#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PPP1R3A	5506	hgsc.bcm.edu	37	7	113518637	113518637	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr7:113518637C>T	ENST00000284601.3	-	4	2578	c.2510G>A	c.(2509-2511)tGt>tAt	p.C837Y		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	837					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.C837Y(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TCCAGTGCCACATTTCTCCCT	0.378																																					p.C837Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2510A	7						.						186.0	167.0	174.0					7																	113518637		2203	4300	6503	113305873	SO:0001583	missense	5506	exon4			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2510G>A	7.37:g.113518637C>T	ENSP00000284601:p.Cys837Tyr	Somatic		Capture	SOLID	Phase_I	113305873	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	C	0.025	-1.382644	0.01204	.	.	ENSG00000154415	ENST00000284601	T	0.15256	2.44	5.92	-10.5	0.00291	.	2.314490	0.01258	N	0.009080	T	0.08358	0.0208	L	0.36672	1.1	0.09310	N	1	B	0.23490	0.086	B	0.19148	0.024	T	0.31724	-0.9933	10	0.06757	T	0.87	-0.2139	3.1724	0.06556	0.2057:0.3157:0.0732:0.4054	.	837	Q16821	PPR3A_HUMAN	Y	837	ENSP00000284601:C837Y	ENSP00000284601:C837Y	C	-	2	0	PPP1R3A	113305873	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.571000	0.05889	-2.070000	0.00881	-1.284000	0.01376	TGT		PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
RAMP3	10268	hgsc.bcm.edu	37	7	45222943	45222943	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr7:45222943G>A	ENST00000242249.4	+	3	417	c.379G>A	c.(379-381)Gtc>Atc	p.V127I	RAMP3_ENST00000496212.1_Missense_Mutation_p.V127I|RAMP3_ENST00000481345.1_Missense_Mutation_p.V127I	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	127					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.V127I(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	CGTTATACCCGTCGTTCTGAC	0.622																																					p.V127I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G379A	7						.						130.0	123.0	125.0					7																	45222943		2203	4300	6503	45189468	SO:0001583	missense	10268	exon3			AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.379G>A	7.37:g.45222943G>A	ENSP00000242249:p.Val127Ile	Somatic		Capture	SOLID	Phase_I	45189468	NM_005856	Q7Z2Y1	Missense_Mutation	SNP	ENST00000242249.4	37	CCDS5503.1	.	.	.	.	.	.	.	.	.	.	G	1.747	-0.490277	0.04322	.	.	ENSG00000122679	ENST00000242249;ENST00000481345;ENST00000496212	T;T;T	0.36520	1.25;1.25;1.25	4.37	-0.78	0.10969	.	0.204202	0.41194	N	0.000935	T	0.16471	0.0396	N	0.11789	0.175	0.09310	N	0.999994	P	0.47841	0.901	B	0.40677	0.337	T	0.36311	-0.9753	10	0.22706	T	0.39	-18.4473	8.6703	0.34145	0.4361:0.0:0.5639:0.0	.	127	O60896	RAMP3_HUMAN	I	127	ENSP00000242249:V127I;ENSP00000419012:V127I;ENSP00000418460:V127I	ENSP00000242249:V127I	V	+	1	0	RAMP3	45189468	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	3.751000	0.55165	-0.608000	0.05731	-0.793000	0.03317	GTC		RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251343.1	NM_005856	
CPSF4	10898	hgsc.bcm.edu	37	7	99051673	99051673	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr7:99051673C>A	ENST00000292476.5	+	7	665	c.655C>A	c.(655-657)Ccg>Acg	p.P219T	ATP5J2-PTCD1_ENST00000437572.1_Intron|CPSF4_ENST00000436336.2_Missense_Mutation_p.P194T|CPSF4_ENST00000441580.1_Missense_Mutation_p.P141T|ATP5J2-PTCD1_ENST00000413834.1_Intron|ATP5J2_ENST00000466753.1_Intron|CPSF4_ENST00000451876.1_Missense_Mutation_p.P161T|PTCD1_ENST00000555673.1_Intron			O95639	CPSF4_HUMAN	cleavage and polyadenylation specific factor 4, 30kDa	219					modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA processing (GO:0006397)|viral life cycle (GO:0019058)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P219T(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(5)	14	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					GCAGAGAACCCCGCAGGTCAT	0.557																																					p.P194T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C580A	7						.						155.0	168.0	163.0					7																	99051673		2203	4300	6503	98889609	SO:0001583	missense	10898	exon7				CCDS5664.1, CCDS47652.1	7q22	2007-10-18	2002-08-29		ENSG00000160917	ENSG00000160917			2327	protein-coding gene	gene with protein product		603052	"""cleavage and polyadenylation specific factor 4, 30kD subunit"""			9651582, 9224719	Standard	NM_006693		Approved	NAR, CPSF30	uc003uqj.3	O95639	OTTHUMG00000154599	ENST00000292476.5:c.655C>A	7.37:g.99051673C>A	ENSP00000292476:p.Pro219Thr	Somatic		Capture	SOLID	Phase_I	98889609	NM_001081559	D6W5S8|Q6FGE6|Q86TF8|Q9BTW6	Missense_Mutation	SNP	ENST00000292476.5	37	CCDS5664.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.98|14.98	2.697344|2.697344	0.48202|0.48202	.|.	.|.	ENSG00000160917|ENSG00000160917	ENST00000440514|ENST00000436336;ENST00000451876;ENST00000292476;ENST00000441580	.|T;T;T;T	.|0.29655	.|1.98;1.93;1.94;1.56	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	0.151008|0.151008	0.64402|0.64402	D|D	0.000014|0.000014	T|T	0.24661|0.24661	0.0598|0.0598	L|L	0.27053|0.27053	0.805|0.805	0.58432|0.58432	D|D	0.999994|0.999994	.|B;B;B;B	.|0.06786	.|0.0;0.001;0.001;0.001	.|B;B;B;B	.|0.08055	.|0.0;0.001;0.003;0.001	T|T	0.07424|0.07424	-1.0773|-1.0773	6|10	.|0.14656	.|T	.|0.56	-14.7418|-14.7418	19.7534|19.7534	0.96277|0.96277	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|141;193;219;194	.|B7Z7B0;O95639-3;O95639;O95639-2	.|.;.;CPSF4_HUMAN;.	H|T	100|194;161;219;141	.|ENSP00000395311:P194T;ENSP00000396060:P161T;ENSP00000292476:P219T;ENSP00000402224:P141T	.|ENSP00000292476:P219T	P|P	+|+	2|1	0|0	CPSF4|CPSF4	98889609|98889609	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.841000|0.841000	0.47740|0.47740	5.076000|5.076000	0.64413|0.64413	2.686000|2.686000	0.91538|0.91538	0.655000|0.655000	0.94253|0.94253	CCC|CCG		CPSF4-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336254.1		
ESYT2	57488	hgsc.bcm.edu	37	7	158528258	158528258	+	Missense_Mutation	SNP	G	G	A	rs145653899	byFrequency	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr7:158528258G>A	ENST00000251527.5	-	20	2587	c.2522C>T	c.(2521-2523)aCg>aTg	p.T841M	ESYT2_ENST00000435514.2_Missense_Mutation_p.T276M	NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	869	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)	p.T841M(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						AACGTCGAGCGTTCTCCTCTG	0.458																																					p.T841M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2522T	7						.		MET/THR	0,4406		0,0,2203	147.0	152.0	150.0		2522	5.6	0.9	7	dbSNP_134	150	3,8597	3.0+/-9.4	0,3,4297	yes	missense	ESYT2	NM_020728.2	81	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging	841/894	158528258	3,13003	2203	4300	6503	158221019	SO:0001583	missense	57488	exon20			AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.2522C>T	7.37:g.158528258G>A	ENSP00000251527:p.Thr841Met	Somatic		Capture	SOLID	Phase_I	158221019	NM_020728	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Missense_Mutation	SNP	ENST00000251527.5	37	CCDS34791.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.519471	0.44866	0.0	3.49E-4	ENSG00000117868	ENST00000251527;ENST00000421679;ENST00000275418;ENST00000435514	T;T;T	0.09073	3.02;3.02;3.02	5.59	5.59	0.84812	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.048174	0.85682	D	0.000000	T	0.26521	0.0648	L	0.54965	1.715	0.58432	D	0.999999	D;D	0.89917	1.0;0.957	D;P	0.97110	1.0;0.735	T	0.00086	-1.2094	10	0.48119	T	0.1	-17.4245	18.5774	0.91159	0.0:0.0:1.0:0.0	.	841;869	A0FGR8-2;A0FGR8	.;ESYT2_HUMAN	M	841;890;832;276	ENSP00000251527:T841M;ENSP00000275418:T832M;ENSP00000411488:T276M	ENSP00000251527:T841M	T	-	2	0	ESYT2	158221019	1.000000	0.71417	0.853000	0.33588	0.007000	0.05969	6.189000	0.72051	2.639000	0.89480	0.655000	0.94253	ACG		ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322647.1	NM_020728	
OR7A10	390892	hgsc.bcm.edu	37	19	14952078	14952078	+	Silent	SNP	C	C	T			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr19:14952078C>T	ENST00000248058.1	-	1	611	c.612G>A	c.(610-612)gcG>gcA	p.A204A		NM_001005190.1	NP_001005190.1	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A, member 10	204						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A204A(1)		NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|stomach(1)	19	Ovarian(108;0.203)					CGCCCAGCAGCGCTACTGCAA	0.453																																					p.A204A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G612A	19						.						61.0	59.0	60.0					19																	14952078		2203	4300	6503	14813078	SO:0001819	synonymous_variant	390892	exon1				CCDS32936.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8356	protein-coding gene	gene with protein product							Standard	NM_001005190		Approved		uc002mzx.1	O76100		ENST00000248058.1:c.612G>A	19.37:g.14952078C>T		Somatic		Capture	SOLID	Phase_I	14813078	NM_001005190	Q6IFP0|Q96R97	Silent	SNP	ENST00000248058.1	37	CCDS32936.1																																																																																				OR7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466520.1	NM_001005190	
FUT3	2525	hgsc.bcm.edu	37	19	5844699	5844699	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr19:5844699G>T	ENST00000303225.6	-	3	786	c.152C>A	c.(151-153)tCc>tAc	p.S51Y	FUT3_ENST00000589620.1_Missense_Mutation_p.S51Y|AC024592.9_ENST00000589276.1_RNA|FUT3_ENST00000593144.1_5'Flank|FUT3_ENST00000589918.1_Missense_Mutation_p.S51Y|FUT3_ENST00000458379.2_Missense_Mutation_p.S51Y	NM_000149.3	NP_000140	P21217	FUT3_HUMAN	fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)	51					cell-cell recognition (GO:0009988)|fucosylation (GO:0036065)|macromolecule glycosylation (GO:0043413)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)	p.S51Y(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						CTGTCGGGAGGACCCACTGGG	0.617																																					p.S51Y	Esophageal Squamous(82;745 1728 24593 44831)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C152A	19						.						21.0	23.0	22.0					19																	5844699		2202	4300	6502	5795699	SO:0001583	missense	2525	exon3				CCDS12153.1	19p13.3	2014-07-19	2006-01-12		ENSG00000171124	ENSG00000171124	2.4.1.65	"""CD molecules"", ""Blood group antigens"", ""Fucosyltransferases"""	4014	protein-coding gene	gene with protein product		111100	"""fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group included)"""	LE		1977660, 1740457	Standard	NM_000149		Approved	CD174	uc002mdk.2	P21217	OTTHUMG00000180614	ENST00000303225.6:c.152C>A	19.37:g.5844699G>T	ENSP00000305603:p.Ser51Tyr	Somatic		Capture	SOLID	Phase_I	5795699	NM_001097640	B5U7U9|B5U7V0|Q32NE7|Q99448|Q99449	Missense_Mutation	SNP	ENST00000303225.6	37	CCDS12153.1	.	.	.	.	.	.	.	.	.	.	G	13.30	2.196260	0.38806	.	.	ENSG00000171124	ENST00000303225;ENST00000458379	T;T	0.25250	1.81;1.81	2.33	-0.0794	0.13710	.	1.508160	0.04406	N	0.365254	T	0.40619	0.1124	M	0.61703	1.905	0.09310	N	1	D;D;D;D	0.67145	0.98;0.996;0.98;0.996	P;D;P;D	0.65573	0.873;0.936;0.752;0.936	T	0.31696	-0.9934	10	0.21014	T	0.42	.	4.0367	0.09733	0.1522:0.0:0.6139:0.2339	.	51;51;51;51	B3W6H0;A8K737;B3GVC1;P21217	.;.;.;FUT3_HUMAN	Y	51	ENSP00000305603:S51Y;ENSP00000416443:S51Y	ENSP00000305603:S51Y	S	-	2	0	FUT3	5795699	0.000000	0.05858	0.000000	0.03702	0.152000	0.21847	0.435000	0.21510	0.221000	0.20879	0.205000	0.17691	TCC		FUT3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452204.1	NM_000149	
ZNF91	7644	hgsc.bcm.edu	37	19	23556605	23556605	+	Silent	SNP	A	A	G	rs34740519	byFrequency	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr19:23556605A>G	ENST00000300619.7	-	3	397	c.192T>C	c.(190-192)taT>taC	p.Y64Y	ZNF91_ENST00000397082.2_Intron|ZNF91_ENST00000599743.1_Silent_p.Y64Y	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	64	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.Y64Y(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				CTTGCTCCAGATAAGTAATCA	0.418													A|||	19	0.00379393	0.0	0.0014	5008	,	,		14427	0.0		0.0179	False		,,,				2504	0.0				p.Y64Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T192C	19						.	A		18,4386	24.3+/-50.5	0,18,2184	88.0	92.0	91.0		192	0.2	0.0	19	dbSNP_126	91	115,8483	61.3+/-123.2	1,113,4185	no	coding-synonymous	ZNF91	NM_003430.2		1,131,6369	GG,GA,AA		1.3375,0.4087,1.0229		64/1192	23556605	133,12869	2202	4299	6501	23348445	SO:0001819	synonymous_variant	7644	exon3			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.192T>C	19.37:g.23556605A>G		Somatic		Capture	SOLID	Phase_I	23348445	NM_003430	A8K5E1|B7Z6G6	Silent	SNP	ENST00000300619.7	37	CCDS42541.1																																																																																				ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
FCRL5	83416	hgsc.bcm.edu	37	1	157490846	157490846	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr1:157490846C>T	ENST00000361835.3	-	11	2633	c.2476G>A	c.(2476-2478)Ggg>Agg	p.G826R	FCRL5_ENST00000461387.1_5'UTR|FCRL5_ENST00000356953.4_Missense_Mutation_p.G826R	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	826	Ig-like C2-type 8.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)		p.G826R(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CGCTGGGCCCCGAGGCCATTG	0.567																																					p.G826R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2476A	1						.						58.0	65.0	63.0					1																	157490846		2203	4300	6503	155757470	SO:0001583	missense	83416	exon11			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.2476G>A	1.37:g.157490846C>T	ENSP00000354691:p.Gly826Arg	Somatic		Capture	SOLID	Phase_I	155757470	NM_031281	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	37	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	C	11.42	1.633977	0.29068	.	.	ENSG00000143297	ENST00000361835;ENST00000356953	T;T	0.14766	2.48;2.48	5.25	2.26	0.28386	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.23649	0.0572	H	0.99336	4.52	0.09310	N	0.999996	D;D	0.60160	0.972;0.987	B;P	0.48677	0.422;0.586	T	0.29119	-1.0022	9	0.87932	D	0	.	5.3179	0.15866	0.3625:0.5416:0.0:0.0959	.	826;826	A6NJE8;Q96RD9	.;FCRL5_HUMAN	R	826	ENSP00000354691:G826R;ENSP00000349434:G826R	ENSP00000349434:G826R	G	-	1	0	FCRL5	155757470	0.006000	0.16342	0.013000	0.15412	0.163000	0.22366	1.216000	0.32443	0.316000	0.23135	-0.188000	0.12872	GGG		FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281	
HHIPL2	79802	hgsc.bcm.edu	37	1	222697016	222697016	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr1:222697016C>T	ENST00000343410.6	-	8	1884	c.1826G>A	c.(1825-1827)tGc>tAc	p.C609Y	HHIPL2_ENST00000473144.1_5'UTR	NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	609					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)	p.C609Y(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		CTTGTATTTGCACTTGCCTGG	0.517																																					p.C609Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1826A	1						.						165.0	140.0	148.0					1																	222697016		2203	4300	6503	220763639	SO:0001583	missense	79802	exon8			BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1826G>A	1.37:g.222697016C>T	ENSP00000342118:p.Cys609Tyr	Somatic		Capture	SOLID	Phase_I	220763639	NM_024746	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	37	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	C	20.6	4.019298	0.75275	.	.	ENSG00000143512	ENST00000343410	T	0.20200	2.09	5.19	5.19	0.71726	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.49745	0.1575	M	0.81942	2.565	0.80722	D	1	D	0.71674	0.998	D	0.67231	0.95	T	0.55988	-0.8053	10	0.87932	D	0	-10.1453	18.3105	0.90197	0.0:1.0:0.0:0.0	.	609	Q6UWX4	HIPL2_HUMAN	Y	609	ENSP00000342118:C609Y	ENSP00000342118:C609Y	C	-	2	0	HHIPL2	220763639	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	6.463000	0.73530	2.397000	0.81536	0.655000	0.94253	TGC		HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746	
TXNDC12	51060	hgsc.bcm.edu	37	1	52490196	52490196	+	Missense_Mutation	SNP	C	C	T	rs138944221		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr1:52490196C>T	ENST00000371626.4	-	5	1415	c.341G>A	c.(340-342)cGa>cAa	p.R114Q	TXNDC12_ENST00000471493.1_5'UTR	NM_015913.3	NP_056997.1	O95881	TXD12_HUMAN	thioredoxin domain containing 12 (endoplasmic reticulum)	114					cell redox homeostasis (GO:0045454)	endoplasmic reticulum (GO:0005783)	protein-disulfide reductase (glutathione) activity (GO:0019153)	p.R114Q(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	7					Glutathione(DB00143)	AAAAAGGATTCGTGGAATATA	0.413																																					p.R114Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G341A	1						.	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	96.0	89.0	92.0		341	5.5	1.0	1	dbSNP_134	92	0,8600		0,0,4300	no	missense	TXNDC12	NM_015913.2	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	114/173	52490196	1,13005	2203	4300	6503	52262784	SO:0001583	missense	51060	exon5			AF131758	CCDS561.1	1p32.3	2011-10-19			ENSG00000117862	ENSG00000117862		"""Protein disulfide isomerases"""	24626	protein-coding gene	gene with protein product	"""endoplasmic reticulum thioredoxin superfamily member, 18 kDa"", ""anterior gradient homolog 1 (Xenopus laevis)"", ""protein disulfide isomerase family A, member 16"""	609448				8619474, 9110174	Standard	NM_015913		Approved	TLP19, ERP18, ERP19, hAG-1, AGR1, PDIA16	uc001cti.4	O95881	OTTHUMG00000008629	ENST00000371626.4:c.341G>A	1.37:g.52490196C>T	ENSP00000360688:p.Arg114Gln	Somatic		Capture	SOLID	Phase_I	52262784	NM_015913	B3KQS0|Q5T1T4|Q96H50	Missense_Mutation	SNP	ENST00000371626.4	37	CCDS561.1	.	.	.	.	.	.	.	.	.	.	C	32	5.186878	0.94923	2.27E-4	0.0	ENSG00000117862	ENST00000371626	T	0.54675	0.56	5.46	5.46	0.80206	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.000000	0.85682	D	0.000000	T	0.71753	0.3377	M	0.71581	2.175	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.70004	-0.4991	10	0.37606	T	0.19	.	17.4958	0.87717	0.0:1.0:0.0:0.0	.	114	O95881	TXD12_HUMAN	Q	114	ENSP00000360688:R114Q	ENSP00000360688:R114Q	R	-	2	0	TXNDC12	52262784	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.215000	0.72206	2.550000	0.86006	0.655000	0.94253	CGA		TXNDC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023818.1	NM_015913	
KIAA1804	84451	hgsc.bcm.edu	37	1	233497916	233497916	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr1:233497916C>T	ENST00000366624.3	+	5	1690	c.1429C>T	c.(1429-1431)Cgg>Tgg	p.R477W	MLK4_ENST00000366623.3_Missense_Mutation_p.R477W	NM_032435.2	NP_115811.2												p.R477W(2)									CGTGCTGGAGCGGGAACTTAA	0.532																																					p.R477W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1429T	1						.						64.0	62.0	62.0					1																	233497916		2203	4300	6503	231564539	SO:0001583	missense	84451	exon5																														ENST00000366624.3:c.1429C>T	1.37:g.233497916C>T	ENSP00000355583:p.Arg477Trp	Somatic		Capture	SOLID	Phase_I	231564539	NM_032435		Missense_Mutation	SNP	ENST00000366624.3	37	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455729	0.84209	.	.	ENSG00000143674	ENST00000366623;ENST00000366624	T;T	0.12774	2.65;2.65	4.88	4.88	0.63580	.	0.000000	0.64402	D	0.000001	T	0.40145	0.1105	M	0.80183	2.485	0.80722	D	1	D;D	0.71674	0.998;0.971	D;P	0.66351	0.943;0.823	T	0.37502	-0.9703	10	0.66056	D	0.02	.	18.2298	0.89931	0.0:1.0:0.0:0.0	.	477;477	Q5TCX8;Q5TCX8-2	M3KL4_HUMAN;.	W	477	ENSP00000355582:R477W;ENSP00000355583:R477W	ENSP00000355582:R477W	R	+	1	2	RP5-862P8.2	231564539	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	3.760000	0.55235	2.525000	0.85131	0.655000	0.94253	CGG		MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
ALDH8A1	64577	hgsc.bcm.edu	37	6	135260508	135260508	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr6:135260508C>T	ENST00000265605.2	-	4	556	c.488G>A	c.(487-489)tGg>tAg	p.W163*	ALDH8A1_ENST00000367847.2_Intron|ALDH8A1_ENST00000367845.2_Nonsense_Mutation_p.W163*|RP11-349J5.2_ENST00000416448.2_RNA	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	163					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)	p.W163*(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		AGCTATCTTCCAGGTCAGCAA	0.542																																					p.W163X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G488A	6						.						95.0	83.0	88.0					6																	135260508		2203	4300	6503	135302201	SO:0001587	stop_gained	64577	exon4			AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.488G>A	6.37:g.135260508C>T	ENSP00000265605:p.Trp163*	Somatic		Capture	SOLID	Phase_I	135302201	NM_170771	B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Nonsense_Mutation	SNP	ENST00000265605.2	37	CCDS5171.1	.	.	.	.	.	.	.	.	.	.	C	37	6.225861	0.97394	.	.	ENSG00000118514	ENST00000265605;ENST00000367845	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.2831	0.94060	0.0:1.0:0.0:0.0	.	.	.	.	X	163	.	ENSP00000265605:W163X	W	-	2	0	ALDH8A1	135302201	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.818000	0.86416	2.548000	0.85928	0.563000	0.77884	TGG		ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2		
TTLL2	83887	hgsc.bcm.edu	37	6	167753657	167753657	+	Missense_Mutation	SNP	G	G	A	rs553495918		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr6:167753657G>A	ENST00000239587.5	+	3	357	c.269G>A	c.(268-270)cGc>cAc	p.R90H		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	90	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)	p.R90H(1)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		CTGGTTTTTCGCGTTGACGAG	0.522													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19861	0.0		0.0	False		,,,				2504	0.0				p.R90H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G269A	6						.						51.0	52.0	51.0					6																	167753657		2203	4300	6503	167673647	SO:0001583	missense	83887	exon3			AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.269G>A	6.37:g.167753657G>A	ENSP00000239587:p.Arg90His	Somatic		Capture	SOLID	Phase_I	167673647	NM_031949	B2RB11|B3KS77|Q7Z6R8|Q86X22	Missense_Mutation	SNP	ENST00000239587.5	37	CCDS5301.1	.	.	.	.	.	.	.	.	.	.	G	11.30	1.598208	0.28445	.	.	ENSG00000120440	ENST00000239587;ENST00000540954	T	0.02763	4.17	3.37	-0.717	0.11208	.	0.282248	0.26582	N	0.023563	T	0.00784	0.0026	L	0.53617	1.68	0.09310	N	1	P	0.43750	0.816	B	0.29524	0.103	T	0.50874	-0.8776	10	0.72032	D	0.01	.	5.1128	0.14819	0.2806:0.15:0.5694:0.0	.	90	Q9BWV7	TTLL2_HUMAN	H	90;17	ENSP00000239587:R90H	ENSP00000239587:R90H	R	+	2	0	TTLL2	167673647	0.009000	0.17119	0.002000	0.10522	0.008000	0.06430	1.134000	0.31442	-0.319000	0.08652	0.484000	0.47621	CGC		TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043127.3	NM_031949	
MYH1	4619	hgsc.bcm.edu	37	17	10409146	10409146	+	Silent	SNP	A	A	G			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr17:10409146A>G	ENST00000226207.5	-	19	2251	c.2157T>C	c.(2155-2157)taT>taC	p.Y719Y	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	719	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.Y719Y(2)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TGAAGTCTGCATAAAGGATTC	0.408																																					p.Y719Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T2157C	17						.						53.0	50.0	51.0					17																	10409146		2203	4300	6503	10349871	SO:0001819	synonymous_variant	4619	exon19				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2157T>C	17.37:g.10409146A>G		Somatic		Capture	SOLID	Phase_I	10349871	NM_005963	Q14CA4|Q9Y622	Silent	SNP	ENST00000226207.5	37	CCDS11155.1																																																																																				MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
MAP2K3	5606	hgsc.bcm.edu	37	17	21205470	21205470	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr17:21205470T>A	ENST00000342679.4	+	6	664	c.415T>A	c.(415-417)Tgc>Agc	p.C139S	MAP2K3_ENST00000361818.5_Missense_Mutation_p.C110S|MAP2K3_ENST00000316920.6_Missense_Mutation_p.C110S	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	139	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.C143S(1)							COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CGTGTGGATCTGCATGGAGCT	0.587																																					p.C110S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T328A	17						.						120.0	95.0	104.0					17																	21205470		2203	4300	6503	21146063	SO:0001583	missense	5606	exon6			L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.415T>A	17.37:g.21205470T>A	ENSP00000345083:p.Cys139Ser	Somatic		Capture	SOLID	Phase_I	21146063	NM_002756	B3KSK7|Q99441|Q9UE71|Q9UE72	Missense_Mutation	SNP	ENST00000342679.4	37	CCDS11217.1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.689565	0.48097	.	.	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000526076;ENST00000316920	T;T;T	0.64991	1.12;1.12;-0.13	5.17	5.17	0.71159	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.56140	0.1965	L	0.36672	1.1	0.80722	D	1	B	0.23377	0.084	B	0.28139	0.086	T	0.57670	-0.7771	10	0.87932	D	0	-30.6155	15.046	0.71827	0.0:0.0:0.0:1.0	.	139	P46734	MP2K3_HUMAN	S	139;110;110;110;143	ENSP00000345083:C139S;ENSP00000355081:C110S;ENSP00000434068:C110S	ENSP00000319139:C143S	C	+	1	0	MAP2K3	21146063	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.947000	0.87758	1.942000	0.56320	0.533000	0.62120	TGC		MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	NM_145109	
TP53	7157	hgsc.bcm.edu	37	17	7578470	7578470	+	Missense_Mutation	SNP	C	C	A	rs137852790|rs137852791|rs137852789		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr17:7578470C>A	ENST00000269305.4	-	5	649	c.460G>T	c.(460-462)Ggc>Tgc	p.G154C	TP53_ENST00000445888.2_Missense_Mutation_p.G154C|TP53_ENST00000359597.4_Missense_Mutation_p.G154C|TP53_ENST00000413465.2_Missense_Mutation_p.G154C|TP53_ENST00000455263.2_Missense_Mutation_p.G154C|TP53_ENST00000420246.2_Missense_Mutation_p.G154C|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	154	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in a sporadic cancer; somatic mutation).|G -> D (in sporadic cancers; somatic mutation).|G -> I (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> S (in sporadic cancers; somatic mutation).|G -> V (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G154S(9)|p.0?(8)|p.T150fs*16(6)|p.?(5)|p.P152fs*14(5)|p.G154C(4)|p.G154I(3)|p.G154fs*14(2)|p.P153fs*26(2)|p.P153fs*22(2)|p.G154fs*27(2)|p.P151_V173del23(1)|p.G154_R156delGTR(1)|p.G22C(1)|p.Q144_G154del11(1)|p.T57fs*16(1)|p.D148_T155delDSTPPPGT(1)|p.D148fs*23(1)|p.G61C(1)|p.S149fs*72(1)|p.G154fs*22(1)|p.Q144fs*16(1)|p.P153_G154insX(1)|p.T18fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACGCGGGTGCCGGGCGGGGGT	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.G154C	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,lung,NS,Substitution - Missense,+1	.	61	Deletion - Frameshift(23)|Substitution - Missense(18)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(4)|Insertion - Frameshift(2)|Insertion - In frame(1)	large_intestine(9)|stomach(8)|skin(8)|ovary(8)|oesophagus(5)|lung(4)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|liver(2)|cervix(1)|soft_tissue(1)|urinary_tract(1)|pancreas(1)	c.G460T	17	GRCh37	CD090894	TP53	D	rs137852789	.						50.0	51.0	51.0					17																	7578470		2203	4300	6503	7519195	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.460G>T	17.37:g.7578470C>A	ENSP00000269305:p.Gly154Cys	Somatic		Capture	SOLID	Phase_I	7519195	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.616540	0.46736	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99901	-7.65;-7.65;-7.65;-7.65;-7.65;-7.65;-7.65;-7.65;-7.65	5.59	3.61	0.41365	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.158634	0.56097	D	0.000036	D	0.99878	0.9942	M	0.90759	3.145	0.53688	D	0.999978	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.996;0.997;0.95;0.995;0.999;0.996;0.998	D	0.96970	0.9708	10	0.87932	D	0	-10.7989	10.674	0.45774	0.0:0.8435:0.0:0.1565	.	115;154;154;61;154;154;154	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	154;154;154;154;154;154;143;61;22;61;22;154	ENSP00000410739:G154C;ENSP00000352610:G154C;ENSP00000269305:G154C;ENSP00000398846:G154C;ENSP00000391127:G154C;ENSP00000391478:G154C;ENSP00000425104:G22C;ENSP00000423862:G61C;ENSP00000424104:G154C	ENSP00000269305:G154C	G	-	1	0	TP53	7519195	0.990000	0.36364	0.002000	0.10522	0.004000	0.04260	4.065000	0.57513	0.846000	0.35142	0.655000	0.94253	GGC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MED24	9862	hgsc.bcm.edu	37	17	38178692	38178692	+	Silent	SNP	T	T	G			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr17:38178692T>G	ENST00000394128.2	-	22	2559	c.2478A>C	c.(2476-2478)ggA>ggC	p.G826G	MED24_ENST00000501516.3_Silent_p.G845G|MED24_ENST00000394126.1_Silent_p.G851G|MED24_ENST00000356271.3_Silent_p.G813G|MED24_ENST00000394127.2_Silent_p.G813G	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	826					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.G826G(1)		autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					TGGACGCCTGTCCCTTGTGGG	0.602																																					p.G813G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2439C	17						.						43.0	40.0	41.0					17																	38178692		2203	4300	6503	35432218	SO:0001819	synonymous_variant	9862	exon21			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.2478A>C	17.37:g.38178692T>G		Somatic		Capture	SOLID	Phase_I	35432218	NM_001079518	A8K4S5|B3KMR9|Q14143|Q9NNY5	Silent	SNP	ENST00000394128.2	37	CCDS11359.1	.	.	.	.	.	.	.	.	.	.	T	9.097	1.003102	0.19121	.	.	ENSG00000008838	ENST00000422942	.	.	.	5.33	-9.94	0.00449	.	.	.	.	.	T	0.33789	0.0875	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42241	-0.9463	4	.	.	.	-6.4149	2.512	0.04659	0.1516:0.2535:0.3677:0.2273	.	.	.	.	P	81	.	.	T	-	1	0	MED24	35432218	0.009000	0.17119	0.848000	0.33437	0.656000	0.38851	-1.221000	0.02968	-1.527000	0.01758	-0.261000	0.10672	ACA		MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	
RNF213	57674	hgsc.bcm.edu	37	17	78268655	78268655	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr17:78268655C>G	ENST00000582970.1	+	9	1751	c.1608C>G	c.(1606-1608)agC>agG	p.S536R	RNF213_ENST00000456466.1_Missense_Mutation_p.S536R|RNF213_ENST00000508628.2_Missense_Mutation_p.S585R|RNF213_ENST00000319921.4_Missense_Mutation_p.S536R	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	536					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S585R(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TGCTGGACAGCACCTTCAGCA	0.537																																					p.S536R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1608G	17						.						109.0	99.0	102.0					17																	78268655		2203	4300	6503	75883250	SO:0001583	missense	57714	exon9			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.1608C>G	17.37:g.78268655C>G	ENSP00000464087:p.Ser536Arg	Somatic		Capture	SOLID	Phase_I	75883250	NM_020954	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	c	3.116	-0.181581	0.06340	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466;ENST00000319921	.	.	.	5.03	0.172	0.15031	.	0.753181	0.11927	N	0.516118	T	0.16811	0.0404	N	0.17674	0.51	0.28672	N	0.905597	B;B	0.11235	0.003;0.004	B;B	0.10450	0.003;0.005	T	0.23476	-1.0187	9	0.20519	T	0.43	-10.6944	0.48	0.00546	0.1816:0.2885:0.1776:0.3523	.	536;536	Q9HCF4;Q9HCF4-2	ALO17_HUMAN;.	R	536;585;536;536	.	ENSP00000324392:S536R	S	+	3	2	RNF213	75883250	0.001000	0.12720	0.480000	0.27341	0.073000	0.16967	-0.337000	0.07852	0.151000	0.19162	0.457000	0.33378	AGC		RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
TRPM2	7226	hgsc.bcm.edu	37	21	45855080	45855080	+	Silent	SNP	G	G	A			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr21:45855080G>A	ENST00000397928.1	+	28	4486	c.4041G>A	c.(4039-4041)acG>acA	p.T1347T	TRPM2_ENST00000397932.2_Silent_p.T1397T|TRPM2_ENST00000300482.5_Silent_p.T1347T|TRPM2_ENST00000300481.9_Silent_p.T1293T|snoZ6_ENST00000581669.1_RNA|TRPM2_ENST00000498430.1_3'UTR	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	1347			T -> M (in dbSNP:rs45589233). {ECO:0000269|Ref.6}.		calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)	p.T1347T(1)		breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CCAACCACACGCTGTACCCCA	0.662																																					p.T1347T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4041A	21						.						81.0	70.0	74.0					21																	45855080		2203	4300	6503	44679508	SO:0001819	synonymous_variant	7226	exon28			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.4041G>A	21.37:g.45855080G>A		Somatic		Capture	SOLID	Phase_I	44679508	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Silent	SNP	ENST00000397928.1	37	CCDS13710.1																																																																																				TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
PLK1	5347	hgsc.bcm.edu	37	16	23702270	23702270	+	IGR	SNP	C	C	T	rs377283392		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr16:23702270C>T	ENST00000300093.4	+	0	2227				ERN2_ENST00000256797.4_Missense_Mutation_p.R936Q|CTD-2196E14.5_ENST00000566143.1_RNA|ERN2_ENST00000457008.2_Missense_Mutation_p.R836Q	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1						activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.R936Q(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		GAGGAGCAGCCGTGGGAAGCG	0.627																																					p.R936Q	Colon(12;240 564 27038 33155)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2807A	16						.						68.0	66.0	66.0					16																	23702270		2197	4300	6497	23609771	SO:0001628	intergenic_variant	10595	exon22				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984		16.37:g.23702270C>T		Somatic		Capture	SOLID	Phase_I	23609771	NM_033266	Q15153|Q99746	Missense_Mutation	SNP	ENST00000300093.4	37	CCDS10616.1	.	.	.	.	.	.	.	.	.	.	C	4.439	0.081159	0.08533	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.29142	1.58;1.58	5.22	-3.28	0.05033	.	0.708209	0.13566	N	0.378434	T	0.14527	0.0351	L	0.28458	0.855	0.22601	N	0.998946	B;B	0.26081	0.141;0.023	B;B	0.19666	0.013;0.026	T	0.25572	-1.0128	10	0.18276	T	0.48	.	4.4086	0.11421	0.24:0.3856:0.0:0.3743	.	836;888	E7ETG2;A5YM65	.;.	Q	936;836	ENSP00000256797:R936Q;ENSP00000413812:R836Q	ENSP00000256797:R936Q	R	-	2	0	ERN2	23609771	0.000000	0.05858	0.028000	0.17463	0.007000	0.05969	-0.248000	0.08854	-0.173000	0.10761	-1.332000	0.01269	CGG		PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214057.2	NM_005030	
CDYL2	124359	hgsc.bcm.edu	37	16	80654809	80654809	+	Silent	SNP	C	C	T	rs200676958		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr16:80654809C>T	ENST00000570137.2	-	4	1013	c.858G>A	c.(856-858)gcG>gcA	p.A286A	CDYL2_ENST00000563890.1_Silent_p.A287A|CDYL2_ENST00000566173.1_Silent_p.A287A|CDYL2_ENST00000562812.1_Silent_p.A287A	NM_152342.2	NP_689555.2	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	286						nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.A286A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	21						CGTTGCAGAGCGCTCGCCGGA	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		17985	0.0		0.0	False		,,,				2504	0.001				p.A286A												CDYL2,central_nervous_system,brain,Substitution - Missense,-1	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G858A	16						.	C		0,4406		0,0,2203	48.0	43.0	44.0		858	-10.6	0.2	16		44	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CDYL2	NM_152342.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		286/507	80654809	1,13005	2203	4300	6503	79212310	SO:0001819	synonymous_variant	124359	exon4			AK096185	CCDS32493.1	16q23.2	2008-02-05	2003-09-12			ENSG00000166446			23030	protein-coding gene	gene with protein product			"""chromodomain Y-like protein 2"""			12837688	Standard	NM_152342		Approved	FLJ38866	uc002ffs.3	Q8N8U2		ENST00000570137.2:c.858G>A	16.37:g.80654809C>T		Somatic		Capture	SOLID	Phase_I	79212310	NM_152342	Q7Z5I8	Silent	SNP	ENST00000570137.2	37	CCDS32493.1																																																																																				CDYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434727.2	NM_152342	
SERPINB4	6318	hgsc.bcm.edu	37	18	61305192	61305192	+	Missense_Mutation	SNP	C	C	T	rs201095674		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr18:61305192C>T	ENST00000341074.5	-	8	1049	c.934G>A	c.(934-936)Gca>Aca	p.A312T	SERPINB4_ENST00000356424.6_Missense_Mutation_p.A260T	NM_002974.2	NP_002965.1	P48594	SPB4_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 4	312					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.A312T(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	42						GAGAGGTCTGCATCCCCATTG	0.498																																					p.A312T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G934A	18						.						174.0	152.0	159.0					18																	61305192		2203	4300	6503	59456172	SO:0001583	missense	6318	exon8			X89015	CCDS11986.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206073	ENSG00000206073		"""Serine (or cysteine) peptidase inhibitors"""	10570	protein-coding gene	gene with protein product	"""squamous cell carcinoma antigen 2"""	600518	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4"""	SCCA2		7724531, 14630915, 24172014	Standard	NM_175041		Approved	PI11, LEUPIN, SCCA-2, SCCA1		P48594	OTTHUMG00000060405	ENST00000341074.5:c.934G>A	18.37:g.61305192C>T	ENSP00000343445:p.Ala312Thr	Somatic		Capture	SOLID	Phase_I	59456172	NM_002974	A8K847	Missense_Mutation	SNP	ENST00000341074.5	37	CCDS11986.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.3|22.3	4.275341|4.275341	0.80580|0.80580	.|.	.|.	ENSG00000206073|ENSG00000206073	ENST00000341074;ENST00000356424|ENST00000413673	D;D|.	0.87256|.	-2.23;-2.23|.	4.41|4.41	4.41|4.41	0.53225|0.53225	Serpin domain (3);|.	0.173238|.	0.27518|.	N|.	0.019005|.	T|T	0.81341|0.81341	0.4802|0.4802	M|M	0.90483|0.90483	3.12|3.12	0.35153|0.35153	D|D	0.769983|0.769983	D;D;D|.	0.71674|.	0.998;0.998;0.998|.	D;D;D|.	0.67382|.	0.935;0.935;0.951|.	D|D	0.89058|0.89058	0.3460|0.3460	10|5	0.87932|.	D|.	0|.	.|.	16.5216|16.5216	0.84318|0.84318	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	312;312;291|.	Q5K684;P48594;Q9BYF7|.	.;SPB4_HUMAN;.|.	T|I	312;260|292	ENSP00000343445:A312T;ENSP00000348795:A260T|.	ENSP00000343445:A312T|.	A|M	-|-	1|3	0|0	SERPINB4|SERPINB4	59456172|59456172	0.423000|0.423000	0.25482|0.25482	0.281000|0.281000	0.24762|0.24762	0.122000|0.122000	0.20287|0.20287	2.375000|2.375000	0.44283|0.44283	2.431000|2.431000	0.82371|0.82371	0.609000|0.609000	0.83330|0.83330	GCA|ATG		SERPINB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133794.2	NM_175041	
GALNT15	117248	hgsc.bcm.edu	37	3	16254193	16254193	+	Missense_Mutation	SNP	C	C	T	rs191977190		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr3:16254193C>T	ENST00000339732.5	+	6	1818	c.1315C>T	c.(1315-1317)Cgc>Tgc	p.R439C	GALNT15_ENST00000437509.1_Missense_Mutation_p.R439C	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	439					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.R439C(1)									GAACAGGGTTCGCATTGCTGA	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		20618	0.0		0.001	False		,,,				2504	0.0				p.R439C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1315T	3						.						105.0	101.0	103.0					3																	16254193		2203	4300	6503	16229197	SO:0001583	missense	117248	exon6			AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.1315C>T	3.37:g.16254193C>T	ENSP00000344260:p.Arg439Cys	Somatic		Capture	SOLID	Phase_I	16229197	NM_054110	A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Missense_Mutation	SNP	ENST00000339732.5	37	CCDS33711.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	19.38	3.816623	0.70912	.	.	ENSG00000131386	ENST00000339732;ENST00000437509	T;T	0.61980	0.06;0.06	5.38	3.57	0.40892	.	0.268931	0.36703	N	0.002455	D	0.83083	0.5177	H	0.97659	4.05	0.54753	D	0.99998	D	0.89917	1.0	P	0.61275	0.886	D	0.85842	0.1398	10	0.87932	D	0	.	10.4884	0.44735	0.1337:0.7965:0.0:0.0698	.	439	Q8N3T1	GLTL2_HUMAN	C	439	ENSP00000344260:R439C;ENSP00000395873:R439C	ENSP00000344260:R439C	R	+	1	0	GALNTL2	16229197	0.999000	0.42202	0.663000	0.29738	0.868000	0.49771	4.191000	0.58372	0.627000	0.30340	0.561000	0.74099	CGC		GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346483.2	NM_054110	
HRASLS	57110	hgsc.bcm.edu	37	3	192973513	192973513	+	Missense_Mutation	SNP	G	G	A	rs150318874	byFrequency	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr3:192973513G>A	ENST00000602513.1	+	2	483	c.74G>A	c.(73-75)cGt>cAt	p.R25H	HRASLS_ENST00000264735.2_Missense_Mutation_p.R130H			Q9HDD0	HRSL1_HUMAN	HRAS-like suppressor	25					ether lipid metabolic process (GO:0046485)|lipid catabolic process (GO:0016042)|peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|nuclear envelope lumen (GO:0005641)|peroxisome (GO:0005777)	phospholipase activity (GO:0004620)|transferase activity (GO:0016740)	p.R25H(1)		breast(1)|large_intestine(2)|lung(4)|prostate(1)|skin(2)	10	all_cancers(143;9.1e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000159)		GAAGTGTTCCGTCCTGGCTAT	0.493																																					p.R25H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G74A	3						.	G	HIS/ARG	5,4401	9.9+/-24.2	0,5,2198	198.0	181.0	187.0		74	5.5	1.0	3	dbSNP_134	187	0,8600		0,0,4300	no	missense	HRASLS	NM_020386.3	29	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	probably-damaging	25/169	192973513	5,13001	2203	4300	6503	194456207	SO:0001583	missense	57110	exon2			AB030816	CCDS3303.1, CCDS3303.2	3q29	2008-05-15			ENSG00000127252	ENSG00000127252			14922	protein-coding gene	gene with protein product		606487					Standard	NM_020386		Approved	H-REV107, HRASLS1	uc003fta.4	Q9HDD0	OTTHUMG00000156104	ENST00000602513.1:c.74G>A	3.37:g.192973513G>A	ENSP00000473258:p.Arg25His	Somatic		Capture	SOLID	Phase_I	194456207	NM_020386	D2KX19	Missense_Mutation	SNP	ENST00000602513.1	37		.	.	.	.	.	.	.	.	.	.	G	26.5	4.742860	0.89573	0.001135	0.0	ENSG00000127252	ENST00000264735	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.86343	0.5910	M	0.92604	3.325	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	D	0.88598	0.3148	9	0.66056	D	0.02	0.0	18.5869	0.91192	0.0:0.0:1.0:0.0	.	25	Q9HDD0	HRSL1_HUMAN	H	25	.	ENSP00000264735:R25H	R	+	2	0	HRASLS	194456207	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.095000	0.76952	2.868000	0.98415	0.557000	0.71058	CGT		HRASLS-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
CD163L1	283316	hgsc.bcm.edu	37	12	7526002	7526002	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr12:7526002G>A	ENST00000313599.3	-	14	3701	c.3644C>T	c.(3643-3645)aCg>aTg	p.T1215M	CD163L1_ENST00000544331.1_5'Flank|CD163L1_ENST00000416109.2_Missense_Mutation_p.T1225M|CD163L1_ENST00000396630.1_Missense_Mutation_p.T1215M			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1215	SRCR 11. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.T1215M(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						GGAGATATGCGTTTTAGGACA	0.527																																					p.T1215M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3644T	12						.						149.0	121.0	130.0					12																	7526002		2203	4300	6503	7417269	SO:0001583	missense	283316	exon14			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.3644C>T	12.37:g.7526002G>A	ENSP00000315945:p.Thr1215Met	Somatic		Capture	SOLID	Phase_I	7417269	NM_174941	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	G	2.333	-0.352846	0.05173	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.37058	1.22;1.22;1.22	2.25	-4.5	0.03493	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.309370	0.06101	N	0.665345	T	0.23926	0.0579	L	0.38838	1.175	0.09310	N	1	B;B	0.21753	0.015;0.06	B;B	0.24848	0.01;0.056	T	0.13953	-1.0490	10	0.27082	T	0.32	.	3.4183	0.07384	0.5963:0.1674:0.132:0.1043	.	1225;1215	E7EVK4;Q9NR16	.;C163B_HUMAN	M	1215;1225;1215	ENSP00000315945:T1215M;ENSP00000393474:T1225M;ENSP00000379871:T1215M	ENSP00000315945:T1215M	T	-	2	0	CD163L1	7417269	0.000000	0.05858	0.000000	0.03702	0.340000	0.28889	-1.169000	0.03120	-2.706000	0.00396	-0.693000	0.03709	ACG		CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	SOLID	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
DHX37	57647	hgsc.bcm.edu	37	12	125453485	125453485	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr12:125453485C>T	ENST00000308736.2	-	9	1319	c.1221G>A	c.(1219-1221)atG>atA	p.M407I	DHX37_ENST00000544745.1_Missense_Mutation_p.M194I	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	407	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.M407I(1)		breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		GCGTGGCCGACATGATGAGCA	0.617																																					p.M407I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1221A	12						.						81.0	60.0	67.0					12																	125453485		2203	4300	6503	124019438	SO:0001583	missense	57647	exon9			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.1221G>A	12.37:g.125453485C>T	ENSP00000311135:p.Met407Ile	Somatic		Capture	SOLID	Phase_I	124019438	NM_032656	Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	C	31	5.069997	0.93950	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.10763	2.84;2.84	4.82	4.82	0.62117	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.50480	0.1618	H	0.98111	4.15	0.80722	D	1	D	0.63880	0.993	D	0.71656	0.974	T	0.71919	-0.4447	10	0.87932	D	0	-4.3043	17.8635	0.88789	0.0:1.0:0.0:0.0	.	407	Q8IY37	DHX37_HUMAN	I	407;194	ENSP00000311135:M407I;ENSP00000439009:M194I	ENSP00000311135:M407I	M	-	3	0	DHX37	124019438	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.239000	0.78182	2.382000	0.81193	0.561000	0.74099	ATG		DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	
EPHA5	2044	hgsc.bcm.edu	37	4	66356239	66356239	+	Missense_Mutation	SNP	C	C	T	rs370503988		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr4:66356239C>T	ENST00000273854.3	-	5	1858	c.1258G>A	c.(1258-1260)Ggc>Agc	p.G420S	EPHA5_ENST00000511294.1_Missense_Mutation_p.G420S|EPHA5_ENST00000432638.2_Intron|EPHA5_ENST00000354839.4_Missense_Mutation_p.G420S	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	420	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.G420S(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TTTTTCAGGCCGCTTTGCCGG	0.502										TSP Lung(17;0.13)																											p.G420S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1258A	4						.	C	SER/GLY,SER/GLY	0,4406		0,0,2203	125.0	101.0	109.0		1258,1258	6.1	1.0	4		109	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	EPHA5	NM_004439.5,NM_182472.2	56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	420/1038,420/1016	66356239	1,13005	2203	4300	6503	66038834	SO:0001583	missense	2044	exon5			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1258G>A	4.37:g.66356239C>T	ENSP00000273854:p.Gly420Ser	Somatic		Capture	SOLID	Phase_I	66038834	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	C	33	5.245266	0.95272	0.0	1.16E-4	ENSG00000145242	ENST00000273854;ENST00000354839;ENST00000511294	T;T;T	0.56275	0.47;0.47;0.47	6.08	6.08	0.98989	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000006	T	0.76983	0.4064	M	0.83012	2.62	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;1.0;1.0	T	0.76206	-0.3044	10	0.51188	T	0.08	.	20.6721	0.99693	0.0:1.0:0.0:0.0	.	420;420;420;420	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	S	420	ENSP00000273854:G420S;ENSP00000346899:G420S;ENSP00000427638:G420S	ENSP00000273854:G420S	G	-	1	0	EPHA5	66038834	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.952000	0.63618	2.894000	0.99253	0.591000	0.81541	GGC		EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
ANK2	287	hgsc.bcm.edu	37	4	114267166	114267166	+	Silent	SNP	G	G	A	rs183590716		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr4:114267166G>A	ENST00000357077.4	+	35	4412	c.4359G>A	c.(4357-4359)ccG>ccA	p.P1453P	ANK2_ENST00000264366.6_Silent_p.P1420P|ANK2_ENST00000394537.3_Silent_p.P1453P|ANK2_ENST00000506722.1_Silent_p.P1444P|ANK2_ENST00000510275.2_Silent_p.P105P|ANK2_ENST00000509550.1_Silent_p.P629P	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1453	Death 1. {ECO:0000255|PROSITE- ProRule:PRU00064}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.P1453P(2)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TCACTTTGCCGATTTATACAA	0.393													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19838	0.0		0.0	False		,,,				2504	0.0				p.P1453P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.G4359A	4						.						111.0	99.0	103.0					4																	114267166		2203	4300	6503	114486615	SO:0001819	synonymous_variant	287	exon35			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.4359G>A	4.37:g.114267166G>A		Somatic		Capture	SOLID	Phase_I	114486615	NM_020977	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	ENST00000357077.4	37	CCDS3702.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	7.491	0.650674	0.14516	.	.	ENSG00000145362	ENST00000514960;ENST00000504415	.	.	.	5.89	-6.29	0.02013	.	.	.	.	.	T	0.36248	0.0960	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39121	-0.9629	4	.	.	.	.	2.3502	0.04281	0.2541:0.1865:0.3769:0.1825	.	.	.	.	N	466;106	.	.	D	+	1	0	ANK2	114486615	0.000000	0.05858	0.176000	0.23000	0.989000	0.77384	-2.212000	0.01225	-1.090000	0.03069	0.585000	0.79938	GAT		ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
YY2	404281	hgsc.bcm.edu	37	X	21874924	21874924	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chrX:21874924C>G	ENST00000429584.2	+	1	820	c.322C>G	c.(322-324)Ccg>Gcg	p.P108A	MBTPS2_ENST00000465888.1_3'UTR|MBTPS2_ENST00000379484.5_Intron|MBTPS2_ENST00000365779.2_Intron	NM_206923.3	NP_996806.2	O15391	TYY2_HUMAN	YY2 transcription factor	108					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P108A(1)|p.P108>L(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	19						GTTGGCCCTCCCGGATAGCAT	0.557																																					p.P108A												.	.	2	Substitution - Missense(1)|Complex - compound substitution(1)	large_intestine(1)|skin(1)	c.C322G	X						.						87.0	70.0	75.0					X																	21874924		2203	4300	6503	21784845	SO:0001583	missense	404281	exon1			AK091850	CCDS14202.1	Xp22.2-p22.1	2011-02-11			ENSG00000230797	ENSG00000230797		"""Zinc fingers, C2H2-type"""	31684	protein-coding gene	gene with protein product	"""transcription factor yin yang 2"""	300570				14702039	Standard	NM_206923		Approved	ZNF631	uc011mjp.2	O15391	OTTHUMG00000021236	ENST00000429584.2:c.322C>G	X.37:g.21874924C>G	ENSP00000389381:p.Pro108Ala	Somatic		Capture	SOLID	Phase_I	21784845	NM_206923	B2RP10|Q6Q1S4	Silent	SNP	ENST00000429584.2	37	CCDS14202.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.325645	0.60743	.	.	ENSG00000230797	ENST00000429584	T	0.12147	2.71	3.99	3.13	0.36017	.	0.069497	0.64402	U	0.000018	T	0.21347	0.0514	M	0.61703	1.905	0.19945	N	0.999948	D	0.58268	0.982	P	0.51415	0.669	T	0.04333	-1.0959	10	0.66056	D	0.02	.	8.8554	0.35225	0.0:0.8853:0.0:0.1147	.	108	O15391	TYY2_HUMAN	A	108	ENSP00000389381:P108A	ENSP00000389381:P108A	P	+	1	0	YY2	21784845	0.058000	0.20735	0.005000	0.12908	0.008000	0.06430	1.830000	0.39131	1.049000	0.40321	0.600000	0.82982	CCG		YY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056025.1	NM_206923	
DCAF8L1	139425	hgsc.bcm.edu	37	X	27998157	27998157	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chrX:27998157T>A	ENST00000441525.1	-	1	1409	c.1295A>T	c.(1294-1296)aAg>aTg	p.K432M		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	432										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						TCTGTGCCCCTTATATCTCTT	0.458																																					p.K432M												.	.	0			c.A1295T	X						.						63.0	57.0	59.0					X																	27998157		2202	4300	6502	27908078	SO:0001583	missense	139425	exon1				CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.1295A>T	X.37:g.27998157T>A	ENSP00000405222:p.Lys432Met	None		Capture	SOLID	Phase_I	27908078	NM_001017930	B3KXX1	Missense_Mutation	SNP	ENST00000441525.1	37	CCDS35222.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413667	0.42817	.	.	ENSG00000226372	ENST00000441525	D	0.81908	-1.55	0.842	0.842	0.18927	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.85936	0.5813	M	0.69823	2.125	0.51767	D	0.999934	D	0.71674	0.998	D	0.63381	0.914	D	0.83369	0.0006	10	0.62326	D	0.03	-8.1957	5.6395	0.17557	0.0:1.0E-4:0.0:0.9999	.	432	A6NGE4	DC8L1_HUMAN	M	432	ENSP00000405222:K432M	ENSP00000405222:K432M	K	-	2	0	DCAF8L1	27908078	1.000000	0.71417	0.543000	0.28128	0.101000	0.19017	4.351000	0.59398	0.571000	0.29365	0.235000	0.17854	AAG		DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690	
RAB40A	142684	hgsc.bcm.edu	37	X	102755133	102755133	+	Silent	SNP	C	C	T			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chrX:102755133C>T	ENST00000372633.1	-	1	2670	c.552G>A	c.(550-552)ggG>ggA	p.G184G	RAB40A_ENST00000304236.1_Silent_p.G184G|LL0XNC01-250H12.3_ENST00000445990.1_RNA			Q8WXH6	RB40A_HUMAN	RAB40A, member RAS oncogene family	184	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.G184G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	12						TGCTCGGCCTCCCGAGCCAAT	0.572																																					p.G184G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G552A	X						.						53.0	44.0	48.0					X																	102755133		2203	4299	6502	102641789	SO:0001819	synonymous_variant	142684	exon3			AF132748	CCDS35357.1	Xq22.1	2009-08-25			ENSG00000172476	ENSG00000172476		"""RAB, member RAS oncogene"""	18283	protein-coding gene	gene with protein product						11697911	Standard	NM_080879		Approved	RAR2A, Rar-2	uc004ekk.3	Q8WXH6	OTTHUMG00000022100	ENST00000372633.1:c.552G>A	X.37:g.102755133C>T		Somatic		Capture	SOLID	Phase_I	102641789	NM_080879	O00407|Q17RQ5|Q6DK06|Q8TF06	Silent	SNP	ENST00000372633.1	37	CCDS35357.1																																																																																				RAB40A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057714.1		
IL18RAP	8807	hgsc.bcm.edu	37	2	103039784	103039784	+	Missense_Mutation	SNP	G	G	A	rs142509174		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr2:103039784G>A	ENST00000264260.2	+	3	636	c.47G>A	c.(46-48)cGa>cAa	p.R16Q	IL18RAP_ENST00000409369.1_5'UTR	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	16					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R16Q(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						GCAGGAGAGCGAATTAAAGGA	0.408																																					p.R16Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G47A	2						.	G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	251.0	246.0	248.0		47	-0.5	0.0	2	dbSNP_134	248	0,8600		0,0,4300	no	missense	IL18RAP	NM_003853.2	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	16/600	103039784	1,13005	2203	4300	6503	102406216	SO:0001583	missense	8807	exon3			AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.47G>A	2.37:g.103039784G>A	ENSP00000264260:p.Arg16Gln	Somatic		Capture	SOLID	Phase_I	102406216	NM_003853	B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	37	CCDS2061.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210262	0.39003	2.27E-4	0.0	ENSG00000115607	ENST00000264260;ENST00000450855	T	0.02301	4.35	5.67	-0.516	0.11950	.	0.655438	0.15220	N	0.273989	T	0.01730	0.0055	L	0.36672	1.1	0.09310	N	0.999996	P	0.50443	0.935	B	0.34722	0.188	T	0.51252	-0.8729	10	0.38643	T	0.18	.	9.1957	0.37226	0.478:0.0:0.522:0.0	.	16	O95256	I18RA_HUMAN	Q	16	ENSP00000264260:R16Q	ENSP00000264260:R16Q	R	+	2	0	IL18RAP	102406216	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-0.266000	0.08631	-0.313000	0.08728	0.591000	0.81541	CGA		IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	NM_003853	
DPP10	57628	hgsc.bcm.edu	37	2	116520177	116520177	+	Silent	SNP	C	C	T			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr2:116520177C>T	ENST00000410059.1	+	12	1584	c.1104C>T	c.(1102-1104)ctC>ctT	p.L368L	DPP10_ENST00000310323.8_Silent_p.L361L|DPP10_ENST00000393147.2_Silent_p.L372L|DPP10_ENST00000409163.1_Silent_p.L318L	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	368						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.L361L(1)|p.L368L(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						ATACGTGGCTCTCTCAGCAGG	0.348																																					p.L318L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C954T	2						.						195.0	183.0	187.0					2																	116520177		2203	4300	6503	116236647	SO:0001819	synonymous_variant	57628	exon13			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1104C>T	2.37:g.116520177C>T		Somatic		Capture	SOLID	Phase_I	116236647	NM_001178036	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Silent	SNP	ENST00000410059.1	37	CCDS46400.1																																																																																				DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
LRP1B	53353	hgsc.bcm.edu	37	2	140995732	140995732	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr2:140995732C>G	ENST00000389484.3	-	89	14520	c.13549G>C	c.(13549-13551)Gac>Cac	p.D4517H		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4517					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.D4517H(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTTGTTGGGTCTATCATAAAG	0.373										TSP Lung(27;0.18)																											p.D4517H	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G13549C	2						.						170.0	158.0	162.0					2																	140995732		2203	4300	6503	140712202	SO:0001583	missense	53353	exon89			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13549G>C	2.37:g.140995732C>G	ENSP00000374135:p.Asp4517His	Somatic		Capture	SOLID	Phase_I	140712202	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.6|22.6	4.308656|4.308656	0.81247|0.81247	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000389484;ENST00000544579|ENST00000437977	T|.	0.63580|.	-0.05|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.155296|.	0.41712|.	D|.	0.000826|.	T|.	0.61924|.	0.2386|.	L|L	0.56199|0.56199	1.76|1.76	0.46078|0.46078	D|D	0.998853|0.998853	P|.	0.43477|.	0.808|.	P|.	0.48952|.	0.596|.	T|.	0.59883|.	-0.7370|.	10|.	0.72032|.	D|.	0.01|.	.|.	10.5741|10.5741	0.45217|0.45217	0.0:0.8835:0.0:0.1165|0.0:0.8835:0.0:0.1165	.|.	4517|.	Q9NZR2|.	LRP1B_HUMAN|.	H|Y	4517;4455|748	ENSP00000374135:D4517H|.	ENSP00000374135:D4517H|.	D|X	-|-	1|3	0|2	LRP1B|LRP1B	140712202|140712202	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	5.502000|5.502000	0.66956|0.66956	2.596000|2.596000	0.87737|0.87737	0.655000|0.655000	0.94253|0.94253	GAC|TAG		LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
APOB	338	hgsc.bcm.edu	37	2	21234050	21234050	+	Missense_Mutation	SNP	C	C	T	rs199510126		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr2:21234050C>T	ENST00000233242.1	-	26	5817	c.5690G>A	c.(5689-5691)cGt>cAt	p.R1897H		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1897					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.R1897H(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATTACAGAACGGAAGACATT	0.478													C|||	1	0.000199681	0.0	0.0	5008	,	,		23181	0.0		0.001	False		,,,				2504	0.0				p.R1897H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5690A	2						.						127.0	119.0	122.0					2																	21234050		2203	4300	6503	21087555	SO:0001583	missense	338	exon26			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.5690G>A	2.37:g.21234050C>T	ENSP00000233242:p.Arg1897His	Somatic		Capture	SOLID	Phase_I	21087555	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	0.042	-1.282531	0.01398	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00966	5.49	5.67	-2.41	0.06562	.	0.437392	0.21535	N	0.072995	T	0.00468	0.0015	N	0.01729	-0.75	0.58432	D	0.999992	B	0.10296	0.003	B	0.06405	0.002	T	0.55685	-0.8102	10	0.11794	T	0.64	.	13.1172	0.59307	0.0:0.6611:0.0:0.3389	.	1897	P04114	APOB_HUMAN	H	1897	ENSP00000233242:R1897H	ENSP00000233242:R1897H	R	-	2	0	APOB	21087555	0.000000	0.05858	0.334000	0.25495	0.531000	0.34715	-0.148000	0.10219	-0.395000	0.07715	-0.351000	0.07748	CGT		APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
LRP2	4036	hgsc.bcm.edu	37	2	170127524	170127524	+	Missense_Mutation	SNP	G	G	A	rs201860953		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr2:170127524G>A	ENST00000263816.3	-	16	2495	c.2210C>T	c.(2209-2211)tCg>tTg	p.S737L	LRP2_ENST00000443831.1_Intron	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	737					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.S737L(2)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AGGATTCCCCGAAACTGGAAC	0.413																																					p.S737L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2210T	2						.	G	LEU/SER	0,4406		0,0,2203	122.0	106.0	111.0		2210	4.9	0.2	2		111	6,8594	5.0+/-18.6	0,6,4294	yes	missense	LRP2	NM_004525.2	145	0,6,6497	AA,AG,GG		0.0698,0.0,0.0461	benign	737/4656	170127524	6,13000	2203	4300	6503	169835770	SO:0001583	missense	4036	exon16				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.2210C>T	2.37:g.170127524G>A	ENSP00000263816:p.Ser737Leu	Somatic		Capture	SOLID	Phase_I	169835770	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	13.97	2.397079	0.42512	0.0	6.98E-4	ENSG00000081479	ENST00000263816	D	0.90788	-2.73	5.77	4.9	0.64082	Six-bladed beta-propeller, TolB-like (1);	0.101407	0.64402	D	0.000003	T	0.80363	0.4609	N	0.20685	0.6	0.80722	D	1	B	0.33120	0.398	B	0.22152	0.038	T	0.78288	-0.2262	10	0.07813	T	0.8	.	15.2561	0.73585	0.0675:0.0:0.9325:0.0	.	737	P98164	LRP2_HUMAN	L	737	ENSP00000263816:S737L	ENSP00000263816:S737L	S	-	2	0	LRP2	169835770	1.000000	0.71417	0.229000	0.23960	0.126000	0.20510	7.917000	0.87498	1.581000	0.49865	0.655000	0.94253	TCG		LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
PRR30	339779	hgsc.bcm.edu	37	2	27360701	27360701	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr2:27360701G>T	ENST00000335524.3	-	3	1022	c.497C>A	c.(496-498)tCt>tAt	p.S166Y		NM_178553.3	NP_848648.2	Q53SZ7	PRR30_HUMAN		166								p.S166Y(1)		cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGCCTATGAGAAGGTGGGCT	0.622																																					p.S166Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C497A	2						.						55.0	57.0	57.0					2																	27360701		2203	4300	6503	27214205	SO:0001583	missense	339779	exon3																														ENST00000335524.3:c.497C>A	2.37:g.27360701G>T	ENSP00000335017:p.Ser166Tyr	Somatic		Capture	SOLID	Phase_I	27214205	NM_178553	Q86UE2	Missense_Mutation	SNP	ENST00000335524.3	37	CCDS1739.1	.	.	.	.	.	.	.	.	.	.	g	16.50	3.141319	0.57044	.	.	ENSG00000186143	ENST00000335524	T	0.45276	0.9	4.96	4.07	0.47477	.	0.419266	0.17756	N	0.163052	T	0.48892	0.1525	L	0.32530	0.975	0.22127	N	0.999349	D	0.69078	0.997	D	0.63192	0.912	T	0.35276	-0.9795	10	0.54805	T	0.06	-6.9043	11.2863	0.49224	0.0:0.185:0.815:0.0	.	166	Q53SZ7	CB053_HUMAN	Y	166	ENSP00000335017:S166Y	ENSP00000335017:S166Y	S	-	2	0	C2orf53	27214205	0.994000	0.37717	0.241000	0.24154	0.006000	0.05464	2.396000	0.44468	1.032000	0.39892	0.556000	0.70494	TCT		C2orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250188.1		
GALNT14	79623	hgsc.bcm.edu	37	2	31133781	31133781	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr2:31133781T>C	ENST00000349752.5	-	15	2284	c.1645A>G	c.(1645-1647)Atg>Gtg	p.M549V	GALNT14_ENST00000324589.5_Missense_Mutation_p.M554V|GALNT14_ENST00000356174.3_Missense_Mutation_p.M516V|GALNT14_ENST00000486564.1_5'UTR|GALNT14_ENST00000406653.1_Missense_Mutation_p.M529V|GALNT14_ENST00000420311.2_Missense_Mutation_p.M514V	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	549	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.M549V(1)		cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					GAGCTCACCATGTCCCAGTGC	0.577																																					p.M549V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1645G	2						.						124.0	100.0	108.0					2																	31133781		2203	4300	6503	30987285	SO:0001583	missense	79623	exon15			AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.1645A>G	2.37:g.31133781T>C	ENSP00000288988:p.Met549Val	Somatic		Capture	SOLID	Phase_I	30987285	NM_024572	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	T	12.11	1.839087	0.32513	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311	T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08	5.26	1.55	0.23275	Ricin B-related lectin (1);Ricin B lectin (2);	0.340043	0.36444	N	0.002594	T	0.32496	0.0831	L	0.47190	1.495	0.31084	N	0.711596	B;B;B;B	0.06786	0.0;0.001;0.0;0.0	B;B;B;B	0.10450	0.002;0.005;0.001;0.001	T	0.24941	-1.0146	10	0.59425	D	0.04	.	7.3242	0.26545	0.0:0.076:0.2979:0.626	.	514;554;549;529	F5H263;Q96FL9-3;Q96FL9;B3KV89	.;.;GLT14_HUMAN;.	V	549;554;529;516;514	ENSP00000288988:M549V;ENSP00000314500:M554V;ENSP00000385435:M529V;ENSP00000348497:M516V;ENSP00000415514:M514V	ENSP00000314500:M554V	M	-	1	0	GALNT14	30987285	1.000000	0.71417	0.871000	0.34182	0.985000	0.73830	1.971000	0.40530	0.027000	0.15297	0.533000	0.62120	ATG		GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572	
SEMA4F	10505	hgsc.bcm.edu	37	2	74902673	74902673	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr2:74902673C>T	ENST00000357877.2	+	11	1543	c.1394C>T	c.(1393-1395)gCa>gTa	p.A465V	SEMA4F_ENST00000339773.5_Missense_Mutation_p.A310V|SEMA4F_ENST00000473350.1_3'UTR	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	465	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)	p.A465V(1)		biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						CTCCACCGAGCAGTGCGGATC	0.488																																					p.A465V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1394T	2						.						119.0	112.0	114.0					2																	74902673		2203	4300	6503	74756181	SO:0001583	missense	10505	exon11			AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.1394C>T	2.37:g.74902673C>T	ENSP00000350547:p.Ala465Val	Somatic		Capture	SOLID	Phase_I	74756181	NM_004263	Q542Y7|Q9NS35	Missense_Mutation	SNP	ENST00000357877.2	37	CCDS1955.1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.418910	0.42918	.	.	ENSG00000135622	ENST00000357877;ENST00000339773	T;T	0.27256	1.68;1.68	4.77	4.77	0.60923	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.157215	0.42172	D	0.000758	T	0.26846	0.0657	N	0.05510	-0.035	0.34767	D	0.733289	P;D	0.55605	0.924;0.972	P;D	0.66716	0.646;0.946	T	0.17961	-1.0352	10	0.12103	T	0.63	.	15.3434	0.74314	0.0:1.0:0.0:0.0	.	310;465	O95754-2;O95754	.;SEM4F_HUMAN	V	465;310	ENSP00000350547:A465V;ENSP00000342675:A310V	ENSP00000342675:A310V	A	+	2	0	SEMA4F	74756181	0.962000	0.33011	1.000000	0.80357	0.291000	0.27294	3.849000	0.55910	2.475000	0.83589	0.467000	0.42956	GCA		SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252214.2	NM_004263	
STK36	27148	hgsc.bcm.edu	37	2	219540759	219540759	+	Missense_Mutation	SNP	C	C	T	rs200288195		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr2:219540759C>T	ENST00000295709.3	+	6	721	c.442C>T	c.(442-444)Cgg>Tgg	p.R148W	STK36_ENST00000392106.2_Missense_Mutation_p.R148W|STK36_ENST00000440309.1_Missense_Mutation_p.R148W|STK36_ENST00000392105.3_Missense_Mutation_p.R148W	NM_015690.4	NP_056505.2			serine/threonine kinase 36									p.R148W(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		CAGATTTGCCCGGGCTATGAG	0.478																																					p.R148W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C442T	2						.						105.0	108.0	107.0					2																	219540759		2203	4300	6503	219249003	SO:0001583	missense	27148	exon6			AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.442C>T	2.37:g.219540759C>T	ENSP00000295709:p.Arg148Trp	Somatic		Capture	SOLID	Phase_I	219249003	NM_015690		Missense_Mutation	SNP	ENST00000295709.3	37	CCDS2421.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.927971	0.92389	.	.	ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309;ENST00000424080	T;T;T;T;D	0.84873	1.59;1.59;1.59;1.59;-1.91	6.17	6.17	0.99709	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.40908	D	0.000985	D	0.92811	0.7714	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92320	0.5865	10	0.87932	D	0	-25.3868	20.8794	0.99867	0.0:1.0:0.0:0.0	.	148;148	Q9NRP7-2;Q9NRP7	.;STK36_HUMAN	W	148	ENSP00000295709:R148W;ENSP00000375955:R148W;ENSP00000375954:R148W;ENSP00000394095:R148W;ENSP00000403527:R148W	ENSP00000295709:R148W	R	+	1	2	STK36	219249003	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.829000	0.69316	2.941000	0.99782	0.655000	0.94253	CGG		STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2		
DCLK1	9201	hgsc.bcm.edu	37	13	36428647	36428647	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr13:36428647G>A	ENST00000360631.3	-	6	1235	c.1024C>T	c.(1024-1026)Cgg>Tgg	p.R342W	DCLK1_ENST00000460982.1_5'UTR|DCLK1_ENST00000379892.4_Missense_Mutation_p.R342W|DCLK1_ENST00000379893.1_Missense_Mutation_p.R35W|DCLK1_ENST00000255448.4_Missense_Mutation_p.R342W			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	342					axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.R342W(2)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		CTCTGCTTCCGCAGGCTTCCT	0.537																																					p.R35W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C103T	13						.						126.0	105.0	112.0					13																	36428647		2203	4300	6503	35326647	SO:0001583	missense	9201	exon2			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1024C>T	13.37:g.36428647G>A	ENSP00000353846:p.Arg342Trp	Somatic		Capture	SOLID	Phase_I	35326647	NM_001195430	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	37		.	.	.	.	.	.	.	.	.	.	G	26.7	4.758816	0.89843	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451;ENST00000379892	T;T;T;T	0.69806	-0.43;-0.42;-0.38;1.6	5.67	5.67	0.87782	.	0.054463	0.64402	D	0.000001	T	0.78761	0.4334	M	0.61703	1.905	0.58432	D	0.999992	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.69479	0.964;0.921;0.964	T	0.80231	-0.1468	10	0.87932	D	0	.	14.5943	0.68395	0.0:0.0:0.8542:0.1458	.	35;342;35	O15075-4;O15075-2;O15075-3	.;.;.	W	34;342;342;35;342;342	ENSP00000255448:R342W;ENSP00000353846:R342W;ENSP00000369223:R35W;ENSP00000369222:R342W	ENSP00000255448:R342W	R	-	1	2	DCLK1	35326647	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.382000	0.52463	2.687000	0.91594	0.655000	0.94253	CGG		DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
GPR183	1880	hgsc.bcm.edu	37	13	99947989	99947989	+	Silent	SNP	T	T	G	rs530898155	byFrequency	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr13:99947989T>G	ENST00000376414.4	-	2	494	c.411A>C	c.(409-411)ctA>ctC	p.L137L	UBAC2_ENST00000376440.2_Intron|UBAC2_ENST00000403766.3_Intron	NM_004951.4	NP_004942.1	P32249	GP183_HUMAN	G protein-coupled receptor 183	137					G-protein coupled receptor signaling pathway (GO:0007186)|humoral immune response (GO:0006959)|immune response (GO:0006955)|mature B cell differentiation involved in immune response (GO:0002313)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|oxysterol binding (GO:0008142)	p.L137L(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	23						TGTTGTAGCGTAGAGGGTGCA	0.438																																					p.L137L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A411C	13						.						161.0	128.0	139.0					13																	99947989		2203	4300	6503	98745990	SO:0001819	synonymous_variant	1880	exon2			L08177	CCDS9492.1	13q32.3	2012-08-21	2008-07-21	2008-07-21	ENSG00000169508	ENSG00000169508		"""GPCR / Class A : Orphans"""	3128	protein-coding gene	gene with protein product	"""EBV-induced G-protein coupled receptor 2"""	605741	"""Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled receptor)"""	EBI2		8383238	Standard	NM_004951		Approved		uc001vog.3	P32249	OTTHUMG00000017263	ENST00000376414.4:c.411A>C	13.37:g.99947989T>G		Somatic		Capture	SOLID	Phase_I	98745990	NM_004951	B2R8N5|Q53F99|Q5JUH7	Silent	SNP	ENST00000376414.4	37	CCDS9492.1																																																																																				GPR183-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045582.2	NM_004951	
F10	2159	hgsc.bcm.edu	37	13	113803789	113803789	+	Silent	SNP	G	G	A			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr13:113803789G>A	ENST00000375559.3	+	8	1463	c.1425G>A	c.(1423-1425)aaG>aaA	p.K475K	F10_ENST00000375551.3_3'UTR	NM_000504.3	NP_000495.1	P00742	FA10_HUMAN	coagulation factor X	475					blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|serine-type endopeptidase activity (GO:0004252)	p.K475K(1)		endometrium(2)|large_intestine(4)|lung(10)|pancreas(1)|stomach(1)	18	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Antihemophilic Factor(DB00025)|Apixaban(DB06605)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Menadione(DB00170)|Rivaroxaban(DB06228)	CCAAGGCCAAGAGCCATGCCC	0.582																																					p.K475K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1425A	13						.						113.0	97.0	103.0					13																	113803789		2203	4300	6503	112851790	SO:0001819	synonymous_variant	2159	exon8				CCDS9530.1	13q34	2012-10-02			ENSG00000126218	ENSG00000126218	3.4.21.6		3528	protein-coding gene	gene with protein product		613872					Standard	XM_005268298		Approved		uc001vsx.3	P00742	OTTHUMG00000017374	ENST00000375559.3:c.1425G>A	13.37:g.113803789G>A		Somatic		Capture	SOLID	Phase_I	112851790	NM_000504	Q14340	Silent	SNP	ENST00000375559.3	37	CCDS9530.1																																																																																				F10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045841.3		
ZEB1	6935	hgsc.bcm.edu	37	10	31812949	31812949	+	Missense_Mutation	SNP	G	G	A	rs35653460		TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr10:31812949G>A	ENST00000320985.10	+	8	2800	c.2690G>A	c.(2689-2691)cGg>cAg	p.R897Q	ZEB1_ENST00000560721.2_Missense_Mutation_p.R877Q|ZEB1_ENST00000446923.2_Missense_Mutation_p.R881Q|ZEB1_ENST00000361642.5_Missense_Mutation_p.R898Q|ZEB1_ENST00000542815.3_Missense_Mutation_p.R830Q			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	897					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R897Q(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				AAGAAAATGCGGAAGACAGAA	0.373																																					p.R877Q	Ovarian(40;423 959 14296 36701 49589)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2630A	10						.	G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	111.0	111.0	111.0		2642,2630,2639,2489,2693,2690	4.8	1.0	10	dbSNP_126	111	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense	ZEB1	NM_001128128.2,NM_001174093.1,NM_001174094.1,NM_001174095.1,NM_001174096.1,NM_030751.5	43,43,43,43,43,43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	881/1109,877/1105,880/1108,830/1058,898/1126,897/1125	31812949	1,13005	2203	4300	6503	31852955	SO:0001583	missense	6935	exon7			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.2690G>A	10.37:g.31812949G>A	ENSP00000319248:p.Arg897Gln	Somatic		Capture	SOLID	Phase_I	31852955	NM_001174093	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	37	CCDS7169.1	.	.	.	.	.	.	.	.	.	.	G	19.47	3.833834	0.71258	2.27E-4	0.0	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000543514;ENST00000446923	T;T;T;T;T	0.07444	3.19;3.19;3.19;3.19;3.19	5.72	4.8	0.61643	.	0.369405	0.21055	N	0.080939	T	0.14184	0.0343	L	0.27053	0.805	0.37448	D	0.91469	D;P;P;P;P	0.69078	0.997;0.913;0.574;0.913;0.913	D;B;B;B;B	0.64144	0.922;0.174;0.068;0.129;0.089	T	0.12811	-1.0533	10	0.41790	T	0.15	-12.9237	10.1047	0.42526	0.071:0.1383:0.7907:0.0	rs35653460	830;881;877;898;897	F5H4I8;E9PCM7;Q5VZ84;Q2KJ05;P37275	.;.;.;.;ZEB1_HUMAN	Q	679;897;898;892;830;897;877;788;881	ENSP00000444282:R679Q;ENSP00000354487:R898Q;ENSP00000444891:R830Q;ENSP00000319248:R897Q;ENSP00000391612:R881Q	ENSP00000319248:R897Q	R	+	2	0	ZEB1	31852955	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.665000	0.68052	1.410000	0.46936	0.585000	0.79938	CGG		ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751	
RHOBTB1	9886	hgsc.bcm.edu	37	10	62648035	62648035	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr10:62648035G>A	ENST00000337910.5	-	6	1728	c.1391C>T	c.(1390-1392)aCg>aTg	p.T464M	RHOBTB1_ENST00000357917.4_Missense_Mutation_p.T464M	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	464					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.T464M(2)		endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					AAAGGCTTTCGTAATCTCCTG	0.507																																					p.T464M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1391T	10						.						111.0	102.0	105.0					10																	62648035		2203	4300	6503	62318041	SO:0001583	missense	9886	exon6			AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.1391C>T	10.37:g.62648035G>A	ENSP00000338671:p.Thr464Met	Somatic		Capture	SOLID	Phase_I	62318041	NM_014836		Missense_Mutation	SNP	ENST00000337910.5	37	CCDS7261.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.322517	0.81580	.	.	ENSG00000072422	ENST00000357917;ENST00000337910	T;T	0.16743	2.32;2.32	5.71	5.71	0.89125	BTB/POZ fold (1);	0.000000	0.85682	D	0.000000	T	0.46619	0.1402	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.32771	-0.9894	10	0.49607	T	0.09	.	19.8677	0.96824	0.0:0.0:1.0:0.0	.	464	O94844	RHBT1_HUMAN	M	464	ENSP00000350595:T464M;ENSP00000338671:T464M	ENSP00000338671:T464M	T	-	2	0	RHOBTB1	62318041	1.000000	0.71417	0.943000	0.38184	0.970000	0.65996	9.803000	0.99136	2.709000	0.92574	0.655000	0.94253	ACG		RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048220.1		
APC	324	hgsc.bcm.edu	37	5	112175328	112175328	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr5:112175328C>G	ENST00000457016.1	+	16	4417	c.4037C>G	c.(4036-4038)tCa>tGa	p.S1346*	APC_ENST00000508376.2_Nonsense_Mutation_p.S1346*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.S1346*			P25054	APC_HUMAN	adenomatous polyposis coli	1346	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S1346*(14)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCTTCAGAATCAGCCAGGCAC	0.483		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S1328X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0	.	16	Substitution - Nonsense(14)|Unknown(1)|Deletion - Frameshift(1)	large_intestine(14)|soft_tissue(1)|skin(1)	c.C3983G	5						.						59.0	63.0	61.0					5																	112175328		2202	4300	6502	112203227	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4037C>G	5.37:g.112175328C>G	ENSP00000413133:p.Ser1346*	Somatic		Capture	SOLID	Phase_I	112203227	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.934355	0.99008	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.03	6.03	0.97812	.	0.386425	0.26734	N	0.022770	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.3113	20.1672	0.98154	0.0:1.0:0.0:0.0	.	.	.	.	X	1346	.	.	S	+	2	0	APC	112203227	0.997000	0.39634	0.940000	0.37924	0.981000	0.71138	5.272000	0.65559	2.861000	0.98227	0.655000	0.94253	TCA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
RANBP17	64901	hgsc.bcm.edu	37	5	170598234	170598234	+	Silent	SNP	A	A	G			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr5:170598234A>G	ENST00000523189.1	+	16	1973	c.1809A>G	c.(1807-1809)ggA>ggG	p.G603G	RANBP17_ENST00000521759.1_Intron	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	603					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)	p.G603G(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AATACTGGGGAAGATATGAGC	0.313			T	TRD@	ALL																																p.G603G			Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1809G	5						.						134.0	130.0	132.0					5																	170598234		2203	4295	6498	170530839	SO:0001819	synonymous_variant	64901	exon16			AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.1809A>G	5.37:g.170598234A>G		Somatic		Capture	SOLID	Phase_I	170530839	NM_022897	Q8IU74	Silent	SNP	ENST00000523189.1	37	CCDS34287.1																																																																																				RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897	
STK10	6793	hgsc.bcm.edu	37	5	171534792	171534792	+	Silent	SNP	C	C	T			TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3602-01A-02W-0833-10	TCGA-AG-3602-10A-01W-0833-10	g.chr5:171534792C>T	ENST00000176763.5	-	5	928	c.585G>A	c.(583-585)acG>acA	p.T195T		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	195	Activation segment.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)	p.T195T(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ACCAGTAAGGCGTGCCGATGA	0.498											OREG0017039	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T195T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G585A	5						.						90.0	87.0	88.0					5																	171534792		2203	4300	6503	171467397	SO:0001819	synonymous_variant	6793	exon5			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.585G>A	5.37:g.171534792C>T		Somatic	1893	Capture	SOLID	Phase_I	171467397	NM_005990	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Silent	SNP	ENST00000176763.5	37	CCDS34290.1																																																																																				STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990	
