#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MARCKSL1	65108	broad.mit.edu	37	1	32800539	32800540	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AG-3893-01	TCGA-AG-3893-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr1:32800539_32800540insG	ENST00000329421.7	-	2	591_592	c.246_247insC	c.(244-249)cccaagfs	p.K83fs		NM_023009.6	NP_075385.1	P49006	MRP_HUMAN	MARCKS-like 1	83					positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.K83fs*33(2)		breast(1)|large_intestine(3)|lung(1)|ovary(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GGGGTCTCCTTGGGGGGGACCT	0.589																																					p.K83fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.247_248insC	1						.																																			32573127	SO:0001589	frameshift_variant	65108	exon2			AF031640	CCDS361.1	1p35.1	2008-02-05	2004-11-17	2004-11-17	ENSG00000175130	ENSG00000175130			7142	protein-coding gene	gene with protein product		602940	"""MARCKS-like protein"""	MLP		9598313	Standard	NM_023009		Approved	F52, MacMARCKS, MLP1	uc001bvd.4	P49006	OTTHUMG00000007589	ENST00000329421.7:c.247dupC	1.37:g.32800546_32800546dupG	ENSP00000362638:p.Lys83fs	Somatic		Unspecified	Illumina	Phase_I	32573126	NM_023009	D3DPQ0|Q5TEE6|Q6NXS5	Frame_Shift_Ins	INS	ENST00000329421.7	37	CCDS361.1																																																																																				MARCKSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020059.3	NM_023009	
FBXO24	26261	broad.mit.edu	37	7	100192116	100192116	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr7:100192116C>T	ENST00000241071.6	+	6	1226	c.904C>T	c.(904-906)Cgc>Tgc	p.R302C	PCOLCE-AS1_ENST00000442166.2_RNA|FBXO24_ENST00000360609.2_Missense_Mutation_p.R288C|FBXO24_ENST00000468962.1_Missense_Mutation_p.R290C|FBXO24_ENST00000427939.2_Missense_Mutation_p.R340C|FBXO24_ENST00000465843.1_Missense_Mutation_p.R288C|PCOLCE-AS1_ENST00000544873.1_RNA	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24	302			R -> H (in dbSNP:rs7801492).		protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.R302C(1)		NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					GCCTCACCTGCGCGTGGCCTG	0.597																																					p.R290C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C868T	7						.						100.0	74.0	83.0					7																	100192116		2203	4300	6503	100030052	SO:0001583	missense	26261	exon6			AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.904C>T	7.37:g.100192116C>T	ENSP00000241071:p.Arg302Cys	Somatic		Unspecified	Illumina	Phase_I	100030052	NM_001163499	A4D2D4|B4DX91|B4DY42|Q9H0G1	Missense_Mutation	SNP	ENST00000241071.6	37	CCDS5698.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.523346	0.64747	.	.	ENSG00000106336	ENST00000241071;ENST00000360609;ENST00000465843;ENST00000468962;ENST00000427939	T;T;T;T;T	0.81330	-1.48;0.77;0.77;-1.48;-1.48	5.03	4.15	0.48705	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.206931	0.34223	N	0.004150	T	0.71779	0.3380	N	0.08118	0	0.44587	D	0.997559	D;D;D;D	0.71674	0.997;0.997;0.997;0.998	P;P;P;P	0.56700	0.676;0.676;0.676;0.804	T	0.73603	-0.3930	10	0.54805	T	0.06	-3.1175	7.2647	0.26224	0.0:0.7404:0.1692:0.0903	.	290;340;302;288	B4DY42;B4DX91;O75426;O75426-2	.;.;FBX24_HUMAN;.	C	302;288;288;290;340	ENSP00000241071:R302C;ENSP00000353821:R288C;ENSP00000419602:R288C;ENSP00000420239:R290C;ENSP00000416558:R340C	ENSP00000241071:R302C	R	+	1	0	FBXO24	100030052	0.972000	0.33761	1.000000	0.80357	0.842000	0.47809	1.026000	0.30103	1.377000	0.46286	0.478000	0.44815	CGC		FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356104.1		
THSD7A	221981	broad.mit.edu	37	7	11632996	11632996	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr7:11632996G>A	ENST00000423059.4	-	3	1407	c.1156C>T	c.(1156-1158)Cgt>Tgt	p.R386C		NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	386	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R386C(1)		NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GTCCTTACACGAGTGCCTGCA	0.507										HNSCC(18;0.044)																											p.R386C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1156T	7						.						99.0	96.0	97.0					7																	11632996		1937	4131	6068	11599521	SO:0001583	missense	221981	exon3				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.1156C>T	7.37:g.11632996G>A	ENSP00000406482:p.Arg386Cys	Somatic		Unspecified	Illumina	Phase_I	11599521	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	37	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	G	16.38	3.107037	0.56291	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.58210	0.35	5.26	5.26	0.73747	.	0.099634	0.64402	D	0.000001	T	0.82125	0.4969	H	0.96269	3.795	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87696	0.2557	10	0.62326	D	0.03	.	18.8505	0.92227	0.0:0.0:1.0:0.0	.	386	Q9UPZ6	THS7A_HUMAN	C	386	ENSP00000406482:R386C	ENSP00000262042:R386C	R	-	1	0	THSD7A	11599521	1.000000	0.71417	0.028000	0.17463	0.011000	0.07611	6.453000	0.73488	2.460000	0.83146	0.561000	0.74099	CGT		THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
SLC12A9	56996	broad.mit.edu	37	7	100459163	100459163	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr7:100459163C>T	ENST00000354161.3	+	11	1618	c.1493C>T	c.(1492-1494)cCc>cTc	p.P498L	SLC12A9_ENST00000540482.1_Missense_Mutation_p.P498L|SLC12A9_ENST00000428758.1_Missense_Mutation_p.P498L|SLC12A9_ENST00000415287.1_Missense_Mutation_p.P409L|SLC12A9_ENST00000275729.3_Missense_Mutation_p.P409L	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	498					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)	p.P498L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					CGAGGAGGCCCCAGTAGCTGG	0.642																																					p.P498L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1493T	7						.						45.0	47.0	46.0					7																	100459163		2203	4300	6503	100297099	SO:0001583	missense	56996	exon11			AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.1493C>T	7.37:g.100459163C>T	ENSP00000275730:p.Pro498Leu	Somatic		Unspecified	Illumina	Phase_I	100297099	NM_020246	B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	Missense_Mutation	SNP	ENST00000354161.3	37	CCDS5707.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.860205	0.51482	.	.	ENSG00000146828	ENST00000540482;ENST00000428758;ENST00000275729;ENST00000415287;ENST00000354161;ENST00000539308	D;D;D;D;D	0.98968	-5.28;-5.28;-5.28;-5.28;-5.28	5.51	5.51	0.81932	Amino acid permease domain (1);	0.154474	0.56097	D	0.000035	D	0.97247	0.9100	L	0.51422	1.61	0.58432	D	0.999998	B;B	0.34214	0.442;0.168	B;B	0.36186	0.219;0.166	D	0.97115	0.9807	10	0.59425	D	0.04	.	14.8945	0.70633	0.0:1.0:0.0:0.0	.	409;498	Q9BXP2-2;Q9BXP2	.;S12A9_HUMAN	L	498;498;409;409;498;124	ENSP00000443702:P498L;ENSP00000408301:P498L;ENSP00000275729:P409L;ENSP00000413796:P409L;ENSP00000275730:P498L	ENSP00000275729:P409L	P	+	2	0	SLC12A9	100297099	1.000000	0.71417	1.000000	0.80357	0.259000	0.26198	2.290000	0.43531	2.590000	0.87494	0.491000	0.48974	CCC		SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342837.1	NM_020246	
SPAM1	6677	broad.mit.edu	37	7	123594019	123594019	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr7:123594019C>A	ENST00000439500.1	+	4	1008	c.395C>A	c.(394-396)aCa>aAa	p.T132K	SPAM1_ENST00000223028.7_Missense_Mutation_p.T132K|SPAM1_ENST00000402183.2_Missense_Mutation_p.T132K|SPAM1_ENST00000460182.1_Missense_Mutation_p.T132K|SPAM1_ENST00000340011.5_Missense_Mutation_p.T132K	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	132					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)	p.T132K(2)		breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						AAAGACATTACATTTTATATG	0.398																																					p.T132K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C395A	7						.						88.0	90.0	89.0					7																	123594019		2203	4300	6503	123381255	SO:0001583	missense	6677	exon3			L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.395C>A	7.37:g.123594019C>A	ENSP00000402123:p.Thr132Lys	Somatic		Unspecified	Illumina	Phase_I	123381255	NM_001174044	Q8TC30	Missense_Mutation	SNP	ENST00000439500.1	37	CCDS5791.1	.	.	.	.	.	.	.	.	.	.	C	5.381	0.255573	0.10185	.	.	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05	6.03	-9.7	0.00521	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	4.007680	0.00166	N	0.000002	T	0.07279	0.0184	N	0.02802	-0.49	0.09310	N	1	B;B	0.12013	0.002;0.005	B;B	0.24701	0.034;0.055	T	0.22695	-1.0209	9	.	.	.	11.6006	6.4722	0.22015	0.3396:0.3097:0.0:0.3507	.	132;132	Q8TC30;P38567	.;HYALP_HUMAN	K	132	ENSP00000386028:T132K;ENSP00000417934:T132K;ENSP00000345849:T132K;ENSP00000402123:T132K;ENSP00000223028:T132K	.	T	+	2	0	SPAM1	123381255	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.739000	0.04866	-1.284000	0.02390	-1.053000	0.02334	ACA		SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1		
PAX4	5078	broad.mit.edu	37	7	127253858	127253858	+	Missense_Mutation	SNP	G	G	A	rs121917718		TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr7:127253858G>A	ENST00000341640.2	-	4	695	c.490C>T	c.(490-492)Cgg>Tgg	p.R164W	PAX4_ENST00000338516.3_Missense_Mutation_p.R172W|PAX4_ENST00000463946.1_Missense_Mutation_p.R162W|PAX4_ENST00000378740.2_Missense_Mutation_p.R164W	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	172					cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.R164W(1)		cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						GTCCGATTCCGGTGGCCGGTC	0.582																																					p.R164W	Ovarian(113;737 1605 7858 27720 34092)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C490T	7	GRCh37	CM073257	PAX4	M	rs121917718	.						80.0	78.0	79.0					7																	127253858		2203	4300	6503	127041094	SO:0001583	missense	5078	exon4				CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.490C>T	7.37:g.127253858G>A	ENSP00000339906:p.Arg164Trp	Somatic		Unspecified	Illumina	Phase_I	127041094	NM_006193	O95161|Q6B0H0	Missense_Mutation	SNP	ENST00000341640.2	37	CCDS5797.1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907612	0.72868	.	.	ENSG00000106331	ENST00000341640;ENST00000338516;ENST00000378740;ENST00000463946	D;D;D	0.96940	-4.18;-4.18;-4.18	5.18	1.8	0.24995	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.071031	0.52532	D	0.000074	D	0.98298	0.9436	M	0.93638	3.44	0.49389	A	0.999782	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	D	0.99927	1.1290	9	0.87932	D	0	.	12.3749	0.55275	0.0:0.0:0.477:0.523	.	164;162;172;162	O43316-4;Q1W386;O43316;G3V4Q1	.;.;PAX4_HUMAN;.	W	164;172;172;162	ENSP00000339906:R164W;ENSP00000344297:R172W;ENSP00000451923:R162W	ENSP00000344297:R172W	R	-	1	2	PAX4	127041094	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.090000	0.30902	0.501000	0.28013	-0.175000	0.13238	CGG		PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349165.1		
LRGUK	136332	broad.mit.edu	37	7	133884080	133884080	+	Missense_Mutation	SNP	C	C	T	rs150378173		TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr7:133884080C>T	ENST00000285928.2	+	14	1723	c.1654C>T	c.(1654-1656)Cgt>Tgt	p.R552C		NM_144648.1	NP_653249.1	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain containing	552	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)	p.R552C(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	49						ATTATTCAGTCGTGCAGAAAT	0.363													C|||	1	0.000199681	0.0	0.0014	5008	,	,		15031	0.0		0.0	False		,,,				2504	0.0				p.R552C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1654T	7						.	C	CYS/ARG	0,4406		0,0,2203	109.0	120.0	117.0		1654	6.2	1.0	7	dbSNP_134	117	3,8597	3.0+/-9.4	0,3,4297	yes	missense	LRGUK	NM_144648.1	180	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	552/826	133884080	3,13003	2203	4300	6503	133534620	SO:0001583	missense	136332	exon14			AK057348	CCDS5830.1	7q33	2006-10-27			ENSG00000155530	ENSG00000155530			21964	protein-coding gene	gene with protein product							Standard	NM_144648		Approved	FLJ32786	uc003vrm.1	Q96M69	OTTHUMG00000155320	ENST00000285928.2:c.1654C>T	7.37:g.133884080C>T	ENSP00000285928:p.Arg552Cys	Somatic		Unspecified	Illumina	Phase_I	133534620	NM_144648	Q2M3I1	Missense_Mutation	SNP	ENST00000285928.2	37	CCDS5830.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	20.2	3.949185	0.73787	0.0	3.49E-4	ENSG00000155530	ENST00000285928	T	0.43688	0.94	6.17	6.17	0.99709	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.204143	0.42682	D	0.000679	T	0.59838	0.2223	L	0.54323	1.7	0.43467	D	0.995676	D	0.89917	1.0	D	0.76071	0.987	T	0.59423	-0.7457	10	0.87932	D	0	-19.6321	14.2257	0.65858	0.246:0.754:0.0:0.0	.	552	Q96M69	LRGUK_HUMAN	C	552	ENSP00000285928:R552C	ENSP00000285928:R552C	R	+	1	0	LRGUK	133534620	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.289000	0.43523	2.941000	0.99782	0.655000	0.94253	CGT		LRGUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339442.1	NM_144648	
PMS2	5395	broad.mit.edu	37	7	6022481	6022481	+	Silent	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr7:6022481G>A	ENST00000265849.7	-	12	2253	c.2148C>T	c.(2146-2148)acC>acT	p.T716T	PMS2_ENST00000382321.4_Silent_p.T315T|PMS2_ENST00000469652.1_5'Flank|PMS2_ENST00000441476.2_Silent_p.T610T|PMS2_ENST00000406569.3_Intron	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	716					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)	p.T716T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		CCTGGAGCACGGTGTGCTGCT	0.488			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.T716T		yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2148T	7						.						20.0	20.0	20.0					7																	6022481		2199	4277	6476	5989007	SO:0001819	synonymous_variant	5395	exon12	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.2148C>T	7.37:g.6022481G>A		Somatic		Unspecified	Illumina	Phase_I	5989007	NM_000535	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Silent	SNP	ENST00000265849.7	37	CCDS5343.1																																																																																				PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535	
HDAC9	9734	broad.mit.edu	37	7	18767335	18767335	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr7:18767335C>T	ENST00000432645.2	+	12	1855	c.1855C>T	c.(1855-1857)Cct>Tct	p.P619S	HDAC9_ENST00000401921.1_Missense_Mutation_p.P578S|HDAC9_ENST00000406451.4_Missense_Mutation_p.P619S|HDAC9_ENST00000441542.2_Missense_Mutation_p.P622S	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	619					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.P622S(2)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	CTCTGTTTTACCTCACCCAGC	0.562																																					p.P619S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1855T	7						.						49.0	54.0	53.0					7																	18767335		2004	4155	6159	18733860	SO:0001583	missense	9734	exon13			AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1855C>T	7.37:g.18767335C>T	ENSP00000410337:p.Pro619Ser	Somatic		Unspecified	Illumina	Phase_I	18733860	NM_178423	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	C	19.28	3.797854	0.70567	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	T;T;T;T	0.59083	0.31;0.29;0.3;0.3	5.64	5.64	0.86602	.	0.113597	0.39759	N	0.001265	T	0.76695	0.4023	M	0.69823	2.125	0.80722	D	1	B;D;D;D;D;D;D	0.89917	0.192;1.0;1.0;1.0;1.0;1.0;1.0	B;D;D;D;D;D;D	0.87578	0.392;0.998;0.996;0.996;0.992;0.996;0.992	T	0.75013	-0.3467	10	0.46703	T	0.11	-35.6953	20.0585	0.97663	0.0:1.0:0.0:0.0	.	619;531;578;622;619;619;597	Q9UKV0-4;Q9UKV0-2;Q9UKV0-6;Q9UKV0-7;Q9UKV0;Q9UKV0-5;Q8N879	.;.;.;.;HDAC9_HUMAN;.;.	S	619;578;619;622;531	ENSP00000384657:P619S;ENSP00000383912:P578S;ENSP00000410337:P619S;ENSP00000408617:P622S	ENSP00000339165:P531S	P	+	1	0	HDAC9	18733860	1.000000	0.71417	0.961000	0.40146	0.975000	0.68041	3.964000	0.56780	2.812000	0.96745	0.557000	0.71058	CCT		HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
CACNA2D1	781	broad.mit.edu	37	7	81596502	81596502	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3893-01	TCGA-AG-3893-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr7:81596502A>C	ENST00000356253.5	-	31	2776	c.2521T>G	c.(2521-2523)Tgc>Ggc	p.C841G	CACNA2D1_ENST00000535308.1_Missense_Mutation_p.C41G|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.C829G			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	841					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.C829G(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TTTCTTTTGCAGTCACAAACT	0.294																																					p.C829G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2485G	7						.						77.0	74.0	75.0					7																	81596502		2202	4296	6498	81434438	SO:0001583	missense	781	exon31			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2521T>G	7.37:g.81596502A>C	ENSP00000348589:p.Cys841Gly	Somatic		Unspecified	Illumina	Phase_I	81434438	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37		.	.	.	.	.	.	.	.	.	.	A	19.46	3.832608	0.71258	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000535308	T;T;T	0.79940	-1.32;-1.32;-1.32	5.31	5.31	0.75309	.	0.223505	0.48767	D	0.000162	D	0.88577	0.6474	M	0.73962	2.25	0.44807	D	0.99781	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.984	D	0.87908	0.2695	10	0.36615	T	0.2	-13.0731	14.4354	0.67277	1.0:0.0:0.0:0.0	.	41;829	B7Z658;P54289-2	.;.	G	829;848;841;41	ENSP00000349320:C829G;ENSP00000348589:C841G;ENSP00000443124:C41G	ENSP00000284088:C848G	C	-	1	0	CACNA2D1	81434438	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.669000	0.61575	2.005000	0.58758	0.482000	0.46254	TGC		CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
SLC4A2	6522	broad.mit.edu	37	7	150767635	150767635	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr7:150767635C>A	ENST00000485713.1	+	11	2581	c.1541C>A	c.(1540-1542)gCc>gAc	p.A514D	SLC4A2_ENST00000310317.5_Missense_Mutation_p.A432D|SLC4A2_ENST00000392826.2_Missense_Mutation_p.A505D|SLC4A2_ENST00000413384.2_Missense_Mutation_p.A514D|SLC4A2_ENST00000461735.1_Missense_Mutation_p.A500D	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	514					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCTGAGAATGCCGAGGCCACG	0.632																																					p.A500D												.	.	0			c.C1499A	7						.						46.0	34.0	38.0					7																	150767635		2203	4300	6503	150398568	SO:0001583	missense	6522	exon10				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.1541C>A	7.37:g.150767635C>A	ENSP00000419412:p.Ala514Asp	None		Unspecified	Illumina	Phase_I	150398568	NM_001199694	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	ENST00000485713.1	37	CCDS5917.1	.	.	.	.	.	.	.	.	.	.	c	21.5	4.153992	0.78114	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56	5.17	5.17	0.71159	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.057647	0.64402	D	0.000002	D	0.88815	0.6539	H	0.95043	3.615	0.80722	D	1	D;D;D	0.63880	0.991;0.991;0.993	D;D;D	0.71184	0.972;0.948;0.969	D	0.92014	0.5620	10	0.87932	D	0	.	17.6555	0.88176	0.0:1.0:0.0:0.0	.	505;500;514	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	D	514;514;432;505;500	ENSP00000419412:A514D;ENSP00000405600:A514D;ENSP00000311402:A432D;ENSP00000376571:A505D;ENSP00000419164:A500D	ENSP00000311402:A432D	A	+	2	0	SLC4A2	150398568	1.000000	0.71417	0.874000	0.34290	0.610000	0.37248	7.667000	0.83888	2.575000	0.86900	0.550000	0.68814	GCC		SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
BPIFB6	128859	broad.mit.edu	37	20	31625416	31625416	+	Missense_Mutation	SNP	G	G	A	rs202105575		TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr20:31625416G>A	ENST00000349552.1	+	8	718	c.718G>A	c.(718-720)Ggg>Agg	p.G240R		NM_174897.2	NP_777557.1	Q8NFQ5	BPIB6_HUMAN	BPI fold containing family B, member 6	240						extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.G240R(1)									TGCTGATGCCGGGGAGGCCCT	0.607																																					p.G240R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G718A	20						.						102.0	87.0	92.0					20																	31625416		2203	4300	6503	31089077	SO:0001583	missense	128859	exon8			AF465767	CCDS13211.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000167104	ENSG00000167104		"""BPI fold containing"""	16504	protein-coding gene	gene with protein product		614110	"""bactericidal/permeability-increasing protein-like 3"""	BPIL3		12185532, 21787333	Standard	NM_174897		Approved	LPLUNC6	uc010zuc.2	Q8NFQ5	OTTHUMG00000032238	ENST00000349552.1:c.718G>A	20.37:g.31625416G>A	ENSP00000344929:p.Gly240Arg	Somatic		Unspecified	Illumina	Phase_I	31089077	NM_174897		Missense_Mutation	SNP	ENST00000349552.1	37	CCDS13211.1	.	.	.	.	.	.	.	.	.	.	G	0.055	-1.239474	0.01493	.	.	ENSG00000167104	ENST00000349552	T	0.06687	3.27	4.15	0.761	0.18448	.	1.335750	0.05192	N	0.503217	T	0.06325	0.0163	N	0.25031	0.7	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.43507	-0.9387	10	0.23891	T	0.37	.	6.4558	0.21928	0.3564:0.0:0.6436:0.0	.	240	Q8NFQ5	BPIB6_HUMAN	R	240	ENSP00000344929:G240R	ENSP00000344929:G240R	G	+	1	0	BPIFB6	31089077	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.234000	0.17930	0.009000	0.14813	-0.254000	0.11334	GGG		BPIFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078658.2	NM_174897	
NCOA6	23054	broad.mit.edu	37	20	33329481	33329481	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3893-01	TCGA-AG-3893-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr20:33329481T>C	ENST00000374796.2	-	12	7149	c.4579A>G	c.(4579-4581)Aaa>Gaa	p.K1527E	NCOA6_ENST00000359003.2_Missense_Mutation_p.K1527E			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1527					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.K1527E(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						ACAGATGCTTTTTTGAGGTCC	0.448																																					p.K1527E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4579G	20						.						107.0	108.0	108.0					20																	33329481		2203	4300	6503	32793142	SO:0001583	missense	23054	exon11			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.4579A>G	20.37:g.33329481T>C	ENSP00000363929:p.Lys1527Glu	Somatic		Unspecified	Illumina	Phase_I	32793142	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	37	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	T	18.19	3.568499	0.65651	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.27256	1.68;1.68	5.55	5.55	0.83447	.	0.097805	0.53938	D	0.000050	T	0.36552	0.0971	N	0.24115	0.695	0.53005	D	0.999969	D	0.69078	0.997	D	0.75020	0.985	T	0.09378	-1.0677	10	0.35671	T	0.21	-8.9733	15.8689	0.79091	0.0:0.0:0.0:1.0	.	1527	Q14686	NCOA6_HUMAN	E	1527	ENSP00000363929:K1527E;ENSP00000351894:K1527E	ENSP00000351894:K1527E	K	-	1	0	NCOA6	32793142	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.173000	0.58249	2.333000	0.79357	0.482000	0.46254	AAA		NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
LAMP5	24141	broad.mit.edu	37	20	9510366	9510366	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr20:9510366G>A	ENST00000246070.2	+	6	1234	c.742G>A	c.(742-744)Gtc>Atc	p.V248I	LAMP5_ENST00000427562.2_Missense_Mutation_p.V204I	NM_012261.3	NP_036393.1	Q9UJQ1	LAMP5_HUMAN	lysosomal-associated membrane protein family, member 5	248						cytoplasmic vesicle membrane (GO:0030659)|dendrite membrane (GO:0032590)|early endosome membrane (GO:0031901)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|endosome membrane (GO:0010008)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)		p.V248I(1)									CTTGGGCCTCGTCATCATGGT	0.517																																					p.V204I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G610A	20						.						129.0	103.0	112.0					20																	9510366		2203	4300	6503	9458366	SO:0001583	missense	24141	exon5			AL121740	CCDS13106.1, CCDS56177.1	20p12	2013-03-14	2011-11-25	2011-11-25	ENSG00000125869	ENSG00000125869			16097	protein-coding gene	gene with protein product	"""brain and dendritic cell associated LAMP"""	614641	"""chromosome 20 open reading frame 103"""	C20orf103		11780052, 21642595	Standard	NM_012261		Approved	dJ1119D9.3, BAD-LAMP, UNC-43	uc002wni.2	Q9UJQ1	OTTHUMG00000031851	ENST00000246070.2:c.742G>A	20.37:g.9510366G>A	ENSP00000246070:p.Val248Ile	Somatic		Unspecified	Illumina	Phase_I	9458366	NM_001199897	B4DHZ7|B7Z9Z9	Missense_Mutation	SNP	ENST00000246070.2	37	CCDS13106.1	.	.	.	.	.	.	.	.	.	.	G	6.483	0.457336	0.12342	.	.	ENSG00000125869	ENST00000246070;ENST00000427562	T;T	0.34072	1.38;1.38	6.16	4.24	0.50183	.	0.174292	0.51477	N	0.000094	T	0.13798	0.0334	N	0.02539	-0.55	0.36554	D	0.872034	B;B	0.15473	0.013;0.001	B;B	0.12156	0.007;0.002	T	0.12578	-1.0542	9	.	.	.	-15.3548	8.8869	0.35409	0.1241:0.0:0.7538:0.1221	.	204;248	Q9UJQ1-2;Q9UJQ1	.;CT103_HUMAN	I	248;204	ENSP00000246070:V248I;ENSP00000406360:V204I	.	V	+	1	0	C20orf103	9458366	0.980000	0.34600	0.928000	0.36995	0.459000	0.32528	1.879000	0.39618	0.948000	0.37687	-0.806000	0.03193	GTC		LAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077946.2	NM_012261	
CEP250	11190	broad.mit.edu	37	20	34099299	34099299	+	Silent	SNP	C	C	T	rs549300192		TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr20:34099299C>T	ENST00000397527.1	+	35	7893	c.7173C>T	c.(7171-7173)ctC>ctT	p.L2391L	CEP250_ENST00000342580.4_Silent_p.L2335L	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	2391					centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.L2391L(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			ACCACAGCCTCTCACACTCAC	0.612																																					p.L2391L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C7173T	20						.						62.0	58.0	59.0					20																	34099299		2203	4300	6503	33562713	SO:0001819	synonymous_variant	11190	exon35			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.7173C>T	20.37:g.34099299C>T		Somatic		Unspecified	Illumina	Phase_I	33562713	NM_007186	E1P5Q3|O14812|O60588|Q9H450	Silent	SNP	ENST00000397527.1	37	CCDS13255.1																																																																																				CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
CPNE6	9362	broad.mit.edu	37	14	24546153	24546153	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3893-01	TCGA-AG-3893-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr14:24546153A>G	ENST00000397016.2	+	15	1542	c.1231A>G	c.(1231-1233)Aat>Gat	p.N411D	CPNE6_ENST00000537691.1_Missense_Mutation_p.N466D|CPNE6_ENST00000216775.2_Missense_Mutation_p.N411D	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	411	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.N411D(1)		endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		CGGCCCCACCAATGTGGCCCC	0.612																																					p.N411D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1231G	14						.						57.0	52.0	53.0					14																	24546153		2203	4300	6503	23615993	SO:0001583	missense	9362	exon14			AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.1231A>G	14.37:g.24546153A>G	ENSP00000380211:p.Asn411Asp	Somatic		Unspecified	Illumina	Phase_I	23615993	NM_006032	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Missense_Mutation	SNP	ENST00000397016.2	37	CCDS9607.1	.	.	.	.	.	.	.	.	.	.	A	33	5.249172	0.95305	.	.	ENSG00000100884	ENST00000537691;ENST00000397016;ENST00000216775	T;T;T	0.24723	1.84;1.84;1.84	5.08	5.08	0.68730	von Willebrand factor, type A (2);Copine (1);	0.000000	0.64402	D	0.000010	T	0.51363	0.1670	M	0.78049	2.395	0.46499	D	0.999077	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.994;1.0;0.999	T	0.56715	-0.7933	10	0.87932	D	0	-14.5398	12.8026	0.57594	1.0:0.0:0.0:0.0	.	466;236;411	F5GXN1;B3KWK1;O95741	.;.;CPNE6_HUMAN	D	466;411;411	ENSP00000440077:N466D;ENSP00000380211:N411D;ENSP00000216775:N411D	ENSP00000216775:N411D	N	+	1	0	CPNE6	23615993	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	9.339000	0.96797	1.907000	0.55213	0.460000	0.39030	AAT		CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071869.5		
NYNRIN	57523	broad.mit.edu	37	14	24886265	24886265	+	Silent	SNP	G	G	A	rs534007372		TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr14:24886265G>A	ENST00000382554.3	+	9	5628	c.5310G>A	c.(5308-5310)gaG>gaA	p.E1770E		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1770	Integrase catalytic. {ECO:0000255|PROSITE-ProRule:PRU00457}.				DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)	p.E1770E(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						GGCTCACGGAGCCCCTGTGGT	0.637																																					p.E1770E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5310A	14						.						42.0	46.0	45.0					14																	24886265		2054	4192	6246	23956105	SO:0001819	synonymous_variant	57523	exon9			AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.5310G>A	14.37:g.24886265G>A		Somatic		Unspecified	Illumina	Phase_I	23956105	NM_025081	Q6P153|Q86TR3|Q9HAC4	Silent	SNP	ENST00000382554.3	37	CCDS45090.1																																																																																				NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
AHNAK2	113146	broad.mit.edu	37	14	105416366	105416366	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr14:105416366C>A	ENST00000333244.5	-	7	5541	c.5422G>T	c.(5422-5424)Gac>Tac	p.D1808Y	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1808						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.D1808Y(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGGGACAGGTCACCCTCCAGC	0.627																																					p.D1808Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5422T	14						.						137.0	167.0	157.0					14																	105416366		2001	4143	6144	104487411	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.5422G>T	14.37:g.105416366C>A	ENSP00000353114:p.Asp1808Tyr	Somatic		Unspecified	Illumina	Phase_I	104487411	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	17.43	3.387988	0.61956	.	.	ENSG00000185567	ENST00000333244	T	0.01313	5.02	4.52	3.62	0.41486	.	.	.	.	.	T	0.08044	0.0201	M	0.90082	3.085	0.24518	N	0.99418	D	0.71674	0.998	D	0.63877	0.919	T	0.11397	-1.0589	9	0.66056	D	0.02	.	6.2627	0.20910	0.185:0.7171:0.0:0.0979	.	1808	Q8IVF2	AHNK2_HUMAN	Y	1808	ENSP00000353114:D1808Y	ENSP00000353114:D1808Y	D	-	1	0	AHNAK2	104487411	.	.	0.206000	0.23566	0.101000	0.19017	.	.	2.087000	0.62958	0.456000	0.33151	GAC		AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
FBXO7	25793	broad.mit.edu	37	22	32875253	32875253	+	Silent	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr22:32875253C>T	ENST00000266087.7	+	2	735	c.408C>T	c.(406-408)gaC>gaT	p.D136D	FBXO7_ENST00000382058.3_Silent_p.D57D|FBXO7_ENST00000397426.1_Silent_p.D22D	NM_012179.3	NP_036311.3	Q9Y3I1	FBX7_HUMAN	F-box protein 7	136	Important for interaction with CDK6.				cell death (GO:0008219)|mitochondrion degradation (GO:0000422)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of lymphocyte differentiation (GO:0045620)|protein targeting to mitochondrion (GO:0006626)|protein ubiquitination (GO:0016567)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.D136D(2)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TTTGGAATGACGACAGTATGG	0.428																																					p.D57D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C171T	22						.						55.0	54.0	54.0					22																	32875253		2203	4300	6503	31205253	SO:0001819	synonymous_variant	25793	exon2			AF129537	CCDS13907.1, CCDS58806.1	22q12.3	2013-09-19	2004-06-15		ENSG00000100225	ENSG00000100225		"""F-boxes /  ""other"""", ""Parkinson disease"""	13586	protein-coding gene	gene with protein product		605648	"""F-box only protein 7"""			10531035, 10531037, 19038853	Standard	NM_001257990		Approved	FBX7, Fbx, PARK15	uc003amq.3	Q9Y3I1	OTTHUMG00000030674	ENST00000266087.7:c.408C>T	22.37:g.32875253C>T		Somatic		Unspecified	Illumina	Phase_I	31205253	NM_001033024	B4DNB3|B4DWX5|Q5TGC4|Q5TI86|Q96HM6|Q9UF21|Q9UKT2	Silent	SNP	ENST00000266087.7	37	CCDS13907.1																																																																																				FBXO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129001.1		
ZNF99	7652	broad.mit.edu	37	19	22941524	22941524	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr19:22941524G>A	ENST00000596209.1	-	4	1277	c.1187C>T	c.(1186-1188)cCc>cTc	p.P396L	ZNF99_ENST00000397104.3_Missense_Mutation_p.P305L	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	396					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P305L(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				ACATTTGTAGGGTTTCTGTCC	0.368																																					p.P305L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C914T	19						.						65.0	70.0	69.0					19																	22941524		2029	4219	6248	22733364	SO:0001583	missense	7652	exon5			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1187C>T	19.37:g.22941524G>A	ENSP00000472969:p.Pro396Leu	Somatic		Unspecified	Illumina	Phase_I	22733364	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	N	14.94	2.686765	0.48097	.	.	ENSG00000213973	ENST00000397104	T	0.27557	1.66	1.28	1.28	0.21552	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.50000	0.1590	M	0.80616	2.505	0.51482	D	0.999924	D	0.71674	0.998	D	0.64144	0.922	T	0.52442	-0.8575	9	0.54805	T	0.06	.	9.4929	0.38971	0.0:0.0:1.0:0.0	.	305	A8MXY4	ZNF99_HUMAN	L	305	ENSP00000380293:P305L	ENSP00000380293:P305L	P	-	2	0	ZNF99	22733364	0.941000	0.31946	0.012000	0.15200	0.259000	0.26198	1.462000	0.35266	0.675000	0.31264	0.395000	0.25975	CCC		ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
RYR1	6261	broad.mit.edu	37	19	39062846	39062846	+	Missense_Mutation	SNP	G	G	A	rs193922860		TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr19:39062846G>A	ENST00000359596.3	+	95	13934	c.13934G>A	c.(13933-13935)cGg>cAg	p.R4645Q	RYR1_ENST00000355481.4_Missense_Mutation_p.R4640Q|RYR1_ENST00000360985.3_Missense_Mutation_p.R4640Q			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4645					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.R4645Q(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCCGCCCTGCGGTGTCTGAGC	0.577																																					p.R4640Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G13919A	19	GRCh37	CM064219	RYR1	M		.						129.0	111.0	117.0					19																	39062846		2203	4300	6503	43754686	SO:0001583	missense	6261	exon94			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.13934G>A	19.37:g.39062846G>A	ENSP00000352608:p.Arg4645Gln	Somatic		Unspecified	Illumina	Phase_I	43754686	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.214457	0.39102	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.94232	-3.38;-3.38;-3.38	5.11	5.11	0.69529	Ryanodine Receptor TM 4-6 (1);	0.598876	0.15295	U	0.269946	D	0.92176	0.7519	M	0.80183	2.485	0.23653	N	0.997197	B;B	0.21309	0.043;0.054	B;B	0.12837	0.005;0.008	D	0.84620	0.0683	10	0.46703	T	0.11	.	9.0998	0.36662	0.162:0.0:0.838:0.0	.	4640;4645	P21817-2;P21817	.;RYR1_HUMAN	Q	4645;4640;4640	ENSP00000352608:R4645Q;ENSP00000347667:R4640Q;ENSP00000354254:R4640Q	ENSP00000347667:R4640Q	R	+	2	0	RYR1	43754686	0.711000	0.27906	0.989000	0.46669	0.843000	0.47879	2.546000	0.45778	2.659000	0.90383	0.561000	0.74099	CGG		RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
HNRNPL	3191	broad.mit.edu	37	19	39330793	39330793	+	Silent	SNP	A	A	C			TCGA-AG-3893-01	TCGA-AG-3893-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr19:39330793A>C	ENST00000221419.5	-	8	1542	c.1176T>G	c.(1174-1176)tcT>tcG	p.S392S	AC104534.3_ENST00000594769.1_Missense_Mutation_p.L9R|HNRNPL_ENST00000600873.1_Silent_p.S259S	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	392	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)	p.S259S(1)|p.S392S(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			AGTTCATCTTAGATTGATCCA	0.602																																					p.S259S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T777G	19						.						41.0	45.0	43.0					19																	39330793		2159	4231	6390	44022633	SO:0001819	synonymous_variant	3191	exon8			X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1176T>G	19.37:g.39330793A>C		Somatic		Unspecified	Illumina	Phase_I	44022633	NM_001005335	A6ND69|A6NIT8|Q9H3P3	Silent	SNP	ENST00000221419.5	37	CCDS33015.1																																																																																				HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1		
RELB	5971	broad.mit.edu	37	19	45537542	45537542	+	Silent	SNP	C	C	T	rs368632431		TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr19:45537542C>T	ENST00000221452.8	+	10	1398	c.1248C>T	c.(1246-1248)ccC>ccT	p.P416P	RELB_ENST00000505236.1_Silent_p.P413P|RELB_ENST00000540120.1_Silent_p.P416P	NM_006509.3	NP_006500.2	Q01201	RELB_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog B	416	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				antigen processing and presentation (GO:0019882)|circadian regulation of gene expression (GO:0032922)|myeloid dendritic cell differentiation (GO:0043011)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of gene expression (GO:0010628)|T-helper 1 cell differentiation (GO:0045063)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P416P(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(3)|skin(1)	12		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		GGGGGATGCCCGACGTCCTTG	0.552													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15107	0.0		0.0	False		,,,				2504	0.0				p.P415L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1244T	19						.	C		2,3916		0,2,1957	53.0	57.0	56.0		1248	-9.6	0.1	19		56	0,8290		0,0,4145	no	coding-synonymous	RELB	NM_006509.3		0,2,6102	TT,TC,CC		0.0,0.051,0.0164		416/580	45537542	2,12206	1959	4145	6104	50229382	SO:0001819	synonymous_variant	5971	exon9			M83221	CCDS46110.1	19q13.32	2013-07-09	2013-07-09		ENSG00000104856	ENSG00000104856			9956	protein-coding gene	gene with protein product		604758	"""v-rel avian reticuloendotheliosis viral oncogene homolog B (nuclear factor of kappa light polypeptide gene enhancer in B-cells 3)"""			1531086	Standard	NM_006509		Approved	REL-B	uc021uvp.1	Q01201	OTTHUMG00000162116	ENST00000221452.8:c.1248C>T	19.37:g.45537542C>T		Somatic		Unspecified	Illumina	Phase_I	50229382	NM_006509	Q6GTX7|Q9UEI7	Silent	SNP	ENST00000221452.8	37	CCDS46110.1																																																																																				RELB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000367361.2		
FPR2	2358	broad.mit.edu	37	19	52272425	52272425	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr19:52272425G>T	ENST00000598776.1	+	2	1286	c.514G>T	c.(514-516)Ggg>Tgg	p.G172W	FPR2_ENST00000598953.1_Missense_Mutation_p.G172W|FPR2_ENST00000340023.6_Missense_Mutation_p.G172W	NM_001462.3	NP_001453.1	P25090	FPR2_HUMAN	formyl peptide receptor 2	172					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|N-formyl peptide receptor activity (GO:0004982)	p.G172W(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33						TATTCCAAATGGGGACACATA	0.498																																					p.G172W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G514T	19						.						129.0	122.0	125.0					19																	52272425		2203	4300	6503	56964237	SO:0001583	missense	2358	exon2			M88107	CCDS12840.1	19q13.3-q13.4	2012-08-10	2008-04-17	2008-04-17		ENSG00000171049		"""GPCR / Class A : Formyl peptide receptors"", ""GPCR / Class A : Leukotriene receptors"""	3827	protein-coding gene	gene with protein product		136538	"""formyl peptide receptor-like 1"""	FPRL1		9054386	Standard	NM_001462		Approved	LXA4R, HM63, FPRH2, FMLPX, FPR2A, FMLP-R-II, ALXR	uc002pxr.3	P25090		ENST00000598776.1:c.514G>T	19.37:g.52272425G>T	ENSP00000468897:p.Gly172Trp	Somatic		Unspecified	Illumina	Phase_I	56964237	NM_001462	A8K3E2	Missense_Mutation	SNP	ENST00000598776.1	37	CCDS12840.1	.	.	.	.	.	.	.	.	.	.	.	13.42	2.230912	0.39399	.	.	ENSG00000171049	ENST00000340023	T	0.38240	1.15	3.09	2.05	0.26809	GPCR, rhodopsin-like superfamily (1);	0.169329	0.41294	U	0.000903	T	0.65207	0.2669	H	0.96111	3.77	0.09310	N	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.56208	-0.8017	10	0.87932	D	0	.	5.1974	0.15245	0.2704:0.0:0.7296:0.0	.	172	P25090	FPR2_HUMAN	W	172	ENSP00000340191:G172W	ENSP00000340191:G172W	G	+	1	0	FPR2	56964237	0.107000	0.21998	0.005000	0.12908	0.006000	0.05464	1.050000	0.30404	0.870000	0.35726	-0.339000	0.08088	GGG		FPR2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466912.2	NM_001005738	
ZNF610	162963	broad.mit.edu	37	19	52869685	52869685	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr19:52869685G>A	ENST00000403906.3	+	6	1510	c.1054G>A	c.(1054-1056)Gtc>Atc	p.V352I	ZNF610_ENST00000601151.1_Missense_Mutation_p.V309I|ZNF610_ENST00000327920.8_Missense_Mutation_p.V352I|ZNF610_ENST00000321287.8_Missense_Mutation_p.V352I	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	352					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V352I(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		ATGTGGCAAGGTCTTTAGTCT	0.408																																					p.V352I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1054A	19						.						89.0	90.0	90.0					19																	52869685		2203	4300	6503	57561497	SO:0001583	missense	162963	exon6			AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.1054G>A	19.37:g.52869685G>A	ENSP00000383922:p.Val352Ile	Somatic		Unspecified	Illumina	Phase_I	57561497	NM_173530	A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	ENST00000403906.3	37	CCDS12851.1	.	.	.	.	.	.	.	.	.	.	G	5.854	0.341687	0.11069	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	T;T	0.19105	2.17;2.17	1.58	0.138	0.14793	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16428	0.0395	L	0.37507	1.11	0.09310	N	1	P;P	0.36048	0.478;0.534	B;B	0.38562	0.181;0.276	T	0.25433	-1.0132	9	0.66056	D	0.02	.	5.7688	0.18241	0.0:0.0:0.399:0.601	.	309;352	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	I	352;309;352	ENSP00000383922:V352I;ENSP00000327597:V352I	ENSP00000324441:V309I	V	+	1	0	ZNF610	57561497	0.000000	0.05858	0.539000	0.28077	0.288000	0.27193	-0.635000	0.05471	0.835000	0.34877	0.313000	0.20887	GTC		ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462880.1	NM_173530	
LILRB5	10990	broad.mit.edu	37	19	54754670	54754670	+	Missense_Mutation	SNP	C	C	A	rs201610708		TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr19:54754670C>A	ENST00000316219.5	-	13	1860	c.1753G>T	c.(1753-1755)Gcc>Tcc	p.A585S	CTD-2337J16.1_ENST00000595133.1_lincRNA|LILRB5_ENST00000449561.2_Missense_Mutation_p.A586S|LILRB5_ENST00000450632.1_3'UTR|LILRB5_ENST00000345866.6_Missense_Mutation_p.A486S	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	585					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.A585S(1)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GCCAGGGGGGCGTAGATGCTG	0.607																																					p.A586S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1756T	19						.						67.0	68.0	67.0					19																	54754670		2203	4300	6503	59446482	SO:0001583	missense	10990	exon13			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1753G>T	19.37:g.54754670C>A	ENSP00000320390:p.Ala585Ser	Somatic		Unspecified	Illumina	Phase_I	59446482	NM_001081442	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	37	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	C	9.630	1.136148	0.21123	.	.	ENSG00000105609	ENST00000316219;ENST00000449561;ENST00000345866	T;T;T	0.00545	6.67;6.67;6.7	2.75	0.562	0.17290	.	.	.	.	.	T	0.00724	0.0024	M	0.67397	2.05	0.09310	N	1	B;B;P	0.47484	0.214;0.388;0.896	B;B;P	0.44647	0.118;0.106;0.456	T	0.50083	-0.8869	9	0.59425	D	0.04	.	4.4004	0.11383	0.0:0.6624:0.0:0.3376	.	486;586;585	O75023-2;O75023-3;O75023	.;.;LIRB5_HUMAN	S	585;586;486	ENSP00000320390:A585S;ENSP00000406478:A586S;ENSP00000263430:A486S	ENSP00000320390:A585S	A	-	1	0	LILRB5	59446482	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.070000	0.11523	0.504000	0.28082	-0.237000	0.12165	GCC		LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
NLRP7	199713	broad.mit.edu	37	19	55450708	55450708	+	Silent	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr19:55450708G>A	ENST00000590030.1	-	3	1519	c.1479C>T	c.(1477-1479)caC>caT	p.H493H	NLRP7_ENST00000592784.1_Silent_p.H493H|NLRP7_ENST00000446217.1_Silent_p.H521H|NLRP7_ENST00000448121.2_Silent_p.H493H|NLRP7_ENST00000328092.5_Silent_p.H493H|NLRP7_ENST00000340844.2_Silent_p.H493H|NLRP7_ENST00000588756.1_Silent_p.H493H			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	493							ATP binding (GO:0005524)	p.H493H(4)		autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TGTCCCAGGCGTGGCCGTCCC	0.567																																					p.H493H												.	.	4	Substitution - coding silent(4)	large_intestine(2)|kidney(2)	c.C1479T	19						.						65.0	63.0	64.0					19																	55450708		2203	4300	6503	60142520	SO:0001819	synonymous_variant	199713	exon4			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1479C>T	19.37:g.55450708G>A		Somatic		Unspecified	Illumina	Phase_I	60142520	NM_139176	E9PE16|Q32MH8|Q7RTR1	Silent	SNP	ENST00000590030.1	37	CCDS33109.1																																																																																				NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	
ZIM3	114026	broad.mit.edu	37	19	57646558	57646558	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3893-01	TCGA-AG-3893-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr19:57646558T>G	ENST00000269834.1	-	5	1532	c.1147A>C	c.(1147-1149)Aaa>Caa	p.K383Q	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	383					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K383Q(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GTATGGATTTTTTTATGTTGA	0.383																																					p.K383Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1147C	19						.						111.0	116.0	115.0					19																	57646558		2203	4300	6503	62338370	SO:0001583	missense	114026	exon5			AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.1147A>C	19.37:g.57646558T>G	ENSP00000269834:p.Lys383Gln	Somatic		Unspecified	Illumina	Phase_I	62338370	NM_052882	Q14CA6	Missense_Mutation	SNP	ENST00000269834.1	37	CCDS33125.1	.	.	.	.	.	.	.	.	.	.	T	13.74	2.327466	0.41197	.	.	ENSG00000141946	ENST00000269834	T	0.23950	1.88	2.71	2.71	0.32032	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.30103	0.0754	N	0.16602	0.42	0.25556	N	0.987037	D	0.55800	0.973	D	0.64506	0.926	T	0.08249	-1.0731	9	0.72032	D	0.01	.	8.871	0.35316	0.0:0.0:0.0:1.0	.	383	Q96PE6	ZIM3_HUMAN	Q	383	ENSP00000269834:K383Q	ENSP00000269834:K383Q	K	-	1	0	ZIM3	62338370	0.000000	0.05858	0.454000	0.27019	0.248000	0.25809	-0.114000	0.10757	1.237000	0.43756	0.260000	0.18958	AAA		ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1		
LOXL2	4017	broad.mit.edu	37	8	23217682	23217682	+	Missense_Mutation	SNP	G	G	A	rs186026557		TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr8:23217682G>A	ENST00000389131.3	-	3	821	c.452C>T	c.(451-453)aCg>aTg	p.T151M	RP11-177H13.2_ENST00000519692.1_RNA	NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	151	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)	p.T151M(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		GACATCCTCCGTGTGCTTGCA	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		20224	0.001		0.0	False		,,,				2504	0.0				p.T151M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C452T	8						.	G	MET/THR	0,4406		0,0,2203	105.0	87.0	93.0		452	5.6	1.0	8		93	1,8599	1.2+/-3.3	0,1,4299	no	missense	LOXL2	NM_002318.2	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	151/775	23217682	1,13005	2203	4300	6503	23273627	SO:0001583	missense	4017	exon3			U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.452C>T	8.37:g.23217682G>A	ENSP00000373783:p.Thr151Met	Somatic		Unspecified	Illumina	Phase_I	23273627	NM_002318	B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Missense_Mutation	SNP	ENST00000389131.3	37	CCDS34864.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	19.75	3.885817	0.72410	0.0	1.16E-4	ENSG00000134013	ENST00000389131;ENST00000524144;ENST00000520871;ENST00000518083	T;T;T;T	0.47528	0.84;0.84;0.84;4.09	5.62	5.62	0.85841	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.202118	0.51477	D	0.000093	T	0.52964	0.1767	L	0.43646	1.37	0.32528	N	0.535298	D	0.53462	0.96	P	0.53062	0.717	T	0.63875	-0.6538	10	0.66056	D	0.02	.	14.2324	0.65903	0.0:0.1493:0.8507:0.0	.	151	Q9Y4K0	LOXL2_HUMAN	M	151;232;192;151	ENSP00000373783:T151M;ENSP00000427883:T232M;ENSP00000429778:T192M;ENSP00000430519:T151M	ENSP00000373783:T151M	T	-	2	0	LOXL2	23273627	0.999000	0.42202	0.983000	0.44433	0.915000	0.54546	2.951000	0.49089	2.804000	0.96469	0.655000	0.94253	ACG		LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375603.1		
EFCAB1	79645	broad.mit.edu	37	8	49641699	49641699	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr8:49641699C>A	ENST00000262103.3	-	5	558	c.478G>T	c.(478-480)Gac>Tac	p.D160Y	EFCAB1_ENST00000521002.1_Intron|EFCAB1_ENST00000523092.1_Missense_Mutation_p.D108Y|EFCAB1_ENST00000433756.1_Missense_Mutation_p.D108Y	NM_024593.3	NP_078869.1	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1	160	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)	p.D160Y(1)		endometrium(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(2)	14		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				CCATCATGGTCATGATCCTAG	0.413																																					p.D160Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G478T	8						.						110.0	93.0	99.0					8																	49641699		2203	4300	6503	49804252	SO:0001583	missense	79645	exon5				CCDS6145.1, CCDS47853.1	8q11.21	2013-01-10			ENSG00000034239	ENSG00000034239		"""EF-hand domain containing"""	25678	protein-coding gene	gene with protein product						12477932	Standard	NM_024593		Approved	FLJ11767	uc003xqo.2	Q9HAE3	OTTHUMG00000164203	ENST00000262103.3:c.478G>T	8.37:g.49641699C>A	ENSP00000262103:p.Asp160Tyr	Somatic		Unspecified	Illumina	Phase_I	49804252	NM_024593	B4DSB4|E7EVN7	Missense_Mutation	SNP	ENST00000262103.3	37	CCDS6145.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.1|22.1	4.239734|4.239734	0.79800|0.79800	.|.	.|.	ENSG00000034239|ENSG00000034239	ENST00000433756;ENST00000262103;ENST00000450553;ENST00000523092|ENST00000523008;ENST00000522254	T;T;T|.	0.76060|.	-0.99;-0.99;-0.99|.	5.09|5.09	5.09|5.09	0.68999|0.68999	EF-hand-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.91503|.	0.7317|.	H|H	0.99619|0.99619	4.66|4.66	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	D|.	0.94961|.	0.8108|.	9|.	.|.	.|.	.|.	.|.	16.0365|16.0365	0.80635|0.80635	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	108;160|.	Q9HAE3-2;Q9HAE3|.	.;EFCB1_HUMAN|.	Y|L	108;160;160;108|26;77	ENSP00000400873:D108Y;ENSP00000262103:D160Y;ENSP00000430765:D108Y|.	.|.	D|X	-|-	1|2	0|2	EFCAB1|EFCAB1	49804252|49804252	1.000000|1.000000	0.71417|0.71417	0.958000|0.958000	0.39756|0.39756	0.876000|0.876000	0.50452|0.50452	7.352000|7.352000	0.79404|0.79404	2.641000|2.641000	0.89580|0.89580	0.455000|0.455000	0.32223|0.32223	GAC|TGA		EFCAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377778.1	NM_024593	
RP1	6101	broad.mit.edu	37	8	55539894	55539894	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3893-01	TCGA-AG-3893-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr8:55539894A>T	ENST00000220676.1	+	4	3600	c.3452A>T	c.(3451-3453)cAc>cTc	p.H1151L		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1151					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.H1151L(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GTTGATGCTCACAAGGCTACC	0.413																																					p.H1151L	Colon(91;1014 1389 7634 14542 40420)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3452T	8						.						95.0	90.0	92.0					8																	55539894		2203	4300	6503	55702447	SO:0001583	missense	6101	exon4			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.3452A>T	8.37:g.55539894A>T	ENSP00000220676:p.His1151Leu	Somatic		Unspecified	Illumina	Phase_I	55702447	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.894966	0.00522	.	.	ENSG00000104237	ENST00000220676	T	0.19938	2.11	5.7	-2.17	0.07059	.	1.314670	0.05011	N	0.470926	T	0.10294	0.0252	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.24870	-1.0148	10	0.02654	T	1	1.2284	2.7699	0.05330	0.5068:0.158:0.068:0.2671	.	1151	P56715	RP1_HUMAN	L	1151	ENSP00000220676:H1151L	ENSP00000220676:H1151L	H	+	2	0	RP1	55702447	0.000000	0.05858	0.000000	0.03702	0.184000	0.23303	0.552000	0.23376	-0.171000	0.10797	0.460000	0.39030	CAC		RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
CLVS1	157807	broad.mit.edu	37	8	62370877	62370877	+	Silent	SNP	T	T	C			TCGA-AG-3893-01	TCGA-AG-3893-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr8:62370877T>C	ENST00000519846.1	+	6	1225	c.753T>C	c.(751-753)caT>caC	p.H251H	CLVS1_ENST00000518592.1_5'UTR|CLVS1_ENST00000325897.4_Silent_p.H251H			Q8IUQ0	CLVS1_HUMAN	clavesin 1	251	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)	p.H251H(1)		endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						TTTTCCTGCATGGAAACAATT	0.368																																					p.H251H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T753C	8						.						115.0	110.0	112.0					8																	62370877		2203	4300	6503	62533431	SO:0001819	synonymous_variant	157807	exon5			AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.753T>C	8.37:g.62370877T>C		Somatic		Unspecified	Illumina	Phase_I	62533431	NM_173519	B2R7M5|C8UZT3|Q8NB32	Silent	SNP	ENST00000519846.1	37	CCDS6176.1																																																																																				CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378323.1	NM_173519	
ZFPM2	23414	broad.mit.edu	37	8	106814517	106814517	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr8:106814517G>A	ENST00000407775.2	+	8	2457	c.2207G>A	c.(2206-2208)cGc>cAc	p.R736H	RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.R604H|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|ZFPM2_ENST00000378472.4_Missense_Mutation_p.R467H|RP11-152P17.2_ENST00000520594.1_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.R604H	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	736					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R736H(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			ATGCGCACACGCAAGCGCAGA	0.507																																					p.R736H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2207A	8						.						48.0	47.0	48.0					8																	106814517		2086	4219	6305	106883693	SO:0001583	missense	23414	exon8			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2207G>A	8.37:g.106814517G>A	ENSP00000384179:p.Arg736His	Somatic		Unspecified	Illumina	Phase_I	106883693	NM_012082	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	37	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.674769	0.88445	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.54675	0.56;1.13;1.13;2.36	5.72	5.72	0.89469	.	0.044995	0.85682	D	0.000000	T	0.73418	0.3584	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.72268	-0.4343	10	0.48119	T	0.1	.	19.88	0.96892	0.0:0.0:1.0:0.0	.	736	Q8WW38	FOG2_HUMAN	H	736;604;604;467	ENSP00000384179:R736H;ENSP00000430757:R604H;ENSP00000428720:R604H;ENSP00000367733:R467H	ENSP00000367733:R467H	R	+	2	0	ZFPM2	106883693	1.000000	0.71417	0.993000	0.49108	0.989000	0.77384	9.869000	0.99810	2.708000	0.92522	0.561000	0.74099	CGC		ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1		
OTUD7B	56957	broad.mit.edu	37	1	149936185	149936185	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3893-01	TCGA-AG-3893-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr1:149936185T>C	ENST00000369135.4	-	6	988	c.694A>G	c.(694-696)Agg>Ggg	p.R232G	OTUD7B_ENST00000479905.1_5'UTR	NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	232	Catalytic.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding.				mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.R232G(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			CTCCAGCGCCTTTTCAACGCT	0.522																																					p.R232G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A694G	1						.						109.0	120.0	117.0					1																	149936185		2115	4244	6359	148202809	SO:0001583	missense	56957	exon6			AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.694A>G	1.37:g.149936185T>C	ENSP00000358131:p.Arg232Gly	Somatic		Unspecified	Illumina	Phase_I	148202809	NM_020205	B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Missense_Mutation	SNP	ENST00000369135.4	37	CCDS41389.1	.	.	.	.	.	.	.	.	.	.	T	18.58	3.653667	0.67472	.	.	ENSG00000163113	ENST00000369135;ENST00000543330;ENST00000417191	T;T	0.36520	1.25;1.32	4.87	2.83	0.33086	Ovarian tumour, otubain (2);	0.000000	0.85682	D	0.000000	T	0.46600	0.1401	M	0.74389	2.26	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.48681	-0.9014	9	.	.	.	-33.3308	12.242	0.54549	0.0:0.0:0.5726:0.4274	.	232;232	B7Z643;Q6GQQ9	.;OTU7B_HUMAN	G	232	ENSP00000358131:R232G;ENSP00000408231:R232G	.	R	-	1	2	OTUD7B	148202809	0.895000	0.30542	0.928000	0.36995	0.859000	0.49053	0.241000	0.18065	0.615000	0.30124	-0.264000	0.10439	AGG		OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034146.3	NM_020205	
PTCH2	8643	broad.mit.edu	37	1	45295378	45295378	+	Missense_Mutation	SNP	G	G	A	rs200534670		TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr1:45295378G>A	ENST00000372192.3	-	8	1121	c.991C>T	c.(991-993)Cat>Tat	p.H331Y	PTCH2_ENST00000447098.2_Missense_Mutation_p.H331Y	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	331					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)	p.H331Y(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					CCCCGGAAATGCTCGTACAGC	0.607									Basal Cell Nevus syndrome																												p.H331Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C991T	1						.						67.0	67.0	67.0					1																	45295378		2203	4300	6503	45067965	SO:0001583	missense	8643	exon8	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.991C>T	1.37:g.45295378G>A	ENSP00000361266:p.His331Tyr	Somatic		Unspecified	Illumina	Phase_I	45067965	NM_001166292	O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	ENST00000372192.3	37	CCDS516.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.445478	0.43429	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.92495	-3.04;-3.05	4.63	4.63	0.57726	.	0.000000	0.56097	D	0.000027	D	0.93112	0.7807	L	0.38649	1.16	0.49915	D	0.999838	B;D	0.76494	0.007;0.999	B;D	0.87578	0.032;0.998	D	0.90250	0.4293	10	0.14656	T	0.56	-12.767	17.2969	0.87172	0.0:0.0:1.0:0.0	.	331;331	Q9Y6C5-2;Q9Y6C5	.;PTC2_HUMAN	Y	331	ENSP00000389703:H331Y;ENSP00000361266:H331Y	ENSP00000361266:H331Y	H	-	1	0	PTCH2	45067965	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	9.173000	0.94815	2.415000	0.81967	0.561000	0.74099	CAT		PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4	NM_003738	
CACHD1	57685	broad.mit.edu	37	1	65130314	65130314	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3893-01	TCGA-AG-3893-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr1:65130314A>G	ENST00000371073.2	+	15	2228	c.2228A>G	c.(2227-2229)tAt>tGt	p.Y743C	CACHD1_ENST00000290039.5_Missense_Mutation_p.Y692C|CACHD1_ENST00000495994.1_3'UTR			Q5VU97	CAHD1_HUMAN	cache domain containing 1	743					calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)		p.Y692C(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CTCAGAATTTATCCTGGTTCC	0.468																																					p.Y692C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2075G	1						.						178.0	158.0	165.0					1																	65130314		2203	4300	6503	64902902	SO:0001583	missense	57685	exon15			AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.2228A>G	1.37:g.65130314A>G	ENSP00000360113:p.Tyr743Cys	Somatic		Unspecified	Illumina	Phase_I	64902902	NM_020925	Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Missense_Mutation	SNP	ENST00000371073.2	37		.	.	.	.	.	.	.	.	.	.	A	23.1	4.378173	0.82682	.	.	ENSG00000158966	ENST00000371073;ENST00000290039	T;T	0.30448	1.53;1.54	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.50633	0.1627	M	0.78285	2.405	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.56378	-0.7989	10	0.72032	D	0.01	-23.9082	16.5655	0.84588	1.0:0.0:0.0:0.0	.	743	Q5VU97	CAHD1_HUMAN	C	743;692	ENSP00000360113:Y743C;ENSP00000290039:Y692C	ENSP00000290039:Y692C	Y	+	2	0	CACHD1	64902902	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.027000	0.76463	2.302000	0.77476	0.533000	0.62120	TAT		CACHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_020925	
HRNR	388697	broad.mit.edu	37	1	152192976	152192976	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr1:152192976G>A	ENST00000368801.2	-	3	1204	c.1129C>T	c.(1129-1131)Cat>Tat	p.H377Y	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	377					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.H377Y(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTAGATCCATGTTGTCCCTGG	0.557																																					p.H377Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1129T	1						.						177.0	156.0	163.0					1																	152192976		2203	4300	6503	150459600	SO:0001583	missense	388697	exon3			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1129C>T	1.37:g.152192976G>A	ENSP00000357791:p.His377Tyr	Somatic		Unspecified	Illumina	Phase_I	150459600	NM_001009931	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	G	7.086	0.571232	0.13623	.	.	ENSG00000197915	ENST00000368801	T	0.05139	3.49	4.53	3.61	0.41365	.	.	.	.	.	T	0.01320	0.0043	N	0.14661	0.345	0.09310	N	1	D	0.56968	0.978	P	0.49140	0.601	T	0.16041	-1.0416	9	0.02654	T	1	.	6.3961	0.21613	0.0987:0.1866:0.7147:0.0	.	377	Q86YZ3	HORN_HUMAN	Y	377	ENSP00000357791:H377Y	ENSP00000357791:H377Y	H	-	1	0	HRNR	150459600	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	0.341000	0.19909	1.096000	0.41439	0.644000	0.83932	CAT		HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
HTR3A	3359	broad.mit.edu	37	11	113857531	113857531	+	Intron	SNP	G	G	T			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr11:113857531G>T	ENST00000504030.2	+	8	1361				HTR3A_ENST00000506841.2_Missense_Mutation_p.A333S|HTR3A_ENST00000355556.2_Missense_Mutation_p.A339S|HTR3A_ENST00000375498.2_Intron|HTR3A_ENST00000535865.1_Intron|HTR3A_ENST00000299961.5_Intron			P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A, ionotropic						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cellular response to growth factor stimulus (GO:0071363)|digestion (GO:0007586)|ion transmembrane transport (GO:0034220)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)|voltage-gated potassium channel activity (GO:0005249)	p.A333S(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	36		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)	TCTTGCCTCTGCCCTGGGCTG	0.582																																					p.A339S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1015T	11						.						117.0	102.0	107.0					11																	113857531		2201	4296	6497	113362741	SO:0001627	intron_variant	3359	exon7			D49394	CCDS8365.1, CCDS8366.1, CCDS8365.2, CCDS8366.2, CCDS53710.1	11q23.1-q23.2	2012-05-22	2012-02-03					"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5297	protein-coding gene	gene with protein product		182139	"""5-hydroxytryptamine (serotonin) receptor 3A"""	HTR3		8530095, 12867984	Standard	NM_000869		Approved	5-HT3R, 5-HT3A	uc010rxb.2	P46098		ENST00000504030.2:c.917-16G>T	11.37:g.113857531G>T		Somatic		Unspecified	Illumina	Phase_I	113362741	NM_213621	B4DSY6|G5E986|O60854|Q7KZM7|Q99918|Q9BSZ9	Missense_Mutation	SNP	ENST00000504030.2	37		.	.	.	.	.	.	.	.	.	.	G	2.902	-0.227281	0.06022	.	.	ENSG00000166736	ENST00000355556;ENST00000506841	D;D	0.87650	-2.28;-2.28	2.81	-5.63	0.02474	.	0.915429	0.08980	N	0.865952	T	0.65831	0.2729	N	0.08118	0	0.09310	N	1	B	0.22683	0.073	B	0.19391	0.025	T	0.55192	-0.8179	9	.	.	.	-0.6469	3.3351	0.07098	0.2651:0.4612:0.1571:0.1166	.	339	G5E986	.	S	339;333	ENSP00000347754:A339S;ENSP00000424776:A333S	.	A	+	1	0	HTR3A	113362741	.	.	0.000000	0.03702	0.159000	0.22180	.	.	-1.366000	0.02155	-0.258000	0.10820	GCC		HTR3A-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000360822.2	NM_000869	
MPEG1	219972	broad.mit.edu	37	11	58980158	58980158	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr11:58980158G>A	ENST00000361050.3	-	1	266	c.181C>T	c.(181-183)Cga>Tga	p.R61*	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	61	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.					integral component of membrane (GO:0016021)		p.R61*(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				TCCATAACTCGTCCCATGTCC	0.478																																					p.R61X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C181T	11						.						170.0	169.0	169.0					11																	58980158		2017	4174	6191	58736734	SO:0001587	stop_gained	219972	exon1			AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.181C>T	11.37:g.58980158G>A	ENSP00000354335:p.Arg61*	Somatic		Unspecified	Illumina	Phase_I	58736734	NM_001039396	Q2M1T6|Q8TEF8	Nonsense_Mutation	SNP	ENST00000361050.3	37	CCDS41650.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.994369	0.93167	.	.	ENSG00000197629	ENST00000361050;ENST00000545098	.	.	.	5.41	3.33	0.38152	.	0.064428	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.1937	10.4012	0.44231	0.0:0.0:0.5005:0.4995	.	.	.	.	X	61	.	ENSP00000354335:R61X	R	-	1	2	MPEG1	58736734	0.994000	0.37717	1.000000	0.80357	0.940000	0.58332	2.854000	0.48325	1.262000	0.44165	0.644000	0.83932	CGA		MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
FERMT3	83706	broad.mit.edu	37	11	63988498	63988498	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr11:63988498G>A	ENST00000279227.5	+	13	1663	c.1568G>A	c.(1567-1569)cGg>cAg	p.R523Q	FERMT3_ENST00000345728.5_Missense_Mutation_p.R519Q	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	523	FERM.				integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)	p.R523Q(1)|p.R519Q(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						CTCACCCCACGGATCCTGGAA	0.652																																					p.R523Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1568A	11						.						97.0	83.0	88.0					11																	63988498		2201	4297	6498	63745074	SO:0001583	missense	83706	exon13			L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.1568G>A	11.37:g.63988498G>A	ENSP00000279227:p.Arg523Gln	Somatic		Unspecified	Illumina	Phase_I	63745074	NM_178443	Q8IUA1|Q8N207|Q9BT48	Missense_Mutation	SNP	ENST00000279227.5	37	CCDS8060.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909337	0.92107	.	.	ENSG00000149781	ENST00000345728;ENST00000279227	T;T	0.80653	-1.4;-1.4	4.29	4.29	0.51040	Band 4.1 domain (1);FERM central domain (2);	0.000000	0.85682	D	0.000000	D	0.86134	0.5860	L	0.46947	1.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.985	D	0.87494	0.2429	10	0.66056	D	0.02	-41.2461	16.0438	0.80704	0.0:0.0:1.0:0.0	.	519;523	Q86UX7-2;Q86UX7	.;URP2_HUMAN	Q	519;523	ENSP00000339950:R519Q;ENSP00000279227:R523Q	ENSP00000279227:R523Q	R	+	2	0	FERMT3	63745074	1.000000	0.71417	0.947000	0.38551	0.593000	0.36681	7.368000	0.79567	2.386000	0.81285	0.462000	0.41574	CGG		FERMT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396297.1	NM_031471	
DLG2	1740	broad.mit.edu	37	11	84245744	84245744	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr11:84245744G>A	ENST00000532653.1	-	2	375	c.73C>T	c.(73-75)Cat>Tat	p.H25Y	DLG2_ENST00000398309.2_Missense_Mutation_p.H25Y|DLG2_ENST00000543673.1_Missense_Mutation_p.H130Y|DLG2_ENST00000524982.1_Missense_Mutation_p.H25Y|DLG2_ENST00000376104.2_Missense_Mutation_p.H130Y			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.H25Y(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GAATGATCATGTGGAGCGTCC	0.388																																					p.H25Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C73T	11						.						185.0	172.0	176.0					11																	84245744		1879	4114	5993	83923392	SO:0001583	missense	1740	exon2			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.73C>T	11.37:g.84245744G>A	ENSP00000435849:p.His25Tyr	Somatic		Unspecified	Illumina	Phase_I	83923392	NM_001364	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000532653.1	37		.	.	.	.	.	.	.	.	.	.	G	27.6	4.848669	0.91277	.	.	ENSG00000150672	ENST00000398309;ENST00000376104;ENST00000543673;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000527088	T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96	5.88	5.88	0.94601	Membrane-associated guanylate kinase (MAGUK), PEST domain, N-terminal (1);	0.090245	0.45126	D	0.000396	T	0.33760	0.0874	N	0.19112	0.55	0.80722	D	1	B;P;P;P	0.42296	0.432;0.773;0.775;0.647	B;B;B;B	0.40602	0.227;0.334;0.201;0.334	T	0.03608	-1.1020	9	.	.	.	.	20.2279	0.98344	0.0:0.0:1.0:0.0	.	25;25;130;25	B7Z2T4;E9PN83;Q15700-2;Q15700	.;.;.;DLG2_HUMAN	Y	25;130;130;25;25;130;46	ENSP00000381355:H25Y;ENSP00000365272:H130Y;ENSP00000441994:H130Y;ENSP00000432894:H25Y;ENSP00000435849:H25Y;ENSP00000435809:H46Y	.	H	-	1	0	DLG2	83923392	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.270000	0.95690	2.778000	0.95560	0.655000	0.94253	CAT		DLG2-009	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000259253.2	NM_001364	
FAT3	120114	broad.mit.edu	37	11	92533683	92533683	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr11:92533683G>A	ENST00000298047.6	+	9	7521	c.7504G>A	c.(7504-7506)Gta>Ata	p.V2502I	FAT3_ENST00000525166.1_Missense_Mutation_p.V2352I|FAT3_ENST00000409404.2_Missense_Mutation_p.V2502I			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2502	Cadherin 23. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V2502I(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AAGCACATACGTAGCTGAGGT	0.498										TCGA Ovarian(4;0.039)																											p.V2502I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G7504A	11						.						84.0	81.0	82.0					11																	92533683		2056	4199	6255	92173331	SO:0001583	missense	120114	exon9			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7504G>A	11.37:g.92533683G>A	ENSP00000298047:p.Val2502Ile	Somatic		Unspecified	Illumina	Phase_I	92173331	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	G	15.96	2.986499	0.53934	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.53423	0.62;0.62;0.62	5.95	5.95	0.96441	.	.	.	.	.	T	0.38108	0.1028	N	0.25789	0.76	0.80722	D	1	P	0.49961	0.93	B	0.38225	0.268	T	0.22417	-1.0217	9	0.42905	T	0.14	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	2502	Q8TDW7-3	.	I	2502;2502;2352	ENSP00000298047:V2502I;ENSP00000387040:V2502I;ENSP00000432586:V2352I	ENSP00000298047:V2502I	V	+	1	0	FAT3	92173331	1.000000	0.71417	0.948000	0.38648	0.891000	0.51852	6.668000	0.74457	2.824000	0.97209	0.655000	0.94253	GTA		FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
TECTA	7007	broad.mit.edu	37	11	120989269	120989269	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr11:120989269G>T	ENST00000392793.1	+	7	1316	c.1045G>T	c.(1045-1047)Gcc>Tcc	p.A349S	TECTA_ENST00000264037.2_Missense_Mutation_p.A349S			O75443	TECTA_HUMAN	tectorin alpha	349	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.A349S(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CTACTTGCTGGCCCGACAGTG	0.572																																					p.A349S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1045T	11						.						139.0	123.0	128.0					11																	120989269		2203	4299	6502	120494479	SO:0001583	missense	7007	exon6			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.1045G>T	11.37:g.120989269G>T	ENSP00000376543:p.Ala349Ser	Somatic		Unspecified	Illumina	Phase_I	120494479	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.081468	0.76528	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.62498	0.02;0.02	5.72	5.72	0.89469	von Willebrand factor, type D domain (3);	0.000000	0.85682	D	0.000000	T	0.69214	0.3086	N	0.21142	0.635	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	T	0.65594	-0.6130	10	0.27785	T	0.31	.	19.8885	0.96919	0.0:0.0:1.0:0.0	.	349	O75443	TECTA_HUMAN	S	349	ENSP00000376543:A349S;ENSP00000264037:A349S	ENSP00000264037:A349S	A	+	1	0	TECTA	120494479	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.742000	0.74843	2.700000	0.92200	0.563000	0.77884	GCC		TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
WASF1	8936	broad.mit.edu	37	6	110429848	110429848	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr6:110429848C>T	ENST00000392589.1	-	6	1141	c.305G>A	c.(304-306)cGa>cAa	p.R102Q	WASF1_ENST00000392587.2_Missense_Mutation_p.R102Q|WASF1_ENST00000392588.1_Missense_Mutation_p.R102Q|WASF1_ENST00000359451.2_Missense_Mutation_p.R102Q|WASF1_ENST00000392586.1_Missense_Mutation_p.R102Q	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	102					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)	p.R102Q(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		TGTAGAACTTCGGAAAGCTTT	0.353																																					p.R102Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G305A	6						.						82.0	76.0	78.0					6																	110429848		2203	4300	6503	110536541	SO:0001583	missense	8936	exon5			D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.305G>A	6.37:g.110429848C>T	ENSP00000376368:p.Arg102Gln	Somatic		Unspecified	Illumina	Phase_I	110536541	NM_001024934	E1P5F2|Q5SZK7	Missense_Mutation	SNP	ENST00000392589.1	37	CCDS5080.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656883	0.88154	.	.	ENSG00000112290	ENST00000392586;ENST00000392587;ENST00000392589;ENST00000392588;ENST00000359451;ENST00000444391;ENST00000265601;ENST00000368938	T;T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91	6.06	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.16981	0.0408	L	0.49126	1.545	0.52099	D	0.999946	P	0.39847	0.691	B	0.18871	0.023	T	0.04281	-1.0963	10	0.22706	T	0.39	.	15.5809	0.76439	0.0:0.934:0.0:0.066	.	102	Q92558	WASF1_HUMAN	Q	102	ENSP00000376365:R102Q;ENSP00000376366:R102Q;ENSP00000376368:R102Q;ENSP00000376367:R102Q;ENSP00000352425:R102Q;ENSP00000407041:R102Q;ENSP00000265601:R102Q;ENSP00000357934:R102Q	ENSP00000265601:R102Q	R	-	2	0	WASF1	110536541	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.777000	0.55364	1.574000	0.49760	0.650000	0.86243	CGA		WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041784.3	NM_003931	
FAM65B	9750	broad.mit.edu	37	6	24865566	24865566	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3893-01	TCGA-AG-3893-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr6:24865566A>C	ENST00000259698.4	-	7	702	c.527T>G	c.(526-528)cTg>cGg	p.L176R	FAM65B_ENST00000540914.1_Missense_Mutation_p.L176R|FAM65B_ENST00000538035.1_Missense_Mutation_p.L205R|FAM65B_ENST00000378023.4_Missense_Mutation_p.L176R|FAM65B_ENST00000510784.2_Missense_Mutation_p.L210R	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	176					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)		p.L176R(2)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						GATCTCTGTCAGACTCTCCCG	0.507																																					p.L176R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T527G	6						.						89.0	88.0	88.0					6																	24865566		1922	4134	6056	24973545	SO:0001583	missense	9750	exon7			U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.527T>G	6.37:g.24865566A>C	ENSP00000259698:p.Leu176Arg	Somatic		Unspecified	Illumina	Phase_I	24973545	NM_015864	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	ENST00000259698.4	37	CCDS47383.1	.	.	.	.	.	.	.	.	.	.	A	18.37	3.609165	0.66558	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.02323	4.34;4.34;4.34;4.34;4.34	5.59	5.59	0.84812	.	0.068970	0.64402	D	0.000015	T	0.09818	0.0241	M	0.74467	2.265	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.989;1.0;0.989;1.0	T	0.00961	-1.1499	10	0.87932	D	0	-13.4911	15.7744	0.78198	1.0:0.0:0.0:0.0	.	210;205;176;176	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	R	176;205;176;176;210	ENSP00000259698:L176R;ENSP00000441138:L205R;ENSP00000367262:L176R;ENSP00000438425:L176R;ENSP00000441305:L210R	ENSP00000259698:L176R	L	-	2	0	FAM65B	24973545	1.000000	0.71417	0.112000	0.21494	0.504000	0.33889	8.740000	0.91579	2.120000	0.65058	0.459000	0.35465	CTG		FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2		
LRRC16A	55604	broad.mit.edu	37	6	25488808	25488808	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr6:25488808C>T	ENST00000329474.6	+	13	1428	c.1060C>T	c.(1060-1062)Ctc>Ttc	p.L354F		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	354					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)	p.L354F(1)		breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						TGGAGATGACCTCTCAGTAAG	0.453																																					p.L354F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1060T	6						.						162.0	156.0	158.0					6																	25488808		1917	4128	6045	25596787	SO:0001583	missense	55604	exon13			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.1060C>T	6.37:g.25488808C>T	ENSP00000331983:p.Leu354Phe	Somatic		Unspecified	Illumina	Phase_I	25596787	NM_017640	B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	ENST00000329474.6	37	CCDS54973.1	.	.	.	.	.	.	.	.	.	.	C	12.35	1.911097	0.33721	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	T	0.55930	0.49	4.99	4.11	0.48088	.	0.199515	0.44285	D	0.000465	T	0.20047	0.0482	N	0.11845	0.185	0.80722	D	1	B;B;B	0.21821	0.043;0.036;0.061	B;B;B	0.21151	0.03;0.022;0.033	T	0.05818	-1.0862	10	0.36615	T	0.2	.	13.1093	0.59265	0.0:0.922:0.0:0.0779	.	354;354;354	Q5VZK9;B2RTQ5;Q5VZK9-2	LR16A_HUMAN;.;.	F	354	ENSP00000331983:L354F	ENSP00000331983:L354F	L	+	1	0	LRRC16A	25596787	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.326000	0.52037	2.465000	0.83290	0.655000	0.94253	CTC		LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040045.2	NM_017640	
LSM2	57819	broad.mit.edu	37	6	31773919	31773919	+	Splice_Site	SNP	G	G	C			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr6:31773919G>C	ENST00000375661.5	-	2	230	c.4C>G	c.(4-6)Ctc>Gtc	p.L2V	LSM2_ENST00000491421.1_5'UTR	NM_021177.4	NP_067000.1	Q9Y333	LSM2_HUMAN	LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)	2					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|U6 snRNA binding (GO:0017070)	p.L2V(1)		large_intestine(1)|lung(1)	2						GAATAGAAGAGCTATTGGGAG	0.473																																					p.L2V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4G	6						.						61.0	54.0	56.0					6																	31773919		1510	2709	4219	31881898	SO:0001630	splice_region_variant	57819	exon2			AF182288	CCDS4722.1	6p21.3	2010-02-17	2003-02-17	2003-02-21	ENSG00000204392	ENSG00000204392			13940	protein-coding gene	gene with protein product		607282	"""chromosome 6 open reading frame 28"""	C6orf28		10523320, 8428774	Standard	NM_021177		Approved	G7b, YBL026W	uc003nxg.3	Q9Y333	OTTHUMG00000031121	ENST00000375661.5:c.4-1C>G	6.37:g.31773919G>C		Somatic		Unspecified	Illumina	Phase_I	31881898	NM_021177	Q6FGG1	Missense_Mutation	SNP	ENST00000375661.5	37	CCDS4722.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875656	0.91664	.	.	ENSG00000204392	ENST00000375661	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.68888	0.3050	.	.	.	0.80722	D	1	D	0.60160	0.987	P	0.54856	0.762	T	0.70970	-0.4727	8	0.62326	D	0.03	-12.6367	17.8572	0.88769	0.0:0.0:1.0:0.0	.	2	Q9Y333	LSM2_HUMAN	V	2	.	ENSP00000364813:L2V	L	-	1	0	LSM2	31881898	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.362000	0.66098	2.890000	0.99128	0.655000	0.94253	CTC		LSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076205.2	NM_021177	Missense_Mutation
PKHD1	5314	broad.mit.edu	37	6	51524264	51524264	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr6:51524264C>G	ENST00000371117.3	-	61	10935	c.10660G>C	c.(10660-10662)Gaa>Caa	p.E3554Q		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3554					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.E3554Q(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GAGCGTATTTCAATGGGCTCC	0.408																																					p.E3554Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G10660C	6						.						71.0	70.0	70.0					6																	51524264		2203	4300	6503	51632223	SO:0001583	missense	5314	exon61			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.10660G>C	6.37:g.51524264C>G	ENSP00000360158:p.Glu3554Gln	Somatic		Unspecified	Illumina	Phase_I	51632223	NM_138694	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.324171	0.81580	.	.	ENSG00000170927	ENST00000371117	D	0.89343	-2.5	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.90277	0.6959	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.66716	0.946	D	0.90859	0.4737	10	0.66056	D	0.02	.	19.3249	0.94258	0.0:1.0:0.0:0.0	.	3554	P08F94	PKHD1_HUMAN	Q	3554	ENSP00000360158:E3554Q	ENSP00000360158:E3554Q	E	-	1	0	PKHD1	51632223	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.143000	0.64826	2.805000	0.96524	0.655000	0.94253	GAA		PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
TXLNB	167838	broad.mit.edu	37	6	139564112	139564112	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr6:139564112C>T	ENST00000358430.3	-	10	1838	c.1606G>A	c.(1606-1608)Gcc>Acc	p.A536T	RP1-225E12.3_ENST00000585874.1_RNA	NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	536						cytoplasm (GO:0005737)		p.A536T(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		TTGAGAGCGGCGTCAGCACTC	0.567																																					p.A536T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1606A	6						.						77.0	84.0	81.0					6																	139564112		2203	4300	6503	139605805	SO:0001583	missense	167838	exon10				CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.1606G>A	6.37:g.139564112C>T	ENSP00000351206:p.Ala536Thr	Somatic		Unspecified	Illumina	Phase_I	139605805	NM_153235	Q5VTF3|Q76L25|Q86T52|Q8N3S2	Missense_Mutation	SNP	ENST00000358430.3	37	CCDS34545.1	.	.	.	.	.	.	.	.	.	.	C	5.295	0.239808	0.10023	.	.	ENSG00000164440	ENST00000358430	T	0.14391	2.51	3.95	-7.9	0.01169	.	2.538650	0.01279	N	0.009686	T	0.01092	0.0036	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32613	-0.9900	9	.	.	.	5.6381	1.2535	0.01987	0.365:0.2665:0.0915:0.277	.	536	Q8N3L3	TXLNB_HUMAN	T	536	ENSP00000351206:A536T	.	A	-	1	0	TXLNB	139605805	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.799000	0.00762	-3.131000	0.00236	-1.340000	0.01251	GCC		TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042458.1	NM_153235	
DNAH9	1770	broad.mit.edu	37	17	11648155	11648155	+	Silent	SNP	G	G	C			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr17:11648155G>C	ENST00000262442.4	+	31	6221	c.6153G>C	c.(6151-6153)ctG>ctC	p.L2051L	DNAH9_ENST00000454412.2_Silent_p.L2051L	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2051	AAA 1. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.L2051L(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGTCCGTGCTGGTGGTGGCAG	0.572																																					p.L2051L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G6153C	17						.						65.0	58.0	61.0					17																	11648155		2203	4300	6503	11588880	SO:0001819	synonymous_variant	1770	exon31			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.6153G>C	17.37:g.11648155G>C		Somatic		Unspecified	Illumina	Phase_I	11588880	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																				DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
GGNBP2	79893	broad.mit.edu	37	17	34942326	34942326	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3893-01	TCGA-AG-3893-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr17:34942326A>C	ENST00000304718.4	+	11	1739	c.1423A>C	c.(1423-1425)Agt>Cgt	p.S475R		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	475					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)		p.S475R(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		CATGGAAGGGAGTGAAACAGG	0.413																																					p.S475R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1423C	17						.						159.0	159.0	159.0					17																	34942326		2203	4300	6503	32016439	SO:0001583	missense	79893	exon11			AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.1423A>C	17.37:g.34942326A>C	ENSP00000307617:p.Ser475Arg	Somatic		Unspecified	Illumina	Phase_I	32016439	NM_024835	B2RPK7|Q96T90|Q9GZR8|Q9H767	Missense_Mutation	SNP	ENST00000304718.4	37	CCDS11314.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.807042	0.90623	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.67683	0.2919	L	0.32530	0.975	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.994;0.996	T	0.70945	-0.4734	9	0.72032	D	0.01	-16.6878	15.9962	0.80250	1.0:0.0:0.0:0.0	.	475;475	A8K3S2;Q9H3C7	.;GGNB2_HUMAN	R	475	.	ENSP00000307617:S475R	S	+	1	0	GGNBP2	32016439	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.605000	0.90883	2.180000	0.69256	0.459000	0.35465	AGT		GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835	
ACACA	31	broad.mit.edu	37	17	35536342	35536342	+	Silent	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr17:35536342C>T	ENST00000394406.2	-	41	5017	c.4827G>A	c.(4825-4827)ctG>ctA	p.L1609L	ACACA_ENST00000360679.3_Silent_p.L1551L|ACACA_ENST00000353139.5_Silent_p.L1646L|ACACA_ENST00000335166.5_Silent_p.L1531L	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1609					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.L1551L(1)|p.L1646L(1)		NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	AGAGTTTGATCAGGGACTAGT	0.388																																					p.L1646L	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G4938A	17						.						102.0	97.0	99.0					17																	35536342		2203	4300	6503	32610455	SO:0001819	synonymous_variant	31	exon41			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.4827G>A	17.37:g.35536342C>T		Somatic		Unspecified	Illumina	Phase_I	32610455	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Silent	SNP	ENST00000394406.2	37	CCDS11317.1																																																																																				ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
PLCD3	113026	broad.mit.edu	37	17	43195807	43195807	+	Silent	SNP	C	C	T	rs563660926	byFrequency	TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr17:43195807C>T	ENST00000322765.5	-	6	1079	c.966G>A	c.(964-966)tcG>tcA	p.S322S	PLCD3_ENST00000540511.1_5'UTR	NM_133373.3	NP_588614.1	Q8N3E9	PLCD3_HUMAN	phospholipase C, delta 3	322					angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.S322S(2)		breast(2)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	17						CCCCCTCCGGCGACAACAGGT	0.577													c|||	4	0.000798722	0.0	0.0	5008	,	,		18637	0.004		0.0	False		,,,				2504	0.0				p.S322S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G966A	17						.						115.0	127.0	123.0					17																	43195807		2119	4228	6347	40551333	SO:0001819	synonymous_variant	113026	exon6			AC002117	CCDS74077.1	17q21	2012-04-20			ENSG00000161714	ENSG00000161714	3.1.4.11		9061	protein-coding gene	gene with protein product		608795				10702670, 9056492	Standard	NM_133373		Approved		uc002iib.3	Q8N3E9	OTTHUMG00000168029	ENST00000322765.5:c.966G>A	17.37:g.43195807C>T		Somatic		Unspecified	Illumina	Phase_I	40551333	NM_133373	Q8TEC1|Q8TF37|Q96FL6	Silent	SNP	ENST00000322765.5	37																																																																																					PLCD3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_133373	
HELZ	9931	broad.mit.edu	37	17	65174933	65174933	+	Silent	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr17:65174933C>T	ENST00000358691.5	-	13	1438	c.1272G>A	c.(1270-1272)ttG>ttA	p.L424L	HELZ_ENST00000580168.1_Silent_p.L424L	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	424						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.L424L(1)		NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					GGCTCTTCTCCAAATCAGTAG	0.398																																					p.L424L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1272A	17						.						145.0	140.0	142.0					17																	65174933		1834	4095	5929	62605395	SO:0001819	synonymous_variant	9931	exon13			D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.1272G>A	17.37:g.65174933C>T		Somatic		Unspecified	Illumina	Phase_I	62605395	NM_014877	I6L9H4	Silent	SNP	ENST00000358691.5	37	CCDS42374.1																																																																																				HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
TP53	7157	broad.mit.edu	37	17	7578517	7578517	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr17:7578517G>A	ENST00000269305.4	-	5	602	c.413C>T	c.(412-414)gCc>gTc	p.A138V	TP53_ENST00000359597.4_Missense_Mutation_p.A138V|TP53_ENST00000413465.2_Missense_Mutation_p.A138V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.A138V|TP53_ENST00000455263.2_Missense_Mutation_p.A138V|TP53_ENST00000445888.2_Missense_Mutation_p.A138V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	138	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934875).|A -> S (in LFS; germline mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A138V(20)|p.0?(8)|p.A138_P142delAKTCP(4)|p.C135fs*9(3)|p.N131fs*27(2)|p.A138fs*31(1)|p.L137_W146del10(1)|p.K139fs*4(1)|p.F134_T140>S(1)|p.A45_P49delAKTCP(1)|p.V73fs*9(1)|p.K132_A138delKMFCQLA(1)|p.A138_V143delAKTCPV(1)|p.A6_P10delAKTCP(1)|p.C3fs*9(1)|p.A138del(1)|p.C42fs*9(1)|p.A6V(1)|p.C135_A138delCQLA(1)|p.Q136_K139delQLAK(1)|p.C135_T140delCQLAKT(1)|p.A45V(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGGTCTTGGCCAGTTGGCA	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.A138V	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,-1	.	54	Substitution - Missense(22)|Deletion - In frame(13)|Deletion - Frameshift(10)|Whole gene deletion(8)|Complex - deletion inframe(1)	large_intestine(9)|ovary(7)|haematopoietic_and_lymphoid_tissue(6)|urinary_tract(6)|breast(6)|stomach(4)|lung(4)|bone(4)|central_nervous_system(3)|soft_tissue(1)|endometrium(1)|skin(1)|oesophagus(1)|liver(1)	c.C413T	17						.						54.0	54.0	54.0					17																	7578517		2203	4300	6503	7519242	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.413C>T	17.37:g.7578517G>A	ENSP00000269305:p.Ala138Val	Somatic		Unspecified	Illumina	Phase_I	7519242	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.067507	0.76301	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99859	-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99819	0.9920	M	0.70595	2.14	0.58432	D	0.999998	P;P;D;P;D;D;D	0.89917	0.821;0.952;0.981;0.886;0.984;0.98;1.0	P;P;P;B;P;P;D	0.91635	0.528;0.716;0.646;0.328;0.813;0.771;0.999	D	0.96765	0.9564	10	0.87932	D	0	-15.6629	17.2272	0.86973	0.0:0.0:1.0:0.0	.	99;138;138;45;138;138;138	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	V	138;138;138;138;138;138;127;45;6;45;6;138	ENSP00000410739:A138V;ENSP00000352610:A138V;ENSP00000269305:A138V;ENSP00000398846:A138V;ENSP00000391127:A138V;ENSP00000391478:A138V;ENSP00000425104:A6V;ENSP00000423862:A45V;ENSP00000424104:A138V	ENSP00000269305:A138V	A	-	2	0	TP53	7519242	1.000000	0.71417	0.989000	0.46669	0.377000	0.30045	5.601000	0.67606	2.733000	0.93635	0.655000	0.94253	GCC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ABCA8	10351	broad.mit.edu	37	17	66871834	66871834	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr17:66871834C>A	ENST00000269080.2	-	34	4428	c.4291G>T	c.(4291-4293)Gcc>Tcc	p.A1431S	ABCA8_ENST00000586539.1_Missense_Mutation_p.A1471S|ABCA8_ENST00000430352.2_Missense_Mutation_p.A1471S	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1431	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.A1431S(1)		breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GTTAGGAGGGCACCCCTTTCC	0.507																																					p.A1431S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4291T	17						.						87.0	67.0	74.0					17																	66871834		2203	4300	6503	64383429	SO:0001583	missense	10351	exon34			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.4291G>T	17.37:g.66871834C>A	ENSP00000269080:p.Ala1431Ser	Somatic		Unspecified	Illumina	Phase_I	64383429	NM_007168	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	37	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.719216	0.89205	.	.	ENSG00000141338	ENST00000269080;ENST00000430352	D;D	0.95412	-3.7;-3.7	4.36	4.36	0.52297	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.248824	0.28047	N	0.016813	D	0.96175	0.8753	L	0.40543	1.245	0.51233	D	0.999916	D;D;D	0.76494	0.994;0.998;0.999	P;D;D	0.71414	0.902;0.973;0.94	D	0.96722	0.9533	10	0.72032	D	0.01	.	16.4175	0.83746	0.0:1.0:0.0:0.0	.	1471;1471;1431	A1L3U3;C9JQE6;O94911	.;.;ABCA8_HUMAN	S	1431;1471	ENSP00000269080:A1431S;ENSP00000402814:A1471S	ENSP00000269080:A1431S	A	-	1	0	ABCA8	64383429	1.000000	0.71417	0.986000	0.45419	0.872000	0.50106	5.577000	0.67444	2.441000	0.82636	0.650000	0.86243	GCC		ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	
GAS7	8522	broad.mit.edu	37	17	9828912	9828912	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr17:9828912C>T	ENST00000432992.2	-	11	1179	c.1019G>A	c.(1018-1020)cGg>cAg	p.R340Q	GAS7_ENST00000437099.2_Missense_Mutation_p.R276Q|GAS7_ENST00000580865.1_Missense_Mutation_p.R200Q|GAS7_ENST00000583882.1_Intron|GAS7_ENST00000540214.1_Intron|GAS7_ENST00000579158.1_Missense_Mutation_p.R276Q|GAS7_ENST00000542249.1_Missense_Mutation_p.R276Q|GAS7_ENST00000323816.4_Missense_Mutation_p.R280Q|GAS7_ENST00000396115.2_Intron|GAS7_ENST00000585266.1_Missense_Mutation_p.R280Q	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7	340					actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R340Q(2)|p.R200Q(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						GAGGGCTTTCCGGGCCTGGGG	0.617			T	MLL	AML*																																p.R200Q			Dom	yes		17	17p	8522	growth arrest-specific 7		L	.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G599A	17						.						107.0	88.0	95.0					17																	9828912		2203	4300	6503	9769637	SO:0001583	missense	8522	exon7			AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.1019G>A	17.37:g.9828912C>T	ENSP00000407552:p.Arg340Gln	Somatic		Unspecified	Illumina	Phase_I	9769637	NM_003644	A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Missense_Mutation	SNP	ENST00000432992.2	37	CCDS11152.1	.	.	.	.	.	.	.	.	.	.	C	34	5.389495	0.95988	.	.	ENSG00000007237	ENST00000323816;ENST00000396115;ENST00000437099;ENST00000432992;ENST00000537970;ENST00000541114	T	0.45276	0.9	4.73	4.73	0.59995	.	0.143577	0.47455	D	0.000226	T	0.43389	0.1245	N	0.19112	0.55	0.80722	D	1	D;D;D;D	0.76494	0.999;0.992;0.96;0.992	P;P;B;P	0.56751	0.805;0.46;0.44;0.543	T	0.26189	-1.0110	9	.	.	.	-4.3585	16.6524	0.85220	0.0:1.0:0.0:0.0	.	292;280;200;340	B7Z2L1;A8KAC2;O60861-2;O60861	.;.;.;GAS7_HUMAN	Q	340;280;279;200;280;154	ENSP00000379421:R280Q	.	R	-	2	0	GAS7	9769637	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.549000	0.82163	2.458000	0.83093	0.655000	0.94253	CGG		GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439883.1	NM_003644, NM_201432, NM_201433	
RNF213	57674	broad.mit.edu	37	17	78354648	78354648	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr17:78354648C>T	ENST00000582970.1	+	56	13801	c.13658C>T	c.(13657-13659)aCg>aTg	p.T4553M	RNF213_ENST00000336301.6_Missense_Mutation_p.T2626M|CTD-2047H16.4_ENST00000572151.1_RNA|CTD-2047H16.4_ENST00000575034.1_RNA|CTD-2047H16.4_ENST00000573394.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.T4602M	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4553					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T4602M(1)|p.T2626M(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCAGACAGAACGCAGACCGGC	0.602																																					p.T4602M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C13805T	17						.						125.0	126.0	125.0					17																	78354648		2203	4300	6503	75969243	SO:0001583	missense	57674	exon57			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.13658C>T	17.37:g.78354648C>T	ENSP00000464087:p.Thr4553Met	Somatic		Unspecified	Illumina	Phase_I	75969243	NM_020914	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	C	16.83	3.231563	0.58777	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T;T	0.27557	1.91;1.66	5.26	5.26	0.73747	.	0.060324	0.64402	D	0.000004	T	0.59473	0.2196	M	0.81497	2.545	0.39606	D	0.969809	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.994	T	0.65298	-0.6202	10	0.87932	D	0	.	17.2359	0.86998	0.0:1.0:0.0:0.0	.	4602;2626	C9JCP4;Q63HN8	.;RN213_HUMAN	M	4553;4602;2626	ENSP00000425956:T4553M;ENSP00000338218:T2626M	ENSP00000338218:T2626M	T	+	2	0	RNF213	75969243	1.000000	0.71417	0.938000	0.37757	0.005000	0.04900	6.106000	0.71511	2.728000	0.93425	0.655000	0.94253	ACG		RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
LSS	4047	broad.mit.edu	37	21	47626630	47626630	+	Missense_Mutation	SNP	C	C	T	rs199896537		TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr21:47626630C>T	ENST00000397728.3	-	16	1598	c.1520G>A	c.(1519-1521)cGt>cAt	p.R507H	LSS_ENST00000356396.4_Missense_Mutation_p.R507H|LSS_ENST00000457828.2_Missense_Mutation_p.R427H|LSS_ENST00000522411.1_Missense_Mutation_p.R496H	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)	507					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)	p.R507H(1)		cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					GTGCCCCCCACGCTTGGTCTC	0.607																																					p.R427H	Pancreas(114;955 2313 34923 50507)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1280A	21						.	C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	80.0	72.0	75.0		1520,1487,1280,1520	5.4	1.0	21		75	0,8600		0,0,4300	yes	missense,missense,missense,missense	LSS	NM_001001438.2,NM_001145436.1,NM_001145437.1,NM_002340.5	29,29,29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	507/733,496/722,427/653,507/733	47626630	1,13005	2203	4300	6503	46451058	SO:0001583	missense	4047	exon15			U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.1520G>A	21.37:g.47626630C>T	ENSP00000380837:p.Arg507His	Somatic		Unspecified	Illumina	Phase_I	46451058	NM_001145437	B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	Missense_Mutation	SNP	ENST00000397728.3	37	CCDS13733.1	.	.	.	.	.	.	.	.	.	.	C	36	5.674156	0.96764	2.27E-4	0.0	ENSG00000160285	ENST00000356396;ENST00000457828;ENST00000397728;ENST00000522411	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	5.44	5.44	0.79542	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.094753	0.64402	D	0.000001	T	0.65984	0.2744	H	0.96239	3.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.70716	0.97;0.934	T	0.77574	-0.2537	10	0.87932	D	0	.	19.2365	0.93862	0.0:1.0:0.0:0.0	.	496;507	E9PEI9;P48449	.;ERG7_HUMAN	H	507;427;507;496	ENSP00000348762:R507H;ENSP00000409191:R427H;ENSP00000380837:R507H;ENSP00000429133:R496H	ENSP00000348762:R507H	R	-	2	0	LSS	46451058	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.538000	0.82048	2.732000	0.93576	0.655000	0.94253	CGT		LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207274.2		
ITGAM	3684	broad.mit.edu	37	16	31283239	31283239	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr16:31283239C>A	ENST00000287497.8	+	7	705	c.630C>A	c.(628-630)aaC>aaA	p.N210K	ITGAM_ENST00000544665.3_Missense_Mutation_p.N210K			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	210	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)	p.N210K(1)		endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						ACAACCCTAACCCAAGATCAC	0.527																																					p.N210K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C630A	16						.						81.0	79.0	80.0					16																	31283239		1927	4154	6081	31190740	SO:0001583	missense	3684	exon7			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.630C>A	16.37:g.31283239C>A	ENSP00000287497:p.Asn210Lys	Somatic		Unspecified	Illumina	Phase_I	31190740	NM_000632	Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	37	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	C	8.996	0.978966	0.18812	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	D;D	0.82344	-1.6;-1.6	5.5	1.29	0.21616	von Willebrand factor, type A (3);	.	.	.	.	T	0.69628	0.3132	N	0.21508	0.67	0.09310	N	1	B;B	0.15930	0.015;0.015	B;B	0.17433	0.018;0.018	T	0.58814	-0.7570	9	0.52906	T	0.07	.	5.6306	0.17508	0.0:0.4974:0.29:0.2125	.	210;210	Q4VAK1;P11215	.;ITAM_HUMAN	K	210	ENSP00000441691:N210K;ENSP00000287497:N210K	ENSP00000287497:N210K	N	+	3	2	ITGAM	31190740	0.001000	0.12720	0.016000	0.15963	0.007000	0.05969	0.233000	0.17911	0.384000	0.24942	-0.218000	0.12543	AAC		ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632	
ESRP2	80004	broad.mit.edu	37	16	68266361	68266361	+	Silent	SNP	G	G	C	rs570243647		TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr16:68266361G>C	ENST00000565858.1	-	8	983	c.897C>G	c.(895-897)ggC>ggG	p.G299G	ESRP2_ENST00000473183.2_Silent_p.G289G	NM_024939.2	NP_079215.2	Q9H6T0	ESRP2_HUMAN	epithelial splicing regulatory protein 2	299	RRM 1.				mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G289G(2)		NS(1)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	16						TGAGGGCCTCGCCATTTCTGC	0.627																																					p.G289G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C867G	16						.						56.0	55.0	56.0					16																	68266361		2198	4300	6498	66823862	SO:0001819	synonymous_variant	80004	exon8			AK025571	CCDS10863.1	16q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000103067	ENSG00000103067		"""RNA binding motif (RRM) containing"""	26152	protein-coding gene	gene with protein product		612960	"""RNA binding motif protein 35B"""	RBM35B		12477932	Standard	NM_024939		Approved	FLJ21918	uc002evq.1	Q9H6T0	OTTHUMG00000137557	ENST00000565858.1:c.897C>G	16.37:g.68266361G>C		Somatic		Unspecified	Illumina	Phase_I	66823862	NM_024939	Q8N6H8|Q8WZ15|Q9H6I4	Silent	SNP	ENST00000565858.1	37																																																																																					ESRP2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000433083.1	NM_024939	
PHLPP1	23239	broad.mit.edu	37	18	60646088	60646088	+	Silent	SNP	C	C	G			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr18:60646088C>G	ENST00000262719.5	+	17	4812	c.4578C>G	c.(4576-4578)tcC>tcG	p.S1526S	PHLPP1_ENST00000400316.4_Silent_p.S1014S			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1526					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)	p.S1013S(1)		endometrium(2)|kidney(2)|lung(13)	17						TGTCCAACTCCTTCCAGCGCC	0.637																																					p.S1526S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4578G	18						.						44.0	47.0	46.0					18																	60646088		2118	4242	6360	58797068	SO:0001819	synonymous_variant	23239	exon17			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.4578C>G	18.37:g.60646088C>G		Somatic		Unspecified	Illumina	Phase_I	58797068	NM_194449	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Silent	SNP	ENST00000262719.5	37	CCDS45881.2																																																																																				PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	NM_194449	
ZNF407	55628	broad.mit.edu	37	18	72347113	72347113	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3893-01	TCGA-AG-3893-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr18:72347113A>T	ENST00000299687.5	+	1	4138	c.4138A>T	c.(4138-4140)Ata>Tta	p.I1380L	ZNF407_ENST00000582337.1_Missense_Mutation_p.I1380L|ZNF407_ENST00000577538.1_Missense_Mutation_p.I1380L|ZNF407_ENST00000309902.6_Missense_Mutation_p.I1380L	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1380					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.I1380L(1)		central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		AGAGGGCTTGATAGCAACGGG	0.458																																					p.I1380L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4138T	18						.						124.0	125.0	125.0					18																	72347113		1909	4127	6036	70476101	SO:0001583	missense	55628	exon1			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.4138A>T	18.37:g.72347113A>T	ENSP00000299687:p.Ile1380Leu	Somatic		Unspecified	Illumina	Phase_I	70476101	NM_001146190	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	37	CCDS45885.1	.	.	.	.	.	.	.	.	.	.	A	12.15	1.851266	0.32699	.	.	ENSG00000215421	ENST00000299687;ENST00000309902	T;T	0.08896	3.04;3.49	5.84	-11.7	0.00046	.	1.168720	0.05876	N	0.625545	T	0.02727	0.0082	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.55166	-0.8183	10	0.10111	T	0.7	.	4.7926	0.13256	0.2292:0.1638:0.4465:0.1605	.	1380;1380;1380	Q9C0G0-3;Q9C0G0-2;Q9C0G0	.;.;ZN407_HUMAN	L	1380	ENSP00000299687:I1380L;ENSP00000310359:I1380L	ENSP00000299687:I1380L	I	+	1	0	ZNF407	70476101	0.000000	0.05858	0.001000	0.08648	0.956000	0.61745	-1.103000	0.03329	0.984000	0.38629	0.533000	0.62120	ATA		ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757	
PTPRM	5797	broad.mit.edu	37	18	7926618	7926618	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr18:7926618G>C	ENST00000332175.8	+	5	1637	c.600G>C	c.(598-600)caG>caC	p.Q200H	PTPRM_ENST00000400060.4_Missense_Mutation_p.Q200H|PTPRM_ENST00000580170.1_Missense_Mutation_p.Q200H|PTPRM_ENST00000400053.4_Missense_Mutation_p.Q138H	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	200	Ig-like C2-type.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.Q200H(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				ATGCTGGCCAGTTTGCTACCT	0.453																																					p.Q200H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G600C	18						.						100.0	92.0	95.0					18																	7926618		2203	4300	6503	7916618	SO:0001583	missense	5797	exon5			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.600G>C	18.37:g.7926618G>C	ENSP00000331418:p.Gln200His	Somatic		Unspecified	Illumina	Phase_I	7916618	NM_002845	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	G	12.77	2.036170	0.35893	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053	T;T;T	0.23754	1.89;1.89;1.89	5.72	4.84	0.62591	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.49881	0.1583	M	0.68317	2.08	0.80722	D	1	D;D	0.62365	0.991;0.991	D;D	0.74348	0.983;0.983	T	0.51260	-0.8728	10	0.72032	D	0.01	.	15.6781	0.77344	0.1273:0.0:0.8727:0.0	.	200;200	A7MBN1;P28827	.;PTPRM_HUMAN	H	200;200;138	ENSP00000331418:Q200H;ENSP00000382933:Q200H;ENSP00000382927:Q138H	ENSP00000331418:Q200H	Q	+	3	2	PTPRM	7916618	1.000000	0.71417	1.000000	0.80357	0.096000	0.18686	3.104000	0.50306	0.785000	0.33685	-1.119000	0.02030	CAG		PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
PARD6G	84552	broad.mit.edu	37	18	77960793	77960793	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3893-01	TCGA-AG-3893-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr18:77960793A>G	ENST00000353265.3	-	2	292	c.95T>C	c.(94-96)tTc>tCc	p.F32S	AC139100.3_ENST00000588950.1_RNA|PARD6G_ENST00000470488.2_Missense_Mutation_p.F32S	NM_032510.3	NP_115899.1	Q9BYG4	PAR6G_HUMAN	par-6 family cell polarity regulator gamma	32	OPR.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.F32S(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	8		all_cancers(4;5.63e-22)|all_epithelial(4;5.86e-15)|all_lung(4;1.32e-05)|Ovarian(4;1.33e-05)|Lung NSC(4;2.77e-05)|Esophageal squamous(42;0.0157)|all_hematologic(56;0.13)|Melanoma(33;0.144)		Epithelial(2;1.48e-13)|all cancers(1;5.77e-13)|OV - Ovarian serous cystadenocarcinoma(15;2.74e-10)|BRCA - Breast invasive adenocarcinoma(31;0.00166)|STAD - Stomach adenocarcinoma(84;0.18)|Lung(128;0.23)		GTCCAGAGAGAACCTTCGGAA	0.463																																					p.F32S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T95C	18						.						64.0	61.0	62.0					18																	77960793		2203	4300	6503	76061784	SO:0001583	missense	84552	exon2				CCDS12022.1	18q23	2013-08-28	2013-08-28		ENSG00000178184	ENSG00000178184			16076	protein-coding gene	gene with protein product		608976	"""par-6 (partitioning defective 6, C.elegans) homolog gamma"", ""par-6 partitioning defective 6 homolog gamma (C. elegans)"""			11260256	Standard	NM_032510		Approved	PAR-6G, PAR6gamma	uc002lny.3	Q9BYG4	OTTHUMG00000132922	ENST00000353265.3:c.95T>C	18.37:g.77960793A>G	ENSP00000343144:p.Phe32Ser	Somatic		Unspecified	Illumina	Phase_I	76061784	NM_032510	A8QM57	Missense_Mutation	SNP	ENST00000353265.3	37	CCDS12022.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.598339	0.87055	.	.	ENSG00000178184	ENST00000353265	T	0.30182	1.54	5.43	5.43	0.79202	Phox/Bem1p (2);	0.000000	0.85682	D	0.000000	T	0.58779	0.2146	M	0.84219	2.685	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.87578	0.939;0.998	T	0.63274	-0.6674	9	.	.	.	-36.6998	14.5927	0.68378	1.0:0.0:0.0:0.0	.	32;32	A8QM57;Q9BYG4	.;PAR6G_HUMAN	S	32	ENSP00000343144:F32S	.	F	-	2	0	PARD6G	76061784	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.931000	0.87625	2.282000	0.76494	0.533000	0.62120	TTC		PARD6G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256435.2	NM_032510	
ACKR4	51554	broad.mit.edu	37	3	132319843	132319843	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3893-01	TCGA-AG-3893-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr3:132319843A>T	ENST00000249887.2	+	2	698	c.602A>T	c.(601-603)cAa>cTa	p.Q201L	ACAD11_ENST00000355458.3_Intron|ACAD11_ENST00000264990.6_Intron|ACAD11_ENST00000545291.1_Intron	NM_016557.2|NM_178445.2	NP_057641.1|NP_848540.1	Q9NPB9	ACKR4_HUMAN	atypical chemokine receptor 4	201					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)	p.Q201L(1)									GCATTGATTCAAATGCTAGAG	0.408																																					p.Q201L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A602T	3						.						20.0	20.0	20.0					3																	132319843		2200	4294	6494	133802533	SO:0001583	missense	51554	exon1			AF110640	CCDS3075.1	3q22	2013-07-17	2013-07-16	2013-07-16	ENSG00000129048	ENSG00000129048		"""GPCR / Class A : Chemokine receptors : Atypical"""	1611	protein-coding gene	gene with protein product		606065	"""chemokine (C-C motif) receptor-like 1"""	CCRL1		10767544, 16148	Standard	NM_016557		Approved	CCR11, CCBP2, VSHK1, CCX-CKR, PPR1	uc003eow.3	Q9NPB9	OTTHUMG00000159768	ENST00000249887.2:c.602A>T	3.37:g.132319843A>T	ENSP00000249887:p.Gln201Leu	Somatic		Unspecified	Illumina	Phase_I	133802533	NM_178445	B2R9U7	Missense_Mutation	SNP	ENST00000249887.2	37	CCDS3075.1	.	.	.	.	.	.	.	.	.	.	A	0.906	-0.720526	0.03182	.	.	ENSG00000129048	ENST00000249887;ENST00000424114	T	0.34859	1.34	5.66	4.5	0.54988	GPCR, rhodopsin-like superfamily (1);	0.227351	0.45867	D	0.000332	T	0.25005	0.0607	N	0.26042	0.785	0.44719	D	0.997715	P	0.49253	0.921	B	0.39935	0.314	T	0.02042	-1.1224	10	0.42905	T	0.14	.	11.4514	0.50156	0.9294:0.0:0.0706:0.0	.	201	Q9NPB9	CCRL1_HUMAN	L	201	ENSP00000249887:Q201L	ENSP00000249887:Q201L	Q	+	2	0	CCRL1	133802533	1.000000	0.71417	0.847000	0.33407	0.275000	0.26752	3.391000	0.52530	0.977000	0.38444	0.533000	0.62120	CAA		ACKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357238.2	NM_016557	
SETD5	55209	broad.mit.edu	37	3	9516836	9516836	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3893-01	TCGA-AG-3893-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr3:9516836A>G	ENST00000406341.1	+	21	3906	c.3716A>G	c.(3715-3717)tAc>tGc	p.Y1239C	SETD5_ENST00000407969.1_Missense_Mutation_p.Y1258C|SETD5_ENST00000402198.1_Missense_Mutation_p.Y1239C|SETD5_ENST00000302463.6_Missense_Mutation_p.Y1141C|SETD5_ENST00000402466.1_Missense_Mutation_p.Y1141C			Q9C0A6	SETD5_HUMAN	SET domain containing 5	1239	Ser-rich.							p.Y1239C(1)|p.Y1141C(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		AGATACAGCTACCAGGTGAGA	0.478																																					p.Y1239C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A3716G	3						.						49.0	46.0	47.0					3																	9516836		1941	4148	6089	9491836	SO:0001583	missense	55209	exon22			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.3716A>G	3.37:g.9516836A>G	ENSP00000383939:p.Tyr1239Cys	Somatic		Unspecified	Illumina	Phase_I	9491836	NM_001080517	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	ENST00000406341.1	37	CCDS46741.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.238400	0.79800	.	.	ENSG00000168137	ENST00000402198;ENST00000402466;ENST00000406341;ENST00000407969;ENST00000302463	D;D;D;D;D	0.92805	-2.78;-3.11;-2.78;-2.76;-3.11	5.76	5.76	0.90799	.	0.155285	0.46145	D	0.000305	D	0.93148	0.7818	L	0.27053	0.805	0.40588	D	0.981466	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.998;0.994	D	0.94086	0.7348	10	0.52906	T	0.07	-9.6189	16.0843	0.81031	1.0:0.0:0.0:0.0	.	908;1141;1239	B3KXG4;Q9C0A6-3;Q9C0A6	.;.;SETD5_HUMAN	C	1239;1141;1239;1258;1141	ENSP00000385852:Y1239C;ENSP00000384429:Y1141C;ENSP00000383939:Y1239C;ENSP00000384114:Y1258C;ENSP00000302028:Y1141C	ENSP00000302028:Y1141C	Y	+	2	0	SETD5	9491836	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.668000	0.74457	2.191000	0.70037	0.533000	0.62120	TAC		SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614	
SCN10A	6336	broad.mit.edu	37	3	38740002	38740002	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr3:38740002G>A	ENST00000449082.2	-	27	4708	c.4709C>T	c.(4708-4710)aCg>aTg	p.T1570M		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1570					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.T1570M(3)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TCTGAAGAGCGTTGGGGAGAA	0.483																																					p.T1570M												.	.	3	Substitution - Missense(3)	large_intestine(2)|central_nervous_system(1)	c.C4709T	3						.						67.0	68.0	68.0					3																	38740002		2203	4300	6503	38715006	SO:0001583	missense	6336	exon27			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.4709C>T	3.37:g.38740002G>A	ENSP00000390600:p.Thr1570Met	Somatic		Unspecified	Illumina	Phase_I	38715006	NM_006514	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.924514	0.52653	.	.	ENSG00000185313	ENST00000449082	D	0.97575	-4.44	5.21	5.21	0.72293	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99108	0.9693	H	0.97291	3.975	0.58432	D	0.999998	D	0.89917	1.0	D	0.77557	0.99	D	0.99091	1.0840	10	0.87932	D	0	.	18.9486	0.92632	0.0:0.0:1.0:0.0	.	1570	Q9Y5Y9	SCNAA_HUMAN	M	1570	ENSP00000390600:T1570M	ENSP00000390600:T1570M	T	-	2	0	SCN10A	38715006	1.000000	0.71417	0.102000	0.21198	0.303000	0.27691	7.716000	0.84723	2.713000	0.92767	0.655000	0.94253	ACG		SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
CADPS	8618	broad.mit.edu	37	3	62423781	62423781	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr3:62423781C>A	ENST00000383710.4	-	28	4124	c.3775G>T	c.(3775-3777)Gat>Tat	p.D1259Y	CADPS_ENST00000283269.9_Missense_Mutation_p.D1220Y|CADPS_ENST00000357948.3_Missense_Mutation_p.D1180Y	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	1259	Mediates targeting and association with DCVs. {ECO:0000250}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.D1220Y(1)|p.D1259Y(1)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TTACTTACATCAAATAACCTT	0.453																																					p.D1180Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3538T	3						.						80.0	75.0	77.0					3																	62423781		2203	4300	6503	62398821	SO:0001583	missense	8618	exon25			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.3775G>T	3.37:g.62423781C>A	ENSP00000373215:p.Asp1259Tyr	Somatic		Unspecified	Illumina	Phase_I	62398821	NM_183393	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	CCDS46858.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	20.1|20.1|20.1	3.932276|3.932276|3.932276	0.73442|0.73442|0.73442	.|.|.	.|.|.	ENSG00000163618|ENSG00000163618|ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269|ENST00000473635|ENST00000466621	T;T;T|.|.	0.32023|.|.	1.47;1.47;1.47|.|.	5.65|5.65|5.65	5.65|5.65|5.65	0.86999|0.86999|0.86999	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|.	0.76688|0.76688|.	0.4022|0.4022|.	M|M|M	0.72118|0.72118|0.72118	2.19|2.19|2.19	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;D;D|.|.	0.89917|.|.	0.999;1.0;0.976;0.996|.|.	D;D;P;D|.|.	0.85130|.|.	0.967;0.997;0.726;0.959|.|.	T|T|.	0.74748|0.74748|.	-0.3560|-0.3560|.	10|5|.	0.87932|.|.	D|.|.	0|.|.	.|.|.	19.7806|19.7806|19.7806	0.96414|0.96414|0.96414	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	1180;1220;1259;1264|.|.	Q9ULU8-2;Q9ULU8-3;Q9ULU8;Q9ULU8-4|.|.	.;.;CAPS1_HUMAN;.|.|.	Y|F|L	1265;1259;1180;1220|250|159	ENSP00000373215:D1259Y;ENSP00000350632:D1180Y;ENSP00000283269:D1220Y|.|.	ENSP00000283269:D1220Y|.|.	D|L|X	-|-|-	1|3|2	0|2|2	CADPS|CADPS|CADPS	62398821|62398821|62398821	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.999000|0.999000|0.999000	0.98932|0.98932|0.98932	7.770000|7.770000|7.770000	0.85390|0.85390|0.85390	2.668000|2.668000|2.668000	0.90789|0.90789|0.90789	0.644000|0.644000|0.644000	0.83932|0.83932|0.83932	GAT|TTG|TGA		CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
IQCG	84223	broad.mit.edu	37	3	197670674	197670674	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3893-01	TCGA-AG-3893-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr3:197670674T>C	ENST00000265239.6	-	4	681	c.257A>G	c.(256-258)tAc>tGc	p.Y86C	IQCG_ENST00000455191.1_Missense_Mutation_p.Y86C|IQCG_ENST00000453254.1_Missense_Mutation_p.Y86C|IQCG_ENST00000480302.1_5'UTR	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G	86						extracellular vesicular exosome (GO:0070062)		p.Y86C(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		TCTCCCTTCGTACTGAACGGG	0.458																																					p.Y86C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A257G	3						.						140.0	138.0	138.0					3																	197670674		2203	4300	6503	199155071	SO:0001583	missense	84223	exon4			AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.257A>G	3.37:g.197670674T>C	ENSP00000265239:p.Tyr86Cys	Somatic		Unspecified	Illumina	Phase_I	199155071	NM_032263	Q9BST2|Q9HAG8	Missense_Mutation	SNP	ENST00000265239.6	37	CCDS3331.1	.	.	.	.	.	.	.	.	.	.	T	15.68	2.906336	0.52333	.	.	ENSG00000114473	ENST00000265239;ENST00000455191;ENST00000453254;ENST00000416896	T;T;T;T	0.57595	0.39;0.39;0.93;0.93	5.4	-0.499	0.12015	.	0.249234	0.29616	N	0.011656	T	0.65123	0.2661	M	0.76002	2.32	0.09310	N	1	D;D	0.76494	0.999;0.998	D;P	0.65443	0.935;0.847	T	0.58702	-0.7590	10	0.48119	T	0.1	-1.0614	10.8036	0.46504	0.5025:0.0:0.0:0.4975	.	86;86	C9JKX8;Q9H095	.;IQCG_HUMAN	C	86;86;86;67	ENSP00000265239:Y86C;ENSP00000407736:Y86C;ENSP00000389897:Y86C;ENSP00000406411:Y67C	ENSP00000265239:Y86C	Y	-	2	0	IQCG	199155071	0.034000	0.19679	0.040000	0.18447	0.003000	0.03518	0.632000	0.24583	0.004000	0.14682	-0.516000	0.04426	TAC		IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339730.1	NM_032263	
KCNA1	3736	broad.mit.edu	37	12	5021087	5021087	+	Silent	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr12:5021087C>T	ENST00000382545.3	+	2	1650	c.543C>T	c.(541-543)atC>atT	p.I181I	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	181					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.I181I(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	TCATCTCCATCGTCATCTTTT	0.597																																					p.I181I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C543T	12						.						89.0	85.0	86.0					12																	5021087		2203	4300	6503	4891348	SO:0001819	synonymous_variant	3736	exon2			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.543C>T	12.37:g.5021087C>T		Somatic		Unspecified	Illumina	Phase_I	4891348	NM_000217	A6NM83|Q3MIQ9	Silent	SNP	ENST00000382545.3	37	CCDS8535.1																																																																																				KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217	
LAG3	3902	broad.mit.edu	37	12	6884504	6884504	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr12:6884504C>T	ENST00000203629.2	+	5	1180	c.847C>T	c.(847-849)Cgc>Tgc	p.R283C	LAG3_ENST00000441671.2_Missense_Mutation_p.R283C	NM_002286.5	NP_002277.4	P18627	LAG3_HUMAN	lymphocyte-activation gene 3	283	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell activation (GO:0050868)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|MHC class II protein binding (GO:0042289)|transmembrane signaling receptor activity (GO:0004888)	p.R283C(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						GCTGCCCTGCCGCCTGCCTGC	0.607																																					p.R283C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C847T	12						.						79.0	84.0	82.0					12																	6884504		2203	4300	6503	6754765	SO:0001583	missense	3902	exon5				CCDS8561.1	12p13.3	2013-01-11			ENSG00000089692	ENSG00000089692		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6476	protein-coding gene	gene with protein product		153337					Standard	NM_002286		Approved	CD223	uc001qqt.4	P18627	OTTHUMG00000169197	ENST00000203629.2:c.847C>T	12.37:g.6884504C>T	ENSP00000203629:p.Arg283Cys	Somatic		Unspecified	Illumina	Phase_I	6754765	NM_002286	A8K7T9|Q7Z643	Missense_Mutation	SNP	ENST00000203629.2	37	CCDS8561.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.826486	0.71143	.	.	ENSG00000089692	ENST00000441671;ENST00000203629	T;T	0.13196	2.61;2.61	5.55	5.55	0.83447	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.692253	0.14181	N	0.336059	T	0.30479	0.0766	L	0.54323	1.7	0.38867	D	0.956607	D;D	0.76494	0.997;0.999	P;P	0.60609	0.828;0.877	T	0.00795	-1.1563	10	0.46703	T	0.11	-7.5573	15.0046	0.71501	0.0:1.0:0.0:0.0	.	283;283	P18627;Q7Z643	LAG3_HUMAN;.	C	283	ENSP00000413825:R283C;ENSP00000203629:R283C	ENSP00000203629:R283C	R	+	1	0	LAG3	6754765	0.108000	0.22018	0.968000	0.41197	0.638000	0.38207	0.361000	0.20267	2.623000	0.88846	0.462000	0.41574	CGC		LAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402846.1		
CALCOCO1	57658	broad.mit.edu	37	12	54110049	54110049	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr12:54110049G>A	ENST00000550804.1	-	8	1060	c.1000C>T	c.(1000-1002)Cgg>Tgg	p.R334W	CALCOCO1_ENST00000548263.1_Missense_Mutation_p.R334W|CALCOCO1_ENST00000262059.4_Missense_Mutation_p.R334W|CALCOCO1_ENST00000430117.2_Intron			Q9P1Z2	CACO1_HUMAN	calcium binding and coiled-coil domain 1	334					intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)	p.R334W(1)		NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	28						CTCACCACCCGCTGCTGGGCC	0.577																																					p.R334W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1000T	12						.						83.0	75.0	78.0					12																	54110049		2203	4300	6503	52396316	SO:0001583	missense	57658	exon8			AL136895	CCDS8864.1, CCDS44908.1	12q13.13	2014-01-02			ENSG00000012822	ENSG00000012822			29306	protein-coding gene	gene with protein product	"""coiled-coil leucine zipper coactivator 1"", ""inorganic pyrophosphatase activator"""					10819331, 11230166	Standard	NM_020898		Approved	KIAA1536, calphoglin, Cocoa	uc001sef.3	Q9P1Z2	OTTHUMG00000170095	ENST00000550804.1:c.1000C>T	12.37:g.54110049G>A	ENSP00000449960:p.Arg334Trp	Somatic		Unspecified	Illumina	Phase_I	52396316	NM_020898	B3KVA8|Q6FI59|Q71RC3|Q86WF8|Q96JU3|Q9H090	Missense_Mutation	SNP	ENST00000550804.1	37	CCDS8864.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121726	0.56613	.	.	ENSG00000012822	ENST00000342760;ENST00000262059;ENST00000413257;ENST00000548263;ENST00000550804;ENST00000549935;ENST00000454332	T;T;T	0.10668	2.85;2.85;2.85	4.78	3.79	0.43588	.	0.415778	0.18263	N	0.146576	T	0.07818	0.0196	N	0.08118	0	0.28894	N	0.893688	D;P;P;P	0.56035	0.974;0.894;0.894;0.913	B;B;B;P	0.47206	0.438;0.406;0.406;0.541	T	0.07481	-1.0770	10	0.72032	D	0.01	-12.1252	9.7553	0.40500	0.0:0.0:0.7144:0.2856	.	327;334;334;334	B4DG60;Q9P1Z2-3;Q9P1Z2-2;Q9P1Z2	.;.;.;CACO1_HUMAN	W	11;334;272;334;334;327;211	ENSP00000262059:R334W;ENSP00000447647:R334W;ENSP00000449960:R334W	ENSP00000262059:R334W	R	-	1	2	CALCOCO1	52396316	0.995000	0.38212	0.998000	0.56505	0.953000	0.61014	1.430000	0.34914	1.161000	0.42604	0.655000	0.94253	CGG		CALCOCO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407233.2	NM_020898	
MBD6	114785	broad.mit.edu	37	12	57921641	57921642	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-AG-3893-01	TCGA-AG-3893-01			TT	-	TT	TT	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr12:57921641_57921642delTT	ENST00000355673.3	+	9	2603_2604	c.2247_2248delTT	c.(2245-2250)tcttcafs	p.SS749fs	MBD6_ENST00000431731.2_Frame_Shift_Del_p.SS749fs	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	749	Pro-rich.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.S750fs*42(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						GTGACCTGTCTTCACTGACCAG	0.579																																					p.749_750del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2247_2248del	12						.																																			56207909	SO:0001589	frameshift_variant	114785	exon9			AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.2247_2248delTT	12.37:g.57921641_57921642delTT	ENSP00000347896:p.Ser749fs	Somatic		Unspecified	Illumina	Phase_I	56207908	NM_052897	Q8N3M0|Q8NA81|Q96Q00	Frame_Shift_Del	DEL	ENST00000355673.3	37	CCDS8944.1																																																																																				MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407250.1		
TBX5	6910	broad.mit.edu	37	12	114804048	114804048	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr12:114804048G>T	ENST00000310346.4	-	8	1570	c.904C>A	c.(904-906)Cag>Aag	p.Q302K	TBX5_ENST00000349716.5_Missense_Mutation_p.Q252K|TBX5_ENST00000405440.2_Missense_Mutation_p.Q302K|TBX5_ENST00000526441.1_Missense_Mutation_p.Q302K	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	302					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.Q302K(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		AGGAGGTCCTGGGAGGGGCCG	0.557																																					p.Q302K	NSCLC(152;1358 1980 4050 23898 40356)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C904A	12						.						116.0	102.0	107.0					12																	114804048		2203	4300	6503	113288431	SO:0001583	missense	6910	exon8			U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.904C>A	12.37:g.114804048G>T	ENSP00000309913:p.Gln302Lys	Somatic		Unspecified	Illumina	Phase_I	113288431	NM_000192	A6ND77|O15301|Q96TB0|Q9Y4I2	Missense_Mutation	SNP	ENST00000310346.4	37	CCDS9173.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.256528	0.80246	.	.	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000448888;ENST00000405440;ENST00000526441	T;T;T;D	0.87179	0.98;0.98;0.98;-2.22	5.62	4.72	0.59763	.	0.113864	0.64402	D	0.000008	D	0.91546	0.7330	M	0.80746	2.51	0.58432	D	0.999996	P;P	0.50528	0.936;0.817	P;B	0.56127	0.792;0.169	D	0.90187	0.4247	10	0.24483	T	0.36	.	16.0386	0.80648	0.0:0.0:0.865:0.135	.	302;302	Q99593-2;Q99593	.;TBX5_HUMAN	K	252;302;199;302;302	ENSP00000337723:Q252K;ENSP00000309913:Q302K;ENSP00000384152:Q302K;ENSP00000433292:Q302K	ENSP00000309913:Q302K	Q	-	1	0	TBX5	113288431	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.609000	0.82925	1.357000	0.45904	0.655000	0.94253	CAG		TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	NM_080717	
SPINT1	6692	broad.mit.edu	37	15	41137042	41137042	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr15:41137042G>T	ENST00000344051.4	+	2	524	c.290G>T	c.(289-291)tGc>tTc	p.C97F	RP11-532F12.5_ENST00000564302.1_RNA|RP11-532F12.5_ENST00000565315.1_RNA|SPINT1_ENST00000431806.1_Missense_Mutation_p.C97F|SPINT1_ENST00000562057.1_Missense_Mutation_p.C97F|RP11-532F12.5_ENST00000568419.1_RNA|RP11-532F12.5_ENST00000568525.1_RNA			O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	97	MANSC. {ECO:0000255|PROSITE- ProRule:PRU00341}.				branching involved in labyrinthine layer morphogenesis (GO:0060670)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|placenta blood vessel development (GO:0060674)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.C97F(1)		central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	16		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		ACCCAGAACTGCAACTTGGCG	0.662																																					p.C97F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G290T	15						.						32.0	31.0	31.0					15																	41137042		2203	4299	6502	38924334	SO:0001583	missense	6692	exon2				CCDS10067.1, CCDS45231.1	15q13.3	2008-02-05	2005-08-17		ENSG00000166145	ENSG00000166145			11246	protein-coding gene	gene with protein product		605123	"""serine protease inhibitor, Kunitz type 1"""				Standard	XM_006720657		Approved	HAI, MANSC2	uc001zna.3	O43278	OTTHUMG00000130068	ENST00000344051.4:c.290G>T	15.37:g.41137042G>T	ENSP00000342098:p.Cys97Phe	Somatic		Unspecified	Illumina	Phase_I	38924334	NM_003710	Q7Z7D2	Missense_Mutation	SNP	ENST00000344051.4	37	CCDS10067.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.671079	0.88348	.	.	ENSG00000166145	ENST00000344051;ENST00000536281;ENST00000431806	T;T	0.56444	0.46;0.46	4.98	4.98	0.66077	Seven cysteines (1);Seven cysteines, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.76630	0.4014	M	0.85777	2.775	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.81174	-0.1053	10	0.87932	D	0	-28.9488	18.6124	0.91290	0.0:0.0:1.0:0.0	.	97;97;97	B2RBU9;O43278-2;O43278	.;.;SPIT1_HUMAN	F	97;64;97	ENSP00000342098:C97F;ENSP00000409935:C97F	ENSP00000342098:C97F	C	+	2	0	SPINT1	38924334	1.000000	0.71417	0.996000	0.52242	0.850000	0.48378	9.721000	0.98766	2.471000	0.83476	0.563000	0.77884	TGC		SPINT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252359.2	NM_003710	
UNC13C	440279	broad.mit.edu	37	15	54590085	54590085	+	Silent	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr15:54590085G>A	ENST00000260323.11	+	11	4065	c.4065G>A	c.(4063-4065)aaG>aaA	p.K1355K	UNC13C_ENST00000545554.1_Silent_p.K1355K|UNC13C_ENST00000537900.1_Silent_p.K1353K	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1355					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.K1355K(2)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GAGAAGAGAAGGTTGCTCCAT	0.313																																					p.K1355K												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G4065A	15						.						74.0	71.0	72.0					15																	54590085		1840	4082	5922	52377377	SO:0001819	synonymous_variant	440279	exon10			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.4065G>A	15.37:g.54590085G>A		Somatic		Unspecified	Illumina	Phase_I	52377377	NM_001080534	Q0P613|Q8ND48|Q96NP3	Silent	SNP	ENST00000260323.11	37	CCDS45264.1																																																																																				UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
AQP9	366	broad.mit.edu	37	15	58467220	58467220	+	Silent	SNP	C	C	T	rs562183896		TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr15:58467220C>T	ENST00000219919.4	+	4	850	c.480C>T	c.(478-480)aaC>aaT	p.N160N	AQP9_ENST00000558772.1_Silent_p.N95N|AQP9_ENST00000536493.1_Silent_p.N160N|ALDH1A2_ENST00000558231.1_Intron	NM_020980.3	NP_066190.2	O43315	AQP9_HUMAN	aquaporin 9	160					amine transport (GO:0015837)|canalicular bile acid transport (GO:0015722)|carboxylic acid transport (GO:0046942)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|glycerol transport (GO:0015793)|immune response (GO:0006955)|metabolic process (GO:0008152)|polyol transport (GO:0015791)|purine nucleobase transport (GO:0006863)|pyrimidine nucleobase transport (GO:0015855)|pyrimidine-containing compound transmembrane transport (GO:0072531)|response to mercury ion (GO:0046689)|response to organic substance (GO:0010033)|response to osmotic stress (GO:0006970)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water homeostasis (GO:0030104)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carboxylic acid transmembrane transporter activity (GO:0046943)|glycerol channel activity (GO:0015254)|polyol transmembrane transporter activity (GO:0015166)|porin activity (GO:0015288)|purine nucleobase transmembrane transporter activity (GO:0005345)|pyrimidine nucleobase transmembrane transporter activity (GO:0005350)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.N160N(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)	21				GBM - Glioblastoma multiforme(80;0.16)		CTCTGGCGAACGCATTTGCAG	0.418													c|||	1	0.000199681	0.0	0.0014	5008	,	,		22102	0.0		0.0	False		,,,				2504	0.0				p.N160N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C480T	15						.						144.0	130.0	135.0					15																	58467220		2192	4292	6484	56254512	SO:0001819	synonymous_variant	366	exon4			AF016495	CCDS10165.1	15q	2005-09-20			ENSG00000103569	ENSG00000103569		"""Ion channels / Aquaporins"""	643	protein-coding gene	gene with protein product		602914					Standard	NM_020980		Approved	SSC1, HsT17287	uc002aez.2	O43315	OTTHUMG00000132631	ENST00000219919.4:c.480C>T	15.37:g.58467220C>T		Somatic		Unspecified	Illumina	Phase_I	56254512	NM_020980	Q9NP32	Silent	SNP	ENST00000219919.4	37	CCDS10165.1																																																																																				AQP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255878.2	NM_020980	
C4orf17	84103	broad.mit.edu	37	4	100443847	100443847	+	Silent	SNP	G	G	A	rs376797865		TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr4:100443847G>A	ENST00000326581.4	+	3	680	c.318G>A	c.(316-318)gtG>gtA	p.V106V	C4orf17_ENST00000503257.1_3'UTR|C4orf17_ENST00000514652.1_Silent_p.V106V	NM_032149.2	NP_115525.2	Q53FE4	CD017_HUMAN	chromosome 4 open reading frame 17	106								p.V106V(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|prostate(1)|urinary_tract(3)	18				OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)		GTGCCAAAGTGCCTCCACGGC	0.498																																					p.V106V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G318A	4						.	G		0,4406		0,0,2203	60.0	59.0	59.0		318	3.5	0.0	4		59	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C4orf17	NM_032149.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		106/360	100443847	1,13005	2203	4300	6503	100662870	SO:0001819	synonymous_variant	84103	exon3			AL136838	CCDS3649.1	4q23	2008-02-05			ENSG00000138813	ENSG00000138813			25274	protein-coding gene	gene with protein product						11230166	Standard	NM_032149		Approved	DKFZP434G072	uc003huw.3	Q53FE4	OTTHUMG00000131027	ENST00000326581.4:c.318G>A	4.37:g.100443847G>A		Somatic		Unspecified	Illumina	Phase_I	100662870	NM_032149	Q6FI84|Q6IS77|Q8NA78|Q9H0D9	Silent	SNP	ENST00000326581.4	37	CCDS3649.1																																																																																				C4orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253670.2	NM_032149	
FAT4	79633	broad.mit.edu	37	4	126412296	126412296	+	Silent	SNP	G	G	T			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr4:126412296G>T	ENST00000394329.3	+	17	14332	c.14319G>T	c.(14317-14319)ccG>ccT	p.P4773P	FAT4_ENST00000335110.5_Silent_p.P3014P	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4773	Necessary and sufficient for interaction with MPDZ. {ECO:0000250}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P4716P(1)|p.P4773P(1)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TAAAGCAGCCGATTGGGCAGA	0.517																																					p.P4773P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G14319T	4						.						47.0	49.0	48.0					4																	126412296		2203	4300	6503	126631746	SO:0001819	synonymous_variant	79633	exon17			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.14319G>T	4.37:g.126412296G>T		Somatic		Unspecified	Illumina	Phase_I	126631746	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																				FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
PCDH10	57575	broad.mit.edu	37	4	134072612	134072612	+	Silent	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr4:134072612C>T	ENST00000264360.5	+	1	2143	c.1317C>T	c.(1315-1317)ggC>ggT	p.G439G	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	439	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G439G(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		GGGACCGGGGCGAGCCTGCGC	0.587																																					p.G439G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1317T	4						.						91.0	103.0	99.0					4																	134072612		2203	4300	6503	134292062	SO:0001819	synonymous_variant	57575	exon1			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1317C>T	4.37:g.134072612C>T		Somatic		Unspecified	Illumina	Phase_I	134292062	NM_032961	Q4W5F6|Q96SF0	Silent	SNP	ENST00000264360.5	37	CCDS34063.1																																																																																				PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
TLL1	7092	broad.mit.edu	37	4	166915629	166915629	+	Missense_Mutation	SNP	C	C	T	rs115824698	byFrequency	TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr4:166915629C>T	ENST00000061240.2	+	4	1105	c.458C>T	c.(457-459)aCg>aTg	p.T153M	TLL1_ENST00000507499.1_Missense_Mutation_p.T153M|TLL1_ENST00000513213.1_Missense_Mutation_p.T153M	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	153	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T153M(2)|p.T153K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		ACATCAAGAACGGAAAGAATA	0.413													C|||	4	0.000798722	0.0	0.0	5008	,	,		16422	0.004		0.0	False		,,,				2504	0.0				p.T153M												.	.	3	Substitution - Missense(3)	large_intestine(2)|kidney(1)	c.C458T	4						.	C	MET/THR,MET/THR	0,4406		0,0,2203	72.0	71.0	71.0		458,458	5.5	1.0	4	dbSNP_132	71	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	TLL1	NM_001204760.1,NM_012464.4	81,81	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging	153/393,153/1014	166915629	2,13004	2203	4300	6503	167135079	SO:0001583	missense	7092	exon4			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.458C>T	4.37:g.166915629C>T	ENSP00000061240:p.Thr153Met	Somatic		Unspecified	Illumina	Phase_I	167135079	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	C	16.45	3.125917	0.56721	0.0	2.33E-4	ENSG00000038295	ENST00000061240;ENST00000507499;ENST00000513213;ENST00000506144	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	5.51	5.51	0.81932	Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.063495	0.64402	U	0.000005	T	0.51873	0.1700	N	0.19112	0.55	0.54753	D	0.999987	D;D	0.76494	0.998;0.999	P;P	0.51016	0.585;0.656	T	0.61322	-0.7086	10	0.51188	T	0.08	.	19.4226	0.94727	0.0:1.0:0.0:0.0	.	153;153	E9PD25;O43897	.;TLL1_HUMAN	M	153;153;153;53	ENSP00000061240:T153M;ENSP00000426082:T153M;ENSP00000422937:T153M;ENSP00000423748:T53M	ENSP00000061240:T153M	T	+	2	0	TLL1	167135079	1.000000	0.71417	0.961000	0.40146	0.002000	0.02628	6.005000	0.70716	2.593000	0.87608	0.655000	0.94253	ACG		TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
SMR3A	26952	broad.mit.edu	37	4	71232569	71232569	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr4:71232569G>T	ENST00000226460.4	+	3	359	c.263G>T	c.(262-264)aGa>aTa	p.R88I		NM_012390.3	NP_036522.3	Q99954	SMR3A_HUMAN	submaxillary gland androgen regulated protein 3A	88	Pro-rich.					extracellular region (GO:0005576)		p.R88I(1)		endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)	15		all_hematologic(202;0.196)				GGTCCAGGGAGAATTCAATCA	0.552																																					p.R88I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G263T	4						.						177.0	158.0	164.0					4																	71232569		2203	4300	6503	71267158	SO:0001583	missense	26952	exon3			D89501	CCDS34000.1	4q13.3	2009-04-17	2008-02-27	2005-02-07	ENSG00000109208	ENSG00000109208			19216	protein-coding gene	gene with protein product			"""proline rich 5 (salivary)"", ""submaxillary gland androgen regulated protein 3 homolog A (mouse)"""	PROL5		9354371, 17512016	Standard	NM_012390		Approved	PBI, PRL5	uc003hfg.1	Q99954	OTTHUMG00000160839	ENST00000226460.4:c.263G>T	4.37:g.71232569G>T	ENSP00000226460:p.Arg88Ile	Somatic		Unspecified	Illumina	Phase_I	71267158	NM_012390		Missense_Mutation	SNP	ENST00000226460.4	37	CCDS34000.1	.	.	.	.	.	.	.	.	.	.	G	5.099	0.203993	0.09704	.	.	ENSG00000109208	ENST00000226460	T	0.27890	1.64	3.25	0.151	0.14888	.	.	.	.	.	T	0.15782	0.0380	N	0.14661	0.345	0.09310	N	1	B	0.27229	0.172	B	0.25140	0.058	T	0.30621	-0.9972	9	0.20046	T	0.44	.	8.9647	0.35869	0.0:0.0:0.3668:0.6332	.	88	Q99954	SMR3A_HUMAN	I	88	ENSP00000226460:R88I	ENSP00000226460:R88I	R	+	2	0	SMR3A	71267158	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.136000	0.10405	-0.006000	0.14370	-0.397000	0.06425	AGA		SMR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362574.1	NM_012390	
AMBN	258	broad.mit.edu	37	4	71472251	71472251	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr4:71472251C>T	ENST00000322937.6	+	13	1251	c.1148C>T	c.(1147-1149)gCt>gTt	p.A383V	AMBN_ENST00000449493.2_Missense_Mutation_p.A368V	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	383				A -> V (in Ref. 3; AAG35772). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)	p.A383V(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			CCAGCAGCTGCTGACCCACTG	0.557																																					p.A383V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1148T	4						.						67.0	66.0	66.0					4																	71472251		2203	4300	6503	71506840	SO:0001583	missense	258	exon13			AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.1148C>T	4.37:g.71472251C>T	ENSP00000313809:p.Ala383Val	Somatic		Unspecified	Illumina	Phase_I	71506840	NM_016519	Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	ENST00000322937.6	37	CCDS3543.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.006410	0.54361	.	.	ENSG00000178522	ENST00000322937;ENST00000538728;ENST00000449493	T;T	0.42131	0.98;0.98	5.79	5.79	0.91817	.	0.162219	0.41396	D	0.000898	T	0.55465	0.1922	M	0.76574	2.34	0.40409	D	0.979739	P	0.42908	0.793	P	0.48815	0.591	T	0.59215	-0.7496	10	0.59425	D	0.04	-0.7487	15.5384	0.76021	0.0:1.0:0.0:0.0	.	383	Q9NP70	AMBN_HUMAN	V	383;382;368	ENSP00000313809:A383V;ENSP00000391234:A368V	ENSP00000313809:A383V	A	+	2	0	AMBN	71506840	0.516000	0.26218	0.739000	0.30968	0.102000	0.19082	3.995000	0.57001	2.747000	0.94245	0.655000	0.94253	GCT		AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252165.1	NM_016519	
SMARCAD1	56916	broad.mit.edu	37	4	95206150	95206150	+	Silent	SNP	T	T	A			TCGA-AG-3893-01	TCGA-AG-3893-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr4:95206150T>A	ENST00000354268.4	+	23	3022	c.2949T>A	c.(2947-2949)atT>atA	p.I983I	SMARCAD1_ENST00000457823.2_Silent_p.I985I|SMARCAD1_ENST00000509418.1_Silent_p.I553I			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	983	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.I983I(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		AAGGGACGATTGAAGAATCCA	0.289																																					p.I985I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2955A	4						.						101.0	108.0	106.0					4																	95206150		2203	4299	6502	95425173	SO:0001819	synonymous_variant	56916	exon23			AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.2949T>A	4.37:g.95206150T>A		Somatic		Unspecified	Illumina	Phase_I	95425173	NM_001128429	B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Silent	SNP	ENST00000354268.4	37	CCDS3639.1																																																																																				SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253583.1	NM_020159	
NEK1	4750	broad.mit.edu	37	4	170428889	170428889	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr4:170428889G>T	ENST00000439128.2	-	20	2444	c.1804C>A	c.(1804-1806)Cgc>Agc	p.R602S	NEK1_ENST00000510533.1_Missense_Mutation_p.R558S|NEK1_ENST00000511633.1_Missense_Mutation_p.R586S|NEK1_ENST00000507142.1_Missense_Mutation_p.R630S|NEK1_ENST00000512193.1_Missense_Mutation_p.R533S	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	602				R -> RK (in Ref. 2; CAI45943). {ECO:0000305}.	cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.R630S(2)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		ATTTTTTTGCGCCTCATGTCA	0.343																																					p.R558S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1672A	4						.						128.0	117.0	121.0					4																	170428889		1839	4092	5931	170665464	SO:0001583	missense	4750	exon19			AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.1804C>A	4.37:g.170428889G>T	ENSP00000408020:p.Arg602Ser	Somatic		Unspecified	Illumina	Phase_I	170665464	NM_001199400	G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	ENST00000439128.2	37	CCDS47162.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.551721	0.45487	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.74421	-0.84;-0.83;-0.66;-0.81;-0.62	5.53	3.81	0.43845	.	0.194647	0.36854	N	0.002370	T	0.80433	0.4622	M	0.64997	1.995	0.31051	N	0.715259	D;D;D;D;D	0.71674	0.998;0.997;0.998;0.997;0.997	D;D;D;D;P	0.68353	0.957;0.933;0.957;0.933;0.907	T	0.78303	-0.2256	10	0.56958	D	0.05	.	6.4185	0.21730	0.1509:0.0:0.7025:0.1466	.	533;586;630;558;602	Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;NEK1_HUMAN	S	602;586;558;630;533	ENSP00000408020:R602S;ENSP00000423332:R586S;ENSP00000427653:R558S;ENSP00000424757:R630S;ENSP00000424938:R533S	ENSP00000408020:R602S	R	-	1	0	NEK1	170665464	1.000000	0.71417	0.672000	0.29872	0.219000	0.24729	1.900000	0.39828	0.806000	0.34183	0.655000	0.94253	CGC		NEK1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363157.3		
ZCCHC16	340595	broad.mit.edu	37	X	111698287	111698287	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chrX:111698287G>A	ENST00000340433.2	+	1	561	c.331G>A	c.(331-333)Ggg>Agg	p.G111R		NM_001004308.2	NP_001004308.2	Q6ZR62	ZCH16_HUMAN	zinc finger, CCHC domain containing 16	111							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.G111R(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27						AGAAAGTTGTGGGATCATATC	0.403																																					p.G111R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G331A	X						.						100.0	90.0	93.0					X																	111698287		2203	4300	6503	111584943	SO:0001583	missense	340595	exon3			AK128465	CCDS35369.1	Xq23	2008-05-02			ENSG00000187823	ENSG00000187823		"""Zinc fingers, CCHC domain containing"""	25214	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_001004308		Approved	Mart4, Mar4, FLJ46608	uc004epo.1	Q6ZR62	OTTHUMG00000159706	ENST00000340433.2:c.331G>A	X.37:g.111698287G>A	ENSP00000340590:p.Gly111Arg	Somatic		Unspecified	Illumina	Phase_I	111584943	NM_001004308	B2RPG1	Missense_Mutation	SNP	ENST00000340433.2	37	CCDS35369.1	.	.	.	.	.	.	.	.	.	.	G	4.933	0.173268	0.09391	.	.	ENSG00000187823	ENST00000340433	T	0.42513	0.97	3.9	-0.543	0.11851	.	0.843995	0.09756	N	0.759928	T	0.25382	0.0617	L	0.32530	0.975	0.09310	N	1	B	0.15930	0.015	B	0.17433	0.018	T	0.28364	-1.0046	10	0.16420	T	0.52	0.175	3.635	0.08146	0.3953:0.1906:0.4141:0.0	.	111	Q6ZR62	ZCH16_HUMAN	R	111	ENSP00000340590:G111R	ENSP00000340590:G111R	G	+	1	0	ZCCHC16	111584943	0.071000	0.21146	0.000000	0.03702	0.009000	0.06853	0.177000	0.16801	-0.235000	0.09767	0.523000	0.50628	GGG		ZCCHC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356964.1	NM_001004308	
VCX3B	425054	broad.mit.edu	37	X	8434341	8434341	+	Missense_Mutation	SNP	G	G	A	rs200360954		TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chrX:8434341G>A	ENST00000381032.1	+	3	965	c.658G>A	c.(658-660)Gtg>Atg	p.V220M	VCX3B_ENST00000453306.1_Intron|VCX3B_ENST00000444481.1_Missense_Mutation_p.V190M|VCX3B_ENST00000440654.2_Missense_Mutation_p.V170M|VCX3B_ENST00000381029.4_Missense_Mutation_p.V188M	NM_001001888.3	NP_001001888.3	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	220	14 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.					nucleolus (GO:0005730)|nucleus (GO:0005634)		p.V190M(1)		NS(1)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|urinary_tract(3)	11						GGAGAGCCAGGTGGAGGAACC	0.567													-|||	8	0.00211921	0.0	0.0029	3775	,	,		7799	0.0		0.003	False		,,,				2504	0.0031				p.V220M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G658A	X						.	G	MET/VAL	0,3809		0,0,0,1626,557	87.0	167.0	140.0		658		0.0	X		140	14,6655		1,7,5,2416,1816	no	missense	VCX3B	NM_001001888.3	21	1,7,5,4042,2373	AA,AG,A,GG,G		0.2099,0.0,0.1336		220/247	8434341	14,10464	2183	4245	6428	8394341	SO:0001583	missense	425054	exon3				CCDS48077.1, CCDS48077.2	Xp22.31	2009-01-14			ENSG00000205642	ENSG00000205642			31838	protein-coding gene	gene with protein product							Standard	NM_001001888		Approved	VCX-C	uc011mht.2	Q9H321	OTTHUMG00000021106	ENST00000381032.1:c.658G>A	X.37:g.8434341G>A	ENSP00000370420:p.Val220Met	Somatic		Unspecified	Illumina	Phase_I	8394341	NM_001001888	C9JS46|Q4KN12	Missense_Mutation	SNP	ENST00000381032.1	37	CCDS48077.2	.	.	.	.	.	.	.	.	.	.	N	2.887	-0.230465	0.05983	0.0	0.002099	ENSG00000205642	ENST00000381032;ENST00000444481;ENST00000440654;ENST00000381029	T;T;T;T	0.22539	2.09;2.09;1.95;2.09	.	.	.	.	.	.	.	.	T	0.10508	0.0257	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.31586	-0.9938	5	0.44086	T	0.13	.	.	.	.	.	190;170	Q9H321;E7ERZ8	VCX3B_HUMAN;.	M	220;190;170;188	ENSP00000370420:V220M;ENSP00000414780:V190M;ENSP00000410372:V170M;ENSP00000370417:V188M	ENSP00000370417:V188M	V	+	1	0	VCX3B	8394341	0.009000	0.17119	0.001000	0.08648	0.001000	0.01503	-1.939000	0.01545	0.328000	0.23435	0.330000	0.21533	GTG		VCX3B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055691.1		
PHEX	5251	broad.mit.edu	37	X	22065266	22065266	+	Missense_Mutation	SNP	G	G	A	rs149168023		TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chrX:22065266G>A	ENST00000379374.4	+	3	851	c.286G>A	c.(286-288)Gaa>Aaa	p.E96K	PHEX_ENST00000535894.1_5'UTR|PHEX_ENST00000537599.1_Missense_Mutation_p.E96K	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	96					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E96K(1)		breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						TCCAATTCCCGAAGATATGCC	0.418																																					p.E96K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G286A	X						.	G	LYS/GLU	0,3835		0,0,1632,571	183.0	151.0	162.0		286	5.6	1.0	X	dbSNP_134	162	2,6726		0,2,2426,1872	no	missense	PHEX	NM_000444.4	56	0,2,4058,2443	AA,AG,GG,G		0.0297,0.0,0.0189	probably-damaging	96/750	22065266	2,10561	2203	4300	6503	21975187	SO:0001583	missense	5251	exon3			U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.286G>A	X.37:g.22065266G>A	ENSP00000368682:p.Glu96Lys	Somatic		Unspecified	Illumina	Phase_I	21975187	NM_000444	O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	ENST00000379374.4	37	CCDS14204.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617147	0.87359	0.0	2.97E-4	ENSG00000102174	ENST00000379374;ENST00000537599	T;T	0.74526	-0.85;-0.85	5.6	5.6	0.85130	Peptidase M13 (1);	0.045657	0.85682	D	0.000000	T	0.66829	0.2829	L	0.33137	0.985	0.80722	D	1	P;P	0.44776	0.812;0.843	B;B	0.38616	0.182;0.277	T	0.70594	-0.4829	10	0.51188	T	0.08	.	18.6748	0.91525	0.0:0.0:1.0:0.0	.	96;96	F5GXU4;P78562	.;PHEX_HUMAN	K	96	ENSP00000368682:E96K;ENSP00000440362:E96K	ENSP00000368682:E96K	E	+	1	0	PHEX	21975187	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.771000	0.91751	2.355000	0.79922	0.594000	0.82650	GAA		PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056035.1	NM_000444	
GAGE10	643832	broad.mit.edu	37	X	49161343	49161343	+	Missense_Mutation	SNP	G	G	A	rs202043957		TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chrX:49161343G>A	ENST00000407599.3	+	2	98	c.5G>A	c.(4-6)aGt>aAt	p.S2N		NM_001098413.2	NP_001091883.2	A6NGK3	GAG10_HUMAN	G antigen 10	2								p.S2N(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)	4	Ovarian(276;0.236)					TGAAATATGAGTTGGCGAGGA	0.458																																					p.S2N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5A	X						.	G	ASN/SER	0,3835		0,0,0,1632,571	197.0	198.0	198.0		5	0.3	0.0	X		198	1,6727		0,0,1,2428,1871	no	missense	GAGE10	NM_001098413.2	46	0,0,1,4060,2442	AA,AG,A,GG,G		0.0149,0.0,0.0095	benign	2/117	49161343	1,10562	2203	4300	6503	49048287	SO:0001583	missense	643832	exon2					Xp11.23	2010-06-03			ENSG00000215274	ENSG00000215274			30968	protein-coding gene	gene with protein product							Standard	XM_006710256		Approved	OTTHUMG00000024136	uc010nir.1	A6NGK3	OTTHUMG00000024136	ENST00000407599.3:c.5G>A	X.37:g.49161343G>A	ENSP00000385415:p.Ser2Asn	Somatic		Unspecified	Illumina	Phase_I	49048287	NM_001098413		Missense_Mutation	SNP	ENST00000407599.3	37	CCDS43938.1	.	.	.	.	.	.	.	.	.	.	G	3.691	-0.063503	0.07273	0.0	1.49E-4	ENSG00000215274	ENST00000407599	T	0.12039	2.72	1.2	0.288	0.15719	.	.	.	.	.	T	0.12347	0.0300	M	0.61703	1.905	0.09310	N	1	B	0.11235	0.004	B	0.18263	0.021	T	0.36383	-0.9750	9	0.26408	T	0.33	.	3.4447	0.07477	0.2917:0.0:0.7083:0.0	.	2	A6NGK3	GAG10_HUMAN	N	2	ENSP00000385415:S2N	ENSP00000385415:S2N	S	+	2	0	GAGE10	49048287	0.712000	0.27916	0.010000	0.14722	0.028000	0.11728	0.679000	0.25291	0.029000	0.15352	0.292000	0.19580	AGT		GAGE10-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060816.1	NM_001098413	
ATP11C	286410	broad.mit.edu	37	X	138871554	138871554	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chrX:138871554C>A	ENST00000327569.3	-	13	1407	c.1309G>T	c.(1309-1311)Gta>Tta	p.V437L	ATP11C_ENST00000460773.1_5'UTR|ATP11C_ENST00000370543.1_Missense_Mutation_p.V437L|ATP11C_ENST00000370557.1_Missense_Mutation_p.V434L|ATP11C_ENST00000359686.2_Missense_Mutation_p.V437L|ATP11C_ENST00000361648.2_Missense_Mutation_p.V437L	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	437					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.V437L(1)		breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					TCTTGAGTTACACCTTTATAT	0.328																																					p.V437L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1309T	X						.						191.0	150.0	163.0					X																	138871554		2202	4299	6501	138699220	SO:0001583	missense	286410	exon13			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.1309G>T	X.37:g.138871554C>A	ENSP00000332756:p.Val437Leu	Somatic		Unspecified	Illumina	Phase_I	138699220	NM_001010986	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	ENST00000327569.3	37	CCDS14668.1	.	.	.	.	.	.	.	.	.	.	C	7.147	0.582952	0.13749	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2	5.84	4.05	0.47172	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	1.156480	0.06444	N	0.726459	T	0.42291	0.1196	L	0.36672	1.1	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.11329	0.001;0.006	T	0.36138	-0.9760	10	0.13853	T	0.58	.	0.9798	0.01433	0.1668:0.4179:0.1579:0.2575	.	437;437	Q8NB49-3;Q8NB49	.;AT11C_HUMAN	L	434;437;437;437;437	ENSP00000359588:V434L;ENSP00000355165:V437L;ENSP00000332756:V437L;ENSP00000359574:V437L;ENSP00000352715:V437L	ENSP00000332756:V437L	V	-	1	0	ATP11C	138699220	0.000000	0.05858	0.335000	0.25508	0.933000	0.57130	0.643000	0.24750	1.213000	0.43380	0.529000	0.55759	GTA		ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694	
GLI2	2736	broad.mit.edu	37	2	121747300	121747300	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr2:121747300C>A	ENST00000452319.1	+	14	3870	c.3810C>A	c.(3808-3810)tgC>tgA	p.C1270*	GLI2_ENST00000361492.4_Nonsense_Mutation_p.C1270*|GLI2_ENST00000314490.11_Intron					GLI family zinc finger 2									p.C1270*(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CCCAATCCTGCAGCAACATGC	0.627																																					p.C1270X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3810A	2						.						31.0	32.0	32.0					2																	121747300		2200	4299	6499	121463770	SO:0001587	stop_gained	2736	exon13				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.3810C>A	2.37:g.121747300C>A	ENSP00000390436:p.Cys1270*	Somatic		Unspecified	Illumina	Phase_I	121463770	NM_005270		Nonsense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	C	37	6.233104	0.97399	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	.	.	.	4.72	0.619	0.17630	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.5772	0.22573	0.0:0.4079:0.0:0.5921	.	.	.	.	X	1270	.	.	C	+	3	2	GLI2	121463770	0.992000	0.36948	0.986000	0.45419	0.347000	0.29111	0.149000	0.16243	0.226000	0.20979	0.455000	0.32223	TGC		GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
ANKAR	150709	broad.mit.edu	37	2	190592782	190592782	+	Silent	SNP	C	C	T	rs540415324		TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr2:190592782C>T	ENST00000520309.1	+	13	2924	c.2836C>T	c.(2836-2838)Ctg>Ttg	p.L946L	ANKAR_ENST00000281412.6_Silent_p.L721L|ANKAR_ENST00000313581.4_Silent_p.L946L|ANKAR_ENST00000431575.2_Silent_p.L875L|ANKAR_ENST00000438402.2_Silent_p.L946L	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	946						integral component of membrane (GO:0016021)		p.L875L(1)		breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			GAAAGCATTTCTGGAAAAATC	0.333													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15960	0.0		0.0	False		,,,				2504	0.0				p.L946L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2836T	2						.						52.0	57.0	55.0					2																	190592782		2203	4300	6503	190301027	SO:0001819	synonymous_variant	150709	exon13			AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687		"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803				15110750	Standard	NM_144708		Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.2836C>T	2.37:g.190592782C>T		Somatic		Unspecified	Illumina	Phase_I	190301027	NM_144708	Q3ZCS6|Q4G0M2|Q6ZU02	Silent	SNP	ENST00000520309.1	37	CCDS33351.2																																																																																				ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335045.3	NM_144708	
UGT1A4	54657	broad.mit.edu	37	2	234627798	234627798	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr2:234627798C>A	ENST00000373409.3	+	1	375	c.332C>A	c.(331-333)tCt>tAt	p.S111Y	UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000406651.1_Intron	NM_007120.2	NP_009051.1	P22310	UD14_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A4	111					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.S111Y(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	26		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Asenapine(DB06216)|Clozapine(DB00363)|Ezogabine(DB04953)|Lamotrigine(DB00555)|Midazolam(DB00683)|Paricalcitol(DB00910)|Tamoxifen(DB00675)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)	AAGAGATATTCTAGAAGTATG	0.448																																					p.S111Y	Melanoma(99;1011 1962 13201 26492)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C332A	2						.						164.0	163.0	163.0					2																	234627798		2203	4300	6503	234292537	SO:0001583	missense	54657	exon1			M84128	CCDS33405.1	2q37.1	2014-01-10	2005-07-20		ENSG00000244474	ENSG00000244474		"""UDP glucuronosyltransferases"""	12536	other	complex locus constituent		606429	"""UDP glycosyltransferase 1 family, polypeptide A4"""			9295054, 1339448	Standard	NM_007120		Approved	HUG-BR2, UGT1D	uc002vux.3	P22310	OTTHUMG00000059119	ENST00000373409.3:c.332C>A	2.37:g.234627798C>A	ENSP00000362508:p.Ser111Tyr	Somatic		Unspecified	Illumina	Phase_I	234292537	NM_007120	B2R937|B8K288|Q5DT00	Missense_Mutation	SNP	ENST00000373409.3	37	CCDS33405.1	.	.	.	.	.	.	.	.	.	.	C	0.403	-0.917516	0.02396	.	.	ENSG00000244474	ENST00000373409	T	0.60171	0.21	4.16	0.319	0.15873	.	.	.	.	.	T	0.43433	0.1247	L	0.49350	1.555	0.09310	N	1	B;B	0.29136	0.234;0.01	B;B	0.34536	0.185;0.063	T	0.38222	-0.9671	9	0.02654	T	1	.	4.9994	0.14257	0.0:0.3631:0.1623:0.4747	.	111;111	B8K288;P22310	.;UD14_HUMAN	Y	111	ENSP00000362508:S111Y	ENSP00000362508:S111Y	S	+	2	0	UGT1A4	234292537	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.386000	0.07370	-0.226000	0.09899	-0.339000	0.08088	TCT		UGT1A4-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130984.1	NM_007120	
ACKR3	57007	broad.mit.edu	37	2	237489126	237489126	+	Silent	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr2:237489126C>T	ENST00000272928.3	+	2	328	c.18C>T	c.(16-18)ttC>ttT	p.F6F		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	6					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)	p.F6F(1)									TGCATCTCTTCGACTACTCAG	0.493																																					p.F6F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C18T	2						.						116.0	91.0	99.0					2																	237489126		2203	4300	6503	237153865	SO:0001819	synonymous_variant	57007	exon2			BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.18C>T	2.37:g.237489126C>T		Somatic		Unspecified	Illumina	Phase_I	237153865	NM_020311	A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Silent	SNP	ENST00000272928.3	37	CCDS2516.1																																																																																				ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257079.2	NM_020311	
KIDINS220	57498	broad.mit.edu	37	2	8871762	8871762	+	Silent	SNP	G	G	A	rs77234849		TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr2:8871762G>A	ENST00000256707.3	-	30	4585	c.4404C>T	c.(4402-4404)aaC>aaT	p.N1468N	KIDINS220_ENST00000418530.1_Silent_p.N1369N|KIDINS220_ENST00000473731.1_Silent_p.N1449N|KIDINS220_ENST00000427284.1_Silent_p.N1449N	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1468					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)	p.N1468N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GGGAAGCATCGTTGGTGGAAA	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		19530	0.001		0.0	False		,,,				2504	0.0				p.N1468N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4404T	2						.						94.0	90.0	92.0					2																	8871762		1889	4101	5990	8789213	SO:0001819	synonymous_variant	57498	exon30			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.4404C>T	2.37:g.8871762G>A		Somatic		Unspecified	Illumina	Phase_I	8789213	NM_020738	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Silent	SNP	ENST00000256707.3	37	CCDS42650.1																																																																																				KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2	NM_020738	
LRPPRC	10128	broad.mit.edu	37	2	44132856	44132856	+	Silent	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr2:44132856C>T	ENST00000260665.7	-	31	3396	c.3339G>A	c.(3337-3339)acG>acA	p.T1113T		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	1113					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.T1113T(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GCCTAACTTGCGTTATGATGA	0.443																																					p.T1113T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3339A	2						.						146.0	125.0	133.0					2																	44132856		2203	4300	6503	43986360	SO:0001819	synonymous_variant	10128	exon31			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.3339G>A	2.37:g.44132856C>T		Somatic		Unspecified	Illumina	Phase_I	43986360	NM_133259	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Silent	SNP	ENST00000260665.7	37	CCDS33189.1																																																																																				LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	
TET3	200424	broad.mit.edu	37	2	74274629	74274629	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr2:74274629C>A	ENST00000409262.3	+	1	1180	c.1180C>A	c.(1180-1182)Cag>Aag	p.Q394K		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	394					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)	p.Q394K(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GACCGCCCTGCAGCAGCACCT	0.672																																					p.Q394K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1180A	2						.						54.0	71.0	65.0					2																	74274629		2157	4260	6417	74128137	SO:0001583	missense	200424	exon1				CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.1180C>A	2.37:g.74274629C>A	ENSP00000386869:p.Gln394Lys	Somatic		Unspecified	Illumina	Phase_I	74128137	NM_144993	A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	ENST00000409262.3	37	CCDS46339.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.281694	0.80692	.	.	ENSG00000187605	ENST00000305799;ENST00000409262;ENST00000233310	T;T	0.39229	1.09;2.16	5.29	5.29	0.74685	.	.	.	.	.	T	0.50599	0.1625	N	0.19112	0.55	0.53005	D	0.999965	D	0.69078	0.997	D	0.73380	0.98	T	0.51576	-0.8688	9	0.45353	T	0.12	.	18.0716	0.89408	0.0:1.0:0.0:0.0	.	394	O43151	TET3_HUMAN	K	436;394;394	ENSP00000307803:Q436K;ENSP00000386869:Q394K	ENSP00000233310:Q394K	Q	+	1	0	TET3	74128137	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.217000	0.77982	2.635000	0.89317	0.561000	0.74099	CAG		TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4		
OR6B2	389090	broad.mit.edu	37	2	240969461	240969461	+	Missense_Mutation	SNP	G	G	A	rs376640191	byFrequency	TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr2:240969461G>A	ENST00000402971.2	-	1	445	c.386C>T	c.(385-387)cCg>cTg	p.P129L		NM_001005853.1	NP_001005853.1	Q6IFH4	OR6B2_HUMAN	olfactory receptor, family 6, subfamily B, member 2	129						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P129L(1)		endometrium(1)|large_intestine(4)|lung(9)|prostate(1)	15		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.4e-29)|all cancers(36;2.08e-27)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)		GTAGCGCAGCGGGTGGCAGAT	0.602													G|||	14	0.00279553	0.0106	0.0	5008	,	,		21571	0.0		0.0	False		,,,				2504	0.0				p.P129L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C386T	2						.	G	LEU/PRO	24,3528		0,24,1752	7.0	7.0	7.0		386	4.3	0.9	2		7	0,7966		0,0,3983	no	missense	OR6B2	NM_001005853.1	98	0,24,5735	AA,AG,GG		0.0,0.6757,0.2084	probably-damaging	129/313	240969461	24,11494	1776	3983	5759	240618134	SO:0001583	missense	389090	exon1				CCDS46559.1	2q37.3	2012-08-09	2004-10-07	2004-10-07	ENSG00000182083	ENSG00000182083		"""GPCR / Class A : Olfactory receptors"""	15041	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 2 pseudogene"""	OR6B2P			Standard	XM_005247004		Approved		uc010zoc.2	Q6IFH4	OTTHUMG00000152400	ENST00000402971.2:c.386C>T	2.37:g.240969461G>A	ENSP00000384563:p.Pro129Leu	Somatic		Unspecified	Illumina	Phase_I	240618134	NM_001005853	B2RPR3|Q8NGW0	Missense_Mutation	SNP	ENST00000402971.2	37	CCDS46559.1	.	.	.	.	.	.	.	.	.	.	g	15.82	2.945740	0.53079	0.006757	0.0	ENSG00000182083	ENST00000402971	T	0.01902	4.57	4.29	4.29	0.51040	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000292	T	0.13372	0.0324	H	0.94582	3.555	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.03514	-1.1029	10	0.87932	D	0	.	14.62	0.68576	0.0:0.0:1.0:0.0	.	129	Q6IFH4	OR6B2_HUMAN	L	129	ENSP00000384563:P129L	ENSP00000384563:P129L	P	-	2	0	OR6B2	240618134	1.000000	0.71417	0.928000	0.36995	0.010000	0.07245	8.835000	0.92100	2.357000	0.79964	0.591000	0.81541	CCG		OR6B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326079.1	NM_001005853	
AKNA	80709	broad.mit.edu	37	9	117139205	117139205	+	Silent	SNP	T	T	C			TCGA-AG-3893-01	TCGA-AG-3893-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr9:117139205T>C	ENST00000307564.4	-	3	1043	c.882A>G	c.(880-882)gaA>gaG	p.E294E	AKNA_ENST00000312033.3_Silent_p.E294E|AKNA_ENST00000374075.5_Silent_p.E213E|AKNA_ENST00000223791.3_5'UTR|AKNA_ENST00000374088.3_Silent_p.E294E	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	294					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.E294E(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						TCCAGATGTGTTCCTTGGGCT	0.582																																					p.E294E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A882G	9						.						125.0	110.0	115.0					9																	117139205		2203	4300	6503	116179026	SO:0001819	synonymous_variant	80709	exon3			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.882A>G	9.37:g.117139205T>C		Somatic		Unspecified	Illumina	Phase_I	116179026	NM_030767	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Silent	SNP	ENST00000307564.4	37	CCDS6805.1																																																																																				AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
MPDZ	8777	broad.mit.edu	37	9	13224414	13224414	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr9:13224414C>A	ENST00000319217.7	-	4	599	c.352G>T	c.(352-354)Gct>Tct	p.A118S	MPDZ_ENST00000381022.2_Missense_Mutation_p.A118S|MPDZ_ENST00000536827.1_Missense_Mutation_p.A118S|MPDZ_ENST00000546205.1_Missense_Mutation_p.A118S|MPDZ_ENST00000541718.1_Missense_Mutation_p.A118S|MPDZ_ENST00000447879.1_Missense_Mutation_p.A118S|MPDZ_ENST00000381015.4_Missense_Mutation_p.A118S	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	118					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.A118S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TCATCACAAGCAGGTTTCCCA	0.358																																					p.A118S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G352T	9						.						132.0	126.0	128.0					9																	13224414		1843	4089	5932	13214414	SO:0001583	missense	8777	exon3			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.352G>T	9.37:g.13224414C>A	ENSP00000320006:p.Ala118Ser	Somatic		Unspecified	Illumina	Phase_I	13214414	NM_003829	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37		.	.	.	.	.	.	.	.	.	.	C	3.285	-0.146096	0.06627	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T	0.09538	3.02;2.97;2.97;2.97;3.02;3.02;3.02	5.72	1.36	0.22044	.	0.877885	0.09597	N	0.780779	T	0.04588	0.0125	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.002	T	0.42582	-0.9443	10	0.33940	T	0.23	.	6.0574	0.19819	0.1613:0.5302:0.0:0.3085	.	118;118;118	B7ZMI4;O75970-3;O75970-2	.;.;.	S	118	ENSP00000320006:A118S;ENSP00000439807:A118S;ENSP00000370410:A118S;ENSP00000444151:A118S;ENSP00000415208:A118S;ENSP00000370403:A118S;ENSP00000446358:A118S	ENSP00000320006:A118S	A	-	1	0	MPDZ	13214414	0.000000	0.05858	0.521000	0.27850	0.992000	0.81027	0.011000	0.13264	0.331000	0.23511	0.655000	0.94253	GCT		MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829	
GLE1	2733	broad.mit.edu	37	9	131271183	131271183	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr9:131271183C>G	ENST00000309971.4	+	2	234	c.128C>G	c.(127-129)cCc>cGc	p.P43R	GLE1_ENST00000372770.4_Missense_Mutation_p.P43R|GLE1_ENST00000539582.1_5'UTR	NM_001003722.1	NP_001003722.1	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator	43					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear pore (GO:0005643)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.P43R(2)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	16						ATGTCTCTTCCCAAGCTATCT	0.443																																					p.P43R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C128G	9						.						145.0	137.0	140.0					9																	131271183		2203	4300	6503	130311004	SO:0001583	missense	2733	exon2			AF058922	CCDS6904.1, CCDS35154.1	9q34.13	2014-09-17	2013-06-18	2007-10-04	ENSG00000119392	ENSG00000119392			4315	protein-coding gene	gene with protein product		603371	"""GLE1 (yeast homolog)-like, RNA export mediator"", ""GLE1 RNA export mediator-like (yeast)"", ""GLE1 RNA export mediator (yeast)"", ""lethal congenital contracture syndrome 1"", ""GLE1 RNA export mediator homolog (yeast)"""	GLE1L, LCCS1		9618489, 18204449	Standard	NM_001499		Approved	hGLE1	uc004bvj.3	Q53GS7	OTTHUMG00000020749	ENST00000309971.4:c.128C>G	9.37:g.131271183C>G	ENSP00000308622:p.Pro43Arg	Somatic		Unspecified	Illumina	Phase_I	130311004	NM_001003722	O75458|Q53GT9|Q5VVU1|Q8NCP6|Q9UFL6	Missense_Mutation	SNP	ENST00000309971.4	37	CCDS35154.1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.289853	0.40494	.	.	ENSG00000119392	ENST00000309971;ENST00000372770	T;T	0.66815	-0.23;0.18	5.47	5.47	0.80525	.	0.301441	0.37761	N	0.001954	T	0.62295	0.2416	M	0.63843	1.955	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.11329	0.003;0.006	T	0.59815	-0.7383	10	0.44086	T	0.13	-17.5558	10.4085	0.44278	0.0:0.9111:0.0:0.0889	.	43;43	Q53GS7;Q53GS7-2	GLE1_HUMAN;.	R	43	ENSP00000308622:P43R;ENSP00000361856:P43R	ENSP00000308622:P43R	P	+	2	0	GLE1	130311004	0.823000	0.29233	1.000000	0.80357	0.960000	0.62799	2.668000	0.46816	2.582000	0.87167	0.455000	0.32223	CCC		GLE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054456.1	NM_001003722	
DOCK8	81704	broad.mit.edu	37	9	441900	441900	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3893-01	TCGA-AG-3893-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr9:441900A>T	ENST00000453981.1	+	42	5493	c.5381A>T	c.(5380-5382)tAc>tTc	p.Y1794F	DOCK8_ENST00000382329.1_Missense_Mutation_p.Y1261F|DOCK8_ENST00000469391.1_Missense_Mutation_p.Y1694F|DOCK8_ENST00000432829.2_Missense_Mutation_p.Y1726F			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1794	DHR-2.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.Y1794F(1)|p.Y1726F(1)		breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TTTGGAACCTACTTCCGAGTT	0.428																																					p.Y1694F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A5081T	9						.						106.0	103.0	104.0					9																	441900		2203	4300	6503	431900	SO:0001583	missense	81704	exon40			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.5381A>T	9.37:g.441900A>T	ENSP00000408464:p.Tyr1794Phe	Somatic		Unspecified	Illumina	Phase_I	431900	NM_001190458	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	37	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	A	28.6	4.934990	0.92458	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.47869	1.06;1.07;1.07;0.83	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.65322	0.2680	M	0.66506	2.035	0.80722	D	1	D;D;D	0.61080	0.989;0.989;0.989	D;P;D	0.64410	0.925;0.88;0.925	T	0.64744	-0.6335	10	0.42905	T	0.14	.	16.0399	0.80667	1.0:0.0:0.0:0.0	.	1694;1261;1794	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	F	1794;1762;1726;1694;1261	ENSP00000408464:Y1794F;ENSP00000394888:Y1726F;ENSP00000419438:Y1694F;ENSP00000371766:Y1261F	ENSP00000287364:Y1762F	Y	+	2	0	DOCK8	431900	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.033000	0.93741	2.371000	0.80710	0.533000	0.62120	TAC		DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
ZDHHC21	340481	broad.mit.edu	37	9	14674311	14674311	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr9:14674311C>A	ENST00000380916.4	-	4	494	c.28G>T	c.(28-30)Gac>Tac	p.D10Y		NM_178566.4	NP_848661.1	Q8IVQ6	ZDH21_HUMAN	zinc finger, DHHC-type containing 21	10					hair follicle development (GO:0001942)|nitric oxide metabolic process (GO:0046209)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)|regulation of nitric-oxide synthase activity (GO:0050999)|sebaceous gland development (GO:0048733)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.D10Y(1)		endometrium(2)|large_intestine(4)|lung(2)|skin(1)	9				GBM - Glioblastoma multiforme(50;4.31e-06)		CCATGTGGGTCAACAACAAAG	0.388																																					p.D10Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G28T	9						.						102.0	107.0	105.0					9																	14674311		2203	4300	6503	14664311	SO:0001583	missense	340481	exon4			AF161360	CCDS6475.1	9p22.3	2010-02-09			ENSG00000175893	ENSG00000175893		"""Zinc fingers, DHHC-type"""	20750	protein-coding gene	gene with protein product		614605				19956733	Standard	NM_178566		Approved	HSPC097, DNZ1	uc003zlg.2	Q8IVQ6	OTTHUMG00000019573	ENST00000380916.4:c.28G>T	9.37:g.14674311C>A	ENSP00000370303:p.Asp10Tyr	Somatic		Unspecified	Illumina	Phase_I	14664311	NM_178566	A8KA95|D3DRI7|Q5VWG1	Missense_Mutation	SNP	ENST00000380916.4	37	CCDS6475.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.449468	0.84101	.	.	ENSG00000175893	ENST00000380916	T	0.52526	0.66	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.59932	0.2230	L	0.27053	0.805	0.58432	D	0.999999	D	0.76494	0.999	D	0.77557	0.99	T	0.62148	-0.6915	10	0.87932	D	0	-17.0095	20.2956	0.98549	0.0:1.0:0.0:0.0	.	10	Q8IVQ6	ZDH21_HUMAN	Y	10	ENSP00000370303:D10Y	ENSP00000370303:D10Y	D	-	1	0	ZDHHC21	14664311	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.628000	0.74262	2.805000	0.96524	0.460000	0.39030	GAC		ZDHHC21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051748.2	NM_178566	
LAMC3	10319	broad.mit.edu	37	9	133917079	133917079	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr9:133917079C>T	ENST00000361069.4	+	7	1472	c.1339C>T	c.(1339-1341)Cgc>Tgc	p.R447C	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	447	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)	p.R447C(2)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CCGCAGTGGGCGCTGCCCCTG	0.547																																					p.R447C												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C1339T	9						.						51.0	46.0	48.0					9																	133917079		2203	4300	6503	132906900	SO:0001583	missense	10319	exon7			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.1339C>T	9.37:g.133917079C>T	ENSP00000354360:p.Arg447Cys	Somatic		Unspecified	Illumina	Phase_I	132906900	NM_006059	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	C	18.76	3.692866	0.68271	.	.	ENSG00000050555	ENST00000361069;ENST00000355048;ENST00000320021	T	0.62364	0.03	4.97	3.01	0.34805	EGF-like, laminin (3);	0.558844	0.19673	N	0.108699	T	0.79370	0.4434	M	0.89095	3.005	0.09310	N	0.999995	D	0.76494	0.999	D	0.64877	0.93	T	0.71590	-0.4547	10	0.54805	T	0.06	.	12.3069	0.54908	0.3029:0.6971:0.0:0.0	.	447	Q9Y6N6	LAMC3_HUMAN	C	447	ENSP00000354360:R447C	ENSP00000325873:R447C	R	+	1	0	LAMC3	132906900	0.008000	0.16893	0.529000	0.27951	0.961000	0.63080	1.954000	0.40362	0.430000	0.26230	0.462000	0.41574	CGC		LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
TPTE2	93492	broad.mit.edu	37	13	20039679	20039679	+	Nonsense_Mutation	SNP	G	G	A	rs202071055		TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr13:20039679G>A	ENST00000400230.2	-	8	582	c.538C>T	c.(538-540)Cga>Tga	p.R180*	TPTE2_ENST00000400103.2_Nonsense_Mutation_p.R69*|TPTE2_ENST00000382977.4_Nonsense_Mutation_p.R180*|TPTE2_ENST00000382975.4_Nonsense_Mutation_p.R140*|TPTE2_ENST00000457266.2_Nonsense_Mutation_p.R69*|TPTE2_ENST00000382978.1_Nonsense_Mutation_p.R140*|TPTE2_ENST00000255310.6_Nonsense_Mutation_p.R103*|TPTE2_ENST00000390680.2_Nonsense_Mutation_p.R103*			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	180					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R103*(2)		NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		ATAATAAGTCGTAGAAGTCGA	0.318													g|||	1	0.000199681	0.0008	0.0	5008	,	,		18760	0.0		0.0	False		,,,				2504	0.0				p.R69X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|prostate(1)	c.C205T	13						.	G	stop/ARG,stop/ARG,stop/ARG	0,4400		0,0,2200	38.0	37.0	37.0		205,307,538	1.9	0.0	13		37	1,8597		0,1,4298	yes	stop-gained,stop-gained,stop-gained	TPTE2	NM_001141968.1,NM_130785.3,NM_199254.2	,,	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	,,	69/412,103/446,180/523	20039679	1,12997	2200	4299	6499	18937679	SO:0001587	stop_gained	93492	exon7			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.538C>T	13.37:g.20039679G>A	ENSP00000383089:p.Arg180*	Somatic		Unspecified	Illumina	Phase_I	18937679	NM_001141968	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Nonsense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	g	19.37	3.815305	0.70912	0.0	1.16E-4	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000255310;ENST00000390680;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548;ENST00000419256	.	.	.	2.79	1.9	0.25705	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.2096	6.8484	0.24000	0.0:0.0:0.7234:0.2766	.	.	.	.	X	140;69;180;103;103;180;140;69;180;49	.	.	R	-	1	2	TPTE2	18937679	1.000000	0.71417	0.002000	0.10522	0.004000	0.04260	1.957000	0.40392	0.688000	0.31529	0.467000	0.42956	CGA		TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
SACS	26278	broad.mit.edu	37	13	23904434	23904434	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3893-01	TCGA-AG-3893-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr13:23904434T>G	ENST00000382292.3	-	9	13854	c.13581A>C	c.(13579-13581)gaA>gaC	p.E4527D	SACS_ENST00000402364.1_Missense_Mutation_p.E3777D|SACS_ENST00000382298.3_Missense_Mutation_p.E4527D			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	4527	HEPN. {ECO:0000255|PROSITE- ProRule:PRU00105}.				cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.E4380D(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CACCATAAGCTTCCAATGTGT	0.398																																					p.E4527D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A13581C	13						.						187.0	165.0	173.0					13																	23904434		2203	4300	6503	22802434	SO:0001583	missense	26278	exon10			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.13581A>C	13.37:g.23904434T>G	ENSP00000371729:p.Glu4527Asp	Somatic		Unspecified	Illumina	Phase_I	22802434	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	T	16.13	3.035718	0.54896	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.85773	-2.03;-2.03;-2.03	5.85	-3.7	0.04437	HEPN (3);	0.000000	0.85682	D	0.000000	D	0.84547	0.5496	L	0.34521	1.04	0.43385	D	0.995496	D	0.57257	0.979	D	0.66196	0.942	T	0.80705	-0.1263	10	0.27082	T	0.32	.	15.4777	0.75497	0.0:0.5578:0.0:0.4421	.	4527	Q9NZJ4	SACS_HUMAN	D	4527;3777;4527	ENSP00000371729:E4527D;ENSP00000385844:E3777D;ENSP00000371735:E4527D	ENSP00000371729:E4527D	E	-	3	2	SACS	22802434	0.899000	0.30636	0.909000	0.35828	0.333000	0.28666	-0.003000	0.12901	-0.647000	0.05444	0.460000	0.39030	GAA		SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
F7	2155	broad.mit.edu	37	13	113771901	113771901	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr13:113771901G>A	ENST00000375581.3	+	8	831	c.796G>A	c.(796-798)Gcg>Acg	p.A266T	F7_ENST00000541084.1_Missense_Mutation_p.A197T|F7_ENST00000346342.3_Missense_Mutation_p.A244T	NM_000131.4	NP_000122.1	P08709	FA7_HUMAN	coagulation factor VII (serum prothrombin conversion accelerator)	266	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		A -> T (in FA7D). {ECO:0000269|PubMed:10862079, ECO:0000269|PubMed:18976247}.		blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|cellular protein metabolic process (GO:0044267)|circadian rhythm (GO:0007623)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell migration (GO:0030335)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to growth hormone (GO:0060416)|response to vitamin K (GO:0032571)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.A266T(1)		large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	GAACCTGATCGCGGTGCTGGG	0.632																																					p.A266T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G796A	13	GRCh37	CM001149	F7	M		.						149.0	141.0	144.0					13																	113771901		2203	4300	6503	112819902	SO:0001583	missense	2155	exon8				CCDS9528.1, CCDS9529.1, CCDS73602.1	13q34	2014-02-03			ENSG00000057593	ENSG00000057593	3.4.21.21		3544	protein-coding gene	gene with protein product	"""eptacog alfa"", ""FVII coagulation protein"", ""factor VII"""	613878				3264725, 2511201	Standard	NM_000131		Approved		uc001vsv.4	P08709	OTTHUMG00000017373	ENST00000375581.3:c.796G>A	13.37:g.113771901G>A	ENSP00000364731:p.Ala266Thr	Somatic		Unspecified	Illumina	Phase_I	112819902	NM_000131	B0YJC8|Q14339|Q5JVF1|Q5JVF2|Q9UD52|Q9UD53|Q9UD54	Missense_Mutation	SNP	ENST00000375581.3	37	CCDS9528.1	.	.	.	.	.	.	.	.	.	.	G	13.21	2.170365	0.38315	.	.	ENSG00000057593	ENST00000346342;ENST00000541084;ENST00000375581	D;D;D	0.82081	-1.57;-1.57;-1.57	4.32	2.48	0.30137	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.430428	0.22519	N	0.058994	T	0.74928	0.3781	L	0.48174	1.505	0.09310	N	1	P;P;P	0.48834	0.854;0.897;0.916	B;B;B	0.40038	0.317;0.185;0.282	T	0.67304	-0.5704	10	0.72032	D	0.01	.	8.5566	0.33485	0.2725:0.0:0.7275:0.0	.	197;244;266	F5H8B0;P08709-2;P08709	.;.;FA7_HUMAN	T	244;197;266	ENSP00000329546:A244T;ENSP00000442051:A197T;ENSP00000364731:A266T	ENSP00000329546:A244T	A	+	1	0	F7	112819902	0.448000	0.25681	0.011000	0.14972	0.004000	0.04260	2.582000	0.46085	0.471000	0.27319	-0.269000	0.10298	GCG		F7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045838.4	NM_000131	
ARHGAP21	57584	broad.mit.edu	37	10	24909176	24909176	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr10:24909176G>C	ENST00000396432.2	-	9	2134	c.1648C>G	c.(1648-1650)Cat>Gat	p.H550D	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.H337D	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	549					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.H549D(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						AAAGATTTATGAATTTCTTGC	0.418																																					p.H550D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1648G	10						.						82.0	84.0	83.0					10																	24909176		2203	4300	6503	24949182	SO:0001583	missense	57584	exon9			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.1648C>G	10.37:g.24909176G>C	ENSP00000379709:p.His550Asp	Somatic		Unspecified	Illumina	Phase_I	24949182	NM_020824	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	G	16.02	3.003465	0.54254	.	.	ENSG00000107863	ENST00000396432;ENST00000447364;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.50277	2.72;2.83;0.75;0.77	5.5	5.5	0.81552	.	0.336409	0.35466	N	0.003189	T	0.64505	0.2604	M	0.68317	2.08	0.37622	D	0.921358	D;B	0.59357	0.985;0.226	P;B	0.56916	0.809;0.064	T	0.68773	-0.5320	10	0.56958	D	0.05	.	19.7622	0.96325	0.0:0.0:1.0:0.0	.	540;549	F8W9U9;Q5T5U3	.;RHG21_HUMAN	D	550;539;337;540;550;385	ENSP00000379709:H550D;ENSP00000365604:H337D;ENSP00000365592:H540D;ENSP00000405018:H550D	ENSP00000365604:H337D	H	-	1	0	ARHGAP21	24949182	1.000000	0.71417	0.201000	0.23476	0.966000	0.64601	5.313000	0.65798	2.732000	0.93576	0.650000	0.86243	CAT		ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
GPR158	57512	broad.mit.edu	37	10	25887089	25887090	+	Missense_Mutation	DNP	AA	AA	TT			TCGA-AG-3893-01	TCGA-AG-3893-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr10:25887089_25887090AA>TT	ENST00000376351.3	+	11	2893_2894	c.2534_2535AA>TT	c.(2533-2535)gAA>gTT	p.E845V	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	845					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.E845>?(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						GAGACAACAGAAAATTCCACAC	0.485																																					.												.	.	1	Complex(1)	large_intestine(1)	c.2534_2535TT	10						.																																			25927096	SO:0001583	missense	57512	exon11			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	Exception_encountered	10.37:g.25887089_25887090delinsTT	ENSP00000365529:p.Glu845Val	Somatic		Unspecified	Illumina	Phase_I	25927095	NM_020752	Q6QR81|Q9ULT3	Missense_Mutation	DNP	ENST00000376351.3	37	CCDS31166.1																																																																																				GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	
PTCHD3	374308	broad.mit.edu	37	10	27702772	27702772	+	Silent	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr10:27702772C>T	ENST00000438700.3	-	1	525	c.408G>A	c.(406-408)gcG>gcA	p.A136A		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	136					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)	p.A136A(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						TCCAGGGGTGCGCGCCCACCT	0.667																																					p.A136A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G408A	10						.						28.0	33.0	31.0					10																	27702772		2203	4299	6502	27742778	SO:0001819	synonymous_variant	374308	exon1			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.408G>A	10.37:g.27702772C>T		Somatic		Unspecified	Illumina	Phase_I	27742778	NM_001034842	I3L499|Q6ZU28	Silent	SNP	ENST00000438700.3	37	CCDS31173.1																																																																																				PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
ZSWIM8	23053	broad.mit.edu	37	10	75548921	75548921	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr10:75548921C>T	ENST00000605216.1	+	3	647	c.430C>T	c.(430-432)Cgg>Tgg	p.R144W	ZSWIM8_ENST00000398706.2_Missense_Mutation_p.R144W|ZSWIM8_ENST00000603114.1_Missense_Mutation_p.R144W|ZSWIM8_ENST00000604729.1_Missense_Mutation_p.R144W|ZSWIM8_ENST00000604524.1_Missense_Mutation_p.R144W	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	144							zinc ion binding (GO:0008270)	p.R144W(4)									CTTCCGCATGCGGGCTGTGAA	0.572																																					p.R144W												.	.	4	Substitution - Missense(4)	urinary_tract(2)|large_intestine(2)	c.C430T	10						.						97.0	102.0	100.0					10																	75548921		2104	4225	6329	75218927	SO:0001583	missense	23053	exon3			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.430C>T	10.37:g.75548921C>T	ENSP00000474748:p.Arg144Trp	Somatic		Unspecified	Illumina	Phase_I	75218927	NM_015037	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	ENST00000605216.1	37		.	.	.	.	.	.	.	.	.	.	C	18.15	3.560024	0.65538	.	.	ENSG00000214655	ENST00000398706	T	0.42513	0.97	5.61	1.98	0.26296	.	.	.	.	.	T	0.56702	0.2003	M	0.65498	2.005	0.51012	D	0.999909	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72338	0.965;0.977;0.965	T	0.55159	-0.8184	9	0.72032	D	0.01	.	8.091	0.30801	0.6771:0.2563:0.0666:0.0	.	144;144;144	A7E2V4;A7E2V4-5;A7E2V4-4	K0913_HUMAN;.;.	W	144	ENSP00000381693:R144W	ENSP00000381693:R144W	R	+	1	2	KIAA0913	75218927	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	0.696000	0.25541	0.385000	0.24970	-0.264000	0.10439	CGG		ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1	NM_001242487	
APC	324	broad.mit.edu	37	5	112175358	112175358	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr5:112175358C>G	ENST00000457016.1	+	16	4447	c.4067C>G	c.(4066-4068)tCa>tGa	p.S1356*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.S1356*|APC_ENST00000508376.2_Nonsense_Mutation_p.S1356*			P25054	APC_HUMAN	adenomatous polyposis coli	1356	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S1356*(11)|p.G1357fs*13(2)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GAATTTTCTTCAGGAGCGAAA	0.473		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S1338X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Missense,-2	.	15	Substitution - Nonsense(11)|Deletion - Frameshift(3)|Unknown(1)	large_intestine(13)|soft_tissue(1)|skin(1)	c.C4013G	5						.						62.0	64.0	63.0					5																	112175358		2202	4300	6502	112203257	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4067C>G	5.37:g.112175358C>G	ENSP00000413133:p.Ser1356*	Somatic		Unspecified	Illumina	Phase_I	112203257	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	9.058983	0.99051	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	6.17	0.99709	.	0.141330	0.49916	D	0.000133	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-14.6466	20.4898	0.99202	0.0:1.0:0.0:0.0	.	.	.	.	X	1356	.	.	S	+	2	0	APC	112203257	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	TCA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
H2AFY	9555	broad.mit.edu	37	5	134670687	134670687	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr5:134670687C>G	ENST00000511689.1	-	9	1691	c.1098G>C	c.(1096-1098)atG>atC	p.M366I	H2AFY_ENST00000304332.4_Missense_Mutation_p.M365I|H2AFY_ENST00000312469.4_Missense_Mutation_p.M363I|CTC-349C3.1_ENST00000432382.3_Intron|H2AFY_ENST00000423969.2_Missense_Mutation_p.M194I|H2AFY_ENST00000510038.1_Missense_Mutation_p.M366I|H2AFY_ENST00000512507.1_5'UTR	NM_001040158.1|NM_138610.2	NP_001035248.1|NP_613258.2	O75367	H2AY_HUMAN	H2A histone family, member Y	366	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				chromatin modification (GO:0016568)|dosage compensation (GO:0007549)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of cell cycle G2/M phase transition (GO:1902750)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of histone phosphorylation (GO:0033128)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|nucleosome assembly (GO:0006334)	Barr body (GO:0001740)|condensed chromosome (GO:0000793)|extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleosome (GO:0000786)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|sex chromatin (GO:0001739)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|rDNA binding (GO:0000182)|transcription regulatory region DNA binding (GO:0044212)	p.M366I(1)|p.M363I(1)		endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCAGCTTGGCCATTTCCTGCA	0.463																																					p.M365I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1095C	5						.						139.0	126.0	131.0					5																	134670687		2203	4300	6503	134698586	SO:0001583	missense	9555	exon9			AF054174	CCDS4183.1, CCDS4184.1, CCDS4185.1	5q31.1	2011-01-27			ENSG00000113648	ENSG00000113648		"""Histones / Replication-independent"""	4740	protein-coding gene	gene with protein product		610054				9653160, 9714746	Standard	NM_004893		Approved	macroH2A1.2	uc003lam.1	O75367	OTTHUMG00000129141	ENST00000511689.1:c.1098G>C	5.37:g.134670687C>G	ENSP00000423563:p.Met366Ile	Somatic		Unspecified	Illumina	Phase_I	134698586	NM_004893	O75377|Q503A8|Q7Z5E3|Q96D41|Q9H8P3|Q9UP96	Missense_Mutation	SNP	ENST00000511689.1	37	CCDS4185.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.714237	0.68730	.	.	ENSG00000113648	ENST00000511689;ENST00000304332;ENST00000312469;ENST00000423969;ENST00000510038	T;T;T;T	0.24151	1.91;1.87;1.9;1.91	5.17	5.17	0.71159	Appr-1-p processing (1);	0.000000	0.85682	D	0.000000	T	0.48572	0.1507	M	0.66939	2.045	0.80722	D	1	P;B;P;B	0.49635	0.899;0.244;0.926;0.158	P;B;P;B	0.59825	0.462;0.231;0.864;0.116	T	0.47886	-0.9082	10	0.87932	D	0	.	18.8759	0.92334	0.0:1.0:0.0:0.0	.	194;365;363;366	B4DJC3;O75367-3;O75367-2;O75367	.;.;.;H2AY_HUMAN	I	366;365;363;194;366	ENSP00000423563:M366I;ENSP00000302572:M365I;ENSP00000310169:M363I;ENSP00000424971:M366I	ENSP00000302572:M365I	M	-	3	0	H2AFY	134698586	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.683000	0.91414	0.655000	0.94253	ATG		H2AFY-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251196.3	NM_004893	
PCDHA13	56136	broad.mit.edu	37	5	140263105	140263105	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3893-01	TCGA-AG-3893-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr5:140263105G>A	ENST00000289272.2	+	1	1252	c.1252G>A	c.(1252-1254)Gta>Ata	p.V418I	PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.V418I|PCDHA1_ENST00000504120.2_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	418	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V418I(2)		NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCGAGAGCGTATCAGCCTA	0.637																																					p.V418I	Melanoma(147;1739 1852 5500 27947 37288)											.	.	2	Substitution - Missense(2)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.G1252A	5						.						129.0	129.0	129.0					5																	140263105		2203	4300	6503	140243289	SO:0001583	missense	56136	exon1			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1252G>A	5.37:g.140263105G>A	ENSP00000289272:p.Val418Ile	Somatic		Unspecified	Illumina	Phase_I	140243289	NM_031865	O75277	Missense_Mutation	SNP	ENST00000289272.2	37	CCDS4240.1	.	.	.	.	.	.	.	.	.	.	G	1.597	-0.527658	0.04141	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.49139	0.79;0.79	5.19	0.3	0.15776	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.36138	0.0956	L	0.33792	1.035	0.09310	N	1	B;B;B	0.27416	0.178;0.085;0.148	B;B;B	0.29716	0.106;0.068;0.041	T	0.26258	-1.0108	9	0.41790	T	0.15	.	10.2037	0.43101	0.433:0.0:0.567:0.0	.	418;418;418	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	I	418	ENSP00000386821:V418I;ENSP00000289272:V418I	ENSP00000289272:V418I	V	+	1	0	PCDHA13	140243289	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	-0.312000	0.08113	-0.177000	0.10690	-0.459000	0.05422	GTA		PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
LIFR	3977	broad.mit.edu	37	5	38493781	38493781	+	Silent	SNP	C	C	T	rs142392717		TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr5:38493781C>T	ENST00000263409.4	-	14	2154	c.1992G>A	c.(1990-1992)tcG>tcA	p.S664S	LIFR_ENST00000503088.1_5'UTR|LIFR_ENST00000453190.2_Silent_p.S664S	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	664	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.		S -> L (in dbSNP:rs3729744).		cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.S664S(3)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					CCGACCGAGACGAGTTACACC	0.438			T	PLAG1	salivary adenoma																																p.S664S	Melanoma(13;4 730 6426 9861 34751)		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	.	3	Substitution - coding silent(3)	large_intestine(2)|breast(1)	c.G1992A	5						.	C	,	1,4405	2.1+/-5.4	0,1,2202	179.0	159.0	165.0		1992,1992	-8.2	0.0	5	dbSNP_134	165	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	LIFR	NM_001127671.1,NM_002310.5	,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,	664/1098,664/1098	38493781	2,13004	2203	4300	6503	38529538	SO:0001819	synonymous_variant	3977	exon14			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.1992G>A	5.37:g.38493781C>T		Somatic		Unspecified	Illumina	Phase_I	38529538	NM_001127671	Q6LCD9	Silent	SNP	ENST00000263409.4	37	CCDS3927.1																																																																																				LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
PCDHB2	56133	broad.mit.edu	37	5	140475487	140475487	+	Silent	SNP	C	C	T			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chr5:140475487C>T	ENST00000194155.4	+	1	1261	c.1113C>T	c.(1111-1113)agC>agT	p.S371S		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	371	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S371S(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGTATTCAGCGTTTCAGATC	0.433																																					p.S371S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1113T	5						.						66.0	61.0	63.0					5																	140475487		2203	4300	6503	140455671	SO:0001819	synonymous_variant	56133	exon1			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1113C>T	5.37:g.140475487C>T		Somatic		Unspecified	Illumina	Phase_I	140455671	NM_018936	Q4KMU1	Silent	SNP	ENST00000194155.4	37	CCDS4244.1																																																																																				PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
SSX6	280657	broad.mit.edu	37	X	47978945	47978945	+	RNA	SNP	C	C	A			TCGA-AG-3893-01	TCGA-AG-3893-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3893-01	TCGA-AG-3893-01	g.chrX:47978945C>A	ENST00000509958.1	+	0	94							Q7RTT6	SSX6_HUMAN	synovial sarcoma, X breakpoint 6 (pseudogene)						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.H166N(1)		large_intestine(6)|lung(4)|skin(2)|stomach(1)	13						TGCCTGGACCCACAGACTGCG	0.498																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	X						.						217.0	212.0	214.0					X																	47978945		2198	4288	6486	47863889			280657	.			BK000686		Xp11.23	2009-09-11	2009-08-26		ENSG00000171483	ENSG00000171483			19652	pseudogene	pseudogene		300541	"""SSX family pseudogene 2"", ""synovial sarcoma, X breakpoint 6"""	SSXP2		12216073	Standard	NR_028366		Approved	psiSSX2	uc011mlv.2	Q7RTT6	OTTHUMG00000021464		X.37:g.47978945C>A		Somatic		Unspecified	Illumina	Phase_I	47863889	.		Missense_Mutation	SNP	ENST00000509958.1	37		.	.	.	.	.	.	.	.	.	.	.	11.27	1.589255	0.28357	.	.	ENSG00000171483	ENST00000376932;ENST00000319275	T;T	0.49432	3.04;0.78	2.11	-4.22	0.03800	SSXRD motif (1);	0.997339	0.08118	N	0.995062	T	0.57257	0.2041	.	.	.	0.09310	N	1	D	0.69078	0.997	D	0.70487	0.969	T	0.53739	-0.8396	9	0.72032	D	0.01	.	3.214	0.06692	0.5163:0.2113:0.0:0.2723	.	166	Q7RTT6	SSX6_HUMAN	N	166;68	ENSP00000366131:H166N;ENSP00000325176:H68N	ENSP00000325176:H68N	H	+	1	0	SSX6	47863889	0.000000	0.05858	0.000000	0.03702	0.082000	0.17680	-2.312000	0.01127	-1.602000	0.01599	0.279000	0.19357	CAC		SSX6-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000362117.1	NR_028366	
