#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATP13A5	344905	hgsc.bcm.edu	37	3	192994585	192994586	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr3:192994585_192994586insC	ENST00000342358.4	-	29	3466_3467	c.3349_3350insG	c.(3349-3351)attfs	p.I1117fs	ATP13A5_ENST00000495496.1_5'UTR	NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	1117						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.I1117fs*24(1)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TACCACCAAAATTAAAACCCTC	0.327																																					p.I1117fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.3350_3351insG	3						.																																			194477280	SO:0001589	frameshift_variant	344905	exon29			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.3349_3350insG	3.37:g.192994585_192994586insC	ENSP00000341942:p.Ile1117fs	Somatic		Capture	SOLID	Phase_I	194477279	NM_198505	Q6UWS4|Q6ZWL0	Frame_Shift_Ins	INS	ENST00000342358.4	37	CCDS33914.1																																																																																				ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
SLC26A3	1811	hgsc.bcm.edu	37	7	107414556	107414556	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr7:107414556C>T	ENST00000340010.5	-	17	2000	c.1816G>A	c.(1816-1818)Gaa>Aaa	p.E606K	SLC26A3_ENST00000422236.2_Intron	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	606	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)	p.E606K(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						TCCAGCTCTTCGTCAGAATCT	0.398																																					p.E606K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1816A	7						.						296.0	263.0	274.0					7																	107414556		2203	4300	6503	107201792	SO:0001583	missense	1811	exon17			L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.1816G>A	7.37:g.107414556C>T	ENSP00000345873:p.Glu606Lys	Somatic		Capture	SOLID	Phase_I	107201792	NM_000111		Missense_Mutation	SNP	ENST00000340010.5	37	CCDS5748.1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.991506	0.54041	.	.	ENSG00000091138	ENST00000340010	D	0.93133	-3.17	6.16	6.16	0.99307	Sulphate transporter/antisigma-factor antagonist STAS (3);	0.389798	0.33092	N	0.005298	D	0.92586	0.7645	M	0.78637	2.42	0.80722	D	1	P	0.43633	0.813	B	0.37239	0.244	D	0.90487	0.4464	10	0.14656	T	0.56	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	606	P40879	S26A3_HUMAN	K	606	ENSP00000345873:E606K	ENSP00000345873:E606K	E	-	1	0	SLC26A3	107201792	1.000000	0.71417	0.987000	0.45799	0.542000	0.35054	5.338000	0.65947	2.937000	0.99478	0.650000	0.86243	GAA		SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337190.1	NM_000111	
AUTS2	26053	hgsc.bcm.edu	37	7	70239028	70239028	+	Silent	SNP	C	C	T	rs200480602		TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr7:70239028C>T	ENST00000342771.4	+	12	2166	c.1845C>T	c.(1843-1845)atC>atT	p.I615I	AUTS2_ENST00000406775.2_Intron	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	615								p.I615I(1)		breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CCAACCCTATCGATGTCGCTG	0.488																																					p.I615I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1845T	7						.						123.0	98.0	106.0					7																	70239028		2203	4300	6503	69876964	SO:0001819	synonymous_variant	26053	exon12			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.1845C>T	7.37:g.70239028C>T		Somatic		Capture	SOLID	Phase_I	69876964	NM_015570	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	ENST00000342771.4	37	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	C	10.17	1.277072	0.23307	.	.	ENSG00000158321	ENST00000443672	.	.	.	6.06	-1.91	0.07641	.	.	.	.	.	T	0.63593	0.2524	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62058	-0.6934	4	.	.	.	-25.5569	13.1112	0.59275	0.0:0.3717:0.0:0.6283	.	.	.	.	L	142	.	.	S	+	2	0	AUTS2	69876964	0.542000	0.26426	0.992000	0.48379	0.990000	0.78478	-0.400000	0.07241	-0.150000	0.11195	-0.136000	0.14681	TCG		AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
DBF4	10926	hgsc.bcm.edu	37	7	87536887	87536887	+	Silent	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr7:87536887G>A	ENST00000265728.1	+	12	1938	c.1434G>A	c.(1432-1434)agG>agA	p.R478R		NM_006716.3	NP_006707.1	Q9UBU7	DBF4A_HUMAN	DBF4 zinc finger	478					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)	nucleoplasm (GO:0005654)	enzyme activator activity (GO:0008047)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.R478R(1)		endometrium(4)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|skin(3)	28	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				AAGAACTAAGGGTAGATCACT	0.353																																					p.R478R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1434A	7						.						79.0	76.0	77.0					7																	87536887		2203	4300	6503	87374823	SO:0001819	synonymous_variant	10926	exon12			AF160876	CCDS5611.1	7q21.3	2014-02-17	2014-02-17		ENSG00000006634	ENSG00000006634		"""Zinc fingers, DBF-type"""	17364	protein-coding gene	gene with protein product	"""activator of S phase kinase"", ""chiffon homolog (Drosophila)"", ""zinc finger, DBF-type containing 1"", ""DBF4 zinc finger A"""	604281	"""DBF4 homolog (S. cerevisiae)"""			10373557, 10517317	Standard	NM_006716		Approved	ASK, chif, ZDBF1, DBF4A	uc003ujf.1	Q9UBU7	OTTHUMG00000131034	ENST00000265728.1:c.1434G>A	7.37:g.87536887G>A		Somatic		Capture	SOLID	Phase_I	87374823	NM_006716	A4D1D8|A8K954|O75226|Q75MS6|Q75N01|Q9Y2M6	Silent	SNP	ENST00000265728.1	37	CCDS5611.1																																																																																				DBF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253678.1	NM_006716	
CNTNAP2	26047	hgsc.bcm.edu	37	7	148112614	148112614	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr7:148112614C>T	ENST00000361727.3	+	24	4418	c.3902C>T	c.(3901-3903)gCg>gTg	p.A1301V	CNTNAP2_ENST00000538075.1_Missense_Mutation_p.A360V|CNTNAP2_ENST00000463592.2_3'UTR	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	1301					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.A1301V(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GCAAAGGGGGCGGAGTCGGCA	0.542										HNSCC(39;0.1)																											p.A1301V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3902T	7						.						94.0	83.0	87.0					7																	148112614		2203	4300	6503	147743547	SO:0001583	missense	26047	exon24			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.3902C>T	7.37:g.148112614C>T	ENSP00000354778:p.Ala1301Val	Somatic		Capture	SOLID	Phase_I	147743547	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	C	16.94	3.259586	0.59321	.	.	ENSG00000174469	ENST00000361727;ENST00000538075	D;T	0.89196	-2.48;2.74	5.42	5.42	0.78866	.	0.158047	0.45361	D	0.000376	D	0.89015	0.6595	L	0.52573	1.65	0.34628	D	0.719271	P	0.51240	0.943	P	0.47346	0.544	D	0.92495	0.6003	10	0.51188	T	0.08	.	17.8137	0.88624	0.0:1.0:0.0:0.0	.	1301	Q9UHC6	CNTP2_HUMAN	V	1301;360	ENSP00000354778:A1301V;ENSP00000440732:A360V	ENSP00000354778:A1301V	A	+	2	0	CNTNAP2	147743547	0.997000	0.39634	0.888000	0.34837	0.428000	0.31595	3.310000	0.51911	2.534000	0.85438	0.655000	0.94253	GCG		CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
PHF20	51230	hgsc.bcm.edu	37	20	34451072	34451072	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr20:34451072G>T	ENST00000374012.3	+	6	687	c.558G>T	c.(556-558)aaG>aaT	p.K186N	PHF20_ENST00000481202.1_3'UTR|PHF20_ENST00000439301.1_Missense_Mutation_p.K186N			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	186	Lys-rich.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K186N(1)		breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					AACCCTTAAAGACAGAAAAGC	0.383																																					p.K186N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G558T	20						.						107.0	103.0	104.0					20																	34451072		2203	4300	6503	33914486	SO:0001583	missense	51230	exon6			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.558G>T	20.37:g.34451072G>T	ENSP00000363124:p.Lys186Asn	Somatic		Capture	SOLID	Phase_I	33914486	NM_016436	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	ENST00000374012.3	37	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.476161	0.63737	.	.	ENSG00000025293	ENST00000374012;ENST00000439301;ENST00000339089;ENST00000374000;ENST00000449988	T;T;T;T	0.50813	1.35;0.75;0.73;0.73	5.5	2.42	0.29668	.	0.086755	0.49916	D	0.000138	T	0.42359	0.1199	N	0.14661	0.345	0.31931	N	0.612182	D;D;D	0.76494	0.998;0.997;0.999	D;D;D	0.69824	0.966;0.939;0.966	T	0.45396	-0.9264	10	0.25751	T	0.34	.	5.4787	0.16710	0.2454:0.1421:0.6125:0.0	.	186;186;186	Q566Q2;Q9BVI0;Q66K49	.;PHF20_HUMAN;.	N	186;186;186;186;79	ENSP00000363124:K186N;ENSP00000410373:K186N;ENSP00000341900:K186N;ENSP00000363112:K186N	ENSP00000341900:K186N	K	+	3	2	PHF20	33914486	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	1.382000	0.34374	0.333000	0.23563	0.561000	0.74099	AAG		PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2	NM_016436	
PHF20	51230	hgsc.bcm.edu	37	20	34451231	34451231	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr20:34451231G>T	ENST00000374012.3	+	6	846	c.717G>T	c.(715-717)aaG>aaT	p.K239N	PHF20_ENST00000481202.1_3'UTR|PHF20_ENST00000439301.1_Intron			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	239					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K239N(1)		breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					AAGTGGATAAGAAACCTGAAA	0.433																																					p.K239N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G717T	20						.						118.0	127.0	124.0					20																	34451231		2203	4300	6503	33914645	SO:0001583	missense	51230	exon6			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.717G>T	20.37:g.34451231G>T	ENSP00000363124:p.Lys239Asn	Somatic		Capture	SOLID	Phase_I	33914645	NM_016436	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	ENST00000374012.3	37	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.960263	0.74016	.	.	ENSG00000025293	ENST00000374012;ENST00000339089;ENST00000374000;ENST00000449988	T;T;T	0.55760	1.15;0.5;0.5	5.83	1.71	0.24356	.	0.048452	0.85682	D	0.000000	T	0.54791	0.1880	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.997	D;D;D	0.87578	0.966;0.998;0.951	T	0.50355	-0.8838	10	0.46703	T	0.11	.	10.6635	0.45717	0.2576:0.0:0.7424:0.0	.	239;239;239	Q566Q2;Q9BVI0;Q66K49	.;PHF20_HUMAN;.	N	239;239;239;132	ENSP00000363124:K239N;ENSP00000341900:K239N;ENSP00000363112:K239N	ENSP00000341900:K239N	K	+	3	2	PHF20	33914645	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	1.009000	0.29886	0.099000	0.17552	0.561000	0.74099	AAG		PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2	NM_016436	
PHF20	51230	hgsc.bcm.edu	37	20	34451238	34451238	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr20:34451238G>A	ENST00000374012.3	+	6	853	c.724G>A	c.(724-726)Gaa>Aaa	p.E242K	PHF20_ENST00000481202.1_3'UTR|PHF20_ENST00000439301.1_Intron			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	242					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.E242K(1)		breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					TAAGAAACCTGAAAATGACAT	0.428																																					p.E242K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G724A	20						.						119.0	128.0	125.0					20																	34451238		2203	4300	6503	33914652	SO:0001583	missense	51230	exon6			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.724G>A	20.37:g.34451238G>A	ENSP00000363124:p.Glu242Lys	Somatic		Capture	SOLID	Phase_I	33914652	NM_016436	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	ENST00000374012.3	37	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614276	0.66672	.	.	ENSG00000025293	ENST00000374012;ENST00000339089;ENST00000374000;ENST00000449988	T;T;T	0.55760	1.2;0.5;0.5	5.83	5.83	0.93111	.	0.507538	0.21818	N	0.068668	T	0.41673	0.1169	N	0.19112	0.55	0.80722	D	1	P;B;P	0.36354	0.549;0.324;0.549	B;B;B	0.39617	0.305;0.207;0.305	T	0.21895	-1.0232	10	0.22706	T	0.39	.	15.5855	0.76479	0.0:0.137:0.863:0.0	.	242;242;242	Q566Q2;Q9BVI0;Q66K49	.;PHF20_HUMAN;.	K	242;242;242;135	ENSP00000363124:E242K;ENSP00000341900:E242K;ENSP00000363112:E242K	ENSP00000341900:E242K	E	+	1	0	PHF20	33914652	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	4.956000	0.63645	2.763000	0.94921	0.561000	0.74099	GAA		PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2	NM_016436	
RHOJ	57381	hgsc.bcm.edu	37	14	63671738	63671738	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr14:63671738G>A	ENST00000316754.3	+	1	613	c.151G>A	c.(151-153)Gtg>Atg	p.V51M	RHOJ_ENST00000555125.1_Missense_Mutation_p.V51M|RHOJ_ENST00000557133.1_3'UTR	NM_020663.4	NP_065714.1	Q9H4E5	RHOJ_HUMAN	ras homolog family member J	51					actin cytoskeleton organization (GO:0030036)|GTP catabolic process (GO:0006184)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.V51M(3)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)		AGAGGAATACGTGCCCACTGT	0.557																																					p.V51M												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G151A	14						.						110.0	89.0	96.0					14																	63671738		2203	4300	6503	62741491	SO:0001583	missense	57381	exon1			AK027351	CCDS9757.1	14q23.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000126785	ENSG00000126785			688	protein-coding gene	gene with protein product		607653	"""RAS-like, family 7, member B"", ""ras homolog gene family, member J"""	RASL7B, ARHJ		10967094	Standard	NM_020663		Approved	FLJ14445, TCL	uc001xgb.2	Q9H4E5	OTTHUMG00000140342	ENST00000316754.3:c.151G>A	14.37:g.63671738G>A	ENSP00000316729:p.Val51Met	Somatic		Capture	SOLID	Phase_I	62741491	NM_020663	Q96KC1	Missense_Mutation	SNP	ENST00000316754.3	37	CCDS9757.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.672079	0.67928	.	.	ENSG00000126785	ENST00000316754;ENST00000555125	T;T	0.77229	-1.08;-1.08	4.41	4.41	0.53225	Small GTP-binding protein domain (1);	0.082559	0.49916	D	0.000134	T	0.80476	0.4630	M	0.84585	2.705	0.80722	D	1	D	0.55385	0.971	B	0.40741	0.339	D	0.86285	0.1670	10	0.72032	D	0.01	.	17.5398	0.87844	0.0:0.0:1.0:0.0	.	51	Q9H4E5	RHOJ_HUMAN	M	51	ENSP00000316729:V51M;ENSP00000451643:V51M	ENSP00000316729:V51M	V	+	1	0	RHOJ	62741491	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.371000	0.66150	2.445000	0.82738	0.563000	0.77884	GTG		RHOJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276975.3		
ESRRB	2103	hgsc.bcm.edu	37	14	76957940	76957940	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr14:76957940G>A	ENST00000509242.1	+	7	1036	c.938G>A	c.(937-939)cGc>cAc	p.R313H	ESRRB_ENST00000556177.1_Missense_Mutation_p.R313H|ESRRB_ENST00000261532.7_Missense_Mutation_p.R313H|ESRRB_ENST00000380887.2_Missense_Mutation_p.R313H	NM_004452.3	NP_004443.3	O95718	ERR2_HUMAN	estrogen-related receptor beta	313					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|trophectodermal cell proliferation (GO:0001834)|trophectodermal cellular morphogenesis (GO:0001831)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R313H(1)		endometrium(2)|large_intestine(4)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(234;0.0213)		GAGCACTCCCGCCTCGCGGGG	0.592																																					p.R313H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G938A	14						.						49.0	41.0	44.0					14																	76957940		2201	4298	6499	76027693	SO:0001583	missense	2103	exon8			X51417	CCDS9850.1, CCDS9850.2	14q24.3	2013-01-16				ENSG00000119715		"""Nuclear hormone receptors"""	3473	protein-coding gene	gene with protein product		602167	"""deafness, autosomal recessive 35"""	ESRL2, DFNB35		3267207, 9344655, 18179891	Standard	NM_004452		Approved	ERR2, ERRbeta, NR3B2, ERRb	uc001xsr.3	O95718		ENST00000509242.1:c.938G>A	14.37:g.76957940G>A	ENSP00000422488:p.Arg313His	Somatic		Capture	SOLID	Phase_I	76027693	NM_004452	A2VDJ2|B6ZGU4|Q5F0P7|Q5F0P8|Q9HCB4	Missense_Mutation	SNP	ENST00000509242.1	37	CCDS9850.2	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289576	0.80914	.	.	ENSG00000119715	ENST00000512784;ENST00000509242;ENST00000556177;ENST00000380887;ENST00000261532	D;D;D;D;D	0.96587	-4.06;-4.06;-4.06;-4.06;-4.06	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.96824	0.8963	L	0.46741	1.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.70487	0.969;0.969	D	0.95684	0.8734	10	0.39692	T	0.17	.	13.7717	0.63029	0.0697:0.0:0.9303:0.0	.	313;318	Q5F0P7;E7EWD9	.;.	H	318;313;313;313;313	ENSP00000424992:R318H;ENSP00000422488:R313H;ENSP00000451658:R313H;ENSP00000370270:R313H;ENSP00000261532:R313H	ENSP00000261532:R313H	R	+	2	0	ESRRB	76027693	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.882000	0.98803	0.655000	0.94253	CGC		ESRRB-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360663.1		
SPATA7	55812	hgsc.bcm.edu	37	14	88904598	88904598	+	Silent	SNP	T	T	C			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr14:88904598T>C	ENST00000393545.4	+	12	1921	c.1632T>C	c.(1630-1632)gaT>gaC	p.D544D	SPATA7_ENST00000356583.5_Silent_p.D512D|SPATA7_ENST00000556553.1_Silent_p.D512D|SPATA7_ENST00000045347.7_Intron	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	544					response to stimulus (GO:0050896)|visual perception (GO:0007601)			p.D544D(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						TTGAAGGTGATAGTGACCCTG	0.378																																					p.D512D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1536C	14						.						102.0	89.0	93.0					14																	88904598		2203	4300	6503	87974351	SO:0001819	synonymous_variant	55812	exon11			AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.1632T>C	14.37:g.88904598T>C		Somatic		Capture	SOLID	Phase_I	87974351	NM_001040428	Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Silent	SNP	ENST00000393545.4	37	CCDS9883.1																																																																																				SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410172.1		
SLC5A4	6527	hgsc.bcm.edu	37	22	32625329	32625329	+	Silent	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr22:32625329G>A	ENST00000266086.4	-	11	1143	c.1132C>T	c.(1132-1134)Ctg>Ttg	p.L378L	RP1-90G24.10_ENST00000434942.1_RNA	NM_014227.2	NP_055042.1	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (glucose activated ion channel), member 4	378					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.L378L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|pancreas(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AGGCCTCGCAGTCCTGGAGCC	0.532																																					p.L378L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1132T	22						.						64.0	62.0	63.0					22																	32625329		2203	4300	6503	30955329	SO:0001819	synonymous_variant	6527	exon11			U41897	CCDS13903.1	22q12.3	2013-07-19	2013-07-19		ENSG00000100191	ENSG00000100191		"""Solute carriers"""	11039	protein-coding gene	gene with protein product			"""solute carrier family 5 (low affinity glucose cotransporter), member 4"""			9501190, 12354616	Standard	NM_014227		Approved	SAAT1, SGLT3, DJ90G24.4	uc003ami.3	Q9NY91	OTTHUMG00000150007	ENST00000266086.4:c.1132C>T	22.37:g.32625329G>A		Somatic		Capture	SOLID	Phase_I	30955329	NM_014227	O15279	Silent	SNP	ENST00000266086.4	37	CCDS13903.1																																																																																				SLC5A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315724.1	NM_014227	
RANGAP1	5905	hgsc.bcm.edu	37	22	41647072	41647072	+	Silent	SNP	T	T	C			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr22:41647072T>C	ENST00000455915.2	-	12	2891	c.1422A>G	c.(1420-1422)ctA>ctG	p.L474L	RANGAP1_ENST00000407260.4_Silent_p.L419L|RANGAP1_ENST00000405486.1_Silent_p.L474L|RANGAP1_ENST00000356244.3_Silent_p.L474L			P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	474					mitotic cell cycle (GO:0000278)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear pore (GO:0005643)|perinuclear region of cytoplasm (GO:0048471)	Ran GTPase activator activity (GO:0005098)	p.L474L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ATGACACCTTTAGGAAGGCAG	0.567																																					p.L474L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1422G	22						.						199.0	136.0	158.0					22																	41647072		2203	4300	6503	39977018	SO:0001819	synonymous_variant	5905	exon13			X82260	CCDS14012.1	22q13	2013-01-17			ENSG00000100401	ENSG00000100401			9854	protein-coding gene	gene with protein product		602362	"""segregation distorter homolog (Drosophila)"""	SD		7878053	Standard	NM_002883		Approved	Fug1, KIAA1835	uc003azu.3	P46060	OTTHUMG00000150940	ENST00000455915.2:c.1422A>G	22.37:g.41647072T>C		Somatic		Capture	SOLID	Phase_I	39977018	NM_002883	Q96JJ2	Silent	SNP	ENST00000455915.2	37	CCDS14012.1																																																																																				RANGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320606.1	NM_002883	
ACSBG2	81616	hgsc.bcm.edu	37	19	6183157	6183157	+	Missense_Mutation	SNP	C	C	T	rs139677949	byFrequency	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr19:6183157C>T	ENST00000586696.1	+	10	1472	c.1196C>T	c.(1195-1197)gCg>gTg	p.A399V	ACSBG2_ENST00000588304.1_Missense_Mutation_p.A349V|ACSBG2_ENST00000591403.1_Missense_Mutation_p.A399V|ACSBG2_ENST00000252669.5_Missense_Mutation_p.A399V|ACSBG2_ENST00000588485.1_Missense_Mutation_p.A212V|ACSBG2_ENST00000591741.1_3'UTR			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	399					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.A399V(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGTGGGACTGCGCCCCTCAAC	0.512																																					p.A399V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1196T	19						.	C	VAL/ALA	5,4401	9.9+/-24.2	0,5,2198	102.0	95.0	97.0		1196	1.8	0.0	19	dbSNP_134	97	2,8598	2.2+/-6.3	0,2,4298	yes	missense	ACSBG2	NM_030924.3	64	0,7,6496	TT,TC,CC		0.0233,0.1135,0.0538	possibly-damaging	399/667	6183157	7,12999	2203	4300	6503	6134157	SO:0001583	missense	81616	exon10				CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.1196C>T	19.37:g.6183157C>T	ENSP00000465589:p.Ala399Val	Somatic		Capture	SOLID	Phase_I	6134157	NM_030924	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	ENST00000586696.1	37	CCDS12159.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347586	0.61183	0.001135	2.33E-4	ENSG00000130377	ENST00000252669	T	0.13778	2.56	5.16	1.83	0.25207	AMP-dependent synthetase/ligase (1);	0.635484	0.13108	N	0.413193	T	0.45816	0.1361	H	0.95402	3.665	0.38212	D	0.940503	D;D	0.71674	0.998;0.987	D;P	0.68621	0.959;0.694	T	0.51593	-0.8686	10	0.72032	D	0.01	-14.5884	9.7467	0.40451	0.0:0.7366:0.1192:0.1442	.	399;399	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	V	399	ENSP00000252669:A399V	ENSP00000252669:A399V	A	+	2	0	ACSBG2	6134157	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	4.649000	0.61433	-0.037000	0.13646	-0.813000	0.03139	GCG		ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
ZNF667	63934	hgsc.bcm.edu	37	19	56953003	56953003	+	Missense_Mutation	SNP	C	C	T	rs376504755		TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr19:56953003C>T	ENST00000504904.3	-	7	2080	c.1361G>A	c.(1360-1362)cGc>cAc	p.R454H	ZNF667_ENST00000342634.3_Missense_Mutation_p.R582H|ZNF667_ENST00000591790.1_3'UTR|ZNF667_ENST00000292069.6_Missense_Mutation_p.R454H			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	454					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R454H(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		AAATGATTGGCGGCCGAAAAC	0.373																																					p.R454H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1361A	19						.	C	HIS/ARG	0,4406		0,0,2203	51.0	52.0	51.0		1361	3.9	0.9	19		51	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF667	NM_022103.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	454/611	56953003	1,13005	2203	4300	6503	61644815	SO:0001583	missense	63934	exon5				CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.1361G>A	19.37:g.56953003C>T	ENSP00000439402:p.Arg454His	Somatic		Capture	SOLID	Phase_I	61644815	NM_022103	B2RMS6|B9EK36|Q6B093|Q9H807	Missense_Mutation	SNP	ENST00000504904.3	37	CCDS12944.1	.	.	.	.	.	.	.	.	.	.	C	8.627	0.892747	0.17613	0.0	1.16E-4	ENSG00000198046	ENST00000342634;ENST00000504904;ENST00000292069;ENST00000452518;ENST00000360227	T;T;T	0.07327	3.2;3.2;3.2	5.03	3.94	0.45596	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45126	D	0.000397	T	0.03390	0.0098	N	0.13299	0.325	0.09310	N	1	P;P	0.49447	0.924;0.924	B;B	0.31337	0.128;0.128	T	0.48502	-0.9030	10	0.19147	T	0.46	-12.2436	10.2221	0.43203	0.0:0.8955:0.0:0.1045	.	582;454	E7EPS0;Q5HYK9	.;ZN667_HUMAN	H	582;454;454;236;169	ENSP00000344699:R582H;ENSP00000439402:R454H;ENSP00000292069:R454H	ENSP00000292069:R454H	R	-	2	0	ZNF667	61644815	0.000000	0.05858	0.947000	0.38551	0.003000	0.03518	-0.443000	0.06862	2.599000	0.87857	0.655000	0.94253	CGC		ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458394.1	NM_022103	
ANK1	286	hgsc.bcm.edu	37	8	41521208	41521208	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr8:41521208G>A	ENST00000347528.4	-	40	5530	c.5447C>T	c.(5446-5448)aCg>aTg	p.T1816M	ANK1_ENST00000379758.2_Missense_Mutation_p.T1816M|ANK1_ENST00000396945.1_Intron|ANK1_ENST00000396942.1_Missense_Mutation_p.T1816M|ANK1_ENST00000457297.1_Missense_Mutation_p.T91M|ANK1_ENST00000314214.8_Missense_Mutation_p.T91M|RP11-930P14.1_ENST00000520418.1_RNA|ANK1_ENST00000289734.7_Missense_Mutation_p.T1816M|RP11-930P14.1_ENST00000585088.1_RNA|ANK1_ENST00000352337.4_Missense_Mutation_p.T1816M|ANK1_ENST00000522231.1_Missense_Mutation_p.T91M|ANK1_ENST00000522543.1_Missense_Mutation_p.T91M|RP11-930P14.1_ENST00000522388.1_RNA|ANK1_ENST00000265709.8_Missense_Mutation_p.T1857M	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1816	55 kDa regulatory domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.T1816M(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CTGCTCATCCGTGAATTGCTC	0.512																																					p.T1816M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5447T	8						.						216.0	154.0	175.0					8																	41521208		2203	4300	6503	41640365	SO:0001583	missense	286	exon40			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.5447C>T	8.37:g.41521208G>A	ENSP00000339620:p.Thr1816Met	Somatic		Capture	SOLID	Phase_I	41640365	NM_020475	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.174116	0.78452	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000457297;ENST00000396942;ENST00000352337;ENST00000522231;ENST00000522543;ENST00000314214;ENST00000265709;ENST00000348036;ENST00000335651	T;T;T;T;T;D;D;D;T	0.88277	-0.38;-0.4;-0.74;-0.36;-0.64;-1.95;-2.36;-2.33;-0.46	6.04	6.04	0.98038	.	0.116472	0.56097	D	0.000040	D	0.93220	0.7840	L	0.49513	1.565	0.53005	D	0.999967	D;P;P;D;P;P;D;D;D;D	0.89917	0.995;0.888;0.861;1.0;0.916;0.888;0.985;0.978;1.0;0.987	P;B;B;D;P;B;B;B;D;P	0.97110	0.897;0.242;0.173;0.915;0.505;0.242;0.297;0.395;1.0;0.782	D	0.93089	0.6498	10	0.72032	D	0.01	.	19.1573	0.93516	0.0:0.0:1.0:0.0	.	91;1857;1654;1816;1816;1816;970;91;91;91	Q6PK32;P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39;A0PJN8;Q53ER1;E5RFL7	.;.;.;ANK1_HUMAN;.;.;.;.;.;.	M	1816;1816;1816;91;1816;1816;91;91;91;1857;91;91	ENSP00000339620:T1816M;ENSP00000289734:T1816M;ENSP00000369082:T1816M;ENSP00000380147:T1816M;ENSP00000309131:T1816M;ENSP00000428750:T91M;ENSP00000430368:T91M;ENSP00000319123:T91M;ENSP00000265709:T1857M	ENSP00000265709:T1857M	T	-	2	0	ANK1	41640365	1.000000	0.71417	0.993000	0.49108	0.982000	0.71751	7.161000	0.77505	2.873000	0.98535	0.561000	0.74099	ACG		ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
KCNB2	9312	hgsc.bcm.edu	37	8	73849449	73849449	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr8:73849449C>T	ENST00000523207.1	+	3	2447	c.1859C>T	c.(1858-1860)cCg>cTg	p.P620L		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	620					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.P620L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GAGAGATCGCCGCTGCCGCCG	0.602																																					p.P620L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1859T	8						.						71.0	77.0	75.0					8																	73849449		2203	4300	6503	74012003	SO:0001583	missense	9312	exon3			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.1859C>T	8.37:g.73849449C>T	ENSP00000430846:p.Pro620Leu	Somatic		Capture	SOLID	Phase_I	74012003	NM_004770	Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	C	6.680	0.494028	0.12702	.	.	ENSG00000182674	ENST00000523207	T	0.26067	1.76	5.04	5.04	0.67666	.	0.822792	0.09883	N	0.743415	T	0.29620	0.0739	L	0.48642	1.525	0.39033	D	0.959976	P	0.40834	0.73	B	0.38803	0.282	T	0.25433	-1.0132	10	0.35671	T	0.21	.	18.5564	0.91086	0.0:1.0:0.0:0.0	.	620	Q92953	KCNB2_HUMAN	L	620	ENSP00000430846:P620L	ENSP00000430846:P620L	P	+	2	0	KCNB2	74012003	0.162000	0.22906	0.887000	0.34795	0.068000	0.16541	2.678000	0.46900	2.602000	0.87976	0.591000	0.81541	CCG		KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
KCNA10	3744	hgsc.bcm.edu	37	1	111060545	111060545	+	Silent	SNP	G	G	T	rs371836114		TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr1:111060545G>T	ENST00000369771.2	-	1	1252	c.865C>A	c.(865-867)Cgg>Agg	p.R289R		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	289					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)	p.R289R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	ACCACGAACCGGAGCACCAGC	0.502																																					p.R289R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C865A	1						.						147.0	123.0	131.0					1																	111060545		2203	4300	6503	110862068	SO:0001819	synonymous_variant	3744	exon1			U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.865C>A	1.37:g.111060545G>T		Somatic		Capture	SOLID	Phase_I	110862068	NM_005549		Silent	SNP	ENST00000369771.2	37	CCDS826.1																																																																																				KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059081.1	NM_005549	
ARHGEF2	9181	hgsc.bcm.edu	37	1	155920267	155920267	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr1:155920267G>A	ENST00000361247.4	-	21	2809	c.2710C>T	c.(2710-2712)Cga>Tga	p.R904*	ARHGEF2_ENST00000313667.4_Nonsense_Mutation_p.R903*|ARHGEF2_ENST00000368316.1_Nonsense_Mutation_p.R876*|ARHGEF2_ENST00000462460.2_Nonsense_Mutation_p.R949*|ARHGEF2_ENST00000313695.7_Nonsense_Mutation_p.R876*|ARHGEF2_ENST00000368315.4_Nonsense_Mutation_p.R905*|ARHGEF2_ENST00000477754.2_Intron	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	904					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R876*(1)		breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCAGTGCCTCGGCTGGGCTGT	0.597																																					p.R904X	Melanoma(178;35 2768 6610 28839)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2710T	1						.						62.0	56.0	58.0					1																	155920267		2203	4300	6503	154186891	SO:0001587	stop_gained	9181	exon21			AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.2710C>T	1.37:g.155920267G>A	ENSP00000354837:p.Arg904*	Somatic		Capture	SOLID	Phase_I	154186891	NM_001162383	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Nonsense_Mutation	SNP	ENST00000361247.4	37	CCDS53376.1	.	.	.	.	.	.	.	.	.	.	G	40	8.396271	0.98794	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000313667	.	.	.	5.45	5.45	0.79879	.	0.000000	0.36519	N	0.002552	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.3685	14.657	0.68841	0.0:0.0:1.0:0.0	.	.	.	.	X	876;904;905;876;903	.	ENSP00000314787:R903X	R	-	1	2	ARHGEF2	154186891	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	1.479000	0.35453	2.838000	0.97847	0.655000	0.94253	CGA		ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723	
DIRAS3	9077	hgsc.bcm.edu	37	1	68512353	68512353	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr1:68512353C>T	ENST00000370981.1	-	4	1264	c.628G>A	c.(628-630)Gag>Aag	p.E210K	GNG12-AS1_ENST00000420587.1_RNA|DIRAS3_ENST00000395201.1_Missense_Mutation_p.E210K|GNG12-AS1_ENST00000413628.1_RNA			O95661	DIRA3_HUMAN	DIRAS family, GTP-binding RAS-like 3	210					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of gene expression by genetic imprinting (GO:0006349)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.E210K(1)|p.E210Q(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GATTTCTTCTCGGGCTCCTGG	0.517																																					p.E210K												.	.	2	Substitution - Missense(2)	cervix(1)|large_intestine(1)	c.G628A	1						.						118.0	120.0	119.0					1																	68512353		2203	4300	6503	68284941	SO:0001583	missense	9077	exon2			U96750	CCDS641.1	1p31	2014-05-09		2005-01-27	ENSG00000162595	ENSG00000162595			687	protein-coding gene	gene with protein product		605193	"""ras homolog gene family, member I"""	ARHI		9874798	Standard	XM_006711027		Approved	NOEY2	uc001ded.3	O95661	OTTHUMG00000009544	ENST00000370981.1:c.628G>A	1.37:g.68512353C>T	ENSP00000360020:p.Glu210Lys	Somatic		Capture	SOLID	Phase_I	68284941	NM_004675	B3KMP3	Missense_Mutation	SNP	ENST00000370981.1	37	CCDS641.1	.	.	.	.	.	.	.	.	.	.	C	7.214	0.596096	0.13875	.	.	ENSG00000162595	ENST00000370981;ENST00000395201	T;T	0.72725	-0.68;-0.68	4.66	-6.76	0.01732	.	.	.	.	.	T	0.15349	0.0370	N	0.02539	-0.55	0.09310	N	1	B	0.21753	0.06	B	0.15870	0.014	T	0.35325	-0.9793	9	0.08599	T	0.76	.	11.8348	0.52316	0.0:0.6059:0.141:0.2531	.	210	O95661	DIRA3_HUMAN	K	210	ENSP00000360020:E210K;ENSP00000378627:E210K	ENSP00000360020:E210K	E	-	1	0	DIRAS3	68284941	0.926000	0.31397	0.000000	0.03702	0.002000	0.02628	0.746000	0.26275	-0.807000	0.04393	-0.171000	0.13296	GAG		DIRAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026354.2	NM_004675	
TTLL7	79739	hgsc.bcm.edu	37	1	84394906	84394906	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr1:84394906C>T	ENST00000260505.8	-	10	1432	c.1055G>A	c.(1054-1056)cGa>cAa	p.R352Q	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	352	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)	p.R352Q(1)		kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		GCTTGGGGCTCGGTTAATCTG	0.348																																					p.R352Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1055A	1						.						104.0	97.0	99.0					1																	84394906		2202	4298	6500	84167494	SO:0001583	missense	79739	exon10			AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.1055G>A	1.37:g.84394906C>T	ENSP00000260505:p.Arg352Gln	Somatic		Capture	SOLID	Phase_I	84167494	NM_024686	Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Missense_Mutation	SNP	ENST00000260505.8	37	CCDS690.2	.	.	.	.	.	.	.	.	.	.	C	35	5.433541	0.96150	.	.	ENSG00000137941	ENST00000260505;ENST00000370704;ENST00000370703	T	0.07800	3.16	5.11	5.11	0.69529	.	0.068061	0.64402	D	0.000008	T	0.15349	0.0370	M	0.63428	1.95	0.58432	D	0.999998	D	0.76494	0.999	P	0.60173	0.87	T	0.00738	-1.1587	10	0.41790	T	0.15	.	17.1161	0.86689	0.0:1.0:0.0:0.0	.	352	Q6ZT98	TTLL7_HUMAN	Q	352;129;352	ENSP00000260505:R352Q	ENSP00000260505:R352Q	R	-	2	0	TTLL7	84167494	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	7.330000	0.79181	2.538000	0.85594	0.650000	0.86243	CGA		TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027498.1	NM_024686	
DCST2	127579	hgsc.bcm.edu	37	1	155002999	155002999	+	Missense_Mutation	SNP	C	C	T	rs149729324		TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr1:155002999C>T	ENST00000368424.3	-	6	986	c.928G>A	c.(928-930)Gag>Aag	p.E310K	DCST2_ENST00000295536.5_Missense_Mutation_p.E310K	NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	310						integral component of membrane (GO:0016021)		p.E310K(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CTGACAGCCTCGTGGAGGTCC	0.597																																					p.E310K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G928A	1						.	C	LYS/GLU	1,4405		0,1,2202	71.0	55.0	61.0		928	5.4	0.9	1	dbSNP_134	61	1,8599	1.2+/-3.3	0,1,4299	yes	missense	DCST2	NM_144622.2	56	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	310/774	155002999	2,13004	2203	4300	6503	153269623	SO:0001583	missense	127579	exon6			AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.928G>A	1.37:g.155002999C>T	ENSP00000357409:p.Glu310Lys	Somatic		Capture	SOLID	Phase_I	153269623	NM_144622	Q2M2R2|Q8N810|Q96M03	Missense_Mutation	SNP	ENST00000368424.3	37	CCDS1082.2	.	.	.	.	.	.	.	.	.	.	C	12.71	2.019604	0.35606	2.27E-4	1.16E-4	ENSG00000163354	ENST00000368424;ENST00000295536	T;T	0.24151	1.87;1.92	5.38	5.38	0.77491	.	0.268647	0.33875	N	0.004467	T	0.09024	0.0223	L	0.34521	1.04	0.42341	D	0.992333	B	0.29671	0.254	B	0.19946	0.027	T	0.08126	-1.0737	10	0.14252	T	0.57	-16.5965	16.0404	0.80679	0.0:1.0:0.0:0.0	.	310	Q5T1A1	DCST2_HUMAN	K	310	ENSP00000357409:E310K;ENSP00000295536:E310K	ENSP00000295536:E310K	E	-	1	0	DCST2	153269623	0.997000	0.39634	0.929000	0.37066	0.401000	0.30781	5.077000	0.64419	2.531000	0.85337	0.655000	0.94253	GAG		DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090953.3	NM_144622	
ACTN2	88	hgsc.bcm.edu	37	1	236902652	236902652	+	Silent	SNP	C	C	T	rs145411160		TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr1:236902652C>T	ENST00000366578.4	+	10	1093	c.927C>T	c.(925-927)ccC>ccT	p.P309P	ACTN2_ENST00000546208.1_Intron|ACTN2_ENST00000542672.1_Silent_p.P309P|ACTN2_ENST00000492634.1_3'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	309					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.P309P(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			ACCGGACTCCCGAGAAGACCA	0.567													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17396	0.0		0.0	False		,,,				2504	0.0				p.P309P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C927T	1						.	C		7,4399	12.9+/-30.5	0,7,2196	111.0	112.0	112.0		927	-8.2	1.0	1	dbSNP_134	112	0,8600		0,0,4300	no	coding-synonymous	ACTN2	NM_001103.2		0,7,6496	TT,TC,CC		0.0,0.1589,0.0538		309/895	236902652	7,12999	2203	4300	6503	234969275	SO:0001819	synonymous_variant	88	exon10			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.927C>T	1.37:g.236902652C>T		Somatic		Capture	SOLID	Phase_I	234969275	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Silent	SNP	ENST00000366578.4	37	CCDS1613.1																																																																																				ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
E2F8	79733	hgsc.bcm.edu	37	11	19252185	19252185	+	Silent	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr11:19252185G>A	ENST00000527884.1	-	8	1495	c.1263C>T	c.(1261-1263)acC>acT	p.T421T	E2F8_ENST00000250024.4_Silent_p.T421T|RP11-428C19.4_ENST00000527978.1_RNA	NM_001256371.1|NM_001256372.1	NP_001243300.1|NP_001243301.1	A0AVK6	E2F8_HUMAN	E2F transcription factor 8	421					cell cycle comprising mitosis without cytokinesis (GO:0033301)|chorionic trophoblast cell differentiation (GO:0060718)|hepatocyte differentiation (GO:0070365)|negative regulation of cytokinesis (GO:0032466)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.T421T(1)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TACCTTTGTTGGTCTTGATAG	0.388																																					p.T421T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1263T	11						.						93.0	90.0	91.0					11																	19252185		2199	4293	6492	19208761	SO:0001819	synonymous_variant	79733	exon8				CCDS7849.1	11p15	2008-02-05			ENSG00000129173	ENSG00000129173			24727	protein-coding gene	gene with protein product		612047				15722552	Standard	NM_024680		Approved	FLJ23311	uc001mpo.2	A0AVK6	OTTHUMG00000166102	ENST00000527884.1:c.1263C>T	11.37:g.19252185G>A		Somatic		Capture	SOLID	Phase_I	19208761	NM_024680	A8K9H3|Q2VPJ3|Q3C1U6|Q5BKY4|Q8N340|Q9H5M0	Silent	SNP	ENST00000527884.1	37	CCDS7849.1																																																																																				E2F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387830.1	NM_024680	
CST6	1474	hgsc.bcm.edu	37	11	65780352	65780352	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr11:65780352G>A	ENST00000312134.2	+	2	500	c.296G>A	c.(295-297)cGc>cAc	p.R99H		NM_001323.3	NP_001314.1	Q15828	CYTM_HUMAN	cystatin E/M	99					anatomical structure morphogenesis (GO:0009653)|epidermis development (GO:0008544)|negative regulation of endopeptidase activity (GO:0010951)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.R99H(1)		large_intestine(1)|lung(1)|ovary(1)	3						ACAGACTGCCGCAAGACCAGG	0.647																																					p.R99H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G296A	11						.						87.0	70.0	76.0					11																	65780352		2201	4296	6497	65536928	SO:0001583	missense	1474	exon2			U62800	CCDS8126.1	11q13	2005-09-29			ENSG00000175315	ENSG00000175315			2478	protein-coding gene	gene with protein product		601891				9154125, 9099741	Standard	NM_001323		Approved		uc001ogr.3	Q15828	OTTHUMG00000166750	ENST00000312134.2:c.296G>A	11.37:g.65780352G>A	ENSP00000311313:p.Arg99His	Somatic		Capture	SOLID	Phase_I	65536928	NM_001323	Q540N7	Missense_Mutation	SNP	ENST00000312134.2	37	CCDS8126.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073218	0.36566	.	.	ENSG00000175315	ENST00000312134	T	0.26373	1.74	5.66	1.5	0.22942	Proteinase inhibitor I25, cystatin (2);	0.063724	0.64402	N	0.000013	T	0.22244	0.0536	M	0.62266	1.93	0.09310	N	1	P;B	0.38729	0.644;0.238	B;B	0.40165	0.321;0.062	T	0.13495	-1.0507	10	0.48119	T	0.1	-0.1923	2.0922	0.03660	0.1703:0.1558:0.513:0.161	.	99;99	Q6IBD2;Q15828	.;CYTM_HUMAN	H	99	ENSP00000311313:R99H	ENSP00000311313:R99H	R	+	2	0	CST6	65536928	0.004000	0.15560	0.023000	0.16930	0.004000	0.04260	1.098000	0.31000	0.339000	0.23719	-0.253000	0.11424	CGC		CST6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391348.1	NM_001323	
CD83	9308	hgsc.bcm.edu	37	6	14133926	14133926	+	Silent	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr6:14133926G>A	ENST00000379153.3	+	4	600	c.429G>A	c.(427-429)gcG>gcA	p.A143A		NM_001040280.1|NM_001251901.1|NM_004233.3	NP_001035370.1|NP_001238830.1|NP_004224.1	Q01151	CD83_HUMAN	CD83 molecule	143					defense response (GO:0006952)|humoral immune response (GO:0006959)|negative regulation of interleukin-4 production (GO:0032713)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|response to organic cyclic compound (GO:0014070)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.A143A(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	12	Breast(50;0.00245)|Ovarian(93;0.137)	all_hematologic(90;0.117)				AATACAGAGCGGAGATTGTCC	0.358																																					p.A143A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G429A	6						.						135.0	137.0	137.0					6																	14133926		2203	4300	6503	14241905	SO:0001819	synonymous_variant	9308	exon4			Z11697	CCDS4532.1, CCDS75403.1	6p23	2013-01-11	2006-03-31		ENSG00000112149	ENSG00000112149		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1703	protein-coding gene	gene with protein product		604534	"""CD83 antigen (activated B lymphocytes, immunoglobulin superfamily)"", ""CD83 molecule """			1378080, 8422464	Standard	NM_001251901		Approved	HB15, BL11	uc003nbi.3	Q01151	OTTHUMG00000014283	ENST00000379153.3:c.429G>A	6.37:g.14133926G>A		Somatic		Capture	SOLID	Phase_I	14241905	NM_004233	Q5THX9	Silent	SNP	ENST00000379153.3	37	CCDS4532.1																																																																																				CD83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039916.1		
TAP1	6890	hgsc.bcm.edu	37	6	32820991	32820991	+	Silent	SNP	A	A	G	rs55702652	byFrequency	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr6:32820991A>G	ENST00000354258.4	-	1	764	c.603T>C	c.(601-603)gtT>gtC	p.V201V	PSMB9_ENST00000374859.2_5'Flank|PSMB9_ENST00000395330.1_Intron|TAP1_ENST00000425148.2_5'Flank|PSMB9_ENST00000453265.2_5'Flank	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	201					antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	CATAACTGACAACGAAGGCGG	0.657													G|||	167	0.0333466	0.0363	0.0173	5008	,	,		16017	0.005		0.0358	False		,,,				2504	0.0675				p.V201V												.	.	0			c.T603C	6						.	G		97,2921		4,89,1416	25.0	21.0	23.0		603	-4.2	0.0	6	dbSNP_129	23	156,5260		0,156,2552	no	coding-synonymous	TAP1	NM_000593.5		4,245,3968	GG,GA,AA		2.8804,3.214,2.9998		201/809	32820991	253,8181	1509	2708	4217	32928969	SO:0001819	synonymous_variant	6890	exon1				CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.603T>C	6.37:g.32820991A>G		Somatic		Capture	SOLID	Phase_I	32928969	NM_000593	Q16149|Q96CP4	Silent	SNP	ENST00000354258.4	37	CCDS4758.1																																																																																				TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076087.2	NM_000593	
GPR115	221393	hgsc.bcm.edu	37	6	47680271	47680271	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr6:47680271T>C	ENST00000283303.2	+	5	737	c.479T>C	c.(478-480)aTt>aCt	p.I160T	GPR115_ENST00000371220.1_Missense_Mutation_p.I217T|GPR115_ENST00000327753.3_Missense_Mutation_p.I160T|RN7SKP116_ENST00000516902.1_RNA	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	160					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.I160T(1)		NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						TCTGGAAATATTGCATTTATA	0.338																																					p.I160T	GBM(22;431 510 9010 26644 32828)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T479C	6						.						93.0	95.0	94.0					6																	47680271		2203	4300	6503	47788230	SO:0001583	missense	221393	exon5			AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.479T>C	6.37:g.47680271T>C	ENSP00000283303:p.Ile160Thr	Somatic		Capture	SOLID	Phase_I	47788230	NM_153838	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Missense_Mutation	SNP	ENST00000283303.2	37	CCDS4922.2	.	.	.	.	.	.	.	.	.	.	T	21.7	4.192629	0.78902	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	T;T;T	0.43688	1.15;0.94;0.94	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000001	T	0.57946	0.2088	M	0.79258	2.445	0.36953	D	0.892947	D	0.89917	1.0	D	0.91635	0.999	T	0.66677	-0.5863	10	0.87932	D	0	-21.214	13.8563	0.63529	0.0:0.0:0.0:1.0	.	160	Q8IZF3	GP115_HUMAN	T	217;160;160	ENSP00000360264:I217T;ENSP00000328319:I160T;ENSP00000283303:I160T	ENSP00000283303:I160T	I	+	2	0	GPR115	47788230	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.845000	0.62853	2.210000	0.71456	0.533000	0.62120	ATT		GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838	
FAM57A	79850	hgsc.bcm.edu	37	17	641189	641189	+	Missense_Mutation	SNP	C	C	T	rs371723776		TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr17:641189C>T	ENST00000308278.8	+	3	546	c.310C>T	c.(310-312)Cgt>Tgt	p.R104C	FAM57A_ENST00000572018.1_Intron|FAM57A_ENST00000301324.8_Missense_Mutation_p.R104C	NM_024792.1	NP_079068.1	Q8TBR7	FA57A_HUMAN	family with sequence similarity 57, member A	104	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R104C(1)		cervix(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(2)|urinary_tract(2)	10				UCEC - Uterine corpus endometrioid carcinoma (25;0.0217)		AGACCAGAACCGTGCGCCCTC	0.517																																					p.R104C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C310T	17						.	C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	213.0	185.0	194.0		310	2.5	0.0	17		194	0,8600		0,0,4300	no	missense	FAM57A	NM_024792.1	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	104/258	641189	1,13005	2203	4300	6503	587939	SO:0001583	missense	79850	exon3			AK025935	CCDS10996.1	17p13.3	2014-08-14				ENSG00000167695			29646	protein-coding gene	gene with protein product		611627				12270127	Standard	NM_024792		Approved	FLJ22282, CT120	uc002frp.3	Q8TBR7		ENST00000308278.8:c.310C>T	17.37:g.641189C>T	ENSP00000312017:p.Arg104Cys	Somatic		Capture	SOLID	Phase_I	587939	NM_024792	A8K7Q0|Q7Z464|Q96D97|Q9H6H3	Missense_Mutation	SNP	ENST00000308278.8	37	CCDS10996.1	.	.	.	.	.	.	.	.	.	.	C	11.73	1.726624	0.30593	2.27E-4	0.0	ENSG00000167695	ENST00000308278;ENST00000301324;ENST00000451373	.	.	.	5.89	2.52	0.30459	TRAM/LAG1/CLN8 homology domain (3);	3.888680	0.03023	U	0.151098	T	0.41511	0.1162	L	0.29908	0.895	0.09310	N	1	B;B	0.14438	0.01;0.005	B;B	0.08055	0.002;0.003	T	0.37979	-0.9682	9	0.59425	D	0.04	0.666	10.9356	0.47243	0.3059:0.6241:0.0:0.07	.	104;104	Q8TBR7-1;Q8TBR7	.;FA57A_HUMAN	C	104;104;177	.	ENSP00000301324:R104C	R	+	1	0	FAM57A	587939	0.000000	0.05858	0.002000	0.10522	0.046000	0.14306	0.600000	0.24104	0.824000	0.34613	0.638000	0.83543	CGT		FAM57A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437155.2	NM_024792	
TBX21	30009	hgsc.bcm.edu	37	17	45822604	45822604	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr17:45822604G>A	ENST00000177694.1	+	6	1691	c.1480G>A	c.(1480-1482)Gaa>Aaa	p.E494K		NM_013351.1	NP_037483.1	Q9UL17	TBX21_HUMAN	T-box 21	494					cellular response to organic substance (GO:0071310)|lymphocyte migration (GO:0072676)|multicellular organismal development (GO:0007275)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.E494K(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	22						AGGACTGGGCGAAGGAGACTC	0.617																																					p.E494K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1480A	17						.						44.0	45.0	45.0					17																	45822604		2203	4300	6503	43177603	SO:0001583	missense	30009	exon6			AF093098	CCDS11514.1	17q21.2	2008-06-23				ENSG00000073861		"""T-boxes"""	11599	protein-coding gene	gene with protein product		604895					Standard	NM_013351		Approved	TBLYM, T-bet	uc002ilv.1	Q9UL17		ENST00000177694.1:c.1480G>A	17.37:g.45822604G>A	ENSP00000177694:p.Glu494Lys	Somatic		Capture	SOLID	Phase_I	43177603	NM_013351		Missense_Mutation	SNP	ENST00000177694.1	37	CCDS11514.1	.	.	.	.	.	.	.	.	.	.	G	17.67	3.447346	0.63178	.	.	ENSG00000073861	ENST00000177694	D	0.86230	-2.09	5.38	5.38	0.77491	.	0.206123	0.31601	N	0.007363	D	0.88336	0.6409	M	0.73598	2.24	0.36175	D	0.849049	D	0.61697	0.99	P	0.45998	0.5	D	0.92221	0.5784	10	0.62326	D	0.03	.	14.6327	0.68668	0.0:0.0:1.0:0.0	.	494	Q9UL17	TBX21_HUMAN	K	494	ENSP00000177694:E494K	ENSP00000177694:E494K	E	+	1	0	TBX21	43177603	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	3.340000	0.52143	2.499000	0.84300	0.655000	0.94253	GAA		TBX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441365.1	NM_013351	
TP53	7157	hgsc.bcm.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000455263.2_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				p.R273H	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,-1	.	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	c.G818A	17	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576	.						67.0	58.0	61.0					17																	7577120		2203	4300	6503	7517845	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His	Somatic		Capture	SOLID	Phase_I	7517845	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MAP3K3	4215	hgsc.bcm.edu	37	17	61771046	61771046	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr17:61771046G>A	ENST00000361733.3	+	16	2110	c.1790G>A	c.(1789-1791)cGg>cAg	p.R597Q	MAP3K3_ENST00000579585.1_Missense_Mutation_p.R628Q|MAP3K3_ENST00000577395.1_Missense_Mutation_p.R593Q|MAP3K3_ENST00000361357.3_Missense_Mutation_p.R628Q|MAP3K3_ENST00000584573.1_Missense_Mutation_p.R624Q	NM_002401.3	NP_002392.2	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3	597	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)	p.R597Q(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	28						GAACATGGCCGGGACTTCCTG	0.567																																					p.R597Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1790A	17						.						107.0	96.0	100.0					17																	61771046		2203	4300	6503	59124778	SO:0001583	missense	4215	exon16			U78876	CCDS32701.1, CCDS32702.1	17q	2011-06-09				ENSG00000198909		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6855	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 3"", ""MAPK/ERK kinase kinase 3"""	602539		MEKK3		9006902	Standard	NM_002401		Approved	MAPKKK3	uc002jbf.3	Q99759		ENST00000361733.3:c.1790G>A	17.37:g.61771046G>A	ENSP00000354485:p.Arg597Gln	Somatic		Capture	SOLID	Phase_I	59124778	NM_002401	B2RCW2|D3DU15|Q5BKZ6|Q8N3I9	Missense_Mutation	SNP	ENST00000361733.3	37	CCDS32702.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.592291	0.86953	.	.	ENSG00000198909	ENST00000361357;ENST00000361733	T;T	0.64618	-0.11;-0.11	4.95	3.98	0.46160	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.68476	0.3005	L	0.31926	0.97	0.80722	D	1	D;D;D;P	0.76494	0.999;0.999;0.975;0.936	D;D;P;P	0.70935	0.971;0.929;0.608;0.56	T	0.71148	-0.4677	10	0.66056	D	0.02	.	13.4432	0.61125	0.0765:0.0:0.9235:0.0	.	593;565;597;628	Q1PBM3;Q96HN9;Q99759;Q99759-2	.;.;M3K3_HUMAN;.	Q	628;597	ENSP00000354927:R628Q;ENSP00000354485:R597Q	ENSP00000354927:R628Q	R	+	2	0	MAP3K3	59124778	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.835000	0.99442	1.085000	0.41206	0.561000	0.74099	CGG		MAP3K3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000443867.1	NM_002401	
CDH3	1001	hgsc.bcm.edu	37	16	68718642	68718642	+	Missense_Mutation	SNP	G	G	A	rs145160881		TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr16:68718642G>A	ENST00000264012.4	+	10	1883	c.1339G>A	c.(1339-1341)Gtt>Att	p.V447I	CDH3_ENST00000581171.1_Missense_Mutation_p.V392I|CDH3_ENST00000429102.2_Missense_Mutation_p.V447I	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	447	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)|p.V447I(1)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		CTCCAAAGTCGTTGAGGTCCA	0.562																																					p.V447I												.	.	3	Unknown(2)|Substitution - Missense(1)	breast(2)|large_intestine(1)	c.G1339A	16						.	G	ILE/VAL	0,4396		0,0,2198	152.0	151.0	151.0		1339	-2.7	0.0	16	dbSNP_134	151	1,8599	1.2+/-3.3	0,1,4299	no	missense	CDH3	NM_001793.4	29	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	benign	447/830	68718642	1,12995	2198	4300	6498	67276143	SO:0001583	missense	1001	exon10			X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.1339G>A	16.37:g.68718642G>A	ENSP00000264012:p.Val447Ile	Somatic		Capture	SOLID	Phase_I	67276143	NM_001793	B2R6F4|Q05DI6	Missense_Mutation	SNP	ENST00000264012.4	37	CCDS10868.1	.	.	.	.	.	.	.	.	.	.	G	0.416	-0.910867	0.02434	0.0	1.16E-4	ENSG00000062038	ENST00000429102;ENST00000264012;ENST00000542274	T;T	0.50813	0.73;0.73	5.46	-2.65	0.06095	Cadherin (3);Cadherin-like (1);	1.034090	0.07730	N	0.945054	T	0.28830	0.0715	N	0.17723	0.515	0.09310	N	1	B	0.16166	0.016	B	0.12156	0.007	T	0.37596	-0.9699	10	0.02654	T	1	.	14.6385	0.68706	0.2982:0.0:0.7018:0.0	.	447	P22223	CADH3_HUMAN	I	447;447;392	ENSP00000398485:V447I;ENSP00000264012:V447I	ENSP00000264012:V447I	V	+	1	0	CDH3	67276143	0.000000	0.05858	0.034000	0.17996	0.635000	0.38103	0.061000	0.14366	-0.752000	0.04728	-0.367000	0.07326	GTT		CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268896.2	NM_001793	
SETBP1	26040	hgsc.bcm.edu	37	18	42532218	42532218	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr18:42532218C>A	ENST00000282030.5	+	4	3209	c.2913C>A	c.(2911-2913)caC>caA	p.H971Q		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	971						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.H917Q(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GAATCTCCCACCGGAGTTACA	0.473									Schinzel-Giedion syndrome																												p.H971Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2913A	18						.						94.0	91.0	92.0					18																	42532218		2203	4300	6503	40786216	SO:0001583	missense	26040	exon4	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.2913C>A	18.37:g.42532218C>A	ENSP00000282030:p.His971Gln	Somatic		Capture	SOLID	Phase_I	40786216	NM_015559	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	C	15.66	2.898324	0.52227	.	.	ENSG00000152217	ENST00000282030	D	0.92397	-3.03	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.93367	0.7885	L	0.32530	0.975	0.41902	D	0.990422	D	0.89917	1.0	D	0.87578	0.998	D	0.93721	0.7033	10	0.87932	D	0	.	13.9146	0.63890	0.0:0.9221:0.0:0.0779	.	971	Q9Y6X0	SETBP_HUMAN	Q	971	ENSP00000282030:H971Q	ENSP00000282030:H971Q	H	+	3	2	SETBP1	40786216	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.951000	0.40333	2.808000	0.96608	0.655000	0.94253	CAC		SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110	
ZCWPW2	152098	hgsc.bcm.edu	37	3	28476708	28476708	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr3:28476708C>G	ENST00000383768.2	+	4	628	c.440C>G	c.(439-441)tCa>tGa	p.S147*	ZCWPW2_ENST00000421010.1_Nonsense_Mutation_p.S147*			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	147	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.						zinc ion binding (GO:0008270)	p.S147*(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						GATCCCCATTCAAGATCATGG	0.363																																					p.S147X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C440G	3						.						110.0	113.0	112.0					3																	28476708		2203	4300	6503	28451712	SO:0001587	stop_gained	152098	exon3			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.440C>G	3.37:g.28476708C>G	ENSP00000373278:p.Ser147*	Somatic		Capture	SOLID	Phase_I	28451712	NM_001040432		Nonsense_Mutation	SNP	ENST00000383768.2	37	CCDS33723.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	7.044880|7.044880	0.98025|0.98025	.|.	.|.	ENSG00000206559|ENSG00000206559	ENST00000428875|ENST00000383768;ENST00000421010	.|.	.|.	.|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	.|0.119564	.|0.38548	.|N	.|0.001654	T|.	0.72137|.	0.3423|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.71902|.	-0.4452|.	3|.	.|.	.|.	.|.	-9.5709|-9.5709	16.1245|16.1245	0.81382|0.81382	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	L|X	130|147	.|.	.|.	F|S	+|+	3|2	2|0	ZCWPW2|ZCWPW2	28451712|28451712	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.954000|0.954000	0.61252|0.61252	4.220000|4.220000	0.58567|0.58567	2.879000|2.879000	0.98667|0.98667	0.650000|0.650000	0.86243|0.86243	TTC|TCA		ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384	
DUSP7	1849	hgsc.bcm.edu	37	3	52084880	52084880	+	Missense_Mutation	SNP	G	G	A	rs201355085		TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr3:52084880G>A	ENST00000495880.1	-	3	1394	c.1211C>T	c.(1210-1212)aCg>aTg	p.T404M	DUSP7_ENST00000296483.6_Missense_Mutation_p.T353M			Q16829	DUS7_HUMAN	dual specificity phosphatase 7	404					inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of MAP kinase activity (GO:0043407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)	p.T353M(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GTTGGTGGGCGTGGAAAAGTA	0.622																																					p.T404M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1211T	3						.						152.0	119.0	130.0					3																	52084880		2203	4300	6503	52059920	SO:0001583	missense	1849	exon3			X93921	CCDS33766.1, CCDS33766.2	3p21	2011-06-09			ENSG00000164086	ENSG00000164086		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3073	protein-coding gene	gene with protein product		602749				8626780, 9205128	Standard	NM_001947		Approved	MKP-X, PYST2	uc003dct.3	Q16829	OTTHUMG00000157819	ENST00000495880.1:c.1211C>T	3.37:g.52084880G>A	ENSP00000417183:p.Thr404Met	Somatic		Capture	SOLID	Phase_I	52059920	NM_001947	Q2M3J7|Q8NFJ0	Missense_Mutation	SNP	ENST00000495880.1	37	CCDS33766.2	.	.	.	.	.	.	.	.	.	.	g	22.9	4.356160	0.82243	.	.	ENSG00000164086	ENST00000495880;ENST00000296483	T;T	0.02863	4.13;4.17	5.75	4.88	0.63580	.	0.048847	0.85682	N	0.000000	T	0.12178	0.0296	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	T	0.00460	-1.1726	10	0.87932	D	0	.	14.4233	0.67198	0.0715:0.0:0.9285:0.0	.	404	Q16829	DUS7_HUMAN	M	404;353	ENSP00000417183:T404M;ENSP00000296483:T353M	ENSP00000296483:T353M	T	-	2	0	DUSP7	52059920	1.000000	0.71417	0.937000	0.37676	0.813000	0.45954	9.859000	0.99545	1.448000	0.47680	-0.148000	0.13756	ACG		DUSP7-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000349697.1	NM_001947	
WNK1	65125	hgsc.bcm.edu	37	12	936259	936259	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr12:936259C>G	ENST00000315939.6	+	3	1627	c.984C>G	c.(982-984)tgC>tgG	p.C328W	WNK1_ENST00000537687.1_Missense_Mutation_p.C328W|WNK1_ENST00000530271.2_Missense_Mutation_p.C328W|WNK1_ENST00000447667.2_Missense_Mutation_p.C328W|WNK1_ENST00000535572.1_Missense_Mutation_p.C328W	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	328	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.C328W(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GAAGCTGGTGCCGTCAGATCC	0.388																																					p.C328W	Colon(19;451 567 6672 12618 28860)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C984G	12						.						137.0	131.0	133.0					12																	936259		2203	4300	6503	806520	SO:0001583	missense	65125	exon3			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.984C>G	12.37:g.936259C>G	ENSP00000313059:p.Cys328Trp	Somatic		Capture	SOLID	Phase_I	806520	NM_001184985	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	37	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.299408	0.60195	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000447667;ENST00000530271	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	5.54	4.42	0.53409	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000005	T	0.73999	0.3659	M	0.62088	1.915	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.995	T	0.75007	-0.3469	10	0.87932	D	0	-7.7639	9.5683	0.39411	0.0:0.7381:0.0:0.2619	.	328;328;328	F5GWT4;Q9H4A3;F6UYG0	.;WNK1_HUMAN;.	W	328	ENSP00000441972:C328W;ENSP00000313059:C328W;ENSP00000444465:C328W;ENSP00000392542:C328W;ENSP00000433548:C328W	ENSP00000313059:C328W	C	+	3	2	WNK1	806520	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.322000	0.33689	1.008000	0.39264	0.591000	0.81541	TGC		WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
PZP	5858	hgsc.bcm.edu	37	12	9310407	9310407	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr12:9310407C>T	ENST00000261336.2	-	27	3353	c.3325G>A	c.(3325-3327)Gcc>Acc	p.A1109T	PZP_ENST00000539983.1_5'Flank|PZP_ENST00000381997.2_Missense_Mutation_p.A895T	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	1109					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.A895T(1)|p.A1109T(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GTAACATAGGCGGAGAGGGTC	0.433																																					p.A1109T	Melanoma(125;1402 1695 4685 34487 38571)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3325A	12						.						139.0	115.0	123.0					12																	9310407		2203	4300	6503	9201674	SO:0001583	missense	5858	exon27			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.3325G>A	12.37:g.9310407C>T	ENSP00000261336:p.Ala1109Thr	Somatic		Capture	SOLID	Phase_I	9201674	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	C	15.43	2.831214	0.50845	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.57273	0.41;0.41	3.95	1.03	0.20045	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.176745	0.33572	N	0.004771	T	0.68824	0.3043	M	0.92507	3.315	0.27261	N	0.958621	B;D	0.69078	0.039;0.997	B;P	0.55391	0.028;0.775	T	0.64613	-0.6366	10	0.72032	D	0.01	.	8.6886	0.34254	0.0:0.7292:0.0:0.2708	.	895;1109	P20742-2;P20742	.;PZP_HUMAN	T	1109;895	ENSP00000261336:A1109T;ENSP00000371427:A895T	ENSP00000261336:A1109T	A	-	1	0	PZP	9201674	0.997000	0.39634	0.318000	0.25279	0.300000	0.27592	3.106000	0.50322	0.078000	0.16900	-0.219000	0.12488	GCC		PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
ENDOU	8909	hgsc.bcm.edu	37	12	48111365	48111365	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr12:48111365G>T	ENST00000422538.3	-	4	440	c.318C>A	c.(316-318)tgC>tgA	p.C106*	ENDOU_ENST00000229003.3_Nonsense_Mutation_p.C65*|ENDOU_ENST00000542202.1_5'UTR|ENDOU_ENST00000545824.2_Nonsense_Mutation_p.C43*|RP1-197B17.3_ENST00000547799.1_lincRNA	NM_001172439.1	NP_001165910.1	P21128	ENDOU_HUMAN	endonuclease, polyU-specific	106	SMB 2. {ECO:0000255|PROSITE- ProRule:PRU00350}.				female pregnancy (GO:0007565)|immune response (GO:0006955)|proteolysis (GO:0006508)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endoribonuclease activity (GO:0004521)|growth factor activity (GO:0008083)|manganese ion binding (GO:0030145)|polysaccharide binding (GO:0030247)|RNA binding (GO:0003723)|scavenger receptor activity (GO:0005044)|serine-type peptidase activity (GO:0008236)	p.C65*(1)		autonomic_ganglia(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(3)|pancreas(1)|stomach(1)	14						AGCGGGCATTGCAGTGACATT	0.562											OREG0021752	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C106X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C318A	12						.						150.0	144.0	146.0					12																	48111365		2203	4300	6503	46397632	SO:0001587	stop_gained	8909	exon4			M32402	CCDS8754.1, CCDS53784.1, CCDS53785.1	12q13.1	2011-08-31			ENSG00000111405	ENSG00000111405		"""Serine peptidases / Serine peptidases"""	14369	protein-coding gene	gene with protein product		606720				2350438, 1710108, 15755742, 18936097	Standard	NM_006025		Approved	PP11, P11, PRSS26	uc001rpu.2	P21128	OTTHUMG00000169670	ENST00000422538.3:c.318C>A	12.37:g.48111365G>T	ENSP00000397679:p.Cys106*	Somatic	952	Capture	SOLID	Phase_I	46397632	NM_001172439	B2RBJ3|B3KQS7|B7Z6E1|Q2NKJ4	Nonsense_Mutation	SNP	ENST00000422538.3	37	CCDS53785.1	.	.	.	.	.	.	.	.	.	.	G	36	5.907925	0.97093	.	.	ENSG00000111405	ENST00000229003;ENST00000422538;ENST00000545824	.	.	.	5.26	-2.02	0.07388	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.2376	5.7931	0.18371	0.3821:0.0:0.5006:0.1173	.	.	.	.	X	65;106;43	.	ENSP00000229003:C65X	C	-	3	2	ENDOU	46397632	0.937000	0.31787	0.849000	0.33467	0.956000	0.61745	0.140000	0.16056	-0.362000	0.08113	0.563000	0.77884	TGC		ENDOU-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000405352.1	NM_006025.2	
POLR3B	55703	hgsc.bcm.edu	37	12	106824219	106824219	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr12:106824219A>G	ENST00000228347.4	+	14	1654	c.1432A>G	c.(1432-1434)Atg>Gtg	p.M478V	POLR3B_ENST00000539066.1_Missense_Mutation_p.M420V	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	478					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)	p.M478V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						TCAGTGGGGAATGCTGTGTCC	0.502																																					p.M478V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1432G	12						.						100.0	91.0	94.0					12																	106824219		2203	4300	6503	105348349	SO:0001583	missense	55703	exon14			AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.1432A>G	12.37:g.106824219A>G	ENSP00000228347:p.Met478Val	Somatic		Capture	SOLID	Phase_I	105348349	NM_018082	A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	ENST00000228347.4	37	CCDS9105.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.230505	0.79688	.	.	ENSG00000013503	ENST00000228347;ENST00000551370;ENST00000539066	T;T	0.75938	-0.98;-0.98	5.56	5.56	0.83823	RNA polymerase Rpb2, domain 3 (1);	0.000000	0.85682	D	0.000000	T	0.81973	0.4936	M	0.80508	2.5	0.80722	D	1	P	0.35575	0.51	P	0.45406	0.479	D	0.83753	0.0210	10	0.66056	D	0.02	-32.6932	15.7123	0.77641	1.0:0.0:0.0:0.0	.	478	Q9NW08	RPC2_HUMAN	V	478;478;420	ENSP00000228347:M478V;ENSP00000445721:M420V	ENSP00000228347:M478V	M	+	1	0	POLR3B	105348349	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	8.918000	0.92759	2.093000	0.63338	0.533000	0.62120	ATG		POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407166.1	NM_018082	
SPRED1	161742	hgsc.bcm.edu	37	15	38641631	38641631	+	Silent	SNP	T	T	C			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr15:38641631T>C	ENST00000299084.4	+	6	1451	c.591T>C	c.(589-591)ttT>ttC	p.F197F		NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	197					inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)	p.F197F(1)		kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		AGATAACATTTGGTCAGCCAG	0.343									Legius syndrome																												p.F197F	Melanoma(196;2146 2959 7698 16532)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T591C	15						.						86.0	83.0	84.0					15																	38641631		2200	4297	6497	36428923	SO:0001819	synonymous_variant	161742	exon6	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.591T>C	15.37:g.38641631T>C		Somatic		Capture	SOLID	Phase_I	36428923	NM_152594	B2RPJ8|Q05D53|Q8N256	Silent	SNP	ENST00000299084.4	37	CCDS32193.1																																																																																				SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418217.1		
FBN1	2200	hgsc.bcm.edu	37	15	48782244	48782244	+	Silent	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr15:48782244G>A	ENST00000316623.5	-	25	3341	c.2886C>T	c.(2884-2886)taC>taT	p.Y962Y		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	962	TB 5.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.Y962Y(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CCTCGTCCTCGTACCTCAGGA	0.602																																					p.Y962Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2886T	15						.						50.0	45.0	47.0					15																	48782244		2198	4296	6494	46569536	SO:0001819	synonymous_variant	2200	exon25			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.2886C>T	15.37:g.48782244G>A		Somatic		Capture	SOLID	Phase_I	46569536	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	ENST00000316623.5	37	CCDS32232.1																																																																																				FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
FAM227B	196951	hgsc.bcm.edu	37	15	49663509	49663509	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr15:49663509A>G	ENST00000299338.6	-	12	1403	c.1100T>C	c.(1099-1101)cTa>cCa	p.L367P		NM_152647.2	NP_689860.2	Q96M60	F227B_HUMAN	family with sequence similarity 227, member B	367								p.L367P(1)									CTTTGTTGCTAGTCTTGATAA	0.318																																					p.L367P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1100C	15						.						101.0	107.0	105.0					15																	49663509		2196	4289	6485	47450801	SO:0001583	missense	196951	exon12				CCDS32237.1	15q21.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000166262	ENSG00000166262			26543	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 33"""	C15orf33			Standard	NM_152647		Approved	FLJ32800	uc001zxl.2	Q96M60	OTTHUMG00000172328	ENST00000299338.6:c.1100T>C	15.37:g.49663509A>G	ENSP00000299338:p.Leu367Pro	Somatic		Capture	SOLID	Phase_I	47450801	NM_152647	Q86WS2	Missense_Mutation	SNP	ENST00000299338.6	37	CCDS32237.1	.	.	.	.	.	.	.	.	.	.	A	7.751	0.703363	0.15172	.	.	ENSG00000166262	ENST00000299338	.	.	.	3.9	-4.78	0.03209	.	4.691850	0.00357	N	0.000039	T	0.40595	0.1123	M	0.63843	1.955	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.12915	-1.0529	9	0.35671	T	0.21	-0.0521	3.4719	0.07570	0.4158:0.0:0.3014:0.2828	.	367	Q96M60	CO033_HUMAN	P	367	.	ENSP00000299338:L367P	L	-	2	0	C15orf33	47450801	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-0.229000	0.09098	-0.954000	0.03640	-0.297000	0.09499	CTA		FAM227B-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417872.1	NM_152647	
PRPS1	5631	hgsc.bcm.edu	37	X	106882652	106882652	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chrX:106882652C>T	ENST00000372435.4	+	2	372	c.250C>T	c.(250-252)Cgg>Tgg	p.R84W	PRPS1_ENST00000372419.3_Missense_Mutation_p.R84W|PRPS1_ENST00000372418.1_Missense_Mutation_p.R17W|PRPS1_ENST00000543248.1_Missense_Mutation_p.R84W|PRPS1_ENST00000372428.4_Missense_Mutation_p.R17W	NM_002764.3	NP_002755.1	P60891	PRPS1_HUMAN	phosphoribosyl pyrophosphate synthetase 1	84					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|hypoxanthine biosynthetic process (GO:0046101)|nervous system development (GO:0007399)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|pyrimidine nucleotide biosynthetic process (GO:0006221)|ribonucleoside monophosphate biosynthetic process (GO:0009156)|small molecule metabolic process (GO:0044281)|urate biosynthetic process (GO:0034418)	cytosol (GO:0005829)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)	p.R84W(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(3)|lung(11)|upper_aerodigestive_tract(1)	23						TTCAGCCAGCCGGGTTACTGC	0.443																																					p.R84W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C250T	X						.						159.0	150.0	153.0					X																	106882652		2203	4300	6503	106769308	SO:0001583	missense	5631	exon2			X15331	CCDS14529.1, CCDS76007.1	Xq22.3	2014-09-17			ENSG00000147224	ENSG00000147224	2.7.6.1		9462	protein-coding gene	gene with protein product	"""PRS I"", ""ribose-phosphate diphosphokinase 1"""	311850	"""deafness, X-linked 2, perceptive, congenital"""	DFN2		1962753, 20021999	Standard	NM_002764		Approved	CMTX5, DFNX1	uc004ene.4	P60891	OTTHUMG00000022167	ENST00000372435.4:c.250C>T	X.37:g.106882652C>T	ENSP00000361512:p.Arg84Trp	Somatic		Capture	SOLID	Phase_I	106769308	NM_002764	B1ALA8|B2R6T7|B4DNL6|D3DUX6|P09329	Missense_Mutation	SNP	ENST00000372435.4	37	CCDS14529.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.524202	0.64747	.	.	ENSG00000147224	ENST00000372435;ENST00000372428;ENST00000372419;ENST00000543248;ENST00000372418	D;D;D;D;D	0.93953	-3.32;-3.32;-3.32;-3.32;-3.32	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	D	0.95793	0.8631	H	0.99197	4.465	0.54753	D	0.999989	P;P	0.49559	0.925;0.925	B;B	0.39971	0.315;0.315	D	0.96508	0.9376	10	0.87932	D	0	.	11.7434	0.51807	0.1887:0.8113:0.0:0.0	.	84;84	Q53FW2;P60891	.;PRPS1_HUMAN	W	84;17;84;84;17	ENSP00000361512:R84W;ENSP00000361505:R17W;ENSP00000361496:R84W;ENSP00000443185:R84W;ENSP00000361495:R17W	ENSP00000361495:R17W	R	+	1	2	PRPS1	106769308	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.825000	0.39081	2.169000	0.68431	0.600000	0.82982	CGG		PRPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057840.1		
SEPT6	23157	hgsc.bcm.edu	37	X	118771001	118771001	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chrX:118771001G>T	ENST00000343984.5	-	7	1209	c.945C>A	c.(943-945)agC>agA	p.S315R	SEPT6_ENST00000360156.7_Missense_Mutation_p.S315R|SEPT6_ENST00000394616.4_Missense_Mutation_p.S257R|SEPT6_ENST00000354416.3_Missense_Mutation_p.S315R|SEPT6_ENST00000394617.2_Missense_Mutation_p.S345R|SEPT6_ENST00000394610.1_Missense_Mutation_p.S315R|SEPT6_ENST00000489216.1_Missense_Mutation_p.S315R|SEPT6_ENST00000354228.4_Missense_Mutation_p.S315R	NM_015129.5	NP_055944.2	Q14141	SEPT6_HUMAN	septin 6	315					cytokinesis (GO:0000910)|viral process (GO:0016032)	axon terminus (GO:0043679)|kinetochore (GO:0000776)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)	GTP binding (GO:0005525)	p.S315R(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(3)	17						TGAAGGGTTTGCTGTCAGGGT	0.617			T	MLL	AML																																p.S315R			Dom	yes		X	Xq24	23157	septin 6		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C945A	X						.						100.0	70.0	80.0					X																	118771001		2203	4300	6503	118655029	SO:0001583	missense	23157	exon7			D50918	CCDS14583.1, CCDS14584.1, CCDS14585.1	Xq24	2013-01-21			ENSG00000125354	ENSG00000125354		"""Septins"""	15848	protein-coding gene	gene with protein product		300683				8590280, 10744683	Standard	NM_015129		Approved	KIAA0128, SEP2, SEPT2, MGC16619, MGC20339	uc004erv.3	Q14141	OTTHUMG00000022280	ENST00000343984.5:c.945C>A	X.37:g.118771001G>T	ENSP00000341524:p.Ser315Arg	Somatic		Capture	SOLID	Phase_I	118655029	NM_145799	Q5JTK0|Q969W5|Q96A13|Q96GR1|Q96P86|Q96P87	Missense_Mutation	SNP	ENST00000343984.5	37	CCDS14584.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.243490	0.58995	.	.	ENSG00000125354	ENST00000360156;ENST00000354228;ENST00000489216;ENST00000354416;ENST00000394610;ENST00000343984;ENST00000394616;ENST00000394617	D;D;D;D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63	5.29	4.41	0.53225	.	0.076593	0.85682	D	0.000000	D	0.83672	0.5305	L	0.56769	1.78	0.80722	D	1	P;B;B;B	0.37824	0.609;0.001;0.159;0.031	P;B;B;B	0.47528	0.549;0.005;0.185;0.027	T	0.80783	-0.1228	10	0.25751	T	0.34	.	12.5008	0.55953	0.0843:0.0:0.9157:0.0	.	345;257;315;315	F5H1J5;B4E049;Q14141;Q548C9	.;.;SEPT6_HUMAN;.	R	315;315;315;315;315;315;257;345	ENSP00000353278:S315R;ENSP00000346169:S315R;ENSP00000418715:S315R;ENSP00000346397:S315R;ENSP00000378108:S315R;ENSP00000341524:S315R;ENSP00000378114:S257R;ENSP00000378115:S345R	ENSP00000341524:S315R	S	-	3	2	SEPT6	118655029	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.642000	0.83385	2.200000	0.70718	0.594000	0.82650	AGC		SEPT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058059.1	NM_145802	
CDR1	1038	hgsc.bcm.edu	37	X	139865904	139865904	+	Missense_Mutation	SNP	C	C	T	rs143948461		TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chrX:139865904C>T	ENST00000370532.2	-	1	819	c.628G>A	c.(628-630)Gga>Aga	p.G210R		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	210								p.G210R(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				CCACATCTTCCGGAAAAAATC	0.438																																					p.G210R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G628A	X						.	C	ARG/GLY	2,3833		0,2,1630,571	112.0	108.0	109.0		628	3.7	1.0	X	dbSNP_134	109	0,6728		0,0,2428,1872	no	missense	CDR1	NM_004065.2	125	0,2,4058,2443	TT,TC,CC,C		0.0,0.0522,0.0189	possibly-damaging	210/263	139865904	2,10561	2203	4300	6503	139693570	SO:0001583	missense	1038	exon1				CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.628G>A	X.37:g.139865904C>T	ENSP00000359563:p.Gly210Arg	Somatic		Capture	SOLID	Phase_I	139693570	NM_004065	Q5JXH6	Missense_Mutation	SNP	ENST00000370532.2	37	CCDS14670.1	.	.	.	.	.	.	.	.	.	.	C	13.48	2.250435	0.39797	5.22E-4	0.0	ENSG00000184258	ENST00000370532	.	.	.	4.58	3.7	0.42460	.	.	.	.	.	T	0.32704	0.0838	N	0.08118	0	0.24558	N	0.993987	D	0.76494	0.999	D	0.63381	0.914	T	0.09509	-1.0671	7	.	.	.	.	8.8416	0.35146	0.0:0.8854:0.0:0.1146	.	210	P51861	CDR1_HUMAN	R	210	.	.	G	-	1	0	CDR1	139693570	0.061000	0.20836	0.970000	0.41538	0.193000	0.23685	0.177000	0.16801	2.181000	0.69327	0.422000	0.28245	GGA		CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058583.1	NM_004065	
RIF1	55183	hgsc.bcm.edu	37	2	152322564	152322564	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr2:152322564C>T	ENST00000243326.5	+	29	7013	c.6530C>T	c.(6529-6531)cCg>cTg	p.P2177L	RIF1_ENST00000428287.2_Missense_Mutation_p.P2177L|RIF1_ENST00000453091.2_Missense_Mutation_p.P2177L|RIF1_ENST00000430328.2_Missense_Mutation_p.P2177L|RIF1_ENST00000444746.2_Missense_Mutation_p.P2177L			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.P2177L(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TTGGCTTCTCCGTCTACGAGC	0.423																																					p.P2177L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6530T	2						.						79.0	77.0	78.0					2																	152322564		2203	4300	6503	152030810	SO:0001583	missense	55183	exon30			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.6530C>T	2.37:g.152322564C>T	ENSP00000243326:p.Pro2177Leu	Somatic		Capture	SOLID	Phase_I	152030810	NM_001177664	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	C	33	5.222962	0.95139	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.69926	-0.23;-0.44;-0.44;-0.23;-0.44	5.9	5.9	0.94986	.	0.096271	0.64402	D	0.000001	T	0.80909	0.4714	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.81138	-0.1069	10	0.87932	D	0	-14.5893	19.874	0.96863	0.0:1.0:0.0:0.0	.	2177;2177	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	L	2177	ENSP00000390181:P2177L;ENSP00000414615:P2177L;ENSP00000415691:P2177L;ENSP00000243326:P2177L;ENSP00000416123:P2177L	ENSP00000243326:P2177L	P	+	2	0	RIF1	152030810	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.151000	0.77411	2.788000	0.95919	0.650000	0.86243	CCG		RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3		
ITSN2	50618	hgsc.bcm.edu	37	2	24535212	24535212	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr2:24535212A>T	ENST00000355123.4	-	5	664	c.221T>A	c.(220-222)aTg>aAg	p.M74K	ITSN2_ENST00000361999.3_Missense_Mutation_p.M74K|ITSN2_ENST00000406921.3_Missense_Mutation_p.M74K|ITSN2_ENST00000407704.1_5'UTR	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	74	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.|EH 1. {ECO:0000255|PROSITE- ProRule:PRU00077}.				endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)	p.M73K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGCTGATCCATCTTCCCATC	0.453																																					p.M74K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T221A	2						.						203.0	167.0	179.0					2																	24535212		2203	4300	6503	24388716	SO:0001583	missense	50618	exon5			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.221T>A	2.37:g.24535212A>T	ENSP00000347244:p.Met74Lys	Somatic		Capture	SOLID	Phase_I	24388716	NM_019595	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	ENST00000355123.4	37	CCDS1710.2	.	.	.	.	.	.	.	.	.	.	A	24.2	4.508898	0.85282	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000445614;ENST00000406921;ENST00000412011;ENST00000443927	T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52	5.07	5.07	0.68467	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.000000	0.44902	U	0.000410	T	0.56775	0.2008	M	0.79614	2.46	0.80722	D	1	D;D;D;P	0.76494	0.999;0.999;0.999;0.915	D;D;D;D	0.79108	0.984;0.992;0.992;0.937	T	0.62397	-0.6863	10	0.87932	D	0	.	14.9724	0.71243	1.0:0.0:0.0:0.0	.	74;74;74;74	Q9NZM3-4;Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;.;ITSN2_HUMAN	K	74;74;74;73;74;74;60	ENSP00000354561:M74K;ENSP00000347244:M74K;ENSP00000370250:M74K;ENSP00000384499:M74K;ENSP00000391224:M74K;ENSP00000391715:M60K	ENSP00000347244:M74K	M	-	2	0	ITSN2	24388716	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.737000	0.91562	2.266000	0.75297	0.533000	0.62120	ATG		ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	
CAPG	822	hgsc.bcm.edu	37	2	85622746	85622746	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr2:85622746C>T	ENST00000409921.1	-	9	917	c.851G>A	c.(850-852)cGa>cAa	p.R284Q	CAPG_ENST00000409724.1_Missense_Mutation_p.R299Q|CAPG_ENST00000483659.1_5'UTR|CAPG_ENST00000263867.4_Missense_Mutation_p.R299Q|CAPG_ENST00000409670.1_Missense_Mutation_p.R299Q			Q9BPX3	CND3_HUMAN	capping protein (actin filament), gelsolin-like	0					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R299Q(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)	11						ATTCGCTTTTCGCCCTAGATC	0.532																																					p.R299Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G896A	2						.						35.0	33.0	34.0					2																	85622746		2203	4300	6503	85476257	SO:0001583	missense	822	exon9			M94345	CCDS1974.1, CCDS58715.1	2p11.2	2008-06-04			ENSG00000042493	ENSG00000042493			1474	protein-coding gene	gene with protein product	"""macrophage capping protein"""	153615		AFCP		1322908, 12754261	Standard	NM_001747		Approved	MCP	uc010fgi.2	P40121	OTTHUMG00000130183	ENST00000409921.1:c.851G>A	2.37:g.85622746C>T	ENSP00000387063:p.Arg284Gln	Somatic		Capture	SOLID	Phase_I	85476257	NM_001747	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	ENST00000409921.1	37	CCDS58715.1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.055063	0.36277	.	.	ENSG00000042493	ENST00000542681;ENST00000263867;ENST00000453973;ENST00000409921;ENST00000409670;ENST00000409724	T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6	5.68	3.87	0.44632	Gelsolin domain (1);	0.284093	0.32736	N	0.005719	T	0.31295	0.0792	L	0.35288	1.05	0.09310	N	1	B;B;P	0.49185	0.019;0.018;0.92	B;B;B	0.29267	0.013;0.003;0.1	T	0.39292	-0.9621	10	0.87932	D	0	.	7.6992	0.28613	0.0:0.8143:0.0:0.1857	.	278;284;299	B4DU58;B8ZZS7;P40121	.;.;CAPG_HUMAN	Q	278;299;54;284;299;299	ENSP00000263867:R299Q;ENSP00000397381:R54Q;ENSP00000387063:R284Q;ENSP00000386315:R299Q;ENSP00000386965:R299Q	ENSP00000263867:R299Q	R	-	2	0	CAPG	85476257	0.001000	0.12720	0.988000	0.46212	0.141000	0.21300	1.223000	0.32527	1.406000	0.46857	0.491000	0.48974	CGA		CAPG-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000329383.1	NM_001747	
SCN1A	6323	hgsc.bcm.edu	37	2	166859191	166859191	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr2:166859191G>T	ENST00000303395.4	-	21	4074	c.4075C>A	c.(4075-4077)Cta>Ata	p.L1359I	AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.L1348I|SCN1A_ENST00000423058.2_Missense_Mutation_p.L1359I|SCN1A_ENST00000409050.1_Missense_Mutation_p.L1331I|AC010127.3_ENST00000597623.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1359					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.L1348I(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTGAAAATTAGCCAGAATATA	0.383																																					p.L1331I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3991A	2						.						81.0	81.0	81.0					2																	166859191		2203	4299	6502	166567437	SO:0001583	missense	6323	exon21			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4075C>A	2.37:g.166859191G>T	ENSP00000303540:p.Leu1359Ile	Somatic		Capture	SOLID	Phase_I	166567437	NM_001165964	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.176811	0.78564	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.98550	-4.99;-4.99;-4.99;-4.99	5.54	4.66	0.58398	Ion transport (1);	0.000000	0.52532	D	0.000068	D	0.98760	0.9583	M	0.77103	2.36	0.58432	D	0.999996	P;D;D	0.76494	0.955;0.997;0.999	P;D;D	0.85130	0.665;0.997;0.99	D	0.99793	1.1032	10	0.87932	D	0	.	14.4334	0.67266	0.0709:0.0:0.9291:0.0	.	1348;1331;1359	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	I	1359;1359;1348;1331	ENSP00000407030:L1359I;ENSP00000303540:L1359I;ENSP00000364554:L1348I;ENSP00000386312:L1331I	ENSP00000303540:L1359I	L	-	1	2	SCN1A	166567437	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.967000	0.87967	1.473000	0.48159	0.591000	0.81541	CTA		SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
ERP44	23071	hgsc.bcm.edu	37	9	102784447	102784447	+	Silent	SNP	C	C	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr9:102784447C>T	ENST00000262455.6	-	5	547	c.348G>A	c.(346-348)ggG>ggA	p.G116G		NM_015051.1	NP_055866.1	Q9BS26	ERP44_HUMAN	endoplasmic reticulum protein 44	116	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|glycoprotein metabolic process (GO:0009100)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	protein disulfide isomerase activity (GO:0003756)	p.G116G(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(2)	19						TCATCATCATCCCATTACGAA	0.393																																					p.G116G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G348A	9						.						161.0	150.0	154.0					9																	102784447		2203	4300	6503	101824268	SO:0001819	synonymous_variant	23071	exon5			AB011145	CCDS35082.1	9q22.33	2011-10-19	2009-02-23	2009-02-23	ENSG00000023318	ENSG00000023318		"""Protein disulfide isomerases"""	18311	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 10"""	609170	"""thioredoxin domain containing 4 (endoplasmic reticulum)"""	TXNDC4		11847130	Standard	NM_015051		Approved	KIAA0573, PDIA10	uc004bam.3	Q9BS26	OTTHUMG00000020363	ENST00000262455.6:c.348G>A	9.37:g.102784447C>T		Somatic		Capture	SOLID	Phase_I	101824268	NM_015051	O60319|Q4VXC1|Q5VWZ7|Q6UW14|Q8WX67	Silent	SNP	ENST00000262455.6	37	CCDS35082.1																																																																																				ERP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053402.1	XM_088476	
FAM102A	399665	hgsc.bcm.edu	37	9	130716198	130716198	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr9:130716198C>A	ENST00000373095.1	-	2	528	c.153G>T	c.(151-153)gaG>gaT	p.E51D		NM_001035254.2	NP_001030331.1	Q5T9C2	F102A_HUMAN	family with sequence similarity 102, member A	51								p.E51D(1)		breast(1)|cervix(1)|large_intestine(3)|lung(1)|ovary(4)	10						TCTCCTGTACCTCCTCCCTGT	0.617																																					p.E51D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G153T	9						.						78.0	69.0	72.0					9																	130716198		2203	4300	6503	129756019	SO:0001583	missense	399665	exon2				CCDS6888.1, CCDS35150.1	9q34.11	2012-11-05	2005-11-17	2005-11-17	ENSG00000167106	ENSG00000167106			31419	protein-coding gene	gene with protein product	"""sym-3 homolog A (C. elegans)"""	610891	"""chromosome 9 open reading frame 132"""	C9orf132			Standard	NM_001035254		Approved	Eeig1, bA203J24.7, SYM-3A	uc004bsx.2	Q5T9C2	OTTHUMG00000020720	ENST00000373095.1:c.153G>T	9.37:g.130716198C>A	ENSP00000362187:p.Glu51Asp	Somatic		Capture	SOLID	Phase_I	129756019	NM_001035254	A2A329|Q8TEL4	Missense_Mutation	SNP	ENST00000373095.1	37	CCDS35150.1	.	.	.	.	.	.	.	.	.	.	C	18.94	3.730204	0.69074	.	.	ENSG00000167106	ENST00000373095	T	0.40756	1.02	5.9	1.1	0.20463	.	0.099394	0.64402	D	0.000002	T	0.47967	0.1474	M	0.85542	2.76	0.80722	D	1	P	0.47484	0.896	P	0.50754	0.649	T	0.43845	-0.9366	10	0.22109	T	0.4	-32.9067	3.8517	0.08957	0.1671:0.3627:0.0:0.4702	.	51	Q5T9C2	F102A_HUMAN	D	51	ENSP00000362187:E51D	ENSP00000362187:E51D	E	-	3	2	FAM102A	129756019	0.998000	0.40836	1.000000	0.80357	0.952000	0.60782	0.684000	0.25364	0.310000	0.22990	-0.140000	0.14226	GAG		FAM102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054298.2		
SPTAN1	6709	hgsc.bcm.edu	37	9	131346721	131346721	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr9:131346721G>A	ENST00000372731.4	+	17	2464	c.2354G>A	c.(2353-2355)cGg>cAg	p.R785Q	SPTAN1_ENST00000358161.5_Missense_Mutation_p.R785Q|SPTAN1_ENST00000372739.3_Missense_Mutation_p.R785Q	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	785					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R785Q(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						GATTCTCTGCGGTTGCAGCAG	0.557																																					p.R785Q	NSCLC(120;833 1744 2558 35612 37579)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2354A	9						.						49.0	51.0	50.0					9																	131346721		2203	4300	6503	130386542	SO:0001583	missense	6709	exon17			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.2354G>A	9.37:g.131346721G>A	ENSP00000361816:p.Arg785Gln	Somatic		Capture	SOLID	Phase_I	130386542	NM_001195532	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	G	12.26	1.883626	0.33255	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.32272	1.46;1.46;1.46	5.63	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.17450	0.0419	N	0.16862	0.45	0.50813	D	0.999894	B;P;B;B;B	0.46142	0.114;0.873;0.008;0.007;0.077	B;B;B;B;B	0.38880	0.057;0.284;0.005;0.001;0.046	T	0.03773	-1.1005	10	0.12766	T	0.61	.	13.6241	0.62155	0.0741:0.0:0.9259:0.0	.	785;785;785;785;785	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	Q	785	ENSP00000350882:R785Q;ENSP00000361816:R785Q;ENSP00000361824:R785Q	ENSP00000350882:R785Q	R	+	2	0	SPTAN1	130386542	1.000000	0.71417	0.706000	0.30403	0.597000	0.36814	9.400000	0.97290	1.386000	0.46466	0.561000	0.74099	CGG		SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
PHYHD1	254295	hgsc.bcm.edu	37	9	131702678	131702678	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr9:131702678A>G	ENST00000372592.3	+	10	1421	c.488A>G	c.(487-489)tAc>tGc	p.Y163C	PHYHD1_ENST00000421063.2_Missense_Mutation_p.Y142C|PHYHD1_ENST00000487504.1_3'UTR|PHYHD1_ENST00000308941.5_Missense_Mutation_p.T156A|PHYHD1_ENST00000353176.5_Missense_Mutation_p.Y142C|RP11-101E3.5_ENST00000482796.1_5'Flank	NM_001100876.1	NP_001094346.1	Q5SRE7	PHYD1_HUMAN	phytanoyl-CoA dioxygenase domain containing 1	163							dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.T156A(1)		central_nervous_system(1)|endometrium(2)|large_intestine(3)|skin(1)|stomach(3)	10						TCCTTCCTGTACACGGAGCCC	0.627																																					p.T156A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A466G	9						.						72.0	76.0	75.0					9																	131702678		2203	4300	6503	130742499	SO:0001583	missense	254295	exon9			BC051300	CCDS6914.1, CCDS43885.1, CCDS43886.1	9q34.13	2010-08-13			ENSG00000175287	ENSG00000175287			23396	protein-coding gene	gene with protein product						12477932	Standard	NM_174933		Approved	MGC16638	uc004bwp.2	Q5SRE7	OTTHUMG00000020764	ENST00000372592.3:c.488A>G	9.37:g.131702678A>G	ENSP00000361673:p.Tyr163Cys	Somatic		Capture	SOLID	Phase_I	130742499	NM_174933	A6PWN9|A6PWP0|B3KT57|B4E3X8|Q5SRE9|Q5SRF0|Q7Z623|Q7Z7P9|Q96GM4	Missense_Mutation	SNP	ENST00000372592.3	37	CCDS43885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.0|25.0	4.597116|4.597116	0.87055|0.87055	.|.	.|.	ENSG00000175287|ENSG00000175287	ENST00000308941;ENST00000419872|ENST00000372592;ENST00000353176;ENST00000426694;ENST00000421063	.|D;D;D;D	.|0.90444	.|-2.67;-2.67;-2.67;-2.67	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	1.045490|.	0.07474|.	N|.	0.902729|.	D|D	0.94627|0.94627	0.8268|0.8268	.|.	.|.	.|.	0.43761|0.43761	D|D	0.996272|0.996272	P|D;D	0.51791|0.76494	0.948|0.998;0.999	P|D;D	0.47645|0.68943	0.553|0.952;0.961	D|D	0.94614|0.94614	0.7807|0.7807	8|8	0.10377|0.49607	T|T	0.69|0.09	-0.4037|-0.4037	14.3375|14.3375	0.66600|0.66600	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	156|142;163	Q5SRE7-3|Q5SRE7-2;Q5SRE7	.|.;PHYD1_HUMAN	A|C	156;21|163;142;163;142	.|ENSP00000361673:Y163C;ENSP00000340945:Y142C;ENSP00000412377:Y163C;ENSP00000409928:Y142C	ENSP00000309515:T156A|ENSP00000340945:Y142C	T|Y	+|+	1|2	0|0	PHYHD1|PHYHD1	130742499|130742499	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	7.356000|7.356000	0.79445|0.79445	1.998000|1.998000	0.58463|0.58463	0.454000|0.454000	0.30748|0.30748	ACA|TAC		PHYHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054506.2	NM_174933	
KATNAL1	84056	hgsc.bcm.edu	37	13	30805468	30805468	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr13:30805468G>A	ENST00000380615.3	-	7	1035	c.868C>T	c.(868-870)Cgt>Tgt	p.R290C	KATNAL1_ENST00000380617.3_Missense_Mutation_p.R290C	NM_032116.4	NP_115492.1			katanin p60 subunit A-like 1									p.R290C(2)		autonomic_ganglia(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|skin(1)|urinary_tract(3)	19		Lung SC(185;0.0257)		all cancers(112;0.114)|OV - Ovarian serous cystadenocarcinoma(117;0.213)		AACAACAGACGAACTAACTTC	0.418																																					p.R290C												.	.	2	Substitution - Missense(2)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.C868T	13						.						126.0	120.0	122.0					13																	30805468		2203	4300	6503	29703468	SO:0001583	missense	84056	exon7			AK097423	CCDS31956.1	13q12.3	2010-04-21			ENSG00000102781	ENSG00000102781		"""ATPases / AAA-type"""	28361	protein-coding gene	gene with protein product		614764				12477932	Standard	NM_001014380		Approved	MGC2599	uc001uss.4	Q9BW62	OTTHUMG00000016665	ENST00000380615.3:c.868C>T	13.37:g.30805468G>A	ENSP00000369989:p.Arg290Cys	Somatic		Capture	SOLID	Phase_I	29703468	NM_032116		Missense_Mutation	SNP	ENST00000380615.3	37	CCDS31956.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.452952	0.84209	.	.	ENSG00000102781	ENST00000380615;ENST00000380617	D;D	0.94417	-3.42;-3.42	5.86	5.02	0.67125	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.98495	0.9498	H	0.98818	4.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99466	1.0944	10	0.87932	D	0	-9.7106	15.1804	0.72952	0.0677:0.0:0.9323:0.0	.	290	Q9BW62	KATL1_HUMAN	C	290	ENSP00000369989:R290C;ENSP00000369991:R290C	ENSP00000369989:R290C	R	-	1	0	KATNAL1	29703468	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	9.755000	0.98912	1.486000	0.48398	0.591000	0.81541	CGT		KATNAL1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044346.2	NM_032116	
ITIH2	3698	hgsc.bcm.edu	37	10	7773807	7773807	+	Missense_Mutation	SNP	C	C	T	rs202086391		TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr10:7773807C>T	ENST00000358415.4	+	13	1661	c.1495C>T	c.(1495-1497)Cgg>Tgg	p.R499W	ITIH2_ENST00000379587.4_Missense_Mutation_p.R488W	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	499					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.R499W(1)		NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						TCCATTGCTCCGGAATGTTCA	0.408													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18351	0.0		0.0	False		,,,				2504	0.0				p.R499W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1495T	10						.						142.0	140.0	141.0					10																	7773807		2203	4300	6503	7813813	SO:0001583	missense	3698	exon13			X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.1495C>T	10.37:g.7773807C>T	ENSP00000351190:p.Arg499Trp	Somatic		Capture	SOLID	Phase_I	7813813	NM_002216	Q14659|Q15484|Q5T986	Missense_Mutation	SNP	ENST00000358415.4	37	CCDS31141.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	17.70	3.454874	0.63290	.	.	ENSG00000151655	ENST00000358415;ENST00000379587	T;T	0.11821	2.74;2.74	5.44	4.51	0.55191	.	0.100909	0.64402	D	0.000005	T	0.33789	0.0875	M	0.78049	2.395	0.38545	D	0.94931	D	0.89917	1.0	P	0.61592	0.891	T	0.28332	-1.0047	10	0.54805	T	0.06	-11.6559	12.46	0.55727	0.4824:0.5176:0.0:0.0	.	499	P19823	ITIH2_HUMAN	W	499;488	ENSP00000351190:R499W;ENSP00000368906:R488W	ENSP00000351190:R499W	R	+	1	2	ITIH2	7813813	1.000000	0.71417	0.992000	0.48379	0.934000	0.57294	3.104000	0.50306	1.235000	0.43724	0.643000	0.83706	CGG		ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046678.2	NM_002216	
KAT6B	23522	hgsc.bcm.edu	37	10	76735323	76735323	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr10:76735323A>G	ENST00000287239.4	+	8	1717	c.1228A>G	c.(1228-1230)Acc>Gcc	p.T410A	KAT6B_ENST00000372714.1_Intron|KAT6B_ENST00000372724.1_Intron|KAT6B_ENST00000372711.1_Missense_Mutation_p.T410A|KAT6B_ENST00000372725.1_Intron	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	410	Negatively regulates HAT activity.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.T410A(1)									GCCTGGTGCCACCACCAAAAT	0.468																																					p.T410A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1228G	10						.						130.0	107.0	115.0					10																	76735323		2203	4300	6503	76405329	SO:0001583	missense	23522	exon8			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.1228A>G	10.37:g.76735323A>G	ENSP00000287239:p.Thr410Ala	Somatic		Capture	SOLID	Phase_I	76405329	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	ENST00000287239.4	37	CCDS7345.1	.	.	.	.	.	.	.	.	.	.	A	7.746	0.702395	0.15172	.	.	ENSG00000156650	ENST00000287239;ENST00000372711	T;T	0.76316	-1.01;-1.0	5.97	4.83	0.62350	.	0.000000	0.51477	D	0.000089	T	0.62134	0.2403	N	0.19112	0.55	0.31529	N	0.661386	B;B	0.14805	0.011;0.007	B;B	0.14023	0.01;0.004	T	0.58825	-0.7568	9	.	.	.	-2.4079	10.9408	0.47273	0.9288:0.0:0.0712:0.0	.	410;410	Q8WYB5-2;Q8WYB5	.;KAT6B_HUMAN	A	410	ENSP00000287239:T410A;ENSP00000361796:T410A	.	T	+	1	0	KAT6B	76405329	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.179000	0.58290	1.068000	0.40764	0.533000	0.62120	ACC		KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
NOC3L	64318	hgsc.bcm.edu	37	10	96106249	96106249	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr10:96106249A>C	ENST00000371361.3	-	11	1422	c.1322T>G	c.(1321-1323)aTt>aGt	p.I441S	NOC3L_ENST00000543788.1_Missense_Mutation_p.I179S|NOC3L_ENST00000463649.1_5'UTR|NOC3L_ENST00000371350.1_Missense_Mutation_p.I441S	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	441					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.I441S(1)		endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				TGGTTTATTAATGTCTTCTGT	0.259																																					p.I441S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1322G	10						.						65.0	64.0	64.0					10																	96106249		2188	4271	6459	96096239	SO:0001583	missense	64318	exon11			AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.1322T>G	10.37:g.96106249A>C	ENSP00000360412:p.Ile441Ser	Somatic		Capture	SOLID	Phase_I	96096239	NM_022451	Q9H5M6|Q9H9D8	Missense_Mutation	SNP	ENST00000371361.3	37	CCDS7433.1	.	.	.	.	.	.	.	.	.	.	A	12.11	1.840600	0.32513	.	.	ENSG00000173145	ENST00000543788;ENST00000371361;ENST00000371350	T;T;T	0.13307	2.6;2.81;2.81	5.83	5.83	0.93111	.	0.164239	0.52532	D	0.000066	T	0.08802	0.0218	N	0.14661	0.345	0.38834	D	0.955914	B	0.16396	0.017	B	0.10450	0.005	T	0.21381	-1.0247	10	0.09590	T	0.72	-18.6994	15.8742	0.79148	1.0:0.0:0.0:0.0	.	441	Q8WTT2	NOC3L_HUMAN	S	179;441;441	ENSP00000437838:I179S;ENSP00000360412:I441S;ENSP00000360401:I441S	ENSP00000360401:I441S	I	-	2	0	NOC3L	96096239	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.254000	0.58798	2.236000	0.73375	0.533000	0.62120	ATT		NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049466.1	NM_022451	
APC	324	hgsc.bcm.edu	37	5	112174631	112174631	+	Nonsense_Mutation	SNP	C	C	T	rs121913331		TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr5:112174631C>T	ENST00000457016.1	+	16	3720	c.3340C>T	c.(3340-3342)Cga>Tga	p.R1114*	APC_ENST00000257430.4_Nonsense_Mutation_p.R1114*|APC_ENST00000508376.2_Nonsense_Mutation_p.R1114*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1114	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1114*(30)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGAAACAAATCGAGTGGGTTC	0.403	R1114*(LOVO_LARGE_INTESTINE)|R1114*(SW948_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1096X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0	.	31	Substitution - Nonsense(30)|Unknown(1)	large_intestine(29)|ovary(1)|skin(1)	c.C3286T	5	GRCh37	CM920048	APC	M	rs121913331	.						90.0	82.0	85.0					5																	112174631		2202	4300	6502	112202530	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3340C>T	5.37:g.112174631C>T	ENSP00000413133:p.Arg1114*	Somatic		Capture	SOLID	Phase_I	112202530	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	38	6.950292	0.97956	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.76	4.88	0.63580	.	0.190581	0.42172	D	0.000759	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.7869	14.0911	0.64990	0.3279:0.6721:0.0:0.0	.	.	.	.	X	1114;1096;1114;1114;1114	.	ENSP00000257430:R1114X	R	+	1	2	APC	112202530	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.208000	0.42797	1.423000	0.47198	0.655000	0.94253	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	hgsc.bcm.edu	37	5	112175207	112175207	+	Nonsense_Mutation	SNP	G	G	T	rs121913462		TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr5:112175207G>T	ENST00000457016.1	+	16	4296	c.3916G>T	c.(3916-3918)Gaa>Taa	p.E1306*	APC_ENST00000257430.4_Nonsense_Mutation_p.E1306*|APC_ENST00000508376.2_Nonsense_Mutation_p.E1306*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1306	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E1306*(25)|p.E1306K(2)|p.K1192fs*3(1)|p.?(1)|p.E1306fs*8(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GCAAATAGCAGAAATAAAAGA	0.428		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1288X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,pancreas,NS,Substitution - Missense,0	.	30	Substitution - Nonsense(25)|Substitution - Missense(2)|Deletion - Frameshift(2)|Unknown(1)	large_intestine(26)|pancreas(1)|soft_tissue(1)|liver(1)|skin(1)	c.G3862T	5	GRCh37	CM077502	APC	M	rs121913462	.						53.0	55.0	54.0					5																	112175207		2202	4300	6502	112203106	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3916G>T	5.37:g.112175207G>T	ENSP00000413133:p.Glu1306*	Somatic		Capture	SOLID	Phase_I	112203106	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	37	6.245438	0.97408	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	5.73	5.73	0.89815	.	0.179091	0.53938	D	0.000048	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-23.6779	14.1203	0.65182	0.0727:0.0:0.9273:0.0	.	.	.	.	X	1306	.	.	E	+	1	0	APC	112203106	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	4.734000	0.62043	2.861000	0.98227	0.655000	0.94253	GAA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
FBXO38	81545	hgsc.bcm.edu	37	5	147806906	147806906	+	Silent	SNP	C	C	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr5:147806906C>T	ENST00000340253.5	+	15	2217	c.2049C>T	c.(2047-2049)gcC>gcT	p.A683A	FBXO38_ENST00000296701.6_Intron|FBXO38_ENST00000513826.1_Intron|FBXO38_ENST00000394370.3_Silent_p.A683A|CTD-2283N19.1_ENST00000520980.2_RNA			Q6PIJ6	FBX38_HUMAN	F-box protein 38	683					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A683A(1)	ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGATCAAAGCCGATATGAAAG	0.507																																					p.A683A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2049T	5						.						61.0	57.0	58.0					5																	147806906		2203	4300	6503	147787099	SO:0001819	synonymous_variant	81545	exon15			BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.2049C>T	5.37:g.147806906C>T		Somatic		Capture	SOLID	Phase_I	147787099	NM_205836	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Silent	SNP	ENST00000340253.5	37																																																																																					FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	
FAT2	2196	hgsc.bcm.edu	37	5	150946260	150946260	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr5:150946260C>A	ENST00000261800.5	-	1	2245	c.2233G>T	c.(2233-2235)Ggt>Tgt	p.G745C		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	745	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G745C(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCATTAAAACCAGCATCAGGG	0.537																																					p.G745C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2233T	5						.						69.0	73.0	72.0					5																	150946260		2203	4300	6503	150926453	SO:0001583	missense	2196	exon1			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.2233G>T	5.37:g.150946260C>A	ENSP00000261800:p.Gly745Cys	Somatic		Capture	SOLID	Phase_I	150926453	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	C	18.04	3.535822	0.64972	.	.	ENSG00000086570	ENST00000261800	T	0.56776	0.44	5.78	4.91	0.64330	Cadherin (4);Cadherin-like (1);	0.169327	0.42053	D	0.000776	D	0.82986	0.5156	H	0.98388	4.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89649	0.3868	10	0.66056	D	0.02	.	15.0656	0.71992	0.0:0.9319:0.0:0.0681	.	745	Q9NYQ8	FAT2_HUMAN	C	745	ENSP00000261800:G745C	ENSP00000261800:G745C	G	-	1	0	FAT2	150926453	1.000000	0.71417	0.930000	0.37139	0.936000	0.57629	4.888000	0.63164	1.593000	0.50029	0.655000	0.94253	GGT		FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
SLIT3	6586	hgsc.bcm.edu	37	5	168620552	168620552	+	Missense_Mutation	SNP	C	C	T	rs150636880		TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr5:168620552C>T	ENST00000519560.1	-	4	763	c.344G>A	c.(343-345)cGc>cAc	p.R115H	SLIT3_ENST00000521130.1_5'UTR|SLIT3_ENST00000332966.8_Missense_Mutation_p.R115H|SLIT3_ENST00000404867.3_Missense_Mutation_p.R115H	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	115					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.R115H(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTTGTTCAGGCGCCTAAAGAG	0.433																																					p.R115H	Ovarian(29;311 847 10864 17279 24903)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G344A	5						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	120.0	113.0	115.0		344	5.5	1.0	5	dbSNP_134	115	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLIT3	NM_003062.2	29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	115/1524	168620552	2,13004	2203	4300	6503	168553130	SO:0001583	missense	6586	exon4			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.344G>A	5.37:g.168620552C>T	ENSP00000430333:p.Arg115His	Somatic		Capture	SOLID	Phase_I	168553130	NM_003062	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.731929	0.89390	2.27E-4	1.16E-4	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.24538	1.85;1.85;1.85	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000002	T	0.37865	0.1019	N	0.17922	0.545	0.53688	D	0.99997	D;D	0.89917	0.999;1.0	D;D	0.80764	0.984;0.994	T	0.26780	-1.0093	10	0.87932	D	0	.	17.2915	0.87158	0.0:1.0:0.0:0.0	.	115;115	O75094-2;O75094	.;SLIT3_HUMAN	H	115	ENSP00000430333:R115H;ENSP00000332164:R115H;ENSP00000384890:R115H	ENSP00000332164:R115H	R	-	2	0	SLIT3	168553130	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.033000	0.64146	2.752000	0.94435	0.655000	0.94253	CGC		SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
DOCK2	1794	hgsc.bcm.edu	37	5	169461457	169461457	+	Silent	SNP	C	C	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr5:169461457C>T	ENST00000256935.8	+	35	3602	c.3522C>T	c.(3520-3522)ttC>ttT	p.F1174F	DOCK2_ENST00000520908.1_Silent_p.F666F|DOCK2_ENST00000540750.1_Silent_p.F235F|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1174	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.F1174F(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGGAGAACTTCGTGAACCTGG	0.572																																					p.F1174F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3522T	5						.						110.0	104.0	106.0					5																	169461457		2203	4300	6503	169394035	SO:0001819	synonymous_variant	1794	exon35			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3522C>T	5.37:g.169461457C>T		Somatic		Capture	SOLID	Phase_I	169394035	NM_004946	Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	37	CCDS4371.1																																																																																				DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
NIPBL	25836	hgsc.bcm.edu	37	5	37014821	37014821	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr5:37014821A>C	ENST00000282516.8	+	22	5096	c.4597A>C	c.(4597-4599)Aca>Cca	p.T1533P	NIPBL_ENST00000448238.2_Missense_Mutation_p.T1533P	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1533					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.T1533P(2)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CTCTTATGAAACAGCTATGCG	0.318																																					p.T1533P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A4597C	5						.						143.0	153.0	150.0					5																	37014821		2202	4297	6499	37050578	SO:0001583	missense	25836	exon22			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.4597A>C	5.37:g.37014821A>C	ENSP00000282516:p.Thr1533Pro	Somatic		Capture	SOLID	Phase_I	37050578	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	A	19.53	3.844797	0.71603	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.93811	-3.28;-3.29	4.83	3.65	0.41850	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	D	0.94703	0.8291	L	0.55834	1.745	0.53688	D	0.999974	D;D	0.71674	0.997;0.998	P;D	0.67548	0.897;0.952	D	0.93690	0.7006	10	0.51188	T	0.08	.	11.8808	0.52574	0.8535:0.1465:0.0:0.0	.	1533;1533	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	P	1533	ENSP00000282516:T1533P;ENSP00000406266:T1533P	ENSP00000282516:T1533P	T	+	1	0	NIPBL	37050578	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	6.821000	0.75272	0.782000	0.33613	0.482000	0.46254	ACA		NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
NNT	23530	hgsc.bcm.edu	37	5	43656777	43656777	+	Silent	SNP	C	C	A			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr5:43656777C>A	ENST00000264663.5	+	16	2537	c.2316C>A	c.(2314-2316)ctC>ctA	p.L772L	NNT_ENST00000512996.2_Silent_p.L641L|NNT_ENST00000344920.4_Silent_p.L772L	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	772					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)	p.L772L(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					CTGCCCCTCTCCTACTGCCTG	0.448																																					p.L772L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2316A	5						.						164.0	149.0	154.0					5																	43656777		2203	4300	6503	43692534	SO:0001819	synonymous_variant	23530	exon16			U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.2316C>A	5.37:g.43656777C>A		Somatic		Capture	SOLID	Phase_I	43692534	NM_182977	Q16796|Q2TB60|Q8N3V4	Silent	SNP	ENST00000264663.5	37	CCDS3949.1																																																																																				NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977	
ERGIC1	57222	hgsc.bcm.edu	37	5	172324072	172324072	+	Silent	SNP	A	A	C			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr5:172324072A>C	ENST00000393784.3	+	3	289	c.150A>C	c.(148-150)acA>acC	p.T50T	ERGIC1_ENST00000519860.1_3'UTR|ERGIC1_ENST00000523291.1_Silent_p.T50T	NM_001031711.2	NP_001026881.1	Q969X5	ERGI1_HUMAN	endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1	50					ER to Golgi vesicle-mediated transport (GO:0006888)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.T50T(1)		endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)	9	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TTATAACGACAGAAGTGTAAG	0.502																																					p.T50T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A150C	5						.						197.0	159.0	172.0					5																	172324072		2203	4300	6503	172256678	SO:0001819	synonymous_variant	57222	exon3			AF267855	CCDS34292.1	5q35.1	2009-11-06			ENSG00000113719	ENSG00000113719			29205	protein-coding gene	gene with protein product						10574461, 15308636	Standard	NM_001031711		Approved	ERGIC32, ERGIC-32, KIAA1181, NET24	uc003mbw.4	Q969X5	OTTHUMG00000130520	ENST00000393784.3:c.150A>C	5.37:g.172324072A>C		Somatic		Capture	SOLID	Phase_I	172256678	NM_001031711	Q9H0L0|Q9H2J2|Q9ULN9	Silent	SNP	ENST00000393784.3	37	CCDS34292.1																																																																																				ERGIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252938.3	NM_020462	
TIMM44	10469	hgsc.bcm.edu	37	19	7998369	7998369	+	Splice_Site	SNP	C	C	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr19:7998369C>T	ENST00000270538.3	-	7	1038		c.e7+1		TIMM44_ENST00000598968.1_5'Flank	NM_006351.3	NP_006342.2	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44 homolog (yeast)						cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)	p.?(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	17						CCTTCACTCACGGTTAAACAC	0.592																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	19						.						304.0	258.0	274.0					19																	7998369		2203	4300	6503	7904369	SO:0001630	splice_region_variant	10469	.			AF026030	CCDS12192.1	19p13.3-p13.2	2008-07-04				ENSG00000104980			17316	protein-coding gene	gene with protein product		605058				10848612, 10339406	Standard	NM_006351		Approved	TIM44	uc002miz.3	O43615		ENST00000270538.3:c.769+1G>A	19.37:g.7998369C>T		Somatic		Capture	SOLID	Phase_I	7904369	.	A8K0R9|D6W664|Q8N193	Splice_Site	SNP	ENST00000270538.3	37	CCDS12192.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.016199	0.75161	.	.	ENSG00000104980	ENST00000270538	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7709	0.78167	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TIMM44	7904369	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	4.353000	0.59411	2.335000	0.79485	0.561000	0.74099	.		TIMM44-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461596.3		Intron
ZNF826P	664701	hgsc.bcm.edu	37	19	20577613	20577613	+	RNA	SNP	C	C	T			TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3587-01A-01W-0831-10	TCGA-AG-3587-10A-01W-0831-10	g.chr19:20577613C>T	ENST00000502675.1	-	0	1639				MIR1270-2_ENST00000408220.1_RNA	NR_036455.1		Q6ZT77	ZN826_HUMAN	zinc finger protein 826, pseudogene						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(4)	4						GGCTTTGCCACATTCTTCACA	0.358																																					.												.	.	0			.	19						.																																			20369453			664701	.			BC016785		19p12	2010-08-03	2010-08-03	2010-08-03	ENSG00000231205	ENSG00000231205			33875	pseudogene	pseudogene			"""zinc finger protein 826"""	ZNF826			Standard	NR_036455		Approved	FLJ44894	uc021urn.2	Q6ZT77	OTTHUMG00000162773		19.37:g.20577613C>T		Somatic		Capture	SOLID	Phase_I	20369453	.		Missense_Mutation	SNP	ENST00000502675.1	37																																																																																					ZNF826P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000370365.1	NM_001039884	
