.mit.edu	37	3	165491218	165491218	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr3:165491218A>T	ENST00000264381.3	-	4	1927	c.1761T>A	c.(1759-1761)aaT>aaA	p.N587K	BCHE_ENST00000540653.1_Missense_Mutation_p.N49K	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	587					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)	p.N587K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	CGTTAAATTGATTTTTCCAGT	0.333																																					p.N587K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1761A	3						.						128.0	122.0	124.0					3																	165491218		2202	4300	6502	166973912	SO:0001583	missense	590	exon4			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1761T>A	3.37:g.165491218A>T	ENSP00000264381:p.Asn587Lys	Somatic		Capture	Illumina HiSeq	Phase_I	166973912	NM_000055	A8K7P8	Missense_Mutation	SNP	ENST00000264381.3	37	CCDS3198.1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.750022	0.49257	.	.	ENSG00000114200	ENST00000264381;ENST00000479451;ENST00000540653	T;T;T	0.76448	-0.08;-1.01;-1.02	5.18	4.01	0.46588	Acetylcholinesterase, tetramerisation (2);	0.141568	0.46442	D	0.000285	T	0.74589	0.3736	M	0.68952	2.095	0.43368	D	0.995457	B	0.31769	0.339	B	0.32583	0.148	T	0.73861	-0.3849	10	0.72032	D	0.01	.	10.2796	0.43532	0.9215:0.0:0.0785:0.0	.	587	P06276	CHLE_HUMAN	K	587;117;49	ENSP00000264381:N587K;ENSP00000418325:N117K;ENSP00000443583:N49K	ENSP00000264381:N587K	N	-	3	2	BCHE	166973912	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.097000	0.50251	0.898000	0.36418	0.528000	0.53228	AAT		BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1		
PIK3CA	5290	broad.mit.edu	37	3	178952100	178952100	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr3:178952100C>A	ENST00000263967.3	+	21	3312	c.3155C>A	c.(3154-3156)aCa>aAa	p.T1052K	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1052	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		T -> K (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.T1052K(7)|p.T1052I(2)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GGTGGCTGGACAACAAAAATG	0.388		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.T1052K	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,lung,NS,Substitution - Missense,0 	.	9	Substitution - Missense(9)	endometrium(3)|large_intestine(2)|lung(2)|thyroid(1)|breast(1)	c.C3155A	3						.						98.0	88.0	91.0					3																	178952100		1917	4131	6048	180434794	SO:0001583	missense	5290	exon21				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3155C>A	3.37:g.178952100C>A	ENSP00000263967:p.Thr1052Lys	Somatic		Capture	Illumina HiSeq	Phase_I	180434794	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.379869	0.42207	.	.	ENSG00000121879	ENST00000263967	D	0.83075	-1.68	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.78521	0.4296	L	0.39397	1.21	0.80722	D	1	B	0.31040	0.305	B	0.30782	0.12	T	0.72737	-0.4203	10	0.15066	T	0.55	-14.979	20.6721	0.99693	0.0:1.0:0.0:0.0	.	1052	P42336	PK3CA_HUMAN	K	1052	ENSP00000263967:T1052K	ENSP00000263967:T1052K	T	+	2	0	PIK3CA	180434794	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.403000	0.79983	2.894000	0.99253	0.591000	0.81541	ACA		PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
DHX30	22907	broad.mit.edu	37	3	47888040	47888040	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr3:47888040G>A	ENST00000445061.1	+	11	1885	c.1478G>A	c.(1477-1479)cGc>cAc	p.R493H	DHX30_ENST00000348968.4_Missense_Mutation_p.R465H|DHX30_ENST00000446256.2_Missense_Mutation_p.R454H|DHX30_ENST00000457607.1_Missense_Mutation_p.R521H	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	493	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.R493H(1)		endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		CAACCTCGCCGCATCTCTGCT	0.642																																					p.R493H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1478A	3						.						66.0	68.0	68.0					3																	47888040		2203	4300	6503	47863044	SO:0001583	missense	22907	exon11			AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.1478G>A	3.37:g.47888040G>A	ENSP00000405620:p.Arg493His	Somatic		Capture	Illumina HiSeq	Phase_I	47863044	NM_138615	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	SNP	ENST00000445061.1	37	CCDS2759.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.000140	0.93227	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	4.94	4.94	0.65067	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.62295	0.2416	H	0.96777	3.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.77424	-0.2593	10	0.87932	D	0	.	17.1598	0.86801	0.0:0.0:1.0:0.0	.	493;454	Q7L2E3;Q7L2E3-3	DHX30_HUMAN;.	H	454;493;465;521	ENSP00000392601:R454H;ENSP00000405620:R493H;ENSP00000343442:R465H;ENSP00000394682:R521H	ENSP00000343442:R465H	R	+	2	0	DHX30	47863044	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	9.781000	0.99029	2.289000	0.77006	0.561000	0.74099	CGC		DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615	
EOGT	285203	broad.mit.edu	37	3	69058802	69058802	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr3:69058802G>T	ENST00000383701.3	-	4	938	c.196C>A	c.(196-198)Ctt>Att	p.L66I	EOGT_ENST00000540764.1_5'Flank|EOGT_ENST00000540955.1_5'UTR|EOGT_ENST00000295571.5_Missense_Mutation_p.L66I	NM_001278689.1	NP_001265618.1	Q5NDL2	EOGT_HUMAN	EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase	66					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)	protein N-acetylglucosaminyltransferase activity (GO:0016262)	p.L66I(1)									TATGGACAAAGAGAGTCTTTC	0.403																																					p.L66I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C196A	3						.						88.0	79.0	82.0					3																	69058802		2203	4300	6503	69141492	SO:0001583	missense	285203	exon4			AK091089	CCDS2908.1, CCDS63684.1	3p14.1	2013-10-11	2012-05-21	2012-05-21	ENSG00000163378	ENSG00000163378	2.4.1.255		28526	protein-coding gene	gene with protein product	"""AER61 glycosyltransferase"""	614789	"""chromosome 3 open reading frame 64"""	C3orf64		22310717	Standard	NM_001278689		Approved	AER61, FLJ33770	uc003dnk.3	Q5NDL2	OTTHUMG00000156279	ENST00000383701.3:c.196C>A	3.37:g.69058802G>T	ENSP00000373206:p.Leu66Ile	Somatic		Capture	Illumina HiSeq	Phase_I	69141492	NM_173654	A8K2U1|B4DFH5|L7X1M5|Q6MZY0|Q6P985|Q6ZTV0	Missense_Mutation	SNP	ENST00000383701.3	37		.	.	.	.	.	.	.	.	.	.	G	4.070	0.010883	0.07912	.	.	ENSG00000163378	ENST00000383701;ENST00000295571;ENST00000424374;ENST00000456376	.	.	.	5.83	5.83	0.93111	.	0.452223	0.26955	N	0.021646	T	0.40067	0.1102	N	0.08118	0	0.80722	D	1	B;B	0.17465	0.001;0.022	B;B	0.21708	0.002;0.036	T	0.22452	-1.0216	9	0.32370	T	0.25	-16.9465	15.691	0.77453	0.0:0.0:0.8625:0.1375	.	66;66	Q5NDL2;Q5NDL2-3	AER61_HUMAN;.	I	66	.	ENSP00000295571:L66I	L	-	1	0	C3orf64	69141492	0.499000	0.26083	0.013000	0.15412	0.150000	0.21749	3.907000	0.56348	2.763000	0.94921	0.585000	0.79938	CTT		EOGT-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000343722.1	NM_173654	
FXR1	8087	broad.mit.edu	37	3	180680719	180680719	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr3:180680719C>T	ENST00000357559.4	+	12	1510	c.1126C>T	c.(1126-1128)Cga>Tga	p.R376*	FXR1_ENST00000480918.1_Nonsense_Mutation_p.R363*|FXR1_ENST00000468861.1_Nonsense_Mutation_p.R291*|FXR1_ENST00000491062.1_Nonsense_Mutation_p.R327*|FXR1_ENST00000305586.7_Nonsense_Mutation_p.R291*|FXR1_ENST00000445140.2_Nonsense_Mutation_p.R376*	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	376					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R376*(1)		breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			TGAACAGCTGCGACAGATTGG	0.393																																					p.R376X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1126T	3						.						176.0	181.0	179.0					3																	180680719		2203	4300	6503	182163413	SO:0001587	stop_gained	8087	exon12			M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1126C>T	3.37:g.180680719C>T	ENSP00000350170:p.Arg376*	Somatic		Capture	Illumina HiSeq	Phase_I	182163413	NM_001013438	A8K9B8|Q7Z450|Q8N6R8	Nonsense_Mutation	SNP	ENST00000357559.4	37	CCDS3238.1	.	.	.	.	.	.	.	.	.	.	C	41	8.544115	0.98857	.	.	ENSG00000114416	ENST00000357559;ENST00000305586;ENST00000491062;ENST00000468861;ENST00000445140;ENST00000480918	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0345	19.1372	0.93433	0.0:1.0:0.0:0.0	.	.	.	.	X	376;291;327;291;376;363	.	ENSP00000307633:R291X	R	+	1	2	FXR1	182163413	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	7.130000	0.77235	2.596000	0.87737	0.467000	0.42956	CGA		FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350265.5		
PITX2	5308	broad.mit.edu	37	4	111553532	111553532	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr4:111553532T>A	ENST00000354925.2	-	5	1856	c.151A>T	c.(151-153)Aag>Tag	p.K51*	PITX2_ENST00000394598.2_Nonsense_Mutation_p.K51*|PITX2_ENST00000355080.5_Intron|PITX2_ENST00000394595.3_Nonsense_Mutation_p.K51*	NM_001204397.1	NP_001191326.1	Q99697	PITX2_HUMAN	paired-like homeodomain 2	51					atrial cardiac muscle tissue morphogenesis (GO:0055009)|atrioventricular valve development (GO:0003171)|camera-type eye development (GO:0043010)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|deltoid tuberosity development (GO:0035993)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic hindlimb morphogenesis (GO:0035116)|endodermal digestive tract morphogenesis (GO:0061031)|extraocular skeletal muscle development (GO:0002074)|female gonad development (GO:0008585)|hair cell differentiation (GO:0035315)|hypothalamus cell migration (GO:0021855)|in utero embryonic development (GO:0001701)|iris morphogenesis (GO:0061072)|left lung morphogenesis (GO:0060460)|left/right axis specification (GO:0070986)|male gonad development (GO:0008584)|myoblast fusion (GO:0007520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|patterning of blood vessels (GO:0001569)|positive regulation of DNA binding (GO:0043388)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin secreting cell differentiation (GO:0060127)|pulmonary myocardium development (GO:0003350)|pulmonary vein morphogenesis (GO:0060577)|regulation of cell migration (GO:0030334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|response to vitamin A (GO:0033189)|somatotropin secreting cell differentiation (GO:0060126)|spleen development (GO:0048536)|subthalamic nucleus development (GO:0021763)|superior vena cava morphogenesis (GO:0060578)|vascular smooth muscle cell differentiation (GO:0035886)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)|ribonucleoprotein complex binding (GO:0043021)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.K51*(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(5)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		GGGAAGAACTTGCTGCTGGCT	0.647											OREG0016293	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K51X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A151T	4						.						50.0	58.0	56.0					4																	111553532		2203	4300	6503	111772981	SO:0001587	stop_gained	5308	exon3			U69961	CCDS3692.1, CCDS3693.1, CCDS3694.1	4q25	2011-06-20	2007-07-12		ENSG00000164093	ENSG00000164093		"""Homeoboxes / PRD class"""	9005	protein-coding gene	gene with protein product		601542	"""paired-like homeodomain transcription factor 2"""	IRID2, IHG2, RIEG, RIEG1, RGS		9539779, 7581385	Standard	NM_000325		Approved	IGDS, RS, Brx1, Otlx2, ARP1	uc021xqr.1	Q99697	OTTHUMG00000132837	ENST00000354925.2:c.151A>T	4.37:g.111553532T>A	ENSP00000347004:p.Lys51*	Somatic	1436	Capture	Illumina HiSeq	Phase_I	111772981	NM_153426	A8K6C6|B2RA02|B3KXS0|O60578|O60579|O60580|Q3KQX9|Q9BY17	Nonsense_Mutation	SNP	ENST00000354925.2	37	CCDS3692.1	.	.	.	.	.	.	.	.	.	.	T	38	7.138844	0.98088	.	.	ENSG00000164093	ENST00000394598;ENST00000354925;ENST00000394595;ENST00000511837	.	.	.	4.84	2.44	0.29823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	8.0438	0.30536	0.0:0.169:0.0:0.831	.	.	.	.	X	51	.	ENSP00000347004:K51X	K	-	1	0	PITX2	111772981	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.430000	0.21428	0.366000	0.24427	0.533000	0.62120	AAG		PITX2-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256308.2		
EXOSC9	5393	broad.mit.edu	37	4	122731149	122731149	+	Silent	SNP	A	A	G			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr4:122731149A>G	ENST00000243498.5	+	7	741	c.633A>G	c.(631-633)gaA>gaG	p.E211E	EXOSC9_ENST00000512454.1_Silent_p.E195E|EXOSC9_ENST00000509980.1_3'UTR|EXOSC9_ENST00000379663.3_Silent_p.E211E	NM_005033.2	NP_005024.2	Q06265	EXOS9_HUMAN	exosome component 9	211	ARE binding.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|immune response (GO:0006955)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|intermediate filament cytoskeleton (GO:0045111)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.E211E(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|urinary_tract(1)	16						ATCCCAATGAACGAGAAGAAC	0.393																																					p.E211E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A633G	4						.						179.0	165.0	169.0					4																	122731149		2203	4300	6503	122950599	SO:0001819	synonymous_variant	5393	exon7			M58460	CCDS3722.2, CCDS34057.1	4q27	2010-05-07	2004-06-16	2004-06-18	ENSG00000123737	ENSG00000123737	3.1.13.-		9137	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 1 (75kD)"""	606180	"""polymyositis/scleroderma autoantigen 1, 75kDa"""	PMSCL1			Standard	XR_427545		Approved	PM/Scl-75, Rrp45p, RRP45, p5, p6	uc003idz.3	Q06265	OTTHUMG00000128783	ENST00000243498.5:c.633A>G	4.37:g.122731149A>G		Somatic		Capture	Illumina HiSeq	Phase_I	122950599	NM_001034194	Q12883|Q4W5P5|Q86Y41|Q86Y48	Silent	SNP	ENST00000243498.5	37	CCDS3722.2	.	.	.	.	.	.	.	.	.	.	A	10.27	1.304733	0.23736	.	.	ENSG00000123737	ENST00000511132	.	.	.	5.63	-0.0501	0.13832	.	.	.	.	.	T	0.57242	0.2040	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50276	-0.8847	4	.	.	.	-17.9222	9.7982	0.40748	0.7157:0.0:0.2843:0.0	.	.	.	.	A	47	.	.	T	+	1	0	EXOSC9	122950599	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	0.953000	0.29162	-0.201000	0.10284	0.397000	0.26171	ACG		EXOSC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250708.2	NM_005033	
CCNA2	890	broad.mit.edu	37	4	122740603	122740603	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr4:122740603G>C	ENST00000274026.5	-	5	1229	c.926C>G	c.(925-927)cCa>cGa	p.P309R		NM_001237.3	NP_001228	P20248	CCNA2_HUMAN	cyclin A2	309					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|organ regeneration (GO:0031100)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|response to estradiol (GO:0032355)|response to glucagon (GO:0033762)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.P309R(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	12						ATTTACTGTTGGAGCAGCTAA	0.378																																					p.P309R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C926G	4						.						116.0	114.0	115.0					4																	122740603		2203	4300	6503	122960053	SO:0001583	missense	890	exon5				CCDS3723.1	4q27	2012-07-12			ENSG00000145386	ENSG00000145386			1578	protein-coding gene	gene with protein product		123835		CCNA, CCN1		1675006	Standard	NM_001237		Approved		uc003iec.4	P20248	OTTHUMG00000133072	ENST00000274026.5:c.926C>G	4.37:g.122740603G>C	ENSP00000274026:p.Pro309Arg	Somatic		Capture	Illumina HiSeq	Phase_I	122960053	NM_001237	A8K7B6|Q2M3U6|Q4W5P4|Q6LER8	Missense_Mutation	SNP	ENST00000274026.5	37	CCDS3723.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.965632	0.92855	.	.	ENSG00000145386	ENST00000274026	T	0.37411	1.2	6.04	6.04	0.98038	Cyclin, C-terminal (1);Cyclin-like (2);	0.000000	0.85682	D	0.000000	T	0.76263	0.3963	H	0.97440	4.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83866	0.0271	10	0.87932	D	0	.	20.5792	0.99380	0.0:0.0:1.0:0.0	.	309	P20248	CCNA2_HUMAN	R	309	ENSP00000274026:P309R	ENSP00000274026:P309R	P	-	2	0	CCNA2	122960053	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.787000	0.99055	2.873000	0.98535	0.561000	0.74099	CCA		CCNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256712.2	NM_001237	
FAT4	79633	broad.mit.edu	37	4	126336347	126336348	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	CC	CC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr4:126336347_126336348CC>AG	ENST00000394329.3	+	5	6242_6243	c.6229_6230CC>AG	c.(6229-6231)CCa>AGa	p.P2077R	FAT4_ENST00000335110.5_Missense_Mutation_p.P375R	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2077	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P2077>?(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AGCAACTGACCCAGATAGTGGC	0.416																																					.												.	.	2	Complex(2)	large_intestine(2)	c.6229_6230AG	4						.																																			126555798	SO:0001583	missense	79633	exon5			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	Exception_encountered	4.37:g.126336347_126336348delinsAG	ENSP00000377862:p.Pro2077Arg	Somatic		Capture	Illumina HiSeq	Phase_I	126555797	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	DNP	ENST00000394329.3	37	CCDS3732.3																																																																																				FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
FAT4	79633	broad.mit.edu	37	4	126412605	126412605	+	Silent	SNP	T	T	C			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr4:126412605T>C	ENST00000394329.3	+	17	14641	c.14628T>C	c.(14626-14628)tcT>tcC	p.S4876S	FAT4_ENST00000335110.5_Silent_p.S3117S	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4876					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S4876S(1)|p.S4819S(1)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TCAATGAATCTGATGCAGATG	0.488																																					p.S4876S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T14628C	4						.						65.0	65.0	65.0					4																	126412605		2203	4300	6503	126632055	SO:0001819	synonymous_variant	79633	exon17			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.14628T>C	4.37:g.126412605T>C		Somatic		Capture	Illumina HiSeq	Phase_I	126632055	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																				FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
HTT	3064	broad.mit.edu	37	4	3133387	3133387	+	Silent	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr4:3133387G>A	ENST00000355072.5	+	16	2266	c.2121G>A	c.(2119-2121)gtG>gtA	p.V707V		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	707					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)	p.V707V(1)		breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		ACAGGGATGTGAGGGTCAGCG	0.512																																					p.V707V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2121A	4						.						57.0	63.0	61.0					4																	3133387		2106	4221	6327	3103185	SO:0001819	synonymous_variant	3064	exon16			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.2121G>A	4.37:g.3133387G>A		Somatic		Capture	Illumina HiSeq	Phase_I	3103185	NM_002111	Q9UQB7	Silent	SNP	ENST00000355072.5	37	CCDS43206.1																																																																																				HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
DHX15	1665	broad.mit.edu	37	4	24541846	24541846	+	Silent	SNP	T	T	C			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr4:24541846T>C	ENST00000336812.4	-	10	1827	c.1671A>G	c.(1669-1671)gaA>gaG	p.E557E	DHX15_ENST00000508032.1_5'Flank	NM_001358.2	NP_001349.2	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 15	557					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.E557E(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	30		Breast(46;0.0503)				TGGATCCCAATTCAGTCAGAT	0.403																																					p.E557E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1671G	4						.						144.0	144.0	144.0					4																	24541846		2203	4300	6503	24150944	SO:0001819	synonymous_variant	1665	exon10			AB001636	CCDS33966.1	4p15.3	2013-05-13	2013-05-13	2003-06-20	ENSG00000109606	ENSG00000109606		"""DEAH-boxes"""	2738	protein-coding gene	gene with protein product		603403	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 15"""	DDX15		9388478	Standard	NM_001358		Approved	HRH2, DBP1, PRP43, PrPp43p, PRPF43	uc003gqx.3	O43143	OTTHUMG00000160304	ENST00000336812.4:c.1671A>G	4.37:g.24541846T>C		Somatic		Capture	Illumina HiSeq	Phase_I	24150944	NM_001358	Q9NQT7	Silent	SNP	ENST00000336812.4	37	CCDS33966.1																																																																																				DHX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360143.1	NM_001358	
ARAP2	116984	broad.mit.edu	37	4	36069795	36069795	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr4:36069795C>A	ENST00000303965.4	-	33	5338	c.4849G>T	c.(4849-4851)Gag>Tag	p.E1617*		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1617					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)	p.E1617*(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TCCTTGTGCTCCAGGCAGTGG	0.517																																					p.E1617X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G4849T	4						.						108.0	108.0	108.0					4																	36069795		2203	4300	6503	35746190	SO:0001587	stop_gained	116984	exon33			AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.4849G>T	4.37:g.36069795C>A	ENSP00000302895:p.Glu1617*	Somatic		Capture	Illumina HiSeq	Phase_I	35746190	NM_015230	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Nonsense_Mutation	SNP	ENST00000303965.4	37	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	C	48	14.230299	0.99785	.	.	ENSG00000047365	ENST00000303965	.	.	.	6.08	6.08	0.98989	.	0.137033	0.52532	D	0.000073	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.1635	0.81734	0.0:1.0:0.0:0.0	.	.	.	.	X	1617	.	ENSP00000302895:E1617X	E	-	1	0	ARAP2	35746190	1.000000	0.71417	1.000000	0.80357	0.646000	0.38490	4.309000	0.59135	2.894000	0.99253	0.655000	0.94253	GAG		ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
WDR19	57728	broad.mit.edu	37	4	39229907	39229907	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr4:39229907T>G	ENST00000399820.3	+	16	1861	c.1707T>G	c.(1705-1707)gaT>gaG	p.D569E	WDR19_ENST00000288634.7_Missense_Mutation_p.D409E	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	569					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)		p.D569E(1)		large_intestine(1)	1						GGCCAATGGATAAAGGTGTAT	0.353																																					p.D569E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1707G	4						.						82.0	79.0	80.0					4																	39229907		1851	4097	5948	38906302	SO:0001583	missense	57728	exon16			AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.1707T>G	4.37:g.39229907T>G	ENSP00000382717:p.Asp569Glu	Somatic		Capture	Illumina HiSeq	Phase_I	38906302	NM_025132	B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Missense_Mutation	SNP	ENST00000399820.3	37	CCDS47042.1	.	.	.	.	.	.	.	.	.	.	T	14.26	2.481944	0.44147	.	.	ENSG00000157796	ENST00000399820;ENST00000288634	T;T	0.68624	-0.3;-0.34	5.53	0.19	0.15125	.	0.087328	0.85682	D	0.000000	T	0.63581	0.2523	M	0.73372	2.23	0.40733	D	0.982767	B	0.27498	0.18	B	0.35278	0.199	T	0.54951	-0.8216	10	0.25751	T	0.34	-26.9945	10.3821	0.44119	0.0:0.427:0.0:0.573	.	569	Q8NEZ3	WDR19_HUMAN	E	569;409	ENSP00000382717:D569E;ENSP00000288634:D409E	ENSP00000288634:D409E	D	+	3	2	WDR19	38906302	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	0.809000	0.27168	-0.153000	0.11137	0.528000	0.53228	GAT		WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360689.1		
YIPF7	285525	broad.mit.edu	37	4	44626628	44626628	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr4:44626628A>C	ENST00000332990.5	-	5	686	c.670T>G	c.(670-672)Ttt>Gtt	p.F224V	YIPF7_ENST00000415895.4_Missense_Mutation_p.F200V	NM_182592.2	NP_872398.2	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7	224						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.F224V(1)		breast(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(1)	12						TGCAGTGAAAAGAACATGGCG	0.532																																					p.F224V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T670G	4						.						45.0	50.0	49.0					4																	44626628		2096	4233	6329	44321385	SO:0001583	missense	285525	exon5			AK096895	CCDS54766.1	4p13	2008-08-07			ENSG00000177752	ENSG00000177752		"""Yip1 domain family"""	26825	protein-coding gene	gene with protein product							Standard	NM_182592		Approved	FLJ39576, FinGER9	uc021xnx.1	Q8N8F6	OTTHUMG00000160467	ENST00000332990.5:c.670T>G	4.37:g.44626628A>C	ENSP00000332772:p.Phe224Val	Somatic		Capture	Illumina HiSeq	Phase_I	44321385	NM_182592	Q3SY21|Q3SY22	Missense_Mutation	SNP	ENST00000332990.5	37	CCDS54766.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.893|8.893	0.954445|0.954445	0.18431|0.18431	.|.	.|.	ENSG00000177752|ENSG00000177752	ENST00000332990|ENST00000415895	T|.	0.39406|.	1.08|.	5.0|5.0	3.79|3.79	0.43588|0.43588	Yip1 domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.50429|0.50429	0.1615|0.1615	L|L	0.31157|0.31157	0.91|0.91	0.38882|0.38882	D|D	0.956937|0.956937	B|.	0.15141|.	0.012|.	B|.	0.22880|.	0.042|.	T|T	0.45948|0.45948	-0.9226|-0.9226	9|5	0.16896|.	T|.	0.51|.	-13.9509|-13.9509	11.1277|11.1277	0.48328|0.48328	0.8451:0.1549:0.0:0.0|0.8451:0.1549:0.0:0.0	.|.	224|.	Q8N8F6|.	YIPF7_HUMAN|.	V|R	224|200	ENSP00000332772:F224V|.	ENSP00000332772:F224V|.	F|L	-|-	1|2	0|0	YIPF7|YIPF7	44321385|44321385	1.000000|1.000000	0.71417|0.71417	0.886000|0.886000	0.34754|0.34754	0.086000|0.086000	0.17979|0.17979	4.002000|4.002000	0.57053|0.57053	0.894000|0.894000	0.36317|0.36317	0.533000|0.533000	0.62120|0.62120	TTT|CTT		YIPF7-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_182592	
ATP10D	57205	broad.mit.edu	37	4	47538043	47538043	+	Silent	SNP	C	C	T	rs377297409		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr4:47538043C>T	ENST00000273859.3	+	7	1277	c.1008C>T	c.(1006-1008)ggC>ggT	p.G336G	ATP10D_ENST00000504445.1_Silent_p.G336G	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	336					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.G336G(1)		NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						GCTTAACTGGCGCAGTAGGTA	0.363																																					p.G336G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1008T	4						.	C		1,4405	2.1+/-5.4	0,1,2202	121.0	116.0	117.0		1008	-2.6	0.9	4		117	0,8598		0,0,4299	no	coding-synonymous	ATP10D	NM_020453.3		0,1,6501	TT,TC,CC		0.0,0.0227,0.0077		336/1427	47538043	1,13003	2203	4299	6502	47232800	SO:0001819	synonymous_variant	57205	exon7			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.1008C>T	4.37:g.47538043C>T		Somatic		Capture	Illumina HiSeq	Phase_I	47232800	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Silent	SNP	ENST00000273859.3	37	CCDS3476.1																																																																																				ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
FRYL	285527	broad.mit.edu	37	4	48548248	48548248	+	Silent	SNP	A	A	C			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr4:48548248A>C	ENST00000503238.1	-	39	5114	c.5115T>G	c.(5113-5115)ccT>ccG	p.P1705P	FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Silent_p.P1705P|FRYL_ENST00000358350.4_Silent_p.P1705P|FRYL_ENST00000507873.2_5'UTR			O94915	FRYL_HUMAN	FRY-like	1705					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.P1705P(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						AGTCAGTCATAGGGGAGGGCT	0.408																																					p.P1705P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T5115G	4						.						69.0	69.0	69.0					4																	48548248		1951	4140	6091	48243005	SO:0001819	synonymous_variant	285527	exon42			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.5115T>G	4.37:g.48548248A>C		Somatic		Capture	Illumina HiSeq	Phase_I	48243005	NM_015030	O95640|Q8WTZ5|Q9NT40	Silent	SNP	ENST00000503238.1	37	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	A	9.545	1.114353	0.20795	.	.	ENSG00000075539	ENST00000514617	.	.	.	5.47	-5.41	0.02648	.	.	.	.	.	T	0.48804	0.1520	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50448	-0.8827	4	.	.	.	.	7.7121	0.28684	0.1921:0.0968:0.581:0.1301	.	.	.	.	D	575	.	.	Y	-	1	0	FRYL	48243005	0.076000	0.21285	0.893000	0.35052	0.982000	0.71751	-0.685000	0.05167	-0.775000	0.04584	-0.379000	0.06801	TAT		FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
PCDH10	57575	broad.mit.edu	37	4	134071395	134071395	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr4:134071395G>A	ENST00000264360.5	+	1	926	c.100G>A	c.(100-102)Gtg>Atg	p.V34M	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	34	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V34M(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TGGCACTTTCGTGGGGAATAT	0.498																																					p.V34M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G100A	4						.						132.0	125.0	128.0					4																	134071395		2203	4300	6503	134290845	SO:0001583	missense	57575	exon1			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.100G>A	4.37:g.134071395G>A	ENSP00000264360:p.Val34Met	Somatic		Capture	Illumina HiSeq	Phase_I	134290845	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954452	0.73902	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.54866	0.55	4.91	4.91	0.64330	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	0.000000	0.40818	N	0.001004	T	0.82259	0.4998	H	0.96748	3.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.88567	0.3127	10	0.87932	D	0	.	17.8782	0.88831	0.0:0.0:1.0:0.0	.	34;34	Q9P2E7;Q96SF0	PCD10_HUMAN;.	M	34	ENSP00000264360:V34M	ENSP00000264360:V34M	V	+	1	0	PCDH10	134290845	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.550000	0.86006	0.555000	0.69702	GTG		PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
DOCK2	1794	broad.mit.edu	37	5	169472903	169472904	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr5:169472903_169472904insA	ENST00000256935.8	+	39	4040_4041	c.3960_3961insA	c.(3961-3963)aacfs	p.N1321fs	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Frame_Shift_Ins_p.N382fs|DOCK2_ENST00000520908.1_Frame_Shift_Ins_p.N813fs	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1321	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.N1321fs*10(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGCTCAGCCAGAACCTGGTAAG	0.584																																					p.Q1320fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.3960_3961insA	5						.																																			169405482	SO:0001589	frameshift_variant	1794	exon39			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3962dupA	5.37:g.169472905_169472905dupA	ENSP00000256935:p.Asn1321fs	Somatic		Capture	Illumina HiSeq	Phase_I	169405481	NM_004946	Q2M3I0|Q96AK7	Frame_Shift_Ins	INS	ENST00000256935.8	37	CCDS4371.1																																																																																				DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
APC	324	broad.mit.edu	37	5	112174110	112174110	+	Nonsense_Mutation	SNP	C	C	A	rs544709767		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr5:112174110C>A	ENST00000457016.1	+	16	3199	c.2819C>A	c.(2818-2820)tCg>tAg	p.S940*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.S940*|APC_ENST00000508376.2_Nonsense_Mutation_p.S940*			P25054	APC_HUMAN	adenomatous polyposis coli	940	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)|p.S940*(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTCACTAAGTCGGAAAATTCA	0.358		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S922X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,stomach,NS,Substitution - Nonsense,0 	.	2	Substitution - Nonsense(1)|Unknown(1)	stomach(1)|skin(1)	c.C2765A	5						.						68.0	69.0	69.0					5																	112174110		2202	4300	6502	112202009	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2819C>A	5.37:g.112174110C>A	ENSP00000413133:p.Ser940*	None		Capture	Illumina HiSeq	Phase_I	112202009	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	36	5.846296	0.97016	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.77	5.77	0.91146	.	0.751984	0.12577	N	0.456774	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.3564	15.4734	0.75458	0.0:0.862:0.138:0.0	.	.	.	.	X	940;922;940;940;940	.	ENSP00000257430:S940X	S	+	2	0	APC	112202009	0.979000	0.34478	0.997000	0.53966	0.732000	0.41865	3.769000	0.55303	2.729000	0.93468	0.557000	0.71058	TCG		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175547	112175547	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr5:112175547G>A	ENST00000457016.1	+	16	4636	c.4256G>A	c.(4255-4257)aGc>aAc	p.S1419N	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.S1419N|APC_ENST00000508376.2_Missense_Mutation_p.S1419N			P25054	APC_HUMAN	adenomatous polyposis coli	1419	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Y1376fs*41(1)|p.S1421fs*53(1)|p.?(1)|p.S1411fs*41(1)|p.K1192fs*3(1)|p.S1419N(1)|p.S1419fs*54(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GGCATTATAAGCCCCAGTGAT	0.473		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S1401N	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	7	Deletion - Frameshift(4)|Substitution - Missense(1)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(5)|soft_tissue(1)|skin(1)	c.G4202A	5	GRCh37	CD084034|CX021237	APC	D|X		.						108.0	99.0	102.0					5																	112175547		2202	4300	6502	112203446	SO:0001583	missense	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4256G>A	5.37:g.112175547G>A	ENSP00000413133:p.Ser1419Asn	Somatic		Capture	Illumina HiSeq	Phase_I	112203446	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569954	0.86542	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.97455	-4.39;-4.39;-4.39	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.96623	0.8898	L	0.57536	1.79	0.54753	D	0.999981	P;P	0.46395	0.877;0.877	P;P	0.45829	0.494;0.494	D	0.95510	0.8585	9	.	.	.	-12.9106	20.6439	0.99570	0.0:0.0:1.0:0.0	.	1421;1419	Q4LE70;P25054	.;APC_HUMAN	N	1419	ENSP00000413133:S1419N;ENSP00000257430:S1419N;ENSP00000427089:S1419N	.	S	+	2	0	APC	112203446	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.884000	0.98904	0.655000	0.94253	AGC		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175639	112175639	+	Nonsense_Mutation	SNP	C	C	T	rs121913332		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr5:112175639C>T	ENST00000457016.1	+	16	4728	c.4348C>T	c.(4348-4350)Cga>Tga	p.R1450*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.R1450*|APC_ENST00000508376.2_Nonsense_Mutation_p.R1450*			P25054	APC_HUMAN	adenomatous polyposis coli	1450	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1450*(153)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.R1450fs*22(1)|p.S1436fs*22(1)|p.R1450fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAAACCAAGCGAGAAGTACC	0.478	R1450*(LS123_LARGE_INTESTINE)|R1450*(MKN74_STOMACH)|R1450*(SW1417_LARGE_INTESTINE)|R1450*(SW837_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1432X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,rectum,Substitution - Nonsense,0 	.	159	Substitution - Nonsense(153)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(136)|stomach(13)|soft_tissue(4)|small_intestine(3)|endometrium(1)|skin(1)|pancreas(1)	c.C4294T	5	GRCh37	CM930030	APC	M	rs121913332	.						102.0	90.0	94.0					5																	112175639		2202	4300	6502	112203538	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4348C>T	5.37:g.112175639C>T	ENSP00000413133:p.Arg1450*	Somatic		Capture	Illumina HiSeq	Phase_I	112203538	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.651223	0.98901	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	4.2	0.49525	.	0.600559	0.18052	N	0.153248	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.0649	14.037	0.64651	0.426:0.574:0.0:0.0	.	.	.	.	X	1450	.	.	R	+	1	2	APC	112203538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.171000	0.50824	1.564000	0.49628	0.655000	0.94253	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
DMXL1	1657	broad.mit.edu	37	5	118485814	118485814	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr5:118485814C>T	ENST00000311085.8	+	18	4372	c.4292C>T	c.(4291-4293)aCg>aTg	p.T1431M	DMXL1_ENST00000539542.1_Missense_Mutation_p.T1431M	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1431								p.T1431M(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		AATGAGAGTACGTTAAGTAAA	0.338																																					p.T1431M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4292T	5						.						79.0	79.0	79.0					5																	118485814		2202	4299	6501	118513713	SO:0001583	missense	1657	exon18			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.4292C>T	5.37:g.118485814C>T	ENSP00000309690:p.Thr1431Met	Somatic		Capture	Illumina HiSeq	Phase_I	118513713	NM_005509		Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	C	8.914	0.959535	0.18507	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.10192	2.9;2.9	5.43	2.49	0.30216	.	0.861240	0.10758	N	0.637577	T	0.10423	0.0255	L	0.43152	1.355	0.09310	N	1	P;P	0.50272	0.917;0.933	B;P	0.44897	0.333;0.463	T	0.22906	-1.0203	10	0.34782	T	0.22	-0.933	4.1577	0.10268	0.2541:0.447:0.223:0.076	.	1431;1431	F5H269;Q9Y485	.;DMXL1_HUMAN	M	1431	ENSP00000309690:T1431M;ENSP00000439479:T1431M	ENSP00000309690:T1431M	T	+	2	0	DMXL1	118513713	0.001000	0.12720	0.958000	0.39756	0.802000	0.45316	0.504000	0.22626	0.760000	0.33108	0.563000	0.77884	ACG		DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
PKD2L2	27039	broad.mit.edu	37	5	137243482	137243482	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr5:137243482C>A	ENST00000508883.1	+	7	1053	c.1027C>A	c.(1027-1029)Ctc>Atc	p.L343I	PKD2L2_ENST00000350250.4_Missense_Mutation_p.L309I|PKD2L2_ENST00000502810.1_Intron|PKD2L2_ENST00000508638.1_Missense_Mutation_p.L343I|PKD2L2_ENST00000290431.5_Missense_Mutation_p.L343I			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	343					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)	p.L343I(1)		breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ACAAATTTTTCTCTTACTTGG	0.299																																					p.L343I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1027A	5						.						129.0	114.0	119.0					5																	137243482		1791	4071	5862	137271381	SO:0001583	missense	27039	exon7			AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.1027C>A	5.37:g.137243482C>A	ENSP00000424725:p.Leu343Ile	Somatic		Capture	Illumina HiSeq	Phase_I	137271381	NM_014386	A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Missense_Mutation	SNP	ENST00000508883.1	37		.	.	.	.	.	.	.	.	.	.	C	14.11	2.437748	0.43326	.	.	ENSG00000078795	ENST00000350250;ENST00000508638;ENST00000508883;ENST00000290431	T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43	5.56	4.68	0.58851	Polycystin cation channel, PKD1/PKD2 (1);	0.110999	0.40640	N	0.001048	T	0.71108	0.3301	L	0.45581	1.43	0.09310	N	1	B;D;P	0.63880	0.178;0.993;0.933	B;P;P	0.60949	0.222;0.881;0.528	T	0.62091	-0.6927	10	0.36615	T	0.2	-5.6169	10.4376	0.44445	0.1402:0.5881:0.2716:0.0	.	343;343;343	Q9NZM6;E9PC91;Q9NZM6-5	PK2L2_HUMAN;.;.	I	309;343;343;343	ENSP00000344177:L309I;ENSP00000423382:L343I;ENSP00000424725:L343I;ENSP00000290431:L343I	ENSP00000290431:L343I	L	+	1	0	PKD2L2	137271381	0.000000	0.05858	0.490000	0.27465	0.810000	0.45777	0.395000	0.20850	1.337000	0.45525	0.491000	0.48974	CTC		PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372521.1	NM_014386	
SPINK5	11005	broad.mit.edu	37	5	147493975	147493975	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr5:147493975C>A	ENST00000256084.7	+	21	1980	c.1938C>A	c.(1936-1938)tgC>tgA	p.C646*	SPINK5_ENST00000398454.1_Nonsense_Mutation_p.C646*|SPINK5_ENST00000359874.3_Nonsense_Mutation_p.C646*	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	646	Kazal-like 10. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.C646*(4)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACTTTTCTGCACAAGAGAAA	0.428																																					p.C646X												.	.	4	Substitution - Nonsense(4)	large_intestine(2)|lung(2)	c.C1938A	5						.						78.0	75.0	76.0					5																	147493975		1866	4107	5973	147474168	SO:0001587	stop_gained	11005	exon21			AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.1938C>A	5.37:g.147493975C>A	ENSP00000256084:p.Cys646*	Somatic		Capture	Illumina HiSeq	Phase_I	147474168	NM_001127699	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Nonsense_Mutation	SNP	ENST00000256084.7	37	CCDS43382.1	.	.	.	.	.	.	.	.	.	.	C	37	6.605553	0.97701	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	.	.	.	5.42	4.53	0.55603	.	0.183721	0.38837	N	0.001557	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.7038	10.7148	0.46006	0.0:0.9073:0.0:0.0927	.	.	.	.	X	646;646;627;646	.	ENSP00000256084:C646X	C	+	3	2	SPINK5	147474168	0.999000	0.42202	1.000000	0.80357	0.956000	0.61745	0.405000	0.21015	2.703000	0.92315	0.655000	0.94253	TGC		SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000259215.2	NM_001127698	
FBXL7	23194	broad.mit.edu	37	5	15936995	15936995	+	Silent	SNP	C	C	T	rs142704418	byFrequency	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr5:15936995C>T	ENST00000504595.1	+	4	1657	c.1176C>T	c.(1174-1176)caC>caT	p.H392H	FBXL7_ENST00000510662.1_Silent_p.H345H|MIR887_ENST00000401258.1_RNA|FBXL7_ENST00000329673.7_Silent_p.H380H	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	392					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.H392H(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						TCACGGACCACGGTGTGGAGT	0.622													C|||	8	0.00159744	0.0	0.0	5008	,	,		20080	0.0079		0.0	False		,,,				2504	0.0				p.H392H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1176T	5						.	C		1,4359		0,1,2179	83.0	91.0	88.0		1176	2.6	1.0	5	dbSNP_134	88	0,8518		0,0,4259	no	coding-synonymous	FBXL7	NM_012304.3		0,1,6438	TT,TC,CC		0.0,0.0229,0.0078		392/492	15936995	1,12877	2180	4259	6439	15989995	SO:0001819	synonymous_variant	23194	exon4			AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.1176C>T	5.37:g.15936995C>T		Somatic		Capture	Illumina HiSeq	Phase_I	15989995	NM_012304	B9EGF1|D6RDY7|O94926	Silent	SNP	ENST00000504595.1	37	CCDS54833.1																																																																																				FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
TIMD4	91937	broad.mit.edu	37	5	156381463	156381463	+	Silent	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr5:156381463G>A	ENST00000274532.2	-	2	419	c.363C>T	c.(361-363)aaC>aaT	p.N121N	TIMD4_ENST00000407087.3_Silent_p.N121N	NM_138379.2	NP_612388.2	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain containing 4	121	Ig-like V-type.					integral component of membrane (GO:0016021)		p.N121N(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(23)|ovary(2)|skin(2)	37	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCTTTACATCGTTGAACCAGC	0.512																																					p.N121N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C363T	5						.						82.0	75.0	77.0					5																	156381463		2203	4300	6503	156314041	SO:0001819	synonymous_variant	91937	exon2			BC008988	CCDS4332.1, CCDS54943.1	5q33.3	2013-01-11			ENSG00000145850	ENSG00000145850		"""Immunoglobulin superfamily / V-set domain containing"""	25132	protein-coding gene	gene with protein product		610096				12477932	Standard	NM_001146726		Approved		uc003lwh.2	Q96H15	OTTHUMG00000130244	ENST00000274532.2:c.363C>T	5.37:g.156381463G>A		Somatic		Capture	Illumina HiSeq	Phase_I	156314041	NM_138379	B5MCL9	Silent	SNP	ENST00000274532.2	37	CCDS4332.1																																																																																				TIMD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252568.1	NM_138379	
RPS23	6228	broad.mit.edu	37	5	81572249	81572249	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr5:81572249C>A	ENST00000296674.8	-	3	506	c.253G>T	c.(253-255)Gta>Tta	p.V85L	RPS23_ENST00000503605.1_5'UTR|ATG10_ENST00000514253.2_3'UTR|RPS23_ENST00000507980.1_Missense_Mutation_p.V85L|RPS23_ENST00000510019.1_Intron|RPS23_ENST00000510210.1_Missense_Mutation_p.V85L|RPS23_ENST00000512493.1_Missense_Mutation_p.V85L	NM_001025.4	NP_001016.1	P62266	RS23_HUMAN	ribosomal protein S23	85					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|membrane (GO:0016020)|nucleolus (GO:0005730)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.V85L(1)		prostate(1)	1		Lung NSC(167;0.0025)|all_lung(232;0.00278)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;1.94e-42)|Epithelial(54;8.38e-37)|all cancers(79;1.42e-31)		TCATTGGGTACAAAGGCTGTG	0.428																																					p.V85L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G253T	5						.						101.0	91.0	94.0					5																	81572249		1908	4121	6029	81608005	SO:0001583	missense	6228	exon3			AB007158	CCDS47241.1	5q14.2	2013-05-09			ENSG00000186468	ENSG00000186468		"""S ribosomal proteins"""	10410	protein-coding gene	gene with protein product		603683				9582194	Standard	NM_001025		Approved	S23	uc003khu.3	P62266	OTTHUMG00000162557	ENST00000296674.8:c.253G>T	5.37:g.81572249C>A	ENSP00000296674:p.Val85Leu	Somatic		Capture	Illumina HiSeq	Phase_I	81608005	NM_001025	P39028|Q6IB08	Missense_Mutation	SNP	ENST00000296674.8	37	CCDS47241.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.139717	0.77775	.	.	ENSG00000186468	ENST00000296674;ENST00000510210;ENST00000512493;ENST00000507980	.	.	.	5.4	5.4	0.78164	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.122796	0.53938	D	0.000047	T	0.78110	0.4232	M	0.89030	3	0.80722	D	1	B	0.17852	0.024	B	0.21546	0.035	T	0.77024	-0.2741	9	0.56958	D	0.05	.	18.7651	0.91869	0.0:1.0:0.0:0.0	.	85	P62266	RS23_HUMAN	L	85	.	ENSP00000296674:V85L	V	-	1	0	RPS23	81608005	1.000000	0.71417	0.988000	0.46212	0.833000	0.47200	7.703000	0.84585	2.541000	0.85698	0.655000	0.94253	GTA		RPS23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369546.2	NM_001025	
VCAN	1462	broad.mit.edu	37	5	82875806	82875806	+	Silent	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr5:82875806C>T	ENST00000265077.3	+	14	10453	c.9888C>T	c.(9886-9888)tgC>tgT	p.C3296C	VCAN_ENST00000512590.2_Silent_p.C1494C|VCAN_ENST00000342785.4_Silent_p.C1542C|VCAN_ENST00000502527.2_Silent_p.C555C|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000343200.5_Silent_p.C2309C	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	3296	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.C3296C(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TAGTCGCTTGCGGCCAGCCCC	0.373																																					p.C2309C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6927T	5						.																																			82911562	SO:0001819	synonymous_variant	1462	exon13			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.9888C>T	5.37:g.82875806C>T		Somatic		Capture	Illumina HiSeq	Phase_I	82911562	NM_001164097	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1																																																																																				VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
TTC37	9652	broad.mit.edu	37	5	94860200	94860200	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr5:94860200T>A	ENST00000358746.2	-	16	1719	c.1421A>T	c.(1420-1422)gAt>gTt	p.D474V		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	474						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)		p.D474V(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						CTTTGTTTTATCTTTTCTTGT	0.333																																					p.D474V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1421T	5						.						128.0	131.0	130.0					5																	94860200		2203	4300	6503	94885956	SO:0001583	missense	9652	exon16			AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.1421A>T	5.37:g.94860200T>A	ENSP00000351596:p.Asp474Val	Somatic		Capture	Illumina HiSeq	Phase_I	94885956	NM_014639	O15077|Q6PJI3	Missense_Mutation	SNP	ENST00000358746.2	37	CCDS4072.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.561384	0.86335	.	.	ENSG00000198677	ENST00000358746;ENST00000514952	T;T	0.61742	0.18;0.08	5.82	5.82	0.92795	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.77003	0.4067	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79517	-0.1771	10	0.62326	D	0.03	.	16.188	0.81967	0.0:0.0:0.0:1.0	.	426;474	D6RCE2;Q6PGP7	.;TTC37_HUMAN	V	474;426	ENSP00000351596:D474V;ENSP00000423742:D426V	ENSP00000351596:D474V	D	-	2	0	TTC37	94885956	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.957000	0.76019	2.216000	0.71823	0.528000	0.53228	GAT		TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1	NM_014639	
FBN2	2201	broad.mit.edu	37	5	127595392	127595392	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr5:127595392delT	ENST00000508053.1	-	71	9468	c.8494delA	c.(8494-8496)atcfs	p.I2832fs	FBN2_ENST00000262464.4_Frame_Shift_Del_p.I2832fs			P35556	FBN2_HUMAN	fibrillin 2	2832					anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.I2832fs*65(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACATAACGGATGTGGTTGTTG	0.552																																					p.I2832fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.8494delA	5						.						171.0	155.0	160.0					5																	127595392		2203	4300	6503	127623291	SO:0001589	frameshift_variant	2201	exon65			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.8494delA	5.37:g.127595392delT	ENSP00000424571:p.Ile2832fs	Somatic		Capture	Illumina HiSeq	Phase_I	127623291	NM_001999	B4DU01|Q59ES6	Frame_Shift_Del	DEL	ENST00000508053.1	37	CCDS34222.1																																																																																				FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
EIF4E1B	253314	broad.mit.edu	37	5	176070219	176070219	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr5:176070219C>T	ENST00000318682.6	+	4	736	c.152C>T	c.(151-153)aCg>aTg	p.T51M	EIF4E1B_ENST00000504597.1_Missense_Mutation_p.T51M	NM_001099408.1	NP_001092878.1	A6NMX2	I4E1B_HUMAN	eukaryotic translation initiation factor 4E family member 1B	51					regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)	translation initiation factor activity (GO:0003743)	p.T51M(1)		breast(1)|large_intestine(1)|lung(2)|pancreas(1)	5	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGGCCCGGACGGGGGGCCCC	0.617																																					p.T51M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C152T	5						.						41.0	52.0	48.0					5																	176070219		1909	4116	6025	176002825	SO:0001583	missense	253314	exon4				CCDS47345.1	5q35.2	2008-06-12			ENSG00000175766	ENSG00000175766			33179	protein-coding gene	gene with protein product						16191198	Standard	NM_001099408		Approved	FLJ36951	uc010jkf.1	A6NMX2	OTTHUMG00000163227	ENST00000318682.6:c.152C>T	5.37:g.176070219C>T	ENSP00000323714:p.Thr51Met	Somatic		Capture	Illumina HiSeq	Phase_I	176002825	NM_001099408		Missense_Mutation	SNP	ENST00000318682.6	37	CCDS47345.1	.	.	.	.	.	.	.	.	.	.	C	9.194	1.026877	0.19512	.	.	ENSG00000175766	ENST00000318682;ENST00000510660;ENST00000504597	T;T	0.45668	0.89;0.89	4.79	-9.58	0.00559	Translation Initiation factor eIF- 4e-like  domain (1);	.	.	.	.	T	0.12050	0.0293	N	0.08118	0	0.09310	N	1	P	0.44260	0.83	B	0.29785	0.107	T	0.32693	-0.9897	9	0.48119	T	0.1	.	3.1677	0.06541	0.1253:0.3061:0.3758:0.1928	.	51	A6NMX2	I4E1B_HUMAN	M	51	ENSP00000323714:T51M;ENSP00000427633:T51M	ENSP00000323714:T51M	T	+	2	0	EIF4E1B	176002825	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.180000	0.03088	-2.153000	0.00793	-1.149000	0.01842	ACG		EIF4E1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372187.1	NM_001099408	
TRDN	10345	broad.mit.edu	37	6	123594510	123594511	+	Splice_Site	INS	-	-	A	rs147062785|rs386359375	byFrequency	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	-	-	-	A	-	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr6:123594510_123594511insA	ENST00000398178.3	-	28	1619		c.e28-2		TRDN_ENST00000334268.4_Splice_Site	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin						cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		CAGATATAGCTAAAATAAATAA	0.238													AAAAA|AAAA|AAAAA|deletion	1317	0.262979	0.0946	0.2104	5008	,	,		12974	0.5069		0.1859	False		,,,				2504	0.3558				.												.	.	0			.	6						.			198,1964		33,132,916						4.2	0.0		dbSNP_130	5	764,4058		183,398,1830	no	splice-3	TRDN	NM_006073.2		216,530,2746	A1A1,A1R,RR		15.844,9.1582,13.7743				962,6022				123636210	SO:0001630	splice_region_variant	10345	.			U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.1598-2->T	6.37:g.123594514_123594514dupA		Germline		Capture	Illumina HiSeq	Phase_I	123636209	.	A5D6W5|F5H2W7|Q6NSB8	Splice_Site	INS	ENST00000398178.3	37	CCDS55053.1																																																																																				TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			Intron
TRDN	10345	broad.mit.edu	37	6	123869713	123869713	+	Missense_Mutation	SNP	G	G	A	rs370788759	byFrequency	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr6:123869713G>A	ENST00000398178.3	-	3	298	c.277C>T	c.(277-279)Cgt>Tgt	p.R93C	TRDN_ENST00000542443.1_Missense_Mutation_p.R93C|TRDN_ENST00000334268.4_Missense_Mutation_p.R93C|TRDN_ENST00000546248.1_Missense_Mutation_p.R93C	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	93					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)	p.R93C(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		ATAGCATCACGTACCAGTTTT	0.353													G|||	4	0.000798722	0.003	0.0	5008	,	,		15625	0.0		0.0	False		,,,				2504	0.0				p.R93C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C277T	6						.	G	CYS/ARG	5,3673		0,5,1834	50.0	49.0	50.0		277	3.3	0.9	6		50	0,8174		0,0,4087	no	missense	TRDN	NM_006073.2	180	0,5,5921	AA,AG,GG		0.0,0.1359,0.0422	possibly-damaging	93/730	123869713	5,11847	1839	4087	5926	123911412	SO:0001583	missense	10345	exon3			U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.277C>T	6.37:g.123869713G>A	ENSP00000381240:p.Arg93Cys	Somatic		Capture	Illumina HiSeq	Phase_I	123911412	NM_006073	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	ENST00000398178.3	37	CCDS55053.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.275910	0.40294	0.001359	0.0	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268;ENST00000542014;ENST00000543022;ENST00000546248;ENST00000542443	T;T;T;T	0.64438	1.23;1.23;1.19;-0.1	5.29	3.32	0.38043	Aspartyl beta-hydroxylase/Triadin domain (1);	0.526840	0.20624	N	0.088713	T	0.22820	0.0551	N	0.08118	0	0.27688	N	0.946228	P;D;P;P;P	0.60160	0.618;0.987;0.807;0.807;0.938	B;B;B;B;B	0.43360	0.023;0.159;0.417;0.269;0.417	T	0.06972	-1.0797	10	0.72032	D	0.01	-3.3496	6.8148	0.23824	0.0823:0.0:0.5924:0.3253	.	93;93;93;93;93	F5H6E3;F5H2W7;Q5SWK9;Q8IVK2;Q13061	.;.;.;.;TRDN_HUMAN	C	93	ENSP00000381240:R93C;ENSP00000333984:R93C;ENSP00000439281:R93C;ENSP00000437684:R93C	ENSP00000333984:R93C	R	-	1	0	TRDN	123911412	0.980000	0.34600	0.949000	0.38748	0.720000	0.41350	1.813000	0.38962	1.146000	0.42352	0.655000	0.94253	CGT		TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
HIST1H1C	3006	broad.mit.edu	37	6	26056218	26056218	+	Missense_Mutation	SNP	G	G	A	rs527943061		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr6:26056218G>A	ENST00000343677.2	-	1	481	c.439C>T	c.(439-441)Ccg>Tcg	p.P147S		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	147					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.P147S(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						CTCTTCTTCGGAGTTGCGCCG	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		14155	0.0		0.001	False		,,,				2504	0.0				p.P147S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C439T	6						.						66.0	79.0	74.0					6																	26056218		2202	4296	6498	26164197	SO:0001583	missense	3006	exon1			X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.439C>T	6.37:g.26056218G>A	ENSP00000339566:p.Pro147Ser	Somatic		Capture	Illumina HiSeq	Phase_I	26164197	NM_005319	A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	37	CCDS4577.1	.	.	.	.	.	.	.	.	.	.	G	0.053	-1.243824	0.01481	.	.	ENSG00000187837	ENST00000343677	T	0.04360	3.64	4.76	2.79	0.32731	.	0.501449	0.19452	N	0.113911	T	0.00875	0.0029	N	0.14661	0.345	0.09310	N	1	B	0.20052	0.041	B	0.17098	0.017	T	0.46498	-0.9187	10	0.09843	T	0.71	-9.3723	10.7501	0.46205	0.0:0.3752:0.6248:0.0	.	147	P16403	H12_HUMAN	S	147	ENSP00000339566:P147S	ENSP00000339566:P147S	P	-	1	0	HIST1H1C	26164197	0.038000	0.19896	0.033000	0.17914	0.031000	0.12232	1.485000	0.35519	1.316000	0.45131	0.655000	0.94253	CCG		HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
PTPRK	5796	broad.mit.edu	37	6	128302385	128302385	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr6:128302385G>A	ENST00000368215.3	-	25	3583	c.3584C>T	c.(3583-3585)gCg>gTg	p.A1195V	PTPRK_ENST00000532331.1_Missense_Mutation_p.A1218V|PTPRK_ENST00000368213.5_Missense_Mutation_p.A1202V|PTPRK_ENST00000368210.3_Missense_Mutation_p.A1214V|PTPRK_ENST00000368207.3_Missense_Mutation_p.A1228V|PTPRK_ENST00000368226.4_Missense_Mutation_p.A1196V|PTPRK_ENST00000368227.3_Missense_Mutation_p.A1213V			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1195	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A1196V(1)	PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TGGCAGGCACGCTATACTGCA	0.448																																					p.A1196V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3587T	6						.						101.0	80.0	87.0					6																	128302385		2203	4300	6503	128344078	SO:0001583	missense	5796	exon25			L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.3584C>T	6.37:g.128302385G>A	ENSP00000357198:p.Ala1195Val	Somatic		Capture	Illumina HiSeq	Phase_I	128344078	NM_002844	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	ENST00000368215.3	37		.	.	.	.	.	.	.	.	.	.	G	34	5.392381	0.96009	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207	T;T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38;2.38	5.75	5.75	0.90469	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.85682	D	0.000000	T	0.48696	0.1514	M	0.92317	3.295	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.78314	0.973;0.983;0.98;0.991	T	0.60611	-0.7229	10	0.87932	D	0	.	19.9233	0.97095	0.0:0.0:1.0:0.0	.	1218;1202;1195;1196	B7ZMG0;Q15262-3;Q15262;Q15262-2	.;.;PTPRK_HUMAN;.	V	1196;1213;1218;1202;1214;1195;1228	ENSP00000357209:A1196V;ENSP00000357210:A1213V;ENSP00000432973:A1218V;ENSP00000357196:A1202V;ENSP00000357193:A1214V;ENSP00000357198:A1195V;ENSP00000357190:A1228V	ENSP00000357190:A1228V	A	-	2	0	PTPRK	128344078	1.000000	0.71417	0.963000	0.40424	0.992000	0.81027	9.813000	0.99286	2.728000	0.93425	0.655000	0.94253	GCG		PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		
RSPH10B2	728194	broad.mit.edu	37	7	6797498	6797498	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr7:6797498G>A	ENST00000403107.1	+	2	577	c.190G>A	c.(190-192)Gtt>Att	p.V64I	RSPH10B2_ENST00000433859.2_Missense_Mutation_p.V64I|RSPH10B2_ENST00000359718.3_5'UTR|RSPH10B2_ENST00000404077.1_Missense_Mutation_p.V64I|RSPH10B2_ENST00000297186.3_Missense_Mutation_p.V64I			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	64								p.V64I(2)		breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						CCGCCAAAACGTTCAGCAGAA	0.488																																					p.V64I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G190A	7						.						143.0	159.0	154.0					7																	6797498		2161	4265	6426	6764023	SO:0001583	missense	222967	exon3				CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.190G>A	7.37:g.6797498G>A	ENSP00000384766:p.Val64Ile	Somatic		Capture	Illumina HiSeq	Phase_I	6764023	NM_173565	A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Missense_Mutation	SNP	ENST00000403107.1	37	CCDS43552.1	.	.	.	.	.	.	.	.	.	.	G	8.037	0.763030	0.15914	.	.	ENSG00000169402	ENST00000403107;ENST00000404077;ENST00000297186;ENST00000433859	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	2.32	1.37	0.22104	.	29.591000	0.00166	N	0.000000	T	0.34077	0.0885	N	0.22421	0.69	0.09310	N	0.999997	B	0.13145	0.007	B	0.06405	0.002	T	0.14504	-1.0470	10	0.37606	T	0.19	.	4.1643	0.10300	0.3895:0.0:0.6105:0.0	.	64	B2RC85	R10B2_HUMAN	I	64	ENSP00000384766:V64I;ENSP00000386102:V64I;ENSP00000297186:V64I;ENSP00000416710:V64I	ENSP00000297186:V64I	V	+	1	0	RSPH10B2	6764023	0.000000	0.05858	0.000000	0.03702	0.131000	0.20780	-3.950000	0.00327	0.286000	0.22352	0.392000	0.25879	GTT		RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324184.4	NM_001099697	
KCNH2	3757	broad.mit.edu	37	7	150648842	150648842	+	Missense_Mutation	SNP	C	C	T	rs376021230		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr7:150648842C>T	ENST00000262186.5	-	7	2040	c.1639G>A	c.(1639-1641)Gcg>Acg	p.A547T	KCNH2_ENST00000392968.2_Missense_Mutation_p.A451T|KCNH2_ENST00000430723.3_Missense_Mutation_p.A547T|KCNH2_ENST00000330883.4_Missense_Mutation_p.A207T	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	547					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)	p.A547T(1)		NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	AGCACGGCCGCGCCGTACTCT	0.647																																					p.A207T	GBM(137;110 1844 13671 20123 45161)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G619A	7						.	C	THR/ALA,THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	60.0	51.0	54.0		1639,619,1639,619	4.1	1.0	7		54	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	KCNH2	NM_000238.3,NM_001204798.1,NM_172056.2,NM_172057.2	58,58,58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	547/1160,207/549,547/889,207/820	150648842	1,13005	2203	4300	6503	150279775	SO:0001583	missense	3757	exon3			U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.1639G>A	7.37:g.150648842C>T	ENSP00000262186:p.Ala547Thr	Somatic		Capture	Illumina HiSeq	Phase_I	150279775	NM_172057	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	37	CCDS5910.1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.678089	0.68042	0.0	1.16E-4	ENSG00000055118	ENST00000330883;ENST00000392968;ENST00000262186;ENST00000350328;ENST00000430723	D;D;D;D	0.98531	-4.98;-4.98;-4.98;-4.98	4.08	4.08	0.47627	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98330	0.9446	L	0.55017	1.72	0.54753	D	0.999987	D;D;P;D;P	0.89917	1.0;1.0;0.665;0.976;0.607	D;D;B;P;B	0.85130	0.997;0.995;0.255;0.782;0.23	D	0.99032	1.0821	10	0.87932	D	0	.	13.8392	0.63428	0.0:1.0:0.0:0.0	.	451;547;207;547;207	C4PFH9;G5E9I0;Q708S9;Q12809;Q12809-2	.;.;.;KCNH2_HUMAN;.	T	207;451;547;207;547	ENSP00000328531:A207T;ENSP00000376695:A451T;ENSP00000262186:A547T;ENSP00000387657:A547T	ENSP00000262186:A547T	A	-	1	0	KCNH2	150279775	1.000000	0.71417	1.000000	0.80357	0.104000	0.19210	7.454000	0.80714	2.126000	0.65437	0.491000	0.48974	GCG		KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238	
SGK223	157285	broad.mit.edu	37	8	8185971	8185971	+	Missense_Mutation	SNP	G	G	A	rs199990185		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr8:8185971G>A	ENST00000520004.1	-	5	2585	c.2321C>T	c.(2320-2322)tCg>tTg	p.S774L	SGK223_ENST00000330777.4_Missense_Mutation_p.S774L			Q86YV5	SG223_HUMAN		776							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.S774L(1)|p.S776L(1)									CAGCTCAGACGAGGGACCTGA	0.532																																					p.S774L	GBM(34;731 755 10259 33573 33867)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2321T	8						.						16.0	19.0	18.0					8																	8185971		2017	4159	6176	8223381	SO:0001583	missense	157285	exon4																														ENST00000520004.1:c.2321C>T	8.37:g.8185971G>A	ENSP00000428054:p.Ser774Leu	Somatic		Capture	Illumina HiSeq	Phase_I	8223381	NM_001080826	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	37	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.064242	0.36373	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.59364	0.27;0.27	5.22	5.22	0.72569	.	0.769868	0.11952	N	0.513574	T	0.47135	0.1429	L	0.32530	0.975	0.09310	N	1	P	0.41131	0.739	B	0.31016	0.123	T	0.49234	-0.8961	10	0.44086	T	0.13	.	18.6507	0.91429	0.0:0.0:1.0:0.0	.	774	Q86YV5	SG223_HUMAN	L	774	ENSP00000330930:S774L;ENSP00000428054:S774L	ENSP00000330930:S774L	S	-	2	0	AC068353.1	8223381	0.684000	0.27642	0.008000	0.14137	0.018000	0.09664	3.343000	0.52167	2.821000	0.97095	0.655000	0.94253	TCG		SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
DLC1	10395	broad.mit.edu	37	8	12950329	12950329	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr8:12950329G>A	ENST00000276297.4	-	13	3941	c.3532C>T	c.(3532-3534)Ccc>Tcc	p.P1178S	DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000520226.1_Missense_Mutation_p.P667S|DLC1_ENST00000512044.2_Missense_Mutation_p.P775S|DLC1_ENST00000358919.2_Missense_Mutation_p.P741S	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1178	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.P1178S(1)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						TGGTCCTTGGGCACATCTGCA	0.527																																					p.P1178S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3532T	8						.						39.0	35.0	37.0					8																	12950329		2203	4300	6503	12994700	SO:0001583	missense	10395	exon13			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.3532C>T	8.37:g.12950329G>A	ENSP00000276297:p.Pro1178Ser	Somatic		Capture	Illumina HiSeq	Phase_I	12994700	NM_182643	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	G	19.54	3.847578	0.71603	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.08	4.2	0.49525	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.051991	0.85682	D	0.000000	T	0.56601	0.1996	M	0.67700	2.07	0.80722	D	1	B;D;D	0.59357	0.318;0.968;0.985	B;P;P	0.55615	0.225;0.619;0.78	T	0.62695	-0.6800	10	0.56958	D	0.05	.	16.0974	0.81135	0.0:0.1339:0.8661:0.0	.	1178;775;741	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	S	1178;741;117;775;667	ENSP00000276297:P1178S;ENSP00000351797:P741S;ENSP00000422595:P775S;ENSP00000428028:P667S	ENSP00000276297:P1178S	P	-	1	0	DLC1	12994700	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	9.630000	0.98420	1.513000	0.48852	0.655000	0.94253	CCC		DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
CDCA2	157313	broad.mit.edu	37	8	25346088	25346089	+	Frame_Shift_Del	DEL	AG	AG	-	rs140820459		TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	AG	AG	AG	-	AG	AG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr8:25346088_25346089delAG	ENST00000330560.3	+	13	2031_2032	c.1554_1555delAG	c.(1552-1557)gaagagfs	p.EE518fs	CDCA2_ENST00000380665.3_Frame_Shift_Del_p.EE503fs|CDCA2_ENST00000521098.2_3'UTR	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	518					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S520fs*13(1)		breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		GTGTTGTAGAAGAGAGTGTTTG	0.361																																					p.518_519del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1554_1555del	8						.																																			25402006	SO:0001589	frameshift_variant	157313	exon13			BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.1554_1555delAG	8.37:g.25346092_25346093delAG	ENSP00000328228:p.Glu518fs	Somatic		Capture	Illumina HiSeq	Phase_I	25402005	NM_152562	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Frame_Shift_Del	DEL	ENST00000330560.3	37	CCDS6049.1																																																																																				CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216891.3	NM_152562	
CDCA2	157313	broad.mit.edu	37	8	25365163	25365163	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr8:25365163G>C	ENST00000330560.3	+	15	3458	c.2981G>C	c.(2980-2982)gGc>gCc	p.G994A	CDCA2_ENST00000380665.3_Missense_Mutation_p.G979A|CDCA2_ENST00000521098.2_3'UTR	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	994					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.G994A(1)		breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		CAGTTCAAAGGCTACCGGAGA	0.453																																					p.G994A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2981C	8						.						103.0	114.0	110.0					8																	25365163		2203	4300	6503	25421080	SO:0001583	missense	157313	exon15			BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.2981G>C	8.37:g.25365163G>C	ENSP00000328228:p.Gly994Ala	Somatic		Capture	Illumina HiSeq	Phase_I	25421080	NM_152562	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	ENST00000330560.3	37	CCDS6049.1	.	.	.	.	.	.	.	.	.	.	G	6.542	0.468305	0.12461	.	.	ENSG00000184661	ENST00000330560;ENST00000380665;ENST00000434814	T;T	0.28666	1.6;1.6	5.31	-4.33	0.03677	.	1.905200	0.02039	N	0.049150	T	0.21509	0.0518	L	0.34521	1.04	0.09310	N	1	B;B	0.27732	0.187;0.187	B;B	0.21917	0.037;0.037	T	0.13124	-1.0521	10	0.28530	T	0.3	12.4237	8.0178	0.30391	0.6089:0.0:0.2781:0.1131	.	979;994	E9PEI0;Q69YH5	.;CDCA2_HUMAN	A	994;979;393	ENSP00000328228:G994A;ENSP00000370040:G979A	ENSP00000328228:G994A	G	+	2	0	CDCA2	25421080	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.876000	0.04201	-0.877000	0.04012	-0.136000	0.14681	GGC		CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216891.3	NM_152562	
KCNU1	157855	broad.mit.edu	37	8	36788639	36788639	+	Silent	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr8:36788639C>T	ENST00000399881.3	+	25	2944	c.2907C>T	c.(2905-2907)caC>caT	p.H969H	KCNU1_ENST00000518904.1_3'UTR	NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	969					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.H969H(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TGTCCTTACACGAAACCATTT	0.418																																					p.H969H												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2907T	8						.						136.0	129.0	131.0					8																	36788639		1890	4114	6004	36907797	SO:0001819	synonymous_variant	157855	exon25			BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.2907C>T	8.37:g.36788639C>T		Somatic		Capture	Illumina HiSeq	Phase_I	36907797	NM_001031836		Silent	SNP	ENST00000399881.3	37	CCDS55220.1																																																																																				KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	
ANK1	286	broad.mit.edu	37	8	41581096	41581096	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr8:41581096C>T	ENST00000347528.4	-	8	850	c.767G>A	c.(766-768)cGg>cAg	p.R256Q	ANK1_ENST00000265709.8_Missense_Mutation_p.R289Q|ANK1_ENST00000352337.4_Missense_Mutation_p.R256Q|ANK1_ENST00000396942.1_Missense_Mutation_p.R256Q|ANK1_ENST00000379758.2_Missense_Mutation_p.R256Q|ANK1_ENST00000289734.7_Missense_Mutation_p.R256Q|ANK1_ENST00000396945.1_Missense_Mutation_p.R256Q	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	256	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.R256Q(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CAGCAGCAGCCGCACCATGAT	0.647																																					p.R256Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G767A	8						.						114.0	84.0	94.0					8																	41581096		2203	4300	6503	41700253	SO:0001583	missense	286	exon8			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.767G>A	8.37:g.41581096C>T	ENSP00000339620:p.Arg256Gln	Somatic		Capture	Illumina HiSeq	Phase_I	41700253	NM_020475	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.698565	0.88830	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13	5.58	4.69	0.59074	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.59998	0.2235	N	0.11154	0.105	0.49798	D	0.999824	D;D;P;D;D	0.89917	1.0;1.0;0.905;0.997;1.0	D;D;P;P;D	0.91635	0.999;0.999;0.474;0.776;0.999	T	0.64228	-0.6457	10	0.54805	T	0.06	.	9.2254	0.37402	0.1465:0.781:0.0:0.0725	.	289;256;256;256;256	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	Q	256;256;256;256;256;256;289;256	ENSP00000339620:R256Q;ENSP00000289734:R256Q;ENSP00000369082:R256Q;ENSP00000380149:R256Q;ENSP00000380147:R256Q;ENSP00000309131:R256Q;ENSP00000265709:R289Q	ENSP00000265709:R289Q	R	-	2	0	ANK1	41700253	0.993000	0.37304	1.000000	0.80357	0.997000	0.91878	2.766000	0.47629	1.327000	0.45338	0.655000	0.94253	CGG		ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
SOX17	64321	broad.mit.edu	37	8	55372364	55372364	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr8:55372364G>T	ENST00000297316.4	+	2	1258	c.1054G>T	c.(1054-1056)Gcc>Tcc	p.A352S		NM_022454.3	NP_071899.1	Q9H6I2	SOX17_HUMAN	SRY (sex determining region Y)-box 17	352	Sox C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00849}.				angiogenesis (GO:0001525)|canonical Wnt signaling pathway (GO:0060070)|cardiac cell fate determination (GO:0060913)|cardiogenic plate morphogenesis (GO:0003142)|cell migration involved in gastrulation (GO:0042074)|common bile duct development (GO:0061009)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cell differentiation (GO:0060956)|endocardium formation (GO:0060214)|endoderm formation (GO:0001706)|endodermal cell fate determination (GO:0007493)|endodermal digestive tract morphogenesis (GO:0061031)|gall bladder development (GO:0061010)|heart formation (GO:0060914)|heart looping (GO:0001947)|inner cell mass cellular morphogenesis (GO:0001828)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth (GO:0030308)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell differentiation (GO:0045597)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein destabilization (GO:0031648)|protein stabilization (GO:0050821)|regulation of cardiac cell fate specification (GO:2000043)|regulation of embryonic development (GO:0045995)|regulation of stem cell division (GO:2000035)|regulation of stem cell proliferation (GO:0072091)|regulation of transcription from RNA polymerase II promoter involved in definitive endodermal cell fate specification (GO:0060807)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|rostrocaudal neural tube patterning (GO:0021903)|signal transduction involved in regulation of gene expression (GO:0023019)|spermatogenesis (GO:0007283)|stem cell fate specification (GO:0048866)|vasculogenesis (GO:0001570)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A352S(1)		endometrium(6)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)	18		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)			CAGTCAGCCCGCCGAGCTCCT	0.701																																					p.A352S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1054T	8						.						20.0	25.0	23.0					8																	55372364		2201	4300	6501	55534917	SO:0001583	missense	64321	exon2			AB073988	CCDS6159.1	8q11.23	2014-09-04			ENSG00000164736	ENSG00000164736		"""SRY (sex determining region Y)-boxes"""	18122	protein-coding gene	gene with protein product		610928				11786926	Standard	NM_022454		Approved		uc003xsb.4	Q9H6I2	OTTHUMG00000164377	ENST00000297316.4:c.1054G>T	8.37:g.55372364G>T	ENSP00000297316:p.Ala352Ser	Somatic		Capture	Illumina HiSeq	Phase_I	55534917	NM_022454		Missense_Mutation	SNP	ENST00000297316.4	37	CCDS6159.1	.	.	.	.	.	.	.	.	.	.	G	6.685	0.495053	0.12762	.	.	ENSG00000164736	ENST00000297316	T	0.77489	-1.1	4.72	-2.12	0.07165	.	0.379072	0.26586	N	0.023545	T	0.57592	0.2064	L	0.40543	1.245	0.09310	N	1	B	0.16396	0.017	B	0.15870	0.014	T	0.33292	-0.9874	10	0.22109	T	0.4	.	1.3707	0.02210	0.2169:0.1203:0.4156:0.2472	.	352	Q9H6I2	SOX17_HUMAN	S	352	ENSP00000297316:A352S	ENSP00000297316:A352S	A	+	1	0	SOX17	55534917	0.000000	0.05858	0.573000	0.28510	0.246000	0.25737	0.027000	0.13621	-0.450000	0.07107	-0.391000	0.06502	GCC		SOX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378526.2		
TRPS1	7227	broad.mit.edu	37	8	116616908	116616908	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr8:116616908T>A	ENST00000220888.5	-	3	1408	c.1249A>T	c.(1249-1251)Ata>Tta	p.I417L	TRPS1_ENST00000395715.3_Missense_Mutation_p.I430L|TRPS1_ENST00000520276.1_Missense_Mutation_p.I421L|TRPS1_ENST00000519076.1_Missense_Mutation_p.I371L|TRPS1_ENST00000519674.1_Missense_Mutation_p.I417L			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	417					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.I417L(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			AGGGGCTTTATGGGCACTGAG	0.458									Langer-Giedion syndrome																												p.I430L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1288T	8						.						94.0	91.0	92.0					8																	116616908		1901	4121	6022	116686083	SO:0001583	missense	7227	exon4	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1249A>T	8.37:g.116616908T>A	ENSP00000220888:p.Ile417Leu	Somatic		Capture	Illumina HiSeq	Phase_I	116686083	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37		.	.	.	.	.	.	.	.	.	.	T	15.58	2.875662	0.51695	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	D;D;T;D;T	0.98666	-5.06;-5.03;3.33;-5.03;0.76	5.69	5.69	0.88448	.	0.179654	0.49305	D	0.000144	D	0.96213	0.8765	L	0.27053	0.805	0.41290	D	0.986976	P;P;P	0.38335	0.627;0.493;0.627	B;B;B	0.36186	0.219;0.109;0.219	D	0.96644	0.9476	10	0.49607	T	0.09	.	16.2484	0.82467	0.0:0.0:0.0:1.0	.	421;417;430	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	L	430;417;371;421;417	ENSP00000379065:I430L;ENSP00000220888:I417L;ENSP00000428910:I371L;ENSP00000428680:I421L;ENSP00000429174:I417L	ENSP00000220888:I417L	I	-	1	0	TRPS1	116686083	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.556000	0.60775	2.291000	0.77112	0.533000	0.62120	ATA		TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
OR13C9	286362	broad.mit.edu	37	9	107380176	107380176	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr9:107380176C>T	ENST00000259362.1	-	1	309	c.310G>A	c.(310-312)Ggc>Agc	p.G104S		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G104S(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						ATGGCCAAGCCAAGGAACATC	0.502																																					p.G104S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G310A	9						.						117.0	135.0	129.0					9																	107380176		2203	4300	6503	106419997	SO:0001583	missense	286362	exon1				CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.310G>A	9.37:g.107380176C>T	ENSP00000259362:p.Gly104Ser	Somatic		Capture	Illumina HiSeq	Phase_I	106419997	NM_001001956	Q6IFL2	Missense_Mutation	SNP	ENST00000259362.1	37	CCDS35093.1	.	.	.	.	.	.	.	.	.	.	c	0.027	-1.358811	0.01245	.	.	ENSG00000136839	ENST00000259362	T	0.00922	5.54	4.64	2.77	0.32553	GPCR, rhodopsin-like superfamily (1);	0.294073	0.24339	N	0.039396	T	0.00241	0.0007	N	0.00096	-2.155	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.43845	-0.9366	10	0.02654	T	1	.	5.5708	0.17196	0.3474:0.5597:0.0:0.0929	.	104	Q8NGT0	O13C9_HUMAN	S	104	ENSP00000259362:G104S	ENSP00000259362:G104S	G	-	1	0	OR13C9	106419997	0.004000	0.15560	0.961000	0.40146	0.690000	0.40134	1.173000	0.31920	0.543000	0.28864	-0.150000	0.13652	GGC		OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053490.1		
GOLGA2	2801	broad.mit.edu	37	9	131022786	131022786	+	Silent	SNP	G	G	A			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr9:131022786G>A	ENST00000421699.2	-	17	1647	c.1635C>T	c.(1633-1635)ctC>ctT	p.L545L	AL590708.1_ENST00000408370.1_RNA|GOLGA2_ENST00000609374.1_Silent_p.L533L	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	545					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)		p.L533L(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						GCTGCTCCTTGAGCTCCCGGT	0.637																																					p.L545L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1635T	9						.						63.0	68.0	66.0					9																	131022786		2203	4300	6503	130062607	SO:0001819	synonymous_variant	2801	exon17			L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.1635C>T	9.37:g.131022786G>A		Somatic		Capture	Illumina HiSeq	Phase_I	130062607	NM_004486	Q6GRM9|Q9BRB0|Q9NYF9	Silent	SNP	ENST00000421699.2	37	CCDS6896.2																																																																																				GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2	NM_004486	
ACER2	340485	broad.mit.edu	37	9	19424801	19424801	+	Silent	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr9:19424801C>T	ENST00000340967.2	+	3	353	c.327C>T	c.(325-327)ttC>ttT	p.F109F	ACER2_ENST00000380376.1_Silent_p.F60F	NM_001010887.2	NP_001010887.2	Q5QJU3	ACER2_HUMAN	alkaline ceramidase 2	109					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to drug (GO:0035690)|ceramide metabolic process (GO:0006672)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of protein glycosylation in Golgi (GO:0090285)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	ceramidase activity (GO:0017040)|dihydroceramidase activity (GO:0071633)	p.F109F(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	13						CCATGTGGTTCCCCAGAAGGT	0.438																																					p.F109F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C327T	9						.						205.0	164.0	178.0					9																	19424801		2203	4300	6503	19414801	SO:0001819	synonymous_variant	340485	exon3			AK123581	CCDS34992.1	9p21.3	2013-01-25	2008-12-19	2008-12-19	ENSG00000177076	ENSG00000177076	3.5.1.23	"""Alkaline ceramidase"""	23675	protein-coding gene	gene with protein product		613492	"""N-acylsphingosine amidohydrolase 3-like"""	ASAH3L		18945876	Standard	XM_005251447		Approved	FLJ41587	uc003zny.1	Q5QJU3	OTTHUMG00000019644	ENST00000340967.2:c.327C>T	9.37:g.19424801C>T		Somatic		Capture	Illumina HiSeq	Phase_I	19414801	NM_001010887	A2A3R8|Q569G5|Q5VZR7|Q71RD2	Silent	SNP	ENST00000340967.2	37	CCDS34992.1																																																																																				ACER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051864.1	XM_294540	
POMT1	10585	broad.mit.edu	37	9	134384303	134384303	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chr9:134384303G>T	ENST00000372228.3	+	6	612	c.433G>T	c.(433-435)Gct>Tct	p.A145S	POMT1_ENST00000402686.3_Missense_Mutation_p.A145S|POMT1_ENST00000354713.4_Missense_Mutation_p.A115S|POMT1_ENST00000341012.7_Missense_Mutation_p.A91S|POMT1_ENST00000419118.2_5'UTR|POMT1_ENST00000404875.2_Missense_Mutation_p.A28S|POMT1_ENST00000423007.1_Missense_Mutation_p.A145S|POMT1_ENST00000541219.1_Intron	NM_007171.3	NP_009102	Q9Y6A1	POMT1_HUMAN	protein-O-mannosyltransferase 1	145					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|mannosylation (GO:0097502)|multicellular organismal development (GO:0007275)|protein O-linked glycosylation (GO:0006493)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|sarcoplasmic reticulum (GO:0016529)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannosyltransferase activity (GO:0000030)|metal ion binding (GO:0046872)	p.A145S(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	31		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.65e-05)|Epithelial(140;0.000259)		AACAGAGAATGCTCTCATCAC	0.373																																					p.A145S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G433T	9						.						141.0	117.0	125.0					9																	134384303		2203	4300	6503	133374124	SO:0001583	missense	10585	exon6			AF095136	CCDS6943.1, CCDS43894.1, CCDS43895.1, CCDS48045.1	9q34.1	2014-09-17			ENSG00000130714	ENSG00000130714	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	9202	protein-coding gene	gene with protein product	"""dolichyl-phosphate-mannose-protein mannosyltransferase"""	607423				10366449	Standard	NM_001077366		Approved	LGMD2K	uc004cav.3	Q9Y6A1	OTTHUMG00000020826	ENST00000372228.3:c.433G>T	9.37:g.134384303G>T	ENSP00000361302:p.Ala145Ser	Somatic		Capture	Illumina HiSeq	Phase_I	133374124	NM_007171	B3KQG0|B4DIF0|Q5JT01|Q5JT06|Q5JT08|Q8NC91|Q8TCA9|Q9NX32|Q9NX82|Q9UNT2	Missense_Mutation	SNP	ENST00000372228.3	37	CCDS6943.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.944041	0.34283	.	.	ENSG00000130714	ENST00000423007;ENST00000404875;ENST00000341012;ENST00000441334;ENST00000372221;ENST00000372228;ENST00000402686;ENST00000354713;ENST00000415075;ENST00000448212;ENST00000430619	D;D;D;D;D;D;D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9	5.57	3.58	0.41010	Glycosyl transferase, family 39 (1);	0.102004	0.64402	D	0.000001	T	0.65481	0.2695	N	0.10618	0.005	0.80722	D	1	B;B;B	0.20261	0.04;0.043;0.032	B;B;B	0.23574	0.047;0.045;0.042	T	0.57740	-0.7759	10	0.06236	T	0.91	-1.29	8.1917	0.31372	0.0888:0.0:0.7039:0.2073	.	115;145;145	B4DTW4;Q9Y6A1;Q9Y6A1-2	.;POMT1_HUMAN;.	S	145;28;91;28;28;145;145;115;28;91;28	ENSP00000404119:A145S;ENSP00000384531:A28S;ENSP00000343034:A91S;ENSP00000395060:A28S;ENSP00000361302:A145S;ENSP00000385797:A145S;ENSP00000346748:A115S;ENSP00000405149:A28S;ENSP00000403736:A91S;ENSP00000402083:A28S	ENSP00000343034:A91S	A	+	1	0	POMT1	133374124	0.986000	0.35501	0.447000	0.26932	0.970000	0.65996	1.978000	0.40598	1.350000	0.45770	-0.142000	0.14014	GCT		POMT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054737.1	NM_007171	
ZDHHC15	158866	broad.mit.edu	37	X	74742769	74742769	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chrX:74742769C>T	ENST00000373367.3	-	1	321	c.91G>A	c.(91-93)Gtc>Atc	p.V31I	ZDHHC15_ENST00000373361.3_Missense_Mutation_p.V31I|ZDHHC15_ENST00000482827.1_5'UTR|ZDHHC15_ENST00000541184.1_Missense_Mutation_p.V31I	NM_144969.2	NP_659406.1	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15	31					establishment of protein localization (GO:0045184)|protein palmitoylation (GO:0018345)|synaptic vesicle maturation (GO:0016188)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.V31I(1)		central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(1)|lung(11)|ovary(2)|skin(2)	26						CAGAGCACGACGAGGACAATA	0.572																																					p.V31I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G91A	X						.						112.0	85.0	94.0					X																	74742769		2203	4300	6503	74659494	SO:0001583	missense	158866	exon1			AK056374	CCDS14430.1, CCDS55454.1	Xq13.3	2008-05-02			ENSG00000102383	ENSG00000102383		"""Zinc fingers, DHHC-type"""	20342	protein-coding gene	gene with protein product		300576					Standard	NM_144969		Approved	FLJ31812, MRX91	uc004ecg.3	Q96MV8	OTTHUMG00000021866	ENST00000373367.3:c.91G>A	X.37:g.74742769C>T	ENSP00000362465:p.Val31Ile	Somatic		Capture	Illumina HiSeq	Phase_I	74659494	NM_001146256	B3KVG7|Q3SY30|Q6UWH3	Missense_Mutation	SNP	ENST00000373367.3	37	CCDS14430.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.424448	0.62733	.	.	ENSG00000102383	ENST00000373367;ENST00000541184;ENST00000373361	T;T;T	0.76448	0.94;1.14;-1.02	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.81460	0.4827	L	0.45352	1.415	0.80722	D	1	D;P;P	0.71674	0.998;0.784;0.514	D;B;B	0.75484	0.986;0.33;0.206	T	0.76024	-0.3110	10	0.06625	T	0.88	-10.8015	15.6856	0.77409	0.0:1.0:0.0:0.0	.	31;31;31	Q96MV8-2;B3KVG7;Q96MV8	.;.;ZDH15_HUMAN	I	31	ENSP00000362465:V31I;ENSP00000445420:V31I;ENSP00000362459:V31I	ENSP00000362459:V31I	V	-	1	0	ZDHHC15	74659494	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.732000	0.62029	2.300000	0.77407	0.529000	0.55759	GTC		ZDHHC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057283.1	NM_144969	
FAM46D	169966	broad.mit.edu	37	X	79699151	79699151	+	Silent	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chrX:79699151C>T	ENST00000308293.5	+	3	1352	c.1113C>T	c.(1111-1113)ccC>ccT	p.P371P	FAM46D_ENST00000538312.1_Silent_p.P371P	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	371								p.P371P(1)		kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						AGCCACCCCCCGTTAGCTTCC	0.418																																					p.P371P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1113T	X						.						41.0	40.0	40.0					X																	79699151		2203	4298	6501	79585807	SO:0001819	synonymous_variant	169966	exon5			BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.1113C>T	X.37:g.79699151C>T		Somatic		Capture	Illumina HiSeq	Phase_I	79585807	NM_001170574	B2R9Q6|Q7Z3F6|Q8NHU1	Silent	SNP	ENST00000308293.5	37	CCDS14446.1																																																																																				FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057338.1	NM_152630	
DCX	1641	broad.mit.edu	37	X	110653439	110653439	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A01V-01A-23W-A096-10	TCGA-AA-A01V-11A-11W-A096-10	g.chrX:110653439C>T	ENST00000338081.3	-	2	602	c.431G>A	c.(430-432)cGc>cAc	p.R144H	DCX_ENST00000356915.2_Missense_Mutation_p.R63H|DCX_ENST00000356220.3_Missense_Mutation_p.R63H|DCX_ENST00000496551.1_5'UTR|DCX_ENST00000371993.2_Missense_Mutation_p.R63H|DCX_ENST00000488120.1_Missense_Mutation_p.R63H	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin	144	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)	p.R144H(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						CTTGAAGTAGCGGTCCCCATT	0.527																																					p.R63H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G188A	X						.						308.0	222.0	251.0					X																	110653439		2203	4300	6503	110540095	SO:0001583	missense	1641	exon2			AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.431G>A	X.37:g.110653439C>T	ENSP00000337697:p.Arg144His	Somatic		Capture	Illumina HiSeq	Phase_I	110540095	NM_178153	A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	Missense_Mutation	SNP	ENST00000338081.3	37	CCDS14556.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.3|29.3	4.996441|4.996441	0.93167|0.93167	.|.	.|.	ENSG00000077279|ENSG00000077279	ENST00000358070|ENST00000356915;ENST00000371993;ENST00000338081;ENST00000356220;ENST00000488120;ENST00000468911	.|D;D;D;D;D;D	.|0.93811	.|-2.2;-2.2;-2.2;-2.2;-2.2;-3.29	5.37|5.37	5.37|5.37	0.77165|0.77165	.|Doublecortin domain (4);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.96987|0.96987	0.9016|0.9016	M|M	0.87456|0.87456	2.885|2.885	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.996	.|D;P	.|0.71184	.|0.972;0.897	D|D	0.96894|0.96894	0.9655|0.9655	5|10	.|0.48119	.|T	.|0.1	.|.	18.1845|18.1845	0.89789|0.89789	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|132;144	.|B4DM53;O43602	.|.;DCX_HUMAN	T|H	136|63;63;144;63;63;63	.|ENSP00000349385:R63H;ENSP00000361061:R63H;ENSP00000337697:R144H;ENSP00000348553:R63H;ENSP00000419861:R63H;ENSP00000418811:R63H	.|ENSP00000337697:R144H	A|R	-|-	1|2	0|0	DCX|DCX	110540095|110540095	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.651000|7.651000	0.83577|0.83577	2.487000|2.487000	0.83934|0.83934	0.513000|0.513000	0.50165|0.50165	GCT|CGC		DCX-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357058.1	NM_178153	
