#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
OGDHL	55753	broad.mit.edu	37	10	50944453	50944453	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr10:50944453G>A	ENST00000374103.4	-	21	2789	c.2704C>T	c.(2704-2706)Cgg>Tgg	p.R902W	OGDHL_ENST00000419399.1_Missense_Mutation_p.R845W|OGDHL_ENST00000490844.1_5'UTR|OGDHL_ENST00000432695.1_Missense_Mutation_p.R693W	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	902					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.R902W(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						TGGCTGCTCCGCTCCTTCACC	0.617																																					p.R845W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2533T	10						.						119.0	110.0	113.0					10																	50944453		2203	4300	6503	50614459	SO:0001583	missense	55753	exon20			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.2704C>T	10.37:g.50944453G>A	ENSP00000363216:p.Arg902Trp	Somatic		Capture	Illumina HiSeq	Phase_I	50614459	NM_001143996	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	ENST00000374103.4	37	CCDS7234.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.073147	0.76415	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	T;T;T	0.12879	2.64;2.64;2.64	5.19	3.21	0.36854	.	0.053342	0.64402	N	0.000001	T	0.48978	0.1530	H	0.98276	4.19	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.56768	-0.7924	10	0.87932	D	0	.	6.5262	0.22303	0.0922:0.0:0.55:0.3578	.	845;693;902	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	W	902;845;693	ENSP00000363216:R902W;ENSP00000401356:R845W;ENSP00000390240:R693W	ENSP00000363216:R902W	R	-	1	2	OGDHL	50614459	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	2.123000	0.41996	1.191000	0.43056	0.484000	0.47621	CGG		OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245	
CDH23	64072	broad.mit.edu	37	10	73558900	73558900	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr10:73558900G>A	ENST00000224721.6	+	50	7107	c.7102G>A	c.(7102-7104)Gag>Aag	p.E2368K	CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000398788.3_Missense_Mutation_p.E123K	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2363	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)	p.E2368K(1)		NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						AGTGGACTACGAGGAGGTGCA	0.567																																					p.E123K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G367A	10						.						91.0	100.0	97.0					10																	73558900		2014	4187	6201	73228906	SO:0001583	missense	64072	exon4			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.7102G>A	10.37:g.73558900G>A	ENSP00000224721:p.Glu2368Lys	Somatic		Capture	Illumina HiSeq	Phase_I	73228906	NM_001171933	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37		.	.	.	.	.	.	.	.	.	.	G	34	5.339842	0.95783	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	T	0.72394	-0.65	5.55	5.55	0.83447	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.89853	0.6835	H	0.96301	3.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.989	D	0.92560	0.6057	10	0.72032	D	0.01	.	19.516	0.95165	0.0:0.0:1.0:0.0	.	2363;2363	E9PEX1;Q9H251	.;CAD23_HUMAN	K	2368;2363;2366;123	ENSP00000381768:E123K	ENSP00000224721:E2368K	E	+	1	0	CDH23	73228906	1.000000	0.71417	0.987000	0.45799	0.596000	0.36781	9.827000	0.99397	2.623000	0.88846	0.655000	0.94253	GAG		CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
KIAA1377	57562	broad.mit.edu	37	11	101793458	101793458	+	Missense_Mutation	SNP	G	G	A	rs78220060		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr11:101793458G>A	ENST00000263468.8	+	2	485	c.215G>A	c.(214-216)cGt>cAt	p.R72H		NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	72								p.R72H(1)		breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		AATCGAGCACGTAAATATTTT	0.308													G|||	1	0.000199681	0.0	0.0	5008	,	,		18273	0.001		0.0	False		,,,				2504	0.0				p.R72H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G215A	11						.						69.0	72.0	71.0					11																	101793458		2202	4299	6501	101298668	SO:0001583	missense	57562	exon2			AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.215G>A	11.37:g.101793458G>A	ENSP00000263468:p.Arg72His	Somatic		Capture	Illumina HiSeq	Phase_I	101298668	NM_020802	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	37	CCDS31658.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	23.1	4.374292	0.82573	.	.	ENSG00000110318	ENST00000263468	T	0.13307	2.6	5.84	5.84	0.93424	.	0.000000	0.64402	D	0.000006	T	0.33644	0.0870	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.01909	-1.1249	10	0.72032	D	0.01	-7.3801	10.9711	0.47441	0.0844:0.0:0.9156:0.0	.	72	Q9P2H0	K1377_HUMAN	H	72	ENSP00000263468:R72H	ENSP00000263468:R72H	R	+	2	0	KIAA1377	101298668	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.042000	0.49815	2.758000	0.94735	0.591000	0.81541	CGT		KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
OR4S1	256148	broad.mit.edu	37	11	48328664	48328664	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr11:48328664G>T	ENST00000319988.1	+	1	890	c.890G>T	c.(889-891)aGg>aTg	p.R297M		NM_001004725.1	NP_001004725.1	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S, member 1	297						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R297M(1)		endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|skin(3)	21						AATGCCATGAGGAAGCTGTTT	0.428																																					p.R297M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G890T	11						.						66.0	62.0	63.0					11																	48328664		2201	4298	6499	48285240	SO:0001583	missense	256148	exon1			AB065908	CCDS31488.1	11p11.2	2012-08-09			ENSG00000176555	ENSG00000176555		"""GPCR / Class A : Olfactory receptors"""	14705	protein-coding gene	gene with protein product							Standard	NM_001004725		Approved		uc010rhu.2	Q8NGB4	OTTHUMG00000166578	ENST00000319988.1:c.890G>T	11.37:g.48328664G>T	ENSP00000321447:p.Arg297Met	Somatic		Capture	Illumina HiSeq	Phase_I	48285240	NM_001004725	Q6IFB4	Missense_Mutation	SNP	ENST00000319988.1	37	CCDS31488.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.595785	0.28445	.	.	ENSG00000176555	ENST00000319988	T	0.39997	1.05	5.02	-1.55	0.08558	.	.	.	.	.	T	0.46367	0.1389	L	0.58925	1.835	0.09310	N	0.999991	P	0.47034	0.889	P	0.50490	0.642	T	0.46261	-0.9204	9	0.72032	D	0.01	.	10.054	0.42233	0.556:0.0:0.444:0.0	.	297	Q8NGB4	OR4S1_HUMAN	M	297	ENSP00000321447:R297M	ENSP00000321447:R297M	R	+	2	0	OR4S1	48285240	0.001000	0.12720	0.155000	0.22561	0.227000	0.25037	-0.585000	0.05794	-0.525000	0.06391	-0.137000	0.14449	AGG		OR4S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390556.1	NM_001004725	
OR8H2	390151	broad.mit.edu	37	11	55873040	55873040	+	Silent	SNP	T	T	C			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr11:55873040T>C	ENST00000313503.1	+	1	522	c.522T>C	c.(520-522)atT>atC	p.I174I		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I174I(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CAAACGTAATTCATCACTTTT	0.428										HNSCC(53;0.14)																											p.I174I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T522C	11						.						267.0	243.0	251.0					11																	55873040		2201	4296	6497	55629616	SO:0001819	synonymous_variant	390151	exon1			AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.522T>C	11.37:g.55873040T>C		Somatic		Capture	Illumina HiSeq	Phase_I	55629616	NM_001005200	Q6IFC1	Silent	SNP	ENST00000313503.1	37	CCDS31518.1																																																																																				OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200	
OR5A2	219981	broad.mit.edu	37	11	59189472	59189472	+	Missense_Mutation	SNP	T	T	C	rs556816690		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr11:59189472T>C	ENST00000302040.4	-	1	977	c.955A>G	c.(955-957)Att>Gtt	p.I319V		NM_001001954.1	NP_001001954.1	Q8NGI9	OR5A2_HUMAN	olfactory receptor, family 5, subfamily A, member 2	319						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I319V(1)		large_intestine(3)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	21						GTCATAAAAATGAATGGTCCA	0.383													T|||	1	0.000199681	0.0	0.0	5008	,	,		21062	0.001		0.0	False		,,,				2504	0.0				p.I319V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A955G	11						.						89.0	91.0	90.0					11																	59189472		2201	4295	6496	58946048	SO:0001583	missense	219981	exon1			AB065805	CCDS31560.1	11q12.1	2012-08-09			ENSG00000172324	ENSG00000172324		"""GPCR / Class A : Olfactory receptors"""	15249	protein-coding gene	gene with protein product							Standard	NM_001001954		Approved		uc010rkt.2	Q8NGI9	OTTHUMG00000167419	ENST00000302040.4:c.955A>G	11.37:g.59189472T>C	ENSP00000303834:p.Ile319Val	Somatic		Capture	Illumina HiSeq	Phase_I	58946048	NM_001001954	B9EH21|Q6IFF4|Q96RB0	Missense_Mutation	SNP	ENST00000302040.4	37	CCDS31560.1	.	.	.	.	.	.	.	.	.	.	T	13.48	2.248324	0.39697	.	.	ENSG00000172324	ENST00000302040	T	0.00002	9.87	4.61	-9.22	0.00675	.	.	.	.	.	T	0.00039	0.0001	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21586	-1.0241	9	0.06099	T	0.92	.	7.2816	0.26314	0.0:0.2209:0.469:0.3101	.	319	Q8NGI9	OR5A2_HUMAN	V	319	ENSP00000303834:I319V	ENSP00000303834:I319V	I	-	1	0	OR5A2	58946048	0.000000	0.05858	0.001000	0.08648	0.235000	0.25334	-2.876000	0.00717	-1.458000	0.01916	-0.387000	0.06579	ATT		OR5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394552.1	NM_001001954	
AHNAK	79026	broad.mit.edu	37	11	62300587	62300587	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr11:62300587C>A	ENST00000378024.4	-	5	1576	c.1302G>T	c.(1300-1302)atG>atT	p.M434I	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	434					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.M434I(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TGGGGACTTTCATCTTGGGCA	0.542																																					p.M434I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1302T	11						.						92.0	93.0	92.0					11																	62300587		2202	4299	6501	62057163	SO:0001583	missense	79026	exon5			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.1302G>T	11.37:g.62300587C>A	ENSP00000367263:p.Met434Ile	Somatic		Capture	Illumina HiSeq	Phase_I	62057163	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	C	6.974	0.549715	0.13374	.	.	ENSG00000124942	ENST00000378024	T	0.00958	5.5	5.56	3.68	0.42216	.	0.988835	0.08214	N	0.980158	T	0.01254	0.0041	L	0.42245	1.32	0.21105	N	0.999788	B	0.23249	0.082	B	0.25291	0.059	T	0.51309	-0.8722	10	0.15952	T	0.53	-2.0754	8.7052	0.34349	0.0:0.7663:0.152:0.0818	.	434	Q09666	AHNK_HUMAN	I	434	ENSP00000367263:M434I	ENSP00000367263:M434I	M	-	3	0	AHNAK	62057163	0.032000	0.19561	0.006000	0.13384	0.793000	0.44817	0.045000	0.14013	0.688000	0.31529	0.650000	0.86243	ATG		AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
SLC22A8	9376	broad.mit.edu	37	11	62762134	62762134	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr11:62762134C>T	ENST00000336232.2	-	8	1231	c.1096G>A	c.(1096-1098)Gat>Aat	p.D366N	SLC22A8_ENST00000545207.1_Missense_Mutation_p.D275N|SLC22A8_ENST00000311438.8_Missense_Mutation_p.D366N|SLC22A8_ENST00000542795.1_5'Flank|SLC22A8_ENST00000535878.1_Missense_Mutation_p.D243N|SLC22A8_ENST00000430500.2_Missense_Mutation_p.D366N	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	366					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)	p.D366N(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	GCTGGGACATCGACCCCACCA	0.547																																					p.D366N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1096A	11						.						145.0	109.0	121.0					11																	62762134		2201	4298	6499	62518710	SO:0001583	missense	9376	exon8			AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.1096G>A	11.37:g.62762134C>T	ENSP00000337335:p.Asp366Asn	Somatic		Capture	Illumina HiSeq	Phase_I	62518710	NM_001184732	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Missense_Mutation	SNP	ENST00000336232.2	37	CCDS8042.1	.	.	.	.	.	.	.	.	.	.	C	29.4	4.998802	0.93227	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000545207;ENST00000535878;ENST00000311438;ENST00000430500	T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25	5.31	5.31	0.75309	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.82328	0.5013	M	0.80028	2.48	0.58432	D	0.999991	D;D	0.76494	0.999;0.999	D;D	0.78314	0.984;0.991	D	0.83740	0.0203	10	0.52906	T	0.07	.	16.5015	0.84257	0.0:1.0:0.0:0.0	.	366;366	Q8TCC7-2;Q8TCC7	.;S22A8_HUMAN	N	366;352;275;243;366;366	ENSP00000337335:D366N;ENSP00000441658:D275N;ENSP00000443368:D243N;ENSP00000311463:D366N;ENSP00000398548:D366N	ENSP00000311463:D366N	D	-	1	0	SLC22A8	62518710	1.000000	0.71417	0.509000	0.27700	0.964000	0.63967	6.958000	0.76025	2.481000	0.83766	0.561000	0.74099	GAT		SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396191.1	NM_004254	
ESRRA	2101	broad.mit.edu	37	11	64083221	64083221	+	Missense_Mutation	SNP	G	G	C	rs200986301		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr11:64083221G>C	ENST00000405666.1	+	7	1289	c.1055G>C	c.(1054-1056)cGa>cCa	p.R352P	PRDX5_ENST00000347941.4_5'Flank|PRDX5_ENST00000352435.4_5'Flank|PRDX5_ENST00000265462.4_5'Flank|ESRRA_ENST00000406310.1_Missense_Mutation_p.R351P|ESRRA_ENST00000000442.6_Missense_Mutation_p.R352P	NM_001282450.1	NP_001269379.1	P11474	ERR1_HUMAN	estrogen-related receptor alpha	352	Ligand binding domain.				cartilage development (GO:0051216)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.R352P(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						GAGCAGCTGCGAGAAGCTCTG	0.662																																					p.R352P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1055C	11						.						68.0	69.0	68.0					11																	64083221		1995	4186	6181	63839797	SO:0001583	missense	2101	exon7			X51416, L38487	CCDS41667.1, CCDS60830.1	11q12	2013-01-16			ENSG00000173153	ENSG00000173153		"""Nuclear hormone receptors"""	3471	protein-coding gene	gene with protein product		601998		ESRL1		3267207	Standard	NM_004451		Approved	ERR1, ERRalpha, NR3B1, ERRa	uc001nzq.1	P11474	OTTHUMG00000150641	ENST00000405666.1:c.1055G>C	11.37:g.64083221G>C	ENSP00000384851:p.Arg352Pro	Somatic		Capture	Illumina HiSeq	Phase_I	63839797	NM_004451	Q14514	Missense_Mutation	SNP	ENST00000405666.1	37	CCDS41667.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.36|17.36	3.368790|3.368790	0.61624|0.61624	.|.	.|.	ENSG00000173153|ENSG00000173153	ENST00000545035|ENST00000406310;ENST00000000442;ENST00000405666	.|T;T;T	.|0.39997	.|1.05;1.05;1.05	4.36|4.36	3.45|3.45	0.39498|0.39498	.|Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.64294|0.64294	0.2585|0.2585	M|M	0.81682|0.81682	2.555|2.555	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.83275	.|0.996;0.911	T|T	0.69446|0.69446	-0.5143|-0.5143	5|10	.|0.72032	.|D	.|0.01	.|.	12.4594|12.4594	0.55723|0.55723	0.0:0.1705:0.8295:0.0|0.0:0.1705:0.8295:0.0	.|.	.|351;352	.|P11474-2;P11474	.|.;ERR1_HUMAN	Q|P	133|351;352;352	.|ENSP00000385971:R351P;ENSP00000000442:R352P;ENSP00000384851:R352P	.|ENSP00000000442:R352P	E|R	+|+	1|2	0|0	ESRRA|ESRRA	63839797|63839797	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	2.639000|2.639000	0.46570|0.46570	1.213000|1.213000	0.43380|0.43380	-0.218000|-0.218000	0.12543|0.12543	GAG|CGA		ESRRA-003	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319304.1	NM_004451	
CADM1	23705	broad.mit.edu	37	11	115099876	115099876	+	Silent	SNP	C	C	T	rs138595924	byFrequency	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr11:115099876C>T	ENST00000452722.3	-	5	698	c.678G>A	c.(676-678)gcG>gcA	p.A226A	CADM1_ENST00000331581.6_Silent_p.A226A|CADM1_ENST00000542447.2_Silent_p.A226A|CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000537058.1_Silent_p.A226A|CADM1_ENST00000536727.1_Silent_p.A226A	NM_014333.3	NP_055148.3			cell adhesion molecule 1									p.A226A(1)		cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		TTCCAGTGACCGCAGGGTGCT	0.522													C|||	37	0.00738818	0.0272	0.0014	5008	,	,		16144	0.0		0.0	False		,,,				2504	0.0				p.A226A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G678A	11						.	C	,	129,4273	95.3+/-134.0	3,123,2075	89.0	68.0	75.0		678,678	-12.3	0.5	11	dbSNP_134	75	0,8592		0,0,4296	no	coding-synonymous,coding-synonymous	CADM1	NM_001098517.1,NM_014333.3	,	3,123,6371	TT,TC,CC		0.0,2.9305,0.9928	,	226/415,226/443	115099876	129,12865	2201	4296	6497	114605086	SO:0001819	synonymous_variant	23705	exon5			AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.678G>A	11.37:g.115099876C>T		Somatic		Capture	Illumina HiSeq	Phase_I	114605086	NM_014333		Silent	SNP	ENST00000452722.3	37	CCDS8373.1	14	0.00641025641025641	13	0.026422764227642278	1	0.0027624309392265192	0	0.0	0	0.0	C	10.45	1.353560	0.24512	0.029305	0.0	ENSG00000182985	ENST00000545380	.	.	.	6.17	-12.3	0.00002	.	.	.	.	.	T	0.10852	0.0265	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37244	-0.9714	4	.	.	.	.	0.5308	0.00628	0.3544:0.1406:0.2278:0.2772	.	.	.	.	S	225	.	.	G	-	1	0	CADM1	114605086	0.000000	0.05858	0.497000	0.27552	0.982000	0.71751	-5.388000	0.00126	-1.947000	0.01034	-0.345000	0.07892	GGT		CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
SLCO1A2	6579	broad.mit.edu	37	12	21457448	21457448	+	Missense_Mutation	SNP	G	G	A	rs11568564	byFrequency	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr12:21457448G>A	ENST00000307378.6	-	7	1222	c.502C>T	c.(502-504)Cgt>Tgt	p.R168C	SLCO1A2_ENST00000537524.1_Missense_Mutation_p.R36C|SLCO1A2_ENST00000452078.1_Missense_Mutation_p.R168C|SLCO1A2_ENST00000390670.3_Missense_Mutation_p.R166C|SLCO1A2_ENST00000458504.1_Missense_Mutation_p.R36C	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	168					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.R168C(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	CCCATTCCACGTACAATATTG	0.348																																					p.R168C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C502T	12						.	G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	101.0	95.0	97.0		502,502	4.8	1.0	12	dbSNP_126	97	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SLCO1A2	NM_021094.3,NM_134431.3	180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	168/671,168/671	21457448	1,13005	2203	4300	6503	21348715	SO:0001583	missense	6579	exon7				CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.502C>T	12.37:g.21457448G>A	ENSP00000305974:p.Arg168Cys	Somatic		Capture	Illumina HiSeq	Phase_I	21348715	NM_134431	Q9UGP7|Q9UL38	Missense_Mutation	SNP	ENST00000307378.6	37	CCDS8686.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.052825	0.75960	0.0	1.16E-4	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000458504;ENST00000537524;ENST00000390670	T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33	4.75	4.75	0.60458	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.80003	0.4544	M	0.88105	2.93	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.986	T	0.82424	-0.0464	10	0.45353	T	0.12	.	17.9325	0.89002	0.0:0.0:1.0:0.0	rs11568564;rs45488497;rs11568564	148;166;168	Q8IV69;P46721-2;P46721	.;.;SO1A2_HUMAN	C	168;168;36;36;166	ENSP00000305974:R168C;ENSP00000393973:R168C;ENSP00000394854:R36C;ENSP00000439401:R36C;ENSP00000375088:R166C	ENSP00000305974:R168C	R	-	1	0	SLCO1A2	21348715	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	5.137000	0.64789	2.466000	0.83321	0.591000	0.81541	CGT		SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343648.3	NM_021094	
KRT76	51350	broad.mit.edu	37	12	53166627	53166627	+	Silent	SNP	C	C	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr12:53166627C>A	ENST00000332411.2	-	4	965	c.912G>T	c.(910-912)ctG>ctT	p.L304L		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	304	Coil 1B.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.L304L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CTTTGGCCTGCAGCTCCACCT	0.542																																					p.L304L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G912T	12						.						154.0	137.0	143.0					12																	53166627		2203	4300	6503	51452894	SO:0001819	synonymous_variant	51350	exon4			M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.912G>T	12.37:g.53166627C>A		Somatic		Capture	Illumina HiSeq	Phase_I	51452894	NM_015848	B4DRR3|Q7Z795	Silent	SNP	ENST00000332411.2	37	CCDS8838.1																																																																																				KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405928.1	NM_015848	
WIF1	11197	broad.mit.edu	37	12	65514270	65514270	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr12:65514270T>A	ENST00000286574.4	-	2	589	c.215A>T	c.(214-216)aAa>aTa	p.K72I		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	72	WIF. {ECO:0000255|PROSITE- ProRule:PRU00222}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)		p.K72I(2)		cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		CTGTTGTGCTTTTCTGAAATC	0.378			T	HMGA2	pleomorphic salivary gland adenoma																																p.K72I	Esophageal Squamous(148;1595 1816 48559 49439 49664)		Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A215T	12						.						143.0	148.0	146.0					12																	65514270		2203	4300	6503	63800537	SO:0001583	missense	11197	exon2			AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.215A>T	12.37:g.65514270T>A	ENSP00000286574:p.Lys72Ile	Somatic		Capture	Illumina HiSeq	Phase_I	63800537	NM_007191	Q6UXI1|Q8WVG4	Missense_Mutation	SNP	ENST00000286574.4	37	CCDS8971.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.936726	0.52972	.	.	ENSG00000156076	ENST00000286574;ENST00000546001	D	0.89343	-2.5	5.5	4.29	0.51040	WIF domain (4);	0.051770	0.85682	D	0.000000	D	0.87083	0.6089	L	0.36672	1.1	0.58432	D	0.999992	B	0.19200	0.034	B	0.41619	0.361	T	0.79633	-0.1722	9	.	.	.	.	11.2241	0.48873	0.0:0.0758:0.0:0.9242	.	72	Q9Y5W5	WIF1_HUMAN	I	72;10	ENSP00000286574:K72I	.	K	-	2	0	WIF1	63800537	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	4.074000	0.57577	0.959000	0.37980	0.533000	0.62120	AAA		WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401258.2		
LRRIQ1	84125	broad.mit.edu	37	12	85492697	85492697	+	Missense_Mutation	SNP	A	A	T	rs377283061		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr12:85492697A>T	ENST00000393217.2	+	13	3195	c.3134A>T	c.(3133-3135)aAc>aTc	p.N1045I		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1045								p.N1045I(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TTGGATGATAACAGCATTTCA	0.289																																					p.N1045I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A3134T	12						.						93.0	95.0	95.0					12																	85492697		2202	4290	6492	84016828	SO:0001583	missense	84125	exon13			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3134A>T	12.37:g.85492697A>T	ENSP00000376910:p.Asn1045Ile	Somatic		Capture	Illumina HiSeq	Phase_I	84016828	NM_032165	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.103747	0.76983	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.37915	1.17	5.4	5.4	0.78164	.	0.050999	0.85682	N	0.000000	T	0.70133	0.3189	H	0.94925	3.6	0.41718	D	0.98949	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.80013	-0.1560	10	0.87932	D	0	.	14.3953	0.67007	1.0:0.0:0.0:0.0	.	1045;1020	Q96JM4;C9JI57	LRIQ1_HUMAN;.	I	1045;1020;1045	ENSP00000376910:N1045I	ENSP00000256007:N1045I	N	+	2	0	LRRIQ1	84016828	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.942000	0.63547	2.038000	0.60285	0.477000	0.44152	AAC		LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
UGGT2	55757	broad.mit.edu	37	13	96601605	96601605	+	Missense_Mutation	SNP	C	C	T	rs201688380		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr13:96601605C>T	ENST00000376747.3	-	13	1509	c.1439G>A	c.(1438-1440)cGc>cAc	p.R480H		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	480					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)	p.R480H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						ATGAAAATTGCGCCTTATGGA	0.313													C|||	1	0.000199681	0.0	0.0	5008	,	,		15465	0.0		0.001	False		,,,				2504	0.0				p.R480H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1439A	13						.						39.0	42.0	41.0					13																	96601605		2203	4299	6502	95399606	SO:0001583	missense	55757	exon13			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.1439G>A	13.37:g.96601605C>T	ENSP00000365938:p.Arg480His	Somatic		Capture	Illumina HiSeq	Phase_I	95399606	NM_020121	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	ENST00000376747.3	37	CCDS9480.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	18.94	3.729753	0.69074	.	.	ENSG00000102595	ENST00000376747	T	0.03124	4.04	5.57	5.57	0.84162	.	0.106388	0.64402	D	0.000002	T	0.21962	0.0529	M	0.86953	2.85	0.80722	D	1	D	0.76494	0.999	D	0.65140	0.932	T	0.00706	-1.1601	10	0.87932	D	0	-12.7116	18.2993	0.90158	0.0:1.0:0.0:0.0	.	480	Q9NYU1	UGGG2_HUMAN	H	480	ENSP00000365938:R480H	ENSP00000365938:R480H	R	-	2	0	UGGT2	95399606	1.000000	0.71417	1.000000	0.80357	0.431000	0.31685	6.504000	0.73704	2.616000	0.88540	0.585000	0.79938	CGC		UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121	
GLYR1	84656	broad.mit.edu	37	16	4882006	4882006	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr16:4882006G>C	ENST00000321919.9	-	5	587	c.511C>G	c.(511-513)Cgg>Ggg	p.R171G	GLYR1_ENST00000436648.5_Intron|GLYR1_ENST00000586901.1_5'UTR|GLYR1_ENST00000381983.3_Missense_Mutation_p.R171G|GLYR1_ENST00000591451.1_Missense_Mutation_p.R171G	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	171					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)	p.R171G(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						GGCCGACCCCGCTTCCGGGGA	0.498																																					p.R171G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C511G	16						.						49.0	54.0	52.0					16																	4882006		2197	4300	6497	4822007	SO:0001583	missense	84656	exon5			AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.511C>G	16.37:g.4882006G>C	ENSP00000322716:p.Arg171Gly	Somatic		Capture	Illumina HiSeq	Phase_I	4822007	NM_032569	B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Missense_Mutation	SNP	ENST00000321919.9	37	CCDS10524.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.306319	0.40795	.	.	ENSG00000140632	ENST00000321919;ENST00000381983	T;T	0.66995	-0.24;-0.22	5.29	5.29	0.74685	AT hook, DNA-binding motif (1);	0.243111	0.41194	D	0.000928	T	0.50514	0.1620	N	0.14661	0.345	0.50313	D	0.999861	B;B;B	0.13594	0.008;0.002;0.002	B;B;B	0.08055	0.003;0.002;0.001	T	0.43065	-0.9414	10	0.18710	T	0.47	-14.5991	18.0706	0.89405	0.0:0.0:1.0:0.0	.	171;171;171	Q49A26-3;Q49A26-2;Q49A26	.;.;GLYR1_HUMAN	G	171	ENSP00000322716:R171G;ENSP00000371413:R171G	ENSP00000322716:R171G	R	-	1	2	GLYR1	4822007	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.774000	0.75012	2.634000	0.89283	0.650000	0.86243	CGG		GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251717.2	NM_032569	
TP53	7157	broad.mit.edu	37	17	7579349	7579349	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr17:7579349A>C	ENST00000269305.4	-	4	527	c.338T>G	c.(337-339)tTc>tGc	p.F113C	TP53_ENST00000445888.2_Missense_Mutation_p.F113C|TP53_ENST00000359597.4_Missense_Mutation_p.F113C|TP53_ENST00000455263.2_Missense_Mutation_p.F113C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.F113C|TP53_ENST00000420246.2_Missense_Mutation_p.F113C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	113	Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> G (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|F -> I (in a sporadic cancer; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F113C(11)|p.0?(8)|p.F113S(4)|p.G59fs*23(3)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.G112fs*9(1)|p.F113del(1)|p.Y107fs*44(1)|p.G112_S116delGFLHS(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGAATGCAAGAAGCCCAGACG	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.F113C	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,-1 	.	35	Substitution - Missense(15)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(4)	upper_aerodigestive_tract(6)|lung(5)|large_intestine(4)|bone(4)|central_nervous_system(3)|ovary(3)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|breast(2)|stomach(1)|liver(1)|oesophagus(1)|autonomic_ganglia(1)	c.T338G	17						.						65.0	61.0	62.0					17																	7579349		2203	4300	6503	7520074	SO:0001583	missense	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.338T>G	17.37:g.7579349A>C	ENSP00000269305:p.Phe113Cys	Somatic		Capture	Illumina HiSeq	Phase_I	7520074	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	18.70	3.680367	0.68042	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99867	-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31	4.75	4.75	0.60458	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99854	0.9932	M	0.89414	3.03	0.52099	D	0.999945	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.995;1.0;1.0;1.0	D	0.96472	0.9349	10	0.87932	D	0	-31.6488	12.5363	0.56144	1.0:0.0:0.0:0.0	.	74;113;113;113;113;113;113	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	113	ENSP00000410739:F113C;ENSP00000352610:F113C;ENSP00000269305:F113C;ENSP00000398846:F113C;ENSP00000391127:F113C;ENSP00000391478:F113C;ENSP00000424104:F113C;ENSP00000426252:F113C	ENSP00000269305:F113C	F	-	2	0	TP53	7520074	1.000000	0.71417	0.986000	0.45419	0.960000	0.62799	5.450000	0.66626	2.125000	0.65367	0.533000	0.62120	TTC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DHX58	79132	broad.mit.edu	37	17	40257170	40257170	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr17:40257170C>T	ENST00000251642.3	-	10	1489	c.1267G>A	c.(1267-1269)Gtg>Atg	p.V423M		NM_024119.2	NP_077024.2	Q96C10	DHX58_HUMAN	DEXH (Asp-Glu-X-His) box polypeptide 58	423	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of innate immune response (GO:0045824)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of type I interferon production (GO:0032481)|regulation of innate immune response (GO:0045088)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TTCTGGATCACTTCTTGCTGG	0.582																																					p.V423M												.	.	0			c.G1267A	17						.						54.0	45.0	48.0					17																	40257170		2203	4299	6502	37510696	SO:0001583	missense	79132	exon10			BC014949	CCDS11416.1	17q21.2	2008-02-05			ENSG00000108771	ENSG00000108771			29517	protein-coding gene	gene with protein product	"""RNA helicase LGP2"""	608588				11735219	Standard	NM_024119		Approved	LGP2, D11LGP2	uc002hyw.3	Q96C10	OTTHUMG00000133493	ENST00000251642.3:c.1267G>A	17.37:g.40257170C>T	ENSP00000251642:p.Val423Met	None		Capture	Illumina HiSeq	Phase_I	37510696	NM_024119	Q9HAM6	Missense_Mutation	SNP	ENST00000251642.3	37	CCDS11416.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.895581	0.52121	.	.	ENSG00000108771	ENST00000251642;ENST00000423748	T	0.77620	-1.11	4.87	4.87	0.63330	Helicase, C-terminal (3);	0.138414	0.49305	D	0.000148	D	0.88358	0.6415	M	0.81497	2.545	0.42181	D	0.991689	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.995	D	0.89580	0.3820	10	0.59425	D	0.04	.	16.7659	0.85524	0.0:1.0:0.0:0.0	.	416;423	B7Z455;Q96C10	.;DHX58_HUMAN	M	423;386	ENSP00000251642:V423M	ENSP00000251642:V423M	V	-	1	0	DHX58	37510696	1.000000	0.71417	0.996000	0.52242	0.204000	0.24138	4.359000	0.59449	2.547000	0.85894	0.462000	0.41574	GTG		DHX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257396.1	NM_024119	
CELF4	56853	broad.mit.edu	37	18	35145332	35145332	+	Silent	SNP	T	T	G			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr18:35145332T>G	ENST00000591282.1	-	1	272	c.273A>C	c.(271-273)acA>acC	p.T91T	CELF4_ENST00000361795.5_Silent_p.T91T|CELF4_ENST00000601019.1_Silent_p.T91T|CELF4_ENST00000588597.1_Silent_p.T91T|CELF4_ENST00000420428.2_Silent_p.T91T|CELF4_ENST00000591287.1_Silent_p.T91T|CELF4_ENST00000334919.5_Silent_p.T91T|CELF4_ENST00000603232.1_Silent_p.T91T|CELF4_ENST00000412753.1_Silent_p.T91T			Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4	91	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.|Sufficient for RNA-binding and MSE- dependent splicing activity.				alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)	p.T91T(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						TGTGCATGCCTGTGAACCTGT	0.622																																					p.T91T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A273C	18						.						130.0	118.0	122.0					18																	35145332		2203	4300	6503	33399330	SO:0001819	synonymous_variant	56853	exon1			AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000591282.1:c.273A>C	18.37:g.35145332T>G		Somatic		Capture	Illumina HiSeq	Phase_I	33399330	NM_001025089	Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	Silent	SNP	ENST00000591282.1	37	CCDS32818.1																																																																																				CELF4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440892.1	NM_020180	
ZNF573	126231	broad.mit.edu	37	19	38229639	38229639	+	Silent	SNP	A	A	G			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr19:38229639A>G	ENST00000590414.2	-	4	1773	c.1752T>C	c.(1750-1752)tgT>tgC	p.C584C	ZNF573_ENST00000536220.1_Silent_p.C496C|ZNF573_ENST00000392138.1_Silent_p.C497C|ZNF573_ENST00000357309.3_Silent_p.C496C|ZNF573_ENST00000339503.4_Silent_p.C526C			Q86YE8	ZN573_HUMAN	zinc finger protein 573	584					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C526C(1)		NS(1)|cervix(3)|endometrium(2)|large_intestine(8)|liver(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			CACATTCTTTACATTCATAGG	0.378																																					p.C582C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1746C	19						.						76.0	77.0	77.0					19																	38229639		2203	4300	6503	42921479	SO:0001819	synonymous_variant	126231	exon5			AK074539	CCDS12508.1, CCDS54260.1, CCDS59381.1	19q13.12	2013-09-20			ENSG00000189144	ENSG00000189144		"""Zinc fingers, C2H2-type"", ""-"""	26420	protein-coding gene	gene with protein product						12477932	Standard	NM_152360		Approved	FLJ30921	uc002ohe.3	Q86YE8	OTTHUMG00000048183	ENST00000590414.2:c.1752T>C	19.37:g.38229639A>G		Somatic		Capture	Illumina HiSeq	Phase_I	42921479	NM_001172691	B7WPE1|K7EJ45|Q6P1P1|Q7Z7Q3|Q8N2Q1|Q96BM3|Q96NH0	Silent	SNP	ENST00000590414.2	37	CCDS59381.1																																																																																				ZNF573-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459773.2	NM_152360	
MTOR	2475	broad.mit.edu	37	1	11199625	11199625	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr1:11199625T>A	ENST00000361445.4	-	35	5039	c.4963A>T	c.(4963-4965)Aag>Tag	p.K1655*	MTOR_ENST00000495435.1_5'UTR	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1655	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CTTGCATACTTGAGCCAGGTT	0.577																																					p.K1655X												.	.	0			c.A4963T	1						.						158.0	153.0	154.0					1																	11199625		2203	4300	6503	11122212	SO:0001587	stop_gained	2475	exon35			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.4963A>T	1.37:g.11199625T>A	ENSP00000354558:p.Lys1655*	None		Capture	Illumina HiSeq	Phase_I	11122212	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Nonsense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	T	46	12.649859	0.99685	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.2465	16.3483	0.83171	0.0:0.0:0.0:1.0	.	.	.	.	X	1655	.	ENSP00000354558:K1655X	K	-	1	0	MTOR	11122212	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.555000	0.82223	2.254000	0.74563	0.533000	0.62120	AAG		MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
TCHH	7062	broad.mit.edu	37	1	152083469	152083469	+	Missense_Mutation	SNP	G	G	C	rs368293517		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr1:152083469G>C	ENST00000368804.1	-	2	2223	c.2224C>G	c.(2224-2226)Cgg>Ggg	p.R742G		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	742					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCACTCTCCCGGCGCCGCCTC	0.657																																					p.R742G												.	.	0			c.C2224G	1						.						82.0	99.0	93.0					1																	152083469		1939	4139	6078	150350093	SO:0001583	missense	7062	exon2			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.2224C>G	1.37:g.152083469G>C	ENSP00000357794:p.Arg742Gly	None		Capture	Illumina HiSeq	Phase_I	150350093	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.819047	0.32145	.	.	ENSG00000159450	ENST00000368804	T	0.10668	2.85	4.35	2.43	0.29744	.	.	.	.	.	T	0.01523	0.0049	N	0.08118	0	0.09310	N	1	P	0.43094	0.799	B	0.39590	0.304	T	0.43686	-0.9376	9	0.20519	T	0.43	.	7.3732	0.26813	0.0968:0.1706:0.7325:0.0	.	742	Q07283	TRHY_HUMAN	G	742	ENSP00000357794:R742G	ENSP00000357794:R742G	R	-	1	2	TCHH	150350093	0.000000	0.05858	0.008000	0.14137	0.656000	0.38851	-0.071000	0.11505	0.452000	0.26830	0.457000	0.33378	CGG		TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
SPRR2E	6704	broad.mit.edu	37	1	153066212	153066212	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr1:153066212G>T	ENST00000368751.1	-	2	90	c.16C>A	c.(16-18)Cag>Aag	p.Q6K	SPRR2B_ENST00000368752.4_Intron|SPRR2E_ENST00000368750.3_Missense_Mutation_p.Q6K			P22531	SPR2E_HUMAN	small proline-rich protein 2E	6					epidermis development (GO:0008544)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)	structural molecule activity (GO:0005198)	p.Q6K(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTGCACTGCTGCTGTTGATAA	0.557																																					p.Q6K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C16A	1						.						46.0	49.0	48.0					1																	153066212		2200	4296	6496	151332836	SO:0001583	missense	6704	exon2			AF333955	CCDS30866.1	1q21-q22	2008-02-05			ENSG00000203785	ENSG00000203785			11265	protein-coding gene	gene with protein product						8325635	Standard	NM_001024209		Approved		uc001fbh.3	P22531	OTTHUMG00000014397	ENST00000368751.1:c.16C>A	1.37:g.153066212G>T	ENSP00000357740:p.Gln6Lys	Somatic		Capture	Illumina HiSeq	Phase_I	151332836	NM_001024209	Q5T9T4|Q96RM2	Missense_Mutation	SNP	ENST00000368751.1	37	CCDS30866.1	.	.	.	.	.	.	.	.	.	.	G	6.187	0.402669	0.11696	.	.	ENSG00000203785	ENST00000368751;ENST00000368750	T;T	0.38722	1.12;1.12	4.17	-0.866	0.10659	.	.	.	.	.	T	0.12646	0.0307	.	.	.	0.21984	N	0.999439	B	0.02656	0.0	B	0.06405	0.002	T	0.38023	-0.9680	8	0.87932	D	0	.	6.4697	0.22001	0.0:0.3149:0.3945:0.2906	.	6	P22531	SPR2E_HUMAN	K	6	ENSP00000357740:Q6K;ENSP00000357739:Q6K	ENSP00000357739:Q6K	Q	-	1	0	SPRR2E	151332836	1.000000	0.71417	0.962000	0.40283	0.197000	0.23852	0.749000	0.26320	0.202000	0.20498	0.411000	0.27672	CAG		SPRR2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040054.1		
ASTN1	460	broad.mit.edu	37	1	176926894	176926894	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr1:176926894C>T	ENST00000367654.3	-	11	2042	c.1831G>A	c.(1831-1833)Gac>Aac	p.D611N	ASTN1_ENST00000361833.2_Missense_Mutation_p.D603N|ASTN1_ENST00000367657.3_Missense_Mutation_p.D603N|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000424564.2_Missense_Mutation_p.D603N	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	611	EGF-like 2.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.D603N(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TTGCTGCAGTCGCGCACCGGC	0.552																																					p.D603N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1807A	1						.						66.0	62.0	63.0					1																	176926894		2203	4300	6503	175193517	SO:0001583	missense	460	exon11			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1831G>A	1.37:g.176926894C>T	ENSP00000356626:p.Asp611Asn	Somatic		Capture	Illumina HiSeq	Phase_I	175193517	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		.	.	.	.	.	.	.	.	.	.	C	35	5.536139	0.96460	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	D;D;T;D	0.88509	-2.39;-2.39;2.0;-2.39	5.58	5.58	0.84498	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.91663	0.7365	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.83275	0.996;0.988;0.988	D	0.92658	0.6139	10	0.87932	D	0	-30.3522	19.1684	0.93567	0.0:1.0:0.0:0.0	.	611;603;603	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	N	603;603;611;603;603	ENSP00000356629:D603N;ENSP00000354536:D603N;ENSP00000356626:D611N;ENSP00000395041:D603N	ENSP00000354536:D603N	D	-	1	0	ASTN1	175193517	1.000000	0.71417	0.979000	0.43373	0.954000	0.61252	7.348000	0.79366	2.618000	0.88619	0.563000	0.77884	GAC		ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
USH2A	7399	broad.mit.edu	37	1	216144116	216144116	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr1:216144116C>A	ENST00000307340.3	-	36	7194	c.6808G>T	c.(6808-6810)Gtt>Ttt	p.V2270F	USH2A_ENST00000366943.2_Missense_Mutation_p.V2270F	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2270	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.V2270F(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTCGTGATAACACCTGGGAAG	0.373										HNSCC(13;0.011)																											p.V2270F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6808T	1						.						95.0	93.0	93.0					1																	216144116		2203	4300	6503	214210739	SO:0001583	missense	7399	exon36			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6808G>T	1.37:g.216144116C>A	ENSP00000305941:p.Val2270Phe	Somatic		Capture	Illumina HiSeq	Phase_I	214210739	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	11.48	1.651257	0.29336	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.55234	0.53;0.53	5.72	2.83	0.33086	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.180476	0.26496	N	0.024051	T	0.67915	0.2944	M	0.89715	3.055	0.36131	D	0.846156	D	0.69078	0.997	D	0.63597	0.916	T	0.70296	-0.4911	10	0.23891	T	0.37	.	4.7124	0.12879	0.1414:0.5005:0.0:0.3581	.	2270	O75445	USH2A_HUMAN	F	2270	ENSP00000305941:V2270F;ENSP00000355910:V2270F	ENSP00000305941:V2270F	V	-	1	0	USH2A	214210739	0.995000	0.38212	0.999000	0.59377	0.748000	0.42578	0.757000	0.26433	0.779000	0.33543	0.591000	0.81541	GTT		USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
COL16A1	1307	broad.mit.edu	37	1	32154078	32154078	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr1:32154078T>C	ENST00000373672.3	-	26	2309	c.1793A>G	c.(1792-1794)aAa>aGa	p.K598R	COL16A1_ENST00000271069.6_Intron|COL16A1_ENST00000373668.3_Missense_Mutation_p.K598R	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	598	Collagen-like 2.|Triple-helical region 7 (COL7) with 1 imperfection.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.K598R(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CTTCTCTCCTTTCAGCCCTGG	0.577																																					p.K598R	Colon(143;498 1786 21362 25193 36625)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1793G	1						.						159.0	170.0	166.0					1																	32154078		1980	4143	6123	31926665	SO:0001583	missense	1307	exon26			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.1793A>G	1.37:g.32154078T>C	ENSP00000362776:p.Lys598Arg	Somatic		Capture	Illumina HiSeq	Phase_I	31926665	NM_001856	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	37	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	T	16.60	3.168722	0.57584	.	.	ENSG00000084636	ENST00000373672;ENST00000373668	D;D	0.95307	-3.67;-3.67	5.15	5.15	0.70609	.	.	.	.	.	D	0.95137	0.8424	L	0.44542	1.39	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.996	D;D;D	0.80764	0.994;0.992;0.987	D	0.93489	0.6834	9	0.25106	T	0.35	.	12.8166	0.57669	0.0:0.0:0.0:1.0	.	598;598;598	A6NCT7;Q07092;Q07092-2	.;COGA1_HUMAN;.	R	598	ENSP00000362776:K598R;ENSP00000362772:K598R	ENSP00000362772:K598R	K	-	2	0	COL16A1	31926665	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	3.104000	0.50306	2.089000	0.63090	0.482000	0.46254	AAA		COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
NTPCR	84284	broad.mit.edu	37	1	233091315	233091315	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr1:233091315C>A	ENST00000366628.5	+	2	134	c.47C>A	c.(46-48)aCa>aAa	p.T16K	NTPCR_ENST00000366627.4_Missense_Mutation_p.T16K	NM_032324.1	NP_115700.1	Q9BSD7	NTPCR_HUMAN	nucleoside-triphosphatase, cancer-related	16						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|nucleoside-triphosphatase activity (GO:0017111)|nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|poly(A) RNA binding (GO:0044822)	p.T16K(1)		large_intestine(2)|lung(1)|ovary(1)	4						GTTGGAAAAACAACATTGATC	0.378																																					p.T16K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C47A	1						.						46.0	45.0	45.0					1																	233091315		2202	4300	6502	231157938	SO:0001583	missense	84284	exon2			BC005102	CCDS1597.1	1q42.2	2010-12-20	2010-12-20	2010-12-20	ENSG00000135778	ENSG00000135778	3.6.1.15		28204	protein-coding gene	gene with protein product	"""human cancer-related NTPase"""		"""chromosome 1 open reading frame 57"""	C1orf57		17291528	Standard	NM_032324		Approved	MGC13186, HCR-NTPase	uc001hvj.1	Q9BSD7	OTTHUMG00000037822	ENST00000366628.5:c.47C>A	1.37:g.233091315C>A	ENSP00000355587:p.Thr16Lys	Somatic		Capture	Illumina HiSeq	Phase_I	231157938	NM_032324		Missense_Mutation	SNP	ENST00000366628.5	37	CCDS1597.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.581150	0.86748	.	.	ENSG00000135778	ENST00000366628;ENST00000366627	T;T	0.71579	-0.58;-0.58	5.12	5.12	0.69794	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.89928	0.6857	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	D	0.93099	0.6507	10	0.87932	D	0	0.1707	18.7591	0.91843	0.0:1.0:0.0:0.0	.	16;16	Q9BSD7;Q5TDF0	NTPCR_HUMAN;.	K	16	ENSP00000355587:T16K;ENSP00000355586:T16K	ENSP00000355586:T16K	T	+	2	0	NTPCR	231157938	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.546000	0.73887	2.647000	0.89833	0.655000	0.94253	ACA		NTPCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092324.2	NM_032324	
L3MBTL1	26013	broad.mit.edu	37	20	42161502	42161502	+	Silent	SNP	C	C	T	rs576853992		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr20:42161502C>T	ENST00000427442.2	+	12	1467	c.1308C>T	c.(1306-1308)acC>acT	p.T436T	L3MBTL1_ENST00000444063.1_Silent_p.T368T|L3MBTL1_ENST00000418998.1_Silent_p.T436T|L3MBTL1_ENST00000373134.1_Silent_p.T368T|L3MBTL1_ENST00000373135.3_Silent_p.T368T			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	368					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.T436T(1)		breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						CCAGTGTGACCGATGTGGTGG	0.592																																					p.T436T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1308T	20						.																																			41594916	SO:0001819	synonymous_variant	26013	exon12			U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.1308C>T	20.37:g.42161502C>T		Somatic		Capture	Illumina HiSeq	Phase_I	41594916	NM_032107	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Silent	SNP	ENST00000427442.2	37	CCDS46602.2	.	.	.	.	.	.	.	.	.	.	C	10.19	1.281132	0.23392	.	.	ENSG00000185513	ENST00000445228	.	.	.	5.18	-2.93	0.05598	.	.	.	.	.	T	0.38348	0.1037	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33085	-0.9882	4	.	.	.	.	1.2919	0.02062	0.2279:0.2358:0.1118:0.4244	.	.	.	.	L	59	.	.	P	+	2	0	L3MBTL1	41594916	0.119000	0.22226	0.980000	0.43619	0.970000	0.65996	-0.604000	0.05667	-0.400000	0.07656	-0.218000	0.12543	CCG		L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079300.3	NM_032107	
ADNP	23394	broad.mit.edu	37	20	49508798	49508798	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr20:49508798T>C	ENST00000396029.3	-	5	3020	c.2453A>G	c.(2452-2454)tAc>tGc	p.Y818C	ADNP_ENST00000396032.3_Missense_Mutation_p.Y818C|ADNP_ENST00000371602.4_Missense_Mutation_p.Y818C|ADNP_ENST00000349014.3_Missense_Mutation_p.Y818C	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	818					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y818C(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						GCCAGGCTTGTACTTTTCACA	0.393																																					p.Y818C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2453G	20						.						94.0	91.0	92.0					20																	49508798		2203	4300	6503	48942205	SO:0001583	missense	23394	exon5			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.2453A>G	20.37:g.49508798T>C	ENSP00000379346:p.Tyr818Cys	Somatic		Capture	Illumina HiSeq	Phase_I	48942205	NM_015339	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	ENST00000396029.3	37	CCDS13433.1	.	.	.	.	.	.	.	.	.	.	T	12.49	1.953087	0.34471	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77	6.07	4.98	0.66077	Homeobox (1);Homeodomain-like (1);	0.248267	0.45361	N	0.000376	T	0.68311	0.2987	N	0.14661	0.345	0.39174	D	0.962646	B	0.02656	0.0	B	0.01281	0.0	T	0.64084	-0.6490	10	0.52906	T	0.07	-3.0474	7.7314	0.28789	0.1247:0.0669:0.0:0.8084	.	818	Q9H2P0	ADNP_HUMAN	C	818	ENSP00000360662:Y818C;ENSP00000342905:Y818C;ENSP00000379346:Y818C;ENSP00000379349:Y818C	ENSP00000342905:Y818C	Y	-	2	0	ADNP	48942205	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.032000	0.49736	1.129000	0.42072	0.533000	0.62120	TAC		ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442	
PWP2	5822	broad.mit.edu	37	21	45542075	45542075	+	Missense_Mutation	SNP	C	C	T	rs186297602		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr21:45542075C>T	ENST00000291576.7	+	14	1781	c.1654C>T	c.(1654-1656)Cgc>Tgc	p.R552C		NM_005049.2	NP_005040.2	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog (yeast)	552					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)	p.R552C(1)		cervix(1)|endometrium(6)|large_intestine(6)|lung(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	21				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		TGTGACTTTTCGCCCTGATGG	0.602													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19783	0.0		0.0	False		,,,				2504	0.0				p.R552C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1654T	21						.						184.0	139.0	154.0					21																	45542075		2203	4300	6503	44366503	SO:0001583	missense	5822	exon14				CCDS33579.1	21q22.3	2013-01-10	2001-11-28	2006-11-24	ENSG00000241945	ENSG00000241945		"""WD repeat domain containing"""	9711	protein-coding gene	gene with protein product		601475	"""PWP2 (periodic tryptophan protein, yeast) homolog"""	PWP2H		8893822	Standard	NM_005049		Approved	EHOC-17, UTP1	uc002zeb.3	Q15269	OTTHUMG00000086893	ENST00000291576.7:c.1654C>T	21.37:g.45542075C>T	ENSP00000291576:p.Arg552Cys	Somatic		Capture	Illumina HiSeq	Phase_I	44366503	NM_005049	B2RAG8|Q96A77	Missense_Mutation	SNP	ENST00000291576.7	37	CCDS33579.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	22.7	4.324112	0.81580	.	.	ENSG00000241945	ENST00000291576	T	0.04603	3.59	5.17	4.26	0.50523	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.050882	0.85682	D	0.000000	T	0.22085	0.0532	M	0.83312	2.635	0.58432	D	0.999999	D	0.89917	1.0	D	0.65874	0.939	T	0.02617	-1.1133	10	0.66056	D	0.02	-16.4369	15.0497	0.71858	0.1434:0.8566:0.0:0.0	.	552	Q15269	PWP2_HUMAN	C	552	ENSP00000291576:R552C	ENSP00000291576:R552C	R	+	1	0	PWP2	44366503	1.000000	0.71417	0.297000	0.24988	0.930000	0.56654	7.070000	0.76763	1.250000	0.43966	0.591000	0.81541	CGC		PWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195736.3	NM_005049	
SERPIND1	3053	broad.mit.edu	37	22	21133979	21133979	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr22:21133979delA	ENST00000215727.5	+	2	662	c.379delA	c.(379-381)aacfs	p.N127fs	SERPIND1_ENST00000406799.1_Frame_Shift_Del_p.N127fs|PI4KA_ENST00000466162.1_Intron|PI4KA_ENST00000572273.1_Intron|PI4KA_ENST00000255882.6_Intron	NM_000185.3	NP_000176.2	P05546	HEP2_HUMAN	serpin peptidase inhibitor, clade D (heparin cofactor), member 1	127					blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.N127fs*15(2)		breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)|Sulodexide(DB06271)	CCAGCGTCTTAACATCCTCAA	0.502																																					p.N127fs												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.379delA	22						.						89.0	75.0	80.0					22																	21133979		2203	4300	6503	19463979	SO:0001589	frameshift_variant	3053	exon2			M12849	CCDS13783.1	22q11.21	2014-02-18	2005-08-18		ENSG00000099937	ENSG00000099937		"""Serine (or cysteine) peptidase inhibitors"""	4838	protein-coding gene	gene with protein product	"""heparin cofactor II"""	142360	"""serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1"""	HCF2		1671335, 24172014	Standard	XM_005261597		Approved	HC-II, HLS2, HC2, D22S673	uc002ztb.1	P05546	OTTHUMG00000150755	ENST00000215727.5:c.379delA	22.37:g.21133979delA	ENSP00000215727:p.Asn127fs	Somatic		Capture	Illumina HiSeq	Phase_I	19463979	NM_000185	B2RAI1|D3DX34|Q6IBZ5	Frame_Shift_Del	DEL	ENST00000215727.5	37	CCDS13783.1																																																																																				SERPIND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319961.1	NM_000185	
PSD4	23550	broad.mit.edu	37	2	113953763	113953763	+	Silent	SNP	G	G	A	rs369936457		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr2:113953763G>A	ENST00000245796.6	+	12	2460	c.2265G>A	c.(2263-2265)ccG>ccA	p.P755P	PSD4_ENST00000441564.3_Silent_p.P727P	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	755					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)	p.P755P(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGGCCCAGCCGTCCCTGCCAG	0.562																																					p.P755P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2265A	2						.	G		0,4406		0,0,2203	90.0	78.0	82.0		2265	-1.3	0.0	2		82	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PSD4	NM_012455.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		755/1057	113953763	1,13005	2203	4300	6503	113670234	SO:0001819	synonymous_variant	23550	exon12			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.2265G>A	2.37:g.113953763G>A		Somatic		Capture	Illumina HiSeq	Phase_I	113670234	NM_012455	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Silent	SNP	ENST00000245796.6	37	CCDS33276.1																																																																																				PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1	NM_012455	
LRP1B	53353	broad.mit.edu	37	2	141202169	141202169	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr2:141202169C>A	ENST00000389484.3	-	64	11108	c.10137G>T	c.(10135-10137)gaG>gaT	p.E3379D		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3379	LDL-receptor class A 22. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.E3379D(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CACAATCATTCTCTCCATCAC	0.408										TSP Lung(27;0.18)																											p.E3379D	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G10137T	2						.						110.0	103.0	106.0					2																	141202169		2203	4300	6503	140918639	SO:0001583	missense	53353	exon64			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10137G>T	2.37:g.141202169C>A	ENSP00000374135:p.Glu3379Asp	Somatic		Capture	Illumina HiSeq	Phase_I	140918639	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	10.55	1.381811	0.24944	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.95518	-3.73	5.85	-1.6	0.08426	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.85526	0.5717	N	0.05534	-0.03	0.38656	D	0.951962	B	0.20550	0.046	B	0.22601	0.04	T	0.70850	-0.4760	10	0.19147	T	0.46	.	8.8089	0.34954	0.0:0.4152:0.1002:0.4846	.	3379	Q9NZR2	LRP1B_HUMAN	D	3379;3317	ENSP00000374135:E3379D	ENSP00000374135:E3379D	E	-	3	2	LRP1B	140918639	0.262000	0.24073	0.993000	0.49108	0.997000	0.91878	-0.296000	0.08287	-0.208000	0.10171	0.563000	0.77884	GAG		LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
ARHGAP15	55843	broad.mit.edu	37	2	144381831	144381831	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr2:144381831C>T	ENST00000295095.6	+	12	1300	c.1133C>T	c.(1132-1134)gCg>gTg	p.A378V		NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	378	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)	p.A378V(1)		endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		TTTGTGGAAGCGATCAGTAAG	0.433																																					p.A378V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1133T	2						.						76.0	70.0	72.0					2																	144381831		2203	4300	6503	144098301	SO:0001583	missense	55843	exon12			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.1133C>T	2.37:g.144381831C>T	ENSP00000295095:p.Ala378Val	Somatic		Capture	Illumina HiSeq	Phase_I	144098301	NM_018460	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Missense_Mutation	SNP	ENST00000295095.6	37	CCDS2184.1	.	.	.	.	.	.	.	.	.	.	C	35	5.526942	0.96431	.	.	ENSG00000075884	ENST00000295095	T	0.12465	2.68	6.16	6.16	0.99307	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.056393	0.64402	D	0.000001	T	0.43277	0.1240	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.15321	-1.0441	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	378	Q53QZ3	RHG15_HUMAN	V	378	ENSP00000295095:A378V	ENSP00000295095:A378V	A	+	2	0	ARHGAP15	144098301	1.000000	0.71417	0.973000	0.42090	0.974000	0.67602	7.786000	0.85741	2.937000	0.99478	0.650000	0.86243	GCG		ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	NM_018460	
TTN	7273	broad.mit.edu	37	2	179444528	179444528	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr2:179444528A>C	ENST00000591111.1	-	269	62697	c.62473T>G	c.(62473-62475)Tca>Gca	p.S20825A	TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S22466A|TTN_ENST00000342992.6_Missense_Mutation_p.S19898A|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S13593A|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S13526A|TTN_ENST00000460472.2_Missense_Mutation_p.S13401A|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590932.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20825	Fibronectin type-III 51. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.S13593A(1)|p.S19896A(1)|p.S13526A(1)|p.S13401A(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTACAGGATGACTTAGATACA	0.418																																					p.S13400R												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.T40200G	2						.						121.0	111.0	114.0					2																	179444528		1884	4114	5998	179152774	SO:0001583	missense	7273	exon147			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.62473T>G	2.37:g.179444528A>C	ENSP00000465570:p.Ser20825Ala	Somatic		Capture	Illumina HiSeq	Phase_I	179152774	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	8.919	0.960658	0.18583	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	5.1	5.1	0.69264	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.59032	0.2164	L	0.41124	1.26	0.25696	N	0.985631	P;P;P;P	0.44090	0.826;0.826;0.826;0.826	P;P;P;P	0.47603	0.473;0.473;0.473;0.551	T	0.56848	-0.7911	9	0.87932	D	0	.	15.1532	0.72717	1.0:0.0:0.0:0.0	.	13401;13526;13593;20825	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	19898;13401;13593;13526;13399	ENSP00000343764:S19898A;ENSP00000434586:S13401A;ENSP00000340554:S13593A;ENSP00000352154:S13526A	ENSP00000340554:S13593A	S	-	1	0	TTN	179152774	1.000000	0.71417	0.999000	0.59377	0.656000	0.38851	3.000000	0.49481	2.041000	0.60428	0.260000	0.18958	TCA		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CRYGC	1420	broad.mit.edu	37	2	208994233	208994233	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr2:208994233C>T	ENST00000282141.3	-	2	221	c.184G>A	c.(184-186)Gag>Aag	p.E62K		NM_020989.3	NP_066269.1	P07315	CRGC_HUMAN	crystallin, gamma C	62	Beta/gamma crystallin 'Greek key' 2. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)	p.E62K(1)		NS(1)|endometrium(1)|large_intestine(2)|lung(5)	9				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)		TCGGGGTACTCCCCTCGCCGC	0.567																																					p.E62K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G184A	2						.						69.0	74.0	72.0					2																	208994233		2203	4300	6503	208702478	SO:0001583	missense	1420	exon2				CCDS2379.1	2q33.3	2013-02-14			ENSG00000163254	ENSG00000163254			2410	protein-coding gene	gene with protein product		123680		CRYG3			Standard	NM_020989		Approved		uc002vco.4	P07315	OTTHUMG00000132942	ENST00000282141.3:c.184G>A	2.37:g.208994233C>T	ENSP00000282141:p.Glu62Lys	Somatic		Capture	Illumina HiSeq	Phase_I	208702478	NM_020989	Q53R50	Missense_Mutation	SNP	ENST00000282141.3	37	CCDS2379.1	.	.	.	.	.	.	.	.	.	.	C	16.82	3.229034	0.58777	.	.	ENSG00000163254	ENST00000282141	T	0.79033	-1.23	4.98	4.98	0.66077	Beta/gamma crystallin (5);Gamma-crystallin-related (1);	0.305503	0.34067	N	0.004288	T	0.81635	0.4864	M	0.88105	2.93	0.58432	D	0.999998	B	0.06786	0.001	B	0.12837	0.008	T	0.80407	-0.1395	10	0.49607	T	0.09	.	16.1101	0.81259	0.0:1.0:0.0:0.0	.	62	P07315	CRGC_HUMAN	K	62	ENSP00000282141:E62K	ENSP00000282141:E62K	E	-	1	0	CRYGC	208702478	1.000000	0.71417	0.945000	0.38365	0.366000	0.29705	4.751000	0.62169	2.468000	0.83385	0.462000	0.41574	GAG		CRYGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256474.1	NM_020989	
CNPPD1	27013	broad.mit.edu	37	2	220037588	220037588	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr2:220037588G>A	ENST00000409789.1	-	9	1380	c.953C>T	c.(952-954)cCt>cTt	p.P318L	SLC23A3_ENST00000295738.7_5'Flank|SLC23A3_ENST00000409878.3_5'Flank|CNPPD1_ENST00000360507.5_Missense_Mutation_p.P318L|SLC23A3_ENST00000396775.3_5'Flank|SLC23A3_ENST00000455516.2_5'Flank			Q9BV87	CNPD1_HUMAN	cyclin Pas1/PHO80 domain containing 1	318	Pro-rich.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	integral component of membrane (GO:0016021)		p.P318L(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	12						CAATGGTGGAGGAGTCAGTGA	0.617																																					p.P318L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C953T	2						.						46.0	48.0	48.0					2																	220037588		2202	4300	6502	219745832	SO:0001583	missense	27013	exon8			AF070638	CCDS2433.1	2q36	2011-03-23	2011-03-23	2011-03-23	ENSG00000115649	ENSG00000115649			25220	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 24"""	C2orf24		8619474, 9110174	Standard	NM_015680		Approved	CGI-57	uc002vju.4	Q9BV87	OTTHUMG00000133132	ENST00000409789.1:c.953C>T	2.37:g.220037588G>A	ENSP00000386277:p.Pro318Leu	Somatic		Capture	Illumina HiSeq	Phase_I	219745832	NM_015680	B2RC77|O75548|Q9H4N0|Q9UQN0	Missense_Mutation	SNP	ENST00000409789.1	37	CCDS2433.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.875090	0.33162	.	.	ENSG00000115649	ENST00000360507;ENST00000409789	T;T	0.13778	2.56;2.56	4.89	4.89	0.63831	.	0.203312	0.43416	D	0.000573	T	0.13415	0.0325	L	0.29908	0.895	0.22066	N	0.999386	D	0.58268	0.982	P	0.50708	0.648	T	0.14309	-1.0477	10	0.12103	T	0.63	-18.9483	10.7179	0.46023	0.0:0.0:0.7612:0.2388	.	318	Q9BV87	CNPD1_HUMAN	L	318	ENSP00000353698:P318L;ENSP00000386277:P318L	ENSP00000353698:P318L	P	-	2	0	CNPPD1	219745832	0.959000	0.32827	0.880000	0.34516	0.989000	0.77384	4.077000	0.57598	2.532000	0.85374	0.655000	0.94253	CCT		CNPPD1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336220.1	NM_015680	
C2orf71	388939	broad.mit.edu	37	2	29293873	29293873	+	Silent	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr2:29293873C>T	ENST00000331664.5	-	1	3254	c.3255G>A	c.(3253-3255)tcG>tcA	p.S1085S		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	1085	Pro-rich.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)		p.S1085S(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						GGGAGGGAATCGAGAAAGGGG	0.592																																					p.S1085S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3255A	2						.						59.0	67.0	64.0					2																	29293873		1900	4102	6002	29147377	SO:0001819	synonymous_variant	388939	exon1				CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.3255G>A	2.37:g.29293873C>T		Somatic		Capture	Illumina HiSeq	Phase_I	29147377	NM_001029883		Silent	SNP	ENST00000331664.5	37	CCDS42669.1																																																																																				C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
PAX3	5077	broad.mit.edu	37	2	223066853	223066853	+	Silent	SNP	G	G	A	rs147111779		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr2:223066853G>A	ENST00000350526.4	-	8	1366	c.1230C>T	c.(1228-1230)taC>taT	p.Y410Y	PAX3_ENST00000392070.2_Silent_p.Y410Y|PAX3_ENST00000409551.3_Silent_p.Y409Y|PAX3_ENST00000336840.6_Intron|PAX3_ENST00000344493.4_Intron|PAX3_ENST00000464706.1_5'UTR|PAX3_ENST00000392069.2_Silent_p.Y410Y	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	410					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y410Y(2)	PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGAGAGCGCGTAATCAGTCT	0.542			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																														p.Y409Y			Dom	yes		2	2q35	5077	paired box gene 3	yes	M	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1227T	2						.	G	,,,,,	0,4406		0,0,2203	69.0	67.0	68.0		1227,1230,1230,1230,,	-11.6	0.0	2	dbSNP_134	68	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,intron,intron	PAX3	NM_001127366.2,NM_181457.3,NM_181458.3,NM_181459.3,NM_181460.3,NM_181461.3	,,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,,	409/484,410/480,410/485,410/506,,	223066853	1,13005	2203	4300	6503	222775097	SO:0001819	synonymous_variant	5077	exon8				CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.1230C>T	2.37:g.223066853G>A		Somatic		Capture	Illumina HiSeq	Phase_I	222775097	NM_001127366	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Silent	SNP	ENST00000350526.4	37	CCDS42826.1																																																																																				PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1		
AGAP1	116987	broad.mit.edu	37	2	236945238	236945238	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr2:236945238delC	ENST00000304032.8	+	14	2259	c.1679delC	c.(1678-1680)tccfs	p.S560fs	AGAP1_ENST00000409538.1_Frame_Shift_Del_p.S772fs|AGAP1_ENST00000336665.5_Frame_Shift_Del_p.S507fs|AGAP1_ENST00000428334.2_Frame_Shift_Del_p.S399fs|RNU7-127P_ENST00000458845.1_RNA	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	560	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)	p.L561fs*43(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						ATCATTGTGTCCCTCACTGGC	0.527																																					p.S560fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1679delC	2						.						130.0	135.0	134.0					2																	236945238		2203	4300	6503	236609977	SO:0001589	frameshift_variant	116987	exon14			AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.1679delC	2.37:g.236945238delC	ENSP00000307634:p.Ser560fs	Somatic		Capture	Illumina HiSeq	Phase_I	236609977	NM_001037131	B2RTX7|Q541S5|Q6P9D7|Q9NV93	Frame_Shift_Del	DEL	ENST00000304032.8	37	CCDS33408.1																																																																																				AGAP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257076.2	NM_014914	
CNTN4	152330	broad.mit.edu	37	3	3084063	3084063	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr3:3084063C>T	ENST00000397461.1	+	20	2852	c.2468C>T	c.(2467-2469)gCc>gTc	p.A823V	CNTN4_ENST00000418658.1_Missense_Mutation_p.A823V|CNTN4-AS1_ENST00000442749.2_RNA|CNTN4_ENST00000397459.2_Missense_Mutation_p.A495V|CNTN4_ENST00000448906.2_Missense_Mutation_p.A495V|CNTN4_ENST00000427331.1_Missense_Mutation_p.A823V|CNTN4_ENST00000358480.3_Missense_Mutation_p.A604V	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	823	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.A823V(1)|p.A495V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		GTTTTCTGGGCCTCCCCACTG	0.448																																					p.A495V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1484T	3						.						104.0	100.0	101.0					3																	3084063		2203	4300	6503	3059063	SO:0001583	missense	152330	exon12			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.2468C>T	3.37:g.3084063C>T	ENSP00000380602:p.Ala823Val	Somatic		Capture	Illumina HiSeq	Phase_I	3059063	NM_175613	B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	ENST00000397461.1	37	CCDS43041.1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.879297	0.51801	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906	T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41	5.61	5.61	0.85477	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.193845	0.46442	D	0.000300	T	0.41026	0.1141	N	0.25332	0.735	0.54753	D	0.99998	B;B	0.14805	0.004;0.011	B;B	0.22386	0.023;0.039	T	0.17776	-1.0358	10	0.33141	T	0.24	.	13.2374	0.59976	0.0:0.9275:0.0:0.0725	.	822;823	Q8IWV2-3;Q8IWV2	.;CNTN4_HUMAN	V	823;823;823;604;495;495	ENSP00000396010:A823V;ENSP00000380602:A823V;ENSP00000413642:A823V;ENSP00000351267:A604V;ENSP00000380600:A495V;ENSP00000392077:A495V	ENSP00000351267:A604V	A	+	2	0	CNTN4	3059063	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.649000	0.37281	2.793000	0.96121	0.655000	0.94253	GCC		CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2		
ITGA9	3680	broad.mit.edu	37	3	37560793	37560793	+	Missense_Mutation	SNP	C	C	T	rs147821910		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr3:37560793C>T	ENST00000264741.5	+	11	1440	c.1184C>T	c.(1183-1185)gCg>gTg	p.A395V	ITGA9_ENST00000422441.1_Missense_Mutation_p.A395V	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	395					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.A395V(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		TTCGCAGGGGCGGTCTATATC	0.448																																					p.A395V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1184T	3						.	C	VAL/ALA	2,4404	4.2+/-10.8	0,2,2201	152.0	130.0	137.0		1184	5.9	0.1	3	dbSNP_134	137	0,8600		0,0,4300	no	missense	ITGA9	NM_002207.2	64	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	395/1036	37560793	2,13004	2203	4300	6503	37535797	SO:0001583	missense	3680	exon11			L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.1184C>T	3.37:g.37560793C>T	ENSP00000264741:p.Ala395Val	Somatic		Capture	Illumina HiSeq	Phase_I	37535797	NM_002207	Q14638	Missense_Mutation	SNP	ENST00000264741.5	37	CCDS2669.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.729104	0.89390	4.54E-4	0.0	ENSG00000144668	ENST00000422441;ENST00000264741	T;T	0.56275	0.47;0.47	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.73305	0.3570	M	0.78637	2.42	0.80722	D	1	D;D	0.71674	0.997;0.998	P;D	0.65987	0.904;0.94	T	0.70332	-0.4901	10	0.36615	T	0.2	.	20.1865	0.98220	0.0:1.0:0.0:0.0	.	395;395	Q13797;E9PDS3	ITA9_HUMAN;.	V	395	ENSP00000397258:A395V;ENSP00000264741:A395V	ENSP00000264741:A395V	A	+	2	0	ITGA9	37535797	1.000000	0.71417	0.117000	0.21633	0.407000	0.30961	6.043000	0.71004	2.775000	0.95449	0.655000	0.94253	GCG		ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207	
KLHL24	54800	broad.mit.edu	37	3	183368842	183368842	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr3:183368842T>A	ENST00000454652.2	+	4	1084	c.698T>A	c.(697-699)gTc>gAc	p.V233D	KLHL24_ENST00000476808.1_Missense_Mutation_p.V233D|KLHL24_ENST00000242810.6_Missense_Mutation_p.V233D	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	233	BACK.					cell projection (GO:0042995)|cytoplasm (GO:0005737)		p.V233D(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			TTTGAAGCCGTCATGCGTTGG	0.423																																					p.V233D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T698A	3						.						158.0	151.0	154.0					3																	183368842		2203	4300	6503	184851536	SO:0001583	missense	54800	exon3				CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.698T>A	3.37:g.183368842T>A	ENSP00000395012:p.Val233Asp	Somatic		Capture	Illumina HiSeq	Phase_I	184851536	NM_017644	A5PLN8|Q9H620|Q9NXT9	Missense_Mutation	SNP	ENST00000454652.2	37	CCDS3246.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.053706	0.75960	.	.	ENSG00000114796	ENST00000242810;ENST00000454652;ENST00000476808	T;T;T	0.74002	-0.8;-0.8;-0.8	5.09	5.09	0.68999	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.90635	0.7063	H	0.96861	3.895	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.83275	0.996;0.986	D	0.93716	0.7028	10	0.87932	D	0	.	14.8712	0.70459	0.0:0.0:0.0:1.0	.	233;233	Q6TFL4-2;Q6TFL4	.;KLH24_HUMAN	D	233	ENSP00000242810:V233D;ENSP00000395012:V233D;ENSP00000419010:V233D	ENSP00000242810:V233D	V	+	2	0	KLHL24	184851536	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	5.972000	0.70448	1.913000	0.55393	0.377000	0.23210	GTC		KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346586.2	NM_017644	
ANK2	287	broad.mit.edu	37	4	114158192	114158192	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr4:114158192C>A	ENST00000357077.4	+	6	586	c.533C>A	c.(532-534)gCg>gAg	p.A178E	ANK2_ENST00000264366.6_Missense_Mutation_p.A178E|ANK2_ENST00000394537.3_Missense_Mutation_p.A178E|ANK2_ENST00000506722.1_Missense_Mutation_p.A157E	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	178					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.A178E(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CACAACCAGGCGGTGGCCATC	0.498																																					p.A178E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C533A	4						.						144.0	139.0	141.0					4																	114158192		2203	4300	6503	114377641	SO:0001583	missense	287	exon6			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.533C>A	4.37:g.114158192C>A	ENSP00000349588:p.Ala178Glu	Somatic		Capture	Illumina HiSeq	Phase_I	114377641	NM_020977	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586867	0.86851	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000515034	T;T;T;T;T;T;T;T	0.66280	-0.2;0.54;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2	5.57	5.57	0.84162	Ankyrin repeat-containing domain (4);	0.000000	0.51477	D	0.000097	T	0.72819	0.3508	L	0.45698	1.435	0.80722	D	1	D;P;D;D;D	0.89917	1.0;0.928;1.0;0.983;0.988	D;P;D;P;P	0.83275	0.996;0.682;0.992;0.897;0.774	T	0.74216	-0.3737	10	0.87932	D	0	.	13.1595	0.59537	0.0:0.9267:0.0:0.0733	.	178;178;178;157;157	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	E	157;157;157;193;178;178;178;157;43	ENSP00000423799:A157E;ENSP00000421011:A157E;ENSP00000421067:A157E;ENSP00000424722:A193E;ENSP00000378044:A178E;ENSP00000349588:A178E;ENSP00000264366:A178E;ENSP00000421059:A43E	ENSP00000264366:A178E	A	+	2	0	ANK2	114377641	1.000000	0.71417	0.975000	0.42487	0.912000	0.54170	5.894000	0.69806	2.775000	0.95449	0.650000	0.86243	GCG		ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
CAMK2D	817	broad.mit.edu	37	4	114473239	114473239	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr4:114473239C>G	ENST00000342666.5	-	5	288	c.289G>C	c.(289-291)Gaa>Caa	p.E97Q	CAMK2D_ENST00000505990.1_Missense_Mutation_p.E97Q|CAMK2D_ENST00000508738.1_Missense_Mutation_p.E97Q|CAMK2D_ENST00000515496.1_Missense_Mutation_p.E97Q|CAMK2D_ENST00000394526.2_Missense_Mutation_p.E97Q|CAMK2D_ENST00000379773.2_Missense_Mutation_p.E97Q|CAMK2D_ENST00000296402.5_Missense_Mutation_p.E97Q|CAMK2D_ENST00000514328.1_Missense_Mutation_p.E97Q|CAMK2D_ENST00000394522.3_Missense_Mutation_p.E97Q|CAMK2D_ENST00000429180.1_Missense_Mutation_p.E97Q|CAMK2D_ENST00000511664.1_Missense_Mutation_p.E97Q|CAMK2D_ENST00000454265.2_Missense_Mutation_p.E97Q|CAMK2D_ENST00000418639.2_Missense_Mutation_p.E97Q|CAMK2D_ENST00000394524.3_Missense_Mutation_p.E97Q			Q13557	KCC2D_HUMAN	calcium/calmodulin-dependent protein kinase II delta	97	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cardiac muscle cell contraction (GO:0086003)|cellular response to calcium ion (GO:0071277)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle cell action potential (GO:0098901)|regulation of cardiac muscle cell action potential involved in regulation of contraction (GO:0098909)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cell growth (GO:0001558)|regulation of cellular localization (GO:0060341)|regulation of generation of L-type calcium current (GO:1902514)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of histone deacetylase activity (GO:1901725)|regulation of membrane depolarization (GO:0003254)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of the force of heart contraction (GO:0002026)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|relaxation of cardiac muscle (GO:0055119)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|calcium channel complex (GO:0034704)|calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intercalated disc (GO:0014704)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|ion channel binding (GO:0044325)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|sodium channel inhibitor activity (GO:0019871)|titin binding (GO:0031432)	p.E97Q(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	13		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)		TCAAACAGTTCACCTCCAGTA	0.353																																					p.E97Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G289C	4						.						95.0	91.0	92.0					4																	114473239		2203	4300	6503	114692688	SO:0001583	missense	817	exon5			U50361	CCDS3703.1, CCDS3704.1, CCDS43263.1, CCDS47127.1, CCDS54797.1	4q26	2008-10-30	2008-10-30		ENSG00000145349	ENSG00000145349			1462	protein-coding gene	gene with protein product		607708	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II delta"""	CAMKD			Standard	NM_001221		Approved		uc003ibi.3	Q13557	OTTHUMG00000132910	ENST00000342666.5:c.289G>C	4.37:g.114473239C>G	ENSP00000339740:p.Glu97Gln	Somatic		Capture	Illumina HiSeq	Phase_I	114692688	NM_172115	A8MVS8|Q52PK4|Q59G21|Q8N553|Q9UGH6|Q9UQE9	Missense_Mutation	SNP	ENST00000342666.5	37	CCDS3703.1	.	.	.	.	.	.	.	.	.	.	C	33	5.267773	0.95399	.	.	ENSG00000145349	ENST00000394524;ENST00000454265;ENST00000429180;ENST00000418639;ENST00000394526;ENST00000296402;ENST00000511664;ENST00000342666;ENST00000515496;ENST00000514328;ENST00000394522;ENST00000505990;ENST00000379773;ENST00000508738	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.26518	1.73;1.73;1.73;1.73;1.73;1.73;1.73;1.73;1.73;1.73;1.73;1.73;1.73;1.73	5.84	5.84	0.93424	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.56247	0.1972	M	0.77313	2.365	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.999;0.998;0.998;0.998;0.998	T	0.57768	-0.7754	10	0.87932	D	0	.	20.13	0.97997	0.0:1.0:0.0:0.0	.	97;97;97;97;97	E9PF82;Q13557-3;Q13557-6;Q13557-12;Q13557	.;.;.;.;KCC2D_HUMAN	Q	97	ENSP00000378032:E97Q;ENSP00000415248:E97Q;ENSP00000415707:E97Q;ENSP00000406131:E97Q;ENSP00000378034:E97Q;ENSP00000296402:E97Q;ENSP00000425824:E97Q;ENSP00000339740:E97Q;ENSP00000423482:E97Q;ENSP00000423677:E97Q;ENSP00000378030:E97Q;ENSP00000424245:E97Q;ENSP00000369098:E97Q;ENSP00000422566:E97Q	ENSP00000296402:E97Q	E	-	1	0	CAMK2D	114692688	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.411000	0.80078	2.751000	0.94390	0.650000	0.86243	GAA		CAMK2D-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256420.2		
MFSD8	256471	broad.mit.edu	37	4	128842824	128842824	+	Missense_Mutation	SNP	G	G	A	rs200745039		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr4:128842824G>A	ENST00000296468.3	-	12	1332	c.1205C>T	c.(1204-1206)tCg>tTg	p.S402L	MFSD8_ENST00000513559.1_Missense_Mutation_p.S357L|MFSD8_ENST00000515130.1_5'UTR	NM_152778.2	NP_689991.1	Q8NHS3	MFSD8_HUMAN	major facilitator superfamily domain containing 8	402					cell death (GO:0008219)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)		p.S402L(1)		cervix(2)|endometrium(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)	23						TTGTTCAATCGAGCAACCAGT	0.433													G|||	1	0.000199681	0.0	0.0	5008	,	,		17014	0.001		0.0	False		,,,				2504	0.0				p.S402L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1205T	4						.	G	LEU/SER	0,4406		0,0,2203	114.0	118.0	117.0		1205	5.2	1.0	4		117	2,8598	2.2+/-6.3	0,2,4298	yes	missense	MFSD8	NM_152778.2	145	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	402/519	128842824	2,13004	2203	4300	6503	129062274	SO:0001583	missense	256471	exon12			AK074564	CCDS3736.1	4q28.2	2014-09-17			ENSG00000164073	ENSG00000164073			28486	protein-coding gene	gene with protein product		611124	"""ceroid-lipofuscinosis, neuronal 7, late infantile, variant"""	CLN7		17564970	Standard	NM_152778		Approved	MGC33302	uc003ifp.3	Q8NHS3	OTTHUMG00000133303	ENST00000296468.3:c.1205C>T	4.37:g.128842824G>A	ENSP00000296468:p.Ser402Leu	Somatic		Capture	Illumina HiSeq	Phase_I	129062274	NM_152778	B2RDM1|B7Z205|Q8N2P3	Missense_Mutation	SNP	ENST00000296468.3	37	CCDS3736.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	20.2	3.957569	0.73902	0.0	2.33E-4	ENSG00000164073	ENST00000296468;ENST00000513559	D;D	0.85088	-1.94;-1.85	5.17	5.17	0.71159	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.172925	0.51477	D	0.000081	T	0.71643	0.3364	N	0.04508	-0.205	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.65405	-0.6176	10	0.23891	T	0.37	-5.9727	18.8508	0.92227	0.0:0.0:1.0:0.0	.	402	Q8NHS3	MFSD8_HUMAN	L	402;357	ENSP00000296468:S402L;ENSP00000425000:S357L	ENSP00000296468:S402L	S	-	2	0	MFSD8	129062274	1.000000	0.71417	0.973000	0.42090	0.931000	0.56810	8.626000	0.90969	2.687000	0.91594	0.561000	0.74099	TCG		MFSD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257097.1	NM_152778	
RNF175	285533	broad.mit.edu	37	4	154649420	154649420	+	Missense_Mutation	SNP	C	C	T	rs370409419		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr4:154649420C>T	ENST00000347063.4	-	4	712	c.340G>A	c.(340-342)Gtt>Att	p.V114I	RNF175_ENST00000506505.1_Intron|RP11-153M7.5_ENST00000505051.1_RNA|RNF175_ENST00000274068.4_Intron	NM_173662.2	NP_775933	Q8N4F7	RN175_HUMAN	ring finger protein 175	114						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.V114I(3)		breast(1)|endometrium(1)|large_intestine(5)|lung(1)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	13	all_hematologic(180;0.093)	Renal(120;0.118)				CTGGTAATAACGGAGAACATC	0.478																																					p.V114I												.	.	3	Substitution - Missense(3)	large_intestine(2)|prostate(1)	c.G340A	4						.	C	ILE/VAL	0,3738		0,0,1869	117.0	116.0	116.0		340	-2.6	0.0	4		116	1,8203		0,1,4101	no	missense	RNF175	NM_173662.2	29	0,1,5970	TT,TC,CC		0.0122,0.0,0.0084	probably-damaging	114/329	154649420	1,11941	1869	4102	5971	154868870	SO:0001583	missense	285533	exon4			BC034385	CCDS47149.1	4q31.3	2008-02-05			ENSG00000145428	ENSG00000145428		"""RING-type (C3HC4) zinc fingers"""	27735	protein-coding gene	gene with protein product							Standard	NM_173662		Approved	FLJ34190	uc003int.3	Q8N4F7	OTTHUMG00000161557	ENST00000347063.4:c.340G>A	4.37:g.154649420C>T	ENSP00000340979:p.Val114Ile	Somatic		Capture	Illumina HiSeq	Phase_I	154868870	NM_173662	C9JL66|Q8NB61	Missense_Mutation	SNP	ENST00000347063.4	37	CCDS47149.1	.	.	.	.	.	.	.	.	.	.	C	1.441	-0.567588	0.03910	0.0	1.22E-4	ENSG00000145428	ENST00000347063;ENST00000508248	T;T	0.61274	0.12;0.12	4.69	-2.58	0.06228	.	0.074861	0.52532	D	0.000078	T	0.17450	0.0419	N	0.02802	-0.49	0.19300	N	0.999973	B	0.15719	0.014	B	0.09377	0.004	T	0.21518	-1.0243	10	0.02654	T	1	-2.9588	0.1241	0.00067	0.2456:0.21:0.2406:0.3038	.	114	Q8N4F7	RN175_HUMAN	I	114;54	ENSP00000340979:V114I;ENSP00000427472:V54I	ENSP00000340979:V114I	V	-	1	0	RNF175	154868870	0.000000	0.05858	0.000000	0.03702	0.889000	0.51656	0.001000	0.13038	-0.602000	0.05775	-0.136000	0.14681	GTT		RNF175-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365286.1	NM_173662	
CENPC	1060	broad.mit.edu	37	4	68358653	68358653	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr4:68358653C>A	ENST00000273853.6	-	15	2603	c.2353G>T	c.(2353-2355)Gaa>Taa	p.E785*		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	785					chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)	p.E785*(1)									CCAATATTTTCTTTTGCCTTC	0.294																																					p.E785X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2353T	4						.						76.0	66.0	69.0					4																	68358653		1800	4039	5839	68041248	SO:0001587	stop_gained	1060	exon15			M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.2353G>T	4.37:g.68358653C>A	ENSP00000273853:p.Glu785*	Somatic		Capture	Illumina HiSeq	Phase_I	68041248	NM_001812	Q8IW27|Q9P0M5	Nonsense_Mutation	SNP	ENST00000273853.6	37	CCDS47063.1	.	.	.	.	.	.	.	.	.	.	C	7.302	0.613225	0.14066	.	.	ENSG00000145241	ENST00000273853	.	.	.	4.65	1.67	0.24075	.	1.054720	0.07380	N	0.887340	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-0.4028	6.42	0.21738	0.0:0.6552:0.0:0.3448	.	.	.	.	X	785	.	ENSP00000273853:E785X	E	-	1	0	CENPC1	68041248	0.064000	0.20934	0.363000	0.25875	0.010000	0.07245	0.237000	0.17985	0.329000	0.23460	-0.140000	0.14226	GAA		CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362001.2		
PTPN13	5783	broad.mit.edu	37	4	87671782	87671782	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr4:87671782G>T	ENST00000411767.2	+	18	2873	c.2810G>T	c.(2809-2811)tGc>tTc	p.C937F	PTPN13_ENST00000436978.1_Missense_Mutation_p.C937F|PTPN13_ENST00000427191.2_Missense_Mutation_p.C937F|PTPN13_ENST00000511467.1_Missense_Mutation_p.C937F|PTPN13_ENST00000316707.6_Intron			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	937					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)	p.C937F(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		AGGCTATCCTGCTCAGAGCTG	0.468																																					p.C937F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2810T	4						.						62.0	62.0	62.0					4																	87671782		1938	4154	6092	87890806	SO:0001583	missense	5783	exon18				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.2810G>T	4.37:g.87671782G>T	ENSP00000407249:p.Cys937Phe	Somatic		Capture	Illumina HiSeq	Phase_I	87890806	NM_080683	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.154772	0.57259	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T	0.54866	0.6;0.63;0.55;0.63	6.16	6.16	0.99307	.	0.109289	0.41500	D	0.000875	T	0.50565	0.1623	L	0.56769	1.78	0.42835	D	0.994039	P;P;P	0.44281	0.826;0.831;0.707	B;B;B	0.43251	0.413;0.235;0.299	T	0.42548	-0.9445	10	0.11182	T	0.66	.	14.9398	0.70983	0.0675:0.0:0.9325:0.0	.	937;937;937	Q12923-3;Q12923;Q12923-4	.;PTN13_HUMAN;.	F	937;937;937;937;905	ENSP00000408368:C937F;ENSP00000394794:C937F;ENSP00000407249:C937F;ENSP00000426626:C937F	ENSP00000349909:C905F	C	+	2	0	PTPN13	87890806	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.126000	0.57937	2.937000	0.99478	0.650000	0.86243	TGC		PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
TUBB7P	56604	broad.mit.edu	37	4	190904365	190904365	+	IGR	SNP	C	C	T	rs571837291	byFrequency	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr4:190904365C>T								FRG1 (20006 upstream) : RNA5SP174 (31927 downstream)																							TGTCATATAGCGCTTCGTTAT	0.542													.|||	2	0.000399361	0.0015	0.0	5008	,	,		25916	0.0		0.0	False		,,,				2504	0.0				p.A206T												.	.	0			c.G616A	4						.						16.0	24.0	21.0					4																	190904365		1934	4059	5993	191141359	SO:0001628	intergenic_variant	56604	exon4																															4.37:g.190904365C>T		Somatic		Capture	Illumina HiSeq	Phase_I	191141359	NM_020040		Silent	SNP		37																																																																																				0								
SNX2	6643	broad.mit.edu	37	5	122163297	122163297	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr5:122163297G>A	ENST00000379516.2	+	14	1573	c.1465G>A	c.(1465-1467)Gtt>Att	p.V489I	SNX2_ENST00000514949.1_Missense_Mutation_p.V372I|SNX2_ENST00000510372.1_3'UTR	NM_003100.2	NP_003091.2	O60749	SNX2_HUMAN	sorting nexin 2	489					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)	p.V489I(1)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)|skin(1)	19		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)		TTTTAAAACCGTTATCATCAA	0.299																																					p.V489I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1465A	5						.						83.0	87.0	86.0					5																	122163297		2203	4300	6503	122191196	SO:0001583	missense	6643	exon14			AF043453	CCDS34217.1, CCDS64234.1	5q23.2	2011-05-03			ENSG00000205302	ENSG00000205302		"""Sorting nexins"""	11173	protein-coding gene	gene with protein product		605929				9819414	Standard	NM_003100		Approved		uc003kte.4	O60749	OTTHUMG00000163020	ENST00000379516.2:c.1465G>A	5.37:g.122163297G>A	ENSP00000368831:p.Val489Ile	Somatic		Capture	Illumina HiSeq	Phase_I	122191196	NM_003100	B3KN44|B4DEK4|B7Z408|O43650|P82862|Q53XK8|Q597H6|Q9BTS8	Missense_Mutation	SNP	ENST00000379516.2	37	CCDS34217.1	.	.	.	.	.	.	.	.	.	.	G	11.10	1.539584	0.27563	.	.	ENSG00000205302	ENST00000379516;ENST00000514949	T;T	0.57907	0.37;0.37	5.72	4.85	0.62838	Vps5 C-terminal (1);	0.118494	0.64402	D	0.000018	T	0.32823	0.0842	N	0.11255	0.115	0.41069	D	0.985434	B	0.02656	0.0	B	0.06405	0.002	T	0.12268	-1.0554	10	0.14252	T	0.57	-0.4711	15.1561	0.72743	0.068:0.0:0.932:0.0	.	489	O60749	SNX2_HUMAN	I	489;372	ENSP00000368831:V489I;ENSP00000421663:V372I	ENSP00000368831:V489I	V	+	1	0	SNX2	122191196	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.406000	0.59748	1.551000	0.49450	0.650000	0.86243	GTT		SNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371392.1	NM_003100	
WNT8A	7478	broad.mit.edu	37	5	137420287	137420287	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr5:137420287A>G	ENST00000398754.1	+	3	208	c.203A>G	c.(202-204)aAt>aGt	p.N68S	WNT8A_ENST00000506684.1_Missense_Mutation_p.N86S	NM_058244.2	NP_490645.1	Q9H1J5	WNT8A_HUMAN	wingless-type MMTV integration site family, member 8A	68					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|endoderm development (GO:0007492)|establishment of organ orientation (GO:0048561)|neural crest cell fate commitment (GO:0014034)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|polarity specification of anterior/posterior axis (GO:0009949)|polarity specification of proximal/distal axis (GO:0010085)|regulation of protein localization (GO:0032880)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|response to retinoic acid (GO:0032526)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGCCCTGAAAATGCTCTTCAG	0.532																																					p.N68S												.	.	0			c.A203G	5						.						74.0	79.0	78.0					5																	137420287		2089	4239	6328	137448186	SO:0001583	missense	7478	exon3			AB057725	CCDS43368.1, CCDS75311.1	5q31	2008-07-18			ENSG00000061492	ENSG00000061492		"""Wingless-type MMTV integration sites"""	12788	protein-coding gene	gene with protein product		606360				11408932	Standard	XM_005272076		Approved	WNT8D	uc003lcd.1	Q9H1J5	OTTHUMG00000129196	ENST00000398754.1:c.203A>G	5.37:g.137420287A>G	ENSP00000381739:p.Asn68Ser	None		Capture	Illumina HiSeq	Phase_I	137448186	NM_058244	Q96S51	Missense_Mutation	SNP	ENST00000398754.1	37	CCDS43368.1	.	.	.	.	.	.	.	.	.	.	A	3.558	-0.090288	0.07053	.	.	ENSG00000061492	ENST00000506684;ENST00000504809;ENST00000398754	T;T;T	0.75154	-0.91;-0.91;-0.91	4.96	2.61	0.31194	.	0.370492	0.29410	N	0.012223	T	0.37999	0.1024	N	0.01242	-0.935	0.32336	N	0.560365	B;B;B	0.10296	0.002;0.003;0.0	B;B;B	0.16722	0.016;0.01;0.002	T	0.35943	-0.9768	10	0.09590	T	0.72	.	4.8655	0.13606	0.6137:0.0:0.3863:0.0	.	86;86;68	D6RF47;D6RF94;Q9H1J5	.;.;WNT8A_HUMAN	S	86;86;68	ENSP00000426653:N86S;ENSP00000424809:N86S;ENSP00000381739:N68S	ENSP00000354726:N68S	N	+	2	0	WNT8A	137448186	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	5.067000	0.64357	1.021000	0.39600	0.533000	0.62120	AAT		WNT8A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280395.1	NM_058244	
GRIA1	2890	broad.mit.edu	37	5	153030051	153030051	+	Missense_Mutation	SNP	C	C	T	rs146865938		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr5:153030051C>T	ENST00000285900.5	+	4	965	c.622C>T	c.(622-624)Cgc>Tgc	p.R208C	GRIA1_ENST00000518142.1_Missense_Mutation_p.R128C|GRIA1_ENST00000340592.5_Missense_Mutation_p.R208C|GRIA1_ENST00000518862.1_3'UTR|GRIA1_ENST00000448073.4_Missense_Mutation_p.R218C|GRIA1_ENST00000518783.1_Missense_Mutation_p.R218C|GRIA1_ENST00000521843.2_Missense_Mutation_p.R139C	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	208					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.R208C(2)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TGAATCAGAACGCCTCAATGC	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		15633	0.0		0.001	False		,,,				2504	0.0				p.R208C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C622T	5						.	C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	91.0	84.0	86.0		622,622	4.5	0.9	5	dbSNP_134	86	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	GRIA1	NM_000827.3,NM_001114183.1	180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	208/907,208/907	153030051	1,13005	2203	4300	6503	153010244	SO:0001583	missense	2890	exon4				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.622C>T	5.37:g.153030051C>T	ENSP00000285900:p.Arg208Cys	Somatic		Capture	Illumina HiSeq	Phase_I	153010244	NM_001114183	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	CCDS4322.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	16.79	3.220301	0.58560	0.0	1.16E-4	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	D;D;D;D;D;D;D	0.83335	-1.71;-1.71;-1.71;-1.71;-1.71;-1.71;-1.71	5.33	4.47	0.54385	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.87884	0.6290	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.939;0.999;0.998;0.961	D	0.87596	0.2494	10	0.87932	D	0	.	7.7112	0.28679	0.2715:0.6507:0.0:0.0777	.	218;218;128;218;208;208	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	C	208;208;128;162;208;139;139;218;218	ENSP00000285900:R208C;ENSP00000427920:R128C;ENSP00000339343:R208C;ENSP00000427864:R139C;ENSP00000442108:R139C;ENSP00000428994:R218C;ENSP00000415569:R218C	ENSP00000285900:R208C	R	+	1	0	GRIA1	153010244	1.000000	0.71417	0.869000	0.34112	0.678000	0.39670	2.299000	0.43611	1.257000	0.44085	-0.142000	0.14014	CGC		GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
LCP2	3937	broad.mit.edu	37	5	169697805	169697805	+	Silent	SNP	C	C	T	rs369364060		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr5:169697805C>T	ENST00000046794.5	-	7	1056	c.441G>A	c.(439-441)ccG>ccA	p.P147P		NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	147					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)		p.P147P(2)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		TGGAGGGTGGCGGCTCATAAT	0.562																																					p.P147P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G441A	5						.	C		2,4328		0,2,2163	94.0	116.0	108.0		441	-10.8	0.0	5		108	0,8524		0,0,4262	no	coding-synonymous	LCP2	NM_005565.3		0,2,6425	TT,TC,CC		0.0,0.0462,0.0156		147/534	169697805	2,12852	2165	4262	6427	169630383	SO:0001819	synonymous_variant	3937	exon7				CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.441G>A	5.37:g.169697805C>T		Somatic		Capture	Illumina HiSeq	Phase_I	169630383	NM_005565	A8KA25|Q53XV4	Silent	SNP	ENST00000046794.5	37	CCDS47339.1																																																																																				LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565	
EGFLAM	133584	broad.mit.edu	37	5	38427310	38427310	+	Silent	SNP	C	C	T	rs199798525		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr5:38427310C>T	ENST00000354891.3	+	14	2356	c.2010C>T	c.(2008-2010)caC>caT	p.H670H	EGFLAM_ENST00000322350.5_Silent_p.H670H|EGFLAM_ENST00000397202.2_Silent_p.H36H|EGFLAM_ENST00000336740.6_Silent_p.H436H|EGFLAM-AS1_ENST00000508986.1_RNA	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	670	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)	p.H670H(2)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					CAGGGGGCCACGTGGAGTTCC	0.522													c|||	1	0.000199681	0.0	0.0	5008	,	,		19734	0.001		0.0	False		,,,				2504	0.0				p.H436H	Colon(62;485 1295 3347 17454)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1308T	5						.						146.0	149.0	148.0					5																	38427310		2203	4300	6503	38463067	SO:0001819	synonymous_variant	133584	exon9			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.2010C>T	5.37:g.38427310C>T		Somatic		Capture	Illumina HiSeq	Phase_I	38463067	NM_182798	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	ENST00000354891.3	37	CCDS56363.1																																																																																				EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
C9	735	broad.mit.edu	37	5	39311419	39311419	+	Missense_Mutation	SNP	G	G	A	rs371134723		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr5:39311419G>A	ENST00000263408.4	-	7	1026	c.931C>T	c.(931-933)Cgc>Tgc	p.R311C		NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	311	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)		p.R311C(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			ACAACATCGCGATTTCTCATT	0.363																																					p.R311C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C931T	5						.	G	CYS/ARG	1,4403	2.1+/-5.4	0,1,2201	121.0	114.0	117.0		931	3.5	0.5	5		117	0,8600		0,0,4300	no	missense	C9	NM_001737.3	180	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	311/560	39311419	1,13003	2202	4300	6502	39347176	SO:0001583	missense	735	exon7				CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.931C>T	5.37:g.39311419G>A	ENSP00000263408:p.Arg311Cys	Somatic		Capture	Illumina HiSeq	Phase_I	39347176	NM_001737		Missense_Mutation	SNP	ENST00000263408.4	37	CCDS3929.1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.349085	0.41599	2.27E-4	0.0	ENSG00000113600	ENST00000263408	D	0.84589	-1.87	5.48	3.46	0.39613	Membrane attack complex component/perforin (MACPF) domain (3);	0.124810	0.52532	D	0.000063	D	0.92586	0.7645	M	0.84846	2.72	0.46078	D	0.998857	D	0.89917	1.0	D	0.97110	1.0	D	0.93816	0.7114	10	0.66056	D	0.02	-17.24	15.5067	0.75745	0.0:0.0:0.7368:0.2632	.	311	P02748	CO9_HUMAN	C	311	ENSP00000263408:R311C	ENSP00000263408:R311C	R	-	1	0	C9	39347176	0.987000	0.35691	0.466000	0.27168	0.155000	0.21991	3.481000	0.53179	1.278000	0.44430	0.563000	0.77884	CGC		C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211576.3		
HAPLN1	1404	broad.mit.edu	37	5	82937409	82937409	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	T	C	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr5:82937409C>T	ENST00000274341.4	-	5	1821	c.971G>A	c.(970-972)cGc>cAc	p.R324H		NM_001884.3	NP_001875.1	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	324	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|liver(1)|lung(15)|ovary(1)|prostate(1)|skin(1)	34		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	Hyaluronan(DB08818)	AGGACTGCAGCGCCTTCTTGG	0.532																																					p.R324H												.	.	0			c.G971A	5						.						107.0	114.0	111.0					5																	82937409		2203	4300	6503	82973165	SO:0001583	missense	1404	exon5				CCDS4061.1	5q14.3	2013-01-11	2004-03-16	2004-03-17	ENSG00000145681	ENSG00000145681		"""Immunoglobulin superfamily / V-set domain containing"""	2380	protein-coding gene	gene with protein product	"""Cartilage link protein"", ""hyaluronan and proteoglycan link protein 1"""	115435	"""cartilage linking protein 1"""	CRTL1		2286376, 2320422	Standard	NM_001884		Approved		uc003kin.3	P10915	OTTHUMG00000119045	ENST00000274341.4:c.971G>A	5.37:g.82937409C>T	ENSP00000274341:p.Arg324His	Germline		Capture	Illumina HiSeq	Phase_I	82973165	NM_001884	B2R9A9	Missense_Mutation	SNP	ENST00000274341.4	37	CCDS4061.1	.	.	.	.	.	.	.	.	.	.	C	12.75	2.033007	0.35893	.	.	ENSG00000145681	ENST00000274341	T	0.30981	1.51	5.22	5.22	0.72569	C-type lectin fold (1);Link (4);C-type lectin-like (1);	0.000000	0.85682	D	0.000000	T	0.38983	0.1061	M	0.64260	1.97	0.80722	D	1	P	0.42409	0.779	B	0.42245	0.381	T	0.31280	-0.9949	10	0.52906	T	0.07	.	19.1617	0.93535	0.0:1.0:0.0:0.0	.	324	P10915	HPLN1_HUMAN	H	324	ENSP00000274341:R324H	ENSP00000274341:R324H	R	-	2	0	HAPLN1	82973165	1.000000	0.71417	1.000000	0.80357	0.199000	0.23934	1.678000	0.37586	2.581000	0.87130	0.655000	0.94253	CGC		HAPLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239256.2	NM_001884	
APC	324	broad.mit.edu	37	5	112151276	112151276	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr5:112151276delC	ENST00000457016.1	+	9	1299	c.919delC	c.(919-921)catfs	p.H307fs	APC_ENST00000257430.4_Frame_Shift_Del_p.H307fs|APC_ENST00000508376.2_Frame_Shift_Del_p.H307fs			P25054	APC_HUMAN	adenomatous polyposis coli	307	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.H307fs*29(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GCTGACAAGTCATCTGGGAAC	0.458		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.H289fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.865delC	5						.						109.0	94.0	99.0					5																	112151276		2202	4300	6502	112179175	SO:0001589	frameshift_variant	324	exon7	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.919delC	5.37:g.112151276delC	ENSP00000413133:p.His307fs	Somatic		Capture	Illumina HiSeq	Phase_I	112179175	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
GFPT2	9945	broad.mit.edu	37	5	179743366	179743366	+	Silent	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr5:179743366G>A	ENST00000253778.8	-	13	1417	c.1248C>T	c.(1246-1248)gaC>gaT	p.D416D	GFPT2_ENST00000520165.1_5'Flank	NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	416	SIS 1. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)	p.D416D(1)		breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	AAAAGCAAACGTCATCCCTGA	0.502																																					p.D416D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1248T	5						.						81.0	83.0	82.0					5																	179743366		2099	4234	6333	179675972	SO:0001819	synonymous_variant	9945	exon13			AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.1248C>T	5.37:g.179743366G>A		Somatic		Capture	Illumina HiSeq	Phase_I	179675972	NM_005110	Q53XM2|Q9BWS4	Silent	SNP	ENST00000253778.8	37	CCDS43411.1																																																																																				GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373444.4	NM_005110	
HIST1H1D	3007	broad.mit.edu	37	6	26235082	26235082	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr6:26235082G>A	ENST00000244534.5	-	1	134	c.80C>T	c.(79-81)gCa>gTa	p.A27V		NM_005320.2	NP_005311.1	P16402	H13_HUMAN	histone cluster 1, H1d	27					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.A27V(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				AGTTGCGCCTGCCTTCTTCGC	0.532																																					p.A27V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C80T	6						.						78.0	72.0	74.0					6																	26235082		2203	4300	6503	26343061	SO:0001583	missense	3007	exon1			M60747	CCDS4597.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000124575	ENSG00000124575		"""Histones / Replication-dependent"""	4717	protein-coding gene	gene with protein product		142210	"""H1 histone family, member 3"", ""histone 1, H1d"""	H1F3		1916825, 12408966	Standard	NM_005320		Approved	H1.3, H1d, H1s-2	uc003nhd.3	P16402	OTTHUMG00000014432	ENST00000244534.5:c.80C>T	6.37:g.26235082G>A	ENSP00000244534:p.Ala27Val	Somatic		Capture	Illumina HiSeq	Phase_I	26343061	NM_005320	B2R751|Q2M2I2	Missense_Mutation	SNP	ENST00000244534.5	37	CCDS4597.1	.	.	.	.	.	.	.	.	.	.	.	4.633	0.117706	0.08881	.	.	ENSG00000124575	ENST00000244534	T	0.12255	2.7	5.12	4.24	0.50183	.	0.547857	0.20979	N	0.082246	T	0.02533	0.0077	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.41197	-0.9522	10	0.31617	T	0.26	0.2997	13.6726	0.62434	0.0:0.2952:0.7048:0.0	.	27	P16402	H13_HUMAN	V	27	ENSP00000244534:A27V	ENSP00000244534:A27V	A	-	2	0	HIST1H1D	26343061	0.003000	0.15002	0.001000	0.08648	0.003000	0.03518	1.454000	0.35178	1.288000	0.44600	0.655000	0.94253	GCA		HIST1H1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040095.1	NM_005320	
BRPF3	27154	broad.mit.edu	37	6	36181666	36181666	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr6:36181666A>G	ENST00000357641.6	+	8	2745	c.2492A>G	c.(2491-2493)aAa>aGa	p.K831R	BRPF3_ENST00000339717.7_Intron|BRPF3_ENST00000534694.1_Intron|BRPF3_ENST00000534400.1_Missense_Mutation_p.K831R|BRPF3_ENST00000443324.2_Intron|BRPF3_ENST00000543502.1_Intron	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	831					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)	p.K831R(1)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						GATGACTCCAAACTGCCTCCT	0.488																																					p.K831R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2492G	6						.						72.0	84.0	80.0					6																	36181666		2203	4300	6503	36289644	SO:0001583	missense	27154	exon8			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.2492A>G	6.37:g.36181666A>G	ENSP00000350267:p.Lys831Arg	Somatic		Capture	Illumina HiSeq	Phase_I	36289644	NM_015695	A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	ENST00000357641.6	37	CCDS34437.1	.	.	.	.	.	.	.	.	.	.	A	14.80	2.642187	0.47153	.	.	ENSG00000096070	ENST00000357641;ENST00000534400;ENST00000394572	T;T	0.18338	2.42;2.22	5.86	3.47	0.39725	.	0.222920	0.44902	N	0.000414	T	0.05686	0.0149	L	0.48642	1.525	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.15723	-1.0427	10	0.25751	T	0.34	.	8.8864	0.35406	0.8538:0.0:0.1462:0.0	.	831	Q9ULD4	BRPF3_HUMAN	R	831;831;245	ENSP00000350267:K831R;ENSP00000436504:K831R	ENSP00000350267:K831R	K	+	2	0	BRPF3	36289644	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	3.014000	0.49590	0.476000	0.27440	0.413000	0.27773	AAA		BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040335.3	NM_015695	
PGK2	5232	broad.mit.edu	37	6	49754587	49754587	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr6:49754587T>A	ENST00000304801.3	-	1	466	c.314A>T	c.(313-315)gAg>gTg	p.E105V		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	105					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.E105V(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					ACAGGCTTTCTCCACTTCTGC	0.522																																					p.E105V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A314T	6						.						118.0	112.0	114.0					6																	49754587		2203	4300	6503	49862546	SO:0001583	missense	5232	exon1			K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.314A>T	6.37:g.49754587T>A	ENSP00000305995:p.Glu105Val	Somatic		Capture	Illumina HiSeq	Phase_I	49862546	NM_138733	B2R6Y8|Q9H107	Missense_Mutation	SNP	ENST00000304801.3	37	CCDS4930.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.415090	0.42817	.	.	ENSG00000170950	ENST00000304801	D	0.92495	-3.05	4.09	4.09	0.47781	Phosphoglycerate kinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91382	0.7281	M	0.69248	2.105	0.80722	D	1	B	0.30889	0.299	P	0.45913	0.497	D	0.92473	0.5987	10	0.72032	D	0.01	-28.3565	11.6557	0.51318	0.0:0.0:0.0:1.0	.	105	P07205	PGK2_HUMAN	V	105	ENSP00000305995:E105V	ENSP00000305995:E105V	E	-	2	0	PGK2	49862546	1.000000	0.71417	1.000000	0.80357	0.198000	0.23893	7.264000	0.78432	2.070000	0.61991	0.477000	0.44152	GAG		PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1		
MDN1	23195	broad.mit.edu	37	6	90356307	90356307	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr6:90356307C>A	ENST00000369393.3	-	100	16526	c.16411G>T	c.(16411-16413)Gcc>Tcc	p.A5471S	MDN1_ENST00000428876.1_Missense_Mutation_p.A5471S			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	5471	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AACATGTTGGCAACAGACTCT	0.403																																					p.A5471S												.	.	0			c.G16411T	6						.						74.0	76.0	75.0					6																	90356307		2203	4300	6503	90413028	SO:0001583	missense	23195	exon100			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.16411G>T	6.37:g.90356307C>A	ENSP00000358400:p.Ala5471Ser	None		Capture	Illumina HiSeq	Phase_I	90413028	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	C	9.986	1.229352	0.22542	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.22945	1.93;1.93	5.76	4.88	0.63580	von Willebrand factor, type A (2);	0.185852	0.47093	D	0.000256	T	0.04318	0.0119	N	0.16790	0.44	0.26905	N	0.96703	P	0.39282	0.666	B	0.33339	0.162	T	0.24512	-1.0158	10	0.10377	T	0.69	.	10.9835	0.47508	0.0:0.7977:0.1316:0.0706	.	5471	Q9NU22	MDN1_HUMAN	S	5471	ENSP00000358400:A5471S;ENSP00000413970:A5471S	ENSP00000358400:A5471S	A	-	1	0	MDN1	90413028	1.000000	0.71417	0.372000	0.25991	0.400000	0.30750	3.270000	0.51600	1.534000	0.49203	0.650000	0.86243	GCC		MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
LATS1	9113	broad.mit.edu	37	6	149983289	149983289	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr6:149983289C>T	ENST00000543571.1	-	8	3516	c.2969G>A	c.(2968-2970)cGa>cAa	p.R990Q	LATS1_ENST00000253339.5_Missense_Mutation_p.R990Q	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1									p.R990Q(2)		central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		TTCGGGTCCTCGGCAAAGTTT	0.388																																					p.R990Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2969A	6						.						102.0	107.0	106.0					6																	149983289		2203	4300	6503	150024982	SO:0001583	missense	9113	exon8			AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.2969G>A	6.37:g.149983289C>T	ENSP00000437550:p.Arg990Gln	Somatic		Capture	Illumina HiSeq	Phase_I	150024982	NM_004690		Missense_Mutation	SNP	ENST00000543571.1	37	CCDS34551.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.476762	0.84640	.	.	ENSG00000131023	ENST00000543571;ENST00000253339	T;T	0.07021	3.23;3.23	5.45	5.45	0.79879	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.41001	D	0.000972	T	0.03390	0.0098	N	0.05619	-0.0049999999999999	0.80722	D	1	P	0.39376	0.67	B	0.43838	0.433	T	0.58289	-0.7662	9	.	.	.	.	19.2848	0.94066	0.0:1.0:0.0:0.0	.	990	O95835	LATS1_HUMAN	Q	990	ENSP00000437550:R990Q;ENSP00000253339:R990Q	.	R	-	2	0	LATS1	150024982	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.442000	0.80503	2.562000	0.86427	0.591000	0.81541	CGA		LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690	
PLXNA4	91584	broad.mit.edu	37	7	131853119	131853119	+	Silent	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr7:131853119G>A	ENST00000359827.3	-	22	5192	c.4230C>T	c.(4228-4230)gcC>gcT	p.A1410A	PLXNA4_ENST00000321063.4_Silent_p.A1410A			Q9HCM2	PLXA4_HUMAN	plexin A4	1410					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.A1410A(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CAATGAGGTCGGCCAGCAGCT	0.602																																					p.A1410A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C4230T	7						.						72.0	74.0	73.0					7																	131853119		2203	4300	6503	131503659	SO:0001819	synonymous_variant	91584	exon22			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4230C>T	7.37:g.131853119G>A		Somatic		Capture	Illumina HiSeq	Phase_I	131503659	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	37	CCDS43646.1																																																																																				PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
RAB19	401409	broad.mit.edu	37	7	140107584	140107584	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr7:140107584G>C	ENST00000356407.3	+	1	206	c.138G>C	c.(136-138)caG>caC	p.Q46H	RAB19_ENST00000537763.1_Missense_Mutation_p.Q46H|RAB19_ENST00000275874.5_Missense_Mutation_p.Q46H			A4D1S5	RAB19_HUMAN	RAB19, member RAS oncogene family	46					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.Q46H(2)		breast(3)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	9	Melanoma(164;0.0142)					CTGAGACACAGCAGAACACGA	0.483																																					p.Q46H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G138C	7						.						161.0	133.0	143.0					7																	140107584		2203	4300	6503	139754053	SO:0001583	missense	401409	exon2				CCDS34762.1, CCDS34762.2	7q34	2014-05-09			ENSG00000146955	ENSG00000146955		"""RAB, member RAS oncogene"""	19982	protein-coding gene	gene with protein product							Standard	NM_001008749		Approved	RAB19B	uc010lni.2	A4D1S5	OTTHUMG00000157410	ENST00000356407.3:c.138G>C	7.37:g.140107584G>C	ENSP00000348778:p.Gln46His	Somatic		Capture	Illumina HiSeq	Phase_I	139754053	NM_001008749	A4D1S6|B2RTS6|B5MDR2|Q9UL27	Missense_Mutation	SNP	ENST00000356407.3	37	CCDS34762.2	.	.	.	.	.	.	.	.	.	.	G	15.84	2.953035	0.53293	.	.	ENSG00000146955	ENST00000495590;ENST00000275874;ENST00000537763;ENST00000356407	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	6.06	4.2	0.49525	Small GTP-binding protein domain (1);	0.054522	0.85682	D	0.000000	T	0.61274	0.2334	N	0.05124	-0.11	0.80722	D	1	B	0.15473	0.013	B	0.16289	0.015	T	0.60167	-0.7316	10	0.72032	D	0.01	.	8.8509	0.35199	0.1248:0.0:0.7519:0.1233	.	46	A4D1S5	RAB19_HUMAN	H	46	ENSP00000420782:Q46H;ENSP00000275874:Q46H;ENSP00000440167:Q46H;ENSP00000348778:Q46H	ENSP00000275874:Q46H	Q	+	3	2	RAB19	139754053	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	4.770000	0.62309	1.500000	0.48636	0.655000	0.94253	CAG		RAB19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348740.1		
AMZ1	155185	broad.mit.edu	37	7	2740162	2740162	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr7:2740162C>T	ENST00000312371.4	+	2	445	c.77C>T	c.(76-78)gCa>gTa	p.A26V	AMZ1_ENST00000407112.1_Missense_Mutation_p.A26V	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	26							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A26V(1)		breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		TCCACTGACGCAGCCCTGCAG	0.672																																					p.A26V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C77T	7						.						102.0	109.0	107.0					7																	2740162		2203	4300	6503	2706688	SO:0001583	missense	155185	exon2			AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.77C>T	7.37:g.2740162C>T	ENSP00000308149:p.Ala26Val	Somatic		Capture	Illumina HiSeq	Phase_I	2706688	NM_133463	B3KRS0|Q8TF51	Missense_Mutation	SNP	ENST00000312371.4	37	CCDS34589.1	.	.	.	.	.	.	.	.	.	.	C	10.36	1.329956	0.24167	.	.	ENSG00000174945	ENST00000312371;ENST00000407112	T;T	0.32272	1.94;1.46	4.24	1.25	0.21368	.	0.887885	0.09591	N	0.781532	T	0.14356	0.0347	N	0.08118	0	0.09310	N	1	B;B	0.33807	0.426;0.035	B;B	0.32090	0.14;0.027	T	0.20174	-1.0283	10	0.59425	D	0.04	-4.1793	4.4898	0.11808	0.1755:0.6317:0.0:0.1928	.	26;26	B3KRS0;Q400G9	.;AMZ1_HUMAN	V	26	ENSP00000308149:A26V;ENSP00000386020:A26V	ENSP00000308149:A26V	A	+	2	0	AMZ1	2706688	0.002000	0.14202	0.000000	0.03702	0.339000	0.28857	1.540000	0.36115	-0.061000	0.13110	0.561000	0.74099	GCA		AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325244.1	NM_133463	
ABCA13	154664	broad.mit.edu	37	7	48506562	48506562	+	Silent	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr7:48506562C>T	ENST00000435803.1	+	44	12849	c.12825C>T	c.(12823-12825)ggC>ggT	p.G4275G	ABCA13_ENST00000544596.1_Intron	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4275					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.G4275G(1)|p.G4220G(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GCAGTGGGGGCGACAACTTGG	0.498																																					p.A4221V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C12662T	7						.						101.0	110.0	107.0					7																	48506562		2071	4212	6283	48477108	SO:0001819	synonymous_variant	154664	exon42			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12825C>T	7.37:g.48506562C>T		Somatic		Capture	Illumina HiSeq	Phase_I	48477108	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																				ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
TYW1	55253	broad.mit.edu	37	7	66463094	66463094	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr7:66463094C>T	ENST00000359626.5	+	2	211	c.47C>T	c.(46-48)tCa>tTa	p.S16L	TYW1_ENST00000491969.1_3'UTR|SBDS_ENST00000246868.2_5'Flank	NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	16					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)	p.S16L(1)		breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				CCTTTAATATCATTATGGATA	0.353																																					p.S16L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C47T	7						.						171.0	163.0	166.0					7																	66463094		2203	4300	6503	66100529	SO:0001583	missense	55253	exon2			AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.47C>T	7.37:g.66463094C>T	ENSP00000352645:p.Ser16Leu	Somatic		Capture	Illumina HiSeq	Phase_I	66100529	NM_018264	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Missense_Mutation	SNP	ENST00000359626.5	37	CCDS5538.1	.	.	.	.	.	.	.	.	.	.	C	18.83	3.707924	0.68615	.	.	ENSG00000198874	ENST00000359626;ENST00000442959	T	0.17054	2.3	4.08	4.08	0.47627	.	0.649462	0.13765	U	0.364340	T	0.17238	0.0414	M	0.77103	2.36	0.36783	D	0.884445	B	0.16166	0.016	B	0.11329	0.006	T	0.21552	-1.0242	10	0.02654	T	1	.	7.5914	0.28023	0.0:0.8853:0.0:0.1147	.	16	Q9NV66	TYW1_HUMAN	L	16	ENSP00000352645:S16L	ENSP00000352645:S16L	S	+	2	0	TYW1	66100529	0.039000	0.19947	1.000000	0.80357	0.995000	0.86356	1.790000	0.38734	2.103000	0.63969	0.655000	0.94253	TCA		TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2	NM_018264	
HIP1	3092	broad.mit.edu	37	7	75182849	75182849	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr7:75182849A>G	ENST00000336926.6	-	22	2224	c.2198T>C	c.(2197-2199)cTc>cCc	p.L733P	HIP1_ENST00000434438.2_Missense_Mutation_p.L733P	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	733					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)	p.L735P(1)		breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CAGGTAGGCGAGGGTTTCCCT	0.547			T	PDGFRB	CMML																																p.L733P			Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2198C	7						.						84.0	69.0	74.0					7																	75182849		2203	4300	6503	75020785	SO:0001583	missense	3092	exon22			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2198T>C	7.37:g.75182849A>G	ENSP00000336747:p.Leu733Pro	Somatic		Capture	Illumina HiSeq	Phase_I	75020785	NM_005338	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	37	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	a	14.15	2.450480	0.43531	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.19532	2.4;2.14	5.08	5.08	0.68730	.	0.180634	0.49305	D	0.000141	T	0.41604	0.1166	M	0.80183	2.485	0.58432	D	0.999998	D;D	0.56968	0.978;0.977	P;P	0.62014	0.896;0.897	T	0.38351	-0.9665	10	0.59425	D	0.04	-18.1762	7.4652	0.27318	0.9057:0.0:0.0943:0.0	.	733;733	E7ES17;O00291	.;HIP1_HUMAN	P	733	ENSP00000336747:L733P;ENSP00000410300:L733P	ENSP00000336747:L733P	L	-	2	0	HIP1	75020785	0.997000	0.39634	0.398000	0.26321	0.315000	0.28087	4.726000	0.61986	2.133000	0.65898	0.533000	0.62120	CTC		HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338	
CACNA2D1	781	broad.mit.edu	37	7	81799925	81799925	+	Splice_Site	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr7:81799925G>A	ENST00000356253.5	-	4	550	c.295C>T	c.(295-297)Cgc>Tgc	p.R99C	CACNA2D1_ENST00000423588.1_Splice_Site_p.R99C|CACNA2D1_ENST00000356860.3_Splice_Site_p.R99C			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	99				R -> S (in Ref. 1; AAA51903). {ECO:0000305}.	calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.R99C(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	AATGCCAGGCGCTGAAAAACA	0.348																																					p.R99C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C295T	7						.						142.0	153.0	149.0					7																	81799925		2203	4300	6503	81637861	SO:0001630	splice_region_variant	781	exon4			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.295-1C>T	7.37:g.81799925G>A		Somatic		Capture	Illumina HiSeq	Phase_I	81637861	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37		.	.	.	.	.	.	.	.	.	.	G	28.1	4.890030	0.91889	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000423588	T;T;T	0.24723	3.17;3.16;1.84	6.03	6.03	0.97812	.	0.069805	0.56097	D	0.000022	T	0.43255	0.1239	L	0.42245	1.32	0.80722	D	1	D	0.76494	0.999	P	0.61275	0.886	T	0.13361	-1.0512	10	0.87932	D	0	-8.574	18.7374	0.91761	0.0:0.0:1.0:0.0	.	99	P54289-2	.	C	99	ENSP00000349320:R99C;ENSP00000348589:R99C;ENSP00000405395:R99C	ENSP00000284088:R99C	R	-	1	0	CACNA2D1	81637861	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.336000	0.59304	2.861000	0.98227	0.655000	0.94253	CGC		CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			Missense_Mutation
CDK14	5218	broad.mit.edu	37	7	90546961	90546961	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr7:90546961C>T	ENST00000380050.3	+	8	879	c.748C>T	c.(748-750)Cgt>Tgt	p.R250C	CDK14_ENST00000265741.3_Missense_Mutation_p.R232C|CDK14_ENST00000406263.1_Missense_Mutation_p.R204C|CDK14_ENST00000436577.2_Missense_Mutation_p.R121C			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	250	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.R232C(1)		breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						CATCCACCAGCGTTATATTTT	0.408																																					p.R232C	GBM(83;1228 1256 8311 16577 31299)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C694T	7						.						151.0	140.0	144.0					7																	90546961		2203	4300	6503	90384897	SO:0001583	missense	5218	exon7				CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.748C>T	7.37:g.90546961C>T	ENSP00000369390:p.Arg250Cys	Somatic		Capture	Illumina HiSeq	Phase_I	90384897	NM_012395	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Missense_Mutation	SNP	ENST00000380050.3	37		.	.	.	.	.	.	.	.	.	.	C	16.27	3.074896	0.55646	.	.	ENSG00000058091	ENST00000380050;ENST00000265741;ENST00000406263;ENST00000436577	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.34	5.34	0.76211	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.065118	0.64402	D	0.000013	T	0.73265	0.3565	M	0.67569	2.06	0.80722	D	1	D;D;D	0.71674	0.995;0.998;0.997	P;P;P	0.51657	0.651;0.676;0.531	T	0.77378	-0.2610	10	0.87932	D	0	-6.2701	14.6299	0.68647	0.0:0.8545:0.1455:0.0	.	121;232;250	E7EUK8;O94921-2;O94921	.;.;CDK14_HUMAN	C	250;232;204;121	ENSP00000369390:R250C;ENSP00000265741:R232C;ENSP00000385034:R204C;ENSP00000398936:R121C	ENSP00000265741:R232C	R	+	1	0	CDK14	90384897	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.881000	0.56152	2.507000	0.84556	0.467000	0.42956	CGT		CDK14-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000059970.5	NM_012395	
SAMD9	54809	broad.mit.edu	37	7	92732647	92732647	+	Missense_Mutation	SNP	C	C	T	rs369626579		TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr7:92732647C>T	ENST00000379958.2	-	3	3033	c.2764G>A	c.(2764-2766)Gct>Act	p.A922T		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	922						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.A922T(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TTAAGAAGAGCCAGAAAAGAA	0.363																																					p.A922T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2764A	7						.						49.0	51.0	50.0					7																	92732647		2176	4289	6465	92570583	SO:0001583	missense	54809	exon2			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.2764G>A	7.37:g.92732647C>T	ENSP00000369292:p.Ala922Thr	Somatic		Capture	Illumina HiSeq	Phase_I	92570583	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	37	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	C	12.46	1.945171	0.34283	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.37752	1.18;2.05	4.47	1.52	0.23074	.	0.269941	0.27912	N	0.017347	T	0.26991	0.0661	L	0.50333	1.59	0.22811	N	0.998703	B	0.14805	0.011	B	0.12837	0.008	T	0.15925	-1.0420	10	0.41790	T	0.15	-6.2226	4.9613	0.14068	0.1491:0.5939:0.0:0.2569	.	922	Q5K651	SAMD9_HUMAN	T	922	ENSP00000369292:A922T;ENSP00000414529:A922T	ENSP00000369292:A922T	A	-	1	0	SAMD9	92570583	0.968000	0.33430	0.999000	0.59377	0.712000	0.41017	1.779000	0.38624	0.530000	0.28619	-0.875000	0.02981	GCT		SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
INSIG1	3638	broad.mit.edu	37	7	155094498	155094498	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr7:155094498C>T	ENST00000340368.4	+	5	957	c.746C>T	c.(745-747)cCt>cTt	p.P249L	INSIG1_ENST00000344756.4_Missense_Mutation_p.P97L|INSIG1_ENST00000342407.5_Missense_Mutation_p.L152F	NM_005542.4	NP_005533.2	O15503	INSI1_HUMAN	insulin induced gene 1	249					cell proliferation (GO:0008283)|cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|metabolic process (GO:0008152)|middle ear morphogenesis (GO:0042474)|negative regulation of cargo loading into COPII-coated vesicle (GO:1901303)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)		p.P249L(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	19	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCTTGGCTCCCTTGTATATTT	0.418																																					p.P249L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C746T	7						.						196.0	186.0	190.0					7																	155094498		2203	4300	6503	154725433	SO:0001583	missense	3638	exon5				CCDS5938.1, CCDS5939.1	7q36	2008-07-18			ENSG00000186480	ENSG00000186480			6083	protein-coding gene	gene with protein product	"""INSIG-1 membrane protein"""	602055				9268630	Standard	NM_005542		Approved	CL-6, MGC1405	uc003wly.3	O15503	OTTHUMG00000151330	ENST00000340368.4:c.746C>T	7.37:g.155094498C>T	ENSP00000344741:p.Pro249Leu	Somatic		Capture	Illumina HiSeq	Phase_I	154725433	NM_005542	A4D2N1|A8K6L0|Q53XW8|Q9BUV5	Missense_Mutation	SNP	ENST00000340368.4	37	CCDS5938.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.2|25.2	4.613882|4.613882	0.87359|0.87359	.|.	.|.	ENSG00000186480|ENSG00000186480	ENST00000342407|ENST00000340368;ENST00000344756	T|T;T	0.51574|0.56776	0.7|0.68;0.44	5.19|5.19	5.19|5.19	0.71726|0.71726	.|.	.|0.053224	.|0.85682	.|D	.|0.000000	T|T	0.54615|0.54615	0.1869|0.1869	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	B|B;P	0.33448|0.34757	0.412|0.375;0.467	B|B;B	0.24541|0.37387	0.054|0.248;0.103	T|T	0.51702|0.51702	-0.8672|-0.8672	9|10	0.72032|0.24483	D|T	0.01|0.36	.|.	19.0723|19.0723	0.93145|0.93145	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	152|97;249	A4D2N1|F5H6P3;O15503	.|.;INSI1_HUMAN	F|L	152|249;97	ENSP00000344035:L152F|ENSP00000344741:P249L;ENSP00000340010:P97L	ENSP00000344035:L152F|ENSP00000344741:P249L	L|P	+|+	1|2	0|0	INSIG1|INSIG1	154725433|154725433	1.000000|1.000000	0.71417|0.71417	0.977000|0.977000	0.42913|0.42913	0.917000|0.917000	0.54804|0.54804	7.496000|7.496000	0.81526|0.81526	2.579000|2.579000	0.87056|0.87056	0.650000|0.650000	0.86243|0.86243	CTT|CCT		INSIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322244.3	NM_198336	
SCARA5	286133	broad.mit.edu	37	8	27737203	27737203	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr8:27737203G>A	ENST00000354914.3	-	8	1719	c.1234C>T	c.(1234-1236)Cgg>Tgg	p.R412W	SCARA5_ENST00000380385.2_Missense_Mutation_p.R187W	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	412	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)	p.R412W(1)		central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		CCCCAACGCCGGTCGTGGTAC	0.667																																					p.R412W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1234T	8						.						99.0	82.0	88.0					8																	27737203		2203	4300	6503	27793122	SO:0001583	missense	286133	exon8			AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.1234C>T	8.37:g.27737203G>A	ENSP00000346990:p.Arg412Trp	Somatic		Capture	Illumina HiSeq	Phase_I	27793122	NM_173833	Q6UXZ1|Q7Z4A1|Q8N4Z7	Missense_Mutation	SNP	ENST00000354914.3	37	CCDS6064.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.182895	0.78677	.	.	ENSG00000168079	ENST00000354914;ENST00000380385	T;T	0.29397	1.57;1.57	4.87	3.97	0.46021	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	0.077234	0.52532	D	0.000068	T	0.45875	0.1364	L	0.50333	1.59	0.80722	D	1	D;D	0.76494	0.996;0.999	P;D	0.71184	0.859;0.972	T	0.39683	-0.9602	10	0.62326	D	0.03	.	10.4474	0.44503	0.0:0.0:0.6463:0.3537	.	187;412	Q6ZMJ2-4;Q6ZMJ2	.;SCAR5_HUMAN	W	412;187	ENSP00000346990:R412W;ENSP00000369746:R187W	ENSP00000346990:R412W	R	-	1	2	SCARA5	27793122	0.096000	0.21769	0.907000	0.35723	0.983000	0.72400	2.402000	0.44521	1.129000	0.42072	0.591000	0.81541	CGG		SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2	NM_173833	
ZFHX4	79776	broad.mit.edu	37	8	77768194	77768194	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr8:77768194G>A	ENST00000521891.2	+	10	9485	c.9037G>A	c.(9037-9039)Ggg>Agg	p.G3013R	ZFHX4_ENST00000455469.2_Missense_Mutation_p.G2968R|ZFHX4_ENST00000050961.6_Missense_Mutation_p.G2968R|ZFHX4_ENST00000518282.1_Missense_Mutation_p.G2987R	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2968					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.G2997R(2)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TACCCTCTGCGGGGTGAAGTA	0.478										HNSCC(33;0.089)																											p.G3013R												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G9037A	8						.						49.0	48.0	49.0					8																	77768194		1936	4136	6072	77930749	SO:0001583	missense	79776	exon10				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9037G>A	8.37:g.77768194G>A	ENSP00000430497:p.Gly3013Arg	Somatic		Capture	Illumina HiSeq	Phase_I	77930749	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305352	0.60305	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.52295	0.67;0.73;0.69;0.69	5.19	5.19	0.71726	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	0.000000	0.45361	U	0.000376	T	0.69178	0.3082	M	0.70275	2.135	0.80722	D	1	D;D;D	0.89917	0.998;0.999;1.0	D;D;D	0.78314	0.919;0.963;0.991	T	0.71080	-0.4696	10	0.62326	D	0.03	.	18.8924	0.92410	0.0:0.0:1.0:0.0	.	2968;2968;3013	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	R	3013;2997;2968;2968;2987	ENSP00000430497:G3013R;ENSP00000399605:G2968R;ENSP00000050961:G2968R;ENSP00000430848:G2987R	ENSP00000050961:G2968R	G	+	1	0	ZFHX4	77930749	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.507000	0.66999	2.696000	0.92011	0.655000	0.94253	GGG		ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
CSMD3	114788	broad.mit.edu	37	8	113569152	113569152	+	Silent	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr8:113569152G>A	ENST00000297405.5	-	25	4318	c.4074C>T	c.(4072-4074)ggC>ggT	p.G1358G	CSMD3_ENST00000343508.3_Silent_p.G1318G|CSMD3_ENST00000352409.3_Silent_p.G1358G|CSMD3_ENST00000455883.2_Silent_p.G1254G	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1358	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G1358G(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATTGTGGAATGCCAGGATCTT	0.403										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.G1358G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4074T	8						.						85.0	78.0	80.0					8																	113569152		2203	4299	6502	113638328	SO:0001819	synonymous_variant	114788	exon25			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4074C>T	8.37:g.113569152G>A		Somatic		Capture	Illumina HiSeq	Phase_I	113638328	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1																																																																																				CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
GRIN3A	116443	broad.mit.edu	37	9	104499569	104499569	+	Silent	SNP	C	C	T			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chr9:104499569C>T	ENST00000361820.3	-	1	1293	c.693G>A	c.(691-693)gaG>gaA	p.E231E		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	231					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.E231E(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TCACCTGACTCTCCCGTGGAA	0.602																																					p.E231E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G693A	9						.						47.0	42.0	44.0					9																	104499569		2203	4300	6503	103539390	SO:0001819	synonymous_variant	116443	exon1				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.693G>A	9.37:g.104499569C>T		Somatic		Capture	Illumina HiSeq	Phase_I	103539390	NM_133445	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Silent	SNP	ENST00000361820.3	37	CCDS6758.1																																																																																				GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
YY2	404281	broad.mit.edu	37	X	21875007	21875007	+	Silent	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chrX:21875007G>A	ENST00000429584.2	+	1	903	c.405G>A	c.(403-405)caG>caA	p.Q135Q	MBTPS2_ENST00000379484.5_Intron|MBTPS2_ENST00000465888.1_3'UTR|MBTPS2_ENST00000365779.2_Intron	NM_206923.3	NP_996806.2	O15391	TYY2_HUMAN	YY2 transcription factor	135					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q135Q(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	19						CATCAACCCAGagccgcagca	0.612																																					p.Q135Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G405A	X						.						44.0	39.0	41.0					X																	21875007		2203	4300	6503	21784928	SO:0001819	synonymous_variant	404281	exon1			AK091850	CCDS14202.1	Xp22.2-p22.1	2011-02-11			ENSG00000230797	ENSG00000230797		"""Zinc fingers, C2H2-type"""	31684	protein-coding gene	gene with protein product	"""transcription factor yin yang 2"""	300570				14702039	Standard	NM_206923		Approved	ZNF631	uc011mjp.2	O15391	OTTHUMG00000021236	ENST00000429584.2:c.405G>A	X.37:g.21875007G>A		Somatic		Capture	Illumina HiSeq	Phase_I	21784928	NM_206923	B2RP10|Q6Q1S4	Silent	SNP	ENST00000429584.2	37	CCDS14202.1																																																																																				YY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056025.1	NM_206923	
MAGEB2	4113	broad.mit.edu	37	X	30237091	30237091	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chrX:30237091G>A	ENST00000378988.4	+	2	495	c.394G>A	c.(394-396)Gtt>Att	p.V132I		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	132	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.V132I(2)		breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						AAAAAAGTCCGTTACAAAGGG	0.468																																					p.V132I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G394A	X						.						57.0	56.0	57.0					X																	30237091		2202	4300	6502	30147012	SO:0001583	missense	4113	exon2			AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.394G>A	X.37:g.30237091G>A	ENSP00000368273:p.Val132Ile	Somatic		Capture	Illumina HiSeq	Phase_I	30147012	NM_002364	O75860	Missense_Mutation	SNP	ENST00000378988.4	37	CCDS14219.1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.527811	0.00959	.	.	ENSG00000099399	ENST00000378988	T	0.02395	4.31	3.27	-2.77	0.05877	.	0.259412	0.35772	N	0.002999	T	0.00552	0.0018	N	0.00422	-1.515	0.09310	N	1	B	0.22983	0.078	B	0.09377	0.004	T	0.36915	-0.9728	10	0.02654	T	1	.	1.1465	0.01776	0.2926:0.3895:0.1349:0.183	.	132	O15479	MAGB2_HUMAN	I	132	ENSP00000368273:V132I	ENSP00000368273:V132I	V	+	1	0	MAGEB2	30147012	0.002000	0.14202	0.000000	0.03702	0.005000	0.04900	0.335000	0.19806	-0.686000	0.05170	-0.422000	0.05995	GTT		MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056157.1	NM_002364	
FAM120C	54954	broad.mit.edu	37	X	54185963	54185963	+	Silent	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chrX:54185963G>A	ENST00000375180.2	-	2	842	c.786C>T	c.(784-786)tcC>tcT	p.S262S	FAM120C_ENST00000328235.4_Silent_p.S262S	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	262							poly(A) RNA binding (GO:0044822)	p.S262S(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GAGCATACTCGGAGTCATGGG	0.478																																					p.S262S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C786T	X						.						106.0	86.0	93.0					X																	54185963		2203	4300	6503	54202688	SO:0001819	synonymous_variant	54954	exon2			AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.786C>T	X.37:g.54185963G>A		Somatic		Capture	Illumina HiSeq	Phase_I	54202688	NM_017848	B2RMT7	Silent	SNP	ENST00000375180.2	37	CCDS14356.1																																																																																				FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056795.2	NM_017848	
MAGEA12	4111	broad.mit.edu	37	X	151900718	151900718	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02H-01A-01W-A00E-09	TCGA-AA-A02H-10A-01W-A00E-09	g.chrX:151900718G>A	ENST00000357916.4	-	2	238	c.83C>T	c.(82-84)gCg>gTg	p.A28V	CSAG1_ENST00000452779.2_5'Flank|CSAG1_ENST00000370291.2_5'Flank|MAGEA12_ENST00000393869.3_Missense_Mutation_p.A28V|CSAG4_ENST00000361201.4_RNA|MAGEA12_ENST00000393900.3_Missense_Mutation_p.A28V|CSAG1_ENST00000370287.3_5'Flank	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	28								p.A28V(1)		breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					AGGAGCCTGCGCACCCACCAA	0.622																																					p.A28V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C83T	X						.						41.0	44.0	43.0					X																	151900718		2203	4300	6503	151651374	SO:0001583	missense	4111	exon2				CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650	ENST00000357916.4:c.83C>T	X.37:g.151900718G>A	ENSP00000350592:p.Ala28Val	Somatic		Capture	Illumina HiSeq	Phase_I	151651374	NM_005367	Q9NSD3	Missense_Mutation	SNP	ENST00000357916.4	37	CCDS14710.1	.	.	.	.	.	.	.	.	.	.	G	5.696	0.312881	0.10789	.	.	ENSG00000213401	ENST00000357916;ENST00000393869;ENST00000393900	T;T;T	0.06608	3.28;3.28;3.28	0.801	0.801	0.18679	Melanoma associated antigen, MAGE, N-terminal (1);	1.806090	0.02674	N	0.108921	T	0.06917	0.0176	L	0.38838	1.175	0.09310	N	1	P	0.44344	0.833	B	0.39904	0.313	T	0.35674	-0.9779	9	0.37606	T	0.19	.	.	.	.	.	28	P43365	MAGAC_HUMAN	V	28	ENSP00000350592:A28V;ENSP00000377447:A28V;ENSP00000377478:A28V	ENSP00000350592:A28V	A	-	2	0	MAGEA12	151651374	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	-0.609000	0.05635	0.646000	0.30693	0.179000	0.17066	GCG		MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058764.1	NM_005367	
