#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZWINT	11130	broad.mit.edu	37	10	58118648	58118648	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr10:58118648T>A	ENST00000373944.3	-	6	579	c.541A>T	c.(541-543)Act>Tct	p.T181S	ZWINT_ENST00000318387.2_Missense_Mutation_p.T61S|ZWINT_ENST00000460654.1_5'UTR|ZWINT_ENST00000395405.1_Missense_Mutation_p.T181S|ZWINT_ENST00000361148.6_Intron			O95229	ZWINT_HUMAN	ZW10 interacting kinetochore protein	181					establishment of localization in cell (GO:0051649)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|kinetochore (GO:0000776)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)	p.T181S(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)	20						TCCTGCTGAGTCCCTGTCTTA	0.542																																					p.T181S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A541T	10						.						115.0	112.0	113.0					10																	58118648		2203	4300	6503	57788654	SO:0001583	missense	11130	exon6			AF067656	CCDS7249.1, CCDS31205.1	10q21-q22	2013-05-01	2013-05-01		ENSG00000122952	ENSG00000122952			13195	protein-coding gene	gene with protein product		609177	"""ZW10 interactor"""				Standard	XM_005269463		Approved	KNTC2AP	uc001jka.1	O95229	OTTHUMG00000018261	ENST00000373944.3:c.541A>T	10.37:g.58118648T>A	ENSP00000363055:p.Thr181Ser	Somatic		Capture	Illumina HiSeq	Phase_I	57788654	NM_007057	A6NNV6|Q0D2I3|Q9BWD0	Missense_Mutation	SNP	ENST00000373944.3	37	CCDS7249.1	.	.	.	.	.	.	.	.	.	.	T	8.682	0.905411	0.17760	.	.	ENSG00000122952	ENST00000373944;ENST00000395405;ENST00000318387	T;T;T	0.43688	0.94;0.94;0.94	4.48	0.87	0.19102	.	0.834791	0.10344	N	0.685906	T	0.27559	0.0677	L	0.36672	1.1	0.09310	N	1	B	0.32829	0.386	B	0.34242	0.178	T	0.23261	-1.0193	10	0.09084	T	0.74	-0.3845	6.1186	0.20139	0.0:0.3364:0.0:0.6636	.	181	O95229	ZWINT_HUMAN	S	181;181;61	ENSP00000363055:T181S;ENSP00000378801:T181S;ENSP00000322850:T61S	ENSP00000322850:T61S	T	-	1	0	ZWINT	57788654	0.000000	0.05858	0.001000	0.08648	0.219000	0.24729	0.126000	0.15769	0.138000	0.18790	0.533000	0.62120	ACT		ZWINT-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048132.1		
CTNNA3	29119	broad.mit.edu	37	10	68535223	68535223	+	Silent	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr10:68535223C>T	ENST00000433211.2	-	8	1281	c.1107G>A	c.(1105-1107)aaG>aaA	p.K369K	CTNNA3_ENST00000373744.4_Silent_p.K369K	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3									p.K369K(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						GGTCTCTTGTCTTCTTACACA	0.378																																					p.K369K												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1107A	10						.						187.0	177.0	181.0					10																	68535223		2203	4300	6503	68205229	SO:0001819	synonymous_variant	29119	exon8			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.1107G>A	10.37:g.68535223C>T		Somatic		Capture	Illumina HiSeq	Phase_I	68205229	NM_013266		Silent	SNP	ENST00000433211.2	37	CCDS7269.1																																																																																				CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266	
IFIT1B	439996	broad.mit.edu	37	10	91143741	91143741	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr10:91143741C>T	ENST00000371809.3	+	2	751	c.671C>T	c.(670-672)gCc>gTc	p.A224V	LIPA_ENST00000371837.1_Intron	NM_001010987.2	NP_001010987.1	Q5T764	IFT1B_HUMAN	interferon-induced protein with tetratricopeptide repeats 1B	224								p.A224V(1)		endometrium(2)|large_intestine(3)|lung(8)	13						GTTCTCCTTGCCCTGAAGCTT	0.428																																					p.A224V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C671T	10						.						201.0	213.0	209.0					10																	91143741		2203	4300	6503	91133721	SO:0001583	missense	439996	exon2				CCDS31242.1	10q23.31	2014-05-22	2010-03-22	2010-03-22	ENSG00000204010	ENSG00000204010		"""Tetratricopeptide (TTC) repeat domain containing"""	23442	protein-coding gene	gene with protein product			"""interferon-induced protein with tetratricopeptide repeats 1-like"""	IFIT1L			Standard	NM_001010987		Approved	bA149I23.6	uc001kgh.3	Q5T764	OTTHUMG00000018709	ENST00000371809.3:c.671C>T	10.37:g.91143741C>T	ENSP00000360874:p.Ala224Val	Somatic		Capture	Illumina HiSeq	Phase_I	91133721	NM_001010987	A7E245	Missense_Mutation	SNP	ENST00000371809.3	37	CCDS31242.1	.	.	.	.	.	.	.	.	.	.	C	19.44	3.828722	0.71258	.	.	ENSG00000204010	ENST00000371809	T	0.53423	0.62	3.9	2.97	0.34412	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.304597	0.32106	U	0.006571	T	0.70098	0.3185	M	0.90542	3.125	0.40072	D	0.976029	D	0.76494	0.999	D	0.65987	0.94	T	0.75671	-0.3237	10	0.51188	T	0.08	.	12.3659	0.55228	0.0:0.8286:0.1714:0.0	.	224	Q5T764	IFT1B_HUMAN	V	224	ENSP00000360874:A224V	ENSP00000360874:A224V	A	+	2	0	IFIT1B	91133721	0.851000	0.29673	0.762000	0.31397	0.805000	0.45488	1.338000	0.33873	0.809000	0.34255	0.557000	0.71058	GCC		IFIT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049296.3	NM_001010987	
TPP1	1200	broad.mit.edu	37	11	6638002	6638002	+	Missense_Mutation	SNP	C	C	T	rs140176031		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr11:6638002C>T	ENST00000299427.6	-	7	836	c.776G>A	c.(775-777)cGt>cAt	p.R259H	TPP1_ENST00000533371.1_Missense_Mutation_p.R16H|RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000534644.1_5'Flank	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I	0					embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)	p.R259H(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	TCCAACCACACGGGCTACTGA	0.577													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18362	0.0		0.0	False		,,,				2504	0.0				p.R259H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G776A	11						.	C	HIS/ARG	4,4398	8.1+/-20.4	0,4,2197	100.0	103.0	102.0		776	1.5	0.5	11	dbSNP_134	102	0,8592		0,0,4296	yes	missense	TPP1	NM_000391.3	29	0,4,6493	TT,TC,CC		0.0,0.0909,0.0308	benign	259/564	6638002	4,12990	2201	4296	6497	6594578	SO:0001583	missense	1200	exon7			AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.776G>A	11.37:g.6638002C>T	ENSP00000299427:p.Arg259His	Somatic		Capture	Illumina HiSeq	Phase_I	6594578	NM_000391	Q71V64	Missense_Mutation	SNP	ENST00000299427.6	37	CCDS7770.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	13.47	2.246130	0.39697	9.09E-4	0.0	ENSG00000166340	ENST00000299427;ENST00000533371	D;D	0.98862	-3.16;-5.19	4.48	1.49	0.22878	Peptidase S8/S53, subtilisin/kexin/sedolisin (2);	0.421170	0.25347	N	0.031336	D	0.94098	0.8108	N	0.12569	0.235	0.80722	D	1	B	0.14012	0.009	B	0.10450	0.005	D	0.87087	0.2170	10	0.46703	T	0.11	-11.6721	7.5617	0.27855	0.0:0.6393:0.0:0.3607	.	259	O14773	TPP1_HUMAN	H	259;16	ENSP00000299427:R259H;ENSP00000437066:R16H	ENSP00000299427:R259H	R	-	2	0	TPP1	6594578	0.025000	0.19082	0.548000	0.28192	0.829000	0.46940	0.456000	0.21859	0.022000	0.15160	0.455000	0.32223	CGT		TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257261.2		
TRIM44	54765	broad.mit.edu	37	11	35684885	35684885	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr11:35684885G>T	ENST00000299413.5	+	1	533	c.226G>T	c.(226-228)Gcg>Tcg	p.A76S	RP1-276E15.1_ENST00000525573.2_lincRNA	NM_017583.4	NP_060053.2	Q96DX7	TRI44_HUMAN	tripartite motif containing 44	76	Glu-rich.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.A76S(1)		endometrium(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_lung(20;0.0317)|Lung NSC(22;0.0661)|all_epithelial(35;0.115)	all_hematologic(20;0.107)				Cggagagggggcggggaagga	0.637																																					p.A76S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G226T	11						.						47.0	48.0	48.0					11																	35684885		2202	4296	6498	35641461	SO:0001583	missense	54765	exon1			BC024031	CCDS31461.1	11p13	2011-04-20	2011-01-25		ENSG00000166326	ENSG00000166326		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19016	protein-coding gene	gene with protein product		612298	"""tripartite motif-containing 44"""				Standard	NM_017583		Approved	DIPB, MC7	uc001mwi.2	Q96DX7	OTTHUMG00000166312	ENST00000299413.5:c.226G>T	11.37:g.35684885G>T	ENSP00000299413:p.Ala76Ser	Somatic		Capture	Illumina HiSeq	Phase_I	35641461	NM_017583	D3DR14|Q96QY2|Q9UGK0	Missense_Mutation	SNP	ENST00000299413.5	37	CCDS31461.1	.	.	.	.	.	.	.	.	.	.	G	7.509	0.654237	0.14580	.	.	ENSG00000166326	ENST00000299413	T	0.30981	1.51	3.26	2.29	0.28610	.	0.926365	0.08751	N	0.899108	T	0.15132	0.0365	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.28554	-1.0040	10	0.09843	T	0.71	-0.287	10.0324	0.42109	0.0:0.2089:0.7911:0.0	.	76	Q96DX7	TRI44_HUMAN	S	76	ENSP00000299413:A76S	ENSP00000299413:A76S	A	+	1	0	TRIM44	35641461	0.009000	0.17119	0.008000	0.14137	0.953000	0.61014	0.747000	0.26290	0.449000	0.26747	0.555000	0.69702	GCG		TRIM44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389081.1	NM_017583	
PRKRIR	5612	broad.mit.edu	37	11	76063263	76063263	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr11:76063263G>A	ENST00000260045.3	-	5	1036	c.931C>T	c.(931-933)Cac>Tac	p.H311Y	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	311					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H311Y(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						ATCATAGTGTGAAATTTCACA	0.393																																					p.H311Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C931T	11						.						51.0	54.0	53.0					11																	76063263		2192	4284	6476	75740911	SO:0001583	missense	5612	exon5			AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.931C>T	11.37:g.76063263G>A	ENSP00000260045:p.His311Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	75740911	NM_004705	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	ENST00000260045.3	37	CCDS8243.1	.	.	.	.	.	.	.	.	.	.	G	2.848	-0.238995	0.05944	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	T;T	0.20598	2.06;2.06	4.99	4.99	0.66335	Ribonuclease H-like (1);	0.086471	0.85682	D	0.000000	T	0.19406	0.0466	L	0.41236	1.265	0.43965	D	0.996645	B	0.33103	0.397	B	0.32289	0.143	T	0.04373	-1.0956	10	0.15499	T	0.54	.	18.8019	0.92022	0.0:0.0:1.0:0.0	.	311	O43422	P52K_HUMAN	Y	136;311	ENSP00000436249:H136Y;ENSP00000260045:H311Y	ENSP00000260045:H311Y	H	-	1	0	PRKRIR	75740911	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.658000	0.54482	2.527000	0.85204	0.644000	0.83932	CAC		PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	NM_004705	
OR8B4	283162	broad.mit.edu	37	11	124294277	124294277	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr11:124294277C>T	ENST00000356130.3	-	1	512	c.491G>A	c.(490-492)cGa>cAa	p.R164Q		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R164Q(1)		endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GAAGGTCAGTCGCAGCATGCT	0.537																																					p.R164Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G491A	11						.						92.0	63.0	73.0					11																	124294277		2201	4299	6500	123799487	SO:0001583	missense	283162	exon1			AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.491G>A	11.37:g.124294277C>T	ENSP00000348449:p.Arg164Gln	Somatic		Capture	Illumina HiSeq	Phase_I	123799487	NM_001005196	B2RNF8|Q6IFQ7	Missense_Mutation	SNP	ENST00000356130.3	37	CCDS31710.1	.	.	.	.	.	.	.	.	.	.	c	13.67	2.306337	0.40795	.	.	ENSG00000198657	ENST00000356130	T	0.00145	8.67	4.02	3.08	0.35506	GPCR, rhodopsin-like superfamily (1);	0.106321	0.41938	D	0.000795	T	0.00109	0.0003	N	0.25426	0.745	0.22591	N	0.998953	P	0.39903	0.694	B	0.35770	0.21	T	0.27640	-1.0068	10	0.66056	D	0.02	.	5.5213	0.16933	0.0:0.6729:0.2175:0.1096	.	164	Q96RC9	OR8B4_HUMAN	Q	164	ENSP00000348449:R164Q	ENSP00000348449:R164Q	R	-	2	0	OR8B4	123799487	0.000000	0.05858	0.987000	0.45799	0.563000	0.35712	-0.320000	0.08028	1.261000	0.44149	0.650000	0.86243	CGA		OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387055.1	NM_001005196	
NAB2	4665	broad.mit.edu	37	12	57485449	57485450	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	-	-	-	C	-	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr12:57485449_57485450insC	ENST00000300131.3	+	2	1003_1004	c.625_626insC	c.(625-627)tccfs	p.S209fs	NAB2_ENST00000554718.1_3'UTR|NAB2_ENST00000342556.6_Frame_Shift_Ins_p.S209fs|NAB2_ENST00000357680.4_Frame_Shift_Ins_p.S209fs	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	209					cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						GCCCCCCTTCTCCCCCCCTGCA	0.713																																					p.S209fs												.	.	0			c.625_626insC	12						.																																			55771717	SO:0001589	frameshift_variant	4665	exon2			BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.632dupC	12.37:g.57485456_57485456dupC	ENSP00000300131:p.Ser209fs	Germline		Capture	Illumina HiSeq	Phase_I	55771716	NM_005967	B2RAK3|O76006|Q14797	Frame_Shift_Ins	INS	ENST00000300131.3	37	CCDS8930.1																																																																																				NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412222.1	NM_005967	
WSCD2	9671	broad.mit.edu	37	12	108589988	108589988	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr12:108589988C>T	ENST00000332082.4	+	3	1197	c.379C>T	c.(379-381)Cga>Tga	p.R127*	WSCD2_ENST00000547525.1_Nonsense_Mutation_p.R127*|WSCD2_ENST00000261400.3_Nonsense_Mutation_p.R127*|WSCD2_ENST00000549903.1_Nonsense_Mutation_p.R127*			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	127	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)		p.R127*(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						GGAGGAAGAGCGAGGTAAGAG	0.542																																					p.R127X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C379T	12						.						27.0	29.0	28.0					12																	108589988		1988	4150	6138	107114118	SO:0001587	stop_gained	9671	exon2				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.379C>T	12.37:g.108589988C>T	ENSP00000331933:p.Arg127*	Somatic		Capture	Illumina HiSeq	Phase_I	107114118	NM_014653	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Nonsense_Mutation	SNP	ENST00000332082.4	37	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	C	43	10.488739	0.99414	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	.	.	.	5.07	0.465	0.16711	.	0.110162	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0882	13.6997	0.62602	0.7372:0.2628:0.0:0.0	.	.	.	.	X	127	.	ENSP00000261400:R127X	R	+	1	2	WSCD2	107114118	0.991000	0.36638	0.998000	0.56505	0.547000	0.35210	1.433000	0.34947	0.228000	0.21019	-0.182000	0.12963	CGA		WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653	
WSCD2	9671	broad.mit.edu	37	12	108620880	108620880	+	Silent	SNP	G	G	A	rs367674517		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr12:108620880G>A	ENST00000332082.4	+	7	1736	c.918G>A	c.(916-918)gcG>gcA	p.A306A	WSCD2_ENST00000547525.1_Silent_p.A306A|WSCD2_ENST00000261400.3_Silent_p.A306A|WSCD2_ENST00000549903.1_Silent_p.A306A			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	306	WSC 2. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)		p.A306A(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						AGTGCAGCGCGGAGGAGTTTG	0.592																																					p.A306A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G918A	12						.	G		0,4038		0,0,2019	65.0	69.0	68.0		918	-10.9	0.1	12		68	1,8339		0,1,4169	no	coding-synonymous	WSCD2	NM_014653.2		0,1,6188	AA,AG,GG		0.012,0.0,0.0081		306/566	108620880	1,12377	2019	4170	6189	107145010	SO:0001819	synonymous_variant	9671	exon6				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.918G>A	12.37:g.108620880G>A		Somatic		Capture	Illumina HiSeq	Phase_I	107145010	NM_014653	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Silent	SNP	ENST00000332082.4	37	CCDS41828.1																																																																																				WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653	
KCNA5	3741	broad.mit.edu	37	12	5153876	5153876	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr12:5153876C>T	ENST00000252321.3	+	1	792	c.563C>T	c.(562-564)cCg>cTg	p.P188L		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	188				RP -> G (in Ref. 1; AAA61276). {ECO:0000305}.	atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)	p.P188L(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	CTGCGGAGGCCGGTCAACGTC	0.617																																					p.P188L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C563T	12						.						38.0	42.0	40.0					12																	5153876		2203	4300	6503	5024137	SO:0001583	missense	3741	exon1			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.563C>T	12.37:g.5153876C>T	ENSP00000252321:p.Pro188Leu	Somatic		Capture	Illumina HiSeq	Phase_I	5024137	NM_002234	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	ENST00000252321.3	37	CCDS8536.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491005	0.84962	.	.	ENSG00000130037	ENST00000252321	T	0.77489	-1.1	4.77	4.77	0.60923	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.64402	U	0.000001	D	0.90635	0.7063	M	0.92317	3.295	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.92943	0.6374	10	0.87932	D	0	.	16.9696	0.86295	0.0:1.0:0.0:0.0	.	188	P22460	KCNA5_HUMAN	L	188	ENSP00000252321:P188L	ENSP00000252321:P188L	P	+	2	0	KCNA5	5024137	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.592000	0.82676	2.478000	0.83669	0.561000	0.74099	CCG		KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234	
PLEKHA5	54477	broad.mit.edu	37	12	19518920	19518920	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr12:19518920G>A	ENST00000299275.6	+	24	3139	c.3133G>A	c.(3133-3135)Gca>Aca	p.A1045T	PLEKHA5_ENST00000429027.2_Missense_Mutation_p.A1211T|PLEKHA5_ENST00000424268.1_Missense_Mutation_p.A1034T|PLEKHA5_ENST00000359180.3_Missense_Mutation_p.A989T|PLEKHA5_ENST00000543806.1_Missense_Mutation_p.A1027T|PLEKHA5_ENST00000538714.1_Missense_Mutation_p.A1103T|PLEKHA5_ENST00000539256.1_Missense_Mutation_p.A803T|PLEKHA5_ENST00000317589.4_Missense_Mutation_p.A1108T|PLEKHA5_ENST00000355397.3_Missense_Mutation_p.A1103T	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	1045					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.A1206T(1)|p.A1045T(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					AACACAGACCGCAAATCATAA	0.313																																					p.A1045T	Pancreas(196;329 2193 11246 14234 19524)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3133A	12						.						74.0	68.0	70.0					12																	19518920		2203	4300	6503	19410187	SO:0001583	missense	54477	exon24			AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.3133G>A	12.37:g.19518920G>A	ENSP00000299275:p.Ala1045Thr	Somatic		Capture	Illumina HiSeq	Phase_I	19410187	NM_019012	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Missense_Mutation	SNP	ENST00000299275.6	37	CCDS8682.1	.	.	.	.	.	.	.	.	.	.	A	1.001	-0.690907	0.03303	.	.	ENSG00000052126	ENST00000317589;ENST00000355397;ENST00000359180;ENST00000429027;ENST00000299275;ENST00000539256;ENST00000538714;ENST00000424268;ENST00000543806;ENST00000538972	T;T;T;T;T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98	4.45	-3.19	0.05171	.	0.677862	0.13821	N	0.360427	T	0.15003	0.0362	N	0.04880	-0.145	0.09310	N	1	B;B;B;B;B	0.10296	0.0;0.0;0.0;0.001;0.003	B;B;B;B;B	0.09377	0.001;0.0;0.0;0.001;0.004	T	0.10086	-1.0645	10	0.29301	T	0.29	-0.797	2.1216	0.03727	0.2511:0.2626:0.3577:0.1286	.	1027;1034;989;1045;1103	F5H0I0;E7EME8;Q9HAU0-5;Q9HAU0;Q9HAU0-2	.;.;.;PKHA5_HUMAN;.	T	1108;1103;989;1211;1045;803;1103;1034;1027;326	ENSP00000325155:A1108T;ENSP00000347560:A1103T;ENSP00000352104:A989T;ENSP00000404296:A1211T;ENSP00000299275:A1045T;ENSP00000440611:A803T;ENSP00000439673:A1103T;ENSP00000400411:A1034T;ENSP00000439837:A1027T;ENSP00000443553:A326T	ENSP00000299275:A1045T	A	+	1	0	PLEKHA5	19410187	0.097000	0.21791	0.011000	0.14972	0.065000	0.16274	-0.152000	0.10159	-1.071000	0.03145	-0.530000	0.04314	GCA		PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
KRT4	3851	broad.mit.edu	37	12	53207849	53207849	+	Silent	SNP	A	A	G			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr12:53207849A>G	ENST00000293774.4	-	1	486	c.216T>C	c.(214-216)tcT>tcC	p.S72S	KRT4_ENST00000551956.1_5'UTR|KRT4_ENST00000458244.2_5'Flank			P19013	K2C4_HUMAN	keratin 4	0	Gly-rich.|Head.		A -> V (in allele K4A1). {ECO:0000269|PubMed:7684424}.		cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.S72S(1)		endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						TCATGGCTGCAGAGAGCGAGC	0.627																																					p.S72S	Pancreas(190;284 2995 41444 45903)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T216C	12						.						34.0	40.0	38.0					12																	53207849		1979	4184	6163	51494116	SO:0001819	synonymous_variant	3851	exon1				CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000293774.4:c.216T>C	12.37:g.53207849A>G		Somatic		Capture	Illumina HiSeq	Phase_I	51494116	NM_002272	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Silent	SNP	ENST00000293774.4	37																																																																																					KRT4-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_002272	
HECTD4	283450	broad.mit.edu	37	12	112620953	112620953	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr12:112620953T>C	ENST00000430131.2	-	61	10776	c.9631A>G	c.(9631-9633)Att>Gtt	p.I3211V	HECTD4_ENST00000550722.1_Missense_Mutation_p.I3487V|HECTD4_ENST00000377560.5_Missense_Mutation_p.I3461V			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3211					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.I3211V(1)|p.I3461V(1)									ACGGTTAGAATCTCTTCTGTT	0.353																																					p.I3461V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A10381G	12						.						178.0	172.0	174.0					12																	112620953		1831	4098	5929	111105336	SO:0001583	missense	283450	exon61			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.9631A>G	12.37:g.112620953T>C	ENSP00000404379:p.Ile3211Val	Somatic		Capture	Illumina HiSeq	Phase_I	111105336	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	T	18.92	3.725859	0.69074	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.45668	0.89;0.89;0.89	5.7	5.7	0.88788	.	.	.	.	.	T	0.43456	0.1248	N	0.19112	0.55	0.49687	D	0.999819	P	0.35745	0.518	P	0.47827	0.558	T	0.48896	-0.8994	9	0.87932	D	0	.	15.9662	0.79974	0.0:0.0:0.0:1.0	.	3211	Q9Y4D8	K0614_HUMAN	V	3461;3211;3487	ENSP00000366783:I3461V;ENSP00000404379:I3211V;ENSP00000449784:I3487V	ENSP00000366783:I3461V	I	-	1	0	C12orf51	111105336	1.000000	0.71417	0.997000	0.53966	0.822000	0.46500	7.353000	0.79414	2.170000	0.68504	0.533000	0.62120	ATT		HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
MTUS2	23281	broad.mit.edu	37	13	29855977	29855977	+	Silent	SNP	G	G	A	rs183125172	byFrequency	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr13:29855977G>A	ENST00000431530.3	+	4	2869	c.2811G>A	c.(2809-2811)gcG>gcA	p.A937A		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	927	Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.A937A(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						TACTTCCAGCGCCAAAATCCA	0.562													G|||	7	0.00139776	0.0	0.0014	5008	,	,		14236	0.0		0.005	False		,,,				2504	0.001				p.A937A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2811A	13						.	G		2,3714		0,2,1856	54.0	55.0	55.0		2811	-3.6	0.3	13		55	14,8194		0,14,4090	no	coding-synonymous	MTUS2	NM_001033602.2		0,16,5946	AA,AG,GG		0.1706,0.0538,0.1342		937/1380	29855977	16,11908	1858	4104	5962	28753977	SO:0001819	synonymous_variant	23281	exon4			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2811G>A	13.37:g.29855977G>A		Somatic		Capture	Illumina HiSeq	Phase_I	28753977	NM_001033602	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	ENST00000431530.3	37	CCDS45022.1																																																																																				MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270	
EIF2AK4	440275	broad.mit.edu	37	15	40268931	40268932	+	Frame_Shift_Ins	INS	-	-	CACT			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr15:40268931_40268932insCACT	ENST00000263791.5	+	12	2178_2179	c.2135_2136insCACT	c.(2134-2139)agcactfs	p.-713fs	EIF2AK4_ENST00000382727.2_Frame_Shift_Ins_p.-713fs	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4						cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)	p.S714fs*21(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		GTGGAGTGGAGCACTTCGGGCG	0.723																																					p.S712fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2135_2136insCACT	15						.																																			38056224	SO:0001589	frameshift_variant	440275	exon12			AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.2136_2139dupCACT	15.37:g.40268932_40268935dupCACT	ENSP00000263791:p.Thr713fs	Somatic		Capture	Illumina HiSeq	Phase_I	38056223	NM_001013703	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Frame_Shift_Ins	INS	ENST00000263791.5	37	CCDS42016.1																																																																																				EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
NPAP1	23742	broad.mit.edu	37	15	24921413	24921413	+	Silent	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr15:24921413G>A	ENST00000329468.2	+	1	873	c.399G>A	c.(397-399)ccG>ccA	p.P133P		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	133					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P133P(1)									CACGTGAGCCGGCGGTCAAGG	0.632																																					p.P133P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G399A	15						.						46.0	39.0	42.0					15																	24921413		2203	4299	6502	22472506	SO:0001819	synonymous_variant	23742	exon1			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.399G>A	15.37:g.24921413G>A		Somatic		Capture	Illumina HiSeq	Phase_I	22472506	NM_018958		Silent	SNP	ENST00000329468.2	37	CCDS10015.1																																																																																				NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
MGA	23269	broad.mit.edu	37	15	42052605	42052605	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr15:42052605C>G	ENST00000570161.1	+	19	7276	c.7276C>G	c.(7276-7278)Cgg>Ggg	p.R2426G	MGA_ENST00000545763.1_Missense_Mutation_p.R2217G|MGA_ENST00000566586.1_Missense_Mutation_p.R2217G|MGA_ENST00000219905.7_Missense_Mutation_p.R2426G|MGA_ENST00000389936.4_Missense_Mutation_p.R2387G			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.R2475G(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTATTATCGCCGGACACACAC	0.448																																					p.R2426G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7276G	15						.						118.0	118.0	118.0					15																	42052605		1906	4118	6024	39839897	SO:0001583	missense	23269	exon20			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.7276C>G	15.37:g.42052605C>G	ENSP00000457035:p.Arg2426Gly	Somatic		Capture	Illumina HiSeq	Phase_I	39839897	NM_001164273	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.727447	0.89390	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.97994	-4.65;-4.65;-4.65	5.53	5.53	0.82687	.	0.284658	0.25004	N	0.033887	D	0.98175	0.9397	L	0.49126	1.545	0.32681	N	0.515471	D;D;D	0.67145	0.996;0.995;0.982	D;D;P	0.68192	0.956;0.926;0.598	D	0.99914	1.1218	10	0.87932	D	0	.	19.4485	0.94857	0.0:1.0:0.0:0.0	.	1042;2217;2426	B4DVS1;F5H7K2;E7ENI0	.;.;.	G	2426;2387;2217	ENSP00000219905:R2426G;ENSP00000374586:R2387G;ENSP00000442467:R2217G	ENSP00000219905:R2426G	R	+	1	2	MGA	39839897	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.798000	0.55522	2.583000	0.87209	0.655000	0.94253	CGG		MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
DMXL2	23312	broad.mit.edu	37	15	51756993	51756993	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr15:51756993C>A	ENST00000251076.5	-	32	7971	c.7684G>T	c.(7684-7686)Gat>Tat	p.D2562Y	DMXL2_ENST00000449909.3_Missense_Mutation_p.D1926Y|DMXL2_ENST00000543779.2_Missense_Mutation_p.D2563Y|RP11-707P17.1_ENST00000561007.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2562						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TCAAACTGATCCATTTTCTCT	0.418																																					p.D2562Y												.	.	0			c.G7684T	15						.						134.0	122.0	126.0					15																	51756993		2196	4293	6489	49544285	SO:0001583	missense	23312	exon32			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.7684G>T	15.37:g.51756993C>A	ENSP00000251076:p.Asp2562Tyr	None		Capture	Illumina HiSeq	Phase_I	49544285	NM_015263	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	19.99	3.928317	0.73327	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909;ENST00000436119	T;T;T	0.25749	1.92;1.92;1.78	5.25	5.25	0.73442	.	0.090168	0.85682	D	0.000000	T	0.48447	0.1500	L	0.59436	1.845	0.51233	D	0.999911	D;D;D;P	0.89917	0.995;0.998;1.0;0.613	D;D;P;P	0.65573	0.919;0.936;0.903;0.453	T	0.41840	-0.9486	10	0.72032	D	0.01	.	19.4069	0.94651	0.0:1.0:0.0:0.0	.	2563;1926;2562;2563	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	Y	2562;2563;1926;107	ENSP00000251076:D2562Y;ENSP00000441858:D2563Y;ENSP00000400855:D1926Y	ENSP00000251076:D2562Y	D	-	1	0	DMXL2	49544285	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.426000	0.59882	2.894000	0.99253	0.591000	0.81541	GAT		DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
CNTNAP4	85445	broad.mit.edu	37	16	76389342	76389342	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr16:76389342C>A	ENST00000476707.1	+	2	472	c.333C>A	c.(331-333)agC>agA	p.S111R	CNTNAP4_ENST00000377504.4_Missense_Mutation_p.S107R|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.S107R|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.S83R			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	108	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.S83R(2)|p.S107R(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						GGGTGACCAGCTACCTCCTGA	0.493																																					p.A108D												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C323A	16						.						99.0	89.0	93.0					16																	76389342		2198	4300	6498	74946843	SO:0001583	missense	85445	exon3			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.333C>A	16.37:g.76389342C>A	ENSP00000417628:p.Ser111Arg	Somatic		Capture	Illumina HiSeq	Phase_I	74946843	NM_033401	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	C	16.72	3.200437	0.58126	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	D;D;D;D	0.98345	-4.88;-4.88;-4.88;-4.88	4.8	3.83	0.44106	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.137286	0.33438	N	0.004903	D	0.98349	0.9452	.	.	.	0.40804	D	0.983364	P;D;B;D	0.69078	0.704;0.971;0.368;0.997	P;P;B;D	0.78314	0.6;0.835;0.247;0.991	D	0.97942	1.0326	9	0.26408	T	0.33	.	11.3882	0.49798	0.0:0.9099:0.0:0.0901	.	83;111;83;108	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	R	107;107;83;111	ENSP00000306893:S107R;ENSP00000439733:S107R;ENSP00000418741:S83R;ENSP00000417628:S111R	ENSP00000306893:S107R	S	+	3	2	CNTNAP4	74946843	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	0.568000	0.23623	1.358000	0.45922	0.591000	0.81541	AGC		CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
NAGLU	4669	broad.mit.edu	37	17	40693222	40693222	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr17:40693222C>A	ENST00000225927.2	+	5	1120	c.1019C>A	c.(1018-1020)gCa>gAa	p.A340E	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	340					carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)	p.A340E(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	GCCATGACTGCAGGTACAGTG	0.582																																					p.A340E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1019A	17						.						57.0	50.0	53.0					17																	40693222		2203	4300	6503	37946748	SO:0001583	missense	4669	exon5				CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.1019C>A	17.37:g.40693222C>A	ENSP00000225927:p.Ala340Glu	Somatic		Capture	Illumina HiSeq	Phase_I	37946748	NM_000263		Missense_Mutation	SNP	ENST00000225927.2	37	CCDS11427.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.157038	0.38119	.	.	ENSG00000108784	ENST00000225927	D	0.98028	-4.67	5.07	1.84	0.25277	Alpha-N-acetylglucosaminidase, tim-barrel domain (1);	0.566233	0.19112	N	0.122402	D	0.91573	0.7338	L	0.31120	0.905	0.09310	N	1	B	0.14012	0.009	B	0.14023	0.01	T	0.79591	-0.1740	10	0.02654	T	1	8.6503	3.4183	0.07384	0.4346:0.3406:0.1414:0.0834	.	340	P54802	ANAG_HUMAN	E	340	ENSP00000225927:A340E	ENSP00000225927:A340E	A	+	2	0	NAGLU	37946748	0.954000	0.32549	0.195000	0.23364	0.627000	0.37826	2.473000	0.45145	0.258000	0.21686	0.561000	0.74099	GCA		NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450385.1	NM_000263	
ACAP1	9744	broad.mit.edu	37	17	7240075	7240075	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr17:7240075G>A	ENST00000158762.3	+	1	228	c.22G>A	c.(22-24)Gag>Aag	p.E8K		NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	8	BAR.|Required for formation of endosomal tubules when overexpressed with PIP5K1C.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.E8K(1)		NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						GCTGGATTTCGAGGAGTGTCT	0.612																																					p.E8K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G22A	17						.						88.0	82.0	84.0					17																	7240075		2203	4300	6503	7180799	SO:0001583	missense	9744	exon1			D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.22G>A	17.37:g.7240075G>A	ENSP00000158762:p.Glu8Lys	Somatic		Capture	Illumina HiSeq	Phase_I	7180799	NM_014716	Q53XN9	Missense_Mutation	SNP	ENST00000158762.3	37	CCDS11101.1	.	.	.	.	.	.	.	.	.	.	G	34	5.392230	0.95988	.	.	ENSG00000072818	ENST00000158762	T	0.04454	3.62	5.69	5.69	0.88448	.	0.056556	0.64402	D	0.000002	T	0.20536	0.0494	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.00019	-1.2360	10	0.62326	D	0.03	.	15.3053	0.73987	0.0:0.0:1.0:0.0	.	8	Q15027	ACAP1_HUMAN	K	8	ENSP00000158762:E8K	ENSP00000158762:E8K	E	+	1	0	ACAP1	7180799	1.000000	0.71417	0.953000	0.39169	0.788000	0.44548	6.798000	0.75155	2.688000	0.91661	0.561000	0.74099	GAG		ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220049.4	NM_014716	
INTS2	57508	broad.mit.edu	37	17	59949756	59949756	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr17:59949756T>C	ENST00000444766.3	-	20	2747	c.2672A>G	c.(2671-2673)tAc>tGc	p.Y891C	Y_RNA_ENST00000365491.1_RNA|INTS2_ENST00000251334.6_Missense_Mutation_p.Y883C	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	891					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)		p.Y891C(1)		NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						AGCACTAAGGTAGGCTTTAGA	0.408																																					p.Y891C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2672G	17						.						87.0	74.0	78.0					17																	59949756		1843	4101	5944	57304538	SO:0001583	missense	57508	exon20			AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.2672A>G	17.37:g.59949756T>C	ENSP00000414237:p.Tyr891Cys	Somatic		Capture	Illumina HiSeq	Phase_I	57304538	NM_020748	Q9ULD3	Missense_Mutation	SNP	ENST00000444766.3	37	CCDS45750.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.008260	0.75046	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T	0.44482	0.92	5.2	5.2	0.72013	.	0.056884	0.64402	D	0.000001	T	0.55529	0.1926	L	0.58101	1.795	0.80722	D	1	D	0.65815	0.995	P	0.58873	0.847	T	0.54721	-0.8251	9	.	.	.	-6.255	14.5709	0.68210	0.0:0.0:0.0:1.0	.	891	Q9H0H0	INT2_HUMAN	C	891;890	ENSP00000414237:Y891C	.	Y	-	2	0	INTS2	57304538	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.428000	0.66489	2.090000	0.63153	0.460000	0.39030	TAC		INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748	
ROCK1	6093	broad.mit.edu	37	18	18548760	18548760	+	Silent	SNP	G	G	A	rs375431349		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr18:18548760G>A	ENST00000399799.2	-	25	3916	c.2976C>T	c.(2974-2976)atC>atT	p.I992I		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	992					actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.I992I(1)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					GTTCAGTGTTGATATTCTTTT	0.323																																					p.I992I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2976T	18						.						246.0	243.0	244.0					18																	18548760		2203	4300	6503	16802758	SO:0001819	synonymous_variant	6093	exon25				CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.2976C>T	18.37:g.18548760G>A		Somatic		Capture	Illumina HiSeq	Phase_I	16802758	NM_005406	B0YJ91|Q2KHM4|Q59GZ4	Silent	SNP	ENST00000399799.2	37	CCDS11870.2																																																																																				ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406	
CHST9	83539	broad.mit.edu	37	18	24496530	24496530	+	Missense_Mutation	SNP	C	C	T	rs369998401		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr18:24496530C>T	ENST00000284224.8	-	6	1302	c.1025G>A	c.(1024-1026)cGt>cAt	p.R342H	CHST9_ENST00000581714.1_Missense_Mutation_p.R342H|AQP4-AS1_ENST00000578701.1_RNA|AQP4-AS1_ENST00000568797.1_RNA|CHST9_ENST00000580774.1_3'UTR|AQP4-AS1_ENST00000582605.1_RNA|AQP4-AS1_ENST00000579964.1_RNA	NM_031422.5	NP_113610.2	Q7L1S5	CHST9_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9	342					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)	p.R342H(1)|p.R257H(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|skin(3)	28	all_lung(6;0.0145)|Ovarian(20;0.124)					TCCTACTGGACGGTGGGAATC	0.393													C|||	1	0.000199681	0.0	0.0	5008	,	,		20418	0.0		0.0	False		,,,				2504	0.001				p.R342H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1025A	18						.	C	HIS/ARG	0,3784		0,0,1892	128.0	122.0	124.0		1025	6.2	1.0	18		124	1,8217		0,1,4108	no	missense	CHST9	NM_031422.4	29	0,1,6000	TT,TC,CC		0.0122,0.0,0.0083	probably-damaging	342/444	24496530	1,12001	1892	4109	6001	22750528	SO:0001583	missense	83539	exon6			AF239821	CCDS42422.1, CCDS58618.1	18q11.2	2011-04-28			ENSG00000154080	ENSG00000154080		"""Sulfotransferases, membrane-bound"""	19898	protein-coding gene	gene with protein product		610191				11139592, 11445554	Standard	NM_031422		Approved	GALNAC4ST-2, GALNAC-4-ST2	uc002kwe.4	Q7L1S5		ENST00000284224.8:c.1025G>A	18.37:g.24496530C>T	ENSP00000284224:p.Arg342His	Somatic		Capture	Illumina HiSeq	Phase_I	22750528	NM_031422	Q6UX69|Q9BXH3|Q9BXH4|Q9BZW9	Missense_Mutation	SNP	ENST00000284224.8	37	CCDS42422.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.440670	0.83993	0.0	1.22E-4	ENSG00000154080	ENST00000284224	T	0.75260	-0.92	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000001	D	0.87928	0.6301	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.87562	0.2472	10	0.72032	D	0.01	-12.6387	20.8794	0.99867	0.0:1.0:0.0:0.0	.	342	Q7L1S5	CHST9_HUMAN	H	342	ENSP00000284224:R342H	ENSP00000284224:R342H	R	-	2	0	CHST9	22750528	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	5.745000	0.68672	2.941000	0.99782	0.655000	0.94253	CGT		CHST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446549.1	NM_031422	
SMAD2	4087	broad.mit.edu	37	18	45368211	45368211	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr18:45368211G>C	ENST00000402690.2	-	11	1785	c.1391C>G	c.(1390-1392)tCa>tGa	p.S464*	SMAD2_ENST00000586040.1_Nonsense_Mutation_p.S434*|SMAD2_ENST00000356825.4_Nonsense_Mutation_p.S434*|SMAD2_ENST00000262160.6_Nonsense_Mutation_p.S464*	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	464	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)	p.S464*(4)|p.R462fs*>4(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						TGACATGCTTGAGCAACGCAC	0.423																																					p.S434X												.	.	5	Substitution - Nonsense(4)|Deletion - Frameshift(1)	large_intestine(4)|kidney(1)	c.C1301G	18						.						162.0	130.0	141.0					18																	45368211		2203	4300	6503	43622209	SO:0001587	stop_gained	4087	exon10			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.1391C>G	18.37:g.45368211G>C	ENSP00000384449:p.Ser464*	Somatic		Capture	Illumina HiSeq	Phase_I	43622209	NM_001135937		Nonsense_Mutation	SNP	ENST00000402690.2	37	CCDS11934.1	.	.	.	.	.	.	.	.	.	.	G	41	8.723736	0.98929	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0965	0.97849	0.0:0.0:1.0:0.0	.	.	.	.	X	464;434;464	.	ENSP00000262160:S464X	S	-	2	0	SMAD2	43622209	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.781000	0.99029	2.824000	0.97209	0.655000	0.94253	TCA		SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450571.1	NM_005901	
COL5A3	50509	broad.mit.edu	37	19	10088361	10088361	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr19:10088361C>T	ENST00000264828.3	-	42	3120	c.3035G>A	c.(3034-3036)cGc>cAc	p.R1012H		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1012	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.R1012H(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CAAAGGACCGCGCTCACCAGG	0.577																																					p.R1012H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3035A	19						.						23.0	23.0	23.0					19																	10088361		2203	4300	6503	9949361	SO:0001583	missense	50509	exon42			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3035G>A	19.37:g.10088361C>T	ENSP00000264828:p.Arg1012His	Somatic		Capture	Illumina HiSeq	Phase_I	9949361	NM_015719	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.279574	0.59758	.	.	ENSG00000080573	ENST00000264828	D	0.94232	-3.38	4.84	3.78	0.43462	.	0.000000	0.64402	D	0.000001	D	0.94162	0.8127	L	0.50919	1.6	0.49299	D	0.99977	D	0.76494	0.999	P	0.60609	0.877	D	0.93757	0.7063	10	0.52906	T	0.07	.	12.6821	0.56928	0.0:0.8326:0.1674:0.0	.	1012	P25940	CO5A3_HUMAN	H	1012	ENSP00000264828:R1012H	ENSP00000264828:R1012H	R	-	2	0	COL5A3	9949361	0.995000	0.38212	0.993000	0.49108	0.139000	0.21198	3.304000	0.51866	1.225000	0.43566	0.655000	0.94253	CGC		COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
NLRP8	126205	broad.mit.edu	37	19	56465952	56465954	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	CTT	CTT	CTT	-	CTT	CTT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr19:56465952_56465954delCTT	ENST00000291971.3	+	3	599_601	c.528_530delCTT	c.(526-531)gacttc>gac	p.F178del	NLRP8_ENST00000590542.1_In_Frame_Del_p.F178del	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	178					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.F178delF(1)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		ACCAGAGGGACTTCTTCTACCAA	0.483																																					p.176_177del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.528_530del	19						.																																			61157766	SO:0001651	inframe_deletion	126205	exon3			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.528_530delCTT	19.37:g.56465955_56465957delCTT	ENSP00000291971:p.Phe178del	Somatic		Capture	Illumina HiSeq	Phase_I	61157764	NM_176811	Q7RTR4	In_Frame_Del	DEL	ENST00000291971.3	37	CCDS12937.1																																																																																				NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
ZNF417	147687	broad.mit.edu	37	19	58420313	58420313	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr19:58420313A>T	ENST00000312026.5	-	3	1497	c.1333T>A	c.(1333-1335)Ttt>Att	p.F445I	ZNF417_ENST00000595559.1_Missense_Mutation_p.F444I|ZNF417_ENST00000536263.1_Missense_Mutation_p.F246I|CTD-2583A14.9_ENST00000602124.1_Intron	NM_152475.2	NP_689688.2	Q8TAU3	ZN417_HUMAN	zinc finger protein 417	445					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F445I(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|stomach(3)|upper_aerodigestive_tract(1)	18		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0151)		TTCCTGTTAAATAATTTCCCA	0.418																																					p.F445I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1333A	19						.						150.0	125.0	134.0					19																	58420313		2203	4300	6503	63112125	SO:0001583	missense	147687	exon3			BC025783	CCDS12965.1, CCDS74469.1	19q13.43	2013-01-08				ENSG00000173480		"""Zinc fingers, C2H2-type"", ""-"""	20646	protein-coding gene	gene with protein product							Standard	NM_152475		Approved	MGC34079	uc002qqq.3	Q8TAU3		ENST00000312026.5:c.1333T>A	19.37:g.58420313A>T	ENSP00000311319:p.Phe445Ile	Somatic		Capture	Illumina HiSeq	Phase_I	63112125	NM_152475	B4DEU1	Missense_Mutation	SNP	ENST00000312026.5	37	CCDS12965.1	.	.	.	.	.	.	.	.	.	.	.	21.8	4.203247	0.79127	.	.	ENSG00000173480	ENST00000312026;ENST00000536263	T;T	0.46451	0.87;0.87	2.21	2.21	0.28008	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.71796	0.3382	H	0.95850	3.73	0.31548	N	0.659058	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.74942	-0.3492	9	0.87932	D	0	.	9.1714	0.37083	1.0:0.0:0.0:0.0	.	445;445	F5H0M9;Q8TAU3	.;ZN417_HUMAN	I	445;246	ENSP00000311319:F445I;ENSP00000442760:F246I	ENSP00000311319:F445I	F	-	1	0	ZNF417	63112125	1.000000	0.71417	0.061000	0.19648	0.427000	0.31564	5.742000	0.68646	1.025000	0.39708	0.254000	0.18369	TTT		ZNF417-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466860.1	NM_152475	
OLFM3	118427	broad.mit.edu	37	1	102270324	102270324	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr1:102270324A>T	ENST00000338858.5	-	6	906	c.907T>A	c.(907-909)Tat>Aat	p.Y303N	OLFM3_ENST00000462354.1_5'UTR|OLFM3_ENST00000370103.4_Missense_Mutation_p.Y283N|OLFM3_ENST00000536598.1_3'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3	303	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)		p.Y283N(1)|p.Y303N(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		TTGTTAAAATAGAGTGAGCCA	0.413																																					p.Y283N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T847A	1						.						95.0	93.0	94.0					1																	102270324		2203	4300	6503	102042912	SO:0001583	missense	118427	exon6			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.907T>A	1.37:g.102270324A>T	ENSP00000345192:p.Tyr303Asn	Somatic		Capture	Illumina HiSeq	Phase_I	102042912	NM_058170	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	ENST00000338858.5	37		.	.	.	.	.	.	.	.	.	.	A	19.62	3.862586	0.71949	.	.	ENSG00000118733	ENST00000424771;ENST00000370103;ENST00000338858	D;D	0.94457	-3.43;-3.43	5.35	5.35	0.76521	Olfactomedin-like (3);	0.057026	0.64402	D	0.000001	D	0.97604	0.9215	M	0.92367	3.3	0.80722	D	1	D;P	0.89917	1.0;0.956	D;P	0.81914	0.995;0.761	D	0.98755	1.0722	10	0.87932	D	0	.	15.3288	0.74190	1.0:0.0:0.0:0.0	.	283;303	Q5T3V6;Q96PB7	.;NOE3_HUMAN	N	154;283;303	ENSP00000359121:Y283N;ENSP00000345192:Y303N	ENSP00000345192:Y303N	Y	-	1	0	OLFM3	102042912	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.031000	0.59945	0.528000	0.53228	TAT		OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1		
NRAS	4893	broad.mit.edu	37	1	115258745	115258745	+	Missense_Mutation	SNP	C	C	G	rs121434595		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr1:115258745C>G	ENST00000369535.4	-	2	290	c.37G>C	c.(37-39)Ggt>Cgt	p.G13R	CSDE1_ENST00000483407.1_5'Flank	NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	13			G -> D (in ALPS4). {ECO:0000269|PubMed:17517660}.|G -> R (in CMNS and colorectal cancer; somatic mutation). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:3102434}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G13R(76)|p.G13C(23)|p.G13S(5)|p.G13N(1)|p.G13Y(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCCCAACACCACCTGCTCCA	0.498	G13R(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.G13R			Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,-2 	.	106	Substitution - Missense(106)	haematopoietic_and_lymphoid_tissue(66)|skin(24)|large_intestine(6)|stomach(4)|thyroid(2)|soft_tissue(1)|urinary_tract(1)|autonomic_ganglia(1)|NS(1)	c.G37C	1						.						207.0	184.0	192.0					1																	115258745		2203	4300	6503	115060268	SO:0001583	missense	4893	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.37G>C	1.37:g.115258745C>G	ENSP00000358548:p.Gly13Arg	Somatic		Capture	Illumina HiSeq	Phase_I	115060268	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	C	36	5.675403	0.96764	.	.	ENSG00000213281	ENST00000369535	T	0.73575	-0.76	5.58	5.58	0.84498	Small GTP-binding protein domain (1);	0.000000	0.56097	U	0.000022	D	0.85204	0.5643	M	0.77103	2.36	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	D	0.85665	0.1291	10	0.87932	D	0	.	19.3769	0.94514	0.0:1.0:0.0:0.0	.	13	P01111	RASN_HUMAN	R	13	ENSP00000358548:G13R	ENSP00000358548:G13R	G	-	1	0	NRAS	115060268	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.906000	0.99361	0.655000	0.94253	GGT		NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
SCNM1	79005	broad.mit.edu	37	1	151139646	151139646	+	Silent	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr1:151139646G>A	ENST00000368905.4	+	4	372	c.261G>A	c.(259-261)caG>caA	p.Q87Q	SCNM1_ENST00000461862.1_3'UTR|LYSMD1_ENST00000440902.2_5'Flank|LYSMD1_ENST00000368908.5_5'Flank	NM_001204856.1|NM_024041.3	NP_001191785.1|NP_076946.1	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1	87					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)	p.Q87Q(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AAAGAAAGCAGAATCCAAAAC	0.463																																					p.Q87Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G261A	1						.						152.0	155.0	154.0					1																	151139646		2203	4300	6503	149406270	SO:0001819	synonymous_variant	79005	exon4			BC000264	CCDS987.1, CCDS55636.1	1q21.3	2012-03-13			ENSG00000163156	ENSG00000163156			23136	protein-coding gene	gene with protein product		608095				12920299	Standard	NM_024041		Approved	MGC3180	uc001ewz.3	Q9BWG6	OTTHUMG00000012258	ENST00000368905.4:c.261G>A	1.37:g.151139646G>A		Somatic		Capture	Illumina HiSeq	Phase_I	149406270	NM_024041	B4DWR1|Q5JR74	Silent	SNP	ENST00000368905.4	37	CCDS987.1																																																																																				SCNM1-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034064.2	NM_024041	
FLG	2312	broad.mit.edu	37	1	152285044	152285044	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr1:152285044T>C	ENST00000368799.1	-	3	2353	c.2318A>G	c.(2317-2319)cAg>cGg	p.Q773R	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	773	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.Q773R(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGGTGGCTCTGCTGATGGTG	0.567									Ichthyosis																												p.Q773R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2318G	1						.						342.0	325.0	331.0					1																	152285044		2203	4300	6503	150551668	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2318A>G	1.37:g.152285044T>C	ENSP00000357789:p.Gln773Arg	Somatic		Capture	Illumina HiSeq	Phase_I	150551668	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	3.629	-0.076007	0.07184	.	.	ENSG00000143631	ENST00000368799	T	0.00760	5.73	2.08	1.09	0.20402	.	.	.	.	.	T	0.00210	0.0006	L	0.37466	1.105	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35475	-0.9787	9	0.11182	T	0.66	.	4.325	0.11036	0.0:0.7671:0.0:0.2329	.	773	P20930	FILA_HUMAN	R	773	ENSP00000357789:Q773R	ENSP00000357789:Q773R	Q	-	2	0	FLG	150551668	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.366000	0.02585	0.190000	0.20209	-0.435000	0.05868	CAG		FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
UHMK1	127933	broad.mit.edu	37	1	162492294	162492294	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr1:162492294C>T	ENST00000489294.1	+	8	1372	c.1214C>T	c.(1213-1215)cCg>cTg	p.P405L	UHMK1_ENST00000545294.1_Missense_Mutation_p.P331L|UHMK1_ENST00000282169.8_3'UTR|UHMK1_ENST00000538489.1_3'UTR	NM_175866.4	NP_787062.1	Q8TAS1	UHMK1_HUMAN	U2AF homology motif (UHM) kinase 1	405	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176, ECO:0000305}.				cell cycle arrest (GO:0007050)|neuron projection development (GO:0031175)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of translational initiation (GO:0045948)|protein autophosphorylation (GO:0046777)|regulation of protein export from nucleus (GO:0046825)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|neuronal ribonucleoprotein granule (GO:0071598)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)|transferase activity (GO:0016740)	p.P405L(1)		endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	11	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			ACATTCTACCCGCTGAGTGCC	0.423																																					p.P405L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1214T	1						.						158.0	156.0	156.0					1																	162492294		2203	4300	6503	160758918	SO:0001583	missense	127933	exon8			BC026046	CCDS1239.1, CCDS53423.1, CCDS53424.1	1q23.1	2013-02-12			ENSG00000152332	ENSG00000152332		"""RNA binding motif (RRM) containing"""	19683	protein-coding gene	gene with protein product		608849				12093740, 12782393	Standard	NM_175866		Approved	KIS, Kist	uc001gcc.2	Q8TAS1	OTTHUMG00000031373	ENST00000489294.1:c.1214C>T	1.37:g.162492294C>T	ENSP00000420270:p.Pro405Leu	Somatic		Capture	Illumina HiSeq	Phase_I	160758918	NM_175866	A8K8K4|G3V1M1|Q96C22	Missense_Mutation	SNP	ENST00000489294.1	37	CCDS1239.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490344	0.84962	.	.	ENSG00000152332	ENST00000545294;ENST00000489294	T;T	0.77358	-0.24;-1.09	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.88540	0.6464	M	0.88775	2.98	.	.	.	D;D	0.89917	1.0;1.0	D;D	0.87578	0.982;0.998	D	0.89881	0.4030	9	0.87932	D	0	-6.8932	15.9723	0.80031	0.0:1.0:0.0:0.0	.	405;331	Q8TAS1;G3V1M1	UHMK1_HUMAN;.	L	331;405	ENSP00000441226:P331L;ENSP00000420270:P405L	ENSP00000420270:P405L	P	+	2	0	UHMK1	160758918	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.856000	0.75450	2.788000	0.95919	0.650000	0.86243	CCG		UHMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076788.1	NM_175866	
HMCN1	83872	broad.mit.edu	37	1	186113372	186113372	+	Missense_Mutation	SNP	G	G	T	rs551261120		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr1:186113372G>T	ENST00000271588.4	+	90	14221	c.13992G>T	c.(13990-13992)caG>caT	p.Q4664H	HMCN1_ENST00000367492.2_Missense_Mutation_p.Q4664H	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4664	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.Q4664H(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AAGGTACTCAGACAAGAGCAA	0.483																																					p.Q4664H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G13992T	1						.						152.0	153.0	153.0					1																	186113372		2203	4300	6503	184379995	SO:0001583	missense	83872	exon90			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.13992G>T	1.37:g.186113372G>T	ENSP00000271588:p.Gln4664His	Somatic		Capture	Illumina HiSeq	Phase_I	184379995	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	8.600	0.886678	0.17540	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.57752	0.38;0.38	5.42	2.49	0.30216	.	0.050772	0.85682	D	0.000000	T	0.40979	0.1139	L	0.46947	1.48	0.48236	D	0.999613	B	0.25955	0.138	B	0.22880	0.042	T	0.21245	-1.0251	10	0.49607	T	0.09	.	6.8186	0.23845	0.2181:0.126:0.6559:0.0	.	4664	Q96RW7	HMCN1_HUMAN	H	4664	ENSP00000271588:Q4664H;ENSP00000356462:Q4664H	ENSP00000271588:Q4664H	Q	+	3	2	HMCN1	184379995	1.000000	0.71417	0.657000	0.29651	0.049000	0.14656	2.896000	0.48656	0.339000	0.23719	0.650000	0.86243	CAG		HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
ATP2B4	493	broad.mit.edu	37	1	203680013	203680013	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr1:203680013G>A	ENST00000357681.5	+	12	2931	c.1808G>A	c.(1807-1809)cGa>cAa	p.R603Q	ATP2B4_ENST00000391954.2_Missense_Mutation_p.R603Q|ATP2B4_ENST00000367219.3_Missense_Mutation_p.R591Q|ATP2B4_ENST00000341360.2_Missense_Mutation_p.R603Q|ATP2B4_ENST00000367218.3_Missense_Mutation_p.R603Q	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	603					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)	p.R603Q(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			AGGTGTAATCGAATCCTGGAC	0.493																																					p.R603Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1808A	1						.						56.0	45.0	49.0					1																	203680013		2203	4300	6503	201946636	SO:0001583	missense	493	exon12			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.1808G>A	1.37:g.203680013G>A	ENSP00000350310:p.Arg603Gln	Somatic		Capture	Illumina HiSeq	Phase_I	201946636	NM_001001396	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	ENST00000357681.5	37	CCDS1440.1	.	.	.	.	.	.	.	.	.	.	G	16.56	3.158740	0.57368	.	.	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360	T;T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48;-0.48	5.33	1.34	0.21922	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.808617	0.10582	N	0.657826	T	0.70439	0.3224	N	0.25245	0.725	0.09310	N	1	D;B;D	0.76494	0.988;0.129;0.999	P;B;D	0.70487	0.584;0.018;0.969	T	0.59521	-0.7439	10	0.29301	T	0.29	-2.6445	9.2804	0.37725	0.423:0.0:0.577:0.0	.	603;603;603	P23634;P23634-6;B1APW5	AT2B4_HUMAN;.;.	Q	603;603;591;603;603	ENSP00000350310:R603Q;ENSP00000356187:R603Q;ENSP00000356188:R591Q;ENSP00000375816:R603Q;ENSP00000340930:R603Q	ENSP00000340930:R603Q	R	+	2	0	ATP2B4	201946636	0.000000	0.05858	0.888000	0.34837	0.864000	0.49448	1.034000	0.30204	0.331000	0.23511	0.637000	0.83480	CGA		ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087462.1	NM_001001396	
USH2A	7399	broad.mit.edu	37	1	215916601	215916601	+	Silent	SNP	G	G	A	rs144655434		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr1:215916601G>A	ENST00000307340.3	-	59	11852	c.11466C>T	c.(11464-11466)tcC>tcT	p.S3822S	USH2A_ENST00000366943.2_Silent_p.S3822S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3822	Fibronectin type-III 23. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.S3822S(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GATGACCAACGGAGAAGGCCA	0.428										HNSCC(13;0.011)																											p.S3822S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C11466T	1						.	G		1,4405	2.1+/-5.4	0,1,2202	144.0	137.0	139.0		11466	-7.6	0.0	1	dbSNP_134	139	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	USH2A	NM_206933.2		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		3822/5203	215916601	2,13004	2203	4300	6503	213983224	SO:0001819	synonymous_variant	7399	exon59			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11466C>T	1.37:g.215916601G>A		Somatic		Capture	Illumina HiSeq	Phase_I	213983224	NM_206933	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																				USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
MARK1	4139	broad.mit.edu	37	1	220826508	220826508	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr1:220826508G>A	ENST00000366917.4	+	16	2068	c.1802G>A	c.(1801-1803)cGg>cAg	p.R601Q	MARK1_ENST00000366918.4_Missense_Mutation_p.R579Q|MARK1_ENST00000402574.1_Missense_Mutation_p.R466Q					MAP/microtubule affinity-regulating kinase 1									p.R601Q(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		ACTCCAGACCGGACCCGTTTT	0.527																																					p.R601Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1802A	1						.						82.0	70.0	74.0					1																	220826508		2203	4300	6503	218893131	SO:0001583	missense	4139	exon16			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1802G>A	1.37:g.220826508G>A	ENSP00000355884:p.Arg601Gln	Somatic		Capture	Illumina HiSeq	Phase_I	218893131	NM_018650		Missense_Mutation	SNP	ENST00000366917.4	37	CCDS31029.2	.	.	.	.	.	.	.	.	.	.	G	18.40	3.616319	0.66672	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.37411	1.2;1.2;1.2	4.94	4.01	0.46588	.	0.229978	0.37348	N	0.002131	T	0.32164	0.0820	M	0.69358	2.11	0.34106	D	0.662387	B;P;P;P	0.40360	0.188;0.556;0.714;0.533	B;B;B;B	0.31614	0.01;0.091;0.133;0.063	T	0.53258	-0.8464	10	0.31617	T	0.26	.	13.6142	0.62097	0.0772:0.0:0.9228:0.0	.	601;466;601;579	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	Q	466;579;601	ENSP00000386017:R466Q;ENSP00000355885:R579Q;ENSP00000355884:R601Q	ENSP00000355884:R601Q	R	+	2	0	MARK1	218893131	1.000000	0.71417	0.961000	0.40146	0.961000	0.63080	7.567000	0.82357	2.267000	0.75376	0.462000	0.41574	CGG		MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090899.1		
PUM1	9698	broad.mit.edu	37	1	31437645	31437645	+	Silent	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr1:31437645G>A	ENST00000257075.5	-	14	2292	c.2199C>T	c.(2197-2199)aaC>aaT	p.N733N	PUM1_ENST00000440538.2_Silent_p.N707N|PUM1_ENST00000373747.3_Silent_p.N734N|PUM1_ENST00000423018.2_Silent_p.N589N|PUM1_ENST00000490546.1_5'Flank|PUM1_ENST00000424085.2_Silent_p.N491N|PUM1_ENST00000373742.2_Silent_p.N674N|PUM1_ENST00000426105.2_Silent_p.N733N|PUM1_ENST00000373741.4_Silent_p.N769N	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	733	Ser-rich.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)	p.N733N(1)		breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		AGCTAAGGCCGTTATAAAAAC	0.557																																					p.N733N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2199T	1						.						154.0	145.0	148.0					1																	31437645		2203	4300	6503	31210232	SO:0001819	synonymous_variant	9698	exon14			AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.2199C>T	1.37:g.31437645G>A		Somatic		Capture	Illumina HiSeq	Phase_I	31210232	NM_001020658	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Silent	SNP	ENST00000257075.5	37	CCDS338.1	.	.	.	.	.	.	.	.	.	.	G	4.251	0.045618	0.08196	.	.	ENSG00000134644	ENST00000498419	.	.	.	5.54	4.43	0.53597	.	.	.	.	.	T	0.62073	0.2398	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58730	-0.7585	4	.	.	.	-4.9807	11.4279	0.50022	0.1966:0.0:0.8034:0.0	.	.	.	.	W	445	.	.	R	-	1	2	PUM1	31210232	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.030000	0.30153	2.619000	0.88677	0.655000	0.94253	CGG		PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1		
NUP133	55746	broad.mit.edu	37	1	229633912	229633912	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr1:229633912C>A	ENST00000261396.3	-	6	881	c.790G>T	c.(790-792)Gga>Tga	p.G264*	NUP133_ENST00000537506.1_Nonsense_Mutation_p.G248*	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	264					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.G264*(1)		NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				GATAAAATTCCAAAAAGAGAA	0.358																																					p.G264X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G790T	1						.						53.0	55.0	54.0					1																	229633912		2203	4300	6503	227700535	SO:0001587	stop_gained	55746	exon6				CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.790G>T	1.37:g.229633912C>A	ENSP00000261396:p.Gly264*	Somatic		Capture	Illumina HiSeq	Phase_I	227700535	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Nonsense_Mutation	SNP	ENST00000261396.3	37	CCDS1579.1	.	.	.	.	.	.	.	.	.	.	C	38	6.735255	0.97801	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	.	.	.	5.71	4.8	0.61643	.	0.046657	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-8.2857	16.7811	0.85563	0.0:0.871:0.129:0.0	.	.	.	.	X	264;264;264;248	.	ENSP00000261396:G264X	G	-	1	0	NUP133	227700535	1.000000	0.71417	0.970000	0.41538	0.904000	0.53231	6.318000	0.72866	1.404000	0.46819	0.650000	0.86243	GGA		NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
PAK7	57144	broad.mit.edu	37	20	9520203	9520203	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr20:9520203G>A	ENST00000378429.3	-	11	2612	c.2066C>T	c.(2065-2067)gCa>gTa	p.A689V	PAK7_ENST00000378423.1_Missense_Mutation_p.A689V|PAK7_ENST00000353224.5_Missense_Mutation_p.A689V	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	689	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A689V(1)		NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			CTGGGCTGTTGCTCTCTGAGA	0.507																																					p.A689V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2066T	20						.						222.0	205.0	210.0					20																	9520203		2203	4300	6503	9468203	SO:0001583	missense	57144	exon10			AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.2066C>T	20.37:g.9520203G>A	ENSP00000367686:p.Ala689Val	Somatic		Capture	Illumina HiSeq	Phase_I	9468203	NM_177990	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	37	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.757802	0.89843	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.64991	-0.13;-0.13;-0.13	5.48	3.44	0.39384	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.046779	0.85682	D	0.000000	T	0.70894	0.3276	L	0.58669	1.825	0.80722	D	1	D;P	0.56035	0.974;0.857	P;P	0.62435	0.902;0.686	T	0.69921	-0.5014	9	.	.	.	.	12.7095	0.57082	0.0:0.2103:0.6759:0.1138	.	689;689	B0AZM9;Q9P286	.;PAK7_HUMAN	V	689;689;689;550	ENSP00000367686:A689V;ENSP00000322957:A689V;ENSP00000367679:A689V	.	A	-	2	0	PAK7	9468203	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.569000	0.67391	2.597000	0.87782	0.655000	0.94253	GCA		PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1		
ZNF335	63925	broad.mit.edu	37	20	44592509	44592510	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	CT	CT					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr20:44592509_44592510CT>AA	ENST00000322927.2	-	8	1322_1323	c.1222_1223AG>TT	c.(1222-1224)AGg>TTg	p.R408L	ZNF335_ENST00000494955.1_5'Flank|ZNF335_ENST00000426788.1_Missense_Mutation_p.R253L	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	408					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)	p.R408>?(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				CACAGGGGTCCTGCTCACCTTG	0.653																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1222_1223TT	20						.																																			44025917	SO:0001583	missense	63925	exon8			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.1222_1223delinsAA	20.37:g.44592509_44592510delinsAA	ENSP00000325326:p.Arg408Leu	Somatic		Capture	Illumina HiSeq	Phase_I	44025916	NM_022095	B4DLG7|Q548D0|Q9H684	Missense_Mutation	DNP	ENST00000322927.2	37	CCDS13389.1																																																																																				ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
KRTAP11-1	337880	broad.mit.edu	37	21	32253642	32253642	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr21:32253642G>T	ENST00000332378.4	-	1	232	c.202C>A	c.(202-204)Cca>Aca	p.P68T		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	68						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.P68T(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						TAACAGGTTGGCTGGCAAGCA	0.557																																					p.P68T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C202A	21						.						79.0	73.0	75.0					21																	32253642		2203	4300	6503	31175513	SO:0001583	missense	337880	exon1			AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.202C>A	21.37:g.32253642G>T	ENSP00000330720:p.Pro68Thr	Somatic		Capture	Illumina HiSeq	Phase_I	31175513	NM_175858	A1L4I8	Missense_Mutation	SNP	ENST00000332378.4	37	CCDS13608.1	.	.	.	.	.	.	.	.	.	.	G	11.73	1.726002	0.30593	.	.	ENSG00000182591	ENST00000332378	T	0.02890	4.12	5.4	4.52	0.55395	.	0.393126	0.25514	N	0.030146	T	0.04452	0.0122	L	0.35644	1.08	0.32395	N	0.552697	P	0.48640	0.913	P	0.52109	0.69	T	0.32322	-0.9911	10	0.16420	T	0.52	-1.6373	7.4254	0.27096	0.0851:0.0:0.7499:0.165	.	68	Q8IUC1	KR111_HUMAN	T	68	ENSP00000330720:P68T	ENSP00000330720:P68T	P	-	1	0	KRTAP11-1	31175513	1.000000	0.71417	0.986000	0.45419	0.986000	0.74619	2.864000	0.48404	1.446000	0.47643	0.650000	0.86243	CCA		KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128225.1		
MFSD9	84804	broad.mit.edu	37	2	103335183	103335183	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr2:103335183A>T	ENST00000258436.5	-	6	1164	c.1121T>A	c.(1120-1122)aTg>aAg	p.M374K	MFSD9_ENST00000496253.1_5'Flank	NM_032718.3	NP_116107.3	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing 9	374					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.M374K(1)		breast(3)|large_intestine(7)|liver(1)|lung(6)|ovary(2)|skin(1)	20						AACTGCACCCATGGTGGGGGC	0.612																																					p.M374K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1121A	2						.						44.0	44.0	44.0					2																	103335183		2203	4300	6503	102701615	SO:0001583	missense	84804	exon6				CCDS2063.1	2q12.1	2007-01-12			ENSG00000135953	ENSG00000135953			28158	protein-coding gene	gene with protein product							Standard	NM_032718		Approved	MGC11332	uc002tcb.2	Q8NBP5	OTTHUMG00000130781	ENST00000258436.5:c.1121T>A	2.37:g.103335183A>T	ENSP00000258436:p.Met374Lys	Somatic		Capture	Illumina HiSeq	Phase_I	102701615	NM_032718	Q4ZG89|Q53TU0|Q96GQ4|Q9BRI8	Missense_Mutation	SNP	ENST00000258436.5	37	CCDS2063.1	.	.	.	.	.	.	.	.	.	.	A	9.501	1.103117	0.20632	.	.	ENSG00000135953	ENST00000258436	T	0.80653	-1.4	5.18	5.18	0.71444	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.659579	0.16930	N	0.193740	T	0.72120	0.3421	L	0.29908	0.895	0.22017	N	0.999411	B	0.06786	0.001	B	0.12837	0.008	T	0.58999	-0.7536	10	0.29301	T	0.29	-12.0359	15.3477	0.74355	1.0:0.0:0.0:0.0	.	374	Q8NBP5	MFSD9_HUMAN	K	374	ENSP00000258436:M374K	ENSP00000258436:M374K	M	-	2	0	MFSD9	102701615	0.837000	0.29446	0.030000	0.17652	0.004000	0.04260	6.878000	0.75567	2.081000	0.62600	0.529000	0.55759	ATG		MFSD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253295.2	NM_032718	
SNRNP27	11017	broad.mit.edu	37	2	70124523	70124523	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr2:70124523G>A	ENST00000244227.3	+	4	708	c.283G>A	c.(283-285)Ggc>Agc	p.G95S	SNRNP27_ENST00000409116.1_Missense_Mutation_p.G95S|SNRNP27_ENST00000488986.1_3'UTR	NM_006857.2	NP_006848.1	Q8WVK2	SNR27_HUMAN	small nuclear ribonucleoprotein 27kDa (U4/U6.U5)	95					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.G95S(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	11						AGACTTAGAGGGCAAAACAGA	0.318																																					p.G95S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G283A	2						.						97.0	106.0	103.0					2																	70124523		2203	4300	6503	69978027	SO:0001583	missense	11017	exon4			X76302	CCDS33219.1	2p14	2011-10-11			ENSG00000124380	ENSG00000124380			30240	protein-coding gene	gene with protein product	"""nucleic acid binding protein RY 1"""					7931148	Standard	NM_006857		Approved	RY1	uc002sfw.3	Q8WVK2	OTTHUMG00000152689	ENST00000244227.3:c.283G>A	2.37:g.70124523G>A	ENSP00000244227:p.Gly95Ser	Somatic		Capture	Illumina HiSeq	Phase_I	69978027	NM_006857	Q15410	Missense_Mutation	SNP	ENST00000244227.3	37	CCDS33219.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.690337	0.88735	.	.	ENSG00000124380	ENST00000244227;ENST00000409116	T;T	0.34472	1.36;1.36	5.4	5.4	0.78164	Domain of unknown function DUF1777 (1);	0.000000	0.85682	D	0.000000	T	0.56247	0.1972	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	T	0.46541	-0.9184	10	0.33141	T	0.24	.	16.7131	0.85391	0.0:0.0:1.0:0.0	.	95;95	B8ZZ98;Q8WVK2	.;SNR27_HUMAN	S	95	ENSP00000244227:G95S;ENSP00000386608:G95S	ENSP00000244227:G95S	G	+	1	0	SNRNP27	69978027	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.872000	0.87187	2.810000	0.96702	0.585000	0.79938	GGC		SNRNP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327369.1	NM_006857	
ADD2	119	broad.mit.edu	37	2	70903946	70903946	+	Silent	SNP	G	G	A	rs201133279		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr2:70903946G>A	ENST00000264436.4	-	13	2019	c.1575C>T	c.(1573-1575)gcC>gcT	p.A525A	ADD2_ENST00000430656.1_Silent_p.A541A|ADD2_ENST00000355733.3_Silent_p.A525A|ADD2_ENST00000407644.2_Silent_p.A525A|ADD2_ENST00000413157.2_Silent_p.A525A	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	525					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)	p.A525A(4)|p.A541A(1)		autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						GGCTCTTCTCGGCAATGACGC	0.607																																					p.A525A												.	.	5	Substitution - coding silent(5)	lung(3)|large_intestine(2)	c.C1575T	2						.						63.0	65.0	65.0					2																	70903946		2203	4300	6503	70757454	SO:0001819	synonymous_variant	119	exon13			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1575C>T	2.37:g.70903946G>A		Somatic		Capture	Illumina HiSeq	Phase_I	70757454	NM_001185054	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Silent	SNP	ENST00000264436.4	37	CCDS1906.1																																																																																				ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
RBM43	375287	broad.mit.edu	37	2	152108058	152108058	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr2:152108058G>A	ENST00000331426.5	-	4	587	c.436C>T	c.(436-438)Ccc>Tcc	p.P146S		NM_198557.2	NP_940959.1	Q6ZSC3	RBM43_HUMAN	RNA binding motif protein 43	146							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.P146S(1)		endometrium(2)|large_intestine(3)|lung(2)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.131)		CTTCCATTGGGTTTCAAAGGA	0.388																																					p.P146S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C436T	2						.						108.0	116.0	113.0					2																	152108058		2203	4299	6502	151816304	SO:0001583	missense	375287	exon4			AK127552	CCDS2191.1	2q23.3	2007-01-30	2007-01-30	2007-01-30	ENSG00000184898	ENSG00000184898		"""RNA binding motif (RRM) containing"""	24790	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 38"""	C2orf38			Standard	NM_198557		Approved	FLJ45645	uc002txh.3	Q6ZSC3	OTTHUMG00000131866	ENST00000331426.5:c.436C>T	2.37:g.152108058G>A	ENSP00000331211:p.Pro146Ser	Somatic		Capture	Illumina HiSeq	Phase_I	151816304	NM_198557	B2RMT5	Missense_Mutation	SNP	ENST00000331426.5	37	CCDS2191.1	.	.	.	.	.	.	.	.	.	.	G	0.534	-0.856708	0.02630	.	.	ENSG00000184898	ENST00000331426	T	0.59772	0.24	5.48	-2.43	0.06522	.	1.118960	0.06573	N	0.748880	T	0.29524	0.0736	N	0.12746	0.255	0.09310	N	1	B	0.24823	0.112	B	0.20955	0.032	T	0.12553	-1.0543	10	0.13470	T	0.59	4.9412	1.7804	0.03030	0.3306:0.2132:0.3472:0.109	.	146	Q6ZSC3	RBM43_HUMAN	S	146	ENSP00000331211:P146S	ENSP00000331211:P146S	P	-	1	0	RBM43	151816304	0.000000	0.05858	0.000000	0.03702	0.437000	0.31866	-0.875000	0.04205	-0.310000	0.08766	-0.119000	0.15052	CCC		RBM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254816.2	NM_198557	
GRIP2	80852	broad.mit.edu	37	3	14561996	14561996	+	RNA	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr3:14561996G>A	ENST00000273083.3	-	0	826							Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)		p.T254M(1)		endometrium(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	25						AGACCCTGGCGTCTTGACTAT	0.547																																					p.T351M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1052T	3						.						68.0	76.0	73.0					3																	14561996		2074	4217	6291	14537000			80852	exon9			AB051506		3p24-p23	2012-02-08			ENSG00000144596	ENSG00000144596			23841	protein-coding gene	gene with protein product							Standard	NM_001080423		Approved	KIAA1719	uc021wtn.1	Q9C0E4	OTTHUMG00000155544		3.37:g.14561996G>A		Somatic		Capture	Illumina HiSeq	Phase_I	14537000	NM_001080423	Q8TEH9|Q9H7H3	De_novo_Start_OutOfFrame	SNP	ENST00000273083.3	37																																																																																					GRIP2-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000340582.2	NM_001080423	
TMEM39A	55254	broad.mit.edu	37	3	119153648	119153648	+	Silent	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr3:119153648G>A	ENST00000319172.5	-	8	1614	c.1194C>T	c.(1192-1194)aaC>aaT	p.N398N		NM_018266.1	NP_060736.1	Q9NV64	TM39A_HUMAN	transmembrane protein 39A	398						integral component of membrane (GO:0016021)		p.N398N(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	13				GBM - Glioblastoma multiforme(114;0.244)		GCACTGCCACGTTGTAAGGCC	0.458																																					p.N398N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1194T	3						.						127.0	120.0	123.0					3																	119153648		2203	4300	6503	120636338	SO:0001819	synonymous_variant	55254	exon8			BC021277	CCDS2987.1	3q13.33	2005-01-10			ENSG00000176142	ENSG00000176142			25600	protein-coding gene	gene with protein product						12477932	Standard	NM_018266		Approved	FLJ10902	uc003eck.2	Q9NV64	OTTHUMG00000159361	ENST00000319172.5:c.1194C>T	3.37:g.119153648G>A		Somatic		Capture	Illumina HiSeq	Phase_I	120636338	NM_018266	D3DN80|Q53FN4|Q53GI1|Q6PKB5	Silent	SNP	ENST00000319172.5	37	CCDS2987.1																																																																																				TMEM39A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354941.3	NM_018266	
SLC7A14	57709	broad.mit.edu	37	3	170219133	170219133	+	Splice_Site	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr3:170219133G>A	ENST00000231706.5	-	3	621	c.306C>T	c.(304-306)ggC>ggT	p.G102G	CLDN11_ENST00000451576.1_Intron|CLDN11_ENST00000486975.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	102					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)	p.G102G(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			CATAGCAGACGCCTGCAAGGG	0.488																																					p.G102G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C306T	3						.						51.0	51.0	51.0					3																	170219133		2203	4300	6503	171701827	SO:0001630	splice_region_variant	57709	exon3			BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.305-1C>T	3.37:g.170219133G>A		Somatic		Capture	Illumina HiSeq	Phase_I	171701827	NM_020949	B3KV33|Q9HCF9	Silent	SNP	ENST00000231706.5	37	CCDS33892.1																																																																																				SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949	Silent
TBCCD1	55171	broad.mit.edu	37	3	186274244	186274244	+	Silent	SNP	T	T	G			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr3:186274244T>G	ENST00000424280.1	-	4	1292	c.813A>C	c.(811-813)acA>acC	p.T271T	TBCCD1_ENST00000479590.1_5'Flank|TBCCD1_ENST00000338733.5_Silent_p.T271T|TBCCD1_ENST00000446782.1_Silent_p.T175T	NM_001134415.1	NP_001127887.1	Q9NVR7	TBCC1_HUMAN	TBCC domain containing 1	271					cell morphogenesis (GO:0000902)|cytoskeleton organization (GO:0007010)|maintenance of centrosome location (GO:0051661)|maintenance of Golgi location (GO:0051684)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|spindle pole centrosome (GO:0031616)		p.T271T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|skin(1)	17	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)		GGCAAGCTGATGTACCAAATG	0.378																																					p.T271T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A813C	3						.						52.0	54.0	53.0					3																	186274244		2203	4300	6503	187756938	SO:0001819	synonymous_variant	55171	exon4			BC025748	CCDS3276.1, CCDS75061.1	3q27.3	2006-03-09			ENSG00000113838	ENSG00000113838			25546	protein-coding gene	gene with protein product						12477932	Standard	NM_001134415		Approved	FLJ10560	uc003fqg.3	Q9NVR7	OTTHUMG00000156613	ENST00000424280.1:c.813A>C	3.37:g.186274244T>G		Somatic		Capture	Illumina HiSeq	Phase_I	187756938	NM_001134415	B3KW69|D3DNU6|G5E9J4	Silent	SNP	ENST00000424280.1	37	CCDS3276.1																																																																																				TBCCD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344774.1	NM_018138	
CCR9	10803	broad.mit.edu	37	3	45942892	45942892	+	Silent	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr3:45942892C>T	ENST00000357632.2	+	3	792	c.612C>T	c.(610-612)agC>agT	p.S204S	Y_RNA_ENST00000364765.1_RNA|CCR9_ENST00000395963.2_Silent_p.S192S|CCR9_ENST00000355983.2_Silent_p.S192S|LZTFL1_ENST00000539217.1_Intron|LZTFL1_ENST00000536047.1_Intron|CCR9_ENST00000422395.1_3'UTR	NM_001256369.1|NM_031200.2	NP_001243298.1|NP_112477.1	P51686	CCR9_HUMAN	chemokine (C-C motif) receptor 9	204					cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)	p.S204S(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(2)|ovary(2)|prostate(2)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00118)|KIRC - Kidney renal clear cell carcinoma(197;0.0182)|Kidney(197;0.0214)		TTTACCCTAGCGATGAGAGCA	0.498																																					p.S192S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C576T	3						.						169.0	152.0	158.0					3																	45942892		2203	4300	6503	45917896	SO:0001819	synonymous_variant	10803	exon2			AJ132337	CCDS2732.1, CCDS2733.1	3p21.31	2012-09-20			ENSG00000173585	ENSG00000173585		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1610	protein-coding gene	gene with protein product		604738		GPR28		10229797	Standard	NM_006641		Approved	GPR-9-6, CDw199	uc003coz.2	P51686	OTTHUMG00000133450	ENST00000357632.2:c.612C>T	3.37:g.45942892C>T		Somatic		Capture	Illumina HiSeq	Phase_I	45917896	NM_006641	Q4VBM3|Q549E0|Q9UQQ6	Silent	SNP	ENST00000357632.2	37	CCDS2732.1																																																																																				CCR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257323.2		
MUC20	200958	broad.mit.edu	37	3	195453370	195453370	+	Silent	SNP	G	G	A	rs374691440	byFrequency	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr3:195453370G>A	ENST00000447234.2	+	2	2022	c.1896G>A	c.(1894-1896)gcG>gcA	p.A632A	MUC20_ENST00000436408.1_Silent_p.A632A|MUC20_ENST00000445522.2_Silent_p.A597A|MUC20_ENST00000320736.6_Silent_p.A461A	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	632	Involved in oligomerization.|Thr-rich.				activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)		p.A632A(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CAACCTCAGCGAAGACCACGA	0.612													g|||	7	0.00139776	0.0053	0.0	5008	,	,		27470	0.0		0.0	False		,,,				2504	0.0				p.A426A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1278A	3						.	G	,	9,4223		0,9,2107	99.0	113.0	108.0		1278,1383	-9.5	0.0	3		108	0,8478		0,0,4239	no	coding-synonymous,coding-synonymous	MUC20	NM_001098516.1,NM_152673.2	,	0,9,6346	AA,AG,GG		0.0,0.2127,0.0708	,	426/504,461/539	195453370	9,12701	2116	4239	6355	196939041	SO:0001819	synonymous_variant	200958	exon2			AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1896G>A	3.37:g.195453370G>A		Somatic		Capture	Illumina HiSeq	Phase_I	196939041	NM_001098516	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Silent	SNP	ENST00000447234.2	37		.	.	.	.	.	.	.	.	.	.	G	6.074	0.382031	0.11524	0.002127	0.0	ENSG00000176945	ENST00000423938	.	.	.	4.73	-9.46	0.00597	.	.	.	.	.	T	0.21509	0.0518	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.18398	-1.0338	4	.	.	.	-2.1954	5.7623	0.18207	0.2848:0.1066:0.5032:0.1053	.	.	.	.	K	44	.	.	E	+	1	0	MUC20	196939041	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-3.498000	0.00451	-1.754000	0.01321	-1.162000	0.01777	GAA		MUC20-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000341835.1	NM_152673	
EVC2	132884	broad.mit.edu	37	4	5564693	5564693	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr4:5564693T>C	ENST00000344408.5	-	22	3862	c.3809A>G	c.(3808-3810)gAg>gGg	p.E1270G	EVC2_ENST00000310917.2_Missense_Mutation_p.E1190G|EVC2_ENST00000344938.1_Intron	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	1270					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E1270G(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						AAAGAGCTTCTCTCCTGTGTT	0.473																																					p.E1190G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3569G	4						.						134.0	140.0	138.0					4																	5564693		2203	4300	6503	5615594	SO:0001583	missense	132884	exon22			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.3809A>G	4.37:g.5564693T>C	ENSP00000342144:p.Glu1270Gly	Somatic		Capture	Illumina HiSeq	Phase_I	5615594	NM_001166136	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	CCDS3382.2	.	.	.	.	.	.	.	.	.	.	T	14.74	2.626805	0.46840	.	.	ENSG00000173040	ENST00000310917;ENST00000344408	D;D	0.81821	-1.52;-1.54	5.3	5.3	0.74995	.	0.485335	0.19637	N	0.109525	D	0.82935	0.5145	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80004	-0.1564	10	0.27785	T	0.31	-24.4684	11.6447	0.51255	0.0:0.0:0.0:1.0	.	1270	Q86UK5	LBN_HUMAN	G	1190;1270	ENSP00000311683:E1190G;ENSP00000342144:E1270G	ENSP00000311683:E1190G	E	-	2	0	EVC2	5615594	0.997000	0.39634	0.839000	0.33178	0.143000	0.21401	3.698000	0.54771	2.022000	0.59522	0.533000	0.62120	GAG		EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
GPR125	166647	broad.mit.edu	37	4	22389738	22389738	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr4:22389738C>T	ENST00000334304.5	-	19	3825	c.3556G>A	c.(3556-3558)Gtc>Atc	p.V1186I	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	1186					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)	p.V1186I(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				TCTCTCAGGACTGTGAGTCGG	0.517																																					p.V1186I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3556A	4						.						91.0	83.0	86.0					4																	22389738		2203	4300	6503	21998836	SO:0001583	missense	166647	exon19			AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.3556G>A	4.37:g.22389738C>T	ENSP00000334952:p.Val1186Ile	Somatic		Capture	Illumina HiSeq	Phase_I	21998836	NM_145290	Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	ENST00000334304.5	37	CCDS33964.1	.	.	.	.	.	.	.	.	.	.	C	15.32	2.798075	0.50208	.	.	ENSG00000152990	ENST00000334304	T	0.55760	0.5	5.64	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.69015	0.3064	M	0.62723	1.935	0.80722	D	1	P;D	0.64830	0.935;0.994	P;D	0.72625	0.775;0.978	T	0.71454	-0.4588	10	0.56958	D	0.05	-30.8567	14.7552	0.69557	0.0:0.9304:0.0:0.0696	.	1043;1186	Q8IWK6-3;Q8IWK6	.;GP125_HUMAN	I	1186	ENSP00000334952:V1186I	ENSP00000334952:V1186I	V	-	1	0	GPR125	21998836	1.000000	0.71417	0.208000	0.23602	0.093000	0.18481	7.484000	0.81180	1.367000	0.46095	0.650000	0.86243	GTC		GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3		
KIT	3815	broad.mit.edu	37	4	55604628	55604628	+	Nonsense_Mutation	SNP	C	C	T	rs139000082		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr4:55604628C>T	ENST00000288135.5	+	21	2933	c.2836C>T	c.(2836-2838)Cga>Tga	p.R946*		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	946					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R946*(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CAGCCCCAACCGACAGAAGCC	0.512		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.R946X		yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2836T	4						.	C	stop/ARG,stop/ARG	1,4405	2.1+/-5.4	0,1,2202	137.0	133.0	134.0		2836,2824	5.2	0.0	4	dbSNP_134	134	3,8597	3.0+/-9.4	0,3,4297	yes	stop-gained,stop-gained	KIT	NM_000222.2,NM_001093772.1	,	0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308	,	946/977,942/973	55604628	4,13002	2203	4300	6503	55299385	SO:0001587	stop_gained	3815	exon21	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2836C>T	4.37:g.55604628C>T	ENSP00000288135:p.Arg946*	Somatic		Capture	Illumina HiSeq	Phase_I	55299385	NM_000222	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Nonsense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	C	34	5.412283	0.96072	2.27E-4	3.49E-4	ENSG00000157404	ENST00000288135;ENST00000412167	.	.	.	5.17	5.17	0.71159	.	1.764130	0.03452	N	0.210805	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	.	16.4631	0.84070	0.0:1.0:0.0:0.0	.	.	.	.	X	946;942	.	ENSP00000288135:R946X	R	+	1	2	KIT	55299385	0.033000	0.19621	0.006000	0.13384	0.018000	0.09664	3.219000	0.51200	2.435000	0.82474	0.561000	0.74099	CGA		KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
FBXW7	55294	broad.mit.edu	37	4	153247288	153247288	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr4:153247288C>T	ENST00000281708.4	-	10	2743	c.1514G>A	c.(1513-1515)cGc>cAc	p.R505H	FBXW7_ENST00000603548.1_Missense_Mutation_p.R505H|FBXW7_ENST00000393956.3_Missense_Mutation_p.R329H|FBXW7_ENST00000603841.1_Missense_Mutation_p.R505H|FBXW7_ENST00000296555.5_Missense_Mutation_p.R387H|FBXW7_ENST00000263981.5_Missense_Mutation_p.R425H	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	505			R -> L (in an ovarian cancer cell line). {ECO:0000269|PubMed:11565033, ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R505L(7)|p.R505H(5)|p.R266L(1)|p.R266H(1)|p.?(1)|p.R505P(1)|p.R425H(1)|p.R425L(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TTGAACACAGCGGACTGCTGC	0.468			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R425H			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,-1 	.	18	Substitution - Missense(17)|Unknown(1)	large_intestine(9)|upper_aerodigestive_tract(4)|haematopoietic_and_lymphoid_tissue(3)|ovary(2)	c.G1274A	4						.						169.0	159.0	163.0					4																	153247288		2203	4300	6503	153466738	SO:0001583	missense	55294	exon9			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1514G>A	4.37:g.153247288C>T	ENSP00000281708:p.Arg505His	Somatic		Capture	Illumina HiSeq	Phase_I	153466738	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.043172	0.75732	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.62105	0.05;0.05;0.05;0.05	5.72	4.87	0.63330	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.101576	0.64402	D	0.000001	T	0.75796	0.3898	L	0.55481	1.735	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.78907	-0.2019	10	0.87932	D	0	-12.0024	16.4274	0.83818	0.1326:0.8674:0.0:0.0	.	329;505;387;425	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	H	505;387;425;329	ENSP00000281708:R505H;ENSP00000296555:R387H;ENSP00000263981:R425H;ENSP00000377528:R329H	ENSP00000263981:R425H	R	-	2	0	FBXW7	153466738	1.000000	0.71417	1.000000	0.80357	0.591000	0.36615	7.744000	0.85034	1.533000	0.49186	-0.188000	0.12872	CGC		FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
APC	324	broad.mit.edu	37	5	112154942	112154942	+	Nonsense_Mutation	SNP	C	C	T	rs587779780		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr5:112154942C>T	ENST00000457016.1	+	10	1593	c.1213C>T	c.(1213-1215)Cga>Tga	p.R405*	APC_ENST00000508376.2_Nonsense_Mutation_p.R405*|APC_ENST00000257430.4_Nonsense_Mutation_p.R405*			P25054	APC_HUMAN	adenomatous polyposis coli	405	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R405*(5)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GCGTGAAATCCGAGTCCTTCA	0.527		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R387X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0 	.	5	Substitution - Nonsense(5)	large_intestine(5)	c.C1159T	5	GRCh37	CD042580|CI002196|CM920031	APC	D|I|M		.						50.0	48.0	49.0					5																	112154942		2202	4300	6502	112182841	SO:0001587	stop_gained	324	exon8	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1213C>T	5.37:g.112154942C>T	ENSP00000413133:p.Arg405*	Somatic		Capture	Illumina HiSeq	Phase_I	112182841	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	38	6.900704	0.97920	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.466	20.4191	0.99033	0.0:1.0:0.0:0.0	.	.	.	.	X	405;387;405;405;405	.	ENSP00000257430:R405X	R	+	1	2	APC	112182841	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.914000	0.56401	2.832000	0.97577	0.650000	0.86243	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHA13	56136	broad.mit.edu	37	5	140264083	140264083	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr5:140264083G>A	ENST00000289272.2	+	1	2230	c.2230G>A	c.(2230-2232)Gcg>Acg	p.A744T	PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.A744T|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	744	6 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A744T(1)		NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCTCCAGCGCGGCAGGGAG	0.682																																					p.A744T	Melanoma(147;1739 1852 5500 27947 37288)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2230A	5						.						50.0	55.0	54.0					5																	140264083		2203	4299	6502	140244267	SO:0001583	missense	56136	exon1			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.2230G>A	5.37:g.140264083G>A	ENSP00000289272:p.Ala744Thr	Somatic		Capture	Illumina HiSeq	Phase_I	140244267	NM_031865	O75277	Missense_Mutation	SNP	ENST00000289272.2	37	CCDS4240.1	.	.	.	.	.	.	.	.	.	.	G	11.59	1.685179	0.29872	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.15139	2.45;2.45	4.61	4.61	0.57282	.	.	.	.	.	T	0.23133	0.0559	M	0.87097	2.86	0.23445	N	0.997664	B;B;P	0.38992	0.121;0.338;0.653	B;B;B	0.32533	0.048;0.034;0.147	T	0.32903	-0.9889	9	0.52906	T	0.07	.	8.4497	0.32862	0.0832:0.1557:0.7612:0.0	.	744;744;744	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	T	744	ENSP00000386821:A744T;ENSP00000289272:A744T	ENSP00000289272:A744T	A	+	1	0	PCDHA13	140244267	1.000000	0.71417	1.000000	0.80357	0.094000	0.18550	3.656000	0.54467	2.084000	0.62774	0.655000	0.94253	GCG		PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
PCDHB10	56126	broad.mit.edu	37	5	140573601	140573601	+	Silent	SNP	G	G	A	rs141172055		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr5:140573601G>A	ENST00000239446.4	+	1	1660	c.1476G>A	c.(1474-1476)ccG>ccA	p.P492P		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	492	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P492P(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCTGCTGCCGCCCCAAGACC	0.682																																					p.P492P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1476A	5						.	G		1,4405	2.1+/-5.4	0,1,2202	98.0	112.0	107.0		1476	-1.1	0.9	5	dbSNP_134	107	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous	PCDHB10	NM_018930.3		0,2,6499	AA,AG,GG		0.0116,0.0227,0.0154		492/801	140573601	2,13000	2203	4298	6501	140553785	SO:0001819	synonymous_variant	56126	exon1			AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1476G>A	5.37:g.140573601G>A		Somatic		Capture	Illumina HiSeq	Phase_I	140553785	NM_018930	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																				PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
PCDHGA3	56112	broad.mit.edu	37	5	140723815	140723815	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr5:140723815C>T	ENST00000253812.6	+	1	215	c.215C>T	c.(214-216)aCg>aTg	p.T72M	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	72	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T72M(2)		breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGGTAGGACGCAGCTTTTC	0.602											OREG0016855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T72M												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C215T	5						.						66.0	78.0	74.0					5																	140723815		2178	4291	6469	140703999	SO:0001583	missense	56112	exon1			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.215C>T	5.37:g.140723815C>T	ENSP00000253812:p.Thr72Met	Somatic	1658	Capture	Illumina HiSeq	Phase_I	140703999	NM_018916	Q9Y5D4	De_novo_Start_OutOfFrame	SNP	ENST00000253812.6	37	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	3.593	-0.083268	0.07141	.	.	ENSG00000254245	ENST00000253812	T	0.29142	1.58	5.65	2.79	0.32731	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.595996	0.12256	U	0.485208	T	0.25195	0.0612	L	0.59967	1.855	0.09310	N	1	P;P	0.41710	0.76;0.659	B;B	0.36378	0.143;0.223	T	0.15350	-1.0440	10	0.42905	T	0.14	.	5.1464	0.14987	0.2361:0.5491:0.0:0.2148	.	72;72	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	M	72	ENSP00000253812:T72M	ENSP00000253812:T72M	T	+	2	0	PCDHGA3	140703999	0.000000	0.05858	0.999000	0.59377	0.030000	0.12068	-1.175000	0.03102	0.871000	0.35750	-0.136000	0.14681	ACG		PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
TCERG1	10915	broad.mit.edu	37	5	145890136	145890136	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr5:145890136T>A	ENST00000296702.5	+	22	3266	c.3228T>A	c.(3226-3228)gaT>gaA	p.D1076E	TCERG1_ENST00000394421.2_Missense_Mutation_p.D1055E	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	1076	FF 6.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)	p.D1076E(1)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CATATGTTGATGACCTGGATC	0.463																																					p.D1055E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3165A	5						.						105.0	99.0	101.0					5																	145890136		2203	4300	6503	145870329	SO:0001583	missense	10915	exon21			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.3228T>A	5.37:g.145890136T>A	ENSP00000296702:p.Asp1076Glu	Somatic		Capture	Illumina HiSeq	Phase_I	145870329	NM_001040006	Q2NKN2|Q59EA1	Missense_Mutation	SNP	ENST00000296702.5	37	CCDS4282.1	.	.	.	.	.	.	.	.	.	.	T	0.306	-0.970543	0.02232	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	T;T	0.20738	2.07;2.05	6.16	2.6	0.31112	FF domain (1);	0.086000	0.85682	D	0.000000	T	0.07098	0.0180	N	0.00801	-1.175	0.53688	D	0.999975	B;B	0.29671	0.254;0.024	B;B	0.41374	0.355;0.005	T	0.34976	-0.9807	10	0.02654	T	1	-19.6003	8.3671	0.32393	0.0:0.2766:0.0:0.7234	.	1055;1076	O14776-2;O14776	.;TCRG1_HUMAN	E	1076;1055	ENSP00000296702:D1076E;ENSP00000377943:D1055E	ENSP00000296702:D1076E	D	+	3	2	TCERG1	145870329	0.372000	0.25064	1.000000	0.80357	0.912000	0.54170	-0.327000	0.07955	0.580000	0.29522	0.528000	0.53228	GAT		TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
APC	324	broad.mit.edu	37	5	112175959	112175960	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	TA	TA	TA	TA	TA	TA	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr5:112175959_112175960delTA	ENST00000457016.1	+	16	5048_5049	c.4668_4669delTA	c.(4666-4671)actattfs	p.I1557fs	APC_ENST00000508376.2_Frame_Shift_Del_p.I1557fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.I1557fs			P25054	APC_HUMAN	adenomatous polyposis coli	1557	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.I1557fs*2(10)|p.I1557fs*1(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CAGAAAAAACTATTGATTCTGA	0.347		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.1538_1539del	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	13	Insertion - Frameshift(10)|Deletion - Frameshift(2)|Unknown(1)	large_intestine(10)|adrenal_gland(1)|soft_tissue(1)|skin(1)	c.4614_4615del	5	GRCh37	CD041153|CD084817|CI972541	APC	D|I		.																																			112203859	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4668_4669delTA	5.37:g.112175959_112175960delTA	ENSP00000413133:p.Ile1557fs	None		Capture	Illumina HiSeq	Phase_I	112203858	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ADAMTS2	9509	broad.mit.edu	37	5	178541162	178541162	+	Silent	SNP	G	G	A	rs79606317		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr5:178541162G>A	ENST00000251582.7	-	22	3443	c.3342C>T	c.(3340-3342)aaC>aaT	p.N1114N		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	1114					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.N1114N(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CGTCAATGTCGTTGTGCTTCC	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		19030	0.001		0.0	False		,,,				2504	0.0				p.N1114N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3342T	5						.	G		0,4406		0,0,2203	192.0	148.0	163.0		3342	-7.7	0.7	5	dbSNP_131	163	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	ADAMTS2	NM_014244.4		0,3,6500	AA,AG,GG		0.0349,0.0,0.0231		1114/1212	178541162	3,13003	2203	4300	6503	178473768	SO:0001819	synonymous_variant	9509	exon22			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.3342C>T	5.37:g.178541162G>A		Somatic		Capture	Illumina HiSeq	Phase_I	178473768	NM_014244		Silent	SNP	ENST00000251582.7	37	CCDS4444.1																																																																																				ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
SOGA3	387104	broad.mit.edu	37	6	127796768	127796768	+	Silent	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr6:127796768C>T	ENST00000525778.1	-	6	3148	c.2403G>A	c.(2401-2403)gcG>gcA	p.A801A	SOGA3_ENST00000481848.2_Silent_p.A801A|SOGA3_ENST00000368268.2_Silent_p.A801A|SOGA3_ENST00000556132.1_Silent_p.A801A|SOGA3_ENST00000465909.2_Silent_p.A801A|SOGA3_ENST00000474293.2_5'UTR			Q5TF21	SOGA3_HUMAN	SOGA family member 3	801					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.A801A(1)									AGGGCCCGGGCGCCGGGTAGA	0.701																																					p.A801A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2403A	6						.						27.0	33.0	31.0					6																	127796768		2020	4179	6199	127838461	SO:0001819	synonymous_variant	387104	exon6			AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.2403G>A	6.37:g.127796768C>T		Somatic		Capture	Illumina HiSeq	Phase_I	127838461	NM_001012279		Silent	SNP	ENST00000525778.1	37	CCDS43505.1																																																																																				SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279	
IYD	389434	broad.mit.edu	37	6	150690289	150690289	+	Missense_Mutation	SNP	G	G	A	rs370872496		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr6:150690289G>A	ENST00000344419.3	+	1	262	c.122G>A	c.(121-123)cGc>cAc	p.R41H	IYD_ENST00000229447.5_Missense_Mutation_p.R41H|IYD_ENST00000392256.2_Missense_Mutation_p.R41H|IYD_ENST00000500320.3_Missense_Mutation_p.R41H|IYD_ENST00000392255.3_Missense_Mutation_p.R41H|IYD_ENST00000425615.3_5'Flank	NM_203395.2	NP_981932.1	Q6PHW0	IYD1_HUMAN	iodotyrosine deiodinase	41					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	iodide peroxidase activity (GO:0004447)|oxidoreductase activity (GO:0016491)	p.R41H(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	15		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		GCCGAAGCTCGCCCCTGGGTG	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		18918	0.0		0.0	False		,,,				2504	0.001				p.R41H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G122A	6						.	G	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	85.0	90.0	88.0		122,122,122	0.3	0.0	6		88	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	IYD	NM_001164694.1,NM_001164695.1,NM_203395.2	29,29,29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging,possibly-damaging	41/294,41/248,41/290	150690289	2,13004	2203	4300	6503	150731982	SO:0001583	missense	389434	exon1			AK129950	CCDS5227.1, CCDS55066.1, CCDS55067.1	6q25.1	2006-08-24	2006-08-24	2006-08-24	ENSG00000009765	ENSG00000009765			21071	protein-coding gene	gene with protein product		612025	"""chromosome 6 open reading frame 71"""	C6orf71		16316988, 15289438	Standard	NM_001164694		Approved	dJ422F24.1, DEHAL1	uc003qnx.2	Q6PHW0	OTTHUMG00000016347	ENST00000344419.3:c.122G>A	6.37:g.150690289G>A	ENSP00000343763:p.Arg41His	Somatic		Capture	Illumina HiSeq	Phase_I	150731982	NM_001164695	C9JFW2|Q2VPW0|Q2VPW1|Q5F1L5|Q5F1L6|Q5THM4|Q6ZP69|Q7Z7D7|Q7Z7D8	Missense_Mutation	SNP	ENST00000344419.3	37	CCDS5227.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.903469	0.33628	0.0	2.33E-4	ENSG00000009765	ENST00000229447;ENST00000344419;ENST00000392256;ENST00000392255;ENST00000500320	D;T;D;D;D	0.88124	-2.34;-0.65;-2.25;-2.29;-2.31	5.14	0.299	0.15771	.	0.131761	0.47093	D	0.000247	T	0.81754	0.4889	M	0.72894	2.215	0.25169	N	0.990299	D;D;D	0.71674	0.998;0.996;0.995	P;P;P	0.55749	0.719;0.783;0.611	T	0.74965	-0.3484	10	0.51188	T	0.08	-25.8834	4.8626	0.13592	0.3292:0.1471:0.5237:0.0	.	41;41;41	C9JFW2;Q6PHW0-3;Q6PHW0	.;.;IYD1_HUMAN	H	41	ENSP00000229447:R41H;ENSP00000343763:R41H;ENSP00000376085:R41H;ENSP00000376084:R41H;ENSP00000441276:R41H	ENSP00000229447:R41H	R	+	2	0	IYD	150731982	0.073000	0.21202	0.001000	0.08648	0.242000	0.25591	0.878000	0.28126	-0.171000	0.10797	-0.251000	0.11542	CGC		IYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043754.3	NM_203395	
HIST1H1A	3024	broad.mit.edu	37	6	26017513	26017513	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr6:26017513C>T	ENST00000244573.3	-	1	527	c.448G>A	c.(448-450)Gtc>Atc	p.V150I		NM_005325.3	NP_005316.1	Q02539	H11_HUMAN	histone cluster 1, H1a	150					nucleosome assembly (GO:0006334)|spermatogenesis (GO:0007283)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)	p.V150I(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|ovary(3)|prostate(1)	13						GGAGTCTTGACGCTCTTTTTG	0.473																																					p.V150I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G448A	6						.						147.0	156.0	153.0					6																	26017513		2203	4300	6503	26125492	SO:0001583	missense	3024	exon1			AF531299	CCDS4569.1	6p22.1	2012-11-16	2006-10-11	2003-02-21	ENSG00000124610	ENSG00000124610		"""Histones / Replication-dependent"""	4715	protein-coding gene	gene with protein product		142709	"""H1 histone family, member 1"", ""histone 1, H1a"""	H1F1		2759094, 12408966	Standard	NM_005325		Approved	H1.1, H1a	uc003nfo.3	Q02539	OTTHUMG00000016413	ENST00000244573.3:c.448G>A	6.37:g.26017513C>T	ENSP00000244573:p.Val150Ile	Somatic		Capture	Illumina HiSeq	Phase_I	26125492	NM_005325	Q3MJ34	Missense_Mutation	SNP	ENST00000244573.3	37	CCDS4569.1	.	.	.	.	.	.	.	.	.	.	N	4.599	0.111276	0.08831	.	.	ENSG00000124610	ENST00000244573	T	0.14022	2.54	4.22	4.22	0.49857	.	0.930262	0.08958	N	0.869067	T	0.02767	0.0083	L	0.27053	0.805	0.09310	N	1	P	0.45078	0.85	B	0.28011	0.085	T	0.21177	-1.0253	10	0.27082	T	0.32	-11.5263	10.8707	0.46881	0.0:0.8076:0.1923:0.0	.	150	Q02539	H11_HUMAN	I	150	ENSP00000244573:V150I	ENSP00000244573:V150I	V	-	1	0	HIST1H1A	26125492	0.994000	0.37717	0.125000	0.21846	0.010000	0.07245	1.700000	0.37815	2.273000	0.75805	0.609000	0.83330	GTC		HIST1H1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043884.1	NM_005325	
ZSCAN16	80345	broad.mit.edu	37	6	28097695	28097695	+	Silent	SNP	T	T	C			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr6:28097695T>C	ENST00000340487.4	+	4	1163	c.1014T>C	c.(1012-1014)caT>caC	p.H338H	ZSCAN16-AS1_ENST00000600652.1_RNA|ZSCAN16-AS1_ENST00000602810.1_RNA	NM_025231.1	NP_079507.1	Q9H4T2	ZSC16_HUMAN	zinc finger and SCAN domain containing 16	338					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H338H(1)		large_intestine(5)|liver(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						TTATTAGACATCAAAGAATTC	0.368																																					p.H338H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1014C	6						.						63.0	65.0	64.0					6																	28097695		2203	4300	6503	28205674	SO:0001819	synonymous_variant	80345	exon4			AK025844	CCDS4644.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000196812	ENSG00000196812		"""-"", ""Zinc fingers, C2H2-type"""	20813	protein-coding gene	gene with protein product			"""zinc finger protein 392"", ""zinc finger protein 435"""	ZNF392, ZNF435			Standard	NM_025231		Approved	FLJ22191, dJ265C24.3	uc003nkm.3	Q9H4T2	OTTHUMG00000014509	ENST00000340487.4:c.1014T>C	6.37:g.28097695T>C		Somatic		Capture	Illumina HiSeq	Phase_I	28205674	NM_025231	Q9H6K2	Silent	SNP	ENST00000340487.4	37	CCDS4644.1																																																																																				ZSCAN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040177.1	NM_025231	
HSPA1L	3305	broad.mit.edu	37	6	31778785	31778785	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr6:31778785G>A	ENST00000375654.4	-	2	1154	c.965C>T	c.(964-966)gCg>gTg	p.A322V	HSPA1L_ENST00000417199.3_Missense_Mutation_p.A322V	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	322					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)	p.A322V(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						ATCCCGAAGCGCTTTTTCTAC	0.498																																					p.A322V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C965T	6						.						63.0	64.0	63.0					6																	31778785		2203	4300	6503	31886764	SO:0001583	missense	3305	exon2			D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.965C>T	6.37:g.31778785G>A	ENSP00000364805:p.Ala322Val	Somatic		Capture	Illumina HiSeq	Phase_I	31886764	NM_005527	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	37	CCDS34413.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.2|25.2	4.610439|4.610439	0.87258|0.87258	.|.	.|.	ENSG00000204390|ENSG00000204390	ENST00000424494|ENST00000375654;ENST00000417199;ENST00000375653	.|T;T	.|0.01059	.|5.39;5.39	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	.|0.244523	.|0.21351	.|N	.|0.075971	.|T	.|0.01124	.|0.0037	N|N	0.11698|0.11698	0.16|0.16	0.58432|0.58432	D|D	0.999995|0.999995	.|D	.|0.59357	.|0.985	.|P	.|0.55824	.|0.785	.|T	.|0.77824	.|-0.2444	.|10	.|0.72032	.|D	.|0.01	.|-1.8346	16.7131|16.7131	0.85391|0.85391	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|322	.|P34931	.|HS71L_HUMAN	.|V	-1|322;322;267	.|ENSP00000364805:A322V;ENSP00000387691:A322V	.|ENSP00000364804:A267V	.|A	-|-	.|2	.|0	HSPA1L|HSPA1L	31886764|31886764	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.894000|0.894000	0.52154|0.52154	7.770000|7.770000	0.85390|0.85390	2.810000|2.810000	0.96702|0.96702	0.585000|0.585000	0.79938|0.79938	.|GCG		HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
ITPR3	3710	broad.mit.edu	37	6	33648366	33648366	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr6:33648366C>T	ENST00000374316.5	+	34	5445	c.4385C>T	c.(4384-4386)cCc>cTc	p.P1462L	ITPR3_ENST00000605930.1_Missense_Mutation_p.P1462L			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1462					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GTGGCTGACCCCACCTTGGAG	0.612																																					p.P1462L												.	.	0			c.C4385T	6						.						97.0	80.0	86.0					6																	33648366		2203	4300	6503	33756344	SO:0001583	missense	3710	exon33			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.4385C>T	6.37:g.33648366C>T	ENSP00000363435:p.Pro1462Leu	None		Capture	Illumina HiSeq	Phase_I	33756344	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	C	11.39	1.625329	0.28889	.	.	ENSG00000096433	ENST00000374316	T	0.62232	0.04	5.41	4.54	0.55810	.	0.114368	0.64402	D	0.000009	T	0.30417	0.0764	L	0.29908	0.895	0.53005	D	0.999965	B	0.02656	0.0	B	0.08055	0.003	T	0.15896	-1.0421	10	0.32370	T	0.25	-21.4694	10.0265	0.42074	0.0:0.8473:0.0:0.1527	.	1462	Q14573	ITPR3_HUMAN	L	1462	ENSP00000363435:P1462L	ENSP00000363435:P1462L	P	+	2	0	ITPR3	33756344	0.969000	0.33509	1.000000	0.80357	0.282000	0.26991	2.771000	0.47670	1.266000	0.44231	0.655000	0.94253	CCC		ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
COL9A1	1297	broad.mit.edu	37	6	71011709	71011709	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr6:71011709C>T	ENST00000357250.6	-	2	241	c.83G>A	c.(82-84)cGc>cAc	p.R28H	COL9A1_ENST00000370496.3_Missense_Mutation_p.R28H	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	28	Nonhelical region (NC4).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.R28H(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						CTTACTGGGGCGACGCTTGAC	0.458																																					p.R28H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G83A	6						.						41.0	42.0	41.0					6																	71011709		2203	4300	6503	71068430	SO:0001583	missense	1297	exon2				CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.83G>A	6.37:g.71011709C>T	ENSP00000349790:p.Arg28His	Somatic		Capture	Illumina HiSeq	Phase_I	71068430	NM_001851	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275646	0.80580	.	.	ENSG00000112280	ENST00000357250;ENST00000370496	D;D	0.91577	-2.51;-2.87	6.07	3.94	0.45596	.	0.376557	0.27072	N	0.021078	T	0.68879	0.3049	L	0.29908	0.895	0.80722	D	1	P	0.48998	0.918	B	0.30943	0.122	T	0.74194	-0.3744	10	0.54805	T	0.06	.	5.3673	0.16121	0.2061:0.6563:0.0:0.1376	.	28	P20849	CO9A1_HUMAN	H	28	ENSP00000349790:R28H;ENSP00000359527:R28H	ENSP00000349790:R28H	R	-	2	0	COL9A1	71068430	0.976000	0.34144	1.000000	0.80357	0.954000	0.61252	0.907000	0.28531	1.526000	0.49068	0.655000	0.94253	CGC		COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
C6orf118	168090	broad.mit.edu	37	6	165711552	165711552	+	Silent	SNP	C	C	T	rs369772945		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr6:165711552C>T	ENST00000230301.8	-	5	995	c.975G>A	c.(973-975)ccG>ccA	p.P325P	C6orf118_ENST00000543069.1_Silent_p.P221P	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	325								p.P325P(1)		breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		CCGTCTTCACCGGCCTCTGCC	0.602																																					p.P325P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G975A	6						.						89.0	74.0	79.0					6																	165711552		2203	4300	6503	165631542	SO:0001819	synonymous_variant	168090	exon5				CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.975G>A	6.37:g.165711552C>T		Somatic		Capture	Illumina HiSeq	Phase_I	165631542	NM_144980	Q8TC11	Silent	SNP	ENST00000230301.8	37	CCDS5288.1																																																																																				C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980	
LAMB4	22798	broad.mit.edu	37	7	107756564	107756564	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr7:107756564C>A	ENST00000388781.3	-	3	160	c.77G>T	c.(76-78)gGt>gTt	p.G26V	LAMB4_ENST00000205386.4_Missense_Mutation_p.G26V|LAMB4_ENST00000414450.2_Missense_Mutation_p.G26V|LAMB4_ENST00000388780.3_Missense_Mutation_p.G26V|LAMB4_ENST00000418464.1_Missense_Mutation_p.G26V	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	26	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.G26V(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						ATGACAGGCACCCCTGTTGCA	0.532																																					p.G26V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G77T	7						.						128.0	120.0	123.0					7																	107756564		2203	4300	6503	107543800	SO:0001583	missense	22798	exon3			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.77G>T	7.37:g.107756564C>A	ENSP00000373433:p.Gly26Val	Somatic		Capture	Illumina HiSeq	Phase_I	107543800	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.205604	0.79127	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	T;T;T;T;T	0.34072	1.38;1.38;1.41;1.43;1.47	5.69	3.88	0.44766	Laminin, N-terminal (2);	0.135863	0.33180	N	0.005199	T	0.44540	0.1298	M	0.84082	2.675	0.52501	D	0.999955	P	0.39883	0.693	B	0.40506	0.331	T	0.49634	-0.8919	10	0.87932	D	0	.	11.6386	0.51220	0.0:0.8542:0.0:0.1458	.	26	A4D0S4	LAMB4_HUMAN	V	26	ENSP00000205386:G26V;ENSP00000373433:G26V;ENSP00000373432:G26V;ENSP00000402353:G26V;ENSP00000402265:G26V	ENSP00000205386:G26V	G	-	2	0	LAMB4	107543800	0.039000	0.19947	0.272000	0.24630	0.177000	0.22998	2.253000	0.43205	0.733000	0.32492	0.655000	0.94253	GGT		LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
OR2A12	346525	broad.mit.edu	37	7	143792930	143792930	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr7:143792930C>T	ENST00000408949.2	+	1	790	c.730C>T	c.(730-732)Ctc>Ttc	p.L244F		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	244						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L244F(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					CTCCTCCCACCTCTGCGTGGT	0.562																																					p.L244F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C730T	7						.						140.0	136.0	137.0					7																	143792930		1945	4140	6085	143423863	SO:0001583	missense	346525	exon1				CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.730C>T	7.37:g.143792930C>T	ENSP00000386174:p.Leu244Phe	Somatic		Capture	Illumina HiSeq	Phase_I	143423863	NM_001004135	Q6IF43	Missense_Mutation	SNP	ENST00000408949.2	37	CCDS43670.1	.	.	.	.	.	.	.	.	.	.	C	14.23	2.472301	0.43942	.	.	ENSG00000221858	ENST00000408949	T	0.50277	0.75	4.33	3.42	0.39159	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.54208	0.1844	L	0.58669	1.825	0.29179	N	0.876633	B	0.31989	0.35	B	0.44163	0.443	T	0.57556	-0.7791	9	0.72032	D	0.01	-22.0527	11.7205	0.51678	0.0:0.8196:0.1804:0.0	.	244	Q8NGT7	O2A12_HUMAN	F	244	ENSP00000386174:L244F	ENSP00000386174:L244F	L	+	1	0	OR2A12	143423863	0.916000	0.31088	1.000000	0.80357	0.676000	0.39594	0.238000	0.18004	0.994000	0.38892	0.505000	0.49811	CTC		OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349969.1		
IGF2BP3	10643	broad.mit.edu	37	7	23390935	23390935	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr7:23390935C>A	ENST00000258729.3	-	6	1028	c.672G>T	c.(670-672)caG>caT	p.Q224H	IGF2BP3_ENST00000491719.1_5'Flank	NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	224	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)	p.Q224H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						TAGACTGGGTCTGTTTGGTGA	0.488																																					p.Q224H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G672T	7						.						118.0	105.0	109.0					7																	23390935		2203	4300	6503	23357460	SO:0001583	missense	10643	exon6			AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.672G>T	7.37:g.23390935C>A	ENSP00000258729:p.Gln224His	Somatic		Capture	Illumina HiSeq	Phase_I	23357460	NM_006547	A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Missense_Mutation	SNP	ENST00000258729.3	37	CCDS5382.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715278	0.89112	.	.	ENSG00000136231	ENST00000258729	T	0.30981	1.51	5.89	5.89	0.94794	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.64204	0.2577	M	0.87328	2.875	0.80722	D	1	D	0.69078	0.997	D	0.77557	0.99	T	0.68164	-0.5481	10	0.72032	D	0.01	-20.633	20.2566	0.98424	0.0:1.0:0.0:0.0	.	224	O00425	IF2B3_HUMAN	H	224	ENSP00000258729:Q224H	ENSP00000258729:Q224H	Q	-	3	2	IGF2BP3	23357460	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.133000	0.42093	2.793000	0.96121	0.561000	0.74099	CAG		IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250243.2	NM_006547	
PPP1R17	10842	broad.mit.edu	37	7	31736637	31736637	+	Silent	SNP	C	C	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr7:31736637C>A	ENST00000342032.3	+	4	922	c.294C>A	c.(292-294)ggC>ggA	p.G98G	PPP1R17_ENST00000409146.3_Silent_p.G47G|PPP1R17_ENST00000498609.1_3'UTR	NM_006658.4	NP_006649.2	O96001	PPR17_HUMAN	protein phosphatase 1, regulatory subunit 17	98					central nervous system development (GO:0007417)|intracellular signal transduction (GO:0035556)|regulation of phosphatase activity (GO:0010921)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)	p.G98G(1)									ATCCAAAGGGCAAAATGATCC	0.428																																					p.G98G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C294A	7						.						112.0	104.0	107.0					7																	31736637		2203	4300	6503	31703162	SO:0001819	synonymous_variant	10842	exon4			AF071789	CCDS5436.1, CCDS47570.1	7p15	2012-04-17	2011-10-11	2011-10-11	ENSG00000106341	ENSG00000106341		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16973	protein-coding gene	gene with protein product	"""G-substrate"""	604088	"""chromosome 7 open reading frame 16"""	C7orf16		10051666, 9920894	Standard	NM_006658		Approved	GSBS	uc003tcl.3	O96001	OTTHUMG00000128629	ENST00000342032.3:c.294C>A	7.37:g.31736637C>A		Somatic		Capture	Illumina HiSeq	Phase_I	31703162	NM_006658	B4DE58|Q9UDQ0	Silent	SNP	ENST00000342032.3	37	CCDS5436.1																																																																																				PPP1R17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250498.1	NM_006658	
GTF2IRD2	84163	broad.mit.edu	37	7	74212036	74212036	+	Silent	SNP	C	C	T	rs707394	byFrequency	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr7:74212036C>T	ENST00000405086.2	-	16	2004	c.1815G>A	c.(1813-1815)aaG>aaA	p.K605K	GTF2IRD2_ENST00000451013.2_Silent_p.K152K	NM_173537.2	NP_775808	Q86UP8	GTD2A_HUMAN	GTF2I repeat domain containing 2	605					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K605K(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	11						cgatacagaactttttcaggc	0.502																																					p.K605K	NSCLC(40;560 1096 7501 40315 49546)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1815A	7						.						39.0	38.0	38.0					7																	74212036		2203	4299	6502	73849972	SO:0001819	synonymous_variant	84163	exon16			BC047706	CCDS5576.1, CCDS64682.1	7q11.23	2014-05-06			ENSG00000196275	ENSG00000196275			30775	protein-coding gene	gene with protein product	"""transcription factor GTF2IRD2"""	608899				15243160	Standard	NM_173537		Approved	FLJ37938, GTF2IRD2A	uc003ubd.1	Q86UP8	OTTHUMG00000181527	ENST00000405086.2:c.1815G>A	7.37:g.74212036C>T		Somatic		Capture	Illumina HiSeq	Phase_I	73849972	NM_173537	A8K5W6|B3KUZ2|Q69G40|Q6EKI8|Q6EKI9|Q6NVW2|Q6P7N8|Q86WX4|Q8ND85|Q8NDE5	Silent	SNP	ENST00000405086.2	37	CCDS5576.1																																																																																				GTF2IRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252712.3	NM_173537	
ZNF777	27153	broad.mit.edu	37	7	149129329	149129329	+	Silent	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr7:149129329G>A	ENST00000247930.4	-	6	2357	c.2034C>T	c.(2032-2034)agC>agT	p.S678S		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	678					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S678S(1)		large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			GGATCACCAAGCTGATGTGCA	0.632																																					p.S678S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2034T	7						.						71.0	82.0	78.0					7																	149129329		2181	4293	6474	148760262	SO:0001819	synonymous_variant	27153	exon6			AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.2034C>T	7.37:g.149129329G>A		Somatic		Capture	Illumina HiSeq	Phase_I	148760262	NM_015694	Q8N2R2|Q8N659	Silent	SNP	ENST00000247930.4	37	CCDS43675.1																																																																																				ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352708.1	NM_015694	
ADAM2	2515	broad.mit.edu	37	8	39607199	39607199	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr8:39607199C>T	ENST00000265708.4	-	17	1965	c.1862G>A	c.(1861-1863)tGc>tAc	p.C621Y	ADAM2_ENST00000521880.1_Missense_Mutation_p.C558Y|ADAM2_ENST00000379853.2_Missense_Mutation_p.C465Y|ADAM2_ENST00000347580.4_Missense_Mutation_p.C602Y	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	621	EGF-like.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.C621Y(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TCTATCATTGCATTTGTCAGT	0.363																																					p.C621Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1862A	8						.						155.0	142.0	147.0					8																	39607199		2203	4300	6503	39726356	SO:0001583	missense	2515	exon17			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.1862G>A	8.37:g.39607199C>T	ENSP00000265708:p.Cys621Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	39726356	NM_001464	P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	37	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.805751	0.50421	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	D;D;D;D	0.96491	-4.03;-4.03;-4.03;-4.03	4.21	4.21	0.49690	.	.	.	.	.	D	0.98479	0.9493	H	0.94964	3.605	0.34863	D	0.742847	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.997;0.999;0.997	D	0.99967	1.1887	9	0.87932	D	0	.	12.7857	0.57504	0.0:1.0:0.0:0.0	.	558;465;602;621	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	Y	602;465;621;558	ENSP00000343854:C602Y;ENSP00000369182:C465Y;ENSP00000265708:C621Y;ENSP00000429352:C558Y	ENSP00000265708:C621Y	C	-	2	0	ADAM2	39726356	0.998000	0.40836	0.667000	0.29798	0.031000	0.12232	2.872000	0.48467	2.273000	0.75805	0.655000	0.94253	TGC		ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464	
CHD7	55636	broad.mit.edu	37	8	61654719	61654719	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr8:61654719C>A	ENST00000423902.2	+	2	1207	c.728C>A	c.(727-729)cCc>cAc	p.P243H	CHD7_ENST00000524602.1_Missense_Mutation_p.P243H|CHD7_ENST00000525508.1_Missense_Mutation_p.P243H	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	243					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CAGCAGAGTCCCAGCATGGCA	0.572																																					p.P243H												.	.	0			c.C728A	8						.						102.0	106.0	105.0					8																	61654719		2113	4233	6346	61817273	SO:0001583	missense	55636	exon2			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.728C>A	8.37:g.61654719C>A	ENSP00000392028:p.Pro243His	None		Capture	Illumina HiSeq	Phase_I	61817273	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.678826	0.47886	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000524602;ENST00000525508	T;T;T	0.81415	-1.49;1.97;-1.05	5.35	5.35	0.76521	.	0.000000	0.42420	D	0.000719	T	0.79896	0.4525	N	0.12182	0.205	0.47994	D	0.99956	D	0.76494	0.999	P	0.60012	0.867	T	0.81754	-0.0788	10	0.41790	T	0.15	-9.7924	19.0777	0.93169	0.0:1.0:0.0:0.0	.	243	Q9P2D1	CHD7_HUMAN	H	243	ENSP00000392028:P243H;ENSP00000437061:P243H;ENSP00000436027:P243H	ENSP00000307304:P243H	P	+	2	0	CHD7	61817273	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	4.894000	0.63206	2.529000	0.85273	0.655000	0.94253	CCC		CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
RIMS2	9699	broad.mit.edu	37	8	104948921	104948921	+	Nonsense_Mutation	SNP	C	C	T	rs561377229		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr8:104948921C>T	ENST00000436393.2	+	11	2093	c.1852C>T	c.(1852-1854)Cga>Tga	p.R618*	RIMS2_ENST00000507740.1_Nonsense_Mutation_p.R632*|RIMS2_ENST00000262231.10_Nonsense_Mutation_p.R679*|RIMS2_ENST00000406091.3_Nonsense_Mutation_p.R840*			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	902					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.R618*(2)|p.R632*(2)|p.R907*(2)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGCTCGTGTTCGAGAGGAAGA	0.383										HNSCC(12;0.0054)																											p.R840X												.	.	6	Substitution - Nonsense(6)	large_intestine(6)	c.C2518T	8						.						146.0	132.0	136.0					8																	104948921		1843	4091	5934	105018097	SO:0001587	stop_gained	9699	exon13			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1852C>T	8.37:g.104948921C>T	ENSP00000390665:p.Arg618*	Somatic		Capture	Illumina HiSeq	Phase_I	105018097	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Nonsense_Mutation	SNP	ENST00000436393.2	37		.	.	.	.	.	.	.	.	.	.	C	39	7.483370	0.98312	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	.	.	.	4.89	4.0	0.46444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7516	0.69530	0.1459:0.8541:0.0:0.0	.	.	.	.	X	840;855;840;902;632;679;632;632;618	.	ENSP00000262231:R679X	R	+	1	2	RIMS2	105018097	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.082000	0.50128	1.156000	0.42514	0.467000	0.42956	CGA		RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
ROR2	4920	broad.mit.edu	37	9	94486366	94486367	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr9:94486366_94486367insG	ENST00000375708.3	-	9	2607_2608	c.2409_2410insC	c.(2407-2412)cccatgfs	p.M804fs	ROR2_ENST00000550066.1_5'UTR|ROR2_ENST00000375715.1_Intron	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	804	Pro-rich.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TGGCCCTTCATGGGGATGAACT	0.668																																					p.M804fs												.	.	0			c.2410_2411insC	9						.																																			93526188	SO:0001589	frameshift_variant	4920	exon9			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.2410dupC	9.37:g.94486370_94486370dupG	ENSP00000364860:p.Met804fs	None		Capture	Illumina HiSeq	Phase_I	93526187	NM_004560	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Frame_Shift_Ins	INS	ENST00000375708.3	37	CCDS6691.1																																																																																				ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1		
INSL6	11172	broad.mit.edu	37	9	5185596	5185596	+	Missense_Mutation	SNP	G	G	A	rs373690238		TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr9:5185596G>A	ENST00000381641.3	-	1	72	c.7C>T	c.(7-9)Cgg>Tgg	p.R3W		NM_007179.2	NP_009110.2	Q9Y581	INSL6_HUMAN	insulin-like 6	3					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.R3W(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(2)	15	all_hematologic(13;0.137)	Breast(48;0.147)|Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0128)|Lung(218;0.145)		CGGAGGAGCCGCGGCATCCCT	0.667																																					p.R3W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7T	9						.	G	TRP/ARG	1,4401		0,1,2200	26.0	24.0	24.0		7	0.2	0.0	9		24	0,8600		0,0,4300	no	missense	INSL6	NM_007179.2	101	0,1,6500	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	3/214	5185596	1,13001	2201	4300	6501	5175596	SO:0001583	missense	11172	exon1			AF156094	CCDS6458.1	9p24	2008-07-21			ENSG00000120210	ENSG00000120210			6089	protein-coding gene	gene with protein product	"""relaxin/insulin-like factor 1"""	606414				10819760	Standard	NM_007179		Approved	RIF1	uc003zix.3	Q9Y581	OTTHUMG00000019489	ENST00000381641.3:c.7C>T	9.37:g.5185596G>A	ENSP00000371054:p.Arg3Trp	Somatic		Capture	Illumina HiSeq	Phase_I	5175596	NM_007179	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000381641.3	37	CCDS6458.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.657878	0.47467	2.27E-4	0.0	ENSG00000120210	ENST00000381641	T	0.57436	0.4	4.25	0.175	0.15045	.	1.303650	0.05405	N	0.541371	T	0.48277	0.1491	M	0.79258	2.445	0.09310	N	1	P	0.34462	0.454	B	0.25884	0.064	T	0.44221	-0.9342	10	0.87932	D	0	1.0932	3.4636	0.07541	0.0913:0.3145:0.4322:0.1619	.	3	Q9Y581	INSL6_HUMAN	W	3	ENSP00000371054:R3W	ENSP00000371054:R3W	R	-	1	2	INSL6	5175596	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.010000	0.12743	0.044000	0.15775	-0.147000	0.13772	CGG		INSL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051608.3	NM_007179	
TOPORS	10210	broad.mit.edu	37	9	32543484	32543484	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr9:32543484G>A	ENST00000360538.2	-	3	1155	c.1039C>T	c.(1039-1041)Cga>Tga	p.R347*	TOPORS_ENST00000379858.1_Nonsense_Mutation_p.R282*	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	347	Required for DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R347*(2)		large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		TGCTCAGTTCGATTAAGTAAA	0.378																																					p.R282X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|skin(1)	c.C844T	9						.						56.0	57.0	57.0					9																	32543484		2203	4300	6503	32533484	SO:0001587	stop_gained	10210	exon2			AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.1039C>T	9.37:g.32543484G>A	ENSP00000353735:p.Arg347*	Somatic		Capture	Illumina HiSeq	Phase_I	32533484	NM_001195622	O43273|Q6P987|Q9NS55|Q9UNR9	Nonsense_Mutation	SNP	ENST00000360538.2	37	CCDS6527.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.473734	0.84640	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	.	.	.	5.93	5.03	0.67393	.	0.000000	0.43110	D	0.000609	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.1471	15.4621	0.75366	0.0:0.0:0.86:0.14	.	.	.	.	X	347;282	.	ENSP00000353735:R347X	R	-	1	2	TOPORS	32533484	1.000000	0.71417	1.000000	0.80357	0.489000	0.33432	7.595000	0.82710	1.485000	0.48380	0.655000	0.94253	CGA		TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802	
GNA14	9630	broad.mit.edu	37	9	80038943	80038943	+	Silent	SNP	G	G	C			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chr9:80038943G>C	ENST00000341700.6	-	7	1533	c.1020C>G	c.(1018-1020)gtC>gtG	p.V340V	GNA14_ENST00000464095.1_5'Flank	NM_004297.3	NP_004288.1	O95837	GNA14_HUMAN	guanine nucleotide binding protein (G protein), alpha 14	340					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.V340V(1)		endometrium(3)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	24						TTGTGTCTTTGACAGCAGCAA	0.413																																					p.V340V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1020G	9						.						171.0	154.0	160.0					9																	80038943		2203	4300	6503	79228763	SO:0001819	synonymous_variant	9630	exon7			AF105201	CCDS6657.1	9q21	2008-05-23			ENSG00000156049	ENSG00000156049			4382	protein-coding gene	gene with protein product		604397				10191087, 17620339	Standard	NM_004297		Approved		uc004aku.3	O95837	OTTHUMG00000020058	ENST00000341700.6:c.1020C>G	9.37:g.80038943G>C		Somatic		Capture	Illumina HiSeq	Phase_I	79228763	NM_004297	B1ALW3	Silent	SNP	ENST00000341700.6	37	CCDS6657.1																																																																																				GNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052759.1		
DMD	1756	broad.mit.edu	37	X	31986471	31986471	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chrX:31986471G>C	ENST00000357033.4	-	45	6805	c.6599C>G	c.(6598-6600)tCa>tGa	p.S2200*	DMD_ENST00000474231.1_5'UTR|DMD_ENST00000378707.3_5'UTR|DMD_ENST00000343523.2_5'UTR|DMD_ENST00000378677.2_Nonsense_Mutation_p.S2196*|DMD_ENST00000541735.1_5'UTR|DMD_ENST00000359836.1_5'UTR	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2200					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.S859*(1)|p.S2196*(1)|p.S2195*(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTTTCTGTCTGACAGCTGTTT	0.378																																					p.S859X												.	.	3	Substitution - Nonsense(3)	large_intestine(3)	c.C2576G	X						.						120.0	114.0	116.0					X																	31986471		2202	4299	6501	31896392	SO:0001587	stop_gained	1756	exon17			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.6599C>G	X.37:g.31986471G>C	ENSP00000354923:p.Ser2200*	Somatic		Capture	Illumina HiSeq	Phase_I	31896392	NM_004011	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Nonsense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	48	14.648556	0.99804	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	.	.	.	5.37	4.48	0.54585	.	0.512331	0.13942	U	0.352126	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	6.5433	0.22392	0.0899:0.0:0.5908:0.3193	.	.	.	.	X	2192;859;856;2196;2200;2200;2077	.	ENSP00000354923:S2200X	S	-	2	0	DMD	31896392	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.584000	0.36589	0.989000	0.38761	0.538000	0.68166	TCA		DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
FAM47C	442444	broad.mit.edu	37	X	37026686	37026686	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chrX:37026686C>T	ENST00000358047.3	+	1	255	c.203C>T	c.(202-204)aCg>aTg	p.T68M		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	68								p.T68M(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CCTGAAGATACGCTTGTTTGT	0.542																																					p.T68M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C203T	X						.						86.0	75.0	79.0					X																	37026686		2202	4300	6502	36936607	SO:0001583	missense	442444	exon1			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.203C>T	X.37:g.37026686C>T	ENSP00000367913:p.Thr68Met	Somatic		Capture	Illumina HiSeq	Phase_I	36936607	NM_001013736	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	C	0.944	-0.708671	0.03230	.	.	ENSG00000198173	ENST00000358047	T	0.19394	2.15	0.502	-1.0	0.10196	.	.	.	.	.	T	0.09512	0.0234	N	0.26042	0.785	0.09310	N	1	P	0.37781	0.608	B	0.30716	0.119	T	0.18366	-1.0339	8	0.30078	T	0.28	.	.	.	.	.	68	Q5HY64	FA47C_HUMAN	M	68	ENSP00000367913:T68M	ENSP00000367913:T68M	T	+	2	0	FAM47C	36936607	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-2.020000	0.01441	-1.188000	0.02705	-0.698000	0.03680	ACG		FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
AWAT1	158833	broad.mit.edu	37	X	69459616	69459616	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chrX:69459616G>C	ENST00000374521.3	+	6	705	c.664G>C	c.(664-666)Gaa>Caa	p.E222Q		NM_001013579.2	NP_001013597.1	Q58HT5	AWAT1_HUMAN	acyl-CoA wax alcohol acyltransferase 1	222					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)	p.E302Q(1)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(3)|ovary(4)|skin(1)	15						CACTTTTGGGGAAACTGAGGT	0.453																																					p.E222Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G664C	X						.						127.0	120.0	122.0					X																	69459616		2203	4300	6503	69376341	SO:0001583	missense	158833	exon6			BC039181	CCDS35321.1	Xq13.1	2010-01-25	2009-02-23	2009-02-23	ENSG00000204195	ENSG00000204195			23252	protein-coding gene	gene with protein product		300924	"""diacylglycerol O-acyltransferase 2-like 3"""	DGAT2L3		14970677, 15671038	Standard	NM_001013579		Approved		uc004dxy.3	Q58HT5	OTTHUMG00000021773	ENST00000374521.3:c.664G>C	X.37:g.69459616G>C	ENSP00000363645:p.Glu222Gln	Somatic		Capture	Illumina HiSeq	Phase_I	69376341	NM_001013579	Q5JT21|Q6IEE4	Missense_Mutation	SNP	ENST00000374521.3	37	CCDS35321.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.531365	0.85706	.	.	ENSG00000204195	ENST00000374521	T	0.17213	2.29	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000001	T	0.44008	0.1273	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.39502	-0.9611	10	0.87932	D	0	-15.3505	16.5958	0.84796	0.0:0.0:1.0:0.0	.	222	Q58HT5	AWAT1_HUMAN	Q	222	ENSP00000363645:E222Q	ENSP00000363645:E222Q	E	+	1	0	AWAT1	69376341	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.789000	0.91839	2.490000	0.84030	0.544000	0.68410	GAA		AWAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057066.3	NM_001013579	
GPRASP2	114928	broad.mit.edu	37	X	101972279	101972279	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A024-01A-02W-A00E-09	TCGA-AA-A024-10A-01W-A00E-09	g.chrX:101972279A>G	ENST00000535209.1	+	4	3313	c.2482A>G	c.(2482-2484)Aac>Gac	p.N828D	GPRASP2_ENST00000543253.1_Missense_Mutation_p.N828D|GPRASP2_ENST00000332262.5_Missense_Mutation_p.N828D			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	828						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						CCAAATAGACAACCAAAATGA	0.418																																					p.N828D												.	.	0			c.A2482G	X						.						80.0	84.0	83.0					X																	101972279		2198	4282	6480	101858935	SO:0001583	missense	114928	exon5			AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.2482A>G	X.37:g.101972279A>G	ENSP00000437394:p.Asn828Asp	None		Capture	Illumina HiSeq	Phase_I	101858935	NM_001004051	D3DXA0|Q8NAB4	Missense_Mutation	SNP	ENST00000535209.1	37	CCDS14501.1	.	.	.	.	.	.	.	.	.	.	A	9.424	1.083841	0.20309	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.26660	1.72;1.72;1.72	4.04	4.04	0.47022	Armadillo-type fold (1);	0.153032	0.30791	N	0.008869	T	0.12347	0.0300	N	0.11560	0.145	0.30134	N	0.804569	B	0.17465	0.022	B	0.17433	0.018	T	0.11446	-1.0587	10	0.22706	T	0.39	-11.662	8.4596	0.32921	1.0:0.0:0.0:0.0	.	828	Q96D09	GASP2_HUMAN	D	828	ENSP00000437872:N828D;ENSP00000437394:N828D;ENSP00000339057:N828D	ENSP00000339057:N828D	N	+	1	0	GPRASP2	101858935	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.114000	0.41911	1.816000	0.52996	0.417000	0.27973	AAC		GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437	
