#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KCND2	3751	hgsc.bcm.edu	37	7	120381624	120381624	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr7:120381624G>A	ENST00000331113.4	+	3	2280	c.1315G>A	c.(1315-1317)Gga>Aga	p.G439R		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	439					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.G439R(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	AGCCAAAAGCGGAAGCGCAAA	0.373																																					p.G439R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1315A	7						.						86.0	94.0	91.0					7																	120381624		2203	4300	6503	120168860	SO:0001583	missense	3751	exon3			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.1315G>A	7.37:g.120381624G>A	ENSP00000333496:p.Gly439Arg	Somatic		Capture	SOLID	Phase_I	120168860	NM_012281	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	ENST00000331113.4	37	CCDS5776.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.684736	0.88639	.	.	ENSG00000184408	ENST00000331113	D	0.96940	-4.18	5.62	5.62	0.85841	.	0.073236	0.56097	D	0.000039	D	0.93406	0.7897	L	0.38838	1.175	0.45295	D	0.998294	B	0.28636	0.218	B	0.23852	0.049	D	0.90780	0.4678	9	.	.	.	.	19.662	0.95877	0.0:0.0:1.0:0.0	.	439	Q9NZV8	KCND2_HUMAN	R	439	ENSP00000333496:G439R	.	G	+	1	0	KCND2	120168860	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	7.157000	0.77461	2.649000	0.89929	0.650000	0.86243	GGA		KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281	
TOX2	84969	hgsc.bcm.edu	37	20	42682966	42682966	+	Missense_Mutation	SNP	G	G	A	rs149594311	byFrequency	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr20:42682966G>A	ENST00000358131.5	+	5	914	c.706G>A	c.(706-708)Gac>Aac	p.D236N	TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000423191.2_Missense_Mutation_p.D185N|TOX2_ENST00000341197.4_Missense_Mutation_p.D227N|TOX2_ENST00000372999.1_Missense_Mutation_p.D185N	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	236					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D185N(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			ACCTTCAGCCGACCCAGGAAA	0.527													G|||	2	0.000399361	0.0	0.0014	5008	,	,		17026	0.0		0.001	False		,,,				2504	0.0				p.D185N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G553A	20						.	G	ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP	6,4400	9.9+/-24.2	0,6,2197	25.0	28.0	27.0		553,679,706,553	5.4	0.9	20	dbSNP_134	27	24,8572	16.6+/-54.9	0,24,4274	yes	missense,missense,missense,missense	TOX2	NM_001098796.1,NM_001098797.1,NM_001098798.1,NM_032883.2	23,23,23,23	0,30,6471	AA,AG,GG		0.2792,0.1362,0.2307	probably-damaging,probably-damaging,probably-damaging,probably-damaging	185/465,227/507,236/489,185/465	42682966	30,12972	2203	4298	6501	42116380	SO:0001583	missense	84969	exon6			BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.706G>A	20.37:g.42682966G>A	ENSP00000350849:p.Asp236Asn	Somatic		Capture	SOLID	Phase_I	42116380	NM_032883	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Missense_Mutation	SNP	ENST00000358131.5	37	CCDS42875.1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	G	32	5.188325	0.94923	0.001362	0.002792	ENSG00000124191	ENST00000341197;ENST00000423191;ENST00000372999;ENST00000358131;ENST00000435864	T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.31	5.44	5.44	0.79542	High mobility group, superfamily (1);	0.767910	0.12144	N	0.495596	T	0.41119	0.1145	L	0.61218	1.895	0.80722	D	1	D;D;P;D;D	0.67145	0.991;0.995;0.94;0.996;0.991	P;P;B;P;P	0.56216	0.627;0.794;0.413;0.646;0.627	T	0.07770	-1.0755	9	.	.	.	.	18.2447	0.89981	0.0:0.0:1.0:0.0	.	105;227;185;236;185	B4DQV8;G3XAC7;A8K1J1;Q96NM4;E1P5X0	.;.;.;TOX2_HUMAN;.	N	227;185;185;236;105	ENSP00000344724:D227N;ENSP00000390278:D185N;ENSP00000362090:D185N;ENSP00000350849:D236N;ENSP00000396777:D105N	.	D	+	1	0	TOX2	42116380	1.000000	0.71417	0.914000	0.36105	0.685000	0.39939	9.869000	0.99810	2.556000	0.86216	0.650000	0.86243	GAC		TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2		
CDH26	60437	hgsc.bcm.edu	37	20	58574706	58574706	+	Silent	SNP	G	G	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr20:58574706G>A	ENST00000244047.5	+	14	2396	c.2085G>A	c.(2083-2085)acG>acA	p.T695T	CDH26_ENST00000244049.3_Silent_p.T28T|CDH26_ENST00000350849.6_Silent_p.T28T|CDH26_ENST00000497614.1_3'UTR|CDH26_ENST00000348616.4_Silent_p.T695T			Q8IXH8	CAD26_HUMAN	cadherin 26	695					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T695T(2)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			CAGGACCCACGCAGGGAGTTA	0.522																																					p.T28T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G84A	20						.						82.0	79.0	80.0					20																	58574706		2203	4300	6503	58008101	SO:0001819	synonymous_variant	60437	exon2			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.2085G>A	20.37:g.58574706G>A		Somatic		Capture	SOLID	Phase_I	58008101	NM_021810	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Silent	SNP	ENST00000244047.5	37		.	.	.	.	.	.	.	.	.	.	G	1.401	-0.578220	0.03854	.	.	ENSG00000124215	ENST00000370991	.	.	.	2.88	1.93	0.25924	.	.	.	.	.	T	0.27098	0.0664	.	.	.	0.19300	N	0.999976	.	.	.	.	.	.	T	0.19582	-1.0301	4	.	.	.	.	5.8143	0.18484	0.148:0.0:0.852:0.0	.	.	.	.	H	287	.	.	R	+	2	0	CDH26	58008101	0.004000	0.15560	0.007000	0.13788	0.002000	0.02628	1.070000	0.30653	0.805000	0.34159	-0.136000	0.14681	CGC		CDH26-201	KNOWN	basic	protein_coding	protein_coding		NM_177980	
FRMD6	122786	hgsc.bcm.edu	37	14	52174921	52174921	+	Silent	SNP	C	C	T	rs201743850		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr14:52174921C>T	ENST00000344768.5	+	7	880	c.684C>T	c.(682-684)gaC>gaT	p.D228D	FRMD6_ENST00000554167.1_Silent_p.D151D|FRMD6_ENST00000395718.2_Silent_p.D220D|FRMD6_ENST00000356218.4_Silent_p.D220D			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	228	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.D220D(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					GACTGGATGACGTCGCTGTTC	0.393													C|||	1	0.000199681	0.0	0.0	5008	,	,		18243	0.001		0.0	False		,,,				2504	0.0				p.D220D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C660T	14						.						87.0	75.0	79.0					14																	52174921		2203	4300	6503	51244671	SO:0001819	synonymous_variant	122786	exon7			BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.684C>T	14.37:g.52174921C>T		Somatic		Capture	SOLID	Phase_I	51244671	NM_152330	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Silent	SNP	ENST00000344768.5	37	CCDS58318.1																																																																																				FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330	
SAMD4A	23034	hgsc.bcm.edu	37	14	55215575	55215575	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr14:55215575C>T	ENST00000554335.1	+	5	1685	c.1022C>T	c.(1021-1023)gCc>gTc	p.A341V	SAMD4A_ENST00000392067.3_Missense_Mutation_p.A341V|SAMD4A_ENST00000357634.3_Missense_Mutation_p.A340V|SAMD4A_ENST00000251091.5_Missense_Mutation_p.A253V			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	341	SAM.				negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)	p.A340V(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						CACAAATATGCCGCGCTTTTC	0.547																																					p.A340V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1019T	14						.						57.0	51.0	53.0					14																	55215575		2193	4283	6476	54285325	SO:0001583	missense	23034	exon4			AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.1022C>T	14.37:g.55215575C>T	ENSP00000452535:p.Ala341Val	Somatic		Capture	SOLID	Phase_I	54285325	NM_015589	A8MPZ5|Q0VA96|Q6PEW4	Missense_Mutation	SNP	ENST00000554335.1	37	CCDS32084.2	.	.	.	.	.	.	.	.	.	.	C	32	5.177524	0.94846	.	.	ENSG00000020577	ENST00000554335;ENST00000392067;ENST00000305831;ENST00000251091;ENST00000357634	T;T;T	0.49139	0.79;0.79;0.79	5.32	5.32	0.75619	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.66915	0.2838	M	0.61703	1.905	0.80722	D	1	P;D	0.76494	0.699;0.999	P;D	0.70227	0.601;0.968	T	0.65421	-0.6172	10	0.48119	T	0.1	-13.4416	19.1782	0.93612	0.0:1.0:0.0:0.0	.	253;341	Q9UPU9-3;Q9UPU9	.;SMAG1_HUMAN	V	341;341;253;252;340	ENSP00000452535:A341V;ENSP00000375919:A341V;ENSP00000350261:A340V	ENSP00000306381:A253V	A	+	2	0	SAMD4A	54285325	1.000000	0.71417	0.934000	0.37439	0.816000	0.46133	7.349000	0.79376	2.769000	0.95229	0.563000	0.77884	GCC		SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411186.1	NM_015589	
FNTB	2342	hgsc.bcm.edu	37	14	65520041	65520041	+	Silent	SNP	G	G	A	rs149471226	byFrequency	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr14:65520041G>A	ENST00000246166.2	+	10	1275	c.1041G>A	c.(1039-1041)gcG>gcA	p.A347A	MAX_ENST00000341653.2_Intron|FNTB_ENST00000542227.1_Silent_p.A301A|FNTB_ENST00000447296.2_Silent_p.A381A|CHURC1-FNTB_ENST00000549987.1_Silent_p.A382A	NM_002028.3	NP_002019.1	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta	347					negative regulation of cell proliferation (GO:0008285)|phototransduction, visible light (GO:0007603)|positive regulation of cell cycle (GO:0045787)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|protein farnesylation (GO:0018343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to cytokine (GO:0034097)|response to inorganic substance (GO:0010035)|response to organic cyclic compound (GO:0014070)|rhodopsin mediated signaling pathway (GO:0016056)|wound healing (GO:0042060)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	farnesyltranstransferase activity (GO:0004311)|protein farnesyltransferase activity (GO:0004660)|zinc ion binding (GO:0008270)	p.A347A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		AGTGCCCTGCGGGGGGGCTTC	0.597																																					p.A347A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1041A	14						.	G	,,,	1,4405	2.1+/-5.4	0,1,2202	34.0	34.0	34.0		903,1224,1041,	-10.6	0.0	14	dbSNP_134	34	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,intron	FNTB,MAX,CHURC1-FNTB	NM_001202558.1,NM_001202559.1,NM_002028.3,NM_197957.2	,,,	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	,,,	301/392,408/499,347/438,	65520041	3,13003	2203	4300	6503	64589794	SO:0001819	synonymous_variant	2342	exon10				CCDS9769.1	14q23.3	2011-09-28			ENSG00000257365	ENSG00000257365			3785	protein-coding gene	gene with protein product		134636				8276393	Standard	NM_002028		Approved	FPTB		P49356	OTTHUMG00000142811	ENST00000246166.2:c.1041G>A	14.37:g.65520041G>A		Somatic		Capture	SOLID	Phase_I	64589794	NM_002028	B2RDX6|B4E1A0	Silent	SNP	ENST00000246166.2	37	CCDS9769.1																																																																																				FNTB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000286392.1	NM_002028	
ENTPD5	957	hgsc.bcm.edu	37	14	74439698	74439698	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr14:74439698C>A	ENST00000334696.6	-	13	1235	c.916G>T	c.(916-918)Gaa>Taa	p.E306*	ENTPD5_ENST00000557325.1_Nonsense_Mutation_p.E306*	NM_001249.2	NP_001240.1	O75356	ENTP5_HUMAN	ectonucleoside triphosphate diphosphohydrolase 5	306					'de novo' posttranslational protein folding (GO:0051084)|ATP metabolic process (GO:0046034)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|positive regulation of glycolytic process (GO:0045821)|protein N-linked glycosylation (GO:0006487)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	guanosine-diphosphatase activity (GO:0004382)|uridine-diphosphatase activity (GO:0045134)	p.E306*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(234;0.00394)		CTCAGCACTTCGGCATAGCAG	0.567																																					p.E306X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G916T	14						.						198.0	196.0	197.0					14																	74439698		2203	4300	6503	73509451	SO:0001587	stop_gained	957	exon13			AF039918	CCDS9825.1	14q24	2003-10-03	2003-10-03			ENSG00000187097			3367	protein-coding gene	gene with protein product		603162	"""proto-oncogene CPH"""	CD39L4, PCPH		9271669, 9676430	Standard	NM_001249		Approved	NTPDase-5	uc010tuo.2	O75356		ENST00000334696.6:c.916G>T	14.37:g.74439698C>A	ENSP00000335246:p.Glu306*	Somatic		Capture	SOLID	Phase_I	73509451	NM_001249	A1L4C5|Q96RX0	Nonsense_Mutation	SNP	ENST00000334696.6	37	CCDS9825.1	.	.	.	.	.	.	.	.	.	.	C	42	9.211031	0.99101	.	.	ENSG00000187097	ENST00000557325;ENST00000334696	.	.	.	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-22.093	19.0466	0.93022	0.0:1.0:0.0:0.0	.	.	.	.	X	306	.	ENSP00000335246:E306X	E	-	1	0	ENTPD5	73509451	1.000000	0.71417	0.966000	0.40874	0.962000	0.63368	7.104000	0.77024	2.744000	0.94065	0.563000	0.77884	GAA		ENTPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412637.1	NM_001249	
TCN2	6948	hgsc.bcm.edu	37	22	31007025	31007025	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr22:31007025C>A	ENST00000215838.3	+	2	726	c.232C>A	c.(232-234)Ctt>Att	p.L78I	TCN2_ENST00000407817.3_Missense_Mutation_p.L78I|TCN2_ENST00000405742.3_Missense_Mutation_p.L78I			P20062	TCO2_HUMAN	transcobalamin II	78					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)	p.L78I(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|prostate(2)|urinary_tract(1)	22					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAGCCTCAAGCTTGGTTACCA	0.537																																					p.L78I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C232A	22						.						162.0	146.0	152.0					22																	31007025		2203	4300	6503	29337025	SO:0001583	missense	6948	exon2				CCDS13881.1, CCDS54519.1	22q12.2	2014-09-17	2010-05-11		ENSG00000185339	ENSG00000185339			11653	protein-coding gene	gene with protein product	"""macrocytic anemia"""	613441	"""transcobalamin II; macrocytic anemia"""			1708393, 7742531	Standard	NM_000355		Approved	D22S676, D22S750, TC2	uc003aip.2	P20062	OTTHUMG00000151095	ENST00000215838.3:c.232C>A	22.37:g.31007025C>A	ENSP00000215838:p.Leu78Ile	Somatic		Capture	SOLID	Phase_I	29337025	NM_001184726	Q96FD4|Q9BVI8|Q9UCI5|Q9UCI6|Q9UDM0	Missense_Mutation	SNP	ENST00000215838.3	37	CCDS13881.1	.	.	.	.	.	.	.	.	.	.	C	6.832	0.522616	0.13066	.	.	ENSG00000185339	ENST00000215838;ENST00000423350;ENST00000405742;ENST00000407817	T;T;T;T	0.35236	1.33;1.33;1.33;1.32	6.17	1.51	0.23008	.	0.686490	0.15462	N	0.261067	T	0.27489	0.0675	L	0.40543	1.245	0.54753	D	0.999981	B;B;B	0.18166	0.026;0.001;0.001	B;B;B	0.23574	0.047;0.012;0.012	T	0.07966	-1.0745	10	0.33141	T	0.24	-10.0753	8.562	0.33516	0.2781:0.3727:0.3492:0.0	.	78;78;78	Q96FD4;B5MBX2;P20062	.;.;TCO2_HUMAN	I	78	ENSP00000215838:L78I;ENSP00000411529:L78I;ENSP00000385914:L78I;ENSP00000384914:L78I	ENSP00000215838:L78I	L	+	1	0	TCN2	29337025	0.412000	0.25392	0.928000	0.36995	0.451000	0.32288	-0.028000	0.12350	0.895000	0.36342	0.655000	0.94253	CTT		TCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321282.2	NM_000355	
EFCAB6	64800	hgsc.bcm.edu	37	22	44074037	44074037	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr22:44074037C>T	ENST00000262726.7	-	13	1511	c.1258G>A	c.(1258-1260)Gat>Aat	p.D420N	EFCAB6_ENST00000358439.4_Silent_p.P240P|EFCAB6_ENST00000396231.2_Missense_Mutation_p.D268N	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	420	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.D420N(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				ATCGGTCCATCGGGTTTCTGA	0.323																																					p.D268N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G802A	22						.						68.0	67.0	67.0					22																	44074037		2203	4300	6503	42405370	SO:0001583	missense	64800	exon11			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.1258G>A	22.37:g.44074037C>T	ENSP00000262726:p.Asp420Asn	Somatic		Capture	SOLID	Phase_I	42405370	NM_198856	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	37	CCDS14049.1	.	.	.	.	.	.	.	.	.	.	C	3.781	-0.045679	0.07452	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.10099	2.91;2.91	4.96	-2.73	0.05950	EF-hand-like domain (1);	1.430320	0.04009	N	0.297931	T	0.07413	0.0187	N	0.21240	0.645	0.09310	N	1	B	0.22604	0.072	B	0.22753	0.041	T	0.37957	-0.9683	10	0.23891	T	0.37	-0.7381	6.6729	0.23078	0.0:0.4499:0.1205:0.4296	.	420	Q5THR3	EFCB6_HUMAN	N	268;420	ENSP00000379533:D268N;ENSP00000262726:D420N	ENSP00000262726:D420N	D	-	1	0	EFCAB6	42405370	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.145000	0.03194	-0.773000	0.04596	-3.030000	0.00073	GAT		EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785	
JAK3	3718	hgsc.bcm.edu	37	19	17950354	17950354	+	Missense_Mutation	SNP	C	C	A	rs373774937		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr19:17950354C>A	ENST00000527670.1	-	9	1402	c.1373G>T	c.(1372-1374)tGg>tTg	p.W458L	JAK3_ENST00000534444.1_Missense_Mutation_p.W458L|JAK3_ENST00000458235.1_Missense_Mutation_p.W458L|JAK3_ENST00000526008.1_5'UTR			P52333	JAK3_HUMAN	Janus kinase 3	458	SH2; atypical.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.W458L(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	CCCCCCATCCCAGCAGGTTGC	0.622		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																p.W458L			Dom	yes		19	19p13.1	3718	Janus kinase 3		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1373T	19						.						37.0	30.0	32.0					19																	17950354		2202	4300	6502	17811354	SO:0001583	missense	3718	exon10			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.1373G>T	19.37:g.17950354C>A	ENSP00000432511:p.Trp458Leu	Somatic		Capture	SOLID	Phase_I	17811354	NM_000215	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	37	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	C	8.707	0.911136	0.17833	.	.	ENSG00000105639	ENST00000458235;ENST00000428406;ENST00000527670;ENST00000534444	T;T;T	0.23552	1.9;1.9;1.9	3.7	3.7	0.42460	SH2 motif (2);	0.307903	0.32218	N	0.006416	T	0.20088	0.0483	L	0.44542	1.39	0.33750	D	0.620571	P;B;B	0.38504	0.634;0.007;0.04	B;B;B	0.33620	0.167;0.009;0.013	T	0.38178	-0.9673	10	0.54805	T	0.06	-3.7306	10.8181	0.46589	0.0:1.0:0.0:0.0	.	458;458;458	B4DK43;P52333-2;P52333	.;.;JAK3_HUMAN	L	458	ENSP00000391676:W458L;ENSP00000432511:W458L;ENSP00000436421:W458L	ENSP00000413248:W458L	W	-	2	0	JAK3	17811354	0.987000	0.35691	0.495000	0.27527	0.091000	0.18340	2.450000	0.44943	1.912000	0.55364	0.455000	0.32223	TGG		JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215	
TULP2	7288	hgsc.bcm.edu	37	19	49385439	49385439	+	Missense_Mutation	SNP	G	G	A	rs550619669		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr19:49385439G>A	ENST00000221399.3	-	12	1441	c.1297C>T	c.(1297-1299)Cgt>Tgt	p.R433C		NM_003323.2	NP_003314.2	O00295	TULP2_HUMAN	tubby like protein 2	433					visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	protein complex binding (GO:0032403)	p.R433C(1)		NS(1)|breast(2)|central_nervous_system(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	22		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		CGTTGGTAACGACTCAGTAGC	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		18950	0.0		0.001	False		,,,				2504	0.0				p.R433C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1297T	19						.						84.0	72.0	76.0					19																	49385439		2203	4300	6503	54077251	SO:0001583	missense	7288	exon12			U82469	CCDS12739.1	19q13.1	2009-08-06			ENSG00000104804	ENSG00000104804			12424	protein-coding gene	gene with protein product	"""cancer/testis antigen 65"""	602309				9096357	Standard	NM_003323		Approved	TUBL2, CT65	uc002pkz.2	O00295	OTTHUMG00000164406	ENST00000221399.3:c.1297C>T	19.37:g.49385439G>A	ENSP00000221399:p.Arg433Cys	Somatic		Capture	SOLID	Phase_I	54077251	NM_003323	Q8TC50	Missense_Mutation	SNP	ENST00000221399.3	37	CCDS12739.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.398917	0.62177	.	.	ENSG00000104804	ENST00000221399	D	0.96651	-4.08	4.49	4.49	0.54785	Tubby, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.96015	0.8702	M	0.62723	1.935	0.54753	D	0.999984	D	0.69078	0.997	P	0.53266	0.722	D	0.95382	0.8474	10	0.62326	D	0.03	-13.7637	10.2192	0.43188	0.0:0.0:0.802:0.198	.	433	O00295	TULP2_HUMAN	C	433	ENSP00000221399:R433C	ENSP00000221399:R433C	R	-	1	0	TULP2	54077251	0.796000	0.28864	0.550000	0.28217	0.044000	0.14063	2.621000	0.46418	2.494000	0.84150	0.555000	0.69702	CGT		TULP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378633.1	NM_003323	
SIGLEC10	89790	hgsc.bcm.edu	37	19	51914441	51914441	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr19:51914441G>A	ENST00000339313.5	-	11	2122	c.2006C>T	c.(2005-2007)aCg>aTg	p.T669M	SIGLEC10_ENST00000356298.5_Missense_Mutation_p.T669M|SIGLEC10_ENST00000441969.3_Missense_Mutation_p.T516M|SIGLEC10_ENST00000436984.2_Missense_Mutation_p.T526M|SIGLEC10_ENST00000442846.3_Missense_Mutation_p.T426M|SIGLEC10_ENST00000432469.2_Missense_Mutation_p.T491M|SIGLEC10_ENST00000439889.2_Missense_Mutation_p.T611M|SIGLEC10_ENST00000353836.5_Missense_Mutation_p.T574M|SIGLEC10_ENST00000525998.1_Missense_Mutation_p.T484M			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	669					cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.T611M(1)|p.T669M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GAAGTTGAGCGTGGCATAATG	0.552																																					p.T574M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1721T	19						.						168.0	161.0	164.0					19																	51914441		2203	4300	6503	56606253	SO:0001583	missense	89790	exon10			AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.2006C>T	19.37:g.51914441G>A	ENSP00000345243:p.Thr669Met	Somatic		Capture	SOLID	Phase_I	56606253	NM_001171157	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	ENST00000339313.5	37	CCDS12832.1	.	.	.	.	.	.	.	.	.	.	.	14.53	2.562685	0.45694	.	.	ENSG00000142512	ENST00000353836;ENST00000432469;ENST00000442846;ENST00000356298;ENST00000441969;ENST00000525998;ENST00000439889;ENST00000436984;ENST00000339313	T;T;T;T;T;T;T;T;T	0.53423	0.94;2.15;1.61;0.78;1.99;1.8;0.62;1.93;0.78	4.55	-2.7	0.06004	.	1.841900	0.02815	N	0.124894	T	0.53367	0.1792	L	0.44542	1.39	0.09310	N	1	D;D;D;D;D;D;D	0.89917	0.993;1.0;0.993;0.996;0.996;0.993;0.981	P;D;P;P;P;P;B	0.66847	0.773;0.947;0.773;0.886;0.886;0.838;0.411	T	0.48833	-0.9000	10	0.66056	D	0.02	.	1.3318	0.02136	0.2085:0.3074:0.3279:0.1562	.	526;484;574;574;516;611;669	C9JM10;E9PL79;B7ZL04;Q96LC7-2;Q96LC7-6;Q96LC7-3;Q96LC7	.;.;.;.;.;.;SIG10_HUMAN	M	574;491;426;669;516;484;611;526;669	ENSP00000342389:T574M;ENSP00000396742:T491M;ENSP00000395475:T426M;ENSP00000348646:T669M;ENSP00000408387:T516M;ENSP00000431444:T484M;ENSP00000389132:T611M;ENSP00000414324:T526M;ENSP00000345243:T669M	ENSP00000345243:T669M	T	-	2	0	SIGLEC10	56606253	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.283000	0.08433	-0.153000	0.11137	-0.219000	0.12488	ACG		SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2	NM_033130	
SULF1	23213	hgsc.bcm.edu	37	8	70536398	70536398	+	Missense_Mutation	SNP	G	G	A	rs146445328		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr8:70536398G>A	ENST00000260128.4	+	15	2533	c.1816G>A	c.(1816-1818)Gtg>Atg	p.V606M	SULF1_ENST00000458141.2_Missense_Mutation_p.V606M|SULF1_ENST00000419716.3_Missense_Mutation_p.V606M|SULF1_ENST00000402687.4_Missense_Mutation_p.V606M|SULF1_ENST00000521946.1_3'UTR	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	606					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.V606M(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			CAGCAACGCCGTGGGCCCACC	0.512																																					p.V606M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1816A	8						.						65.0	61.0	62.0					8																	70536398		2203	4300	6503	70698952	SO:0001583	missense	23213	exon15			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.1816G>A	8.37:g.70536398G>A	ENSP00000260128:p.Val606Met	Somatic		Capture	SOLID	Phase_I	70698952	NM_001128205	Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	ENST00000260128.4	37	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.959901	0.53400	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	D;D;D;D	0.98968	-5.28;-5.28;-5.28;-5.28	5.25	3.42	0.39159	Extracellular sulfatase, C-terminal (1);Alkaline-phosphatase-like, core domain (1);	0.222920	0.45867	D	0.000332	D	0.96303	0.8794	L	0.47716	1.5	0.36094	D	0.84368	P	0.49862	0.929	B	0.43251	0.413	D	0.95523	0.8596	10	0.23891	T	0.37	.	8.9403	0.35725	0.1286:0.1433:0.728:0.0	.	606	Q8IWU6	SULF1_HUMAN	M	606	ENSP00000403040:V606M;ENSP00000260128:V606M;ENSP00000385704:V606M;ENSP00000390315:V606M	ENSP00000260128:V606M	V	+	1	0	SULF1	70698952	0.896000	0.30565	0.981000	0.43875	0.773000	0.43773	1.332000	0.33805	1.408000	0.46895	0.655000	0.94253	GTG		SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170	
SLC6A17	388662	hgsc.bcm.edu	37	1	110717556	110717556	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr1:110717556G>A	ENST00000331565.4	+	5	1212	c.727G>A	c.(727-729)Gtt>Att	p.V243I	RP5-1028L10.1_ENST00000443008.1_RNA|RP5-1028L10.2_ENST00000440688.1_RNA	NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	243					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)	p.V243I(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		GATGGCTGTCGTTAAGGGCAT	0.607																																					p.V243I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G727A	1						.						70.0	65.0	67.0					1																	110717556		2203	4300	6503	110519079	SO:0001583	missense	388662	exon5				CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.727G>A	1.37:g.110717556G>A	ENSP00000330199:p.Val243Ile	Somatic		Capture	SOLID	Phase_I	110519079	NM_001010898	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	ENST00000331565.4	37	CCDS30799.1	.	.	.	.	.	.	.	.	.	.	G	1.290	-0.607888	0.03717	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.74106	-0.81	5.27	4.36	0.52297	.	0.251270	0.40818	N	0.001010	T	0.11537	0.0281	N	0.00162	-1.95	0.38906	D	0.957431	B	0.02656	0.0	B	0.04013	0.001	T	0.44329	-0.9335	10	0.02654	T	1	.	6.7558	0.23512	0.3062:0.0:0.6937:0.0	.	243	Q9H1V8	S6A17_HUMAN	I	243	ENSP00000330199:V243I	ENSP00000330199:V243I	V	+	1	0	SLC6A17	110519079	1.000000	0.71417	0.908000	0.35775	0.215000	0.24574	5.038000	0.64177	1.347000	0.45714	0.655000	0.94253	GTT		SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280	
EDEM3	80267	hgsc.bcm.edu	37	1	184703713	184703713	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr1:184703713T>C	ENST00000318130.8	-	5	676	c.410A>G	c.(409-411)gAt>gGt	p.D137G	EDEM3_ENST00000367512.3_Missense_Mutation_p.D94G	NM_025191.3	NP_079467.3	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like 3	137					cellular protein metabolic process (GO:0044267)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.D94G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TACATCGTTATCTAAATTAAC	0.254																																					p.D137G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A410G	1						.						46.0	50.0	49.0					1																	184703713		2196	4287	6483	182970336	SO:0001583	missense	80267	exon5			AF288393	CCDS1363.2	1q25	2008-02-05	2006-03-31	2006-03-31	ENSG00000116406	ENSG00000116406			16787	protein-coding gene	gene with protein product		610214	"""chromosome 1 open reading frame 22"""	C1orf22		15537790, 15579471	Standard	NM_025191		Approved		uc010pok.2	Q9BZQ6	OTTHUMG00000035387	ENST00000318130.8:c.410A>G	1.37:g.184703713T>C	ENSP00000318147:p.Asp137Gly	Somatic		Capture	SOLID	Phase_I	182970336	NM_025191	B2RCH6|B7ZLZ2|Q0VGM5|Q5TEZ0|Q9HCW1|Q9UFV7	Missense_Mutation	SNP	ENST00000318130.8	37	CCDS1363.2	.	.	.	.	.	.	.	.	.	.	T	26.7	4.763199	0.89932	.	.	ENSG00000116406	ENST00000318130;ENST00000367512	T;T	0.73789	-0.78;-0.78	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.87684	0.6239	M	0.84433	2.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.994	D	0.89462	0.3737	10	0.72032	D	0.01	.	16.1678	0.81782	0.0:0.0:0.0:1.0	.	137;94	Q9BZQ6;B7ZLZ2	EDEM3_HUMAN;.	G	137;94	ENSP00000318147:D137G;ENSP00000356482:D94G	ENSP00000318147:D137G	D	-	2	0	EDEM3	182970336	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.562000	0.82300	2.218000	0.71995	0.528000	0.53228	GAT		EDEM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085785.3	NM_025191	
CFHR5	81494	hgsc.bcm.edu	37	1	196964972	196964972	+	Missense_Mutation	SNP	G	G	A	rs201808624		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr1:196964972G>A	ENST00000256785.4	+	5	842	c.733G>A	c.(733-735)Ggg>Agg	p.G245R	CFHR5_ENST00000367414.5_Missense_Mutation_p.G269R			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	245	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)		p.G245R(1)		NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						TATAATAAACGGGCCTAAGAA	0.333																																					p.G245R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G733A	1						.	G	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	94.0	102.0	99.0		733	3.5	0.0	1		99	0,8600		0,0,4300	no	missense	CFHR5	NM_030787.3	125	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	245/570	196964972	1,13005	2203	4300	6503	195231595	SO:0001583	missense	81494	exon5			AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.733G>A	1.37:g.196964972G>A	ENSP00000256785:p.Gly245Arg	Somatic		Capture	SOLID	Phase_I	195231595	NM_030787	Q2NKK2	Missense_Mutation	SNP	ENST00000256785.4	37	CCDS1387.1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.615182	0.46631	2.27E-4	0.0	ENSG00000134389	ENST00000367414;ENST00000256785	T;T	0.72725	-0.68;-0.68	3.49	3.49	0.39957	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	D	0.89044	0.6603	H	0.98199	4.17	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80176	-0.1491	9	0.87932	D	0	.	10.838	0.46698	0.0:0.0:1.0:0.0	.	245	Q9BXR6	FHR5_HUMAN	R	269;245	ENSP00000356384:G269R;ENSP00000256785:G245R	ENSP00000256785:G245R	G	+	1	0	CFHR5	195231595	0.984000	0.35163	0.012000	0.15200	0.001000	0.01503	3.122000	0.50446	1.670000	0.50864	0.544000	0.68410	GGG		CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088814.2	NM_030787	
PRKCZ	5590	hgsc.bcm.edu	37	1	2082318	2082318	+	Silent	SNP	G	G	T			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr1:2082318G>T	ENST00000400921.2	+	6	911	c.228G>T	c.(226-228)ggG>ggT	p.G76G	PRKCZ_ENST00000479263.1_3'UTR|PRKCZ_ENST00000400920.1_Silent_p.G76G	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta	259	OPR.				actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.G259G(2)		breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	GAGTCATCGGGCGCGGGAGCT	0.517																																					p.G259G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G777T	1						.						79.0	78.0	78.0					1																	2082318		2203	4300	6503	2072178	SO:0001819	synonymous_variant	5590	exon9			BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.228G>T	1.37:g.2082318G>T		Somatic		Capture	SOLID	Phase_I	2072178	NM_002744	A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	Silent	SNP	ENST00000400921.2	37	CCDS41229.1																																																																																				PRKCZ-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000098533.3	NM_002744	
PLXNA2	5362	hgsc.bcm.edu	37	1	208206681	208206681	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr1:208206681G>A	ENST00000367033.3	-	28	5795	c.5038C>T	c.(5038-5040)Cgg>Tgg	p.R1680W		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1680					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.R1680W(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GCCAGTAGCCGGGTCAGGTAG	0.577																																					p.R1680W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5038T	1						.						127.0	113.0	117.0					1																	208206681		2203	4300	6503	206273304	SO:0001583	missense	5362	exon28			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.5038C>T	1.37:g.208206681G>A	ENSP00000356000:p.Arg1680Trp	Somatic		Capture	SOLID	Phase_I	206273304	NM_025179	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087286	0.76642	.	.	ENSG00000076356	ENST00000367033	T	0.19250	2.16	5.53	5.53	0.82687	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.113142	0.64402	D	0.000018	T	0.56934	0.2019	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67711	-0.5600	10	0.87932	D	0	.	14.248	0.66001	0.0:0.0:0.8147:0.1853	.	1680	O75051	PLXA2_HUMAN	W	1680	ENSP00000356000:R1680W	ENSP00000356000:R1680W	R	-	1	2	PLXNA2	206273304	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.275000	0.51639	2.605000	0.88082	0.655000	0.94253	CGG		PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
CAMK1G	57172	hgsc.bcm.edu	37	1	209785522	209785522	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr1:209785522G>A	ENST00000009105.1	+	11	1546	c.1301G>A	c.(1300-1302)tGc>tAc	p.C434Y	CAMK1G_ENST00000361322.2_Missense_Mutation_p.C434Y			Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	434						calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)	p.C434Y(1)		breast(2)|central_nervous_system(1)|large_intestine(8)|lung(8)|stomach(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.0475)		TCCTCCTACTGCTCTGAGCCC	0.557																																					p.C434Y	Ovarian(163;530 1939 9680 28669 48710)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1301A	1						.						34.0	36.0	36.0					1																	209785522		2203	4299	6502	207852145	SO:0001583	missense	57172	exon11				CCDS1486.1	1q32.2	2012-09-20			ENSG00000008118	ENSG00000008118			14585	protein-coding gene	gene with protein product		614994				12637513	Standard	NM_020439		Approved	VWS1, CLICKIII, dJ272L16.1	uc001hhd.3	Q96NX5	OTTHUMG00000036361	ENST00000009105.1:c.1301G>A	1.37:g.209785522G>A	ENSP00000009105:p.Cys434Tyr	Somatic		Capture	SOLID	Phase_I	207852145	NM_020439	Q86UH5|Q9Y3J7	Missense_Mutation	SNP	ENST00000009105.1	37	CCDS1486.1	.	.	.	.	.	.	.	.	.	.	G	15.49	2.849349	0.51270	.	.	ENSG00000008118	ENST00000009105;ENST00000361322	T;T	0.72394	-0.65;-0.65	5.59	5.59	0.84812	.	0.098157	0.45867	D	0.000333	T	0.60689	0.2288	N	0.24115	0.695	0.51012	D	0.999903	P;P	0.40834	0.73;0.468	B;B	0.39258	0.295;0.154	T	0.63681	-0.6582	10	0.45353	T	0.12	.	17.8704	0.88808	0.0:0.0:1.0:0.0	.	434;434	Q96NX5-2;Q96NX5	.;KCC1G_HUMAN	Y	434	ENSP00000009105:C434Y;ENSP00000354861:C434Y	ENSP00000009105:C434Y	C	+	2	0	CAMK1G	207852145	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.812000	0.55628	2.648000	0.89879	0.650000	0.86243	TGC		CAMK1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088526.1	NM_020439	
INTS7	25896	hgsc.bcm.edu	37	1	212180626	212180626	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr1:212180626A>G	ENST00000366994.3	-	6	826	c.722T>C	c.(721-723)cTt>cCt	p.L241P	INTS7_ENST00000366992.3_Missense_Mutation_p.L241P|INTS7_ENST00000366993.3_Missense_Mutation_p.L241P|INTS7_ENST00000469606.1_5'UTR|INTS7_ENST00000440600.2_Missense_Mutation_p.L192P	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	241					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)		p.L241P(1)		NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		TGACGCTGCAAGCAGAGTGAA	0.388																																					p.L192P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T575C	1						.						112.0	94.0	100.0					1																	212180626		2203	4300	6503	210247249	SO:0001583	missense	25896	exon5			AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.722T>C	1.37:g.212180626A>G	ENSP00000355961:p.Leu241Pro	Somatic		Capture	SOLID	Phase_I	210247249	NM_001199809	B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Missense_Mutation	SNP	ENST00000366994.3	37	CCDS1501.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.744860	0.89663	.	.	ENSG00000143493	ENST00000366994;ENST00000366993;ENST00000366992;ENST00000440600	T;T;T;T	0.73469	-0.72;-0.72;-0.72;-0.75	6.04	6.04	0.98038	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.86653	0.5984	M	0.77486	2.375	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.88074	0.2802	10	0.87932	D	0	-19.3247	16.5763	0.84648	1.0:0.0:0.0:0.0	.	192;241;241;241	B4DLZ6;Q9NVH2-3;Q9NVH2-2;Q9NVH2	.;.;.;INT7_HUMAN	P	241;241;241;192	ENSP00000355961:L241P;ENSP00000355960:L241P;ENSP00000355959:L241P;ENSP00000388908:L192P	ENSP00000355959:L241P	L	-	2	0	INTS7	210247249	1.000000	0.71417	0.997000	0.53966	0.942000	0.58702	8.649000	0.91067	2.317000	0.78254	0.459000	0.35465	CTT		INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090142.1	NM_015434	
EPRS	2058	hgsc.bcm.edu	37	1	220193411	220193411	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr1:220193411T>C	ENST00000366923.3	-	10	1537	c.1268A>G	c.(1267-1269)tAt>tGt	p.Y423C		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	423	Glutamate--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)	p.Y423C(1)		breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	TAGCCGACTATATTCCCAAAT	0.363																																					p.Y423C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1268G	1						.						174.0	167.0	169.0					1																	220193411		2203	4300	6503	218260034	SO:0001583	missense	2058	exon10			X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.1268A>G	1.37:g.220193411T>C	ENSP00000355890:p.Tyr423Cys	Somatic		Capture	SOLID	Phase_I	218260034	NM_004446	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	37	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.450064	0.84101	.	.	ENSG00000136628	ENST00000366923;ENST00000536921;ENST00000435048	T	0.23754	1.89	5.82	5.82	0.92795	Glutamyl/glutaminyl-tRNA synthetase, class Ib, catalytic domain (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.63768	0.2539	H	0.94385	3.53	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.995;0.996;0.992	T	0.75196	-0.3403	10	0.87932	D	0	-21.0339	16.182	0.81915	0.0:0.0:0.0:1.0	.	447;423;423	E7EMN0;Q3KQZ8;P07814	.;.;SYEP_HUMAN	C	423;423;447	ENSP00000355890:Y423C	ENSP00000355890:Y423C	Y	-	2	0	EPRS	218260034	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.484000	0.81180	2.222000	0.72286	0.528000	0.53228	TAT		EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	
NLRP3	114548	hgsc.bcm.edu	37	1	247611785	247611785	+	Silent	SNP	C	C	A	rs201532680		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr1:247611785C>A	ENST00000336119.3	+	9	3836	c.3090C>A	c.(3088-3090)gtC>gtA	p.V1030V	NLRP3_ENST00000348069.2_Silent_p.V916V|NLRP3_ENST00000366496.2_Silent_p.V973V|NLRP3_ENST00000391828.3_Silent_p.V1030V|NLRP3_ENST00000366497.2_Silent_p.V973V|NLRP3_ENST00000391827.2_Silent_p.V973V	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	1030					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.V1030V(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGCTGACCGTCGTCTTTGAGC	0.502																																					p.V1030V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3090A	1						.						89.0	89.0	89.0					1																	247611785		2203	4300	6503	245678408	SO:0001819	synonymous_variant	114548	exon9			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.3090C>A	1.37:g.247611785C>A		Somatic		Capture	SOLID	Phase_I	245678408	NM_004895	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Silent	SNP	ENST00000336119.3	37	CCDS1632.1																																																																																				NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
ZMYM6	9204	hgsc.bcm.edu	37	1	35470841	35470841	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr1:35470841C>G	ENST00000357182.4	-	13	2073	c.1846G>C	c.(1846-1848)Gag>Cag	p.E616Q	ZMYM6_ENST00000373340.2_Missense_Mutation_p.E616Q|ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000487874.1_Missense_Mutation_p.E616Q	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	616					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.E616Q(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				GAAGGGAGCTCCGTCACAGCA	0.388																																					p.E616Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1846C	1						.						117.0	99.0	106.0					1																	35470841		2203	4300	6503	35243428	SO:0001583	missense	9204	exon13			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.1846G>C	1.37:g.35470841C>G	ENSP00000349708:p.Glu616Gln	Somatic		Capture	SOLID	Phase_I	35243428	NM_007167	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	ENST00000357182.4	37	CCDS387.2	.	.	.	.	.	.	.	.	.	.	C	3.169	-0.170388	0.06461	.	.	ENSG00000163867	ENST00000373340;ENST00000357182	T;T	0.22336	1.96;3.14	4.8	4.8	0.61643	.	1.542990	0.03394	N	0.202389	T	0.28433	0.0703	L	0.33485	1.01	0.09310	N	1	B;B;B	0.31040	0.165;0.019;0.305	B;B;B	0.39660	0.069;0.03;0.306	T	0.43556	-0.9384	10	0.21014	T	0.42	-0.0065	16.5768	0.84704	0.0:1.0:0.0:0.0	.	519;616;616	B4DWC0;O95789;O95789-1	.;ZMYM6_HUMAN;.	Q	616	ENSP00000362437:E616Q;ENSP00000349708:E616Q	ENSP00000349708:E616Q	E	-	1	0	ZMYM6	35243428	0.002000	0.14202	0.017000	0.16124	0.145000	0.21501	1.412000	0.34714	2.655000	0.90218	0.484000	0.47621	GAG		ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167	
ZNF691	51058	hgsc.bcm.edu	37	1	43317084	43317084	+	Missense_Mutation	SNP	G	G	A	rs149242992		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr1:43317084G>A	ENST00000372506.1	+	4	795	c.455G>A	c.(454-456)cGc>cAc	p.R152H	ZNF691_ENST00000372507.1_Missense_Mutation_p.R152H|ZNF691_ENST00000372508.3_Missense_Mutation_p.R152H|ZNF691_ENST00000397044.3_Missense_Mutation_p.R183H|ZNF691_ENST00000372502.1_Missense_Mutation_p.R174H|ZNF691_ENST00000372504.1_Missense_Mutation_p.R174H	NM_001242739.1	NP_001229668.1	Q5VV52	ZN691_HUMAN	zinc finger protein 691	183						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R152H(1)		large_intestine(2)|lung(2)|ovary(2)|prostate(1)	7	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TTTCGGCGGCGCTCAGACCTC	0.587																																					p.R152H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G455A	1						.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	58.0	53.0	55.0		548,455	3.4	1.0	1	dbSNP_134	55	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ZNF691	NM_001242739.1,NM_015911.3	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	183/316,152/285	43317084	1,13005	2203	4300	6503	43089671	SO:0001583	missense	51058	exon2				CCDS476.1, CCDS55595.1	1p34.2	2013-01-08			ENSG00000164011	ENSG00000164011		"""Zinc fingers, C2H2-type"""	28028	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001242739		Approved	Zfp691	uc021omh.1	Q5VV52	OTTHUMG00000007623	ENST00000372506.1:c.455G>A	1.37:g.43317084G>A	ENSP00000361584:p.Arg152His	Somatic		Capture	SOLID	Phase_I	43089671	NM_015911	A8MXP6|B4DJR7|O95878|Q9NWE8	Missense_Mutation	SNP	ENST00000372506.1	37	CCDS476.1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.727974	0.30593	0.0	1.16E-4	ENSG00000164011	ENST00000372508;ENST00000372507;ENST00000372506;ENST00000397044;ENST00000372504;ENST00000372503;ENST00000372502	T;T;T;T;T;T	0.08370	3.1;3.1;3.1;3.1;3.1;3.1	5.31	3.42	0.39159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.222739	0.32703	N	0.005755	T	0.06600	0.0169	L	0.35542	1.07	0.30646	N	0.755923	B;B	0.11235	0.001;0.004	B;B	0.04013	0.001;0.001	T	0.08330	-1.0727	10	0.44086	T	0.13	-22.0432	7.346	0.26664	0.2798:0.0:0.7202:0.0	.	183;183	B4DJR7;Q5VV52	.;ZN691_HUMAN	H	152;152;152;183;174;183;174	ENSP00000361586:R152H;ENSP00000361585:R152H;ENSP00000361584:R152H;ENSP00000380237:R183H;ENSP00000361582:R174H;ENSP00000361580:R174H	ENSP00000361580:R174H	R	+	2	0	ZNF691	43089671	0.000000	0.05858	1.000000	0.80357	0.970000	0.65996	0.076000	0.14712	0.866000	0.35629	0.561000	0.74099	CGC		ZNF691-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020192.1	NM_015911	
OR2B11	127623	hgsc.bcm.edu	37	1	247614762	247614762	+	Silent	SNP	G	G	T			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr1:247614762G>T	ENST00000318749.6	-	1	546	c.523C>A	c.(523-525)Cgg>Agg	p.R175R		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R175W(1)|p.R175R(1)		endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			AGCACCTGCCGCCCGCAGAAT	0.602																																					p.R175R												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|endometrium(1)	c.C523A	1						.						55.0	53.0	53.0					1																	247614762		2203	4300	6503	245681385	SO:0001819	synonymous_variant	127623	exon1				CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.523C>A	1.37:g.247614762G>T		Somatic		Capture	SOLID	Phase_I	245681385	NM_001004492	B2RP03	Silent	SNP	ENST00000318749.6	37	CCDS31090.1																																																																																				OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492	
MLN	4295	hgsc.bcm.edu	37	6	33768863	33768863	+	Silent	SNP	G	G	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr6:33768863G>A	ENST00000430124.2	-	2	143	c.78C>T	c.(76-78)ttC>ttT	p.F26F	MLN_ENST00000507738.1_Silent_p.F26F|MLN_ENST00000266003.5_Silent_p.F26F	NM_001040109.1|NM_001184698.1|NM_002418.2	NP_001035198.1|NP_001171627.1|NP_002409.1	P12872	MOTI_HUMAN	motilin	26					cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	extracellular region (GO:0005576)	receptor binding (GO:0005102)	p.F26F(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|skin(1)	6						AGATGGGGACGAAGGCTTCCG	0.582																																					p.F26F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C78T	6						.						142.0	132.0	135.0					6																	33768863		2203	4300	6503	33876841	SO:0001819	synonymous_variant	4295	exon2				CCDS4786.1, CCDS47412.1, CCDS54993.1	6p21.31	2014-01-30			ENSG00000096395	ENSG00000096395		"""Endogenous ligands"""	7141	protein-coding gene	gene with protein product	"""prepromotilin"""	158270					Standard	NM_001184698		Approved		uc003off.1	P12872	OTTHUMG00000014536	ENST00000430124.2:c.78C>T	6.37:g.33768863G>A		Somatic		Capture	SOLID	Phase_I	33876841	NM_002418	B7ZLR7|E9PDN2|J3KN51|Q2M1L2|Q5T975|Q6NSY7	Silent	SNP	ENST00000430124.2	37	CCDS4786.1																																																																																				MLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040211.4		
ROS1	6098	hgsc.bcm.edu	37	6	117730797	117730797	+	Silent	SNP	C	C	T	rs55736087	byFrequency	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr6:117730797C>T	ENST00000368508.3	-	4	435	c.237G>A	c.(235-237)tcG>tcA	p.S79S	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Silent_p.S88S	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	79					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.S79S(2)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CAACCTCACACGACTCCCGCT	0.468			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""								c|||	3	0.000599042	0.0008	0.0	5008	,	,		17634	0.0		0.001	False		,,,				2504	0.001				p.S79S			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G237A	6						.	T		6,4400	11.4+/-27.6	0,6,2197	137.0	115.0	122.0		237	-7.3	0.2	6	dbSNP_129	122	32,8568	22.2+/-67.0	0,32,4268	no	coding-synonymous	ROS1	NM_002944.2		0,38,6465	TT,TC,CC		0.3721,0.1362,0.2922		79/2348	117730797	38,12968	2203	4300	6503	117837490	SO:0001819	synonymous_variant	6098	exon4			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.237G>A	6.37:g.117730797C>T		Somatic		Capture	SOLID	Phase_I	117837490	NM_002944	Q15368|Q5TDB5	Silent	SNP	ENST00000368508.3	37	CCDS5116.1																																																																																				ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
FBXW10	10517	hgsc.bcm.edu	37	17	18653070	18653070	+	Missense_Mutation	SNP	G	G	A	rs9895749	byFrequency	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr17:18653070G>A	ENST00000395665.4	+	3	927	c.706G>A	c.(706-708)Gaa>Aaa	p.E236K	FBXW10_ENST00000395667.1_Missense_Mutation_p.E236K|FBXW10_ENST00000308799.4_Missense_Mutation_p.E236K|FBXW10_ENST00000301938.4_Missense_Mutation_p.E236K			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	236				E -> K (in Ref. 2; CAB66756). {ECO:0000305}.						NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						GTGTATATCCGAAATGAATAG	0.473																																					p.E236K												.	.	0			c.G706A	17						.	G	LYS/GLU	1325,3081		44,1237,922	144.0	118.0	127.0		706	1.5	0.1	17	dbSNP_119	127	3457,5143		498,2461,1341	no	missense	FBXW10	NM_031456.3	56	542,3698,2263	AA,AG,GG		40.1977,30.0726,36.7676	probably-damaging	236/1052	18653070	4782,8224	2203	4300	6503	18593795	SO:0001583	missense	10517	exon3			BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.706G>A	17.37:g.18653070G>A	ENSP00000379025:p.Glu236Lys	Germline		Capture	SOLID	Phase_I	18593795	NM_031456	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Missense_Mutation	SNP	ENST00000395665.4	37	CCDS11199.3	768	0.3516483516483517	151	0.30691056910569103	136	0.3756906077348066	155	0.270979020979021	326	0.43007915567282323	G	13.41	2.228790	0.39399	0.300726	0.401977	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	2.49	1.48	0.22813	.	0.437341	0.16220	N	0.224080	T	0.00012	0.0000	M	0.63428	1.95	0.80722	P	0.0	B;B;B;B	0.27416	0.178;0.178;0.111;0.108	B;B;B;B	0.23018	0.043;0.043;0.019;0.024	T	0.40346	-0.9568	9	0.62326	D	0.03	.	5.1562	0.15036	0.1795:0.0:0.8205:0.0	rs9895749	236;236;236;236	Q5XX13-3;Q5XX13-2;Q5XX13;Q5XX13-4	.;.;FBW10_HUMAN;.	K	236	ENSP00000379026:E236K;ENSP00000310382:E236K;ENSP00000306937:E236K;ENSP00000379025:E236K	ENSP00000306937:E236K	E	+	1	0	FBXW10	18593795	0.661000	0.27430	0.129000	0.21949	0.040000	0.13550	0.490000	0.22403	0.368000	0.24481	0.405000	0.27470	GAA		FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313531.2	NM_031456	
SLFN13	146857	hgsc.bcm.edu	37	17	33769034	33769034	+	Silent	SNP	G	G	A	rs62078110	byFrequency	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr17:33769034G>A	ENST00000285013.6	-	5	1745	c.1470C>T	c.(1468-1470)acC>acT	p.T490T	SLFN13_ENST00000534689.1_Silent_p.T172T|SLFN13_ENST00000526861.1_Silent_p.T490T|SLFN13_ENST00000360502.2_Silent_p.T172T|SLFN13_ENST00000533791.1_Silent_p.T490T|SLFN13_ENST00000542635.1_Silent_p.T490T	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	490						intracellular (GO:0005622)	ATP binding (GO:0005524)	p.T490T(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		AAGTAAAGGCGGTGCGAGTGC	0.567													G|||	2284	0.45607	0.4569	0.4337	5008	,	,		25283	0.4921		0.4165	False		,,,				2504	0.4744				p.T490T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1470T	17						.						101.0	87.0	92.0					17																	33769034		2203	4300	6503	30793147	SO:0001819	synonymous_variant	146857	exon5			AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.1470C>T	17.37:g.33769034G>A		Somatic		Capture	SOLID	Phase_I	30793147	NM_144682	E1P645|Q658M1|Q6ZS51|Q96A81	Silent	SNP	ENST00000285013.6	37	CCDS32620.1																																																																																				SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682	
TP53	7157	hgsc.bcm.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R248W	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,haematopoietic_and_lymphoid_tissue,lymph_node,Substitution - Missense,+1	.	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	c.C742T	17	GRCh37	CM010465|CM900211	TP53	M	rs121912651	.						151.0	112.0	125.0					17																	7577539		2203	4300	6503	7518264	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp	Somatic		Capture	SOLID	Phase_I	7518264	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
SLC4A1	6521	hgsc.bcm.edu	37	17	42337242	42337242	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr17:42337242C>G	ENST00000262418.6	-	7	699	c.544G>C	c.(544-546)Ggg>Cgg	p.G182R	AC003043.1_ENST00000597382.1_Intron|SLC4A1_ENST00000471005.1_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	182	Globular.|Interaction with ANK1. {ECO:0000305}.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.G182R(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		GAAGGATCCCCAGAGCGTGTC	0.612																																					p.G182R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G544C	17						.						91.0	78.0	82.0					17																	42337242		2203	4300	6503	39692768	SO:0001583	missense	6521	exon7				CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.544G>C	17.37:g.42337242C>G	ENSP00000262418:p.Gly182Arg	Somatic		Capture	SOLID	Phase_I	39692768	NM_000342	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Missense_Mutation	SNP	ENST00000262418.6	37	CCDS11481.1	.	.	.	.	.	.	.	.	.	.	c	19.73	3.882649	0.72410	.	.	ENSG00000004939	ENST00000262418	T	0.67171	-0.25	5.19	5.19	0.71726	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.261736	0.27275	N	0.020114	T	0.69593	0.3128	L	0.37800	1.135	0.25846	N	0.983996	D;P	0.61697	0.99;0.517	P;B	0.58928	0.848;0.229	T	0.62191	-0.6906	10	0.30854	T	0.27	.	14.2885	0.66260	0.0:1.0:0.0:0.0	.	182;182	E2RVJ0;P02730	.;B3AT_HUMAN	R	182	ENSP00000262418:G182R	ENSP00000262418:G182R	G	-	1	0	SLC4A1	39692768	0.004000	0.15560	0.818000	0.32626	0.045000	0.14185	0.170000	0.16663	2.440000	0.82611	0.456000	0.33151	GGG		SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	NM_000342	
E2F4	1874	hgsc.bcm.edu	37	16	67228642	67228642	+	Silent	SNP	C	C	T			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr16:67228642C>T	ENST00000379378.3	+	6	626	c.567C>T	c.(565-567)ccC>ccT	p.P189P	E2F4_ENST00000564718.1_3'UTR	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding	189					blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.P189P(1)		breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		TGAGTGGTCCCATTGAGGTTC	0.532																																					p.P189P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C567T	16						.						124.0	114.0	118.0					16																	67228642		2198	4300	6498	65786143	SO:0001819	synonymous_variant	1874	exon6			BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975	ENST00000379378.3:c.567C>T	16.37:g.67228642C>T		Somatic		Capture	SOLID	Phase_I	65786143	NM_001950	A6NGR8|B5BU56|Q12991|Q15328	Silent	SNP	ENST00000379378.3	37	CCDS32464.1																																																																																				E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421565.1	NM_001950	
PIEZO2	63895	hgsc.bcm.edu	37	18	10689666	10689666	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr18:10689666C>A	ENST00000503781.3	-	45	7144	c.7145G>T	c.(7144-7146)cGg>cTg	p.R2382L	PIEZO2_ENST00000302079.6_Missense_Mutation_p.R2382L|PIEZO2_ENST00000538948.1_Missense_Mutation_p.R339L|PIEZO2_ENST00000580640.1_Missense_Mutation_p.R2407L|PIEZO2_ENST00000285141.4_Missense_Mutation_p.R237L	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2382					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.R2382L(1)|p.R237L(1)									CTCCGACTCCCGCCAACACTT	0.488																																					p.R2382L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G7145T	18						.						98.0	85.0	90.0					18																	10689666		2203	4300	6503	10679666	SO:0001583	missense	63895	exon45			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.7145G>T	18.37:g.10689666C>A	ENSP00000421377:p.Arg2382Leu	Somatic		Capture	SOLID	Phase_I	10679666	NM_022068	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	ENST00000503781.3	37		.	.	.	.	.	.	.	.	.	.	C	25.2	4.615439	0.87359	.	.	ENSG00000154864	ENST00000503781;ENST00000302079;ENST00000538948;ENST00000285141	T;T;T	0.72282	-0.64;-0.64;-0.64	4.62	4.62	0.57501	.	0.000000	0.64402	D	0.000006	D	0.82949	0.5148	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80011	-0.1561	10	0.23302	T	0.38	.	18.0138	0.89232	0.0:1.0:0.0:0.0	.	339	D6RFZ0	.	L	339;2382;339;237	ENSP00000303316:R2382L;ENSP00000443129:R339L;ENSP00000285141:R237L	ENSP00000285141:R237L	R	-	2	0	FAM38B	10679666	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	7.236000	0.78154	2.560000	0.86352	0.643000	0.83706	CGG		PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068	
SMAD2	4087	hgsc.bcm.edu	37	18	45374932	45374932	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr18:45374932T>C	ENST00000402690.2	-	8	1305	c.911A>G	c.(910-912)gAc>gGc	p.D304G	SMAD2_ENST00000262160.6_Missense_Mutation_p.D304G|SMAD2_ENST00000356825.4_Missense_Mutation_p.D274G|SMAD2_ENST00000586040.1_Missense_Mutation_p.D274G|SMAD2_ENST00000591214.1_Missense_Mutation_p.D274G	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	304	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)	p.D304G(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						ATTTGATGGGTCTGTAAAGCC	0.403																																					p.D274G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A821G	18						.						126.0	114.0	118.0					18																	45374932		2203	4300	6503	43628930	SO:0001583	missense	4087	exon7			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.911A>G	18.37:g.45374932T>C	ENSP00000384449:p.Asp304Gly	Somatic		Capture	SOLID	Phase_I	43628930	NM_001135937		Missense_Mutation	SNP	ENST00000402690.2	37	CCDS11934.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.866336	0.91511	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	D;D;D	0.98060	-4.69;-4.69;-4.69	5.81	5.81	0.92471	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98823	0.9603	M	0.87827	2.91	0.80722	D	1	D;D;D	0.89917	1.0;0.988;0.999	D;P;D	0.97110	1.0;0.856;0.988	D	0.99813	1.1042	10	0.87932	D	0	.	16.1773	0.81862	0.0:0.0:0.0:1.0	.	274;274;304	B7Z5N5;Q15796-2;Q15796	.;.;SMAD2_HUMAN	G	304;274;304	ENSP00000262160:D304G;ENSP00000349282:D274G;ENSP00000384449:D304G	ENSP00000262160:D304G	D	-	2	0	SMAD2	43628930	1.000000	0.71417	0.998000	0.56505	0.897000	0.52465	8.040000	0.89188	2.217000	0.71921	0.482000	0.46254	GAC		SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450571.1	NM_005901	
TCTEX1D2	255758	hgsc.bcm.edu	37	3	196022935	196022935	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr3:196022935G>A	ENST00000325318.5	-	4	458	c.323C>T	c.(322-324)gCt>gTt	p.A108V	RP11-447L10.1_ENST00000431391.1_Intron	NM_152773.4	NP_689986.2	Q8WW35	TC1D2_HUMAN	Tctex1 domain containing 2	108								p.A108V(1)		breast(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)	7	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		ACAGCGAGAAGCCATGCTAAA	0.378																																					p.A108V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C323T	3						.						103.0	97.0	99.0					3																	196022935		2203	4300	6503	197507332	SO:0001583	missense	255758	exon4			BC021177	CCDS33929.1	3q29	2010-07-19			ENSG00000213123	ENSG00000213123			28482	protein-coding gene	gene with protein product						12477932	Standard	NM_152773		Approved	MGC33212	uc003fwi.3	Q8WW35	OTTHUMG00000155672	ENST00000325318.5:c.323C>T	3.37:g.196022935G>A	ENSP00000324323:p.Ala108Val	Somatic		Capture	SOLID	Phase_I	197507332	NM_152773	A6NCN5	Missense_Mutation	SNP	ENST00000325318.5	37	CCDS33929.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.424164	0.83667	.	.	ENSG00000213123	ENST00000325318	T	0.37058	1.22	4.95	4.95	0.65309	.	0.223550	0.27581	U	0.018738	T	0.51736	0.1692	M	0.71920	2.185	0.80722	D	1	P	0.49090	0.919	P	0.55749	0.783	T	0.45366	-0.9266	10	0.37606	T	0.19	4.5712	13.8915	0.63742	0.0:0.0:1.0:0.0	.	108	Q8WW35	TC1D2_HUMAN	V	108	ENSP00000324323:A108V	ENSP00000324323:A108V	A	-	2	0	TCTEX1D2	197507332	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.452000	0.73485	2.730000	0.93505	0.655000	0.94253	GCT		TCTEX1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341166.1	NM_152773	
RIC8B	55188	hgsc.bcm.edu	37	12	107237687	107237687	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr12:107237687C>T	ENST00000392839.2	+	6	1229	c.1123C>T	c.(1123-1125)Cga>Tga	p.R375*	RIC8B_ENST00000392837.4_Nonsense_Mutation_p.R375*|RIC8B_ENST00000549643.1_Intron|RIC8B_ENST00000355478.2_Nonsense_Mutation_p.R335*	NM_018157.2	NP_060627.2	Q9NVN3	RIC8B_HUMAN	RIC8 guanine nucleotide exchange factor B	375					regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	G-protein alpha-subunit binding (GO:0001965)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.R375R(1)|p.R375*(1)		kidney(2)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	19						CGAATGTTCCCGAGCCCATCG	0.338																																					p.R375X												.	.	2	Substitution - Nonsense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.C1123T	12						.						99.0	94.0	96.0					12																	107237687		2203	4300	6503	105761817	SO:0001587	stop_gained	55188	exon6			AK128102	CCDS9109.2	12q23.3	2013-08-05	2013-08-05		ENSG00000111785	ENSG00000111785			25555	protein-coding gene	gene with protein product		609147	"""resistance to inhibitors of cholinesterase 8 homolog B (C. elegans)"""				Standard	XM_005268998		Approved	FLJ10620, hSyn, RIC8	uc001tlx.3	Q9NVN3	OTTHUMG00000144188	ENST00000392839.2:c.1123C>T	12.37:g.107237687C>T	ENSP00000376583:p.Arg375*	Somatic		Capture	SOLID	Phase_I	105761817	NM_018157	A2RTZ0|Q4G103|Q6ZRN4|Q86WD3	Nonsense_Mutation	SNP	ENST00000392839.2	37	CCDS9109.2	.	.	.	.	.	.	.	.	.	.	C	36	5.779204	0.96929	.	.	ENSG00000111785	ENST00000392837;ENST00000392839;ENST00000355478	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.704	14.2787	0.66196	0.1488:0.8512:0.0:0.0	.	.	.	.	X	375;375;335	.	ENSP00000347662:R335X	R	+	1	2	RIC8B	105761817	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.616000	0.36933	2.583000	0.87209	0.557000	0.71058	CGA		RIC8B-006	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000291398.2	NM_018157	
LALBA	3906	hgsc.bcm.edu	37	12	48963683	48963683	+	Missense_Mutation	SNP	C	C	T	rs558586421		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr12:48963683C>T	ENST00000301046.2	-	1	146	c.121G>A	c.(121-123)Gct>Act	p.A41T	LALBA_ENST00000549817.1_Missense_Mutation_p.A41T	NM_002289.2	NP_002280.1	P00709	LALBA_HUMAN	lactalbumin, alpha-	41					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|lactose biosynthetic process (GO:0005989)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|lactose synthase activity (GO:0004461)	p.A41T(1)		large_intestine(1)|stomach(2)	3						TCAGGCAAAGCGATGCCTCCA	0.512													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18410	0.0		0.0	False		,,,				2504	0.0				p.A41T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G121A	12						.						146.0	118.0	127.0					12																	48963683		2203	4300	6503	47249950	SO:0001583	missense	3906	exon1				CCDS8765.1	12q13	2012-10-02				ENSG00000167531			6480	protein-coding gene	gene with protein product		149750					Standard	XM_006719395		Approved	LYZL7	uc001rrt.3	P00709	OTTHUMG00000170391	ENST00000301046.2:c.121G>A	12.37:g.48963683C>T	ENSP00000301046:p.Ala41Thr	Somatic		Capture	SOLID	Phase_I	47249950	NM_002289	Q6FGX0|Q9UDK4	Missense_Mutation	SNP	ENST00000301046.2	37	CCDS8765.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.537366	0.27475	.	.	ENSG00000167531	ENST00000301046;ENST00000549817	T;T	0.68903	1.05;-0.36	5.03	-10.1	0.00402	Lysozyme-like domain (1);	1.580710	0.03950	N	0.288296	T	0.25344	0.0616	N	0.00855	-1.145	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.23691	-1.0181	10	0.48119	T	0.1	-2.197	0.1309	0.00073	0.2746:0.1765:0.2039:0.345	.	41	P00709	LALBA_HUMAN	T	41	ENSP00000301046:A41T;ENSP00000449780:A41T	ENSP00000301046:A41T	A	-	1	0	LALBA	47249950	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-0.837000	0.04377	-1.455000	0.01923	-0.493000	0.04662	GCT		LALBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408836.1	NM_002289	
ARHGEF25	115557	hgsc.bcm.edu	37	12	58007851	58007851	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr12:58007851G>A	ENST00000286494.4	+	6	1065	c.605G>A	c.(604-606)cGt>cAt	p.R202H	ARHGEF25_ENST00000333972.7_Missense_Mutation_p.R241H|AC025165.8_ENST00000593846.1_RNA|AC025165.8_ENST00000610219.1_RNA|AC025165.8_ENST00000356672.3_RNA|AC025165.8_ENST00000444467.1_RNA	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	202	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R202H(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						CTTCGAGGCCGTGACAGGATT	0.567																																					p.R241H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G722A	12						.						103.0	101.0	102.0					12																	58007851		2203	4300	6503	56294118	SO:0001583	missense	115557	exon7				CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.605G>A	12.37:g.58007851G>A	ENSP00000286494:p.Arg202His	Somatic		Capture	SOLID	Phase_I	56294118	NM_001111270	A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Missense_Mutation	SNP	ENST00000286494.4	37	CCDS8947.1	.	.	.	.	.	.	.	.	.	.	g	29.9	5.045645	0.93685	.	.	ENSG00000240771	ENST00000333972;ENST00000300189;ENST00000286494	T;T	0.62941	-0.01;-0.01	4.83	3.92	0.45320	Dbl homology (DH) domain (5);	0.000000	0.38272	N	0.001754	T	0.62466	0.2430	L	0.38649	1.16	0.50632	D	0.999881	D;D;D	0.71674	0.998;0.995;0.998	P;P;P	0.60609	0.828;0.774;0.877	T	0.64618	-0.6365	10	0.87932	D	0	.	5.8079	0.18450	0.2653:0.0:0.7347:0.0	.	241;202;76	F8W7Z4;Q86VW2;Q96M35	.;ARHGP_HUMAN;.	H	241;76;202	ENSP00000335560:R241H;ENSP00000286494:R202H	ENSP00000286494:R202H	R	+	2	0	ARHGEF25	56294118	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.758000	0.68776	2.410000	0.81850	0.563000	0.77884	CGT		ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000326561.1	NM_133483	
UBE3B	89910	hgsc.bcm.edu	37	12	109940887	109940887	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr12:109940887G>A	ENST00000342494.3	+	14	1937	c.1342G>A	c.(1342-1344)Ggg>Agg	p.G448R	UBE3B_ENST00000280774.5_Missense_Mutation_p.G448R|UBE3B_ENST00000434735.2_Missense_Mutation_p.G448R|UBE3B_ENST00000535900.1_3'UTR	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	448					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.G448R(1)		NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						CAGGCCTGTCGGGGGTAAACG	0.522																																					p.G448R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1342A	12						.						121.0	115.0	117.0					12																	109940887		2203	4300	6503	108425270	SO:0001583	missense	89910	exon14			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.1342G>A	12.37:g.109940887G>A	ENSP00000340596:p.Gly448Arg	Somatic		Capture	SOLID	Phase_I	108425270	NM_130466	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	ENST00000342494.3	37	CCDS9129.1	.	.	.	.	.	.	.	.	.	.	G	32	5.161550	0.94727	.	.	ENSG00000151148	ENST00000434735;ENST00000280774;ENST00000539599;ENST00000342494	T;T;T;T	0.45668	1.24;0.89;1.49;1.24	5.81	5.81	0.92471	.	0.044702	0.85682	N	0.000000	T	0.48370	0.1496	M	0.63428	1.95	0.80722	D	1	D	0.60575	0.988	P	0.44696	0.458	T	0.53358	-0.8450	10	0.66056	D	0.02	-7.5618	18.6619	0.91474	0.0:0.0:1.0:0.0	.	448	Q7Z3V4	UBE3B_HUMAN	R	448	ENSP00000391529:G448R;ENSP00000280774:G448R;ENSP00000443131:G448R;ENSP00000340596:G448R	ENSP00000280774:G448R	G	+	1	0	UBE3B	108425270	1.000000	0.71417	0.956000	0.39512	0.932000	0.56968	8.952000	0.93031	2.741000	0.93983	0.655000	0.94253	GGG		UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415	
ATP10A	57194	hgsc.bcm.edu	37	15	25966898	25966898	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr15:25966898G>T	ENST00000356865.6	-	7	1380	c.1269C>A	c.(1267-1269)taC>taA	p.Y423*		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	423					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.Y423*(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CTGAGAAAATGTACTGTATCT	0.428																																					p.Y423X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1269A	15						.						138.0	125.0	129.0					15																	25966898		2203	4300	6503	23517991	SO:0001587	stop_gained	57194	exon7			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.1269C>A	15.37:g.25966898G>T	ENSP00000349325:p.Tyr423*	Somatic		Capture	SOLID	Phase_I	23517991	NM_024490	Q4G0S9|Q969I4	Nonsense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	G	35	5.438841	0.96168	.	.	ENSG00000206190	ENST00000356865	.	.	.	5.53	-1.35	0.09114	.	0.060541	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-31.6891	12.1395	0.53991	0.5848:0.0:0.4152:0.0	.	.	.	.	X	423	.	ENSP00000349325:Y423X	Y	-	3	2	ATP10A	23517991	1.000000	0.71417	0.966000	0.40874	0.344000	0.29017	0.969000	0.29370	-0.568000	0.06038	0.549000	0.68633	TAC		ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
CYP11A1	1583	hgsc.bcm.edu	37	15	74630994	74630994	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr15:74630994C>T	ENST00000268053.6	-	8	1506	c.1352G>A	c.(1351-1353)cGg>cAg	p.R451Q	CYP11A1_ENST00000419019.2_Missense_Mutation_p.R293Q|CYP11A1_ENST00000358632.4_Missense_Mutation_p.R293Q	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1	451					biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R451Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	GCCCAAGTTCCGGAAGTAGGT	0.557																																					p.R451Q	Esophageal Squamous(87;818 1337 4093 9268 37314)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1352A	15						.						164.0	144.0	151.0					15																	74630994		2198	4297	6495	72418047	SO:0001583	missense	1583	exon8			AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.1352G>A	15.37:g.74630994C>T	ENSP00000268053:p.Arg451Gln	Somatic		Capture	SOLID	Phase_I	72418047	NM_000781	A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Missense_Mutation	SNP	ENST00000268053.6	37	CCDS32291.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.149938	0.78001	.	.	ENSG00000140459	ENST00000268053;ENST00000358632;ENST00000419019;ENST00000452422	T;T;T	0.68624	-0.34;-0.34;-0.34	5.14	5.14	0.70334	.	0.214018	0.46758	D	0.000280	T	0.72317	0.3445	L	0.41492	1.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.987	T	0.67277	-0.5711	10	0.21014	T	0.42	-27.3561	12.9989	0.58664	0.0:0.9192:0.0:0.0808	.	421;451	B4DTE5;P05108	.;CP11A_HUMAN	Q	451;293;293;216	ENSP00000268053:R451Q;ENSP00000351455:R293Q;ENSP00000405488:R293Q	ENSP00000268053:R451Q	R	-	2	0	CYP11A1	72418047	0.996000	0.38824	1.000000	0.80357	0.897000	0.52465	0.898000	0.28404	2.389000	0.81357	0.542000	0.68232	CGG		CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319737.1		
FBXW7	55294	hgsc.bcm.edu	37	4	153249384	153249384	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr4:153249384C>T	ENST00000281708.4	-	9	2623	c.1394G>A	c.(1393-1395)cGt>cAt	p.R465H	FBXW7_ENST00000263981.5_Missense_Mutation_p.R385H|FBXW7_ENST00000603841.1_Missense_Mutation_p.R465H|FBXW7_ENST00000603548.1_Missense_Mutation_p.R465H|FBXW7_ENST00000393956.3_Missense_Mutation_p.R289H|FBXW7_ENST00000296555.5_Missense_Mutation_p.R347H	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	465			R -> C (in a acute lymphoblastic leukemia cell line). {ECO:0000269|PubMed:11565033}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R465H(69)|p.R385H(16)|p.R226H(16)|p.R465L(4)|p.R347H(4)|p.R465Y(2)|p.?(1)|p.R385L(1)|p.R226L(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ATGCATACAACGCACAGTGGA	0.408			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R385H			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,large_intestine,NS,Substitution - Missense,0	.	114	Substitution - Missense(113)|Unknown(1)	haematopoietic_and_lymphoid_tissue(40)|large_intestine(39)|endometrium(24)|lung(5)|ovary(4)|cervix(1)|biliary_tract(1)	c.G1154A	4						.						253.0	218.0	230.0					4																	153249384		2203	4300	6503	153468834	SO:0001583	missense	55294	exon8			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1394G>A	4.37:g.153249384C>T	ENSP00000281708:p.Arg465His	Somatic		Capture	SOLID	Phase_I	153468834	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	C	32	5.178201	0.94846	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	6.05	6.05	0.98169	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.63827	0.2544	L	0.56124	1.755	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.62469	-0.6848	10	0.87932	D	0	-17.2313	20.6013	0.99457	0.0:1.0:0.0:0.0	.	289;465;347;385	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	H	465;347;385;289	ENSP00000281708:R465H;ENSP00000296555:R347H;ENSP00000263981:R385H;ENSP00000377528:R289H	ENSP00000263981:R385H	R	-	2	0	FBXW7	153468834	1.000000	0.71417	0.960000	0.40013	0.996000	0.88848	7.818000	0.86416	2.878000	0.98634	0.650000	0.86243	CGT		FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
IL1RAPL2	26280	hgsc.bcm.edu	37	X	104984651	104984651	+	Missense_Mutation	SNP	C	C	T	rs375566296		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chrX:104984651C>T	ENST00000372582.1	+	8	1771	c.1015C>T	c.(1015-1017)Cgg>Tgg	p.R339W	IL1RAPL2_ENST00000485671.1_3'UTR|IL1RAPL2_ENST00000344799.4_Missense_Mutation_p.R339W	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	339	Ig-like C2-type 3.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.R339W(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CCGAAATGGACGGAAACATGC	0.373																																					p.R339W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1015T	X						.	C	TRP/ARG	0,3835		0,0,1632,571	75.0	64.0	68.0		1015	1.7	1.0	X		68	1,6727		0,1,2427,1872	no	missense	IL1RAPL2	NM_017416.1	101	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	probably-damaging	339/687	104984651	1,10562	2203	4300	6503	104871307	SO:0001583	missense	26280	exon8			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1015C>T	X.37:g.104984651C>T	ENSP00000361663:p.Arg339Trp	Somatic		Capture	SOLID	Phase_I	104871307	NM_017416	Q2M3U3|Q9NZN0	Missense_Mutation	SNP	ENST00000372582.1	37	CCDS14517.1	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671661	0.67928	0.0	1.49E-4	ENSG00000189108	ENST00000372582;ENST00000344799	T;T	0.77750	-1.12;-1.12	5.61	1.7	0.24286	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000012	D	0.86818	0.6024	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84578	0.0659	10	0.38643	T	0.18	.	14.0838	0.64942	0.5179:0.4821:0.0:0.0	.	339	Q9NP60	IRPL2_HUMAN	W	339	ENSP00000361663:R339W;ENSP00000344976:R339W	ENSP00000344976:R339W	R	+	1	2	IL1RAPL2	104871307	1.000000	0.71417	0.990000	0.47175	0.997000	0.91878	2.545000	0.45769	-0.092000	0.12417	0.600000	0.82982	CGG		IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
DACH2	117154	hgsc.bcm.edu	37	X	86069706	86069706	+	Missense_Mutation	SNP	G	G	A	rs201550153		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chrX:86069706G>A	ENST00000373125.4	+	10	1553	c.1553G>A	c.(1552-1554)cGc>cAc	p.R518H	DACH2_ENST00000373131.1_Missense_Mutation_p.R505H|DACH2_ENST00000510272.1_Missense_Mutation_p.R299H|DACH2_ENST00000508860.1_Missense_Mutation_p.R351H	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	518	DACHbox-C.				development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R518H(1)|p.R505H(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						ATGCAAAAGCGCCTGAAGAAG	0.418																																					p.R518H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1553A	X						.	G	HIS/ARG,HIS/ARG,HIS/ARG	0,3835		0,0,1632,571	52.0	49.0	50.0		1514,1052,1553	4.8	1.0	X		50	2,6726		0,2,2426,1872	yes	missense,missense,missense	DACH2	NM_001139514.1,NM_001139515.1,NM_053281.3	29,29,29	0,2,4058,2443	AA,AG,GG,G		0.0297,0.0,0.0189	probably-damaging,probably-damaging,probably-damaging	505/572,351/433,518/600	86069706	2,10561	2203	4300	6503	85956362	SO:0001583	missense	117154	exon10			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.1553G>A	X.37:g.86069706G>A	ENSP00000362217:p.Arg518His	Somatic		Capture	SOLID	Phase_I	85956362	NM_053281	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479378	0.84747	0.0	2.97E-4	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297;ENST00000484479	D;D	0.89617	-2.5;-2.54	4.76	4.76	0.60689	.	0.000000	0.64402	D	0.000003	D	0.94128	0.8117	M	0.76727	2.345	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.996;0.997	D	0.95005	0.8146	10	0.87932	D	0	.	17.002	0.86383	0.0:0.0:1.0:0.0	.	384;518;505;518	Q1RMF5;A8K3I1;Q96NX9-2;Q96NX9	.;.;.;DACH2_HUMAN	H	518;505;518;351;299;351;183	ENSP00000362223:R505H;ENSP00000362217:R518H	ENSP00000345134:R518H	R	+	2	0	DACH2	85956362	1.000000	0.71417	0.989000	0.46669	0.860000	0.49131	9.288000	0.96055	1.932000	0.55993	0.415000	0.27848	CGC		DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
GPR112	139378	hgsc.bcm.edu	37	X	135426910	135426910	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chrX:135426910G>T	ENST00000394143.1	+	6	1336	c.1045G>T	c.(1045-1047)Gaa>Taa	p.E349*	GPR112_ENST00000370652.1_Nonsense_Mutation_p.E349*|GPR112_ENST00000287534.4_Nonsense_Mutation_p.E286*|GPR112_ENST00000412101.1_Nonsense_Mutation_p.E144*|GPR112_ENST00000394141.1_Nonsense_Mutation_p.E144*	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	349					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.E349*(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TCCATCTTCAGAAAGCACAAA	0.383																																					p.E349X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1045T	X						.						89.0	82.0	84.0					X																	135426910		2203	4299	6502	135254576	SO:0001587	stop_gained	139378	exon6			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.1045G>T	X.37:g.135426910G>T	ENSP00000377699:p.Glu349*	Somatic		Capture	SOLID	Phase_I	135254576	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Nonsense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	g	27.6	4.842225	0.91197	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	.	.	.	3.95	3.08	0.35506	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	7.3703	0.26798	0.1339:0.0:0.8661:0.0	.	.	.	.	X	349;349;144;286;144	.	ENSP00000287534:E286X	E	+	1	0	GPR112	135254576	0.413000	0.25400	0.010000	0.14722	0.018000	0.09664	2.221000	0.42917	0.758000	0.33059	0.502000	0.49764	GAA		GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
TPO	7173	hgsc.bcm.edu	37	2	1457495	1457495	+	Missense_Mutation	SNP	C	C	T	rs139312937		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr2:1457495C>T	ENST00000345913.4	+	6	603	c.512C>T	c.(511-513)aCg>aTg	p.T171M	TPO_ENST00000382198.1_Missense_Mutation_p.T171M|TPO_ENST00000337415.3_Missense_Mutation_p.T171M|TPO_ENST00000497517.2_Intron|TPO_ENST00000382201.3_Missense_Mutation_p.T171M|TPO_ENST00000349624.3_Missense_Mutation_p.T171M|TPO_ENST00000329066.4_Missense_Mutation_p.T171M|TPO_ENST00000346956.3_Missense_Mutation_p.T171M	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	171					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.T171M(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GCCTCCAACACGGCCCTGGCA	0.587																																					p.T171M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C512T	2						.	C	MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR	0,4406		0,0,2203	70.0	78.0	75.0		512,512,512,512,512,512	5.3	1.0	2	dbSNP_134	75	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	81,81,81,81,81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	171/934,171/934,171/877,171/877,171/890,171/761	1457495	1,13005	2203	4300	6503	1436502	SO:0001583	missense	7173	exon5				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.512C>T	2.37:g.1457495C>T	ENSP00000318820:p.Thr171Met	Somatic		Capture	SOLID	Phase_I	1436502	NM_175721	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676017	0.67928	0.0	1.16E-4	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000423320;ENST00000382198;ENST00000422464	T;T;T;T;T;T;T;T;T	0.74842	-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.88;-0.5;-0.5	5.27	5.27	0.74061	.	0.145775	0.64402	D	0.000010	D	0.85847	0.5792	M	0.70842	2.15	0.80722	D	1	D;D;D;D	0.89917	0.989;1.0;0.989;0.981	P;D;P;P	0.72982	0.538;0.979;0.538;0.668	D	0.87183	0.2229	10	0.72032	D	0.01	-13.2269	18.8829	0.92364	0.0:1.0:0.0:0.0	.	171;171;171;171	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	M	171;171;171;171;171;171;171;171;100	ENSP00000337263:T171M;ENSP00000318820:T171M;ENSP00000263886:T171M;ENSP00000332044:T171M;ENSP00000329869:T171M;ENSP00000371636:T171M;ENSP00000390994:T171M;ENSP00000371633:T171M;ENSP00000405788:T100M	ENSP00000329869:T171M	T	+	2	0	TPO	1436502	0.963000	0.33076	1.000000	0.80357	0.260000	0.26232	2.135000	0.42112	2.438000	0.82558	0.557000	0.71058	ACG		TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
SMARCAL1	50485	hgsc.bcm.edu	37	2	217288358	217288358	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr2:217288358G>A	ENST00000357276.4	+	6	1429	c.1099G>A	c.(1099-1101)Gtc>Atc	p.V367I	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.V367I	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	367	HARP 2. {ECO:0000255|PROSITE- ProRule:PRU00800}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)	p.V367I(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CATTGCAGATGTCAAGACCAG	0.373									Schimke Immuno-Osseous Dysplasia																												p.V367I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1099A	2						.						222.0	210.0	214.0					2																	217288358		2203	4300	6503	216996603	SO:0001583	missense	50485	exon6	Familial Cancer Database	SIOD	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.1099G>A	2.37:g.217288358G>A	ENSP00000349823:p.Val367Ile	Somatic		Capture	SOLID	Phase_I	216996603	NM_014140	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.611455	0.28712	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128;ENST00000412913	T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6	5.44	-0.886	0.10590	HepA-related (1);	2.737020	0.00868	N	0.001996	T	0.53222	0.1783	L	0.29908	0.895	0.09310	N	1	B	0.10296	0.003	B	0.15870	0.014	T	0.13124	-1.0521	10	0.16896	T	0.51	0.629	0.7082	0.00920	0.2391:0.1215:0.2682:0.3711	.	367	Q9NZC9	SMAL1_HUMAN	I	367;367;231;87	ENSP00000349823:V367I;ENSP00000350940:V367I;ENSP00000375974:V231I;ENSP00000390248:V87I	ENSP00000349823:V367I	V	+	1	0	SMARCAL1	216996603	0.991000	0.36638	0.251000	0.24312	0.994000	0.84299	0.636000	0.24644	-0.097000	0.12307	0.655000	0.94253	GTC		SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
CATIP	375307	hgsc.bcm.edu	37	2	219225317	219225317	+	Missense_Mutation	SNP	C	C	T	rs373829179		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr2:219225317C>T	ENST00000289388.3	+	5	426	c.397C>T	c.(397-399)Cgg>Tgg	p.R133W	AC021016.8_ENST00000411433.1_RNA|C2orf62_ENST00000481940.1_3'UTR	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		133					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R133W(1)		endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCCCATGGAACGGAAGATGAG	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		17412	0.0		0.0	False		,,,				2504	0.001				p.R133W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C397T	2						.	C	TRP/ARG	0,4406		0,0,2203	99.0	83.0	89.0		397	-3.8	0.0	2		89	1,8599	1.2+/-3.3	0,1,4299	no	missense	C2orf62	NM_198559.1	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	133/388	219225317	1,13005	2203	4300	6503	218933561	SO:0001583	missense	375307	exon5																														ENST00000289388.3:c.397C>T	2.37:g.219225317C>T	ENSP00000289388:p.Arg133Trp	Somatic		Capture	SOLID	Phase_I	218933561	NM_198559		Missense_Mutation	SNP	ENST00000289388.3	37	CCDS2414.1	.	.	.	.	.	.	.	.	.	.	C	12.51	1.960061	0.34565	0.0	1.16E-4	ENSG00000158428	ENST00000289388	.	.	.	4.36	-3.78	0.04333	.	0.357444	0.26300	N	0.025163	T	0.47248	0.1435	L	0.59436	1.845	0.09310	N	1	D	0.71674	0.998	P	0.53861	0.736	T	0.56202	-0.8018	9	0.87932	D	0	-4.5987	14.6876	0.69059	0.8073:0.1927:0.0:0.0	.	133	Q7Z7H3	CB062_HUMAN	W	133	.	ENSP00000289388:R133W	R	+	1	2	C2orf62	218933561	0.001000	0.12720	0.000000	0.03702	0.114000	0.19823	-0.202000	0.09451	-0.510000	0.06523	-0.165000	0.13383	CGG		C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256771.1		
TSGA10	80705	hgsc.bcm.edu	37	2	99725861	99725861	+	Silent	SNP	T	T	C			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr2:99725861T>C	ENST00000393483.3	-	6	886	c.42A>G	c.(40-42)ccA>ccG	p.P14P	TSGA10_ENST00000410001.1_Silent_p.P14P|TSGA10_ENST00000542655.1_Silent_p.P14P|TSGA10_ENST00000478090.1_5'UTR|TSGA10_ENST00000355053.4_Silent_p.P14P|TSGA10_ENST00000539964.1_Silent_p.P14P	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	14					cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.P14P(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						CCCGGGCAGTTGGTGATGGGC	0.368																																					p.P14P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A42G	2						.						134.0	125.0	128.0					2																	99725861		2203	4300	6503	99092293	SO:0001819	synonymous_variant	80705	exon6			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.42A>G	2.37:g.99725861T>C		Somatic		Capture	SOLID	Phase_I	99092293	NM_025244	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Silent	SNP	ENST00000393483.3	37	CCDS2037.1																																																																																				TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911	
TRAF3IP1	26146	hgsc.bcm.edu	37	2	239237961	239237961	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr2:239237961A>G	ENST00000373327.4	+	5	1115	c.893A>G	c.(892-894)gAg>gGg	p.E298G	TRAF3IP1_ENST00000391994.2_Missense_Mutation_p.E298G|TRAF3IP1_ENST00000391993.3_Missense_Mutation_p.E298G	NM_015650.3	NP_056465.2	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting protein 1	298	Abolishes microtubules-binding when missing.|DISC1-interaction domain.				cilium assembly (GO:0042384)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic heart tube development (GO:0035050)|intraciliary transport (GO:0042073)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube patterning (GO:0021532)|post-anal tail morphogenesis (GO:0036342)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)		p.E298G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(2)	23		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		AAGAACAGAGAGCATGACAAA	0.502																																					p.E298G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A893G	2						.						67.0	76.0	73.0					2																	239237961		2199	4286	6485	238902700	SO:0001583	missense	26146	exon5			AF230877	CCDS33415.1, CCDS46557.1	2q37.3	2014-02-21			ENSG00000204104	ENSG00000204104		"""Intraflagellar transport homologs"""	17861	protein-coding gene	gene with protein product	"""microtubule interacting protein that associates with TRAF3"""	607380				10791955, 12935900	Standard	NM_015650		Approved	MIP-T3, DKFZP434F124, MIPT3, IFT54	uc002vye.3	Q8TDR0	OTTHUMG00000152872	ENST00000373327.4:c.893A>G	2.37:g.239237961A>G	ENSP00000362424:p.Glu298Gly	Somatic		Capture	SOLID	Phase_I	238902700	NM_001139490	Q6PCT1|Q7L8N9|Q9NRD6|Q9Y4Q1	Missense_Mutation	SNP	ENST00000373327.4	37	CCDS33415.1	.	.	.	.	.	.	.	.	.	.	A	11.45	1.641907	0.29157	.	.	ENSG00000204104	ENST00000391993;ENST00000373327;ENST00000391994;ENST00000440998	T;T;T	0.15256	2.44;2.44;2.44	4.37	4.37	0.52481	.	0.800459	0.11944	N	0.514359	T	0.17704	0.0425	L	0.44542	1.39	0.32258	N	0.570498	P;B	0.40731	0.728;0.008	B;B	0.39339	0.297;0.012	T	0.11542	-1.0583	10	0.44086	T	0.13	-14.7413	12.1392	0.53989	1.0:0.0:0.0:0.0	.	298;298	Q8TDR0-2;Q8TDR0	.;MIPT3_HUMAN	G	298	ENSP00000375851:E298G;ENSP00000362424:E298G;ENSP00000375852:E298G	ENSP00000362424:E298G	E	+	2	0	TRAF3IP1	238902700	1.000000	0.71417	0.208000	0.23602	0.369000	0.29798	3.397000	0.52572	1.754000	0.51921	0.533000	0.62120	GAG		TRAF3IP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328312.1	NM_015650	
PNPLA7	375775	hgsc.bcm.edu	37	9	140437201	140437201	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr9:140437201C>T	ENST00000277531.4	-	6	670	c.484G>A	c.(484-486)Gtc>Atc	p.V162I	PNPLA7_ENST00000406427.1_Missense_Mutation_p.V187I|AL365502.1_ENST00000580317.1_RNA	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	162					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)	p.V162I(1)		breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		TGCACAAAGACGATGTGTTTG	0.632																																					p.V162I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G484A	9						.						78.0	71.0	73.0					9																	140437201		2203	4300	6503	139557022	SO:0001583	missense	375775	exon6			AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.484G>A	9.37:g.140437201C>T	ENSP00000277531:p.Val162Ile	Somatic		Capture	SOLID	Phase_I	139557022	NM_152286	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	ENST00000277531.4	37	CCDS7045.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.727361	0.30593	.	.	ENSG00000130653	ENST00000277531;ENST00000406427;ENST00000371451;ENST00000434090;ENST00000371450	T;T;T	0.42900	0.96;0.96;0.96	4.15	3.24	0.37175	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);	0.289186	0.31834	N	0.006992	T	0.27798	0.0684	L	0.47016	1.485	0.80722	D	1	P;P	0.39250	0.541;0.665	B;B	0.28139	0.064;0.086	T	0.05338	-1.0891	10	0.39692	T	0.17	-29.311	7.3581	0.26731	0.1762:0.7295:0.0:0.0943	.	187;162	Q6ZV29-5;Q6ZV29	.;PLPL7_HUMAN	I	162;187;162;153;187	ENSP00000277531:V162I;ENSP00000384610:V187I;ENSP00000400582:V153I	ENSP00000277531:V162I	V	-	1	0	PNPLA7	139557022	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.197000	0.32211	0.851000	0.35264	0.563000	0.77884	GTC		PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1	NM_152286	
AMER2	219287	hgsc.bcm.edu	37	13	25744387	25744387	+	Silent	SNP	C	C	T			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr13:25744387C>T	ENST00000515384.1	-	1	2038	c.1371G>A	c.(1369-1371)gcG>gcA	p.A457A	AMER2_ENST00000381853.3_Silent_p.A338A|AMER2_ENST00000357816.2_Silent_p.A338A|AMER2-AS1_ENST00000413501.1_lincRNA			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	457			A -> T (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.A338A(1)|p.A457A(1)									CCACCTTAGCCGCGCCCTCCT	0.652																																					p.A457A												FAM123A,large_intestine,colon,Substitution - Missense,-2	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1371A	13						.						24.0	23.0	23.0					13																	25744387		2203	4300	6503	24642387	SO:0001819	synonymous_variant	219287	exon1			AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.1371G>A	13.37:g.25744387C>T		Somatic		Capture	SOLID	Phase_I	24642387	NM_152704	Q5RL80|Q5VX56|Q8N593|Q96NN5	Silent	SNP	ENST00000515384.1	37	CCDS53859.1																																																																																				AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1	NM_152704	
SEPHS1	22929	hgsc.bcm.edu	37	10	13361209	13361209	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr10:13361209C>T	ENST00000327347.5	-	9	1487	c.1112G>A	c.(1111-1113)cGg>cAg	p.R371Q	SEPHS1_ENST00000537130.1_Missense_Mutation_p.R304Q|SEPHS1_ENST00000378614.4_Missense_Mutation_p.R300Q|SEPHS1_ENST00000545675.1_3'UTR	NM_001195602.1|NM_012247.4	NP_001182531.1|NP_036379.2	P49903	SPS1_HUMAN	selenophosphate synthetase 1	371					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|selenide, water dikinase activity (GO:0004756)	p.R371Q(2)		cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|stomach(1)	16						CTCGATGATCCGGGGTTTGTC	0.483																																					p.R300Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G899A	10						.						232.0	231.0	232.0					10																	13361209		2203	4300	6503	13401215	SO:0001583	missense	22929	exon8			BC000941	CCDS7098.1, CCDS55702.1, CCDS55703.1	10p14	2006-10-06			ENSG00000086475	ENSG00000086475			19685	protein-coding gene	gene with protein product		600902				7665581	Standard	NM_012247		Approved	SPS, SPS1	uc001imk.3	P49903	OTTHUMG00000017696	ENST00000327347.5:c.1112G>A	10.37:g.13361209C>T	ENSP00000367893:p.Arg371Gln	Somatic		Capture	SOLID	Phase_I	13401215	NM_001195604	B4DWK0|D3DRS9|D6PSQ9|Q5T5U8|Q5T5U9|Q9BVT4	Missense_Mutation	SNP	ENST00000327347.5	37	CCDS7098.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.222977	0.58668	.	.	ENSG00000086475	ENST00000327347;ENST00000319684;ENST00000378614;ENST00000537130	T;T;T	0.50813	0.88;0.73;0.89	5.23	5.23	0.72850	AIR synthase-related protein, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.45175	0.1329	L	0.51914	1.62	0.80722	D	1	B;B;B;B	0.28128	0.098;0.201;0.201;0.055	B;B;B;B	0.12837	0.003;0.008;0.008;0.003	T	0.43540	-0.9385	10	0.59425	D	0.04	-25.7142	19.197	0.93693	0.0:1.0:0.0:0.0	.	323;371;371;304	B4DLS1;P49903;D3DRS9;B4DWK0	.;SPS1_HUMAN;.;.	Q	371;300;300;304	ENSP00000367893:R371Q;ENSP00000367877:R300Q;ENSP00000442768:R304Q	ENSP00000367887:R300Q	R	-	2	0	SEPHS1	13401215	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.605000	0.88082	0.655000	0.94253	CGG		SEPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046856.1	NM_012247	
MPP7	143098	hgsc.bcm.edu	37	10	28527516	28527516	+	Silent	SNP	C	C	T	rs375446313		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr10:28527516C>T	ENST00000375732.1	-	2	277	c.18G>A	c.(16-18)acG>acA	p.T6T	MPP7_ENST00000375719.3_Silent_p.T6T|MPP7_ENST00000445954.2_5'UTR|MPP7_ENST00000540098.1_Silent_p.T6T|MPP7_ENST00000481244.1_5'UTR|MPP7_ENST00000337532.5_Silent_p.T6T			Q5T2T1	MPP7_HUMAN	membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)	6					establishment of cell polarity (GO:0030010)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of signal transduction (GO:0009967)|protein localization to adherens junction (GO:0071896)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cell junction (GO:0030054)|mitochondrion (GO:0005739)|MPP7-DLG1-LIN7 complex (GO:0097025)|tight junction (GO:0005923)	protein complex scaffold (GO:0032947)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|signaling adaptor activity (GO:0035591)	p.T6T(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	22						TCCCAGATCCCGTTGACAAAG	0.507																																					p.T6T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G18A	10						.	C		1,4405	2.1+/-5.4	0,1,2202	148.0	118.0	128.0		18	-12.1	0.0	10		128	0,8600		0,0,4300	no	coding-synonymous	MPP7	NM_173496.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		6/577	28527516	1,13005	2203	4300	6503	28567522	SO:0001819	synonymous_variant	143098	exon4			BC038105	CCDS7158.1	10p12.1	2004-01-15			ENSG00000150054	ENSG00000150054			26542	protein-coding gene	gene with protein product		610973				14719143	Standard	NM_173496		Approved	FLJ32798	uc001iua.1	Q5T2T1	OTTHUMG00000017868	ENST00000375732.1:c.18G>A	10.37:g.28527516C>T		Somatic		Capture	SOLID	Phase_I	28567522	NM_173496	B2RCC9|B4DWL9|B5MDZ3|D3DRW3|Q5T2T0|Q8IY28	Silent	SNP	ENST00000375732.1	37	CCDS7158.1																																																																																				MPP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047345.1	NM_173496	
LRRC18	474354	hgsc.bcm.edu	37	10	50121829	50121829	+	Silent	SNP	G	G	A	rs144747704	byFrequency	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr10:50121829G>A	ENST00000374160.3	-	1	448	c.372C>T	c.(370-372)cgC>cgT	p.R124R	RP11-523O18.7_ENST00000430438.1_RNA|WDFY4_ENST00000325239.5_Intron|WDFY4_ENST00000413659.2_Intron|LRRC18_ENST00000298124.3_Silent_p.R124R	NM_001006939.3	NP_001006940.3	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	124						cytoplasm (GO:0005737)		p.R124R(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						GGTTCACAGCGCGGATGTTCT	0.597													G|||	3	0.000599042	0.0023	0.0	5008	,	,		19139	0.0		0.0	False		,,,				2504	0.0				p.R124R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C372T	10						.	G	,	7,4399	12.9+/-30.5	0,7,2196	93.0	90.0	91.0		372,	-2.0	0.4	10	dbSNP_134	91	2,8598	2.2+/-6.3	0,2,4298	yes	coding-synonymous,intron	WDFY4,LRRC18	NM_001006939.3,NM_020945.1	,	0,9,6494	AA,AG,GG		0.0233,0.1589,0.0692	,	124/262,	50121829	9,12997	2203	4300	6503	49791835	SO:0001819	synonymous_variant	474354	exon1			AY358137	CCDS31197.1	10q11.23	2011-02-10			ENSG00000165383	ENSG00000165383			23199	protein-coding gene	gene with protein product							Standard	NM_001006939		Approved	UNQ933, MGC34773, UNQ9338, VKGE9338	uc001jhd.3	Q8N456	OTTHUMG00000018182	ENST00000374160.3:c.372C>T	10.37:g.50121829G>A		Somatic		Capture	SOLID	Phase_I	49791835	NM_001006939	Q6UY02	Silent	SNP	ENST00000374160.3	37	CCDS31197.1																																																																																				LRRC18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047964.1	NM_001006939	
KAT6B	23522	hgsc.bcm.edu	37	10	76781908	76781908	+	Silent	SNP	A	A	G	rs72074375|rs144154275|rs371512199|rs79644703|rs559824889|rs71929101	byFrequency	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr10:76781908A>G	ENST00000287239.4	+	16	3780	c.3291A>G	c.(3289-3291)gaA>gaG	p.E1097E	KAT6B_ENST00000372724.1_Silent_p.E805E|KAT6B_ENST00000490365.1_3'UTR|KAT6B_ENST00000372711.1_Silent_p.E914E|KAT6B_ENST00000372714.1_Silent_p.E805E|KAT6B_ENST00000372725.1_Silent_p.E805E|RP11-77G23.5_ENST00000436608.1_RNA|RP11-77G23.2_ENST00000413431.1_RNA	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1097	Poly-Glu.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E1097E(4)|p.E1097delE(1)									aagaagaggaagaagaagaag	0.443											OREG0020273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E1097E												MYST4,central_nervous_system,brain,Substitution - coding silent,0	.	5	Substitution - coding silent(4)|Deletion - In frame(1)	ovary(3)|large_intestine(1)|central_nervous_system(1)	c.A3291G	10						.						19.0	38.0	32.0					10																	76781908		2198	4300	6498	76451914	SO:0001819	synonymous_variant	23522	exon16			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.3291A>G	10.37:g.76781908A>G		Somatic	1170	Capture	SOLID	Phase_I	76451914	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Silent	SNP	ENST00000287239.4	37	CCDS7345.1																																																																																				KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
KCNN2	3781	hgsc.bcm.edu	37	5	113831789	113831789	+	Silent	SNP	C	C	T	rs573113551		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr5:113831789C>T	ENST00000512097.3	+	9	2668	c.1650C>T	c.(1648-1650)caC>caT	p.H550H	KCNN2_ENST00000503706.1_Silent_p.H202H|KCNN2_ENST00000264773.3_Silent_p.H550H|RP11-492A10.1_ENST00000514115.1_RNA			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	550					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.H550H(2)|p.H202H(2)		breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	ACGACAAGCACGTCACTTACA	0.547													c|||	1	0.000199681	0.0	0.0	5008	,	,		17795	0.001		0.0	False		,,,				2504	0.0				p.H550H												.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.C1650T	5						.						120.0	114.0	116.0					5																	113831789		2202	4300	6502	113859688	SO:0001819	synonymous_variant	3781	exon8			AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.1650C>T	5.37:g.113831789C>T		Somatic		Capture	SOLID	Phase_I	113859688	NM_021614	A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Silent	SNP	ENST00000512097.3	37	CCDS4114.1																																																																																				KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250775.2	NM_021614	
CTNNA1	1495	hgsc.bcm.edu	37	5	138223183	138223183	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr5:138223183G>A	ENST00000302763.7	+	9	1238	c.1148G>A	c.(1147-1149)cGc>cAc	p.R383H	CTNNA1_ENST00000540387.1_Missense_Mutation_p.R13H|CTNNA1_ENST00000355078.5_Missense_Mutation_p.R280H|CTNNA1_ENST00000518825.1_Missense_Mutation_p.R383H|CTNNA1_ENST00000520400.1_3'UTR	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	383	Interaction with alpha-actinin.				adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)	p.R383H(1)		NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CATTAGCTCCGCAAAGCTGTC	0.318																																					p.R383H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1148A	5						.						82.0	82.0	82.0					5																	138223183		2203	4300	6503	138251082	SO:0001583	missense	1495	exon9			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.1148G>A	5.37:g.138223183G>A	ENSP00000304669:p.Arg383His	Somatic		Capture	SOLID	Phase_I	138251082	NM_001903	Q12795|Q8N1C0	Missense_Mutation	SNP	ENST00000302763.7	37	CCDS34243.1	.	.	.	.	.	.	.	.	.	.	G	32	5.152145	0.94645	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000518381;ENST00000522013;ENST00000520260;ENST00000523298;ENST00000520865;ENST00000519634;ENST00000517533;ENST00000523685;ENST00000519768;ENST00000517656;ENST00000521683;ENST00000521640;ENST00000519116;ENST00000540387;ENST00000520522	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.58133	0.2101	L	0.50333	1.59	0.80722	D	1	D;D;P	0.76494	0.975;0.999;0.702	P;D;P	0.64506	0.615;0.926;0.483	T	0.54840	-0.8233	10	0.39692	T	0.17	-8.1631	18.4839	0.90821	0.0:0.0:1.0:0.0	.	383;260;383	G3XAM7;B4DKT9;P35221	.;.;CTNA1_HUMAN	H	280;383;383;368;383;13;13;13;13;13;13;13;13;13;13;13;13;13;13;13	ENSP00000347190:R280H;ENSP00000304669:R383H;ENSP00000427821:R383H;ENSP00000429738:R13H;ENSP00000430379:R13H;ENSP00000429569:R13H;ENSP00000428044:R13H;ENSP00000430841:R13H;ENSP00000428088:R13H;ENSP00000431118:R13H;ENSP00000430240:R13H;ENSP00000430177:R13H;ENSP00000430981:R13H;ENSP00000430623:R13H;ENSP00000428894:R13H;ENSP00000438476:R13H;ENSP00000428710:R13H	ENSP00000304669:R383H	R	+	2	0	CTNNA1	138251082	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.827000	0.99397	2.463000	0.83235	0.655000	0.94253	CGC		CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903	
PCDHA10	56139	hgsc.bcm.edu	37	5	140236291	140236291	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr5:140236291G>C	ENST00000307360.5	+	1	658	c.658G>C	c.(658-660)Gaa>Caa	p.E220Q	PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Missense_Mutation_p.E220Q|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	220	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.E220Q(2)		NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGCAAACCTGAATTTACCGG	0.433																																					p.E220Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G658C	5						.						104.0	99.0	101.0					5																	140236291		2196	4271	6467	140216475	SO:0001583	missense	56139	exon1			AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.658G>C	5.37:g.140236291G>C	ENSP00000304234:p.Glu220Gln	Somatic		Capture	SOLID	Phase_I	140216475	NM_031860	A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	ENST00000307360.5	37	CCDS54921.1	.	.	.	.	.	.	.	.	.	.	G	8.606	0.888093	0.17540	.	.	ENSG00000250120	ENST00000506939;ENST00000307360	T;T	0.19669	2.13;2.13	4.29	4.29	0.51040	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.26412	0.0645	L	0.33792	1.035	0.09310	N	1	P;P;P	0.49961	0.744;0.627;0.93	B;B;P	0.53224	0.412;0.317;0.721	T	0.04885	-1.0920	9	0.49607	T	0.09	.	10.8894	0.46988	0.0869:0.0:0.9131:0.0	.	220;220;220	Q9Y5I2-3;Q9Y5I2;Q9Y5I2-2	.;PCDAA_HUMAN;.	Q	220	ENSP00000421030:E220Q;ENSP00000304234:E220Q	ENSP00000304234:E220Q	E	+	1	0	PCDHA10	140216475	0.737000	0.28175	0.134000	0.22075	0.988000	0.76386	0.000000	0.12993	2.383000	0.81215	0.561000	0.74099	GAA		PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
RAB24	53917	hgsc.bcm.edu	37	5	176729591	176729591	+	Missense_Mutation	SNP	C	C	T	rs200543182		TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr5:176729591C>T	ENST00000303251.6	-	4	739	c.320G>A	c.(319-321)cGc>cAc	p.R107H	PRELID1_ENST00000303204.4_5'Flank|RAB24_ENST00000393611.2_Missense_Mutation_p.R107H|RAB24_ENST00000303270.6_Missense_Mutation_p.R78H|PRELID1_ENST00000503216.1_5'Flank	NM_001031677.2	NP_001026847.1	Q969Q5	RAB24_HUMAN	RAB24, member RAS oncogene family	107					autophagy (GO:0006914)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	autophagic vacuole (GO:0005776)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)	p.R107H(2)				all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCTAGGCTGCGCAGTTCCTT	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		18452	0.001		0.0	False		,,,				2504	0.0				p.R107H												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G320A	5						.						122.0	117.0	119.0					5																	176729591		2203	4300	6503	176662197	SO:0001583	missense	53917	exon5			AF087904	CCDS34300.1	5q35.3	2009-10-06			ENSG00000169228	ENSG00000169228		"""RAB, member RAS oncogene"""	9765	protein-coding gene	gene with protein product		612415					Standard	NM_001031677		Approved		uc003mfw.3	Q969Q5	OTTHUMG00000130849	ENST00000303251.6:c.320G>A	5.37:g.176729591C>T	ENSP00000304376:p.Arg107His	Somatic		Capture	SOLID	Phase_I	176662197	NM_130781	Q7Z4Z7	Missense_Mutation	SNP	ENST00000303251.6	37	CCDS34300.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	13.37	2.215757	0.39102	.	.	ENSG00000169228	ENST00000393611;ENST00000303251;ENST00000303270	T;T;T	0.70631	-0.5;-0.5;-0.5	5.49	1.18	0.20946	Small GTP-binding protein domain (1);	0.076059	0.52532	U	0.000069	T	0.51890	0.1701	L	0.31120	0.905	0.80722	D	1	B;B	0.30511	0.216;0.282	B;B	0.24269	0.052;0.031	T	0.47368	-0.9123	10	0.87932	D	0	-20.9143	6.7933	0.23711	0.0:0.355:0.0:0.645	.	107;78	Q969Q5;F8W8H5	RAB24_HUMAN;.	H	107;107;78	ENSP00000377235:R107H;ENSP00000304376:R107H;ENSP00000302085:R78H	ENSP00000304376:R107H	R	-	2	0	RAB24	176662197	1.000000	0.71417	0.832000	0.32986	0.494000	0.33585	1.788000	0.38714	0.299000	0.22661	-0.266000	0.10368	CGC		RAB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253416.1	NM_130781	
VNN3	55350	hgsc.bcm.edu	37	6	133049941	133049941	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3608-01A-01W-0833-10	TCGA-AG-3608-10A-01W-0833-10	g.chr6:133049941T>C	ENST00000367927.5	-	3	548	c.476A>G	c.(475-477)tAc>tGc	p.Y159C	VNN3_ENST00000423615.2_Intron|VNN3_ENST00000417437.2_Intron|VNN3_ENST00000414302.2_Intron|VNN3_ENST00000427187.2_Missense_Mutation_p.Y159C|VNN3_ENST00000450865.2_Intron|VNN3_ENST00000275223.3_3'UTR|VNN3_ENST00000207771.3_Missense_Mutation_p.Y159C|VNN3_ENST00000425515.2_3'UTR|VNN3_ENST00000580813.1_5'Flank|VNN3_ENST00000509351.1_Intron|VNN3_ENST00000392393.3_3'UTR|VNN3_ENST00000519686.2_3'UTR			Q9NY84	VNN3_HUMAN	vanin 3	159	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				nitrogen compound metabolic process (GO:0006807)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)	p.Y159C(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00242)|GBM - Glioblastoma multiforme(226;0.0168)		GTTGTATTGGTAACGGCCATC	0.483																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	6						.						196.0	161.0	173.0					6																	133049941		2203	4300	6503	133091634	SO:0001583	missense	55350	.			AJ238982		6q23.2	2014-04-09	2010-11-15	2010-11-15	ENSG00000093134	ENSG00000093134	3.5.1.92	"""Vanins"""	16431	other	unknown		606592				10501839, 19932582, 19322213	Standard	NR_028290		Approved	HSA238982	uc010kfs.3	Q9NY84	OTTHUMG00000015589	ENST00000367927.5:c.476A>G	6.37:g.133049941T>C	ENSP00000438024:p.Tyr159Cys	Somatic		Capture	SOLID	Phase_I	133091634	.	B2DFY0|B2DFY1|B2DFY3|B2DFY5|B2DFY6|B2DFY7|B2DFY8|Q3SX90|Q9BQY2	Missense_Mutation	SNP	ENST00000367927.5	37		.	.	.	.	.	.	.	.	.	.	T	18.17	3.565132	0.65651	.	.	ENSG00000093134	ENST00000367927;ENST00000207771;ENST00000427187	D;D;D	0.87571	-2.27;-2.27;-2.27	5.29	5.29	0.74685	.	0.106709	0.41605	D	0.000854	D	0.87006	0.6070	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.88030	0.2774	7	0.52906	T	0.07	-23.0632	10.723	0.46050	0.1421:0.0:0.0:0.8579	.	.	.	.	C	159	ENSP00000438024:Y159C;ENSP00000440594:Y159C;ENSP00000444491:Y159C	ENSP00000440594:Y159C	Y	-	2	0	VNN3	133091634	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	2.223000	0.42936	2.134000	0.65973	0.533000	0.62120	TAC		VNN3-001	KNOWN	NMD_exception|basic	protein_coding	protein_coding	OTTHUMT00000042265.4	NR_028290	
