#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CAV1	857	hgsc.bcm.edu	37	7	116166586	116166586	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr7:116166586T>A	ENST00000341049.2	+	2	316	c.38T>A	c.(37-39)cTc>cAc	p.L13H	CAV1_ENST00000405348.1_5'UTR|CAV1_ENST00000393467.1_5'UTR|CAV1_ENST00000393470.1_Intron|CAV1_ENST00000393468.1_5'UTR	NM_001753.4	NP_001744.2	Q03135	CAV1_HUMAN	caveolin 1, caveolae protein, 22kDa	13					angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cellular calcium ion homeostasis (GO:0006874)|cellular response to hyperoxia (GO:0071455)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol transport (GO:0030301)|cytosolic calcium ion homeostasis (GO:0051480)|inactivation of MAPK activity (GO:0000188)|lactation (GO:0007595)|leukocyte migration (GO:0050900)|lipid storage (GO:0019915)|maintenance of protein location in cell (GO:0032507)|mammary gland development (GO:0030879)|mammary gland involution (GO:0060056)|MAPK cascade (GO:0000165)|membrane depolarization (GO:0051899)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of pinocytosis (GO:0048550)|negative regulation of protein binding (GO:0032091)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|nitric oxide homeostasis (GO:0033484)|nitric oxide metabolic process (GO:0046209)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of vasoconstriction (GO:0045907)|protein homooligomerization (GO:0051260)|protein localization (GO:0008104)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)|regulation of blood coagulation (GO:0030193)|regulation of fatty acid metabolic process (GO:0019217)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidase activity (GO:0052547)|regulation of smooth muscle contraction (GO:0006940)|regulation of the force of heart contraction by chemical signal (GO:0003057)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to ischemia (GO:0002931)|response to progesterone (GO:0032570)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|vasculogenesis (GO:0001570)|vasoconstriction (GO:0042310)|vesicle organization (GO:0016050)|viral process (GO:0016032)	acrosomal membrane (GO:0002080)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell cortex (GO:0005938)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lipid particle (GO:0005811)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cholesterol binding (GO:0015485)|enzyme binding (GO:0019899)|nitric-oxide synthase binding (GO:0050998)|patched binding (GO:0005113)|peptidase activator activity (GO:0016504)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)	p.L13H(1)		endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)			CAGGGACATCTCTACACCGTT	0.592											OREG0018273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L13H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T38A	7						.						97.0	79.0	85.0					7																	116166586		2203	4300	6503	115953822	SO:0001583	missense	857	exon2			AF125348	CCDS5767.1, CCDS55156.1	7q31	2006-02-09	2002-08-29		ENSG00000105974	ENSG00000105974			1527	protein-coding gene	gene with protein product		601047	"""caveolin 1, caveolae protein, 22kD"""	CAV		10087206	Standard	NM_001753		Approved		uc003vif.2	Q03135	OTTHUMG00000023413	ENST00000341049.2:c.38T>A	7.37:g.116166586T>A	ENSP00000339191:p.Leu13His	Somatic	1471	Capture	SOLID	Phase_I	115953822	NM_001753	Q9UGP1|Q9UNG1|Q9UQH6	Missense_Mutation	SNP	ENST00000341049.2	37	CCDS5767.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.512232	0.85389	.	.	ENSG00000105974	ENST00000341049	D	0.94138	-3.36	5.26	5.26	0.73747	.	0.309988	0.31897	N	0.006898	D	0.93304	0.7866	M	0.61703	1.905	0.80722	D	1	D	0.55172	0.97	P	0.49708	0.62	D	0.93683	0.7000	10	0.87932	D	0	-9.3259	11.7718	0.51962	0.0:0.0:0.1469:0.8531	.	13	Q03135	CAV1_HUMAN	H	13	ENSP00000339191:L13H	ENSP00000339191:L13H	L	+	2	0	CAV1	115953822	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.510000	0.60455	2.100000	0.63781	0.528000	0.53228	CTC		CAV1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000059734.4	NM_001753	
IL6	3569	hgsc.bcm.edu	37	7	22769162	22769162	+	Silent	SNP	T	T	G			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr7:22769162T>G	ENST00000404625.1	+	5	813	c.354T>G	c.(352-354)ggT>ggG	p.G118G	IL6_ENST00000406575.1_Silent_p.G118G|IL6_ENST00000258743.5_Silent_p.G118G|IL6_ENST00000401651.1_Silent_p.G42G|IL6_ENST00000401630.3_Silent_p.G95G|IL6_ENST00000407492.1_Silent_p.G42G|IL6_ENST00000420258.2_Silent_p.G172G|AC073072.5_ENST00000325042.2_RNA			P05231	IL6_HUMAN	interleukin 6	118					acute-phase response (GO:0006953)|aging (GO:0007568)|bone remodeling (GO:0046849)|branching involved in salivary gland morphogenesis (GO:0060445)|cell growth (GO:0016049)|cell redox homeostasis (GO:0045454)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endocrine pancreas development (GO:0031018)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|glucagon secretion (GO:0070091)|hepatic immune response (GO:0002384)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of hormone secretion (GO:0046888)|negative regulation of lipid storage (GO:0010888)|negative regulation of muscle organ development (GO:0048635)|negative regulation of neuron death (GO:1901215)|negative regulation of protein kinase activity (GO:0006469)|neuron projection development (GO:0031175)|neutrophil apoptotic process (GO:0001781)|neutrophil mediated immunity (GO:0002446)|platelet activation (GO:0030168)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell activation (GO:0050871)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of angiogenesis (GO:0045765)|regulation of cell shape (GO:0008360)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of vascular endothelial growth factor production (GO:0010574)|response to amino acid (GO:0043200)|response to antibiotic (GO:0046677)|response to caffeine (GO:0031000)|response to calcium ion (GO:0051592)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to heat (GO:0009408)|response to insulin (GO:0032868)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to peptidoglycan (GO:0032494)|T-helper 17 cell lineage commitment (GO:0072540)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-6 receptor binding (GO:0005138)	p.G118G(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(1)	8					Ginseng(DB01404)	TCATCACTGGTCTTTTGGAGT	0.423																																					p.G118G	Esophageal Squamous(47;342 1214 13936 33513)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T354G	7						.						158.0	157.0	157.0					7																	22769162		2203	4300	6503	22735687	SO:0001819	synonymous_variant	3569	exon4			M18403	CCDS5375.1	7p21-p15	2014-04-04	2014-04-04		ENSG00000136244	ENSG00000136244		"""Interleukins and interleukin receptors"", ""Interferons"""	6018	protein-coding gene	gene with protein product	"""interferon, beta 2"""	147620	"""interleukin 6 (interferon, beta 2)"""	IFNB2		3294161	Standard	NM_000600		Approved	IL-6, BSF2, HGF, HSF	uc003svj.4	P05231	OTTHUMG00000023178	ENST00000404625.1:c.354T>G	7.37:g.22769162T>G		Somatic		Capture	SOLID	Phase_I	22735687	NM_000600	Q9UCU2|Q9UCU3|Q9UCU4	Silent	SNP	ENST00000404625.1	37	CCDS5375.1																																																																																				IL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250225.2	NM_000600	
EPDR1	54749	hgsc.bcm.edu	37	7	37989844	37989844	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr7:37989844C>T	ENST00000199448.4	+	3	900	c.521C>T	c.(520-522)cCt>cTt	p.P174L	EPDR1_ENST00000559325.1_Missense_Mutation_p.P294L|EPDR1_ENST00000423717.1_3'UTR|EPDR1_ENST00000425345.1_Missense_Mutation_p.P113L|EPDR1_ENST00000476620.1_Missense_Mutation_p.P72L	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1	174					cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)	p.P294L(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						GATTGCTATCCTGTCCAGGAA	0.393																																					p.P294L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C881T	7						.						64.0	65.0	64.0					7																	37989844		2203	4300	6503	37956369	SO:0001583	missense	54749	exon3			BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.521C>T	7.37:g.37989844C>T	ENSP00000199448:p.Pro174Leu	Somatic		Capture	SOLID	Phase_I	37956369	NM_017549	A8K4C0|C9JYS3|Q06BL0|Q99M77	Missense_Mutation	SNP	ENST00000199448.4	37	CCDS5454.2	.	.	.	.	.	.	.	.	.	.	C	28.9	4.956465	0.92726	.	.	ENSG00000086289	ENST00000476620;ENST00000199448;ENST00000425345	.	.	.	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.80864	0.4705	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83423	0.0034	9	0.66056	D	0.02	-8.8292	17.1506	0.86777	0.0:1.0:0.0:0.0	.	113;294	C9JYS3;A4D1W8	.;.	L	72;294;113	.	ENSP00000199448:P294L	P	+	2	0	EPDR1	37956369	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	7.609000	0.82925	2.670000	0.90874	0.655000	0.94253	CCT		EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220037.3	NM_017549	
MRPS24	64951	hgsc.bcm.edu	37	7	43908599	43908599	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr7:43908599G>T	ENST00000317534.5	-	3	244	c.183C>A	c.(181-183)taC>taA	p.Y61*	MRPS24_ENST00000467084.1_5'UTR|URGCP-MRPS24_ENST00000603700.1_Missense_Mutation_p.H107N	NM_032014.2	NP_114403.1	Q96EL2	RT24_HUMAN	mitochondrial ribosomal protein S24	61					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrial small ribosomal subunit (GO:0005763)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.Y61*(1)		large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	5						GGTGGGCGATGTAGTGCGGCG	0.607																																					p.Y61X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C183A	7						.						87.0	79.0	82.0					7																	43908599		2203	4300	6503	43875124	SO:0001587	stop_gained	64951	exon3			AB061207	CCDS5473.1	7p14	2012-09-13			ENSG00000062582	ENSG00000062582		"""Mitochondrial ribosomal proteins / small subunits"""	14510	protein-coding gene	gene with protein product		611986				8127713, 11279123	Standard	NM_032014		Approved	MRP-S24, HSPC335	uc003tit.1	Q96EL2	OTTHUMG00000023175	ENST00000317534.5:c.183C>A	7.37:g.43908599G>T	ENSP00000318158:p.Tyr61*	Somatic		Capture	SOLID	Phase_I	43875124	NM_032014	A4D1U9|P82668|Q96Q23|Q9P047	Nonsense_Mutation	SNP	ENST00000317534.5	37	CCDS5473.1	.	.	.	.	.	.	.	.	.	.	G	36	5.656512	0.96724	.	.	ENSG00000062582	ENST00000317534	.	.	.	4.75	2.94	0.34122	.	0.378770	0.30210	N	0.010153	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.9231	0.35623	0.1854:0.0:0.8146:0.0	.	.	.	.	X	61	.	ENSP00000318158:Y61X	Y	-	3	2	MRPS24	43875124	1.000000	0.71417	0.992000	0.48379	0.892000	0.51952	1.366000	0.34193	0.425000	0.26087	0.563000	0.77884	TAC		MRPS24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250949.1	NM_032014	
TRPV6	55503	hgsc.bcm.edu	37	7	142573294	142573294	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr7:142573294C>T	ENST00000359396.3	-	8	1294	c.1049G>A	c.(1048-1050)cGc>cAc	p.R350H	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	350					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)	p.R350H(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					CTTGAGGGGGCGGTAGATGCA	0.572																																					p.R350H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1049A	7						.						127.0	125.0	126.0					7																	142573294		2203	4300	6503	142283416	SO:0001583	missense	55503	exon8			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.1049G>A	7.37:g.142573294C>T	ENSP00000352358:p.Arg350His	Somatic		Capture	SOLID	Phase_I	142283416	NM_018646	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	37	CCDS5874.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.697574	0.88830	.	.	ENSG00000165125	ENST00000359396;ENST00000311470	D	0.89485	-2.52	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.95227	0.8452	M	0.88979	2.995	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.95960	0.8961	10	0.72032	D	0.01	-25.3714	16.8604	0.86016	0.0:1.0:0.0:0.0	.	350	Q9H1D0	TRPV6_HUMAN	H	350;182	ENSP00000352358:R350H	ENSP00000310825:R182H	R	-	2	0	TRPV6	142283416	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	7.299000	0.78831	2.458000	0.83093	0.655000	0.94253	CGC		TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	NM_014274	
APMAP	57136	hgsc.bcm.edu	37	20	24950260	24950260	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr20:24950260T>G	ENST00000217456.2	-	7	1040	c.750A>C	c.(748-750)aaA>aaC	p.K250N	APMAP_ENST00000447138.1_Missense_Mutation_p.K250N	NM_020531.2	NP_065392.1	Q9HDC9	APMAP_HUMAN	adipocyte plasma membrane associated protein	250					biosynthetic process (GO:0009058)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	arylesterase activity (GO:0004064)|strictosidine synthase activity (GO:0016844)	p.K250N(1)									CCAATAAAACTTTTACTTCCC	0.532																																					p.K250N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A750C	20						.						95.0	92.0	93.0					20																	24950260		2203	4300	6503	24898260	SO:0001583	missense	57136	exon7			AB033767	CCDS13166.1	20p11.2	2012-07-20	2012-07-20	2012-07-20	ENSG00000101474	ENSG00000101474			13238	protein-coding gene	gene with protein product		615884	"""chromosome 20 open reading frame 3"""	C20orf3		10945474, 11583587, 20552250	Standard	NM_020531		Approved	BSCv	uc002wty.3	Q9HDC9	OTTHUMG00000032107	ENST00000217456.2:c.750A>C	20.37:g.24950260T>G	ENSP00000217456:p.Lys250Asn	Somatic		Capture	SOLID	Phase_I	24898260	NM_020531	A8K514|B4DXG1|Q6UVZ8|Q9GZS8|Q9NUB2	Missense_Mutation	SNP	ENST00000217456.2	37	CCDS13166.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	6.646|6.646	0.487718|0.487718	0.12641|0.12641	.|.	.|.	ENSG00000101474|ENSG00000101474	ENST00000217456;ENST00000447138|ENST00000451442	T;T|T	0.52057|0.48836	0.68;0.68|0.8	5.68|5.68	-1.46|-1.46	0.08800|0.08800	Strictosidine synthase, conserved region (1);Six-bladed beta-propeller, TolB-like (1);|.	0.285628|0.285628	0.43110|0.43110	D|D	0.000614|0.000614	T|T	0.40272|0.40272	0.1110|0.1110	L|L	0.47016|0.47016	1.485|1.485	0.39898|0.39898	D|D	0.973865|0.973865	B;B;B|.	0.17268|.	0.021;0.002;0.002|.	B;B;B|.	0.14023|.	0.01;0.004;0.01|.	T|T	0.27262|0.27262	-1.0079|-1.0079	10|8	0.41790|0.09843	T|T	0.15|0.71	-13.6284|-13.6284	11.2399|11.2399	0.48964|0.48964	0.0:0.7617:0.0:0.2383|0.0:0.7617:0.0:0.2383	.|.	250;234;250|.	Q9HDC9-2;A2A2F9;Q9HDC9|.	.;.;APMAP_HUMAN|.	N|T	250|235	ENSP00000217456:K250N;ENSP00000415373:K250N|ENSP00000395874:K235T	ENSP00000217456:K250N|ENSP00000395874:K235T	K|K	-|-	3|2	2|0	C20orf3|C20orf3	24898260|24898260	0.893000|0.893000	0.30496|0.30496	0.009000|0.009000	0.14445|0.14445	0.021000|0.021000	0.10359|0.10359	-0.037000|-0.037000	0.12164|0.12164	-0.392000|-0.392000	0.07751|0.07751	-0.912000|-0.912000	0.02778|0.02778	AAA|AAG		APMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078380.2	NM_020531	
ENTPD6	955	hgsc.bcm.edu	37	20	25205904	25205904	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr20:25205904T>G	ENST00000376652.4	+	14	1470	c.1307T>G	c.(1306-1308)gTc>gGc	p.V436G	ENTPD6_ENST00000360031.2_Missense_Mutation_p.V435G|ENTPD6_ENST00000433259.2_Silent_p.R416R|ENTPD6_ENST00000485936.1_3'UTR|ENTPD6_ENST00000354989.5_Missense_Mutation_p.V419G			O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6 (putative)	436					response to calcium ion (GO:0051592)|response to magnesium ion (GO:0032026)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	guanosine-5'-triphosphate,3'-diphosphate diphosphatase activity (GO:0008894)|nucleoside-triphosphatase activity (GO:0017111)|uridine-diphosphatase activity (GO:0045134)	p.V436G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|prostate(1)|skin(1)	27						CTCACCTACGTCAGCCTGCTA	0.612																																					p.V419G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1256G	20						.						117.0	83.0	94.0					20																	25205904		2203	4300	6503	25153904	SO:0001583	missense	955	exon13			AF039916	CCDS13170.1, CCDS46586.1	20p11.21	2010-06-24	2010-06-24		ENSG00000197586	ENSG00000197586			3368	protein-coding gene	gene with protein product		603160	"""interleukin 6 signal transducer-2"""	CD39L2, IL6ST2		9676430	Standard	NM_001247		Approved	NTPDase-6, dJ738P15.3	uc002wuj.2	O75354	OTTHUMG00000032116	ENST00000376652.4:c.1307T>G	20.37:g.25205904T>G	ENSP00000365840:p.Val436Gly	Somatic		Capture	SOLID	Phase_I	25153904	NM_001114089	A6NCX6|D3DW49|Q5QPJ2|Q5QPJ5|Q7Z5B5|Q8N3H3|Q8TAS7|Q9UJD1	Missense_Mutation	SNP	ENST00000376652.4	37	CCDS13170.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.00|14.00	2.404195|2.404195	0.42613|0.42613	.|.	.|.	ENSG00000197586|ENSG00000197586	ENST00000447877;ENST00000376666|ENST00000354989;ENST00000360031;ENST00000376652	.|T;T;T	.|0.12255	.|2.7;2.7;2.7	5.76|5.76	4.66|4.66	0.58398|0.58398	.|.	.|0.253385	.|0.44483	.|D	.|0.000448	T|T	0.28300|0.28300	0.0699|0.0699	L|L	0.61036|0.61036	1.89|1.89	0.40081|0.40081	D|D	0.976138|0.976138	.|P;P;D;D	.|0.61080	.|0.904;0.917;0.989;0.989	.|P;P;P;P	.|0.60345	.|0.664;0.713;0.873;0.873	T|T	0.02424|0.02424	-1.1161|-1.1161	5|10	.|0.87932	.|D	.|0	-14.226|-14.226	9.4365|9.4365	0.38641|0.38641	0.0:0.081:0.0:0.919|0.0:0.081:0.0:0.919	.|.	.|184;419;435;436	.|B4DHS2;O75354-2;Q5QPJ2;O75354	.|.;.;.;ENTP6_HUMAN	A|G	295;274|419;435;436	.|ENSP00000347084:V419G;ENSP00000353131:V435G;ENSP00000365840:V436G	.|ENSP00000347084:V419G	S|V	+|+	1|2	0|0	ENTPD6|ENTPD6	25153904|25153904	1.000000|1.000000	0.71417|0.71417	0.060000|0.060000	0.19600|0.19600	0.023000|0.023000	0.10783|0.10783	5.535000|5.535000	0.67173|0.67173	1.005000|1.005000	0.39183|0.39183	0.460000|0.460000	0.39030|0.39030	TCA|GTC		ENTPD6-020	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078414.2		
SULF2	55959	hgsc.bcm.edu	37	20	46385955	46385955	+	Silent	SNP	C	C	T	rs61730618	byFrequency	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	T	C	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr20:46385955C>T	ENST00000359930.4	-	2	1004	c.153G>A	c.(151-153)acG>acA	p.T51T	SULF2_ENST00000484875.1_Silent_p.T51T|SULF2_ENST00000361612.4_Silent_p.T51T|SULF2_ENST00000467815.1_Silent_p.T51T	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	51					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						CCTGGTCGTCCGTCAGCACCA	0.657													C|||	83	0.0165735	0.0008	0.013	5008	,	,		17515	0.0		0.0388	False		,,,				2504	0.0348				p.T51T												.	.	0			c.G153A	20						.	C	,,	31,4351		0,31,2160	51.0	37.0	41.0		153,153,153	-9.5	0.1	20	dbSNP_129	41	218,8342		1,216,4063	no	coding-synonymous,coding-synonymous,coding-synonymous	SULF2	NM_001161841.1,NM_018837.3,NM_198596.2	,,	1,247,6223	TT,TC,CC		2.5467,0.7074,1.924	,,	51/871,51/871,51/868	46385955	249,12693	2191	4280	6471	45819362	SO:0001819	synonymous_variant	55959	exon2			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.153G>A	20.37:g.46385955C>T		Germline		Capture	SOLID	Phase_I	45819362	NM_198596	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Silent	SNP	ENST00000359930.4	37	CCDS13408.1																																																																																				SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837	
ARID4A	5926	hgsc.bcm.edu	37	14	58795000	58795000	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr14:58795000C>T	ENST00000355431.3	+	9	1001	c.628C>T	c.(628-630)Cag>Tag	p.Q210*	ARID4A_ENST00000431317.2_Nonsense_Mutation_p.Q210*|ARID4A_ENST00000348476.3_Nonsense_Mutation_p.Q210*|ARID4A_ENST00000395168.3_Nonsense_Mutation_p.Q210*	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	210					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q210*(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GAAAAAGGATCAGTGTTTAGT	0.313																																					p.Q210X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C628T	14						.						135.0	130.0	132.0					14																	58795000		2203	4295	6498	57864753	SO:0001587	stop_gained	5926	exon9			S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.628C>T	14.37:g.58795000C>T	ENSP00000347602:p.Gln210*	None		Capture	SOLID	Phase_I	57864753	NM_023000	Q15991|Q15992|Q15993	Nonsense_Mutation	SNP	ENST00000355431.3	37	CCDS9732.1	.	.	.	.	.	.	.	.	.	.	C	39	7.873562	0.98537	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000445108;ENST00000431317	.	.	.	5.52	5.52	0.82312	.	0.107199	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-1.8404	19.5157	0.95162	0.0:1.0:0.0:0.0	.	.	.	.	X	210;210;210;173;210	.	ENSP00000344556:Q210X	Q	+	1	0	ARID4A	57864753	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.554000	0.82212	2.631000	0.89168	0.644000	0.83932	CAG		ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
ATG4D	84971	hgsc.bcm.edu	37	19	10655509	10655509	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr19:10655509C>T	ENST00000309469.4	+	2	459	c.286C>T	c.(286-288)Ctc>Ttc	p.L96F	ATG4D_ENST00000540862.1_5'Flank	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase	96	Cryptic mitochondrial signal peptide.				apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)	p.L96F(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			CAGCATCCACCTCTGTGGCCG	0.647																																					p.L96F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C286T	19						.						81.0	80.0	80.0					19																	10655509		2203	4300	6503	10516509	SO:0001583	missense	84971	exon2			AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582	ENST00000309469.4:c.286C>T	19.37:g.10655509C>T	ENSP00000311318:p.Leu96Phe	None		Capture	SOLID	Phase_I	10516509	NM_032885	Q969K0	Missense_Mutation	SNP	ENST00000309469.4	37	CCDS12241.1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.410278	0.62399	.	.	ENSG00000130734	ENST00000309469	T	0.48836	0.8	4.4	3.34	0.38264	.	0.524501	0.18714	N	0.133220	T	0.56156	0.1966	M	0.71036	2.16	0.80722	D	1	B;D;P	0.61697	0.391;0.99;0.691	B;P;B	0.54815	0.23;0.761;0.259	T	0.53208	-0.8471	10	0.29301	T	0.29	-29.9552	9.9804	0.41811	0.0:0.7934:0.2066:0.0	.	33;119;96	B4DGM8;B7ZAY9;Q86TL0	.;.;ATG4D_HUMAN	F	96	ENSP00000311318:L96F	ENSP00000311318:L96F	L	+	1	0	ATG4D	10516509	0.845000	0.29573	0.992000	0.48379	0.998000	0.95712	1.452000	0.35156	1.022000	0.39626	0.551000	0.68910	CTC		ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452022.1	NM_032885	
ATP1A3	478	hgsc.bcm.edu	37	19	42492205	42492205	+	Silent	SNP	G	G	C			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr19:42492205G>C	ENST00000302102.5	-	4	390	c.240C>G	c.(238-240)gtC>gtG	p.V80V	ATP1A3_ENST00000602133.1_Silent_p.V50V|ATP1A3_ENST00000543770.1_Silent_p.V91V|ATP1A3_ENST00000545399.1_Silent_p.V93V|ATP1A3_ENST00000468774.2_5'Flank	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	80					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.V80V(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						GGCAAAACTTGACCCACTCTG	0.642																																					p.V80V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C240G	19						.						110.0	118.0	115.0					19																	42492205		2203	4300	6503	47184045	SO:0001819	synonymous_variant	478	exon4				CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.240C>G	19.37:g.42492205G>C		Somatic		Capture	SOLID	Phase_I	47184045	NM_152296	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Silent	SNP	ENST00000302102.5	37	CCDS12594.1																																																																																				ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	
ZSCAN5A	79149	hgsc.bcm.edu	37	19	56733295	56733295	+	Silent	SNP	G	G	C	rs540386597		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr19:56733295G>C	ENST00000587340.1	-	7	1835	c.1140C>G	c.(1138-1140)ggC>ggG	p.G380G	ZSCAN5A_ENST00000254165.3_Silent_p.G263G|ZSCAN5A_ENST00000391713.1_Silent_p.G380G|ZSCAN5A_ENST00000587492.1_Silent_p.G234G|ZSCAN5A_ENST00000592355.1_Silent_p.G379G			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	380					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.G380G(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AGAGTCTCTCGCCTGTGTGTG	0.517																																					p.G380G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1140G	19						.						67.0	67.0	67.0					19																	56733295		2203	4300	6503	61425107	SO:0001819	synonymous_variant	79149	exon5			AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.1140C>G	19.37:g.56733295G>C		Somatic		Capture	SOLID	Phase_I	61425107	NM_024303	B4DX98|Q49A73|Q53F04|Q8N7B3	Silent	SNP	ENST00000587340.1	37	CCDS12941.1																																																																																				ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458110.1	NM_024303	
VPS13B	157680	hgsc.bcm.edu	37	8	100514002	100514002	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr8:100514002G>A	ENST00000358544.2	+	26	4069	c.3958G>A	c.(3958-3960)Gga>Aga	p.G1320R	VPS13B_ENST00000357162.2_Missense_Mutation_p.G1320R|VPS13B_ENST00000395996.1_Missense_Mutation_p.G1320R	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1320					protein transport (GO:0015031)			p.G1320R(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AGGAACCAGTGGACGTGTTAG	0.428																																					p.G1320R	Colon(161;2205 2542 7338 31318)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3958A	8						.						171.0	167.0	169.0					8																	100514002		2203	4300	6503	100583178	SO:0001583	missense	157680	exon26			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.3958G>A	8.37:g.100514002G>A	ENSP00000351346:p.Gly1320Arg	Somatic		Capture	SOLID	Phase_I	100583178	NM_152564	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.337952	0.41398	.	.	ENSG00000132549	ENST00000357162;ENST00000358544;ENST00000395996	T;T;T	0.70516	-0.49;-0.47;-0.16	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.81297	0.4793	L	0.54323	1.7	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.85130	0.992;0.997;0.992;0.969	T	0.77576	-0.2536	10	0.28530	T	0.3	.	19.1316	0.93410	0.0:0.0:1.0:0.0	.	1319;1320;1320;1320	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3	.;.;VP13B_HUMAN;.	R	1320	ENSP00000349685:G1320R;ENSP00000351346:G1320R;ENSP00000379318:G1320R	ENSP00000349685:G1320R	G	+	1	0	VPS13B	100583178	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.705000	0.84606	2.589000	0.87451	0.557000	0.71058	GGA		VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
COL14A1	7373	hgsc.bcm.edu	37	8	121381608	121381608	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr8:121381608C>A	ENST00000297848.3	+	47	5465	c.5195C>A	c.(5194-5196)cCt>cAt	p.P1732H	COL14A1_ENST00000247781.3_Missense_Mutation_p.P1637H|COL14A1_ENST00000309791.4_Missense_Mutation_p.P1732H	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.P1732H(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CCTGGGCCCCCTGGCTCTCCT	0.577																																					p.P1732H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5195A	8						.						50.0	54.0	53.0					8																	121381608		2203	4300	6503	121450789	SO:0001583	missense	7373	exon47				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.5195C>A	8.37:g.121381608C>A	ENSP00000297848:p.Pro1732His	Somatic		Capture	SOLID	Phase_I	121450789	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	C	19.42	3.824671	0.71143	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000440844	D;D;D;D	0.94232	-2.66;-2.69;-3.29;-3.38	4.84	4.84	0.62591	.	0.192216	0.46442	D	0.000281	D	0.91586	0.7342	M	0.79343	2.45	0.80722	D	1	P	0.45283	0.855	B	0.35971	0.215	D	0.92338	0.5879	10	0.56958	D	0.05	.	13.4332	0.61068	0.1574:0.8426:0.0:0.0	.	1732	Q05707	COEA1_HUMAN	H	1732;1732;1637;79	ENSP00000311809:P1732H;ENSP00000297848:P1732H;ENSP00000247781:P1637H;ENSP00000403640:P79H	ENSP00000247781:P1637H	P	+	2	0	COL14A1	121450789	0.871000	0.30034	1.000000	0.80357	0.993000	0.82548	3.256000	0.51492	2.618000	0.88619	0.561000	0.74099	CCT		COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
ZHX2	22882	hgsc.bcm.edu	37	8	123965958	123965958	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr8:123965958G>T	ENST00000314393.4	+	3	3043	c.2208G>T	c.(2206-2208)aaG>aaT	p.K736N		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	736					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.K736N(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			ACCCCAAAAAGCTCTGCGAAG	0.532																																					p.K736N	Esophageal Squamous(94;1056 1388 11767 13799 49639)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2208T	8						.						94.0	99.0	97.0					8																	123965958		2203	4300	6503	124035139	SO:0001583	missense	22882	exon3			AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.2208G>T	8.37:g.123965958G>T	ENSP00000314709:p.Lys736Asn	Somatic		Capture	SOLID	Phase_I	124035139	NM_014943		Missense_Mutation	SNP	ENST00000314393.4	37	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	G	4.636	0.118313	0.08881	.	.	ENSG00000178764	ENST00000314393	T	0.17854	2.25	5.41	0.427	0.16489	.	0.773311	0.12349	N	0.476704	T	0.08223	0.0205	N	0.14661	0.345	0.26053	N	0.981459	B	0.27559	0.181	B	0.21708	0.036	T	0.32719	-0.9896	10	0.34782	T	0.22	-6.6243	5.1858	0.15184	0.2284:0.0942:0.5809:0.0965	.	736	Q9Y6X8	ZHX2_HUMAN	N	736	ENSP00000314709:K736N	ENSP00000314709:K736N	K	+	3	2	ZHX2	124035139	0.912000	0.30974	0.697000	0.30258	0.156000	0.22039	1.373000	0.34272	-0.320000	0.08640	-1.134000	0.01955	AAG		ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
KCNQ3	3786	hgsc.bcm.edu	37	8	133141552	133141552	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr8:133141552C>A	ENST00000388996.4	-	15	2996	c.2576G>T	c.(2575-2577)gGg>gTg	p.G859V	KCNQ3_ENST00000521134.1_Missense_Mutation_p.G739V|KCNQ3_ENST00000519445.1_Missense_Mutation_p.G847V	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	859					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.G859V(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	ATCAGAAATCCCATCCCCTGT	0.537																																					p.G859V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2576T	8						.						77.0	63.0	68.0					8																	133141552		2203	4300	6503	133210734	SO:0001583	missense	3786	exon15			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.2576G>T	8.37:g.133141552C>A	ENSP00000373648:p.Gly859Val	Somatic		Capture	SOLID	Phase_I	133210734	NM_004519	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	37	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	C	18.59	3.657065	0.67586	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	T;T;T	0.48836	0.8;0.8;0.8	5.36	4.46	0.54185	.	0.050052	0.85682	N	0.000000	T	0.49287	0.1548	L	0.55481	1.735	0.80722	D	1	P;P	0.50617	0.777;0.937	P;P	0.46940	0.532;0.532	T	0.47535	-0.9110	10	0.37606	T	0.19	-22.1858	14.263	0.66097	0.15:0.85:0.0:0.0	.	847;859	E7ET42;O43525	.;KCNQ3_HUMAN	V	859;739;847;836;738	ENSP00000373648:G859V;ENSP00000429799:G739V;ENSP00000428790:G847V	ENSP00000373648:G859V	G	-	2	0	KCNQ3	133210734	1.000000	0.71417	0.320000	0.25306	0.987000	0.75469	7.175000	0.77632	1.203000	0.43233	0.561000	0.74099	GGG		KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
TBX15	6913	hgsc.bcm.edu	37	1	119427490	119427490	+	Silent	SNP	C	C	A			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr1:119427490C>A	ENST00000369429.3	-	8	1683	c.1674G>T	c.(1672-1674)ctG>ctT	p.L558L	TBX15_ENST00000207157.3_Silent_p.L452L			Q96SF7	TBX15_HUMAN	T-box 15	558					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.L452L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		TCCCTGACGGCAGGTACTGCC	0.552																																					p.L452L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1356T	1						.						86.0	79.0	82.0					1																	119427490		2203	4300	6503	119229013	SO:0001819	synonymous_variant	6913	exon8			AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.1674G>T	1.37:g.119427490C>A		Somatic		Capture	SOLID	Phase_I	119229013	NM_152380	Q08E76|Q5JT54|Q5T9S7	Silent	SNP	ENST00000369429.3	37																																																																																					TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000034351.1	NM_152380	
ZFYVE9	9372	hgsc.bcm.edu	37	1	52810593	52810593	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr1:52810593C>T	ENST00000371591.1	+	17	4224	c.4093C>T	c.(4093-4095)Cgt>Tgt	p.R1365C	ZFYVE9_ENST00000287727.3_Missense_Mutation_p.R1365C|ZFYVE9_ENST00000357206.2_Missense_Mutation_p.R1306C	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	1365					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)	p.R1365C(1)		breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						ACTGGGACTACGTGTGACACT	0.458																																					p.R1306C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3916T	1						.						147.0	128.0	134.0					1																	52810593		2203	4300	6503	52583181	SO:0001583	missense	9372	exon17			AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.4093C>T	1.37:g.52810593C>T	ENSP00000360647:p.Arg1365Cys	Somatic		Capture	SOLID	Phase_I	52583181	NM_007324	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	ENST00000371591.1	37	CCDS563.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.351164	0.82132	.	.	ENSG00000157077	ENST00000357206;ENST00000287727;ENST00000371591	T;T;T	0.70749	-0.29;-0.51;-0.51	5.16	5.16	0.70880	Domain of unknown function DUF3480 (1);	0.109084	0.64402	D	0.000011	D	0.84306	0.5443	M	0.84082	2.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.988	D	0.86165	0.1596	10	0.87932	D	0	.	13.4251	0.61020	0.1569:0.843:0.0:0.0	.	1306;1365	O95405-2;O95405	.;ZFYV9_HUMAN	C	1306;1365;1365	ENSP00000349737:R1306C;ENSP00000287727:R1365C;ENSP00000360647:R1365C	ENSP00000287727:R1365C	R	+	1	0	ZFYVE9	52583181	0.991000	0.36638	0.987000	0.45799	0.996000	0.88848	2.915000	0.48805	2.676000	0.91093	0.655000	0.94253	CGT		ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324	
LRRC7	57554	hgsc.bcm.edu	37	1	70225900	70225900	+	Missense_Mutation	SNP	C	C	T	rs150507629		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr1:70225900C>T	ENST00000035383.5	+	1	43	c.13C>T	c.(13-15)Cgg>Tgg	p.R5W	LRRC7_ENST00000370958.1_Missense_Mutation_p.R43W|LRRC7_ENST00000310961.5_Missense_Mutation_p.R10W|LRRC7_ENST00000415775.2_5'UTR	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	5						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.R5W(2)|p.R43W(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GACCACCAAACGGAAAATCAT	0.458																																					p.R5W												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.C13T	1						.	C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	38.0	39.0	39.0		13	4.8	1.0	1	dbSNP_134	39	0,8596		0,0,4298	no	missense	LRRC7	NM_020794.2	101	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	5/1538	70225900	1,13001	2203	4298	6501	69998488	SO:0001583	missense	57554	exon1				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.13C>T	1.37:g.70225900C>T	ENSP00000035383:p.Arg5Trp	None		Capture	SOLID	Phase_I	69998488	NM_020794	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	CCDS645.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.027422	0.75390	2.27E-4	0.0	ENSG00000033122	ENST00000310961;ENST00000370958;ENST00000035383;ENST00000335298	T;T;T	0.48522	0.95;1.05;0.81	5.77	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.45558	0.1348	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.50684	-0.8799	10	0.87932	D	0	.	12.9121	0.58184	0.3236:0.6764:0.0:0.0	.	5;43	Q96NW7;B1AKT2	LRRC7_HUMAN;.	W	10;43;5;5	ENSP00000309245:R10W;ENSP00000359997:R43W;ENSP00000035383:R5W	ENSP00000035383:R5W	R	+	1	2	LRRC7	69998488	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.075000	0.41538	2.729000	0.93468	0.557000	0.71058	CGG		LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794	
LRRC53	100144878	hgsc.bcm.edu	37	1	74957900	74957900	+	Intron	SNP	C	C	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr1:74957900C>T	ENST00000294635.4	-	2	89				TNNI3K_ENST00000326637.3_Silent_p.F767F|FPGT-TNNI3K_ENST00000557284.2_Silent_p.F881F|TNNI3K_ENST00000370891.2_Silent_p.F868F			A6NM62	LRC53_HUMAN	leucine rich repeat containing 53							integral component of membrane (GO:0016021)		p.F767F(1)		NS(1)|breast(1)|lung(2)	4						GAAGTCGTTTCGAATTGGAAT	0.453																																					p.F767F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2301T	1						.						193.0	195.0	194.0					1																	74957900		2203	4300	6503	74730488	SO:0001627	intron_variant	51086	exon23					1p31.3	2010-08-31			ENSG00000162621	ENSG00000162621			25255	protein-coding gene	gene with protein product							Standard			Approved			A6NM62	OTTHUMG00000009621	ENST00000294635.4:c.26-8841G>A	1.37:g.74957900C>T		Somatic		Capture	SOLID	Phase_I	74730488	NM_015978		Silent	SNP	ENST00000294635.4	37																																																																																					LRRC53-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000026515.2		
SMG7	9887	hgsc.bcm.edu	37	1	183511583	183511583	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr1:183511583G>T	ENST00000347615.2	+	14	1907	c.1788G>T	c.(1786-1788)aaG>aaT	p.K596N	SMG7_ENST00000367537.3_Intron|SMG7_ENST00000507469.1_Intron|SMG7_ENST00000515829.2_Intron|SMG7_ENST00000456731.2_Intron|SMG7_ENST00000508461.1_Missense_Mutation_p.K554N	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	596					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)	p.K596N(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						CTGAAACCAAGAAATGCACCT	0.408																																					p.K554N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1662T	1						.						99.0	96.0	97.0					1																	183511583		2203	4300	6503	181778206	SO:0001583	missense	9887	exon13			D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.1788G>T	1.37:g.183511583G>T	ENSP00000340766:p.Lys596Asn	Somatic		Capture	SOLID	Phase_I	181778206	NM_001174061	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	ENST00000347615.2	37	CCDS1355.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.732116	0.69189	.	.	ENSG00000116698	ENST00000508461;ENST00000347615	T;T	0.50548	0.74;0.74	4.66	4.66	0.58398	.	.	.	.	.	T	0.40067	0.1102	L	0.29908	0.895	0.80722	D	1	P;P	0.48407	0.91;0.91	B;B	0.42882	0.401;0.289	T	0.22941	-1.0202	8	.	.	.	.	17.5373	0.87835	0.0:0.0:1.0:0.0	.	554;596	E9PCI0;Q92540	.;SMG7_HUMAN	N	554;596	ENSP00000426915:K554N;ENSP00000340766:K596N	.	K	+	3	2	SMG7	181778206	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.896000	0.75665	2.281000	0.76405	0.561000	0.74099	AAG		SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000085432.1	NM_014837	
MAP4K2	5871	hgsc.bcm.edu	37	11	64566900	64566900	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr11:64566900T>C	ENST00000294066.2	-	14	1137	c.1046A>G	c.(1045-1047)aAt>aGt	p.N349S	MAP4K2_ENST00000377350.3_Missense_Mutation_p.N349S|MAP4K2_ENST00000468062.1_5'Flank	NM_004579.3	NP_004570.2	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase kinase 2	349	PEST2.				activation of JUN kinase activity (GO:0007257)|immune response (GO:0006955)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|positive regulation of JNK cascade (GO:0046330)|protein phosphorylation (GO:0006468)|vesicle targeting (GO:0006903)	Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.N349S(1)		cervix(1)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(2)	8						CACCGGCTCATTCAGTGGGTC	0.597																																					p.N349S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1046G	11						.						90.0	82.0	85.0					11																	64566900		2201	4297	6498	64323476	SO:0001583	missense	5871	exon14			BC047865	CCDS8082.1	11q13.1	2011-06-09			ENSG00000168067	ENSG00000168067		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6864	protein-coding gene	gene with protein product		603166		RAB8IP		7515885	Standard	NM_004579		Approved	GCK, BL44	uc001obh.3	Q12851	OTTHUMG00000045328	ENST00000294066.2:c.1046A>G	11.37:g.64566900T>C	ENSP00000294066:p.Asn349Ser	Somatic		Capture	SOLID	Phase_I	64323476	NM_004579	Q86VU3	Missense_Mutation	SNP	ENST00000294066.2	37	CCDS8082.1	.	.	.	.	.	.	.	.	.	.	T	6.431	0.447568	0.12223	.	.	ENSG00000168067	ENST00000294066;ENST00000377350;ENST00000439069	T;T;T	0.13420	2.59;2.59;2.59	5.14	0.913	0.19354	.	0.552015	0.18737	N	0.132577	T	0.03871	0.0109	N	0.03608	-0.345	0.19945	N	0.999945	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.42015	-0.9476	10	0.08381	T	0.77	.	3.4663	0.07550	0.0:0.2474:0.1995:0.5531	.	349;349	Q86VU3;Q12851	.;M4K2_HUMAN	S	349;349;305	ENSP00000294066:N349S;ENSP00000366567:N349S;ENSP00000403563:N305S	ENSP00000294066:N349S	N	-	2	0	MAP4K2	64323476	0.000000	0.05858	0.222000	0.23844	0.706000	0.40770	-0.528000	0.06193	0.327000	0.23409	0.456000	0.33151	AAT		MAP4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105239.1	NM_004579	
BBS1	582	hgsc.bcm.edu	37	11	66299434	66299434	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr11:66299434C>T	ENST00000318312.7	+	17	1759	c.1708C>T	c.(1708-1710)Cga>Tga	p.R570*	ZDHHC24_ENST00000526986.1_Intron|BBS1_ENST00000393994.2_3'UTR|CTD-3074O7.11_ENST00000419755.3_Nonsense_Mutation_p.R607*|BBS1_ENST00000455748.2_Nonsense_Mutation_p.R473*	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	570					cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)	p.R570*(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						GCTGGTGCTTCGAGAAGGCCA	0.652									Bardet-Biedl syndrome																												p.R570X	GBM(152;173 2612 9770 10137)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1708T	11						.						43.0	36.0	38.0					11																	66299434		2197	4293	6490	66056010	SO:0001587	stop_gained	582	exon17	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.1708C>T	11.37:g.66299434C>T	ENSP00000317469:p.Arg570*	Somatic		Capture	SOLID	Phase_I	66056010	NM_024649	Q32MM9|Q32MN0|Q96SN4	Nonsense_Mutation	SNP	ENST00000318312.7	37	CCDS8142.1	.	.	.	.	.	.	.	.	.	.	C	37	6.061050	0.97246	.	.	ENSG00000256349;ENSG00000174483;ENSG00000174483	ENST00000419755;ENST00000318312;ENST00000455748	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.1274	0.48325	0.1839:0.8161:0.0:0.0	.	.	.	.	X	607;570;473	.	ENSP00000317469:R570X	R	+	1	2	BBS1;CTD-3074O7.11	66056010	0.990000	0.36364	0.992000	0.48379	0.984000	0.73092	2.603000	0.46266	2.682000	0.91365	0.585000	0.79938	CGA		BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393235.2		
CPT1A	1374	hgsc.bcm.edu	37	11	68548146	68548146	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr11:68548146A>G	ENST00000265641.5	-	12	1574	c.1420T>C	c.(1420-1422)Tcc>Ccc	p.S474P	CPT1A_ENST00000539743.1_Missense_Mutation_p.S474P|CPT1A_ENST00000376618.2_Missense_Mutation_p.S474P|CPT1A_ENST00000540367.1_Missense_Mutation_p.S474P	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	474					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	TCTGCCCAGGAGTGTTCAGCG	0.483																																					p.S474P												.	.	0			c.T1420C	11						.						133.0	113.0	119.0					11																	68548146		2200	4294	6494	68304722	SO:0001583	missense	1374	exon12			L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1420T>C	11.37:g.68548146A>G	ENSP00000265641:p.Ser474Pro	None		Capture	SOLID	Phase_I	68304722	NM_001031847	Q8TCU0|Q9BWK0	Missense_Mutation	SNP	ENST00000265641.5	37	CCDS8185.1	.	.	.	.	.	.	.	.	.	.	A	17.02	3.282289	0.59867	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.93659	-3.26;-3.26;-3.26;-3.26	5.19	2.65	0.31530	.	0.000000	0.85682	D	0.000000	D	0.97501	0.9182	H	0.97390	3.995	0.80722	D	1	D;D	0.69078	0.994;0.997	D;D	0.71656	0.974;0.972	D	0.97637	1.0146	10	0.87932	D	0	.	11.9373	0.52880	0.753:0.247:0.0:0.0	.	474;474	P50416;P50416-2	CPT1A_HUMAN;.	P	474	ENSP00000439084:S474P;ENSP00000365803:S474P;ENSP00000265641:S474P;ENSP00000446108:S474P	ENSP00000265641:S474P	S	-	1	0	CPT1A	68304722	1.000000	0.71417	1.000000	0.80357	0.349000	0.29174	5.643000	0.67895	1.962000	0.57031	0.533000	0.62120	TCC		CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876	
SIM1	6492	hgsc.bcm.edu	37	6	100841378	100841378	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr6:100841378C>T	ENST00000369208.3	-	11	2337	c.1555G>A	c.(1555-1557)Gtc>Atc	p.V519I	SIM1_ENST00000262901.4_Missense_Mutation_p.V519I			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	519	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.V519I(1)		breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		ATCCTGTGGACTGAAGCGATG	0.557																																					p.V519I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1555A	6						.						111.0	104.0	106.0					6																	100841378		2203	4300	6503	100948099	SO:0001583	missense	6492	exon10			U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.1555G>A	6.37:g.100841378C>T	ENSP00000358210:p.Val519Ile	Somatic		Capture	SOLID	Phase_I	100948099	NM_005068	Q5TDP7	Missense_Mutation	SNP	ENST00000369208.3	37	CCDS5045.1	.	.	.	.	.	.	.	.	.	.	C	0.050	-1.252856	0.01457	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.33438	1.41;1.41	5.78	4.0	0.46444	Single-minded, C-terminal (2);	1.083120	0.06897	N	0.805334	T	0.04998	0.0134	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40553	-0.9557	10	0.18276	T	0.48	.	11.1884	0.48671	0.0:0.7994:0.0:0.2006	.	519	P81133	SIM1_HUMAN	I	519	ENSP00000358210:V519I;ENSP00000262901:V519I	ENSP00000262901:V519I	V	-	1	0	SIM1	100948099	0.006000	0.16342	0.004000	0.12327	0.058000	0.15608	1.428000	0.34892	0.781000	0.33589	-0.122000	0.15005	GTC		SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041628.3	NM_005068	
F13A1	2162	hgsc.bcm.edu	37	6	6174830	6174830	+	Missense_Mutation	SNP	G	G	A	rs143711562	byFrequency	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr6:6174830G>A	ENST00000264870.3	-	12	1995	c.1730C>T	c.(1729-1731)aCg>aTg	p.T577M		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	577					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.T577M(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	GGGCTCCAGCGTCACGTCGAA	0.512													G|||	5	0.000998403	0.0008	0.0	5008	,	,		18423	0.0		0.004	False		,,,				2504	0.0				p.T577M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1730T	6						.	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	251.0	223.0	233.0		1730	-4.9	0.0	6	dbSNP_134	233	25,8575	17.3+/-56.4	0,25,4275	yes	missense	F13A1	NM_000129.3	81	0,26,6477	AA,AG,GG		0.2907,0.0227,0.1999	benign	577/733	6174830	26,12980	2203	4300	6503	6119829	SO:0001583	missense	2162	exon12			M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1730C>T	6.37:g.6174830G>A	ENSP00000264870:p.Thr577Met	Somatic		Capture	SOLID	Phase_I	6119829	NM_000129	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	ENST00000264870.3	37	CCDS4496.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	G	5.273	0.235816	0.10023	2.27E-4	0.002907	ENSG00000124491	ENST00000264870;ENST00000441301	T	0.70749	-0.51	5.77	-4.92	0.03075	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.949218	0.08841	N	0.885816	T	0.43144	0.1234	M	0.76002	2.32	0.09310	N	1	B;B	0.32918	0.321;0.39	B;B	0.26517	0.07;0.043	T	0.46205	-0.9208	10	0.56958	D	0.05	.	6.1051	0.20069	0.3301:0.0:0.3672:0.3027	.	514;577	F5H080;P00488	.;F13A_HUMAN	M	577;514	ENSP00000264870:T577M	ENSP00000264870:T577M	T	-	2	0	F13A1	6119829	0.000000	0.05858	0.000000	0.03702	0.229000	0.25112	-0.440000	0.06888	-0.759000	0.04684	-0.963000	0.02626	ACG		F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129	
NOTCH4	4855	hgsc.bcm.edu	37	6	32184986	32184986	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr6:32184986G>A	ENST00000375023.3	-	10	1820	c.1682C>T	c.(1681-1683)gCc>gTc	p.A561V	NOTCH4_ENST00000465528.1_5'Flank	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	561	EGF-like 14; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.A561V(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CCCACCATTGGCACAGGGAGA	0.627																																					p.P561L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1682T	6						.						70.0	57.0	62.0					6																	32184986		1511	2709	4220	32292964	SO:0001583	missense	4855	exon10				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1682C>T	6.37:g.32184986G>A	ENSP00000364163:p.Ala561Val	None		Capture	SOLID	Phase_I	32292964	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.263339	0.23051	.	.	ENSG00000204301	ENST00000375023	D	0.88509	-2.39	4.03	4.03	0.46877	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.40385	N	0.001107	T	0.72985	0.3529	N	0.17345	0.48	0.80722	D	1	P;B	0.41498	0.752;0.002	P;B	0.46208	0.507;0.044	T	0.71619	-0.4538	10	0.14656	T	0.56	.	9.3125	0.37915	0.0:0.0:0.7857:0.2143	.	561;561	Q6P3V5;Q99466	.;NOTC4_HUMAN	V	561	ENSP00000364163:A561V	ENSP00000364163:A561V	A	-	2	0	NOTCH4	32292964	0.000000	0.05858	0.960000	0.40013	0.483000	0.33249	0.031000	0.13710	2.233000	0.73108	0.563000	0.77884	GCC		NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
HLA-DOA	3111	hgsc.bcm.edu	37	6	32975251	32975251	+	Silent	SNP	G	G	A			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr6:32975251G>A	ENST00000229829.5	-	3	525	c.450C>T	c.(448-450)aaC>aaT	p.N150N	HLA-DOA_ENST00000495532.1_5'UTR|HLA-DOA_ENST00000450833.2_Silent_p.N120N	NM_002119.3	NP_002110.1	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO alpha	150	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)	p.N150N(1)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	9						CAGTTTGGCCGTTGCGCAGCC	0.587																																					p.N150N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C450T	6						.						184.0	173.0	177.0					6																	32975251		1511	2709	4220	33083229	SO:0001819	synonymous_variant	3111	exon3			M31525	CCDS4763.1	6p21.3	2013-01-11		2001-10-05	ENSG00000204252	ENSG00000204252		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4936	protein-coding gene	gene with protein product		142930		HLA-DZA, HLA-DNA		2370084	Standard	XM_005272804		Approved	HLA-D0-alpha	uc003ocr.3	P06340	OTTHUMG00000031211	ENST00000229829.5:c.450C>T	6.37:g.32975251G>A		Somatic		Capture	SOLID	Phase_I	33083229	NM_002119	Q58HU0|Q58HU1|Q5STC7|Q9TQC6|Q9TQC7|Q9TQC8|Q9TQC9|Q9TQD0|Q9TQD1|Q9TQD2|Q9TQD3	Silent	SNP	ENST00000229829.5	37	CCDS4763.1																																																																																				HLA-DOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076426.2	NM_002119	
DNAH8	1769	hgsc.bcm.edu	37	6	38919282	38919282	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr6:38919282A>T	ENST00000359357.3	+	80	12040	c.11786A>T	c.(11785-11787)aAg>aTg	p.K3929M	DNAH8_ENST00000441566.1_Missense_Mutation_p.K3893M|RP1-207H1.3_ENST00000416948.1_RNA|DNAH8_ENST00000449981.2_Missense_Mutation_p.K4146M			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3929	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K3929M(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GCATTGGCCAAGAAACTGAAA	0.398																																					p.K3929M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A11786T	6						.						160.0	170.0	167.0					6																	38919282		2203	4300	6503	39027260	SO:0001583	missense	1769	exon80			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.11786A>T	6.37:g.38919282A>T	ENSP00000352312:p.Lys3929Met	Somatic		Capture	SOLID	Phase_I	39027260	NM_001371	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	A	19.91	3.914797	0.72983	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.10382	2.88;2.88;2.88	5.69	5.69	0.88448	Dynein heavy chain (1);	0.147301	0.64402	D	0.000017	T	0.36663	0.0975	H	0.97732	4.065	0.54753	D	0.999982	D;D	0.89917	1.0;1.0	D;D	0.81914	0.991;0.995	T	0.55547	-0.8124	10	0.87932	D	0	.	8.8291	0.35074	0.8891:0.0:0.1109:0.0	.	3893;3929	Q96JB1-2;Q96JB1	.;DYH8_HUMAN	M	4134;4134;3929;3893	ENSP00000333363:K4134M;ENSP00000352312:K3929M;ENSP00000402294:K3893M	ENSP00000333363:K4134M	K	+	2	0	DNAH8	39027260	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.102000	0.71486	2.296000	0.77279	0.533000	0.62120	AAG		DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
IL17F	112744	hgsc.bcm.edu	37	6	52101768	52101768	+	Silent	SNP	G	G	T	rs148267766		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr6:52101768G>T	ENST00000336123.4	-	3	560	c.453C>A	c.(451-453)ggC>ggA	p.G151G		NM_052872.3	NP_443104.1	Q96PD4	IL17F_HUMAN	interleukin 17F	151					cartilage development (GO:0051216)|cytokine biosynthetic process (GO:0042089)|inflammatory response (GO:0006954)|lymphotoxin A biosynthetic process (GO:0042109)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteoglycan metabolic process (GO:0006029)|regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045423)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of interleukin-8 biosynthetic process (GO:0045414)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine binding (GO:0019955)|protein homodimerization activity (GO:0042803)	p.G151G(1)		NS(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)	14	Lung NSC(77;0.116)					CGCAGGTGCAGCCAACAGTCA	0.542																																					p.G151G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C453A	6						.						91.0	80.0	84.0					6																	52101768		2203	4300	6503	52209727	SO:0001819	synonymous_variant	112744	exon3			AF384857	CCDS4938.1	6p12	2014-09-17			ENSG00000112116	ENSG00000112116		"""Interleukins and interleukin receptors"""	16404	protein-coding gene	gene with protein product		606496				11591732, 11591768	Standard	NM_052872		Approved	IL-17F, ML-1, ML1	uc003pam.1	Q96PD4	OTTHUMG00000014845	ENST00000336123.4:c.453C>A	6.37:g.52101768G>T		Somatic		Capture	SOLID	Phase_I	52209727	NM_052872	Q6NSI0|Q7Z6P4|Q96PI8|Q9NUE6	Silent	SNP	ENST00000336123.4	37	CCDS4938.1																																																																																				IL17F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040901.3	NM_052872	
DDX43	55510	hgsc.bcm.edu	37	6	74117253	74117253	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr6:74117253G>A	ENST00000370336.4	+	8	1110	c.952G>A	c.(952-954)Ggc>Agc	p.G318S	DDX43_ENST00000479773.1_3'UTR|DDX43_ENST00000539829.1_3'UTR	NM_018665.2	NP_061135.2	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43	318	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.G318S(1)		NS(1)|breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						GAATAGACCCGGCATGTTAGT	0.363																																					p.G318S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G952A	6						.						137.0	147.0	144.0					6																	74117253		2203	4300	6503	74173974	SO:0001583	missense	55510	exon8				CCDS4977.1	6q13	2014-01-21			ENSG00000080007	ENSG00000080007		"""DEAD-boxes"""	18677	protein-coding gene	gene with protein product	"""cancer/testis antigen 13"""	606286				10919659	Standard	NM_018665		Approved	HAGE, DKFZp434H2114, CT13	uc003pgw.3	Q9NXZ2	OTTHUMG00000015033	ENST00000370336.4:c.952G>A	6.37:g.74117253G>A	ENSP00000359361:p.Gly318Ser	None		Capture	SOLID	Phase_I	74173974	NM_018665	B4E0C8|Q6NXR1	Missense_Mutation	SNP	ENST00000370336.4	37	CCDS4977.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.605676	0.28623	.	.	ENSG00000080007	ENST00000370336	T	0.14144	2.53	4.91	4.91	0.64330	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.051323	0.85682	D	0.000000	T	0.02571	0.0078	N	0.03253	-0.375	0.80722	D	1	P	0.52170	0.951	B	0.43018	0.405	T	0.28522	-1.0041	10	0.06099	T	0.92	-0.8098	17.2093	0.86926	0.0:0.0:1.0:0.0	.	318	Q9NXZ2	DDX43_HUMAN	S	318	ENSP00000359361:G318S	ENSP00000359361:G318S	G	+	1	0	DDX43	74173974	1.000000	0.71417	0.926000	0.36857	0.006000	0.05464	8.213000	0.89758	2.419000	0.82065	0.655000	0.94253	GGC		DDX43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041219.3	NM_018665	
PLG	5340	hgsc.bcm.edu	37	6	161135915	161135915	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr6:161135915A>G	ENST00000308192.9	+	6	700	c.637A>G	c.(637-639)Agc>Ggc	p.S213G		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	213	Kringle 2. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.S213G(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	GGACTCTCAGAGCCCACACGC	0.463																																					p.S213G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A637G	6						.						64.0	60.0	61.0					6																	161135915		2203	4300	6503	161055905	SO:0001583	missense	5340	exon6			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.637A>G	6.37:g.161135915A>G	ENSP00000308938:p.Ser213Gly	None		Capture	SOLID	Phase_I	161055905	NM_000301	Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	ENST00000308192.9	37	CCDS5279.1	.	.	.	.	.	.	.	.	.	.	A	10.32	1.318405	0.23994	.	.	ENSG00000122194	ENST00000308192	T	0.62941	-0.01	5.77	3.09	0.35607	Kringle (4);Kringle-like fold (1);	1.076240	0.07322	U	0.877729	T	0.39517	0.1081	M	0.69523	2.12	0.09310	N	1	B	0.30361	0.277	B	0.31390	0.129	T	0.39623	-0.9605	10	0.17369	T	0.5	.	8.3399	0.32237	0.7715:0.0:0.2285:0.0	.	213	P00747	PLMN_HUMAN	G	213	ENSP00000308938:S213G	ENSP00000308938:S213G	S	+	1	0	PLG	161055905	0.167000	0.22975	0.128000	0.21923	0.950000	0.60333	0.840000	0.27600	1.024000	0.39682	0.533000	0.62120	AGC		PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301	
MYH1	4619	hgsc.bcm.edu	37	17	10401083	10401083	+	Missense_Mutation	SNP	C	C	T	rs139860229		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr17:10401083C>T	ENST00000226207.5	-	31	4427	c.4333G>A	c.(4333-4335)Gcc>Acc	p.A1445T	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1445			A -> T (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.A1445T(2)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TTGTCCAGGGCGGCACAGGCA	0.448																																					p.A1445T												MYH1,breast,NS,Substitution - Missense,0	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.G4333A	17						.	C	THR/ALA	2,4404	4.2+/-10.8	0,2,2201	130.0	125.0	127.0		4333	5.7	1.0	17	dbSNP_134	127	0,8600		0,0,4300	no	missense	MYH1	NM_005963.3	58	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	1445/1940	10401083	2,13004	2203	4300	6503	10341808	SO:0001583	missense	4619	exon31				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.4333G>A	17.37:g.10401083C>T	ENSP00000226207:p.Ala1445Thr	None		Capture	SOLID	Phase_I	10341808	NM_005963	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.235771	0.39498	4.54E-4	0.0	ENSG00000109061	ENST00000226207;ENST00000379814	D	0.83419	-1.72	5.65	5.65	0.86999	Myosin tail (1);	0.000000	0.42964	U	0.000638	D	0.84714	0.5533	M	0.78456	2.415	0.46701	D	0.999161	B	0.15473	0.013	B	0.15052	0.012	T	0.79976	-0.1576	10	0.42905	T	0.14	.	20.073	0.97731	0.0:1.0:0.0:0.0	.	1445	P12882	MYH1_HUMAN	T	1445;534	ENSP00000226207:A1445T	ENSP00000226207:A1445T	A	-	1	0	MYH1	10341808	0.551000	0.26497	0.966000	0.40874	0.630000	0.37929	1.450000	0.35134	2.811000	0.96726	0.655000	0.94253	GCC		MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
COL1A1	1277	hgsc.bcm.edu	37	17	48268203	48268203	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr17:48268203C>G	ENST00000225964.5	-	33	2436	c.2318G>C	c.(2317-2319)gGc>gCc	p.G773A		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	773	Triple-helical region.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	ACCAGCAGGGCCAGGAGGACC	0.622			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																														p.G773A			Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	.	.	0			c.G2318C	17						.						84.0	72.0	76.0					17																	48268203		2203	4300	6503	45623202	SO:0001583	missense	1277	exon33			Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.2318G>C	17.37:g.48268203C>G	ENSP00000225964:p.Gly773Ala	None		Capture	SOLID	Phase_I	45623202	NM_000088	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	ENST00000225964.5	37	CCDS11561.1	.	.	.	.	.	.	.	.	.	.	C	19.58	3.854801	0.71719	.	.	ENSG00000108821	ENST00000225964	D	0.99607	-6.27	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.99760	0.9903	H	0.96175	3.78	0.80722	D	1	D	0.67145	0.996	D	0.83275	0.996	D	0.96962	0.9702	10	0.87932	D	0	.	16.3998	0.83635	0.0:1.0:0.0:0.0	.	773	P02452	CO1A1_HUMAN	A	773	ENSP00000225964:G773A	ENSP00000225964:G773A	G	-	2	0	COL1A1	45623202	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.689000	0.84165	2.158000	0.67659	0.462000	0.41574	GGC		COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2		
STXBP4	252983	hgsc.bcm.edu	37	17	53155448	53155448	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr17:53155448C>G	ENST00000376352.2	+	14	1405	c.1198C>G	c.(1198-1200)Cag>Gag	p.Q400E	STXBP4_ENST00000434978.2_Missense_Mutation_p.Q378E	NM_178509.5	NP_848604.3	Q6ZWJ1	STXB4_HUMAN	syntaxin binding protein 4	400					cellular response to DNA damage stimulus (GO:0006974)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of keratinocyte proliferation (GO:0010838)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.Q400E(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19						GGAAAGTGTTCAGGATTTAAA	0.338																																					p.Q400E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1198G	17						.						82.0	83.0	83.0					17																	53155448		2203	4300	6503	50510447	SO:0001583	missense	252983	exon14			BC041485	CCDS11584.2	17q22	2008-02-05			ENSG00000166263	ENSG00000166263			19694	protein-coding gene	gene with protein product		610415				12855681	Standard	XM_005257187		Approved	Synip, MGC50337	uc002iuf.1	Q6ZWJ1	OTTHUMG00000074043	ENST00000376352.2:c.1198C>G	17.37:g.53155448C>G	ENSP00000365530:p.Gln400Glu	Somatic		Capture	SOLID	Phase_I	50510447	NM_178509	Q8IVZ5	Missense_Mutation	SNP	ENST00000376352.2	37	CCDS11584.2	.	.	.	.	.	.	.	.	.	.	C	12.07	1.826606	0.32329	.	.	ENSG00000166263	ENST00000376352;ENST00000434978	T;T	0.49432	0.78;0.78	5.33	5.33	0.75918	.	0.159950	0.56097	D	0.000034	T	0.44307	0.1287	M	0.65320	2	0.80722	D	1	B;B	0.32350	0.307;0.366	B;B	0.27170	0.051;0.077	T	0.42666	-0.9438	10	0.45353	T	0.12	-3.1791	13.3593	0.60646	0.1575:0.8425:0.0:0.0	.	378;400	E7EPP7;Q6ZWJ1	.;STXB4_HUMAN	E	400;378	ENSP00000365530:Q400E;ENSP00000391087:Q378E	ENSP00000365530:Q400E	Q	+	1	0	STXBP4	50510447	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	3.872000	0.56085	2.644000	0.89710	0.655000	0.94253	CAG		STXBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157184.1	NM_178509	
SLC39A11	201266	hgsc.bcm.edu	37	17	70943964	70943964	+	Silent	SNP	C	C	T	rs138248966	byFrequency	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr17:70943964C>T	ENST00000542342.2	-	5	445	c.357G>A	c.(355-357)acG>acA	p.T119T	SLC39A11_ENST00000579732.1_Silent_p.T119T|SLC39A11_ENST00000255559.3_Silent_p.T119T	NM_001159770.1	NP_001153242.1	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11	119					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)	p.T119T(1)		endometrium(1)|large_intestine(4)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						TCTTCATCAACGTAGAGCCGA	0.527													C|||	5	0.000998403	0.0	0.0	5008	,	,		19344	0.005		0.0	False		,,,				2504	0.0				p.T119T	NSCLC(95;736 1527 12296 39625 41839)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G357A	17						.						125.0	111.0	116.0					17																	70943964		2203	4300	6503	68455559	SO:0001819	synonymous_variant	201266	exon5			AF331643	CCDS11690.1, CCDS54160.1	17q24.3-q25.1	2014-08-12	2013-07-17	2003-10-24	ENSG00000133195	ENSG00000133195		"""Solute carriers"""	14463	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 26"""	C17orf26		11707075	Standard	NM_139177		Approved		uc002jjb.3	Q8N1S5	OTTHUMG00000178306	ENST00000542342.2:c.357G>A	17.37:g.70943964C>T		Somatic		Capture	SOLID	Phase_I	68455559	NM_001159770	B2R8H7|Q8WZ81	Silent	SNP	ENST00000542342.2	37	CCDS54160.1																																																																																				SLC39A11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441442.1		
TP53	7157	hgsc.bcm.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R175H	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,lung,NS,Substitution - Missense,0	.	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	c.G524A	17	GRCh37	CM062017|CM951224	TP53	M	rs28934578	.						50.0	50.0	50.0					17																	7578406		2203	4300	6503	7519131	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	Somatic		Capture	SOLID	Phase_I	7519131	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
RNF157	114804	hgsc.bcm.edu	37	17	74148454	74148454	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr17:74148454A>G	ENST00000269391.6	-	18	2035	c.1903T>C	c.(1903-1905)Tct>Cct	p.S635P	RNF157_ENST00000319945.6_Missense_Mutation_p.S613P|RNF157-AS1_ENST00000586627.1_RNA|RNF157-AS1_ENST00000590137.1_RNA|RNF157-AS1_ENST00000592748.1_RNA|RNF157-AS1_ENST00000586661.1_RNA|RNF157-AS1_ENST00000585542.1_RNA	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	635							zinc ion binding (GO:0008270)	p.S1239P(1)		breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			CAGACCTCAGAGCACAGCTTA	0.512																																					p.S635P	GBM(186;507 2120 27388 27773 52994)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1903C	17						.						287.0	215.0	239.0					17																	74148454		2203	4300	6503	71660049	SO:0001583	missense	114804	exon18			AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.1903T>C	17.37:g.74148454A>G	ENSP00000269391:p.Ser635Pro	Somatic		Capture	SOLID	Phase_I	71660049	NM_052916	Q8NB72|Q96N56	Missense_Mutation	SNP	ENST00000269391.6	37	CCDS32740.1	.	.	.	.	.	.	.	.	.	.	A	13.45	2.240882	0.39598	.	.	ENSG00000141576	ENST00000269391;ENST00000319945	T;T	0.41758	1.43;0.99	5.71	0.884	0.19182	.	0.147882	0.48286	N	0.000194	T	0.34600	0.0903	L	0.59436	1.845	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.10590	-1.0623	10	0.29301	T	0.29	-4.421	9.5203	0.39131	0.7274:0.0:0.2726:0.0	.	613;635	Q96PX1-2;Q96PX1	.;RN157_HUMAN	P	635;613	ENSP00000269391:S635P;ENSP00000321837:S613P	ENSP00000269391:S635P	S	-	1	0	RNF157	71660049	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	3.553000	0.53713	-0.129000	0.11620	0.533000	0.62120	TCT		RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255874.2	XM_290732	
OGFOD3	79701	hgsc.bcm.edu	37	17	80352368	80352368	+	Intron	SNP	G	G	A	rs141341501		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr17:80352368G>A	ENST00000313056.5	-	9	975				OGFOD3_ENST00000578287.1_5'Flank|OGFOD3_ENST00000329197.5_Missense_Mutation_p.P292L	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)										ACTGGCTCTCGGTCCATTAAC	0.567													-|||	1	0.000199681	0.0	0.0	5008	,	,		17897	0.0		0.0	False		,,,				2504	0.001				p.P292L												.	.	0			c.C875T	17						.	G	,LEU/PRO	5,4401	9.9+/-24.2	0,5,2198	93.0	91.0	92.0		,875	-1.8	0.0	17	dbSNP_134	92	0,8600		0,0,4300	no	intron,missense	C17orf101	NM_024648.2,NM_175902.4	,98	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	,	,292/332	80352368	5,13001	2203	4300	6503	77945657	SO:0001627	intron_variant	79701	exon9			BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.824-1958C>T	17.37:g.80352368G>A		None		Capture	SOLID	Phase_I	77945657	NM_175902	C9JDC8|Q8IZ37|Q9H6J2	Missense_Mutation	SNP	ENST00000313056.5	37	CCDS11811.1	.	.	.	.	.	.	.	.	.	.	G	7.232	0.599581	0.13939	0.001135	0.0	ENSG00000181396	ENST00000329197	T	0.34072	1.38	0.894	-1.79	0.07932	.	.	.	.	.	T	0.22859	0.0552	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.23833	-1.0177	8	0.72032	D	0.01	-3.6938	4.0002	0.09576	0.5267:0.0:0.4733:0.0	.	292	Q6PK18-2	.	L	292	ENSP00000330075:P292L	ENSP00000330075:P292L	P	-	2	0	C17orf101	77945657	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-0.945000	0.03909	-0.593000	0.05844	-0.489000	0.04712	CCG		OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442895.1	NM_175902	
ATP8B1	5205	hgsc.bcm.edu	37	18	55322536	55322536	+	Nonsense_Mutation	SNP	G	G	A	rs374340059		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr18:55322536G>A	ENST00000283684.4	-	22	2820	c.2821C>T	c.(2821-2823)Cga>Tga	p.R941*	RP11-35G9.3_ENST00000592201.1_RNA|RP11-35G9.5_ENST00000588925.1_RNA|ATP8B1_ENST00000536015.1_Nonsense_Mutation_p.R941*|RP11-35G9.3_ENST00000599199.1_RNA|RP11-35G9.3_ENST00000591854.1_RNA			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1	941					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R941*(1)		breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				TAAGACCATCGGCCATGCACC	0.433																																					p.R941X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2821T	18						.	G	,stop/ARG	0,4406		0,0,2203	160.0	134.0	143.0		,2821	5.0	1.0	18		143	1,8599	1.2+/-3.3	0,1,4299	no	intron,stop-gained	ATP8B1,LOC100505549	NM_001242804.1,NM_005603.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	,941/1252	55322536	1,13005	2203	4300	6503	53473534	SO:0001587	stop_gained	5205	exon23			AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.2821C>T	18.37:g.55322536G>A	ENSP00000283684:p.Arg941*	Somatic		Capture	SOLID	Phase_I	53473534	NM_005603	Q9BTP8	Nonsense_Mutation	SNP	ENST00000283684.4	37	CCDS11965.1	.	.	.	.	.	.	.	.	.	.	G	41	8.576052	0.98870	0.0	1.16E-4	ENSG00000081923	ENST00000283684;ENST00000536015	.	.	.	5.9	5.02	0.67125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.2467	0.82448	0.0:0.0:0.8662:0.1338	.	.	.	.	X	941	.	ENSP00000283684:R941X	R	-	1	2	ATP8B1	53473534	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	5.491000	0.66887	1.489000	0.48450	0.561000	0.74099	CGA		ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256097.1	NM_005603	
SLC6A11	6538	hgsc.bcm.edu	37	3	10960098	10960098	+	Silent	SNP	G	G	A			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr3:10960098G>A	ENST00000254488.2	+	8	1146	c.1080G>A	c.(1078-1080)gcG>gcA	p.A360A		NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	360					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)	p.A360A(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	GTTTTATGGCGTACGAGCAGG	0.582																																					p.A360A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1080A	3						.						126.0	103.0	111.0					3																	10960098		2203	4300	6503	10935098	SO:0001819	synonymous_variant	6538	exon8			S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.1080G>A	3.37:g.10960098G>A		Somatic		Capture	SOLID	Phase_I	10935098	NM_014229	B2R6U6|Q8IYC9	Silent	SNP	ENST00000254488.2	37	CCDS2602.1																																																																																				SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251927.1	NM_014229	
SEMA5B	54437	hgsc.bcm.edu	37	3	122662372	122662372	+	Silent	SNP	C	C	T	rs566448051		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr3:122662372C>T	ENST00000357599.3	-	4	725	c.339G>A	c.(337-339)ccG>ccA	p.P113P	SEMA5B_ENST00000465147.1_5'UTR|SEMA5B_ENST00000195173.4_Silent_p.P113P|SEMA5B_ENST00000451055.2_Silent_p.P167P	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	113	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.P113P(1)|p.P167P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		TAGAGACCCACGGCTGCAGGT	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16436	0.0		0.0	False		,,,				2504	0.0				p.P113P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G339A	3						.						45.0	54.0	51.0					3																	122662372		2203	4300	6503	124145062	SO:0001819	synonymous_variant	54437	exon4			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.339G>A	3.37:g.122662372C>T		Somatic		Capture	SOLID	Phase_I	124145062	NM_001031702	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Silent	SNP	ENST00000357599.3	37	CCDS35491.1																																																																																				SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
ASTE1	28990	hgsc.bcm.edu	37	3	130743220	130743220	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr3:130743220G>T	ENST00000264992.3	-	3	1372	c.931C>A	c.(931-933)Cag>Aag	p.Q311K	NEK11_ENST00000412440.2_5'Flank|NEK11_ENST00000510688.1_5'Flank|NEK11_ENST00000429253.2_5'Flank|NEK11_ENST00000510769.1_5'Flank|NEK11_ENST00000356918.4_5'Flank|NEK11_ENST00000383366.4_5'Flank|ASTE1_ENST00000514044.1_Missense_Mutation_p.Q311K|NEK11_ENST00000511262.1_5'Flank	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	311					DNA repair (GO:0006281)		nuclease activity (GO:0004518)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						GTACCACACTGGAAGAAGTCC	0.433																																					p.Q311K												.	.	0			c.C931A	3						.						124.0	120.0	121.0					3																	130743220		2203	4300	6503	132225910	SO:0001583	missense	28990	exon3			AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.931C>A	3.37:g.130743220G>T	ENSP00000264992:p.Gln311Lys	None		Capture	SOLID	Phase_I	132225910	NM_014065	B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	ENST00000264992.3	37	CCDS3068.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.240110	0.22711	.	.	ENSG00000034533	ENST00000514044;ENST00000264992;ENST00000446270	.	.	.	5.64	4.72	0.59763	.	0.338853	0.34628	N	0.003819	T	0.48978	0.1530	L	0.60455	1.87	0.40078	D	0.976099	P;P	0.38677	0.642;0.491	B;B	0.34931	0.192;0.138	T	0.50874	-0.8776	9	0.06625	T	0.88	-19.9397	16.0591	0.80826	0.0:0.134:0.866:0.0	.	311;311	D6RG30;Q2TB18	.;ASTE1_HUMAN	K	311	.	ENSP00000264992:Q311K	Q	-	1	0	ASTE1	132225910	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.603000	0.46266	2.661000	0.90470	0.561000	0.74099	CAG		ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356659.1	NM_014065	
ECE2	9718	hgsc.bcm.edu	37	3	183995777	183995777	+	Silent	SNP	C	C	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr3:183995777C>T	ENST00000402825.3	+	5	897	c.897C>T	c.(895-897)tgC>tgT	p.C299C	EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000357474.5_Silent_p.C227C|ECE2_ENST00000404464.3_Silent_p.C181C|ECE2_ENST00000359140.4_Silent_p.C152C	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	299	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)	p.C299C(1)|p.C152C(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ACCTATCTTGCCTACAGGTGG	0.567																																					p.C299C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C897T	3						.						74.0	70.0	71.0					3																	183995777		2203	4300	6503	185478471	SO:0001819	synonymous_variant	9718	exon5			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.897C>T	3.37:g.183995777C>T		Somatic		Capture	SOLID	Phase_I	185478471	NM_014693	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Silent	SNP	ENST00000402825.3	37	CCDS3256.2																																																																																				ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693	
TAS2R20	259295	hgsc.bcm.edu	37	12	11150054	11150054	+	Missense_Mutation	SNP	C	C	T	rs79420812	byFrequency	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	T	C	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr12:11150054C>T	ENST00000538986.1	-	1	420	c.421G>A	c.(421-423)Gtt>Att	p.V141I	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176889.2	NP_795370.2	P59543	T2R20_HUMAN	taste receptor, type 2, member 20	141				VCH -> ICQ (in Ref. 3; AAU21140). {ECO:0000305}.	sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V141I(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						AGGTGACAAACCAAAAAGAAC	0.388													C|||	916	0.182907	0.0371	0.1225	5008	,	,		20886	0.3185		0.2227	False		,,,				2504	0.2423				p.V141I												.	.	1	Substitution - Missense(1)	ovary(1)	c.G421A	12						.	C	ILE/VAL	239,4167	139.6+/-175.2	7,225,1971	128.0	114.0	118.0		421	-5.9	0.0	12	dbSNP_131	118	1704,6896	311.7+/-310.5	167,1370,2763	yes	missense	TAS2R20	NM_176889.2	29	174,1595,4734	TT,TC,CC		19.814,5.4244,14.9393	benign	141/310	11150054	1943,11063	2203	4300	6503	11041321	SO:0001583	missense	259295	exon1			AX097732, AF494236	CCDS8639.1	12p13.2	2012-08-22			ENSG00000255837	ENSG00000255837		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19109	protein-coding gene	gene with protein product		613962	"""taste receptor, type 2, member 49"""	TAS2R49			Standard	NM_176889		Approved	T2R20, T2R56	uc001qzm.2	P59543	OTTHUMG00000162695	ENST00000538986.1:c.421G>A	12.37:g.11150054C>T	ENSP00000441624:p.Val141Ile	Germline		Capture	SOLID	Phase_I	11041321	NM_176889	P59549|Q2HIZ4|Q496D8|Q645X9	Missense_Mutation	SNP	ENST00000538986.1	37	CCDS8639.1	402	0.18406593406593408	19	0.03861788617886179	50	0.13812154696132597	171	0.29895104895104896	162	0.21372031662269128	C	2.515	-0.312165	0.05422	0.054244	0.19814	ENSG00000255837	ENST00000538986	T	0.36340	1.26	2.93	-5.87	0.02297	.	0.867467	0.09448	U	0.800842	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.12156	0.007	T	0.39078	-0.9631	9	0.25751	T	0.34	.	1.3021	0.02081	0.4189:0.2764:0.1245:0.1802	.	141	P59543	T2R20_HUMAN	I	141	ENSP00000441624:V141I	ENSP00000441624:V141I	V	-	1	0	TAS2R20	11041321	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.252000	0.00539	-1.958000	0.01019	-0.964000	0.02622	GTT		TAS2R20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370130.2	NM_176889	
KRAS	3845	hgsc.bcm.edu	37	12	25398281	25398281	+	Missense_Mutation	SNP	C	C	T	rs112445441		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr12:25398281C>T	ENST00000256078.4	-	2	101	c.38G>A	c.(37-39)gGc>gAc	p.G13D	KRAS_ENST00000557334.1_Missense_Mutation_p.G13D|KRAS_ENST00000556131.1_Missense_Mutation_p.G13D|KRAS_ENST00000311936.3_Missense_Mutation_p.G13D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	13			G -> D (in a breast carcinoma cell line and GASC; somatic mutation). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:3627975}.|G -> R (in pylocytic astrocytoma; somatic mutation; increase activation of the Ras pathway). {ECO:0000269|PubMed:16247081}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G13D(3223)|p.G13V(33)|p.G13A(28)|p.G13E(3)|p.G13I(1)|p.G13N(1)|p.G13_V14>DI(1)|p.G13R(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTTGCCTACGCCACCAGCTCC	0.338	G13D(DLD1_LARGE_INTESTINE)|G13D(DV90_LUNG)|G13D(HCT116_LARGE_INTESTINE)|G13D(HCT15_LARGE_INTESTINE)|G13D(LOVO_LARGE_INTESTINE)|G13D(MDAMB231_BREAST)|G13D(NCIH647_LUNG)|G13D(NCIH747_LARGE_INTESTINE)|G13D(NOMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G13D(T84_LARGE_INTESTINE)|G13D(TOLEDO_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G13D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,lung,NS,Substitution - Missense,-1	.	3291	Substitution - Missense(3290)|Complex - compound substitution(1)	large_intestine(2808)|haematopoietic_and_lymphoid_tissue(94)|lung(92)|endometrium(54)|soft_tissue(38)|ovary(38)|stomach(32)|pancreas(30)|thyroid(27)|biliary_tract(21)|prostate(20)|breast(10)|cervix(4)|gastrointestinal_tract_(site_indeterminate)(3)|upper_aerodigestive_tract(3)|urinary_tract(3)|liver(3)|salivary_gland(3)|small_intestine(3)|oesophagus(2)|skin(1)|genital_tract(1)|bone(1)	c.G38A	12						.						88.0	78.0	82.0					12																	25398281		2203	4300	6503	25289548	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.38G>A	12.37:g.25398281C>T	ENSP00000256078:p.Gly13Asp	Somatic		Capture	SOLID	Phase_I	25289548	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867862	0.91587	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	D;T;T;T	0.82803	-1.65;-0.7;-0.7;-0.7	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90079	0.6901	M	0.93062	3.375	0.80722	D	1	B;P	0.43314	0.215;0.803	B;P	0.46172	0.175;0.506	D	0.92106	0.5692	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	13;13	P01116-2;P01116	.;RASK_HUMAN	D	13	ENSP00000308495:G13D;ENSP00000452512:G13D;ENSP00000256078:G13D;ENSP00000451856:G13D	ENSP00000256078:G13D	G	-	2	0	KRAS	25289548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGC		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
FGD4	121512	hgsc.bcm.edu	37	12	32755178	32755178	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr12:32755178A>G	ENST00000427716.2	+	7	1344	c.920A>G	c.(919-921)gAt>gGt	p.D307G	FGD4_ENST00000525053.1_Missense_Mutation_p.D419G|FGD4_ENST00000531134.1_Missense_Mutation_p.D392G|FGD4_ENST00000534526.2_Missense_Mutation_p.D444G|FGD4_ENST00000266482.3_Missense_Mutation_p.D59G|FGD4_ENST00000546442.1_Missense_Mutation_p.D214G|FGD4_ENST00000381025.3_Missense_Mutation_p.D59G	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	307	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.D307G(1)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					AAAGGATTTGATAATGCAATG	0.353																																					p.D307G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A920G	12						.						140.0	145.0	143.0					12																	32755178		2203	4300	6503	32646445	SO:0001583	missense	121512	exon7			AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.920A>G	12.37:g.32755178A>G	ENSP00000394487:p.Asp307Gly	Somatic		Capture	SOLID	Phase_I	32646445	NM_139241	Q6ULS2|Q8TCP6	Missense_Mutation	SNP	ENST00000427716.2	37	CCDS8727.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.425852	0.83667	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000427716;ENST00000266482;ENST00000546442;ENST00000525053;ENST00000381025	T;T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	4.86	4.86	0.63082	Dbl homology (DH) domain (5);	0.000000	0.53938	D	0.000052	T	0.81861	0.4912	M	0.88377	2.95	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.996;0.988;1.0;0.977	D	0.85921	0.1446	10	0.87932	D	0	-22.9247	14.7717	0.69684	1.0:0.0:0.0:0.0	.	419;392;307;59	E9PJX4;B7Z493;Q96M96;G3XA97	.;.;FGD4_HUMAN;.	G	444;392;307;59;214;419;59	ENSP00000449273:D444G;ENSP00000431323:D392G;ENSP00000394487:D307G;ENSP00000266482:D59G;ENSP00000446695:D214G;ENSP00000433666:D419G;ENSP00000370413:D59G	ENSP00000266482:D59G	D	+	2	0	FGD4	32646445	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	8.918000	0.92759	1.955000	0.56771	0.533000	0.62120	GAT		FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241	
CGNL1	84952	hgsc.bcm.edu	37	15	57730905	57730905	+	Silent	SNP	C	C	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr15:57730905C>T	ENST00000281282.5	+	2	786	c.708C>T	c.(706-708)aaC>aaT	p.N236N		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	236	Head.					myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)	p.N236K(1)|p.N236N(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		TGTGTGTAAACGTTCAGAGCT	0.567																																					p.N236N												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(2)	c.C708T	15						.						90.0	94.0	93.0					15																	57730905		2192	4292	6484	55518197	SO:0001819	synonymous_variant	84952	exon2			AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.708C>T	15.37:g.57730905C>T		Somatic		Capture	SOLID	Phase_I	55518197	NM_032866	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Silent	SNP	ENST00000281282.5	37	CCDS10161.1																																																																																				CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866	
CCKAR	886	hgsc.bcm.edu	37	4	26483533	26483533	+	Silent	SNP	G	G	A	rs200960240		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr4:26483533G>A	ENST00000295589.3	-	5	1208	c.1014C>T	c.(1012-1014)taC>taT	p.Y338Y		NM_000730.2	NP_000721.1	P32238	CCKAR_HUMAN	cholecystokinin A receptor	338					axonogenesis (GO:0007409)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|feeding behavior (GO:0007631)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cholecystokinin receptor activity (GO:0004951)	p.Y338Y(1)		NS(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|pancreas(1)|skin(1)	29		Breast(46;0.0503)			Ceruletide(DB00403)	AGGCGGTGTCGTAGGCCCGCC	0.597																																					p.Y338Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1014T	4						.						101.0	90.0	94.0					4																	26483533		2203	4300	6503	26092631	SO:0001819	synonymous_variant	886	exon5			L19315	CCDS3438.1	4p15.2	2013-09-20			ENSG00000163394	ENSG00000163394		"""GPCR / Class A : Cholecystokinin receptors"""	1570	protein-coding gene	gene with protein product		118444					Standard	NM_000730		Approved		uc003gse.1	P32238	OTTHUMG00000128567	ENST00000295589.3:c.1014C>T	4.37:g.26483533G>A		Somatic		Capture	SOLID	Phase_I	26092631	NM_000730	B2R9Z5	Silent	SNP	ENST00000295589.3	37	CCDS3438.1																																																																																				CCKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250418.2		
IL1RAPL2	26280	hgsc.bcm.edu	37	X	104984641	104984641	+	Silent	SNP	C	C	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chrX:104984641C>T	ENST00000372582.1	+	8	1761	c.1005C>T	c.(1003-1005)aaC>aaT	p.N335N	IL1RAPL2_ENST00000344799.4_Silent_p.N335N	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	335	Ig-like C2-type 3.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.N335N(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						ATGTTGAAAACCGAAATGGAC	0.378																																					p.N335N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1005T	X						.						78.0	68.0	71.0					X																	104984641		2203	4300	6503	104871297	SO:0001819	synonymous_variant	26280	exon8			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1005C>T	X.37:g.104984641C>T		Somatic		Capture	SOLID	Phase_I	104871297	NM_017416	Q2M3U3|Q9NZN0	Silent	SNP	ENST00000372582.1	37	CCDS14517.1																																																																																				IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
ARSF	416	hgsc.bcm.edu	37	X	3019147	3019147	+	Silent	SNP	C	C	T	rs141074236	byFrequency	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chrX:3019147C>T	ENST00000381127.1	+	8	1208	c.987C>T	c.(985-987)atC>atT	p.I329I	ARSF_ENST00000359361.2_Silent_p.I329I|ARSF_ENST00000537104.1_Silent_p.I329I	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	329					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.I329I(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TTGATGCTATCGATGATTTTG	0.418													c|||	25	0.00662252	0.0182	0.0014	3775	,	,		14782	0.0		0.0	False		,,,				2504	0.0				p.I329I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C987T	X						.	C	,,	73,3762		1,57,14,1574,557	128.0	106.0	114.0		987,987,987	-5.6	0.0	X	dbSNP_134	114	0,6727		0,0,0,2428,1871	no	coding-synonymous,coding-synonymous,coding-synonymous	ARSF	NM_001201538.1,NM_001201539.1,NM_004042.4	,,	1,57,14,4002,2428	TT,TC,T,CC,C		0.0,1.9035,0.6912	,,	329/591,329/591,329/591	3019147	73,10489	2203	4299	6502	3029147	SO:0001819	synonymous_variant	416	exon8			X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.987C>T	X.37:g.3019147C>T		Somatic		Capture	SOLID	Phase_I	3029147	NM_004042	Q8TCC5	Silent	SNP	ENST00000381127.1	37	CCDS14123.1																																																																																				ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1		
PHEX	5251	hgsc.bcm.edu	37	X	22117215	22117215	+	Missense_Mutation	SNP	G	G	A	rs376461141		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chrX:22117215G>A	ENST00000379374.4	+	9	1590	c.1025G>A	c.(1024-1026)cGc>cAc	p.R342H	PHEX_ENST00000418858.3_Missense_Mutation_p.R45H|PHEX_ENST00000535894.1_Missense_Mutation_p.R245H|PHEX_ENST00000537599.1_Missense_Mutation_p.R342H|PHEX_ENST00000475778.1_3'UTR	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	342					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R342H(1)		breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						GTGGTGGTCCGCGTCCCGCAG	0.448																																					p.R342H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1025A	X						.	G	HIS/ARG	2,3833		0,2,1630,571	117.0	107.0	110.0		1025	5.5	0.9	X		110	0,6728		0,0,2428,1872	no	missense	PHEX	NM_000444.4	29	0,2,4058,2443	AA,AG,GG,G		0.0,0.0522,0.0189	probably-damaging	342/750	22117215	2,10561	2203	4300	6503	22027136	SO:0001583	missense	5251	exon9			U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1025G>A	X.37:g.22117215G>A	ENSP00000368682:p.Arg342His	Somatic		Capture	SOLID	Phase_I	22027136	NM_000444	O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	ENST00000379374.4	37	CCDS14204.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076035	0.76415	5.22E-4	0.0	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79	5.46	5.46	0.80206	Peptidase M13 (1);	0.000000	0.85682	D	0.000000	T	0.79335	0.4428	L	0.38531	1.155	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	P;D	0.64042	0.871;0.921	T	0.75889	-0.3158	10	0.24483	T	0.36	.	18.3838	0.90459	0.0:0.0:1.0:0.0	.	342;342	F5GXU4;P78562	.;PHEX_HUMAN	H	342;342;245;45	ENSP00000368682:R342H;ENSP00000440362:R342H;ENSP00000439418:R245H;ENSP00000443531:R45H	ENSP00000368682:R342H	R	+	2	0	PHEX	22027136	1.000000	0.71417	0.938000	0.37757	0.945000	0.59286	7.562000	0.82300	2.282000	0.76494	0.529000	0.55759	CGC		PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056035.1	NM_000444	
DMD	1756	hgsc.bcm.edu	37	X	32456459	32456459	+	Missense_Mutation	SNP	G	G	A	rs143184877	byFrequency	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chrX:32456459G>A	ENST00000357033.4	-	29	4176	c.3970C>T	c.(3970-3972)Cgc>Tgc	p.R1324C	DMD_ENST00000378677.2_Missense_Mutation_p.R1320C	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1324					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.R1319C(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GCCAATATGCGAATCTGATTT	0.368													G|||	4	0.0010596	0.0023	0.0014	3775	,	,		13294	0.0		0.0	False		,,,				2504	0.0				p.R1324C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3970T	X						.	G	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	31,3802		1,25,4,1605,567	126.0	107.0	113.0		3946,3970,3601,3958,3601	5.8	1.0	X	dbSNP_134	113	0,6728		0,0,0,2428,1872	yes	missense,missense,missense,missense,missense	DMD	NM_000109.3,NM_004006.2,NM_004007.2,NM_004009.3,NM_004010.3	180,180,180,180,180	1,25,4,4033,2439	AA,AG,A,GG,G		0.0,0.8088,0.2935	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1316/3678,1324/3686,1201/3563,1320/3682,1201/3563	32456459	31,10530	2202	4300	6502	32366380	SO:0001583	missense	1756	exon29			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3970C>T	X.37:g.32456459G>A	ENSP00000354923:p.Arg1324Cys	Somatic		Capture	SOLID	Phase_I	32366380	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	2	0.0012055455093429777	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	0	0.0	G	22.3	4.269927	0.80469	0.008088	0.0	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.21361	2.01;2.01	5.82	5.82	0.92795	.	0.000000	0.37178	U	0.002213	T	0.38665	0.1049	M	0.74258	2.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.996;0.997;0.99	T	0.40308	-0.9570	10	0.87932	D	0	.	13.6182	0.62121	0.0:0.0:0.8451:0.1549	.	1316;1324;1320	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	C	1316;1320;1324;1324;1201	ENSP00000367948:R1320C;ENSP00000354923:R1324C	ENSP00000354923:R1324C	R	-	1	0	DMD	32366380	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.702000	0.68332	2.453000	0.82957	0.600000	0.82982	CGC		DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
BCOR	54880	hgsc.bcm.edu	37	X	39913169	39913169	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chrX:39913169C>G	ENST00000378444.4	-	14	5174	c.4946G>C	c.(4945-4947)tGt>tCt	p.C1649S	BCOR_ENST00000378455.4_Missense_Mutation_p.C1597S|BCOR_ENST00000378463.1_Missense_Mutation_p.C492S|BCOR_ENST00000397354.3_Missense_Mutation_p.C1615S|BCOR_ENST00000342274.4_Missense_Mutation_p.C1615S	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1649	Necessary and sufficient for interaction with PCGF1.				heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.C1615S(1)		breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						GATGTTATAACACGGTAAGAG	0.478			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.C1615S			Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4844C	X						.						46.0	40.0	42.0					X																	39913169		2202	4300	6502	39798113	SO:0001583	missense	54880	exon14			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4946G>C	X.37:g.39913169C>G	ENSP00000367705:p.Cys1649Ser	Somatic		Capture	SOLID	Phase_I	39798113	NM_001123383	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Missense_Mutation	SNP	ENST00000378444.4	37	CCDS48093.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.713556	0.68730	.	.	ENSG00000183337	ENST00000413905;ENST00000378463;ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000442018	T;T;T;T;T;T;T	0.72167	-0.55;0.82;0.94;0.93;0.88;0.93;-0.63	5.85	5.85	0.93711	.	.	.	.	.	D	0.82522	0.5055	L	0.56769	1.78	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.91635	0.999;0.989;0.999	T	0.81276	-0.1006	9	0.42905	T	0.14	-12.9757	19.0962	0.93253	0.0:1.0:0.0:0.0	.	1597;1649;1615	Q6W2J9-4;Q6W2J9;Q6W2J9-2	.;BCOR_HUMAN;.	S	519;492;1597;1615;1649;1615;322	ENSP00000408006:C519S;ENSP00000367724:C492S;ENSP00000367716:C1597S;ENSP00000380512:C1615S;ENSP00000367705:C1649S;ENSP00000345923:C1615S;ENSP00000387552:C322S	ENSP00000345923:C1615S	C	-	2	0	BCOR	39798113	1.000000	0.71417	0.557000	0.28306	0.218000	0.24690	7.487000	0.81328	2.459000	0.83118	0.600000	0.82982	TGT		BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
AKAP4	8852	hgsc.bcm.edu	37	X	49958224	49958224	+	Silent	SNP	G	G	A	rs140947270		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chrX:49958224G>A	ENST00000376056.2	-	5	1263	c.1113C>T	c.(1111-1113)tcC>tcT	p.S371S	AKAP4_ENST00000376064.3_Silent_p.S371S|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000358526.2_Silent_p.S380S|AKAP4_ENST00000376058.2_Intron					A kinase (PRKA) anchor protein 4									p.S380S(2)		NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					CAATCAAATCGGACACAATCT	0.463																																					p.S380S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C1140T	X						.	G	,	2,3833		0,1,1,1631,570	70.0	59.0	63.0		1140,1113	-6.4	1.0	X	dbSNP_134	63	0,6728		0,0,0,2428,1872	no	coding-synonymous,coding-synonymous	AKAP4	NM_003886.2,NM_139289.1	,	0,1,1,4059,2442	AA,AG,A,GG,G		0.0,0.0522,0.0189	,	380/855,371/846	49958224	2,10561	2203	4300	6503	49844964	SO:0001819	synonymous_variant	8852	exon5			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.1113C>T	X.37:g.49958224G>A		Somatic		Capture	SOLID	Phase_I	49844964	NM_003886		Silent	SNP	ENST00000376056.2	37	CCDS14330.1																																																																																				AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886	
TENM1	10178	hgsc.bcm.edu	37	X	123526026	123526026	+	Missense_Mutation	SNP	G	G	A	rs149944014		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chrX:123526026G>A	ENST00000371130.3	-	27	5606	c.5543C>T	c.(5542-5544)tCg>tTg	p.S1848L	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.S1855L	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1848					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.S1850L(1)									CACCAATCCCGAAGGTGAATA	0.403																																					p.S1848L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5543T	X						.	G	LEU/SER,LEU/SER,LEU/SER	1,3834		0,1,1631,571	94.0	79.0	84.0		5564,5561,5543	5.4	1.0	X	dbSNP_134	84	0,6726		0,0,2427,1872	no	missense,missense,missense	ODZ1	NM_001163278.1,NM_001163279.1,NM_014253.3	145,145,145	0,1,4058,2443	AA,AG,GG,G		0.0,0.0261,0.0095	benign,benign,benign	1855/2733,1854/2732,1848/2726	123526026	1,10560	2203	4299	6502	123353707	SO:0001583	missense	10178	exon27			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.5543C>T	X.37:g.123526026G>A	ENSP00000360171:p.Ser1848Leu	Somatic		Capture	SOLID	Phase_I	123353707	NM_014253	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.483113	0.44147	2.61E-4	0.0	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.85702	-2.02;-1.99	5.4	5.4	0.78164	.	0.199775	0.45361	D	0.000370	T	0.81602	0.4857	L	0.56769	1.78	0.41845	D	0.99014	B;B;B	0.15141	0.002;0.01;0.012	B;B;B	0.08055	0.001;0.001;0.003	T	0.76782	-0.2832	10	0.28530	T	0.3	.	12.5975	0.56478	0.081:0.0:0.919:0.0	.	1854;1855;1848	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	L	1848;1855	ENSP00000360171:S1848L;ENSP00000403954:S1855L	ENSP00000360171:S1848L	S	-	2	0	ODZ1	123353707	1.000000	0.71417	0.954000	0.39281	0.923000	0.55619	3.940000	0.56599	2.260000	0.74910	0.600000	0.82982	TCG		TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
OSBPL6	114880	hgsc.bcm.edu	37	2	179248000	179248000	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr2:179248000G>A	ENST00000190611.4	+	17	2247	c.1871G>A	c.(1870-1872)cGc>cAc	p.R624H	OSBPL6_ENST00000315022.2_Missense_Mutation_p.R628H|OSBPL6_ENST00000409045.3_Missense_Mutation_p.R593H|OSBPL6_ENST00000359685.3_Missense_Mutation_p.R588H|OSBPL6_ENST00000409631.1_Missense_Mutation_p.R588H|OSBPL6_ENST00000392505.2_Missense_Mutation_p.R649H	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	624					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.R624H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			CCATATGAGCGCATGGTAATA	0.483																																					p.R624H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1871A	2						.						40.0	40.0	40.0					2																	179248000		2203	4300	6503	178956246	SO:0001583	missense	114880	exon17			AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.1871G>A	2.37:g.179248000G>A	ENSP00000190611:p.Arg624His	Somatic		Capture	SOLID	Phase_I	178956246	NM_032523	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	ENST00000190611.4	37	CCDS2277.1	.	.	.	.	.	.	.	.	.	.	G	36	5.667358	0.96745	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T	0.61158	0.13;0.13;0.13;0.13;0.13;0.13	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	D	0.87637	0.6227	H	0.99197	4.465	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.996;0.999;0.998;0.998	D	0.91949	0.5569	10	0.87932	D	0	-10.9136	20.5948	0.99439	0.0:0.0:1.0:0.0	.	593;628;588;649;624	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3	.;.;.;.;OSBL6_HUMAN	H	649;588;593;624;588;628	ENSP00000376293:R649H;ENSP00000352713:R588H;ENSP00000387248:R593H;ENSP00000190611:R624H;ENSP00000386885:R588H;ENSP00000318723:R628H	ENSP00000190611:R624H	R	+	2	0	OSBPL6	178956246	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	9.869000	0.99810	2.873000	0.98535	0.563000	0.77884	CGC		OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
ZNF385B	151126	hgsc.bcm.edu	37	2	180348096	180348096	+	Silent	SNP	C	C	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr2:180348096C>T	ENST00000410066.1	-	6	1176	c.573G>A	c.(571-573)acG>acA	p.T191T	ZNF385B_ENST00000409343.1_Silent_p.T115T|ZNF385B_ENST00000409692.1_Silent_p.T89T|ZNF385B_ENST00000336917.5_Silent_p.T89T|ZNF385B_ENST00000466398.1_5'UTR	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	191	Interaction with p53/TP53.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)	p.T191T(1)		breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			GTTTATTTTTCGTTGCGTCTA	0.468																																					p.T115T	Colon(155;204 2491 32774 51842)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G345A	2						.						365.0	304.0	325.0					2																	180348096		2203	4300	6503	180056341	SO:0001819	synonymous_variant	151126	exon4			AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.573G>A	2.37:g.180348096C>T		Somatic		Capture	SOLID	Phase_I	180056341	NM_001113397	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Silent	SNP	ENST00000410066.1	37	CCDS33339.1																																																																																				ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335972.1	NM_152520	
COL6A3	1293	hgsc.bcm.edu	37	2	238249123	238249123	+	Silent	SNP	G	G	A	rs571287679		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr2:238249123G>A	ENST00000295550.4	-	38	8888	c.8436C>T	c.(8434-8436)ttC>ttT	p.F2812F	COL6A3_ENST00000409809.1_Silent_p.F2606F|COL6A3_ENST00000353578.4_Silent_p.F2606F|COL6A3_ENST00000346358.4_Silent_p.F2612F|COL6A3_ENST00000347401.3_Silent_p.F2611F|COL6A3_ENST00000472056.1_Silent_p.F2205F	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2812	Nonhelical region.|VWFA 12. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.F2812F(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		ACAGCCTCCCGAAGCGCATCA	0.547													g|||	1	0.000199681	0.0	0.0014	5008	,	,		22092	0.0		0.0	False		,,,				2504	0.0				p.F2205F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6615T	2						.						75.0	68.0	70.0					2																	238249123		2203	4300	6503	237913862	SO:0001819	synonymous_variant	1293	exon35			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.8436C>T	2.37:g.238249123G>A		Somatic		Capture	SOLID	Phase_I	237913862	NM_057166	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1																																																																																				COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
HADHA	3030	hgsc.bcm.edu	37	2	26437989	26437989	+	Silent	SNP	T	T	C			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr2:26437989T>C	ENST00000380649.3	-	8	861	c.732A>G	c.(730-732)gcA>gcG	p.A244A	HADHA_ENST00000457468.2_Silent_p.A157A	NM_000182.4	NP_000173.2	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit	244					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)	p.A157A(1)|p.A244A(1)		autonomic_ganglia(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(4)|skin(1)	30	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAAAAGTAATTGCAACTTCTT	0.403																																					p.A244A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A732G	2						.						198.0	195.0	196.0					2																	26437989		2203	4300	6503	26291493	SO:0001819	synonymous_variant	3030	exon8			D16480	CCDS1721.1	2p23	2014-09-17	2010-04-30		ENSG00000084754	ENSG00000084754	1.1.1.211, 4.2.1.17		4801	protein-coding gene	gene with protein product	"""gastrin-binding protein"", ""long-chain-3-hydroxyacyl-CoA dehydrogenase"", ""long-chain 2-enoyl-CoA hydratase"", ""mitochondrial trifunctional protein, alpha subunit"""	600890	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit"""			9605857, 7918661	Standard	NM_000182		Approved	GBP, LCEH, LCHAD, MTPA	uc002rgy.3	P40939	OTTHUMG00000096979	ENST00000380649.3:c.732A>G	2.37:g.26437989T>C		Somatic		Capture	SOLID	Phase_I	26291493	NM_000182	B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Silent	SNP	ENST00000380649.3	37	CCDS1721.1																																																																																				HADHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214051.1	NM_000182	
COL6A3	1293	hgsc.bcm.edu	37	2	238296735	238296735	+	Missense_Mutation	SNP	G	G	T	rs572430889		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr2:238296735G>T	ENST00000295550.4	-	4	1254	c.802C>A	c.(802-804)Ctc>Atc	p.L268I	COL6A3_ENST00000409809.1_Missense_Mutation_p.L62I|COL6A3_ENST00000353578.4_Missense_Mutation_p.L62I|COL6A3_ENST00000346358.4_Missense_Mutation_p.L268I|COL6A3_ENST00000347401.3_Intron|COL6A3_ENST00000392003.2_Intron|COL6A3_ENST00000392004.3_Missense_Mutation_p.L62I|COL6A3_ENST00000472056.1_Intron	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	268	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.L268I(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TTCTCAAGGAGATTTACAAGG	0.453																																					p.L62I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C184A	2						.						70.0	71.0	71.0					2																	238296735		2203	4300	6503	237961474	SO:0001583	missense	1293	exon3			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.802C>A	2.37:g.238296735G>T	ENSP00000295550:p.Leu268Ile	Somatic		Capture	SOLID	Phase_I	237961474	NM_057167	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	G	10.04	1.242330	0.22796	.	.	ENSG00000163359	ENST00000295550;ENST00000353578;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000433762	T;T;T;T;T;D	0.84298	-1.31;-1.31;-1.31;-1.31;-1.31;-1.83	5.43	2.08	0.27032	von Willebrand factor, type A (3);	0.510171	0.16078	U	0.230667	T	0.71517	0.3349	N	0.13371	0.34	0.09310	N	1	B;B;P;B	0.41524	0.007;0.122;0.753;0.007	B;B;B;B	0.42245	0.023;0.2;0.381;0.023	T	0.60556	-0.7240	10	0.27082	T	0.32	.	6.6643	0.23032	0.1654:0.6375:0.1971:0.0	.	268;62;62;268	E9PCV6;E9PGQ9;P12111-2;P12111	.;.;.;CO6A3_HUMAN	I	268;62;62;268;62;268	ENSP00000295550:L268I;ENSP00000315873:L62I;ENSP00000386844:L62I;ENSP00000295546:L268I;ENSP00000375861:L62I;ENSP00000389539:L268I	ENSP00000295550:L268I	L	-	1	0	COL6A3	237961474	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.663000	0.25053	0.602000	0.29896	0.650000	0.86243	CTC		COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
UNC13B	10497	hgsc.bcm.edu	37	9	35231191	35231191	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr9:35231191C>T	ENST00000378495.3	+	3	349	c.127C>T	c.(127-129)Cct>Tct	p.P43S	UNC13B_ENST00000378496.4_Missense_Mutation_p.P43S|UNC13B_ENST00000396787.1_Missense_Mutation_p.P43S	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	43	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.P43S(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			TGGTGATCAGCCTTCCTGGGA	0.358																																					p.P43S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C127T	9						.						134.0	115.0	121.0					9																	35231191		2203	4300	6503	35221191	SO:0001583	missense	10497	exon3			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.127C>T	9.37:g.35231191C>T	ENSP00000367756:p.Pro43Ser	Somatic		Capture	SOLID	Phase_I	35221191	NM_006377	Q5VYM8	Missense_Mutation	SNP	ENST00000378495.3	37	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.970917	0.92919	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496	D;D;D	0.93076	-3.16;-3.16;-3.16	5.23	5.23	0.72850	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.96864	0.8976	M	0.82630	2.6	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.97214	0.9873	10	0.87932	D	0	-6.5537	17.6077	0.88044	0.0:1.0:0.0:0.0	.	43;43;43	Q2NKJ5;F8W8M9;O14795	.;.;UN13B_HUMAN	S	43	ENSP00000380006:P43S;ENSP00000367756:P43S;ENSP00000367757:P43S	ENSP00000367756:P43S	P	+	1	0	UNC13B	35221191	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	7.591000	0.82666	2.736000	0.93811	0.644000	0.83932	CCT		UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377	
ARMC4	55130	hgsc.bcm.edu	37	10	28274019	28274019	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr10:28274019C>A	ENST00000305242.5	-	4	596	c.504G>T	c.(502-504)aaG>aaT	p.K168N	ARMC4_ENST00000537576.1_5'Flank|ARMC4_ENST00000239715.3_Missense_Mutation_p.K25N	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	168					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.K168N(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						CAATCTTCATCTTAATTTCAC	0.328																																					p.K168N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G504T	10						.						74.0	67.0	69.0					10																	28274019		2203	4300	6503	28314025	SO:0001583	missense	55130	exon4			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.504G>T	10.37:g.28274019C>A	ENSP00000306410:p.Lys168Asn	Somatic		Capture	SOLID	Phase_I	28314025	NM_018076	A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	ENST00000305242.5	37	CCDS7157.1	.	.	.	.	.	.	.	.	.	.	C	10.62	1.401699	0.25291	.	.	ENSG00000169126	ENST00000305242;ENST00000434029;ENST00000239715	T;T;T	0.53423	1.36;0.69;0.62	5.55	2.95	0.34219	.	0.226286	0.42682	D	0.000673	T	0.45816	0.1361	M	0.72118	2.19	0.38496	D	0.948097	P	0.51791	0.948	P	0.45829	0.494	T	0.50268	-0.8848	10	0.52906	T	0.07	-9.1292	4.8429	0.13500	0.0:0.4426:0.0:0.5574	.	168	Q5T2S8	ARMC4_HUMAN	N	168;62;25	ENSP00000306410:K168N;ENSP00000398155:K62N;ENSP00000239715:K25N	ENSP00000239715:K25N	K	-	3	2	ARMC4	28314025	0.996000	0.38824	0.159000	0.22649	0.130000	0.20726	0.755000	0.26405	0.996000	0.38943	0.585000	0.79938	AAG		ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076	
NDST2	8509	hgsc.bcm.edu	37	10	75562482	75562482	+	Missense_Mutation	SNP	G	G	A	rs372755048		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr10:75562482G>A	ENST00000309979.6	-	14	3032	c.2476C>T	c.(2476-2478)Cgc>Tgc	p.R826C	ZSWIM8-AS1_ENST00000456638.2_RNA|NDST2_ENST00000299641.4_Missense_Mutation_p.R703C|RP11-574K11.31_ENST00000603027.1_Silent_p.L813L			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	826	Heparan sulfate N-sulfotransferase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)	p.R826C(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					CCTAGACAGCGAGTCTTACCA	0.522																																					p.R826C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2476T	10						.						98.0	95.0	96.0					10																	75562482		2203	4300	6503	75232488	SO:0001583	missense	8509	exon14			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.2476C>T	10.37:g.75562482G>A	ENSP00000310657:p.Arg826Cys	None		Capture	SOLID	Phase_I	75232488	NM_003635	Q2TB32|Q59H89	Missense_Mutation	SNP	ENST00000309979.6	37	CCDS7335.1	.	.	.	.	.	.	.	.	.	.	G	18.58	3.654561	0.67472	.	.	ENSG00000166507	ENST00000309979;ENST00000299641;ENST00000429742	D;D;D	0.84223	-1.82;-1.82;-1.82	6.07	6.07	0.98685	Sulfotransferase domain (1);	0.135434	0.52532	D	0.000071	D	0.90466	0.7014	M	0.75615	2.305	0.58432	D	0.999992	D	0.69078	0.997	P	0.60345	0.873	D	0.90900	0.4768	10	0.87932	D	0	.	13.4973	0.61434	0.0:0.0:0.745:0.255	.	826	P52849	NDST2_HUMAN	C	826;703;107	ENSP00000310657:R826C;ENSP00000299641:R703C;ENSP00000392733:R107C	ENSP00000299641:R703C	R	-	1	0	NDST2	75232488	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.717000	0.61923	2.884000	0.98904	0.655000	0.94253	CGC		NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048710.1	NM_003635	
PPP1R3C	5507	hgsc.bcm.edu	37	10	93390113	93390113	+	Silent	SNP	G	G	T	rs141426360		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr10:93390113G>T	ENST00000238994.5	-	2	609	c.525C>A	c.(523-525)gtC>gtA	p.V175V		NM_005398.5	NP_005389.1			protein phosphatase 1, regulatory subunit 3C									p.V175V(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(1)	12		Colorectal(252;0.235)				TCACATTTTTGACTTTAACAG	0.403																																					p.V175V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C525A	10						.	T		0,4406		0,0,2203	94.0	88.0	90.0		525	-7.8	0.5	10	dbSNP_134	90	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PPP1R3C	NM_005398.4		0,1,6502	TT,TG,GG		0.0116,0.0,0.0077		175/318	93390113	1,13005	2203	4300	6503	93380093	SO:0001819	synonymous_variant	5507	exon2			Y18207	CCDS7416.1	10q23-q24	2012-04-17	2011-10-04	2001-08-01	ENSG00000119938	ENSG00000119938		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9293	protein-coding gene	gene with protein product	"""Phosphatase 1, regulatory inhibitor subunit 5"", ""protein targeting to glycogen"""	602999	"""protein phosphatase 1, regulatory (inhibitor) subunit 3C"""	PPP1R5		8985175	Standard	NM_005398		Approved	PTG	uc001kho.3	Q9UQK1	OTTHUMG00000018745	ENST00000238994.5:c.525C>A	10.37:g.93390113G>T		Somatic		Capture	SOLID	Phase_I	93380093	NM_005398		Silent	SNP	ENST00000238994.5	37	CCDS7416.1																																																																																				PPP1R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049372.1	NM_005398	
APC	324	hgsc.bcm.edu	37	5	112175423	112175423	+	Nonsense_Mutation	SNP	C	C	T	rs121913329		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr5:112175423C>T	ENST00000457016.1	+	16	4512	c.4132C>T	c.(4132-4134)Cag>Tag	p.Q1378*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q1378*|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1378*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1378	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1378*(47)|p.Q1378fs*7(2)|p.Y1376fs*41(1)|p.?(1)|p.Q1378fs*5(1)|p.Q1378fs*8(1)|p.K1192fs*3(1)|p.Y1376fs*5(1)|p.Y1376fs*1(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ACACTATGTTCAGGAGACCCC	0.468		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1360X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0	.	56	Substitution - Nonsense(47)|Deletion - Frameshift(6)|Unknown(1)|Complex - frameshift(1)|Insertion - Frameshift(1)	large_intestine(49)|stomach(5)|soft_tissue(1)|skin(1)	c.C4078T	5						.						91.0	87.0	88.0					5																	112175423		2202	4300	6502	112203322	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4132C>T	5.37:g.112175423C>T	ENSP00000413133:p.Gln1378*	Somatic		Capture	SOLID	Phase_I	112203322	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.764727	0.98945	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.1139	20.4898	0.99202	0.0:1.0:0.0:0.0	.	.	.	.	X	1378	.	.	Q	+	1	0	APC	112203322	1.000000	0.71417	0.999000	0.59377	0.831000	0.47069	5.761000	0.68801	2.941000	0.99782	0.655000	0.94253	CAG		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ADAMTS12	81792	hgsc.bcm.edu	37	5	33643572	33643572	+	Missense_Mutation	SNP	C	C	T	rs368041272		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr5:33643572C>T	ENST00000504830.1	-	10	1818	c.1483G>A	c.(1483-1485)Gtc>Atc	p.V495I	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.V495I|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	495	Disintegrin.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V495I(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GTCTGGCAGACGTTCTAGAAA	0.443										HNSCC(64;0.19)			C|||	1	0.000199681	0.0	0.0014	5008	,	,		22119	0.0		0.0	False		,,,				2504	0.0				p.V495I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1483A	5						.	C	ILE/VAL	0,4406		0,0,2203	117.0	119.0	118.0		1483	2.4	1.0	5		118	1,8599	1.2+/-3.3	0,1,4299	no	missense	ADAMTS12	NM_030955.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	495/1595	33643572	1,13005	2203	4300	6503	33679329	SO:0001583	missense	81792	exon10			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.1483G>A	5.37:g.33643572C>T	ENSP00000422554:p.Val495Ile	Somatic		Capture	SOLID	Phase_I	33679329	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	C	10.34	1.322277	0.23994	0.0	1.16E-4	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.59364	0.27;0.27	5.57	2.39	0.29439	.	0.317314	0.32503	N	0.006009	T	0.30727	0.0774	N	0.16862	0.45	0.80722	D	1	P;B	0.35011	0.48;0.05	B;B	0.23716	0.043;0.048	T	0.05517	-1.0880	10	0.21014	T	0.42	.	7.2003	0.25877	0.0:0.5758:0.1341:0.2901	.	495;495	P58397-3;P58397	.;ATS12_HUMAN	I	495	ENSP00000422554:V495I;ENSP00000344847:V495I	ENSP00000344847:V495I	V	-	1	0	ADAMTS12	33679329	0.606000	0.26949	0.994000	0.49952	0.330000	0.28571	0.944000	0.29043	0.721000	0.32231	-0.379000	0.06801	GTC		ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
PCDHB11	56125	hgsc.bcm.edu	37	5	140580123	140580123	+	Missense_Mutation	SNP	C	C	T	rs115706518		TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3605-01A-01W-0833-10	TCGA-AG-3605-10A-01W-0833-10	g.chr5:140580123C>T	ENST00000354757.3	+	1	776	c.776C>T	c.(775-777)tCg>tTg	p.S259L	PCDHB11_ENST00000536699.1_5'UTR	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	259	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATCCTTGGCTCGCTGATTTTG	0.438																																					p.S259L												.	.	0			c.C776T	5						.						191.0	194.0	193.0					5																	140580123		2203	4300	6503	140560307	SO:0001583	missense	56125	exon1			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.776C>T	5.37:g.140580123C>T	ENSP00000346802:p.Ser259Leu	None		Capture	SOLID	Phase_I	140560307	NM_018931	B4DSF7|Q2M223	Missense_Mutation	SNP	ENST00000354757.3	37	CCDS4253.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.905282	0.33628	.	.	ENSG00000197479	ENST00000354757	T	0.01787	4.64	2.7	1.8	0.24995	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.05227	0.0139	M	0.62154	1.92	0.36177	D	0.849168	P	0.45594	0.862	P	0.53861	0.736	T	0.39563	-0.9608	9	0.66056	D	0.02	.	9.813	0.40835	0.0:0.8824:0.0:0.1176	.	259	Q9Y5F2	PCDBB_HUMAN	L	259	ENSP00000346802:S259L	ENSP00000346802:S259L	S	+	2	0	PCDHB11	140560307	0.002000	0.14202	0.006000	0.13384	0.008000	0.06430	1.855000	0.39378	1.496000	0.48567	0.467000	0.42956	TCG		PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931	
