#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SLC45A2	51151	hgsc.bcm.edu	37	5	33951728	33951729	+	In_Frame_Ins	INS	-	-	GAT			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	-	-	-	GAT	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr5:33951728_33951729insGAT	ENST00000296589.4	-	5	1232_1233	c.1086_1087insATC	c.(1084-1089)atctac>atcATCtac	p.362_363insI	SLC45A2_ENST00000509381.1_3'UTR|SLC45A2_ENST00000342059.3_In_Frame_Ins_p.303_304insI|SLC45A2_ENST00000382102.3_In_Frame_Ins_p.362_363insI|SLC45A2_ENST00000345083.5_In_Frame_Ins_p.254_255insI	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	362					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.I362_Y363insI(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						CCTCTTTCGTAGATGAGAAACT	0.450																																					p.Y363delinsIY	Ovarian(31;380 859 8490 22203 49048)											.	.	1	Insertion - In frame(1)	large_intestine(1)	c.1087_1088insATC	5						.																																			33987486	SO:0001652	inframe_insertion	51151	exon5			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.1084_1086dupATC	5.37:g.33951729_33951731dupGAT	ENSP00000296589:p.Ile362_Ile362dup	Somatic		Capture	SOLID	Phase_I	33987485	NM_016180	Q6P2P0|Q9BTM3	In_Frame_Ins	INS	ENST00000296589.4	37	CCDS3901.1																																																																																				SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180	
SAMD9L	219285	hgsc.bcm.edu	37	7	92762589	92762589	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr7:92762589G>A	ENST00000318238.4	-	5	3912	c.2696C>T	c.(2695-2697)aCa>aTa	p.T899I	SAMD9L_ENST00000411955.1_Missense_Mutation_p.T899I|SAMD9L_ENST00000437805.1_Missense_Mutation_p.T899I	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	899					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.T899I(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TTCTATATATGTTTCATCAAA	0.363																																					p.T899I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2696T	7						.						69.0	72.0	71.0					7																	92762589		2203	4300	6503	92600525	SO:0001583	missense	219285	exon5			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.2696C>T	7.37:g.92762589G>A	ENSP00000326247:p.Thr899Ile	Somatic		Capture	SOLID	Phase_I	92600525	NM_152703	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	G	5.445	0.267210	0.10294	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.23552	1.9;1.9;1.9	5.22	-6.98	0.01611	.	1.034640	0.07659	N	0.933222	T	0.10423	0.0255	N	0.11560	0.145	0.09310	N	1	B	0.12630	0.006	B	0.12156	0.007	T	0.32481	-0.9905	10	0.36615	T	0.2	2.8241	5.8357	0.18605	0.2653:0.0:0.2998:0.4349	.	899	Q8IVG5	SAM9L_HUMAN	I	899	ENSP00000326247:T899I;ENSP00000405760:T899I;ENSP00000408796:T899I	ENSP00000326247:T899I	T	-	2	0	SAMD9L	92600525	0.000000	0.05858	0.000000	0.03702	0.992000	0.81027	-1.249000	0.02888	-1.064000	0.03172	0.467000	0.42956	ACA		SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703	
SCFD1	23256	hgsc.bcm.edu	37	14	31119838	31119838	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr14:31119838T>G	ENST00000458591.2	+	9	964	c.737T>G	c.(736-738)cTt>cGt	p.L246R	SCFD1_ENST00000421551.3_Missense_Mutation_p.L187R|SCFD1_ENST00000396629.2_Missense_Mutation_p.L154R|SCFD1_ENST00000544052.2_Missense_Mutation_p.L179R|SCFD1_ENST00000541123.1_Missense_Mutation_p.L61R	NM_016106.3	NP_057190.2	Q8WVM8	SCFD1_HUMAN	sec1 family domain containing 1	246					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle docking involved in exocytosis (GO:0006904)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi transport complex (GO:0017119)|Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)	syntaxin binding (GO:0019905)	p.L246R(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)	13	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		GGTGATACACTTGGAGCTGGC	0.289																																					p.L179R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T536G	14						.						57.0	63.0	61.0					14																	31119838		2203	4294	6497	30189589	SO:0001583	missense	23256	exon8			AF110646	CCDS9639.1, CCDS45092.1, CCDS58308.1	14q12	2006-04-04	2004-01-15	2004-01-16	ENSG00000092108	ENSG00000092108			20726	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 163"""	C14orf163			Standard	NM_016106		Approved	RA410, KIAA0917, STXBP1L2, SLY1	uc001wqm.2	Q8WVM8	OTTHUMG00000029420	ENST00000458591.2:c.737T>G	14.37:g.31119838T>G	ENSP00000390783:p.Leu246Arg	Somatic		Capture	SOLID	Phase_I	30189589	NM_182835	A8K2Z5|B7Z4U7|B7Z594|O60754|O94990|Q7Z529|Q9BZI3|Q9UNL3|Q9Y6A8	Missense_Mutation	SNP	ENST00000458591.2	37	CCDS9639.1	.	.	.	.	.	.	.	.	.	.	T	12.48	1.951585	0.34471	.	.	ENSG00000092108	ENST00000458591;ENST00000544052;ENST00000421551;ENST00000541123;ENST00000396629;ENST00000469043	T;T;T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98;-0.98;-0.98	5.71	5.71	0.89125	.	0.054730	0.64402	D	0.000001	T	0.58177	0.2104	N	0.12182	0.205	0.58432	D	0.999992	B;P;B;P	0.41393	0.044;0.539;0.336;0.748	B;B;B;B	0.40410	0.063;0.328;0.319;0.328	T	0.58607	-0.7607	10	0.15066	T	0.55	-17.3627	15.1704	0.72869	0.0:0.0:0.0:1.0	.	187;179;154;246	B7Z738;B7Z4U7;B7Z594;Q8WVM8	.;.;.;SCFD1_HUMAN	R	246;179;187;61;154;101	ENSP00000390783:L246R;ENSP00000443010:L179R;ENSP00000388078:L187R;ENSP00000443537:L61R;ENSP00000379870:L154R;ENSP00000452448:L101R	ENSP00000309417:L254R	L	+	2	0	SCFD1	30189589	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.393000	0.79851	2.180000	0.69256	0.533000	0.62120	CTT		SCFD1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276612.3	NM_182835	
AHSA1	10598	hgsc.bcm.edu	37	14	77925961	77925961	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr14:77925961C>T	ENST00000216479.3	+	2	243	c.83C>T	c.(82-84)aCg>aTg	p.T28M	VIPAS39_ENST00000343765.2_5'Flank|VIPAS39_ENST00000556412.1_5'Flank|VIPAS39_ENST00000553888.1_5'Flank|AHSA1_ENST00000555517.1_Missense_Mutation_p.T28M|AHSA1_ENST00000535854.2_Missense_Mutation_p.T28M|VIPAS39_ENST00000556909.1_5'Flank|VIPAS39_ENST00000327028.4_5'Flank|VIPAS39_ENST00000557658.1_5'Flank|VIPAS39_ENST00000448935.2_5'Flank	NM_012111.2	NP_036243.1	O95433	AHSA1_HUMAN	AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)	28					positive regulation of ATPase activity (GO:0032781)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)	p.T28M(1)		endometrium(1)|kidney(3)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)	8			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		CTTTGCAGGACGGAGAGAGAT	0.473																																					p.T28M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C83T	14						.						124.0	114.0	118.0					14																	77925961		2203	4300	6503	76995714	SO:0001583	missense	10598	exon2			AJ243310	CCDS9863.1	14q	2008-02-05	2003-04-04	2003-04-11		ENSG00000100591			1189	protein-coding gene	gene with protein product		608466	"""chromosome 14 open reading frame 3"""	C14orf3			Standard	NM_012111		Approved	p38	uc001xtw.3	O95433		ENST00000216479.3:c.83C>T	14.37:g.77925961C>T	ENSP00000216479:p.Thr28Met	Somatic		Capture	SOLID	Phase_I	76995714	NM_012111	B2R9L2|B4DUR9|Q96IL6|Q9P060	Missense_Mutation	SNP	ENST00000216479.3	37	CCDS9863.1	.	.	.	.	.	.	.	.	.	.	C	31	5.090322	0.94149	.	.	ENSG00000100591	ENST00000216479;ENST00000535854;ENST00000555517	.	.	.	5.58	5.58	0.84498	Activator of Hsp90 ATPase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85444	0.5698	M	0.91090	3.175	0.80722	D	1	D;D	0.76494	0.999;0.996	D;P	0.64877	0.93;0.664	D	0.88094	0.2815	9	0.66056	D	0.02	-12.8383	19.5483	0.95308	0.0:1.0:0.0:0.0	.	28;28	B4DUR9;O95433	.;AHSA1_HUMAN	M	28	.	ENSP00000216479:T28M	T	+	2	0	AHSA1	76995714	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	5.875000	0.69660	2.624000	0.88883	0.650000	0.86243	ACG		AHSA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414017.1	NM_012111	
CNN1	1264	hgsc.bcm.edu	37	19	11660520	11660520	+	Silent	SNP	C	C	T	rs376859144		TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr19:11660520C>T	ENST00000252456.2	+	7	1015	c.804C>T	c.(802-804)taC>taT	p.Y268Y	CNN1_ENST00000592923.1_Silent_p.Y218Y|CNN1_ENST00000535659.2_Silent_p.Y218Y|CNN1_ENST00000544952.1_Silent_p.Y248Y	NM_001299.4	NP_001290.2	P51911	CNN1_HUMAN	calponin 1, basic, smooth muscle	268					actomyosin structure organization (GO:0031032)|regulation of smooth muscle contraction (GO:0006940)	cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)		p.Y268Y(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(2)	9						GCCAGGTCTACGACCCCAAGT	0.622																																					p.Y268Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C804T	19						.						79.0	70.0	73.0					19																	11660520		2203	4300	6503	11521520	SO:0001819	synonymous_variant	1264	exon7			U37019	CCDS12263.1	19p13.2-p13.1	2008-07-16				ENSG00000130176			2155	protein-coding gene	gene with protein product		600806				8526917, 9332369	Standard	XM_005259741		Approved	SMCC, Sm-Calp	uc002msc.1	P51911		ENST00000252456.2:c.804C>T	19.37:g.11660520C>T		Somatic		Capture	SOLID	Phase_I	11521520	NM_001299	B2R868|B4DUX6|O00638|Q15416|Q8IY93|Q99438	Silent	SNP	ENST00000252456.2	37	CCDS12263.1																																																																																				CNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458854.1	NM_001299	
LSM14A	26065	hgsc.bcm.edu	37	19	34687545	34687545	+	Silent	SNP	C	C	T			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr19:34687545C>T	ENST00000433627.5	+	3	367	c.292C>T	c.(292-294)Cta>Tta	p.L98L	LSM14A_ENST00000540746.2_Silent_p.L98L|LSM14A_ENST00000544216.3_Silent_p.L98L	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	98					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.L98L(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					TCAGTCCTCACTAGGCTCATC	0.393																																					p.L98L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C292T	19						.						172.0	153.0	160.0					19																	34687545		2203	4300	6503	39379385	SO:0001819	synonymous_variant	26065	exon3			AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.292C>T	19.37:g.34687545C>T		Somatic		Capture	SOLID	Phase_I	39379385	NM_001114093	B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Silent	SNP	ENST00000433627.5	37	CCDS46040.1																																																																																				LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578	
ZNF567	163081	hgsc.bcm.edu	37	19	37211317	37211317	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr19:37211317C>T	ENST00000536254.2	+	6	1913	c.1691C>T	c.(1690-1692)cCt>cTt	p.P564L	ZNF567_ENST00000392163.2_Missense_Mutation_p.P533L|ZNF567_ENST00000588311.1_Missense_Mutation_p.P533L|ZNF567_ENST00000360729.4_Missense_Mutation_p.P533L|ZNF567_ENST00000585696.1_Missense_Mutation_p.P533L|ZNF850_ENST00000589390.1_Intron			Q8N184	ZN567_HUMAN	zinc finger protein 567	564					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P533L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TATGAATGTCCTCAGTGTGGG	0.413																																					p.P533L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1598T	19						.						66.0	68.0	67.0					19																	37211317		2203	4300	6503	41903157	SO:0001583	missense	163081	exon4			AK093034	CCDS12495.1, CCDS74349.1	19q13.12	2013-10-08				ENSG00000189042		"""Zinc fingers, C2H2-type"", ""-"""	28696	protein-coding gene	gene with protein product						12477932	Standard	XM_006723064		Approved	MGC45586	uc002oep.4	Q8N184		ENST00000536254.2:c.1691C>T	19.37:g.37211317C>T	ENSP00000441838:p.Pro564Leu	Somatic		Capture	SOLID	Phase_I	41903157	NM_152603	B3KX49|Q6N044	Missense_Mutation	SNP	ENST00000536254.2	37		.	.	.	.	.	.	.	.	.	.	C	10.79	1.449007	0.26074	.	.	ENSG00000189042	ENST00000536254;ENST00000378686;ENST00000360729;ENST00000423498;ENST00000392163	T;T;T	0.27256	3.23;1.68;1.68	4.92	-0.0607	0.13788	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.885835	0.09533	N	0.789250	T	0.23054	0.0557	L	0.48877	1.53	0.09310	N	0.999999	B;P	0.38922	0.002;0.651	B;B	0.42030	0.002;0.373	T	0.25779	-1.0122	10	0.59425	D	0.04	.	4.3613	0.11203	0.2715:0.5148:0.1326:0.0811	.	564;533	Q8N184;F8WEL6	ZN567_HUMAN;.	L	564;508;533;563;533	ENSP00000441838:P564L;ENSP00000353957:P533L;ENSP00000376003:P533L	ENSP00000353957:P533L	P	+	2	0	ZNF567	41903157	0.000000	0.05858	0.982000	0.44146	0.998000	0.95712	-2.077000	0.01371	0.335000	0.23614	0.561000	0.74099	CCT		ZNF567-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000453549.1	NM_152603	
UBR5	51366	hgsc.bcm.edu	37	8	103317375	103317375	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr8:103317375A>C	ENST00000520539.1	-	21	3371	c.2765T>G	c.(2764-2766)aTt>aGt	p.I922S	UBR5_ENST00000220959.4_Missense_Mutation_p.I922S|UBR5_ENST00000521922.1_Missense_Mutation_p.I916S	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	922					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)	p.I922S(1)		NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			AGCATGCAAAATATTTCGATT	0.383																																					p.I922S	Ovarian(131;96 1741 5634 7352 27489)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2765G	8						.						171.0	165.0	167.0					8																	103317375		2203	4300	6503	103386551	SO:0001583	missense	51366	exon21			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.2765T>G	8.37:g.103317375A>C	ENSP00000429084:p.Ile922Ser	Somatic		Capture	SOLID	Phase_I	103386551	NM_015902	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	ENST00000520539.1	37	CCDS34933.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.95|17.95	3.513892|3.513892	0.64522|0.64522	.|.	.|.	ENSG00000104517|ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922|ENST00000520898;ENST00000519365	T;T;T|.	0.53857|.	0.6;0.6;0.6|.	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	0.057613|.	0.64402|.	D|.	0.000002|.	T|.	0.68595|.	0.3018|.	L|L	0.54323|0.54323	1.7|1.7	0.58432|0.58432	D|D	0.999999|0.999999	B;B|.	0.27498|.	0.18;0.18|.	B;B|.	0.20955|.	0.032;0.032|.	T|.	0.67221|.	-0.5725|.	10|.	0.87932|.	D|.	0|.	.|.	15.0704|15.0704	0.72030|0.72030	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	916;922|.	E7EMW7;O95071|.	.;UBR5_HUMAN|.	S|X	922;922;916|12;37	ENSP00000429084:I922S;ENSP00000220959:I922S;ENSP00000427819:I916S|.	ENSP00000220959:I922S|.	I|Y	-|-	2|3	0|2	UBR5|UBR5	103386551|103386551	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	9.339000|9.339000	0.96797|0.96797	1.967000|1.967000	0.57214|0.57214	0.254000|0.254000	0.18369|0.18369	ATT|TAT		UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
SLC45A4	57210	hgsc.bcm.edu	37	8	142228979	142228979	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr8:142228979C>T	ENST00000024061.3	-	4	914	c.607G>A	c.(607-609)Gac>Aac	p.D203N	SLC45A4_ENST00000519067.1_Missense_Mutation_p.D203N|SLC45A4_ENST00000433583.2_Missense_Mutation_p.D196N|SLC45A4_ENST00000517878.1_Missense_Mutation_p.D254N	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)		p.D203N(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			TGCTCCTCGTCGATGCTGAAC	0.667																																					p.D203N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G607A	8						.						79.0	83.0	81.0					8																	142228979		2203	4300	6503	142298161	SO:0001583	missense	57210	exon4			AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.607G>A	8.37:g.142228979C>T	ENSP00000024061:p.Asp203Asn	Somatic		Capture	SOLID	Phase_I	142298161	NM_001080431	Q6ZRI2|Q9ULU3	Missense_Mutation	SNP	ENST00000024061.3	37	CCDS34948.1	.	.	.	.	.	.	.	.	.	.	C	15.36	2.809098	0.50421	.	.	ENSG00000022567	ENST00000519067;ENST00000517878;ENST00000433583;ENST00000024061;ENST00000520137	D;D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11;-3.11	5.57	3.77	0.43336	.	0.565347	0.20662	N	0.088008	D	0.82318	0.5011	N	0.12182	0.205	0.25639	N	0.986229	P;P;B	0.38300	0.535;0.626;0.084	B;B;B	0.32090	0.115;0.14;0.057	T	0.74016	-0.3800	10	0.52906	T	0.07	-17.0506	11.9038	0.52699	0.0:0.8603:0.0:0.1397	.	254;203;203	E7EV90;Q5BKX6-3;Q5BKX6-2	.;.;.	N	203;254;196;203;61	ENSP00000429059:D203N;ENSP00000428137:D254N;ENSP00000400799:D196N;ENSP00000024061:D203N;ENSP00000429033:D61N	ENSP00000024061:D203N	D	-	1	0	SLC45A4	142298161	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	1.771000	0.38542	0.722000	0.32252	0.555000	0.69702	GAC		SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	XM_050325	
PTGS2	5743	hgsc.bcm.edu	37	1	186646812	186646812	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr1:186646812C>A	ENST00000367468.5	-	5	744	c.608G>T	c.(607-609)gGg>gTg	p.G203V	RP5-973M2.2_ENST00000608917.1_lincRNA|PTGS2_ENST00000490885.2_5'UTR	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	203					anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)	p.G203V(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	GAAAGCTGGCCCTCGCTTATG	0.428																																					p.G203V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G608T	1						.						107.0	112.0	110.0					1																	186646812		2203	4300	6503	184913435	SO:0001583	missense	5743	exon5			D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.608G>T	1.37:g.186646812C>A	ENSP00000356438:p.Gly203Val	Somatic		Capture	SOLID	Phase_I	184913435	NM_000963	A8K802|Q16876	Missense_Mutation	SNP	ENST00000367468.5	37	CCDS1371.1	.	.	.	.	.	.	.	.	.	.	C	32	5.187310	0.94923	.	.	ENSG00000073756	ENST00000367468	T	0.68765	-0.35	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.87018	0.6073	M	0.92738	3.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.89270	0.3604	10	0.87932	D	0	-20.0984	20.0465	0.97608	0.0:1.0:0.0:0.0	.	203;203	Q8IZA9;P35354	.;PGH2_HUMAN	V	203	ENSP00000356438:G203V	ENSP00000356438:G203V	G	-	2	0	PTGS2	184913435	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.627000	0.83176	2.735000	0.93741	0.557000	0.71058	GGG		PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086157.2	NM_000963	
CEP104	9731	hgsc.bcm.edu	37	1	3750457	3750457	+	Missense_Mutation	SNP	C	C	T	rs200715031		TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr1:3750457C>T	ENST00000378230.3	-	12	1952	c.1628G>A	c.(1627-1629)cGc>cAc	p.R543H	CEP104_ENST00000460038.1_5'UTR	NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa	543						centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)	p.R543H(1)		breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						GACGCGGAGGCGGGCAGAAGA	0.438																																					p.R543H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1628A	1						.						112.0	110.0	111.0					1																	3750457		2203	4300	6503	3740317	SO:0001583	missense	9731	exon12			AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.1628G>A	1.37:g.3750457C>T	ENSP00000367476:p.Arg543His	Somatic		Capture	SOLID	Phase_I	3740317	NM_014704	Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Missense_Mutation	SNP	ENST00000378230.3	37	CCDS30571.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.009810	0.75046	.	.	ENSG00000116198	ENST00000378230	T	0.68331	-0.32	5.03	5.03	0.67393	Armadillo-like helical (1);Armadillo-type fold (1);	0.065109	0.64402	D	0.000013	T	0.81273	0.4788	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	0.995;1.0	P;D	0.87578	0.742;0.998	T	0.83003	-0.0176	10	0.59425	D	0.04	.	17.3632	0.87357	0.0:1.0:0.0:0.0	.	543;543	O60308-3;O60308	.;CE104_HUMAN	H	543	ENSP00000367476:R543H	ENSP00000367476:R543H	R	-	2	0	CEP104	3740317	1.000000	0.71417	0.326000	0.25389	0.466000	0.32739	6.734000	0.74801	2.329000	0.79093	0.467000	0.42956	CGC		CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009747.3	NM_014704	
LEPR	3953	hgsc.bcm.edu	37	1	66102556	66102556	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr1:66102556G>T	ENST00000349533.6	+	20	3541	c.3356G>T	c.(3355-3357)aGt>aTt	p.S1119I	LEPR_ENST00000406510.3_Missense_Mutation_p.S186I	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)	p.S1119I(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		CTCCAGGACAGTTGCTCACAC	0.418																																					p.S1119I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3356T	1						.						71.0	68.0	69.0					1																	66102556		2203	4300	6503	65875144	SO:0001583	missense	3953	exon20			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.3356G>T	1.37:g.66102556G>T	ENSP00000330393:p.Ser1119Ile	Somatic		Capture	SOLID	Phase_I	65875144	NM_002303	Q6FHL5	Missense_Mutation	SNP	ENST00000349533.6	37	CCDS631.1	.	.	.	.	.	.	.	.	.	.	G	6.194	0.403880	0.11754	.	.	ENSG00000116678	ENST00000349533;ENST00000406510	T	0.55413	0.52	5.37	0.96	0.19631	.	0.793988	0.12269	N	0.483994	T	0.28433	0.0703	M	0.65975	2.015	0.21499	N	0.999663	B	0.20671	0.047	B	0.12837	0.008	T	0.33471	-0.9867	10	0.38643	T	0.18	-5.7727	10.0644	0.42295	0.0817:0.5762:0.3421:0.0	.	1119	P48357	LEPR_HUMAN	I	1119;186	ENSP00000330393:S1119I	ENSP00000330393:S1119I	S	+	2	0	LEPR	65875144	0.743000	0.28239	0.921000	0.36526	0.014000	0.08584	1.689000	0.37700	0.205000	0.20568	0.585000	0.79938	AGT		LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303	
ZNF326	284695	hgsc.bcm.edu	37	1	90486384	90486384	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr1:90486384A>G	ENST00000340281.4	+	10	1351	c.1208A>G	c.(1207-1209)gAg>gGg	p.E403G	ZNF326_ENST00000455342.2_Missense_Mutation_p.E197G|ZNF326_ENST00000370447.3_Missense_Mutation_p.E314G	NM_182976.2	NP_892021.1	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326	403					mRNA processing (GO:0006397)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, elongation (GO:0032784)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	DBIRD complex (GO:0044609)|nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)|zinc ion binding (GO:0008270)	p.E403G(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(7)|ovary(1)	25		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		ATGAAGGTAGAGACAGTTCAT	0.353																																					p.E403G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1208G	1						.						154.0	153.0	153.0					1																	90486384		2203	4300	6503	90258972	SO:0001583	missense	284695	exon10			BC013102	CCDS727.1, CCDS728.1	1p22	2012-04-19			ENSG00000162664	ENSG00000162664		"""Zinc fingers, C2H2-type"""	14104	protein-coding gene	gene with protein product	"""ZNF-protein interacting with nuclear mRNPs and DBC1"""	614601				22446626	Standard	NM_182976		Approved	Zfp326, ZAN75, FLJ20403, ZIRD	uc001dnq.2	Q5BKZ1	OTTHUMG00000010675	ENST00000340281.4:c.1208A>G	1.37:g.90486384A>G	ENSP00000340796:p.Glu403Gly	Somatic		Capture	SOLID	Phase_I	90258972	NM_182976	A8MYX1|B4DLN0|B4E179|Q5VW93|Q5VW94|Q5VW96|Q5VW97|Q6NSA2|Q7Z638|Q7Z6C2	Missense_Mutation	SNP	ENST00000340281.4	37	CCDS727.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.839269	0.91117	.	.	ENSG00000162664	ENST00000394590;ENST00000340281;ENST00000370447;ENST00000455342	T;T;T	0.54479	0.57;0.57;0.57	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.66458	0.2791	M	0.72894	2.215	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.71540	-0.4562	10	0.87932	D	0	-11.8054	15.9813	0.80111	1.0:0.0:0.0:0.0	.	403;403	A8MYX1;Q5BKZ1	.;ZN326_HUMAN	G	403;403;314;197	ENSP00000340796:E403G;ENSP00000359476:E314G;ENSP00000403470:E197G	ENSP00000340796:E403G	E	+	2	0	ZNF326	90258972	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.387000	0.79785	2.185000	0.69588	0.460000	0.39030	GAG		ZNF326-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029428.2	NM_181781	
PTPN14	5784	hgsc.bcm.edu	37	1	214560253	214560253	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr1:214560253G>A	ENST00000366956.5	-	12	1194	c.1000C>T	c.(1000-1002)Ccg>Tcg	p.P334S	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	334					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		AGGATGTACGGCTGCTGCCTG	0.617																																					p.P334S	Colon(92;557 1424 24372 34121 40073)											.	.	0			c.C1000T	1						.						80.0	60.0	67.0					1																	214560253		2203	4300	6503	212626876	SO:0001583	missense	5784	exon12			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.1000C>T	1.37:g.214560253G>A	ENSP00000355923:p.Pro334Ser	None		Capture	SOLID	Phase_I	212626876	NM_005401	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	37	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	G	5.769	0.326341	0.10900	.	.	ENSG00000152104	ENST00000366956	D	0.81908	-1.55	5.85	5.85	0.93711	.	0.169844	0.53938	D	0.000050	T	0.78660	0.4318	L	0.49126	1.545	0.44352	D	0.997246	B	0.14438	0.01	B	0.13407	0.009	T	0.71556	-0.4557	10	0.22109	T	0.4	.	14.9374	0.70967	0.0:0.0:0.8571:0.1429	.	334	Q15678	PTN14_HUMAN	S	334	ENSP00000355923:P334S	ENSP00000355923:P334S	P	-	1	0	PTPN14	212626876	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.921000	0.63397	2.767000	0.95098	0.655000	0.94253	CCG		PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
CNGA4	1262	hgsc.bcm.edu	37	11	6261565	6261565	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr11:6261565C>A	ENST00000379936.2	+	4	656	c.541C>A	c.(541-543)Cat>Aat	p.H181N	CNGA4_ENST00000533426.1_Intron	NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	181					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.H181N(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGTCGTCATCCATTGGAACAG	0.592																																					p.H181N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C541A	11						.						67.0	66.0	66.0					11																	6261565		2201	4295	6496	6218141	SO:0001583	missense	1262	exon4			AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.541C>A	11.37:g.6261565C>A	ENSP00000369268:p.His181Asn	Somatic		Capture	SOLID	Phase_I	6218141	NM_001037329		Missense_Mutation	SNP	ENST00000379936.2	37	CCDS31408.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.732006	0.89390	.	.	ENSG00000132259	ENST00000379936	D	0.99545	-6.13	5.25	5.25	0.73442	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99789	0.9911	H	0.96833	3.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.97027	0.9747	10	0.87932	D	0	.	17.7596	0.88461	0.0:1.0:0.0:0.0	.	181;141	Q8IV77;Q8IV77-2	CNGA4_HUMAN;.	N	181	ENSP00000369268:H181N	ENSP00000369268:H181N	H	+	1	0	CNGA4	6218141	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.445000	0.80570	2.602000	0.87976	0.650000	0.86243	CAT		CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383765.2	NM_001037329	
KCNJ5	3762	hgsc.bcm.edu	37	11	128781290	128781290	+	Missense_Mutation	SNP	G	G	A	rs139073333	byFrequency	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr11:128781290G>A	ENST00000338350.4	+	3	474	c.122G>A	c.(121-123)cGc>cAc	p.R41H	KCNJ5_ENST00000533599.1_Missense_Mutation_p.R41H|KCNJ5_ENST00000529694.1_Missense_Mutation_p.R41H			P48544	KCNJ5_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 5	41					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)	p.R41H(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(4)|liver(2)|lung(9)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glyburide(DB01016)	GACCGTACGCGCCTGCTGGCC	0.597													G|||	2	0.000399361	0.0015	0.0	5008	,	,		19335	0.0		0.0	False		,,,				2504	0.0				p.R41H	Pancreas(108;2548 5082)|Esophageal Squamous(165;4544 6231)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G122A	11						.	G	HIS/ARG	2,4400	4.2+/-10.8	0,2,2199	84.0	78.0	80.0		122	5.8	1.0	11	dbSNP_134	80	0,8594		0,0,4297	yes	missense	KCNJ5	NM_000890.3	29	0,2,6496	AA,AG,GG		0.0,0.0454,0.0154	benign	41/420	128781290	2,12994	2201	4297	6498	128286500	SO:0001583	missense	3762	exon2			D50134	CCDS8479.1	11q24	2014-09-17				ENSG00000120457		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6266	protein-coding gene	gene with protein product		600734				16382105	Standard	NM_000890		Approved	Kir3.4, CIR, KATP1, GIRK4, LQT13	uc001qet.3	P48544		ENST00000338350.4:c.122G>A	11.37:g.128781290G>A	ENSP00000339960:p.Arg41His	Somatic		Capture	SOLID	Phase_I	128286500	NM_000890	B2R744|Q6DK13|Q6DK14|Q92807	Missense_Mutation	SNP	ENST00000338350.4	37	CCDS8479.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	15.58	2.875522	0.51695	4.54E-4	0.0	ENSG00000120457	ENST00000533356;ENST00000529694;ENST00000338350;ENST00000533599	D;D;D	0.89270	-2.49;-2.49;-2.49	5.79	5.79	0.91817	.	1.137250	0.06446	N	0.726958	T	0.81197	0.4772	N	0.05510	-0.035	0.45464	D	0.998439	B	0.12013	0.005	B	0.04013	0.001	T	0.60510	-0.7249	10	0.39692	T	0.17	.	13.2623	0.60113	0.072:0.0:0.9279:0.0	.	41	P48544	IRK5_HUMAN	H	41	ENSP00000433295:R41H;ENSP00000339960:R41H;ENSP00000434266:R41H	ENSP00000339960:R41H	R	+	2	0	KCNJ5	128286500	1.000000	0.71417	0.965000	0.40720	0.939000	0.58152	6.270000	0.72563	2.731000	0.93534	0.650000	0.86243	CGC		KCNJ5-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386239.1	NM_000890	
ENPP3	5169	hgsc.bcm.edu	37	6	132006580	132006580	+	Silent	SNP	C	C	T	rs148138275		TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr6:132006580C>T	ENST00000414305.1	+	14	1525	c.1197C>T	c.(1195-1197)taC>taT	p.Y399Y	ENPP3_ENST00000358229.5_Silent_p.Y399Y|ENPP3_ENST00000357639.3_Silent_p.Y399Y			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	399	Phosphodiesterase.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.Y399Y(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		TCTACATGTACGAAGGGCCTG	0.353																																					p.Y399Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1197T	6						.	C		1,4405	2.1+/-5.4	0,1,2202	135.0	152.0	146.0		1197	0.6	0.9	6	dbSNP_134	146	0,8600		0,0,4300	no	coding-synonymous	ENPP3	NM_005021.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		399/876	132006580	1,13005	2203	4300	6503	132048273	SO:0001819	synonymous_variant	5169	exon13			AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.1197C>T	6.37:g.132006580C>T		Somatic		Capture	SOLID	Phase_I	132048273	NM_005021	Q5JTL3	Silent	SNP	ENST00000414305.1	37	CCDS5148.1																																																																																				ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2		
CXXC1	30827	hgsc.bcm.edu	37	18	47810355	47810355	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr18:47810355C>T	ENST00000285106.6	-	10	2036	c.1322G>A	c.(1321-1323)cGc>cAc	p.R441H	MBD1_ENST00000269471.5_5'Flank|MBD1_ENST00000590208.1_5'Flank|CXXC1_ENST00000589940.1_Missense_Mutation_p.R441H|MBD1_ENST00000347968.3_5'Flank|MBD1_ENST00000585672.1_5'Flank|MBD1_ENST00000353909.3_5'Flank|MBD1_ENST00000424334.2_5'Flank|CXXC1_ENST00000412036.2_Missense_Mutation_p.R445H|MBD1_ENST00000591416.1_5'Flank|MBD1_ENST00000436910.1_5'Flank|CXXC1_ENST00000587396.1_5'Flank|MBD1_ENST00000457839.2_5'Flank|MBD1_ENST00000349085.2_5'Flank|MBD1_ENST00000585595.1_5'Flank|MBD1_ENST00000398493.1_5'Flank|MBD1_ENST00000269468.5_5'Flank|MBD1_ENST00000587605.1_5'Flank|MBD1_ENST00000382948.5_5'Flank|MBD1_ENST00000339998.6_5'Flank	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	441					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.R441H(1)		autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						AAGGCGAGTGCGGGCACTCTG	0.602																																					p.R445H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1334A	18						.						102.0	92.0	96.0					18																	47810355		2203	4300	6503	46064353	SO:0001583	missense	30827	exon10			BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.1322G>A	18.37:g.47810355C>T	ENSP00000285106:p.Arg441His	Somatic		Capture	SOLID	Phase_I	46064353	NM_001101654	B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Missense_Mutation	SNP	ENST00000285106.6	37	CCDS11945.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.967806	0.92855	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	T;T	0.25749	1.78;1.78	4.63	4.63	0.57726	CpG binding protein, C-terminal (1);	0.132049	0.50627	D	0.000106	T	0.22781	0.0550	L	0.45137	1.4	0.80722	D	1	P;P;P;B	0.36599	0.499;0.504;0.56;0.279	B;B;B;B	0.32928	0.155;0.057;0.053;0.037	T	0.04855	-1.0922	10	0.45353	T	0.12	-14.6537	15.3385	0.74277	0.0:1.0:0.0:0.0	.	441;445;441;308	B2RC03;Q9P0U4-2;Q9P0U4;Q59EC8	.;.;CXXC1_HUMAN;.	H	441;445	ENSP00000285106:R441H;ENSP00000390475:R445H	ENSP00000285106:R441H	R	-	2	0	CXXC1	46064353	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.389000	0.66255	2.281000	0.76405	0.453000	0.30009	CGC		CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255927.2	NM_014593	
MUC13	56667	hgsc.bcm.edu	37	3	124632412	124632412	+	Missense_Mutation	SNP	C	C	T	rs144481864	byFrequency	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr3:124632412C>T	ENST00000311075.3	-	7	1116	c.1078G>A	c.(1078-1080)Gtt>Att	p.V360I		NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	361	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)	p.V360I(1)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						CACTTACCAACGCAGAAAGGG	0.413													C|||	13	0.00259585	0.0	0.0	5008	,	,		20922	0.0119		0.0	False		,,,				2504	0.001				p.V360I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1078A	3						.	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	115.0	105.0	108.0		1078	-8.4	0.0	3	dbSNP_134	108	2,8598	2.2+/-6.3	0,2,4298	yes	missense	MUC13	NM_033049.3	29	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	possibly-damaging	360/512	124632412	3,13003	2203	4300	6503	126115102	SO:0001583	missense	56667	exon7			AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.1078G>A	3.37:g.124632412C>T	ENSP00000312235:p.Val360Ile	Somatic		Capture	SOLID	Phase_I	126115102	NM_033049	Q6UWD9|Q9NXT5	Missense_Mutation	SNP	ENST00000311075.3	37		4	0.0018315018315018315	0	0.0	0	0.0	4	0.006993006993006993	0	0.0	C	7.416	0.635720	0.14322	2.27E-4	2.33E-4	ENSG00000173702	ENST00000311075	D	0.87179	-2.22	4.18	-8.36	0.00980	.	1.582650	0.03540	N	0.223719	T	0.72045	0.3412	L	0.59436	1.845	0.09310	N	1	P	0.48230	0.907	B	0.36608	0.229	T	0.72350	-0.4320	10	0.23891	T	0.37	.	4.1485	0.10227	0.3342:0.4222:0.0953:0.1483	.	360	Q9H3R2	MUC13_HUMAN	I	360	ENSP00000312235:V360I	ENSP00000312235:V360I	V	-	1	0	MUC13	126115102	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-4.142000	0.00286	-3.858000	0.00098	-0.538000	0.04264	GTT		MUC13-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000355714.1	NM_033049	
LPP	4026	hgsc.bcm.edu	37	3	188327306	188327306	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr3:188327306C>T	ENST00000312675.4	+	6	1033	c.787C>T	c.(787-789)Cca>Tca	p.P263S	LPP_ENST00000543006.1_Missense_Mutation_p.P263S|LPP_ENST00000448637.1_Missense_Mutation_p.P263S|LPP_ENST00000471917.1_3'UTR	NM_001167672.1|NM_005578.3	NP_001161144.1|NP_005569.1	Q93052	LPP_HUMAN	LIM domain containing preferred translocation partner in lipoma	263	Pro-rich.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.P263S(1)	HMGA2/LPP(161)	NS(1)|breast(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		TGGGCAGTGTCCACCTCCTTC	0.572			T	"""HMGA2, MLL, C12orf9"""	"""lipoma, leukemia"""																																p.P263S			Dom	yes		3	3q28	4026	LIM domain containing preferred translocation partner in lipoma		"""L, M"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C787T	3						.						74.0	66.0	68.0					3																	188327306		2203	4300	6503	189810000	SO:0001583	missense	4026	exon6			AL833171	CCDS3291.1	3q27-q28	2004-03-02	2002-01-14		ENSG00000145012	ENSG00000145012			6679	protein-coding gene	gene with protein product		600700	"""LIM domain-containing preferred translocation partner in lipoma"""			8812423	Standard	XM_005247453		Approved		uc003frs.2	Q93052	OTTHUMG00000156387	ENST00000312675.4:c.787C>T	3.37:g.188327306C>T	ENSP00000318089:p.Pro263Ser	Somatic		Capture	SOLID	Phase_I	189810000	NM_001167671	A1L4L6|D3DNV6|Q8NFX5	Missense_Mutation	SNP	ENST00000312675.4	37	CCDS3291.1	.	.	.	.	.	.	.	.	.	.	C	11.90	1.775629	0.31411	.	.	ENSG00000145012	ENST00000448637;ENST00000312675;ENST00000543006;ENST00000415906	T;T;T;T	0.56275	1.94;0.47;0.47;1.53	5.54	3.58	0.41010	.	1.331800	0.04465	N	0.375095	T	0.47488	0.1448	L	0.54323	1.7	0.24338	N	0.994971	B;B	0.30236	0.274;0.204	B;B	0.30943	0.122;0.035	T	0.37753	-0.9692	10	0.07175	T	0.84	.	9.2715	0.37675	0.1278:0.5661:0.3061:0.0	.	263;263	C9JUT4;Q93052	.;LPP_HUMAN	S	263;263;263;100	ENSP00000393602:P263S;ENSP00000318089:P263S;ENSP00000438891:P263S;ENSP00000393008:P100S	ENSP00000318089:P263S	P	+	1	0	LPP	189810000	1.000000	0.71417	0.611000	0.29010	0.770000	0.43624	3.651000	0.54431	1.436000	0.47453	0.655000	0.94253	CCA		LPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344030.1	NM_005578	
CLDN16	10686	hgsc.bcm.edu	37	3	190106053	190106053	+	Missense_Mutation	SNP	C	C	T	rs200400125		TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr3:190106053C>T	ENST00000264734.2	+	1	393	c.145C>T	c.(145-147)Cgc>Tgc	p.R49C	CLDN16_ENST00000468220.1_Intron|CLDN16_ENST00000456423.1_Missense_Mutation_p.R49C	NM_006580.3	NP_006571.1	Q9Y5I7	CLD16_HUMAN	claudin 16	49					calcium-independent cell-cell adhesion (GO:0016338)|cellular metal ion homeostasis (GO:0006875)|excretion (GO:0007588)|magnesium ion transport (GO:0015693)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|structural molecule activity (GO:0005198)	p.R49C(1)		breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|skin(1)	19	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		GACTGACACCCGCCACTTAAG	0.498																																					p.R49C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C145T	3						.						129.0	114.0	119.0					3																	190106053		2203	4300	6503	191588747	SO:0001583	missense	10686	exon1			AF152101	CCDS3296.1	3q28	2008-12-10			ENSG00000113946	ENSG00000113946		"""Claudins"""	2037	protein-coding gene	gene with protein product	"""paracellin-1"", ""hypomagnesemia 3, with hypercalciuria and nephrocalcinosis"""	603959				10390358	Standard	NM_006580		Approved	PCLN1, HOMG3	uc003fsi.3	Q9Y5I7	OTTHUMG00000156215	ENST00000264734.2:c.145C>T	3.37:g.190106053C>T	ENSP00000264734:p.Arg49Cys	Somatic		Capture	SOLID	Phase_I	191588747	NM_006580		Missense_Mutation	SNP	ENST00000264734.2	37	CCDS3296.1	.	.	.	.	.	.	.	.	.	.	C	2.577	-0.298336	0.05532	.	.	ENSG00000113946	ENST00000264734;ENST00000456423	D;D	0.93811	-2.93;-3.29	5.21	-3.34	0.04943	.	1.406730	0.04561	N	0.391642	T	0.80491	0.4633	N	0.03608	-0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.68409	-0.5416	10	0.46703	T	0.11	-14.2408	1.1877	0.01859	0.3037:0.2917:0.2675:0.1371	.	49;49	A0SDD8;Q9Y5I7	.;CLD16_HUMAN	C	49	ENSP00000264734:R49C;ENSP00000414136:R49C	ENSP00000264734:R49C	R	+	1	0	CLDN16	191588747	0.004000	0.15560	0.000000	0.03702	0.003000	0.03518	0.437000	0.21543	-0.492000	0.06687	-1.546000	0.00904	CGC		CLDN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343519.1	NM_006580	
LRCH3	84859	hgsc.bcm.edu	37	3	197556461	197556461	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr3:197556461A>G	ENST00000425562.2	+	6	804	c.804A>G	c.(802-804)atA>atG	p.I268M	LRCH3_ENST00000334859.4_Missense_Mutation_p.I268M|LRCH3_ENST00000441090.2_Missense_Mutation_p.I142M|LRCH3_ENST00000438796.2_Missense_Mutation_p.I268M|LRCH3_ENST00000414675.2_Missense_Mutation_p.I268M|LRCH3_ENST00000536618.1_5'Flank|AC055764.1_ENST00000454526.1_RNA			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	268						cytoplasm (GO:0005737)|extracellular region (GO:0005576)		p.F269fs*7(1)|p.I268M(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		AAGTCCACATATTTAAATACC	0.358																																					p.I268M												.	.	2	Substitution - Missense(1)|Deletion - Frameshift(1)	large_intestine(1)|breast(1)	c.A804G	3						.						136.0	139.0	138.0					3																	197556461		2203	4300	6503	199040858	SO:0001583	missense	84859	exon6			AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.804A>G	3.37:g.197556461A>G	ENSP00000393579:p.Ile268Met	Somatic		Capture	SOLID	Phase_I	199040858	NM_032773	B4E0T7|Q96FP9|Q9NT52	Missense_Mutation	SNP	ENST00000425562.2	37		.	.	.	.	.	.	.	.	.	.	A	18.54	3.645911	0.67358	.	.	ENSG00000186001	ENST00000438796;ENST00000441090;ENST00000414675;ENST00000334859;ENST00000425562	T;T;T;T;T	0.51817	2.23;0.69;2.23;2.23;2.23	5.44	1.59	0.23543	.	0.000000	0.85682	D	0.000000	T	0.63663	0.2530	M	0.79011	2.435	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.998;0.99;1.0;0.997	T	0.61197	-0.7111	10	0.87932	D	0	-18.4273	7.2713	0.26258	0.6165:0.1429:0.0:0.2406	.	142;268;268;268	E9PD99;B4E0T7;Q96II8-2;Q96II8-3	.;.;.;.	M	268;142;268;268;268	ENSP00000399751:I268M;ENSP00000394609:I142M;ENSP00000394965:I268M;ENSP00000334375:I268M;ENSP00000393579:I268M	ENSP00000334375:I268M	I	+	3	3	LRCH3	199040858	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	2.506000	0.45433	0.027000	0.15297	0.529000	0.55759	ATA		LRCH3-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000339965.1	NM_032773	
KCNA1	3736	hgsc.bcm.edu	37	12	5021872	5021872	+	Missense_Mutation	SNP	G	G	A	rs139383685		TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr12:5021872G>A	ENST00000382545.3	+	2	2435	c.1328G>A	c.(1327-1329)cGc>cAc	p.R443H	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	443					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.R443H(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	GACCTCAGTCGCCGCAGTTCC	0.468													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19396	0.0		0.0	False		,,,				2504	0.0				p.R443H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1328A	12						.						199.0	197.0	198.0					12																	5021872		2203	4300	6503	4892133	SO:0001583	missense	3736	exon2			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.1328G>A	12.37:g.5021872G>A	ENSP00000371985:p.Arg443His	Somatic		Capture	SOLID	Phase_I	4892133	NM_000217	A6NM83|Q3MIQ9	Missense_Mutation	SNP	ENST00000382545.3	37	CCDS8535.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	15.85	2.953515	0.53293	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.96396	-4.0	5.35	4.45	0.53987	.	0.000000	0.64402	D	0.000001	D	0.94699	0.8290	M	0.63843	1.955	0.80722	D	1	P	0.50943	0.94	B	0.41202	0.35	D	0.94002	0.7276	10	0.40728	T	0.16	.	15.5422	0.76062	0.0:0.1384:0.8616:0.0	.	443	Q09470	KCNA1_HUMAN	H	443	ENSP00000371985:R443H	ENSP00000228858:R443H	R	+	2	0	KCNA1	4892133	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.620000	0.74224	1.603000	0.50134	0.655000	0.94253	CGC		KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217	
DUSP16	80824	hgsc.bcm.edu	37	12	12630318	12630318	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr12:12630318G>A	ENST00000228862.2	-	7	2078	c.1447C>T	c.(1447-1449)Cga>Tga	p.R483*	DUSP16_ENST00000545864.1_5'Flank|DUSP16_ENST00000298573.4_3'UTR	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	483					dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R483*(2)		endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		GAATGCAATCGCTTGCTCTGG	0.572																																					p.R483X	Ovarian(158;443 1896 15437 36069 46477)											.	.	2	Substitution - Nonsense(2)	large_intestine(1)|endometrium(1)	c.C1447T	12						.						105.0	102.0	103.0					12																	12630318		2203	4300	6503	12521585	SO:0001587	stop_gained	80824	exon7			AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.1447C>T	12.37:g.12630318G>A	ENSP00000228862:p.Arg483*	Somatic		Capture	SOLID	Phase_I	12521585	NM_030640	Q547C7|Q96QS2|Q9C0G3	Nonsense_Mutation	SNP	ENST00000228862.2	37	CCDS8650.1	.	.	.	.	.	.	.	.	.	.	G	38	6.899472	0.97920	.	.	ENSG00000111266	ENST00000228862	.	.	.	5.27	2.23	0.28157	.	0.314503	0.22770	N	0.055846	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.796	0.29148	0.1387:0.0:0.6144:0.2469	.	.	.	.	X	483	.	ENSP00000228862:R483X	R	-	1	2	DUSP16	12521585	0.540000	0.26410	0.012000	0.15200	0.306000	0.27790	1.234000	0.32660	0.792000	0.33850	0.655000	0.94253	CGA		DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400311.1	NM_030640	
DDIT3	1649	hgsc.bcm.edu	37	12	57910760	57910760	+	Silent	SNP	C	C	T			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr12:57910760C>T	ENST00000346473.3	-	4	521	c.342G>A	c.(340-342)cgG>cgA	p.R114R	RN7SL312P_ENST00000582079.1_RNA|DDIT3_ENST00000547303.1_Silent_p.R114R|MIR616_ENST00000385293.1_RNA|DDIT3_ENST00000551116.1_Silent_p.R137R|DDIT3_ENST00000552740.1_Silent_p.R137R	NM_001195057.1|NM_004083.5	NP_001181986.1|NP_004074.2	P35638	DDIT3_HUMAN	DNA-damage-inducible transcript 3	114	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|blood vessel maturation (GO:0001955)|cell cycle arrest (GO:0007050)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of determination of dorsal identity (GO:2000016)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|regulation of transcription, DNA-templated (GO:0006355)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to starvation (GO:0042594)|response to unfolded protein (GO:0006986)|Wnt signaling pathway (GO:0016055)	late endosome (GO:0005770)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.R114R(1)	EWSR1/DDIT3(45)|FUS/DDIT3(631)	central_nervous_system(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(1)	16						GCTTTCCAGCCCGGGCTGGGG	0.542			T	FUS	liposarcoma																																p.R137R	GBM(112;1383 1547 7626 23045 28770)		Dom	yes		12	12q13.1-q13.2	1649	DNA-damage-inducible transcript 3		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G411A	12						.						138.0	147.0	144.0					12																	57910760		2203	4300	6503	56197027	SO:0001819	synonymous_variant	1649	exon4			BC003637	CCDS8943.1, CCDS55838.1	12q13.1-q13.2	2008-02-05				ENSG00000175197			2726	protein-coding gene	gene with protein product	"""C/EBP zeta"""	126337				1990262	Standard	NM_001195053		Approved	CHOP10, GADD153, CHOP	uc021qzk.1	P35638		ENST00000346473.3:c.342G>A	12.37:g.57910760C>T		Somatic		Capture	SOLID	Phase_I	56197027	NM_001195055	F8VS99	Silent	SNP	ENST00000346473.3	37	CCDS8943.1																																																																																				DDIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407137.1	NM_004083	
ANO4	121601	hgsc.bcm.edu	37	12	101493387	101493387	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr12:101493387G>C	ENST00000392977.3	+	22	2248	c.2038G>C	c.(2038-2040)Gta>Cta	p.V680L	ANO4_ENST00000392979.3_Missense_Mutation_p.V645L|ANO4_ENST00000299222.9_Missense_Mutation_p.V200L|ANO4_ENST00000550015.1_Missense_Mutation_p.V200L			Q32M45	ANO4_HUMAN	anoctamin 4	680					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.V645L(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						TAGAAGAAAAGTACGACAAGA	0.358										HNSCC(74;0.22)																											p.V645L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1933C	12						.						111.0	112.0	112.0					12																	101493387		2203	4300	6503	100017518	SO:0001583	missense	121601	exon21			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.2038G>C	12.37:g.101493387G>C	ENSP00000376703:p.Val680Leu	Somatic		Capture	SOLID	Phase_I	100017518	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	37		.	.	.	.	.	.	.	.	.	.	G	6.553	0.470348	0.12461	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	5.73	2.67	0.31697	.	0.184715	0.34725	N	0.003737	T	0.29716	0.0742	N	0.02765	-0.5	0.39377	D	0.966186	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.002	T	0.15009	-1.0452	10	0.06891	T	0.86	.	8.6216	0.33864	0.0:0.2481:0.3197:0.4322	.	200;680;645	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	L	645;200;680;200	ENSP00000376705:V645L;ENSP00000299222:V200L;ENSP00000376703:V680L;ENSP00000450192:V200L	ENSP00000299222:V200L	V	+	1	0	ANO4	100017518	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.116000	0.31221	0.729000	0.32403	0.650000	0.86243	GTA		ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
MAPK10	5602	hgsc.bcm.edu	37	4	87028454	87028454	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr4:87028454G>T	ENST00000359221.3	-	5	814	c.288C>A	c.(286-288)agC>agA	p.S96R	MAPK10_ENST00000395160.3_5'UTR|MAPK10_ENST00000513839.1_5'UTR|MAPK10_ENST00000395169.3_Missense_Mutation_p.S58R|MAPK10_ENST00000395166.1_Missense_Mutation_p.S58R|MAPK10_ENST00000449047.2_5'UTR|MAPK10_ENST00000361569.2_Missense_Mutation_p.S96R|MAPK10_ENST00000395157.3_5'UTR|MAPK10_ENST00000395161.2_Missense_Mutation_p.S96R			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	96	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)	p.S96R(1)		breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		GAAAGGGTCTGCTGAGCTTCT	0.433																																					p.S96R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C288A	4						.						135.0	125.0	129.0					4																	87028454		2203	4300	6503	87247478	SO:0001583	missense	5602	exon5			U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.288C>A	4.37:g.87028454G>T	ENSP00000352157:p.Ser96Arg	Somatic		Capture	SOLID	Phase_I	87247478	NM_138982	A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	ENST00000359221.3	37	CCDS34026.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.3|27.3	4.822838|4.822838	0.90873|0.90873	.|.	.|.	ENSG00000109339|ENSG00000109339	ENST00000515400|ENST00000395169;ENST00000359221;ENST00000361569;ENST00000395166;ENST00000395161;ENST00000512017;ENST00000512564;ENST00000511167;ENST00000511328;ENST00000509464	.|T;T;T;T;T;T;T;T;T;T	.|0.65364	.|-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15	5.9|5.9	5.9|5.9	0.94986|0.94986	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.62060|0.62060	0.2397|0.2397	N|N	0.10809|0.10809	0.05|0.05	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.71674	.|0.998;0.998;0.996	.|D;D;D	.|0.69307	.|0.938;0.961;0.963	T|T	0.68250|0.68250	-0.5458|-0.5458	5|10	.|0.87932	.|D	.|0	-16.9761|-16.9761	13.4734|13.4734	0.61295|0.61295	0.0712:0.0:0.9288:0.0|0.0712:0.0:0.9288:0.0	.|.	.|58;96;96	.|P53779-3;P53779-2;P53779	.|.;.;MK10_HUMAN	K|R	9|58;96;96;58;96;96;58;96;96;58	.|ENSP00000378598:S58R;ENSP00000352157:S96R;ENSP00000355297:S96R;ENSP00000378595:S58R;ENSP00000378590:S96R;ENSP00000424755:S96R;ENSP00000422985:S58R;ENSP00000422277:S96R;ENSP00000421762:S96R;ENSP00000424128:S58R	.|ENSP00000309857:S96R	Q|S	-|-	1|3	0|2	MAPK10|MAPK10	87247478|87247478	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.838000|6.838000	0.75359|0.75359	2.798000|2.798000	0.96311|0.96311	0.650000|0.650000	0.86243|0.86243	CAG|AGC		MAPK10-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000361363.2		
TBL1X	6907	hgsc.bcm.edu	37	X	9661421	9661421	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chrX:9661421C>T	ENST00000217964.7	+	11	1655	c.1015C>T	c.(1015-1017)Cga>Tga	p.R339*	TBL1X_ENST00000536365.1_Nonsense_Mutation_p.R288*|TBL1X_ENST00000407597.2_Nonsense_Mutation_p.R339*|TBL1X_ENST00000380961.1_Nonsense_Mutation_p.R288*|TBL1X_ENST00000424279.1_Nonsense_Mutation_p.R288*	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	339					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.R339*(1)		breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				GAAATGGAACCGAAAGGGGAA	0.393																																					p.R288X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C862T	X						.						103.0	79.0	87.0					X																	9661421		2203	4300	6503	9621421	SO:0001587	stop_gained	6907	exon11			Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.1015C>T	X.37:g.9661421C>T	ENSP00000217964:p.Arg339*	Somatic		Capture	SOLID	Phase_I	9621421	NM_001139468	A8K044|A8K4J7|Q86UY2	Nonsense_Mutation	SNP	ENST00000217964.7	37	CCDS14133.1	.	.	.	.	.	.	.	.	.	.	C	40	8.056139	0.98632	.	.	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000217964	.	.	.	4.56	3.38	0.38709	.	0.057091	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	10.8589	0.46815	0.8422:0.1578:0.0:0.0	.	.	.	.	X	339;288;288;288;339	.	ENSP00000217964:R339X	R	+	1	2	TBL1X	9621421	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	6.904000	0.75708	0.552000	0.29026	-0.316000	0.08728	CGA		TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647	
AMER1	139285	hgsc.bcm.edu	37	X	63411246	63411246	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chrX:63411246G>A	ENST00000330258.3	-	2	2193	c.1921C>T	c.(1921-1923)Cga>Tga	p.R641*	AMER1_ENST00000403336.1_Nonsense_Mutation_p.R641*|AMER1_ENST00000374869.3_Nonsense_Mutation_p.R641*	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	641					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.R641*(2)									TGGGTCTCTCGGACTTGAGTC	0.617																																					p.R641X												.	.	69	Whole gene deletion(67)|Substitution - Nonsense(2)	kidney(65)|large_intestine(3)|ovary(1)	c.C1921T	X						.						26.0	25.0	25.0					X																	63411246		2203	4299	6502	63327971	SO:0001587	stop_gained	139285	exon2			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1921C>T	X.37:g.63411246G>A	ENSP00000329117:p.Arg641*	Somatic		Capture	SOLID	Phase_I	63327971	NM_152424	A2IB86|Q8N885	Nonsense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	G	31	5.075055	0.94000	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	.	.	.	5.21	4.34	0.51931	.	1.243660	0.05695	N	0.592862	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	0.5658	11.2447	0.48990	0.0:0.0:0.6691:0.3309	.	.	.	.	X	641	.	ENSP00000329117:R641X	R	-	1	2	FAM123B	63327971	0.870000	0.30015	0.001000	0.08648	0.015000	0.08874	4.385000	0.59613	1.297000	0.44761	0.600000	0.82982	CGA		AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
ZEB2	9839	hgsc.bcm.edu	37	2	145157772	145157772	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr2:145157772G>A	ENST00000558170.2	-	8	2166	c.982C>T	c.(982-984)Cac>Tac	p.H328Y	ZEB2_ENST00000303660.4_Missense_Mutation_p.H328Y|ZEB2_ENST00000539609.3_Missense_Mutation_p.H304Y|ZEB2_ENST00000409487.3_Missense_Mutation_p.H328Y	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	328					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.H328Y(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CTGCTGATGTGCGAACTGTAG	0.388																																					p.H304Y	Melanoma(33;1235 1264 5755 16332)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C910T	2						.						48.0	51.0	50.0					2																	145157772		2202	4300	6502	144874242	SO:0001583	missense	9839	exon7			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.982C>T	2.37:g.145157772G>A	ENSP00000454157:p.His328Tyr	Somatic		Capture	SOLID	Phase_I	144874242	NM_001171653	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	.	.	.	.	.	.	.	.	.	.	G	18.64	3.667655	0.67814	.	.	ENSG00000169554	ENST00000392860;ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902;ENST00000392861	D;D;D;D;D	0.96168	-3.93;-3.93;-3.93;-3.93;-3.93	5.64	5.64	0.86602	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.97374	0.9141	M	0.62209	1.925	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;0.981;0.981	D;D;D;D	0.91635	0.999;0.978;0.954;0.954	D	0.97793	1.0239	10	0.87932	D	0	-11.5597	19.7156	0.96119	0.0:0.0:1.0:0.0	.	304;193;327;328	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	Y	323;304;328;328;328;328	ENSP00000443792:H304Y;ENSP00000302501:H328Y;ENSP00000386854:H328Y;ENSP00000395496:H328Y;ENSP00000376601:H328Y	ENSP00000302501:H328Y	H	-	1	0	ZEB2	144874242	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.658000	0.90341	0.655000	0.94253	CAC		ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795	
PRKAG3	53632	hgsc.bcm.edu	37	2	219695534	219695534	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr2:219695534G>T	ENST00000529249.1	-	3	479	c.164C>A	c.(163-165)gCc>gAc	p.A55D	PRKAG3_ENST00000392098.3_Missense_Mutation_p.A55D|PRKAG3_ENST00000545803.1_5'UTR|PRKAG3_ENST00000439262.2_Missense_Mutation_p.A30D			Q9UGI9	AAKG3_HUMAN	protein kinase, AMP-activated, gamma 3 non-catalytic subunit	55					cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)	AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|protein kinase binding (GO:0019901)	p.A55D(1)		large_intestine(7)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Acetylsalicylic acid(DB00945)	CAAGGCTTTGGCCCTCCGTTT	0.592																																					p.A55D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C164A	2						.						180.0	148.0	159.0					2																	219695534		2203	4300	6503	219403778	SO:0001583	missense	53632	exon3			AF214519	CCDS2424.1	2q35	2012-09-20			ENSG00000115592	ENSG00000115592			9387	protein-coding gene	gene with protein product		604976				10818001	Standard	NM_017431		Approved		uc002vjb.1	Q9UGI9	OTTHUMG00000133078	ENST00000529249.1:c.164C>A	2.37:g.219695534G>T	ENSP00000436068:p.Ala55Asp	Somatic		Capture	SOLID	Phase_I	219403778	NM_017431	Q4QQG8|Q4V779|Q9NRL1	Missense_Mutation	SNP	ENST00000529249.1	37	CCDS2424.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.065659	0.36470	.	.	ENSG00000115592	ENST00000439262;ENST00000529249;ENST00000392098;ENST00000430489	D;D;T;T	0.82433	-1.6;-1.61;0.24;0.91	4.78	-0.797	0.10909	.	1.075700	0.07193	N	0.856176	T	0.64316	0.2587	N	0.24115	0.695	0.09310	N	1	P;B;B	0.47910	0.902;0.178;0.112	B;B;B	0.40741	0.339;0.054;0.024	T	0.56372	-0.7990	10	0.10902	T	0.67	-1.0118	0.6674	0.00853	0.1974:0.1588:0.3194:0.3243	.	55;30;55	B4DUK8;Q9UGI9-2;Q9UGI9	.;.;AAKG3_HUMAN	D	30;55;55;55	ENSP00000397133:A30D;ENSP00000436068:A55D;ENSP00000375947:A55D;ENSP00000416100:A55D	ENSP00000233944:A55D	A	-	2	0	PRKAG3	219403778	0.440000	0.25618	0.002000	0.10522	0.406000	0.30931	0.506000	0.22658	-0.159000	0.11021	0.655000	0.94253	GCC		PRKAG3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385992.1		
SFXN2	118980	hgsc.bcm.edu	37	10	104486809	104486809	+	Missense_Mutation	SNP	C	C	T	rs200250986		TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr10:104486809C>T	ENST00000369893.5	+	3	394	c.227C>T	c.(226-228)tCg>tTg	p.S76L	SFXN2_ENST00000602785.1_3'UTR	NM_178858.4	NP_849189.1	Q96NB2	SFXN2_HUMAN	sideroflexin 2	76					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)	p.S76L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|prostate(1)	13		Colorectal(252;0.207)		Epithelial(162;4.53e-09)|all cancers(201;1.2e-07)|BRCA - Breast invasive adenocarcinoma(275;0.218)		CTGTATGACTCGGCCTTCCAC	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		18461	0.0		0.001	False		,,,				2504	0.0				p.S76L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C227T	10						.						81.0	71.0	74.0					10																	104486809		2203	4300	6503	104476799	SO:0001583	missense	118980	exon3			AF462052	CCDS7539.1	10q24.32	2006-03-13			ENSG00000156398	ENSG00000156398		"""Sideroflexins"""	16086	protein-coding gene	gene with protein product		615570					Standard	NM_178858		Approved		uc001kwb.2	Q96NB2	OTTHUMG00000018967	ENST00000369893.5:c.227C>T	10.37:g.104486809C>T	ENSP00000358909:p.Ser76Leu	Somatic		Capture	SOLID	Phase_I	104476799	NM_178858	Q5JSM6	Missense_Mutation	SNP	ENST00000369893.5	37	CCDS7539.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	36	5.600879	0.96614	.	.	ENSG00000156398	ENST00000369893	T	0.54071	0.59	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.81470	0.4829	H	0.94582	3.555	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86285	0.1670	10	0.72032	D	0.01	-41.2812	19.4753	0.94985	0.0:1.0:0.0:0.0	.	76	Q96NB2	SFXN2_HUMAN	L	76	ENSP00000358909:S76L	ENSP00000358909:S76L	S	+	2	0	SFXN2	104476799	1.000000	0.71417	0.959000	0.39883	0.980000	0.70556	7.818000	0.86416	2.607000	0.88179	0.561000	0.74099	TCG		SFXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050096.2	XM_058359	
APC	324	hgsc.bcm.edu	37	5	112175639	112175639	+	Nonsense_Mutation	SNP	C	C	T	rs121913332		TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr5:112175639C>T	ENST00000457016.1	+	16	4728	c.4348C>T	c.(4348-4350)Cga>Tga	p.R1450*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.R1450*|APC_ENST00000257430.4_Nonsense_Mutation_p.R1450*			P25054	APC_HUMAN	adenomatous polyposis coli	1450	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1450*(153)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.R1450fs*22(1)|p.S1436fs*22(1)|p.R1450fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAAACCAAGCGAGAAGTACC	0.478	R1450*(LS123_LARGE_INTESTINE)|R1450*(MKN74_STOMACH)|R1450*(SW1417_LARGE_INTESTINE)|R1450*(SW837_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1432X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,rectum,Substitution - Nonsense,0	.	159	Substitution - Nonsense(153)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(136)|stomach(13)|soft_tissue(4)|small_intestine(3)|endometrium(1)|skin(1)|pancreas(1)	c.C4294T	5	GRCh37	CM930030	APC	M	rs121913332	.						102.0	90.0	94.0					5																	112175639		2202	4300	6502	112203538	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4348C>T	5.37:g.112175639C>T	ENSP00000413133:p.Arg1450*	Somatic		Capture	SOLID	Phase_I	112203538	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.651223	0.98901	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	4.2	0.49525	.	0.600559	0.18052	N	0.153248	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.0649	14.037	0.64651	0.426:0.574:0.0:0.0	.	.	.	.	X	1450	.	.	R	+	1	2	APC	112203538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.171000	0.50824	1.564000	0.49628	0.655000	0.94253	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
DNAH5	1767	hgsc.bcm.edu	37	5	13922244	13922244	+	Missense_Mutation	SNP	G	G	A	rs139857637		TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr5:13922244G>A	ENST00000265104.4	-	5	736	c.632C>T	c.(631-633)tCg>tTg	p.S211L		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	211	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.S211L(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CTGTGCACCCGACAGGACGTT	0.532									Kartagener syndrome																												p.S211L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C632T	5						.	G	LEU/SER	0,4406		0,0,2203	83.0	76.0	78.0		632	1.4	0.0	5	dbSNP_134	78	1,8599		0,1,4299	no	missense	DNAH5	NM_001369.2	145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	211/4625	13922244	1,13005	2203	4300	6503	13975244	SO:0001583	missense	1767	exon5	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.632C>T	5.37:g.13922244G>A	ENSP00000265104:p.Ser211Leu	Somatic		Capture	SOLID	Phase_I	13975244	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	.	5.858	0.342421	0.11069	0.0	1.16E-4	ENSG00000039139	ENST00000265104	T	0.24908	1.83	5.44	1.44	0.22558	.	0.973885	0.08457	N	0.943006	T	0.12135	0.0295	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35847	-0.9772	10	0.22109	T	0.4	.	6.6197	0.22796	0.2035:0.239:0.5575:0.0	.	211	Q8TE73	DYH5_HUMAN	L	211	ENSP00000265104:S211L	ENSP00000265104:S211L	S	-	2	0	DNAH5	13975244	0.001000	0.12720	0.002000	0.10522	0.097000	0.18754	0.955000	0.29188	0.276000	0.22118	-0.304000	0.09214	TCG		DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
MEGF10	84466	hgsc.bcm.edu	37	5	126734452	126734452	+	Silent	SNP	C	C	T	rs190469012		TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3584-01A-01W-0831-10	TCGA-AG-3584-10A-01W-0831-10	g.chr5:126734452C>T	ENST00000274473.6	+	8	1011	c.744C>T	c.(742-744)caC>caT	p.H248H	MEGF10_ENST00000503335.2_Silent_p.H248H|MEGF10_ENST00000418761.2_Silent_p.H248H|MEGF10_ENST00000508365.1_Silent_p.H248H	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	248	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.H248H(1)		breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TGTGTCATCACGTCACTGGAG	0.527													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20616	0.0		0.0	False		,,,				2504	0.0				p.H248H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C744T	5						.						265.0	198.0	220.0					5																	126734452		2203	4300	6503	126762351	SO:0001819	synonymous_variant	84466	exon8			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.744C>T	5.37:g.126734452C>T		Somatic		Capture	SOLID	Phase_I	126762351	NM_032446	Q68DE5|Q8WUL3	Silent	SNP	ENST00000274473.6	37	CCDS4142.1																																																																																				MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446	
