#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HSF4	3299	broad.mit.edu	37	16	67201665	67201666	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AG-4008-01	TCGA-AG-4008-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr16:67201665_67201666insG	ENST00000521374.1	+	9	897_898	c.897_898insG	c.(898-900)gggfs	p.G300fs	HSF4_ENST00000421453.1_Intron|NOL3_ENST00000432069.2_5'Flank|NOL3_ENST00000564053.1_5'Flank|HSF4_ENST00000264009.8_Frame_Shift_Ins_p.G300fs|HSF4_ENST00000584272.1_Intron			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	300	Interactions with DUSP26, MAPK1 and MAPK2.				camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.D302fs*14(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		CGGCCAGTCCAGGGGGGGATGG	0.649																																					p.P299fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.897_898insG	16						.																																			65759167	SO:0001589	frameshift_variant	3299	exon11			D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.904dupG	16.37:g.67201672_67201672dupG	ENSP00000430947:p.Gly300fs	Somatic		Unspecified	Illumina	Phase_I	65759166	NM_001040667	Q99472|Q9ULV6	Frame_Shift_Ins	INS	ENST00000521374.1	37	CCDS42175.1																																																																																				HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375080.1	NM_001538	
PMS2	5395	broad.mit.edu	37	7	6029489	6029489	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr7:6029489C>T	ENST00000265849.7	-	10	1191	c.1086G>A	c.(1084-1086)atG>atA	p.M362I	PMS2_ENST00000382321.4_Intron|PMS2_ENST00000469652.1_Intron|PMS2_ENST00000406569.3_Missense_Mutation_p.M362I|PMS2_ENST00000441476.2_Missense_Mutation_p.M256I	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	362					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)	p.M362I(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		CACTATCAAACATTCCTATCA	0.363			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.M362I		yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1086A	7						.						119.0	114.0	116.0					7																	6029489		2203	4300	6503	5996015	SO:0001583	missense	5395	exon10	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.1086G>A	7.37:g.6029489C>T	ENSP00000265849:p.Met362Ile	Somatic		Unspecified	Illumina	Phase_I	5996015	NM_000535	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Missense_Mutation	SNP	ENST00000265849.7	37	CCDS5343.1	.	.	.	.	.	.	.	.	.	.	c	23.8	4.456063	0.84209	.	.	ENSG00000122512	ENST00000265849;ENST00000382322;ENST00000441476;ENST00000406569	T;T;T	0.80393	-1.37;-1.37;-1.37	5.73	5.73	0.89815	Ribosomal protein S5 domain 2-type fold (1);	0.088281	0.85682	D	0.000000	T	0.74906	0.3778	L	0.33189	0.99	0.58432	D	0.999999	B;P;P	0.47191	0.266;0.891;0.865	B;B;B	0.43123	0.096;0.409;0.264	T	0.70978	-0.4725	10	0.15066	T	0.55	-22.4835	19.964	0.97260	0.0:1.0:0.0:0.0	.	362;362;256	P54278-3;P54278;C9J167	.;PMS2_HUMAN;.	I	362;315;256;362	ENSP00000265849:M362I;ENSP00000392843:M256I;ENSP00000384308:M362I	ENSP00000265849:M362I	M	-	3	0	PMS2	5996015	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.634000	0.61325	2.719000	0.93026	0.650000	0.86243	ATG		PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535	
TNS3	64759	broad.mit.edu	37	7	47342865	47342865	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr7:47342865G>A	ENST00000398879.1	-	22	3506	c.3140C>T	c.(3139-3141)gCg>gTg	p.A1047V	TNS3_ENST00000355730.3_Missense_Mutation_p.A807V|TNS3_ENST00000311160.9_Missense_Mutation_p.A1047V			Q68CZ2	TENS3_HUMAN	tensin 3	1047				A -> T (in Ref. 4; CAH18438). {ECO:0000305}.	cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)		p.A1047V(1)		NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						GGTCGGTGACGCTCCATGAGA	0.672																																					p.A1047V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3140T	7						.						17.0	21.0	19.0					7																	47342865		2024	4163	6187	47309390	SO:0001583	missense	64759	exon22			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.3140C>T	7.37:g.47342865G>A	ENSP00000381854:p.Ala1047Val	Somatic		Unspecified	Illumina	Phase_I	47309390	NM_022748	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	ENST00000398879.1	37	CCDS5506.2	.	.	.	.	.	.	.	.	.	.	G	4.881	0.163753	0.09287	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000355730;ENST00000545849;ENST00000457718	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.51	1.64	0.23874	.	1.484980	0.04979	N	0.465343	T	0.32406	0.0828	L	0.32530	0.975	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.24764	-1.0151	10	0.49607	T	0.09	-2.7576	5.1032	0.14770	0.2504:0.1494:0.6002:0.0	.	1047	Q68CZ2	TENS3_HUMAN	V	1047;1157;1047;807;503;1150	ENSP00000312143:A1047V;ENSP00000381854:A1047V;ENSP00000347968:A807V;ENSP00000414358:A1150V	ENSP00000312143:A1047V	A	-	2	0	TNS3	47309390	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.771000	0.26633	0.022000	0.15160	-0.228000	0.12330	GCG		TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
PCIF1	63935	broad.mit.edu	37	20	44569123	44569123	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-4008-01	TCGA-AG-4008-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr20:44569123T>A	ENST00000372409.3	+	5	623	c.259T>A	c.(259-261)Ttg>Atg	p.L87M		NM_022104.3	NP_071387.1	Q9H4Z3	PCIF1_HUMAN	PDX1 C-terminal inhibiting factor 1	87					negative regulation of phosphatase activity (GO:0010923)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)		p.L87M(1)		central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	20						GTCGGACCCTTTGGGGCTGAA	0.627																																					p.L87M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T259A	20						.						24.0	20.0	21.0					20																	44569123		2203	4300	6503	44002530	SO:0001583	missense	63935	exon5			AB050014	CCDS13388.1	20q13.12	2014-06-13	2008-04-29	2008-04-29	ENSG00000100982	ENSG00000100982			16200	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 121"""		"""chromosome 20 open reading frame 67"""	C20orf67		12565871, 15121856	Standard	NM_022104		Approved	bA465L10.1, PPP1R121	uc002xqs.3	Q9H4Z3	OTTHUMG00000032635	ENST00000372409.3:c.259T>A	20.37:g.44569123T>A	ENSP00000361486:p.Leu87Met	Somatic		Unspecified	Illumina	Phase_I	44002530	NM_022104	E1P5P1|Q54AB9|Q9NT85	Missense_Mutation	SNP	ENST00000372409.3	37	CCDS13388.1	.	.	.	.	.	.	.	.	.	.	T	17.55	3.418012	0.62622	.	.	ENSG00000100982	ENST00000372409;ENST00000443130	.	.	.	5.02	3.89	0.44902	.	0.000000	0.64402	D	0.000001	T	0.71728	0.3374	M	0.77103	2.36	0.49389	D	0.999786	D	0.89917	1.0	D	0.91635	0.999	T	0.71656	-0.4527	9	0.66056	D	0.02	-13.6608	6.3465	0.21353	0.0:0.2003:0.0:0.7997	.	87	Q9H4Z3	PCIF1_HUMAN	M	87	.	ENSP00000361486:L87M	L	+	1	2	PCIF1	44002530	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.499000	0.35671	0.897000	0.36392	0.482000	0.46254	TTG		PCIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079550.1	NM_022104	
CDH22	64405	broad.mit.edu	37	20	44803566	44803566	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr20:44803566C>A	ENST00000372262.3	-	11	2466	c.2066G>T	c.(2065-2067)cGg>cTg	p.R689L	CDH22_ENST00000537909.1_Missense_Mutation_p.R689L	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	689					brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R689L(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				GTAGAGGCTCCGCAGCGCCGA	0.721																																					p.R689L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2066T	20						.						19.0	20.0	19.0					20																	44803566		2069	4185	6254	44236973	SO:0001583	missense	64405	exon11			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.2066G>T	20.37:g.44803566C>A	ENSP00000361336:p.Arg689Leu	Somatic		Unspecified	Illumina	Phase_I	44236973	NM_021248	B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	37	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.916295	0.92249	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.78924	-1.22;-1.22	3.89	3.89	0.44902	Cadherin, cytoplasmic domain (1);	0.000000	0.64402	D	0.000001	D	0.88529	0.6461	M	0.84433	2.695	0.46774	D	0.999193	D	0.89917	1.0	D	0.91635	0.999	D	0.90591	0.4537	10	0.66056	D	0.02	.	15.0128	0.71562	0.0:1.0:0.0:0.0	.	689	Q9UJ99	CAD22_HUMAN	L	689	ENSP00000361336:R689L;ENSP00000437790:R689L	ENSP00000361336:R689L	R	-	2	0	CDH22	44236973	0.995000	0.38212	1.000000	0.80357	0.993000	0.82548	2.965000	0.49200	1.999000	0.58509	0.563000	0.77884	CGG		CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
SLC13A3	64849	broad.mit.edu	37	20	45242331	45242331	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr20:45242331C>A	ENST00000279027.4	-	2	163	c.145G>T	c.(145-147)Gcg>Tcg	p.A49S	SLC13A3_ENST00000290317.5_Missense_Mutation_p.A2S|SLC13A3_ENST00000472148.1_Missense_Mutation_p.A2S|SLC13A3_ENST00000372121.1_Missense_Mutation_p.A49S|SLC13A3_ENST00000435032.1_5'UTR|SLC13A3_ENST00000417157.2_Missense_Mutation_p.A2S|SLC13A3_ENST00000413164.2_Missense_Mutation_p.A49S|SLC13A3_ENST00000396360.1_Missense_Mutation_p.A2S|SLC13A3_ENST00000495082.1_Missense_Mutation_p.A2S|SLC13A3_ENST00000339636.3_Missense_Mutation_p.A49S	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	49					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)	p.A49S(2)		breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	CAGTACACCGCCATGAGCAGG	0.642																																					p.A49S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G145T	20						.						46.0	36.0	39.0					20																	45242331		2203	4300	6503	44675738	SO:0001583	missense	64849	exon2			AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.145G>T	20.37:g.45242331C>A	ENSP00000279027:p.Ala49Ser	Somatic		Unspecified	Illumina	Phase_I	44675738	NM_001193339	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	ENST00000279027.4	37	CCDS13400.1	.	.	.	.	.	.	.	.	.	.	C	35	5.492854	0.96339	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082;ENST00000468915;ENST00000420568;ENST00000372121;ENST00000417157;ENST00000339636	T;T;T;T;T;T;T;T;T;T;T	0.03242	4.0;4.0;4.0;4.0;4.0;4.0;4.0;4.0;4.0;4.0;4.0	5.67	5.67	0.87782	.	0.103441	0.64402	D	0.000003	T	0.21186	0.0510	M	0.78456	2.415	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;1.0;0.999;1.0	T	0.00074	-1.2124	10	0.87932	D	0	-18.8515	19.7691	0.96356	0.0:1.0:0.0:0.0	.	49;2;2;2;49	B4DIR8;Q8WWT9-3;F6WI18;C9J4A3;Q8WWT9	.;.;.;.;S13A3_HUMAN	S	2;2;49;2;49;2;2;12;49;2;49	ENSP00000290317:A2S;ENSP00000379648:A2S;ENSP00000279027:A49S;ENSP00000420177:A2S;ENSP00000415852:A49S;ENSP00000419621:A2S;ENSP00000417784:A2S;ENSP00000395095:A12S;ENSP00000361193:A49S;ENSP00000397955:A2S;ENSP00000344912:A49S	ENSP00000279027:A49S	A	-	1	0	SLC13A3	44675738	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.445000	0.80570	2.689000	0.91719	0.462000	0.41574	GCG		SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2		
KCNB1	3745	broad.mit.edu	37	20	47991335	47991335	+	Silent	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr20:47991335C>T	ENST00000371741.4	-	2	928	c.762G>A	c.(760-762)aaG>aaA	p.K254K		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	254					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)	p.K254K(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	AGAACTTCCACTTCTTGGGCG	0.557																																					p.K254K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G762A	20						.						80.0	71.0	74.0					20																	47991335		2203	4300	6503	47424742	SO:0001819	synonymous_variant	3745	exon2			AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.762G>A	20.37:g.47991335C>T		Somatic		Unspecified	Illumina	Phase_I	47424742	NM_004975	Q14193	Silent	SNP	ENST00000371741.4	37	CCDS13418.1																																																																																				KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975	
ZCCHC3	85364	broad.mit.edu	37	20	278688	278690	+	In_Frame_Del	DEL	CGG	CGG	-	rs11468351|rs5839847|rs6147263	byFrequency	TCGA-AG-4008-01	TCGA-AG-4008-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr20:278688_278690delCGG	ENST00000382352.3	+	1	952_954	c.461_463delCGG	c.(460-465)ccggcg>ccg	p.A159del		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	159	Poly-Ala.						poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A159delA(3)		endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CAGGATGAgccggcggcggcggc	0.768														4335	0.865615	0.8343	0.9395	5008	,	,		8937	0.8065		0.9423	False		,,,				2504	0.8374				p.154_155del												.	.	3	Deletion - In frame(3)	prostate(2)|large_intestine(1)	c.461_463del	20						.																																			226690	SO:0001651	inframe_deletion	85364	exon1			AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.461_463delCGG	20.37:g.278697_278699delCGG	ENSP00000371789:p.Ala159del	Somatic		Unspecified	Illumina	Phase_I	226688	NM_033089	Q3B7J3|Q6NT79	In_Frame_Del	DEL	ENST00000382352.3	37	CCDS42844.1																																																																																				ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077447.1		
ZNF831	128611	broad.mit.edu	37	20	57767575	57767575	+	Missense_Mutation	SNP	G	G	A	rs546116387		TCGA-AG-4008-01	TCGA-AG-4008-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr20:57767575G>A	ENST00000371030.2	+	1	1501	c.1501G>A	c.(1501-1503)Gtc>Atc	p.V501I		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	501							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.V501I(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					ATGTGTCCCCGTCACCAGGAG	0.687													.|||	1	0.000199681	0.0008	0.0	5008	,	,		14593	0.0		0.0	False		,,,				2504	0.0				p.V501I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1501A	20						.						19.0	23.0	21.0					20																	57767575		1969	4128	6097	57200970	SO:0001583	missense	128611	exon1			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.1501G>A	20.37:g.57767575G>A	ENSP00000360069:p.Val501Ile	Somatic		Unspecified	Illumina	Phase_I	57200970	NM_178457	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	7.684	0.689654	0.14973	.	.	ENSG00000124203	ENST00000371030	T	0.10960	2.82	5.21	4.26	0.50523	.	.	.	.	.	T	0.06234	0.0161	N	0.05078	-0.115	0.18873	N	0.999986	D	0.56968	0.978	B	0.44085	0.44	T	0.24835	-1.0149	9	0.42905	T	0.14	-16.1228	8.1202	0.30967	0.0801:0.0:0.7642:0.1558	.	501	Q5JPB2	ZN831_HUMAN	I	501	ENSP00000360069:V501I	ENSP00000360069:V501I	V	+	1	0	ZNF831	57200970	0.059000	0.20769	0.823000	0.32752	0.571000	0.35966	0.315000	0.19451	1.186000	0.42985	0.655000	0.94253	GTC		ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
OR11H12	440153	broad.mit.edu	37	14	19377838	19377838	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr14:19377838C>T	ENST00000550708.1	+	1	317	c.245C>T	c.(244-246)tCc>tTc	p.S82F		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	82						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S82F(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GGAAATTTCTCCTTTTTAGAG	0.423																																					p.S82F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C245T	14						.						41.0	50.0	47.0					14																	19377838		1971	4084	6055	18447838	SO:0001583	missense	440153	exon1				CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.245C>T	14.37:g.19377838C>T	ENSP00000449002:p.Ser82Phe	Somatic		Unspecified	Illumina	Phase_I	18447838	NM_001013354		Missense_Mutation	SNP	ENST00000550708.1	37	CCDS32017.1	.	.	.	.	.	.	.	.	.	.	c	10.28	1.305674	0.23736	.	.	ENSG00000257115	ENST00000550708	T	0.12361	2.69	0.585	0.585	0.17428	GPCR, rhodopsin-like superfamily (1);	0.171384	0.27447	N	0.019339	T	0.42630	0.1211	H	0.95539	3.685	0.25486	N	0.9877	D	0.89917	1.0	D	0.83275	0.996	T	0.57723	-0.7762	9	0.87932	D	0	.	7.1009	0.25336	0.0:0.9999:0.0:1.0E-4	.	82	B2RN74	O11HC_HUMAN	F	82	ENSP00000449002:S82F	ENSP00000449002:S82F	S	+	2	0	CR383656.1	18447838	0.178000	0.23122	0.997000	0.53966	0.280000	0.26924	1.272000	0.33109	0.619000	0.30197	0.064000	0.15345	TCC		OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408402.1	NM_001013354	
OR4N2	390429	broad.mit.edu	37	14	20296294	20296294	+	Silent	SNP	T	T	C			TCGA-AG-4008-01	TCGA-AG-4008-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr14:20296294T>C	ENST00000315947.1	+	1	687	c.687T>C	c.(685-687)tcT>tcC	p.S229S	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S229S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GAGGGTCTTCTTCTGAGGCAA	0.488																																					p.S229S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T687C	14						.						107.0	108.0	108.0					14																	20296294		2203	4300	6503	19366134	SO:0001819	synonymous_variant	390429	exon1				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.687T>C	14.37:g.20296294T>C		Somatic		Unspecified	Illumina	Phase_I	19366134	NM_001004723	Q6IEY9|Q6IFA2	Silent	SNP	ENST00000315947.1	37	CCDS32022.1																																																																																				OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2		
BMP4	652	broad.mit.edu	37	14	54417346	54417346	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr14:54417346G>A	ENST00000245451.4	-	4	1024	c.631C>T	c.(631-633)Cgg>Tgg	p.R211W	BMP4_ENST00000558984.1_Missense_Mutation_p.R211W|BMP4_ENST00000559087.1_Missense_Mutation_p.R211W|MIR5580_ENST00000580850.1_RNA|BMP4_ENST00000417573.1_Missense_Mutation_p.R211W	NM_001202.3	NP_001193.2	P12644	BMP4_HUMAN	bone morphogenetic protein 4	211					activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification (GO:0009948)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|BMP signaling pathway involved in nephric duct formation (GO:0071893)|BMP signaling pathway involved in renal system segmentation (GO:0061151)|BMP signaling pathway involved in ureter morphogenesis (GO:0061149)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bronchus development (GO:0060433)|bud dilation involved in lung branching (GO:0060503)|bud elongation involved in lung branching (GO:0060449)|cardiac septum development (GO:0003279)|cellular response to growth factor stimulus (GO:0071363)|chondrocyte differentiation (GO:0002062)|cloacal septation (GO:0060197)|common-partner SMAD protein phosphorylation (GO:0007182)|cranial suture morphogenesis (GO:0060363)|deltoid tuberosity development (GO:0035993)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint morphogenesis (GO:0060272)|endocardial cushion development (GO:0003197)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in lung morphogenesis (GO:0060502)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal cell signaling (GO:0060684)|erythrocyte differentiation (GO:0030218)|extracellular matrix organization (GO:0030198)|germ cell development (GO:0007281)|glomerular capillary formation (GO:0072104)|glomerular visceral epithelial cell development (GO:0072015)|hematopoietic progenitor cell differentiation (GO:0002244)|inner ear receptor cell differentiation (GO:0060113)|intermediate mesodermal cell differentiation (GO:0048392)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lymphoid progenitor cell differentiation (GO:0002320)|macrophage differentiation (GO:0030225)|mammary gland formation (GO:0060592)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|mesenchymal cell proliferation involved in ureter development (GO:0072198)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate determination (GO:0007500)|mesonephros development (GO:0001823)|metanephric collecting duct development (GO:0072205)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway (GO:0072097)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in heart morphogenesis (GO:2000137)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of glomerulus development (GO:0090194)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell proliferation involved in ureter development (GO:0072200)|negative regulation of metanephric comma-shaped body morphogenesis (GO:2000007)|negative regulation of metanephric S-shaped body morphogenesis (GO:2000005)|negative regulation of mitosis (GO:0045839)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of cardiac muscle fiber development (GO:0055020)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell death (GO:0010942)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epidermal cell differentiation (GO:0045606)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of kidney development (GO:0090184)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|pulmonary artery endothelial tube morphogenesis (GO:0061155)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|renal system process (GO:0003014)|secondary heart field specification (GO:0003139)|SMAD protein signal transduction (GO:0060395)|smooth muscle tissue development (GO:0048745)|smoothened signaling pathway (GO:0007224)|specification of organ position (GO:0010159)|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway (GO:0072101)|steroid hormone mediated signaling pathway (GO:0043401)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|tendon cell differentiation (GO:0035990)|trachea development (GO:0060438)|trachea formation (GO:0060440)|type B pancreatic cell development (GO:0003323)|ureter epithelial cell differentiation (GO:0072192)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	BMP receptor binding (GO:0070700)|chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|heparin binding (GO:0008201)	p.R211W(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(3)|urinary_tract(1)	19						GTTTCCCACCGTGTCACATTG	0.537																																					p.R211W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C631T	14						.						110.0	101.0	104.0					14																	54417346		2203	4300	6503	53487096	SO:0001583	missense	652	exon4			AF035427	CCDS9715.1	14q22-q23	2014-01-30			ENSG00000125378	ENSG00000125378		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1071	protein-coding gene	gene with protein product		112262		BMP2B		7558046, 7579580	Standard	NM_001202		Approved		uc010aoh.3	P12644	OTTHUMG00000140303	ENST00000245451.4:c.631C>T	14.37:g.54417346G>A	ENSP00000245451:p.Arg211Trp	Somatic		Unspecified	Illumina	Phase_I	53487096	NM_130851	Q9UM80	Missense_Mutation	SNP	ENST00000245451.4	37	CCDS9715.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.413920	0.62511	.	.	ENSG00000125378	ENST00000245451;ENST00000417573	T;T	0.65916	-0.18;-0.18	5.09	4.19	0.49359	Transforming growth factor-beta, N-terminal (1);	0.417987	0.27126	N	0.020803	T	0.75722	0.3888	M	0.76727	2.345	0.34982	D	0.754164	D	0.64830	0.994	P	0.61722	0.893	D	0.84829	0.0801	10	0.87932	D	0	.	14.0622	0.64806	0.0:0.0:0.8482:0.1518	.	211	P12644	BMP4_HUMAN	W	211	ENSP00000245451:R211W;ENSP00000394165:R211W	ENSP00000245451:R211W	R	-	1	2	BMP4	53487096	0.970000	0.33590	1.000000	0.80357	0.997000	0.91878	2.864000	0.48404	1.355000	0.45865	0.655000	0.94253	CGG		BMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276894.2	NM_001202	
SLC25A47	283600	broad.mit.edu	37	14	100793639	100793639	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr14:100793639G>A	ENST00000361529.3	+	4	337	c.259G>A	c.(259-261)Ggc>Agc	p.G87S	SLC25A47_ENST00000557052.1_5'UTR	NM_207117.2	NP_997000.2	Q6Q0C1	S2547_HUMAN	solute carrier family 25, member 47	87					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.G87S(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	13						GCTCCGGTACGGCAACCCTGA	0.692																																					p.G87S	GBM(11;1289 1351)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G259A	14						.						91.0	88.0	89.0					14																	100793639		2203	4300	6503	99863392	SO:0001583	missense	283600	exon4				CCDS9959.1	14q32.2	2013-05-22	2010-07-19	2010-07-19	ENSG00000140107	ENSG00000140107		"""Solute carriers"""	20115	protein-coding gene	gene with protein product		609911	"""chromosome 14 open reading frame 68"""	C14orf68			Standard	NM_207117		Approved		uc001yhc.3	Q6Q0C1	OTTHUMG00000171571	ENST00000361529.3:c.259G>A	14.37:g.100793639G>A	ENSP00000354886:p.Gly87Ser	Somatic		Unspecified	Illumina	Phase_I	99863392	NM_207117	B2RP39|Q68CL2|Q6PZD8|Q86U14	Missense_Mutation	SNP	ENST00000361529.3	37	CCDS9959.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.762369	0.49468	.	.	ENSG00000140107	ENST00000361529	T	0.77489	-1.1	4.95	4.95	0.65309	Mitochondrial carrier domain (2);	0.263229	0.43416	D	0.000576	T	0.62624	0.2443	N	0.12182	0.205	0.80722	D	1	B	0.26876	0.162	B	0.20384	0.029	T	0.61262	-0.7098	10	0.39692	T	0.17	-16.9087	16.5884	0.84745	0.0:0.0:1.0:0.0	.	87	Q6Q0C1	S2547_HUMAN	S	87	ENSP00000354886:G87S	ENSP00000354886:G87S	G	+	1	0	SLC25A47	99863392	0.997000	0.39634	0.900000	0.35374	0.520000	0.34377	2.840000	0.48215	2.599000	0.87857	0.485000	0.47835	GGC		SLC25A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414231.1		
GGTLC2	91227	broad.mit.edu	37	22	22989502	22989502	+	Silent	SNP	C	C	T	rs149680064		TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr22:22989502C>T	ENST00000480559.1	+	3	354	c.354C>T	c.(352-354)gaC>gaT	p.D118D	POM121L1P_ENST00000402027.1_RNA|GGTLC2_ENST00000448514.1_Silent_p.D118D	NM_199127.2	NP_954578.2	Q14390	GGTL2_HUMAN	gamma-glutamyltransferase light chain 2	118					glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)	gamma-glutamyltransferase activity (GO:0003840)	p.D118D(1)		endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	11	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.3e-31)|Acute lymphoblastic leukemia(6;5.54e-23)		READ - Rectum adenocarcinoma(21;0.145)		TGGGCCAGGACGGCCAGGTCC	0.647																																					p.D118D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C354T	22						.						55.0	65.0	61.0					22																	22989502		2203	4296	6499	21319502	SO:0001819	synonymous_variant	91227	exon3			X98922	CCDS13802.2	22q11.21	2008-03-25	2008-03-10	2008-03-10	ENSG00000100121	ENSG00000100121		"""Gamma-glutamyltransferases"""	18596	protein-coding gene	gene with protein product		612339	"""gamma-glutamyltransferase-like 4"""	GGTL4		9074928, 18357469	Standard	NM_199127		Approved		uc010gtt.2	Q14390	OTTHUMG00000151177	ENST00000480559.1:c.354C>T	22.37:g.22989502C>T		Somatic		Unspecified	Illumina	Phase_I	21319502	NM_199127	A1A516|A2VCM9|Q5NV76|Q6ISH0	Silent	SNP	ENST00000480559.1	37	CCDS13802.2																																																																																				GGTLC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321662.1	NM_199127	
SEZ6L	23544	broad.mit.edu	37	22	26709847	26709847	+	Missense_Mutation	SNP	G	G	A	rs150114413		TCGA-AG-4008-01	TCGA-AG-4008-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr22:26709847G>A	ENST00000248933.6	+	9	2089	c.1994G>A	c.(1993-1995)cGg>cAg	p.R665Q	SEZ6L_ENST00000529632.2_Missense_Mutation_p.R665Q|SEZ6L_ENST00000403121.1_Missense_Mutation_p.R438Q|SEZ6L_ENST00000404234.3_Missense_Mutation_p.R665Q|SEZ6L_ENST00000343706.4_Missense_Mutation_p.R665Q|SEZ6L_ENST00000402979.1_Missense_Mutation_p.R438Q|SEZ6L_ENST00000360929.3_Missense_Mutation_p.R665Q			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	665	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.R665Q(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						GAAGAGAAACGGATCTTCTTA	0.463																																					p.R665Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1994A	22						.	G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	140.0	133.0	136.0		1994,1994,1994,1994,1994,1994	4.7	1.0	22	dbSNP_134	136	0,8600		0,0,4300	yes	missense,missense,missense,missense,missense,missense	SEZ6L	NM_001184773.1,NM_001184774.1,NM_001184775.1,NM_001184776.1,NM_001184777.1,NM_021115.4	43,43,43,43,43,43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	665/1024,665/1014,665/1012,665/950,665/949,665/1025	26709847	1,13005	2203	4300	6503	25039847	SO:0001583	missense	23544	exon9			AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1994G>A	22.37:g.26709847G>A	ENSP00000248933:p.Arg665Gln	Somatic		Unspecified	Illumina	Phase_I	25039847	NM_001184776	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	G	35	5.432254	0.96150	2.27E-4	0.0	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27;2.27	4.65	4.65	0.58169	CUB (5);	0.000000	0.51477	D	0.000089	T	0.39911	0.1096	M	0.70595	2.14	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.983;0.999;0.983;1.0;0.999;0.999;0.999	P;D;P;D;D;P;P	0.63597	0.753;0.915;0.77;0.916;0.916;0.886;0.886	T	0.31110	-0.9955	10	0.66056	D	0.02	.	16.7223	0.85413	0.0:0.0:1.0:0.0	.	665;665;438;665;665;665;665	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	Q	665;665;665;665;665;438;438	ENSP00000384772:R665Q;ENSP00000437037:R665Q;ENSP00000354185:R665Q;ENSP00000248933:R665Q;ENSP00000342661:R665Q;ENSP00000384838:R438Q;ENSP00000384733:R438Q	ENSP00000248933:R665Q	R	+	2	0	SEZ6L	25039847	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.085000	0.94083	2.422000	0.82143	0.561000	0.74099	CGG		SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		
GMIP	51291	broad.mit.edu	37	19	19745480	19745480	+	Silent	SNP	G	G	A	rs367883715		TCGA-AG-4008-01	TCGA-AG-4008-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr19:19745480G>A	ENST00000203556.4	-	18	2057	c.1920C>T	c.(1918-1920)taC>taT	p.Y640Y	GMIP_ENST00000587238.1_Silent_p.Y614Y|GMIP_ENST00000445806.2_Silent_p.Y611Y|GMIP_ENST00000586269.1_Intron	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	640	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)	p.Y640Y(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						TGAAGGCGTCGTAGAGGTGGA	0.672													G|||	1	0.000199681	0.0	0.0	5008	,	,		18158	0.0		0.001	False		,,,				2504	0.0				p.Y640Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1920T	19						.	G		0,4406		0,0,2203	132.0	135.0	134.0		1920	3.5	1.0	19		134	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	GMIP	NM_016573.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		640/971	19745480	1,13005	2203	4300	6503	19606480	SO:0001819	synonymous_variant	51291	exon18			AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.1920C>T	19.37:g.19745480G>A		Somatic		Unspecified	Illumina	Phase_I	19606480	NM_016573	A0AVN9|B7ZLZ0	Silent	SNP	ENST00000203556.4	37	CCDS12408.1																																																																																				GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460551.1	NM_016573	
ZNF492	57615	broad.mit.edu	37	19	22847996	22847996	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4008-01	TCGA-AG-4008-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr19:22847996A>G	ENST00000456783.2	+	4	1769	c.1525A>G	c.(1525-1527)Agt>Ggt	p.S509G	CTC-457E21.9_ENST00000601860.1_RNA	NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	509					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S509G(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				CAAACCTGAAAGTTGTAACAA	0.338																																					p.S509G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1525G	19						.						13.0	14.0	14.0					19																	22847996		1810	4057	5867	22639836	SO:0001583	missense	57615	exon4			AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.1525A>G	19.37:g.22847996A>G	ENSP00000413660:p.Ser509Gly	Somatic		Unspecified	Illumina	Phase_I	22639836	NM_020855	Q08EI7|Q08EI8	Missense_Mutation	SNP	ENST00000456783.2	37	CCDS46032.1	.	.	.	.	.	.	.	.	.	.	.	4.917	0.170329	0.09339	.	.	ENSG00000229676	ENST00000456783	T	0.07800	3.16	1.03	-1.4	0.08968	.	.	.	.	.	T	0.04227	0.0117	N	0.12887	0.27	0.09310	N	1	B	0.22480	0.07	B	0.22753	0.041	T	0.40421	-0.9564	9	0.62326	D	0.03	.	3.7962	0.08740	0.3597:0.0:0.6403:0.0	.	509	Q9P255	ZN492_HUMAN	G	509	ENSP00000413660:S509G	ENSP00000413660:S509G	S	+	1	0	ZNF492	22639836	0.000000	0.05858	0.045000	0.18777	0.406000	0.30931	-1.059000	0.03479	-0.373000	0.07979	0.128000	0.15822	AGT		ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464581.1	NM_020855	
ZNF91	7644	broad.mit.edu	37	19	23544847	23544847	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr19:23544847G>A	ENST00000300619.7	-	4	1139	c.934C>T	c.(934-936)Cat>Tat	p.H312Y	ZNF91_ENST00000397082.2_Missense_Mutation_p.H280Y|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	312					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.H312Y(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				ATTCTCTTATGTTTAGCAAGG	0.393																																					p.H312Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C934T	19						.						71.0	75.0	73.0					19																	23544847		2157	4284	6441	23336687	SO:0001583	missense	7644	exon4			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.934C>T	19.37:g.23544847G>A	ENSP00000300619:p.His312Tyr	Somatic		Unspecified	Illumina	Phase_I	23336687	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.628819	0.28978	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	D;D	0.86769	-2.17;-2.17	1.97	1.97	0.26223	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93746	0.8001	H	0.97918	4.105	0.18873	N	0.999988	P;D	0.58970	0.71;0.984	B;P	0.52267	0.3;0.694	D	0.86791	0.1985	9	0.87932	D	0	.	10.9757	0.47465	0.0:0.0:1.0:0.0	.	280;312	Q05481-2;Q05481	.;ZNF91_HUMAN	Y	312;280	ENSP00000300619:H312Y;ENSP00000380272:H280Y	ENSP00000300619:H312Y	H	-	1	0	ZNF91	23336687	1.000000	0.71417	0.001000	0.08648	0.005000	0.04900	6.514000	0.73746	1.100000	0.41517	0.162000	0.16502	CAT		ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
ARHGAP33	115703	broad.mit.edu	37	19	36275939	36275939	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr19:36275939G>A	ENST00000007510.4	+	17	1796	c.1652G>A	c.(1651-1653)cGc>cAc	p.R551H	ARHGAP33_ENST00000314737.5_Missense_Mutation_p.R551H|ARHGAP33_ENST00000378944.5_Missense_Mutation_p.R415H			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	551					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)	p.R551H(1)		endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						GCCCAGGCACGCACCCAGGGC	0.721																																					p.R551H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1652A	19						.						4.0	6.0	5.0					19																	36275939		2071	4083	6154	40967779	SO:0001583	missense	115703	exon17			AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.1652G>A	19.37:g.36275939G>A	ENSP00000007510:p.Arg551His	Somatic		Unspecified	Illumina	Phase_I	40967779	NM_052948	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	37		.	.	.	.	.	.	.	.	.	.	G	15.35	2.806571	0.50421	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.13307	2.85;2.6;2.94	4.41	3.34	0.38264	.	0.000000	0.64402	D	0.000003	T	0.30448	0.0765	L	0.54323	1.7	0.30718	N	0.748517	D;D;D	0.89917	1.0;1.0;0.996	D;D;P	0.74348	0.972;0.983;0.73	T	0.16630	-1.0396	10	0.59425	D	0.04	.	13.3979	0.60865	0.0:0.1593:0.8407:0.0	.	551;415;551	O14559;O14559-10;O14559-11	RHG33_HUMAN;.;.	H	551;551;415	ENSP00000007510:R551H;ENSP00000320038:R551H;ENSP00000368227:R415H	ENSP00000007510:R551H	R	+	2	0	ARHGAP33	40967779	0.994000	0.37717	0.676000	0.29932	0.169000	0.22640	7.310000	0.78947	1.059000	0.40554	0.305000	0.20034	CGC		ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
RSPH6A	81492	broad.mit.edu	37	19	46299141	46299141	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr19:46299141C>T	ENST00000221538.3	-	6	2282	c.2140G>A	c.(2140-2142)Gag>Aag	p.E714K	RSPH6A_ENST00000597055.1_3'UTR|RSPH6A_ENST00000600188.1_Missense_Mutation_p.E450K	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	714	Glu-rich.					intracellular (GO:0005622)		p.E714K(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						TCATCTGTctcctcgccctcc	0.557																																					p.E714K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2140A	19						.						71.0	74.0	73.0					19																	46299141		2202	4300	6502	50990981	SO:0001583	missense	81492	exon6			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.2140G>A	19.37:g.46299141C>T	ENSP00000221538:p.Glu714Lys	Somatic		Unspecified	Illumina	Phase_I	50990981	NM_030785	Q53FE2|Q6PEZ9	Missense_Mutation	SNP	ENST00000221538.3	37	CCDS12675.1	.	.	.	.	.	.	.	.	.	.	c	14.91	2.675247	0.47781	.	.	ENSG00000104941	ENST00000221538	T	0.16897	2.31	4.16	4.16	0.48862	.	0.239640	0.40554	N	0.001077	T	0.15998	0.0385	L	0.43923	1.385	0.35045	D	0.76007	B	0.29432	0.244	B	0.21917	0.037	T	0.22208	-1.0223	10	0.87932	D	0	-13.0601	14.4001	0.67037	0.0:1.0:0.0:0.0	.	714	Q9H0K4	RSH6A_HUMAN	K	714	ENSP00000221538:E714K	ENSP00000221538:E714K	E	-	1	0	RSPH6A	50990981	1.000000	0.71417	0.943000	0.38184	0.052000	0.14988	4.180000	0.58296	2.335000	0.79485	0.551000	0.68910	GAG		RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1		
CACNG7	59284	broad.mit.edu	37	19	54418696	54418696	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr19:54418696G>T	ENST00000391767.1	+	4	573	c.361G>T	c.(361-363)Ggc>Tgc	p.G121C	CACNG7_ENST00000222212.2_Missense_Mutation_p.G121C|CACNG7_ENST00000468076.1_3'UTR|CACNG7_ENST00000391766.1_Missense_Mutation_p.G121C			P62955	CCG7_HUMAN	calcium channel, voltage-dependent, gamma subunit 7	121					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.G121C(1)		NS(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0711)		CAGCAACATCGGCCACATCCG	0.597																																					p.G121C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G361T	19						.						114.0	98.0	104.0					19																	54418696		2203	4300	6503	59110508	SO:0001583	missense	59284	exon3			AF288387	CCDS12868.1	19q13.4	2008-05-02			ENSG00000105605	ENSG00000105605		"""Calcium channel subunits"""	13626	protein-coding gene	gene with protein product		606899				11170751	Standard	NM_031896		Approved		uc002qcr.2	P62955	OTTHUMG00000064852	ENST00000391767.1:c.361G>T	19.37:g.54418696G>T	ENSP00000375647:p.Gly121Cys	Somatic		Unspecified	Illumina	Phase_I	59110508	NM_031896	Q52LL8|Q8VBX3|Q8WXS6|Q9BXT1	Missense_Mutation	SNP	ENST00000391767.1	37	CCDS12868.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111576	0.77210	.	.	ENSG00000105605	ENST00000391767;ENST00000222212;ENST00000391766	D;D;D	0.91295	-2.82;-2.82;-2.82	3.77	3.77	0.43336	.	0.000000	0.85682	D	0.000000	D	0.94719	0.8296	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.94598	0.7793	10	0.52906	T	0.07	-29.004	13.9093	0.63857	0.0:0.0:1.0:0.0	.	121	P62955	CCG7_HUMAN	C	121	ENSP00000375647:G121C;ENSP00000222212:G121C;ENSP00000375646:G121C	ENSP00000222212:G121C	G	+	1	0	CACNG7	59110508	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.081000	0.94049	2.381000	0.81170	0.563000	0.77884	GGC		CACNG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139240.2		
CRISPLD1	83690	broad.mit.edu	37	8	75941678	75941678	+	Silent	SNP	T	T	G			TCGA-AG-4008-01	TCGA-AG-4008-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr8:75941678T>G	ENST00000262207.4	+	14	1845	c.1377T>G	c.(1375-1377)ggT>ggG	p.G459G	RP11-300E4.2_ENST00000520778.1_RNA|CRISPLD1_ENST00000523524.1_Silent_p.G271G|CRISPLD1_ENST00000517786.1_Silent_p.G273G	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	459	LCCL 2. {ECO:0000255|PROSITE- ProRule:PRU00123}.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)		p.G459G(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			ATCACGGTGGTTATGTTGATG	0.393																																					p.G459G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1377G	8						.						108.0	98.0	101.0					8																	75941678		2203	4300	6503	76104233	SO:0001819	synonymous_variant	83690	exon14			AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.1377T>G	8.37:g.75941678T>G		Somatic		Unspecified	Illumina	Phase_I	76104233	NM_031461	B2RA60|B7Z929	Silent	SNP	ENST00000262207.4	37	CCDS6219.1																																																																																				CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
PRDX6	9588	broad.mit.edu	37	1	173454529	173454529	+	Silent	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr1:173454529C>T	ENST00000340385.5	+	3	414	c.282C>T	c.(280-282)ccC>ccT	p.P94P	PRDX6_ENST00000470017.1_3'UTR	NM_004905.2	NP_004896.1	P30041	PRDX6_HUMAN	peroxiredoxin 6	94	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				hydrogen peroxide catabolic process (GO:0042744)|phospholipid catabolic process (GO:0009395)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|membrane (GO:0016020)	antioxidant activity (GO:0016209)|glutathione peroxidase activity (GO:0004602)|peroxiredoxin activity (GO:0051920)|phospholipase A2 activity (GO:0004623)	p.P94P(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	12						GTGAAGAGCCCACAGAAAAGT	0.443																																					p.P94P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C282T	1						.						147.0	138.0	141.0					1																	173454529		2203	4300	6503	171721152	SO:0001819	synonymous_variant	9588	exon3			D14662	CCDS1307.1	1q24.1	2008-02-05			ENSG00000117592	ENSG00000117592			16753	protein-coding gene	gene with protein product		602316				11233154	Standard	NM_004905		Approved	AOP2, KIAA0106, 1-Cys, NSGPx, PRX, aiPLA2, MGC46173, p29	uc001giy.1	P30041	OTTHUMG00000034804	ENST00000340385.5:c.282C>T	1.37:g.173454529C>T		Somatic		Unspecified	Illumina	Phase_I	171721152	NM_004905	A8JZY7|P32077|Q5TAH4|Q5ZEZ8	Silent	SNP	ENST00000340385.5	37	CCDS1307.1																																																																																				PRDX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084222.1	NM_004905	
SERPINC1	462	broad.mit.edu	37	1	173878853	173878853	+	Silent	SNP	T	T	C			TCGA-AG-4008-01	TCGA-AG-4008-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr1:173878853T>C	ENST00000367698.3	-	5	1108	c.990A>G	c.(988-990)gaA>gaG	p.E330E	SERPINC1_ENST00000494024.1_5'Flank	NM_000488.3	NP_000479.1	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C (antithrombin), member 1	330					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of inflammatory response (GO:0050728)|regulation of blood coagulation, intrinsic pathway (GO:2000266)|regulation of proteolysis (GO:0030162)|response to nutrient (GO:0007584)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.E330E(1)		NS(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(15)|ovary(1)	25					Ardeparin(DB00407)|Dalteparin(DB06779)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Nadroparin(DB08813)|Sulodexide(DB06271)|Tinzaparin(DB06822)	CTGGGGTGAGTTCCTTCTCTA	0.552																																					p.E330E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A990G	1						.						150.0	145.0	147.0					1																	173878853		2203	4300	6503	172145476	SO:0001819	synonymous_variant	462	exon5			X68793	CCDS1313.1	1q25.1	2014-02-18	2005-08-18		ENSG00000117601	ENSG00000117601		"""Serine (or cysteine) peptidase inhibitors"""	775	protein-coding gene	gene with protein product	"""antithrombin III"", ""signal peptide antithrombin part 1"", ""coding sequence signal peptide antithrombin part 1"", ""antithrombin (aa 375-432)"""	107300	"""serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1"""	AT3		3979120, 24172014	Standard	NM_000488		Approved	ATIII, MGC22579	uc001gjt.3	P01008	OTTHUMG00000037276	ENST00000367698.3:c.990A>G	1.37:g.173878853T>C		Somatic		Unspecified	Illumina	Phase_I	172145476	NM_000488	B2R6P0|P78439|P78447|Q13815|Q5TC78|Q7KZ43|Q7KZ97|Q9UC78	Silent	SNP	ENST00000367698.3	37	CCDS1313.1																																																																																				SERPINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090734.1	NM_000488	
CRB1	23418	broad.mit.edu	37	1	197390846	197390846	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-4008-01	TCGA-AG-4008-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr1:197390846T>G	ENST00000367400.3	+	6	2023	c.1888T>G	c.(1888-1890)Ttc>Gtc	p.F630V	CRB1_ENST00000538660.1_Missense_Mutation_p.F630V|CRB1_ENST00000367399.2_Missense_Mutation_p.F518V|CRB1_ENST00000535699.1_Missense_Mutation_p.F561V|CRB1_ENST00000543483.1_Intron|CRB1_ENST00000544212.1_Missense_Mutation_p.F111V|CRB1_ENST00000367397.1_Missense_Mutation_p.F11V	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	630	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F630V(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TCTGCTTAACTTCTATAATAT	0.418																																					p.F630V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1888G	1						.						152.0	139.0	143.0					1																	197390846		2203	4300	6503	195657469	SO:0001583	missense	23418	exon6				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.1888T>G	1.37:g.197390846T>G	ENSP00000356370:p.Phe630Val	Somatic		Unspecified	Illumina	Phase_I	195657469	NM_201253	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	T	0.262	-0.999185	0.02128	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T;D	0.85339	-1.15;-1.15;-1.15;-1.15;-1.15;-1.97	5.96	-0.386	0.12466	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.62233	0.2411	N	0.04508	-0.205	0.09310	N	1	B;B;B;B;B	0.09022	0.002;0.0;0.002;0.0;0.0	B;B;B;B;B	0.08055	0.001;0.0;0.003;0.001;0.001	T	0.48305	-0.9047	9	0.10377	T	0.69	.	5.6202	0.17453	0.5244:0.0:0.3491:0.1265	.	630;561;518;279;630	B7Z5T2;F5H0L2;P82279-3;P82279-4;P82279	.;.;.;.;CRUM1_HUMAN	V	561;630;630;518;111;11;279	ENSP00000438786:F561V;ENSP00000438091:F630V;ENSP00000356370:F630V;ENSP00000356369:F518V;ENSP00000444556:F111V;ENSP00000356367:F11V	ENSP00000356367:F11V	F	+	1	0	CRB1	195657469	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.071000	0.14594	-0.309000	0.08779	-1.415000	0.01116	TTC		CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
PPP1R12B	4660	broad.mit.edu	37	1	202464575	202464575	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr1:202464575C>A	ENST00000608999.1	+	16	2453	c.2300C>A	c.(2299-2301)aCa>aAa	p.T767K	PPP1R12B_ENST00000290419.5_3'UTR|PPP1R12B_ENST00000367270.4_5'UTR|PPP1R12B_ENST00000391959.3_5'UTR|PPP1R12B_ENST00000336894.4_Missense_Mutation_p.T767K	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	767					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)	p.T767K(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			GAGACTACCACAAACACTACA	0.443																																					p.T767K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2300A	1						.						82.0	77.0	79.0					1																	202464575		2203	4300	6503	200731198	SO:0001583	missense	4660	exon16			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.2300C>A	1.37:g.202464575C>A	ENSP00000476755:p.Thr767Lys	Somatic		Unspecified	Illumina	Phase_I	200731198	NM_002481	A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Missense_Mutation	SNP	ENST00000608999.1	37	CCDS1426.1	.	.	.	.	.	.	.	.	.	.	C	3.294	-0.144316	0.06627	.	.	ENSG00000077157	ENST00000406302;ENST00000336894	T;T	0.02890	4.12;4.12	5.34	1.02	0.19986	.	0.663449	0.14535	N	0.313648	T	0.02727	0.0082	M	0.65975	2.015	0.09310	N	0.999999	B;B	0.26258	0.008;0.145	B;B	0.23852	0.007;0.049	T	0.47018	-0.9149	10	0.06891	T	0.86	.	1.4656	0.02405	0.2895:0.4032:0.1411:0.1662	.	767;767	O60237;F8W8M3	MYPT2_HUMAN;.	K	767	ENSP00000384496:T767K;ENSP00000337897:T767K	ENSP00000337897:T767K	T	+	2	0	PPP1R12B	200731198	0.000000	0.05858	0.000000	0.03702	0.790000	0.44656	-0.122000	0.10627	0.307000	0.22880	0.650000	0.86243	ACA		PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000099166.3	NM_032105	
AVPR1B	553	broad.mit.edu	37	1	206225351	206225351	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr1:206225351C>A	ENST00000367126.4	+	1	1376	c.911C>A	c.(910-912)tCc>tAc	p.S304Y	RP11-38J22.3_ENST00000425896.1_RNA	NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	304					activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	CAGATGTGGTCCGTGTGGGAC	0.557																																					p.S304Y												.	.	0			c.C911A	1						.						82.0	76.0	78.0					1																	206225351		2203	4300	6503	204391974	SO:0001583	missense	553	exon1			D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	896	protein-coding gene	gene with protein product		600264		AVPR3		7929452, 8586456	Standard	NM_000707		Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.911C>A	1.37:g.206225351C>A	ENSP00000356094:p.Ser304Tyr	None		Unspecified	Illumina	Phase_I	204391974	NM_000707	B0M0J6|Q5TZ00	Missense_Mutation	SNP	ENST00000367126.4	37	CCDS30994.1	.	.	.	.	.	.	.	.	.	.	C	19.87	3.906751	0.72868	.	.	ENSG00000198049	ENST00000367126	T	0.72942	-0.7	5.34	5.34	0.76211	GPCR, rhodopsin-like superfamily (1);	0.081066	0.53938	D	0.000057	T	0.76506	0.3997	L	0.43554	1.36	0.58432	D	0.999992	D	0.76494	0.999	D	0.76071	0.987	T	0.69320	-0.5176	10	0.02654	T	1	-15.1142	18.6497	0.91427	0.0:1.0:0.0:0.0	.	304	P47901	V1BR_HUMAN	Y	304	ENSP00000356094:S304Y	ENSP00000356094:S304Y	S	+	2	0	AVPR1B	204391974	1.000000	0.71417	0.999000	0.59377	0.760000	0.43138	7.818000	0.86416	2.499000	0.84300	0.462000	0.41574	TCC		AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087996.1	NM_000707	
DAB1	1600	broad.mit.edu	37	1	57476850	57476850	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr1:57476850C>G	ENST00000371231.1	-	14	1673	c.1639G>C	c.(1639-1641)Gaa>Caa	p.E547Q	DAB1_ENST00000414851.2_Missense_Mutation_p.E496Q|DAB1_ENST00000420954.2_Missense_Mutation_p.E512Q|DAB1_ENST00000371236.2_Missense_Mutation_p.E514Q|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000439789.2_Missense_Mutation_p.E428Q|DAB1_ENST00000371234.4_Missense_Mutation_p.E514Q			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	547					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)		p.E514Q(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						CTGGGACTTTCAAAGCCCTCT	0.438																																					p.E514Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1540C	1						.						136.0	137.0	137.0					1																	57476850		2203	4300	6503	57249438	SO:0001583	missense	1600	exon15			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1639G>C	1.37:g.57476850C>G	ENSP00000360275:p.Glu547Gln	Somatic		Unspecified	Illumina	Phase_I	57249438	NM_021080	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	ENST00000371231.1	37		.	.	.	.	.	.	.	.	.	.	C	21.0	4.088248	0.76756	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231	T;T;T;T;T;T	0.46063	0.9;0.9;0.88;0.88;1.89;0.89	4.96	4.96	0.65561	.	0.152990	0.64402	D	0.000015	T	0.51907	0.1702	L	0.36672	1.1	0.50813	D	0.999895	D;D;D;D;D	0.69078	0.994;0.99;0.982;0.978;0.997	P;P;P;P;P	0.62435	0.641;0.801;0.792;0.549;0.902	T	0.35301	-0.9794	10	0.25106	T	0.35	-47.9219	18.7462	0.91794	0.0:1.0:0.0:0.0	.	496;547;514;428;512	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	Q	514;514;514;512;496;428;547	ENSP00000360280:E514Q;ENSP00000360278:E514Q;ENSP00000395296:E512Q;ENSP00000387581:E496Q;ENSP00000409328:E428Q;ENSP00000360275:E547Q	ENSP00000360275:E547Q	E	-	1	0	DAB1	57249438	1.000000	0.71417	0.999000	0.59377	0.922000	0.55478	5.475000	0.66787	2.724000	0.93272	0.555000	0.69702	GAA		DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080	
ARID4B	51742	broad.mit.edu	37	1	235336038	235336038	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr1:235336038G>T	ENST00000264183.3	-	23	4203	c.3706C>A	c.(3706-3708)Ctt>Att	p.L1236I	ARID4B_ENST00000349213.3_Missense_Mutation_p.L1150I|ARID4B-IT1_ENST00000357671.6_RNA|ARID4B_ENST00000366603.2_Missense_Mutation_p.L1236I	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	1236					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L1236I(1)		NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TTTTCTTGAAGAATTGTGATG	0.313																																					p.L1150I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3448A	1						.						76.0	72.0	73.0					1																	235336038		2202	4300	6502	233402661	SO:0001583	missense	51742	exon22			AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.3706C>A	1.37:g.235336038G>T	ENSP00000264183:p.Leu1236Ile	Somatic		Unspecified	Illumina	Phase_I	233402661	NM_031371	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Missense_Mutation	SNP	ENST00000264183.3	37	CCDS31061.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.715070	0.89112	.	.	ENSG00000054267	ENST00000349213;ENST00000366603;ENST00000264183	T;T;T	0.59083	0.29;0.33;0.33	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.72471	0.3464	L	0.48362	1.52	0.54753	D	0.999988	D;D	0.69078	0.99;0.997	D;D	0.78314	0.979;0.991	T	0.73254	-0.4041	10	0.87932	D	0	-11.4728	20.047	0.97613	0.0:0.0:1.0:0.0	.	1150;1236	Q4LE39-2;Q4LE39	.;ARI4B_HUMAN	I	1150;1236;1236	ENSP00000264184:L1150I;ENSP00000355562:L1236I;ENSP00000264183:L1236I	ENSP00000264183:L1236I	L	-	1	0	ARID4B	233402661	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.265000	0.95647	2.821000	0.97095	0.555000	0.69702	CTT		ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095566.3	NM_016374	
MRGPRX1	259249	broad.mit.edu	37	11	18956223	18956223	+	Missense_Mutation	SNP	C	C	T	rs367640618		TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr11:18956223C>T	ENST00000302797.3	-	1	333	c.109G>A	c.(109-111)Gtt>Att	p.V37I	RP11-583F24.8_ENST00000528646.1_RNA|MRGPRX1_ENST00000526914.1_5'UTR	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	37					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V37I(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						ACAAGGGAAACGATGCACGTC	0.557																																					p.V37I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G109A	11						.						206.0	194.0	198.0					11																	18956223		2194	4286	6480	18912799	SO:0001583	missense	259249	exon1				CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.109G>A	11.37:g.18956223C>T	ENSP00000305766:p.Val37Ile	Somatic		Unspecified	Illumina	Phase_I	18912799	NM_147199	Q4V9L2|Q8TDD8|Q8TDD9	Missense_Mutation	SNP	ENST00000302797.3	37	CCDS7846.1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.486962	0.00161	.	.	ENSG00000170255	ENST00000302797	T	0.25250	1.81	2.42	-4.84	0.03151	.	1.176060	0.06178	N	0.678998	T	0.07143	0.0181	N	0.03209	-0.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15350	-1.0440	10	0.02654	T	1	.	1.1666	0.01817	0.3758:0.3123:0.1284:0.1835	.	37	Q96LB2	MRGX1_HUMAN	I	37	ENSP00000305766:V37I	ENSP00000305766:V37I	V	-	1	0	MRGPRX1	18912799	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.194000	0.09559	-3.660000	0.00125	-1.438000	0.01074	GTT		MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369913.1	NM_147199	
OR4A5	81318	broad.mit.edu	37	11	51412308	51412308	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-4008-01	TCGA-AG-4008-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr11:51412308A>C	ENST00000319760.6	-	1	140	c.88T>G	c.(88-90)Tta>Gta	p.L30V		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	30						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L30V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				TATGTGAGTAAAAACATGACA	0.418																																					p.L30V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T88G	11						.						52.0	49.0	50.0					11																	51412308		2201	4296	6497	51268884	SO:0001583	missense	81318	exon1			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.88T>G	11.37:g.51412308A>C	ENSP00000367664:p.Leu30Val	Somatic		Unspecified	Illumina	Phase_I	51268884	NM_001005272	Q6IF84	Missense_Mutation	SNP	ENST00000319760.6	37	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	8.200	0.797894	0.16327	.	.	ENSG00000221840	ENST00000319760	T	0.01902	4.57	2.01	-0.436	0.12275	.	0.194706	0.25302	N	0.031649	T	0.11367	0.0277	H	0.95780	3.72	0.09310	N	1	D	0.57899	0.981	P	0.58721	0.844	T	0.04153	-1.0973	10	0.66056	D	0.02	.	5.6516	0.17620	0.4833:0.0:0.5167:0.0	.	30	Q8NH83	OR4A5_HUMAN	V	30	ENSP00000367664:L30V	ENSP00000367664:L30V	L	-	1	2	OR4A5	51268884	0.000000	0.05858	0.061000	0.19648	0.033000	0.12548	0.525000	0.22956	-0.114000	0.11936	0.136000	0.15936	TTA		OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272	
CDC42BPG	55561	broad.mit.edu	37	11	64600210	64600210	+	Silent	SNP	C	C	T	rs150950292	byFrequency	TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr11:64600210C>T	ENST00000342711.5	-	26	2870	c.2871G>A	c.(2869-2871)ccG>ccA	p.P957P	CDC42BPG_ENST00000491280.1_5'Flank	NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)									p.P957P(1)		central_nervous_system(1)|lung(3)	4						CTGAGGGCCGCGGCACCTGGC	0.697													C|||	2	0.000399361	0.0015	0.0	5008	,	,		13160	0.0		0.0	False		,,,				2504	0.0				p.P957P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2871A	11						.	C		3,4377		0,3,2187	19.0	20.0	20.0		2871	-8.9	0.0	11	dbSNP_134	20	1,8563		0,1,4281	no	coding-synonymous	CDC42BPG	NM_017525.2		0,4,6468	TT,TC,CC		0.0117,0.0685,0.0309		957/1552	64600210	4,12940	2190	4282	6472	64356786	SO:0001819	synonymous_variant	55561	exon26			AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.2871G>A	11.37:g.64600210C>T		Somatic		Unspecified	Illumina	Phase_I	64356786	NM_017525		Silent	SNP	ENST00000342711.5	37	CCDS31601.1																																																																																				CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
NPAS4	266743	broad.mit.edu	37	11	66192375	66192375	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr11:66192375C>A	ENST00000311034.2	+	7	2190	c.2014C>A	c.(2014-2016)Ctg>Atg	p.L672M		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	672					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.L672M(1)		breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						GGACTCCAACCTGTCCCTGTC	0.602																																					p.L672M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2014A	11						.						87.0	94.0	92.0					11																	66192375		2200	4295	6495	65948951	SO:0001583	missense	266743	exon7			AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.2014C>A	11.37:g.66192375C>A	ENSP00000311196:p.Leu672Met	Somatic		Unspecified	Illumina	Phase_I	65948951	NM_178864	B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	ENST00000311034.2	37	CCDS8138.1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.640323	0.47153	.	.	ENSG00000174576	ENST00000311034	T	0.48201	0.82	4.39	4.39	0.52855	.	0.000000	0.43579	D	0.000549	T	0.44244	0.1284	N	0.14661	0.345	0.41114	D	0.98576	D	0.65815	0.995	P	0.59221	0.854	T	0.41016	-0.9532	10	0.46703	T	0.11	-5.3897	10.6578	0.45686	0.0:0.8055:0.1945:0.0	.	672	Q8IUM7	NPAS4_HUMAN	M	672	ENSP00000311196:L672M	ENSP00000311196:L672M	L	+	1	2	NPAS4	65948951	0.970000	0.33590	1.000000	0.80357	0.997000	0.91878	0.138000	0.16016	2.443000	0.82685	0.655000	0.94253	CTG		NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864	
RPS6KB2	6199	broad.mit.edu	37	11	67200072	67200072	+	Splice_Site	SNP	T	T	G	rs200291926	byFrequency	TCGA-AG-4008-01	TCGA-AG-4008-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr11:67200072T>G	ENST00000312629.5	+	6	504	c.459T>G	c.(457-459)ggT>ggG	p.G153G	AP003419.16_ENST00000535922.1_RNA|RPS6KB2_ENST00000524814.1_3'UTR|RPS6KB2_ENST00000539188.1_3'UTR	NM_003952.2	NP_003943.2	Q9UBS0	KS6B2_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide 2	153	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of translational initiation (GO:0045948)|protein kinase B signaling (GO:0043491)|signal transduction (GO:0007165)|translation (GO:0006412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)	p.G153G(2)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(3)|salivary_gland(1)|stomach(2)	25			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			GTGTGGCAGGTGGCGAGCTCT	0.562																																					p.G153G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T459G	11						.						89.0	109.0	103.0					11																	67200072		2189	4279	6468	66956648	SO:0001630	splice_region_variant	6199	exon6			AB019245	CCDS41677.1	11q13.1	2011-04-05	2002-08-29		ENSG00000175634	ENSG00000175634			10437	protein-coding gene	gene with protein product		608939	"""ribosomal protein S6 kinase, 70kD, polypeptide 2"""			9878560, 9804755	Standard	XM_005274164		Approved	p70S6Kb, P70-BETA, STK14B, KLS	uc001old.3	Q9UBS0	OTTHUMG00000167673	ENST00000312629.5:c.458-1T>G	11.37:g.67200072T>G		Somatic		Unspecified	Illumina	Phase_I	66956648	NM_003952	B2RMZ9|B4DML8|O94809|Q9UEC1	Missense_Mutation	SNP	ENST00000312629.5	37	CCDS41677.1	.	.	.	.	.	.	.	.	.	.	T	14.04	2.417666	0.42918	.	.	ENSG00000175634	ENST00000524814	.	.	.	5.43	0.296	0.15757	.	.	.	.	.	T	0.42177	0.1191	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23368	-1.0190	4	.	.	.	.	1.8398	0.03147	0.1365:0.3163:0.1205:0.4267	.	.	.	.	G	104	.	.	V	+	2	0	RPS6KB2	66956648	0.172000	0.23043	0.999000	0.59377	0.966000	0.64601	-0.604000	0.05667	0.139000	0.18822	0.459000	0.35465	GTG		RPS6KB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395508.1	NM_003952	Silent
TRIM10	10107	broad.mit.edu	37	6	30128219	30128219	+	Silent	SNP	C	C	T	rs373243528		TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr6:30128219C>T	ENST00000449742.2	-	1	492	c.417G>A	c.(415-417)gcG>gcA	p.A139A	TRIM15_ENST00000376694.4_5'Flank|TRIM10_ENST00000376704.3_Silent_p.A139A	NM_006778.3	NP_006769.2	Q9UDY6	TRI10_HUMAN	tripartite motif containing 10	139					erythrocyte differentiation (GO:0030218)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)	p.A139A(1)		ovary(1)	1						TATAGGGAGCCGCTGCATCCT	0.572																																					p.A139A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G417A	6						.	C	,	0,4406		0,0,2203	51.0	46.0	48.0		417,417	-10.2	0.0	6		48	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	TRIM10	NM_006778.3,NM_052828.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	139/482,139/396	30128219	1,13005	2203	4300	6503	30236198	SO:0001819	synonymous_variant	10107	exon1			Y07829	CCDS4676.1, CCDS34375.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000204613	ENSG00000204613		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10072	protein-coding gene	gene with protein product		605701	"""tripartite motif-containing 10"""	RNF9		9271628, 10207104	Standard	NM_052828		Approved	RFB30, HERF1	uc003npo.3	Q9UDY6	OTTHUMG00000031295	ENST00000449742.2:c.417G>A	6.37:g.30128219C>T		Somatic		Unspecified	Illumina	Phase_I	30236198	NM_006778	A6NF84|Q5SRJ5|Q5SRK8|Q86Z08|Q96QB6|Q9C023|Q9C024	Silent	SNP	ENST00000449742.2	37	CCDS34375.1																																																																																				TRIM10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076634.1		
RIMS1	22999	broad.mit.edu	37	6	72960676	72960676	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4008-01	TCGA-AG-4008-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr6:72960676T>C	ENST00000521978.1	+	14	2425	c.2425T>C	c.(2425-2427)Tgg>Cgg	p.W809R	RIMS1_ENST00000538414.1_5'Flank|RIMS1_ENST00000520567.1_Missense_Mutation_p.W809R|RIMS1_ENST00000491071.2_Missense_Mutation_p.W809R|RIMS1_ENST00000348717.5_Missense_Mutation_p.W809R|RIMS1_ENST00000517960.1_Missense_Mutation_p.W809R|RIMS1_ENST00000518273.1_Missense_Mutation_p.W809R|RIMS1_ENST00000264839.7_Missense_Mutation_p.W809R|RIMS1_ENST00000517827.1_Missense_Mutation_p.W268R|RIMS1_ENST00000401910.3_Missense_Mutation_p.W283R|RIMS1_ENST00000425662.2_Missense_Mutation_p.W202R|RIMS1_ENST00000522291.1_Missense_Mutation_p.W809R|RIMS1_ENST00000523963.1_Missense_Mutation_p.W283R	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	809	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.W809R(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				AGAACCAAAATGGAATCAAAC	0.333																																					p.W202R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T604C	6						.						85.0	79.0	81.0					6																	72960676		1814	4062	5876	73017397	SO:0001583	missense	22999	exon9			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.2425T>C	6.37:g.72960676T>C	ENSP00000428417:p.Trp809Arg	Somatic		Unspecified	Illumina	Phase_I	73017397	NM_001168409	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.2|22.2	4.257381|4.257381	0.80246|0.80246	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000517433|ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827;ENST00000370420	.|D;D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.84298	.|-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83	5.79|5.79	5.79|5.79	0.91817|0.91817	.|C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.|0.100120	.|0.45867	.|D	.|0.000337	D|D	0.94640|0.94640	0.8272|0.8272	H|H	0.96777|0.96777	3.88|3.88	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0	.|D;D;D;D;D;D;D;D;D;D;D;D	.|0.97110	.|1.0;1.0;0.997;1.0;1.0;0.999;1.0;0.999;1.0;0.998;0.997;1.0	D|D	0.96365|0.96365	0.9269|0.9269	5|10	.|0.87932	.|D	.|0	-5.501|-5.501	16.1056|16.1056	0.81220|0.81220	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|268;283;809;268;283;809;62;809;809;62;809;809	.|B7Z3S3;E9PHF5;E9PHR1;B7Z9Z3;E9PF48;E7EX08;Q5JY22;E7ERQ1;E7ENC2;Q5JY21;C9JNW6;Q86UR5	.|.;.;.;.;.;.;.;.;.;.;.;RIMS1_HUMAN	T|R	382|809;809;809;809;809;809;809;809;809;809;809;809;283;283;202;202;268;34	.|ENSP00000430101:W809R;ENSP00000275037:W809R;ENSP00000264839:W809R;ENSP00000429959:W809R;ENSP00000430408:W809R;ENSP00000430502:W809R;ENSP00000430932:W809R;ENSP00000428417:W809R;ENSP00000385649:W283R;ENSP00000428328:W283R;ENSP00000411235:W202R;ENSP00000389503:W202R;ENSP00000428367:W268R;ENSP00000359448:W34R	.|ENSP00000264839:W809R	M|W	+|+	2|1	0|0	RIMS1|RIMS1	73017397|73017397	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.961000|0.961000	0.63080|0.63080	8.005000|8.005000	0.88553|0.88553	2.207000|2.207000	0.71202|0.71202	0.477000|0.477000	0.44152|0.44152	ATG|TGG		RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
ASCC3	10973	broad.mit.edu	37	6	101312034	101312034	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr6:101312034C>A	ENST00000369162.2	-	3	491	c.147G>T	c.(145-147)aaG>aaT	p.K49N	ASCC3_ENST00000522650.1_Missense_Mutation_p.K49N|ASCC3_ENST00000369143.2_Missense_Mutation_p.K49N	NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	49					cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)	p.K49N(1)		breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		ATTTTATTATCTTCTTCCATG	0.299																																					p.K49N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G147T	6						.						98.0	109.0	105.0					6																	101312034		2201	4297	6498	101418755	SO:0001583	missense	10973	exon3			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.147G>T	6.37:g.101312034C>A	ENSP00000358159:p.Lys49Asn	Somatic		Unspecified	Illumina	Phase_I	101418755	NM_022091	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	C	13.25	2.181350	0.38511	.	.	ENSG00000112249	ENST00000369162;ENST00000522650;ENST00000324723;ENST00000369143	T;T;T	0.59224	0.36;0.28;0.66	5.32	0.726	0.18248	.	0.108694	0.64402	N	0.000009	T	0.49745	0.1575	L	0.59436	1.845	0.28193	N	0.927686	D;D;D;P	0.89917	0.961;1.0;0.961;0.454	P;D;P;B	0.83275	0.541;0.996;0.541;0.084	T	0.42189	-0.9466	10	0.66056	D	0.02	.	2.0724	0.03616	0.2963:0.4164:0.1471:0.1402	.	49;49;49;49	Q4G1A0;Q9H5A2;E7EW23;Q8N3C0	.;.;.;HELC1_HUMAN	N	49	ENSP00000358159:K49N;ENSP00000430769:K49N;ENSP00000320777:K49N	ENSP00000320777:K49N	K	-	3	2	ASCC3	101418755	1.000000	0.71417	0.994000	0.49952	0.965000	0.64279	0.544000	0.23253	0.189000	0.20188	0.655000	0.94253	AAG		ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
RAB11FIP4	84440	broad.mit.edu	37	17	29848366	29848366	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr17:29848366C>T	ENST00000325874.8	+	5	975	c.746C>T	c.(745-747)tCg>tTg	p.S249L	RN7SL45P_ENST00000578050.1_RNA|RAB11FIP4_ENST00000394744.2_Missense_Mutation_p.S147L	NM_032932.3	NP_116321.2	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	249	Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis (GO:0000910)|transport (GO:0006810)|viral process (GO:0016032)	cleavage furrow (GO:0032154)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|midbody (GO:0030496)|recycling endosome membrane (GO:0055038)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)	p.S249L(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				CTGGGGTCTTCGGTGTCTTCC	0.577																																					p.S249L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C746T	17						.						103.0	78.0	87.0					17																	29848366		2203	4300	6503	26872486	SO:0001583	missense	84440	exon5			AB058724	CCDS11267.1	17q11.2	2013-01-10			ENSG00000131242	ENSG00000131242		"""EF-hand domain containing"""	30267	protein-coding gene	gene with protein product		611999				11347906, 11468690	Standard	NM_032932		Approved	RAB11-FIP4, KIAA1821, MGC11316, FLJ00131	uc002hgn.1	Q86YS3	OTTHUMG00000132787	ENST00000325874.8:c.746C>T	17.37:g.29848366C>T	ENSP00000312837:p.Ser249Leu	Somatic		Unspecified	Illumina	Phase_I	26872486	NM_032932	Q52LI1|Q8N829|Q8NDT7|Q969D8	Missense_Mutation	SNP	ENST00000325874.8	37	CCDS11267.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.810051	0.90707	.	.	ENSG00000131242	ENST00000325874;ENST00000394744	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.75664	0.3880	L	0.55103	1.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.976;0.994	T	0.72861	-0.4164	8	.	.	.	-11.9493	17.713	0.88327	0.0:1.0:0.0:0.0	.	147;249	Q86YS3-2;Q86YS3	.;RFIP4_HUMAN	L	249	.	.	S	+	2	0	RAB11FIP4	26872486	1.000000	0.71417	0.691000	0.30163	0.674000	0.39518	7.317000	0.79018	2.780000	0.95670	0.655000	0.94253	TCG		RAB11FIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256195.2	NM_032932	
RPL19	6143	broad.mit.edu	37	17	37360786	37360786	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr17:37360786C>T	ENST00000225430.4	+	6	538	c.476C>T	c.(475-477)gCt>gTt	p.A159V	RPL19_ENST00000582193.1_Missense_Mutation_p.A157V|RPL19_ENST00000579260.1_Missense_Mutation_p.A157V|RPL19_ENST00000579374.1_Missense_Mutation_p.A156V	NM_000981.3	NP_000972.1	P84098	RL19_HUMAN	ribosomal protein L19	159					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.A159V(1)		kidney(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7						AGTGACCAGGCTGAGGCCCGC	0.552																																					p.A159V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C476T	17						.						73.0	79.0	77.0					17																	37360786		1913	4135	6048	34614312	SO:0001583	missense	6143	exon6				CCDS42312.1	17q12	2012-09-20			ENSG00000108298	ENSG00000108298		"""L ribosomal proteins"""	10312	protein-coding gene	gene with protein product	"""60S ribosomal protein L19"", ""ribosomal protein L19, cytosolic, N-terminus truncated"""	180466				1577483	Standard	XM_005257564		Approved	FLJ27452, MGC71997, DKFZp779D216, L19	uc002hrq.1	P84098	OTTHUMG00000178979	ENST00000225430.4:c.476C>T	17.37:g.37360786C>T	ENSP00000225430:p.Ala159Val	Somatic		Unspecified	Illumina	Phase_I	34614312	NM_000981	B2R4K2|P14118|P22908|Q502Y6|Q7Z6E4	Missense_Mutation	SNP	ENST00000225430.4	37	CCDS42312.1	.	.	.	.	.	.	.	.	.	.	c	19.17	3.775191	0.70107	.	.	ENSG00000108298	ENST00000225430	.	.	.	5.22	4.25	0.50352	.	0.000000	0.85682	D	0.000000	T	0.60104	0.2243	M	0.90705	3.14	0.80722	D	1	D	0.57571	0.98	B	0.41412	0.356	T	0.68108	-0.5496	9	0.07482	T	0.82	.	13.4094	0.60933	0.0:0.9242:0.0:0.0758	.	159	P84098	RL19_HUMAN	V	159	.	ENSP00000225430:A159V	A	+	2	0	RPL19	34614312	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.621000	0.83083	1.202000	0.43218	0.563000	0.77884	GCT		RPL19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444190.1	NM_000981	
SCIMP	388325	broad.mit.edu	37	17	5118255	5118255	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4008-01	TCGA-AG-4008-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr17:5118255A>G	ENST00000574081.1	-	4	352	c.248T>C	c.(247-249)cTg>cCg	p.L83P	SCIMP_ENST00000574297.1_Missense_Mutation_p.L83P|SCIMP_ENST00000399600.4_Missense_Mutation_p.L76P|SCIMP_ENST00000571800.1_Missense_Mutation_p.L76P|RP11-333E1.1_ENST00000571689.1_RNA|RP11-333E1.1_ENST00000575601.1_RNA	NM_001271842.1|NM_207103.3	NP_001258771.1|NP_996986.1	Q6UWF3	SCIMP_HUMAN	SLP adaptor and CSK interacting membrane protein	83	Pro-rich.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)	immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|membrane (GO:0016020)|tetraspanin-enriched microdomain (GO:0097197)|uropod membrane (GO:0031259)		p.L83P(1)									CCTCGGTGGCAGAGGCGGTAA	0.438																																					p.L83P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T248C	17						.						73.0	75.0	74.0					17																	5118255		1932	4131	6063	5058979	SO:0001583	missense	388325	exon4			AY358809	CCDS42242.1, CCDS62044.1	17p13.2	2011-11-24	2011-11-23	2011-11-23	ENSG00000161929	ENSG00000161929			33504	protein-coding gene	gene with protein product	"""SLP65/SLP76, Csk-interacting membrane protein"""	614406	"""chromosome 17 open reading frame 87"""	C17orf87		21930792	Standard	NM_207103		Approved	DTFT5783, UNQ5783, FLJ32580, MGC163426, MGC163428	uc002gbh.3	Q6UWF3	OTTHUMG00000132914	ENST00000574081.1:c.248T>C	17.37:g.5118255A>G	ENSP00000461269:p.Leu83Pro	Somatic		Unspecified	Illumina	Phase_I	5058979	NM_207103	A6XGL4|B4DLK1|Q96MD0	Missense_Mutation	SNP	ENST00000574081.1	37	CCDS42242.1	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506538	0.44558	.	.	ENSG00000161929	ENST00000399600	.	.	.	4.89	4.89	0.63831	.	0.000000	0.44097	D	0.000490	T	0.75384	0.3842	M	0.66939	2.045	0.58432	D	0.999993	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.77885	-0.2421	9	0.87932	D	0	-11.2481	11.0857	0.48086	1.0:0.0:0.0:0.0	.	76;76;83	A6XGL4;Q6UWF3-2;Q6UWF3	.;.;CQ087_HUMAN	P	83	.	ENSP00000382509:L83P	L	-	2	0	C17orf87	5058979	1.000000	0.71417	1.000000	0.80357	0.174000	0.22865	3.838000	0.55828	2.194000	0.70268	0.459000	0.35465	CTG		SCIMP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256425.2	NM_207103	
TP53	7157	broad.mit.edu	37	17	7578478	7578478	+	Missense_Mutation	SNP	G	G	T	rs137852790|rs137852791		TCGA-AG-4008-01	TCGA-AG-4008-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr17:7578478G>T	ENST00000269305.4	-	5	641	c.452C>A	c.(451-453)cCc>cAc	p.P151H	TP53_ENST00000420246.2_Missense_Mutation_p.P151H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.P151H|TP53_ENST00000455263.2_Missense_Mutation_p.P151H|TP53_ENST00000445888.2_Missense_Mutation_p.P151H|TP53_ENST00000359597.4_Missense_Mutation_p.P151H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	151	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934874). {ECO:0000269|PubMed:7682763}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P151H(31)|p.P151R(9)|p.0?(8)|p.P151L(7)|p.T150fs*16(6)|p.?(5)|p.P58H(2)|p.P19H(2)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P152fs*28(1)|p.T57fs*16(1)|p.P151del(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.P153fs*28(1)|p.D148fs*23(1)|p.P152del(1)|p.S149fs*72(1)|p.S149fs*17(1)|p.P58R(1)|p.Q144_G154del11(1)|p.P19R(1)|p.Q144fs*16(1)|p.P152fs*14(1)|p.P151fs*30(1)|p.T18fs*16(1)|p.T150_P151delTP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCGGGCGGGGGTGTGGAATC	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.P151H	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,upper_aerodigestive_tract,mouth,Substitution - Missense,-1	.	90	Substitution - Missense(53)|Deletion - Frameshift(14)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(2)	lung(17)|large_intestine(13)|ovary(10)|skin(8)|oesophagus(8)|breast(6)|stomach(5)|haematopoietic_and_lymphoid_tissue(5)|central_nervous_system(4)|bone(4)|upper_aerodigestive_tract(3)|soft_tissue(2)|urinary_tract(2)|liver(2)|vulva(1)	c.C452A	17						.						54.0	55.0	55.0					17																	7578478		2203	4300	6503	7519203	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.452C>A	17.37:g.7578478G>T	ENSP00000269305:p.Pro151His	Somatic		Unspecified	Illumina	Phase_I	7519203	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.040562	0.55003	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99887	-7.53;-7.53;-7.53;-7.53;-7.53;-7.53;-7.53;-7.53;-7.53	5.59	4.63	0.57726	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110207	0.64402	D	0.000007	D	0.99891	0.9948	M	0.91406	3.205	0.53688	D	0.999972	D;P;D;P;P;P;D	0.89917	0.99;0.807;1.0;0.793;0.948;0.84;1.0	P;P;D;P;P;P;D	0.97110	0.84;0.754;0.995;0.625;0.841;0.868;1.0	D	0.96236	0.9172	10	0.87932	D	0	-14.1156	12.4691	0.55777	0.0812:0.0:0.9188:0.0	.	112;151;151;58;151;151;151	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	151;151;151;151;151;151;140;58;19;58;19;151	ENSP00000410739:P151H;ENSP00000352610:P151H;ENSP00000269305:P151H;ENSP00000398846:P151H;ENSP00000391127:P151H;ENSP00000391478:P151H;ENSP00000425104:P19H;ENSP00000423862:P58H;ENSP00000424104:P151H	ENSP00000269305:P151H	P	-	2	0	TP53	7519203	1.000000	0.71417	0.974000	0.42286	0.058000	0.15608	6.711000	0.74675	1.515000	0.48885	0.655000	0.94253	CCC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KRT37	8688	broad.mit.edu	37	17	39577794	39577794	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr17:39577794C>T	ENST00000225550.3	-	6	1065	c.1066G>A	c.(1066-1068)Ggc>Agc	p.G356S	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	356	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.G356S(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				AGCTCTGTGCCGTAGCGGTCC	0.557																																					p.G356S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1066A	17						.						63.0	60.0	61.0					17																	39577794		2203	4300	6503	36831320	SO:0001583	missense	8688	exon6			Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.1066G>A	17.37:g.39577794C>T	ENSP00000225550:p.Gly356Ser	Somatic		Unspecified	Illumina	Phase_I	36831320	NM_003770		Missense_Mutation	SNP	ENST00000225550.3	37	CCDS32653.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.759102	0.00657	.	.	ENSG00000108417	ENST00000225550	D	0.87809	-2.3	4.84	2.58	0.30949	Filament (1);	0.125321	0.35772	N	0.002989	T	0.55737	0.1939	N	0.02158	-0.66	0.20703	N	0.999868	P	0.37441	0.595	B	0.29077	0.098	T	0.62746	-0.6789	10	0.02654	T	1	.	3.7803	0.08677	0.1759:0.4743:0.0:0.3498	.	356	O76014	KRT37_HUMAN	S	356	ENSP00000225550:G356S	ENSP00000225550:G356S	G	-	1	0	KRT37	36831320	0.000000	0.05858	0.101000	0.21167	0.163000	0.22366	-3.095000	0.00607	0.388000	0.25054	0.655000	0.94253	GGC		KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	NM_003770	
NCAM2	4685	broad.mit.edu	37	21	22696712	22696712	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr21:22696712C>A	ENST00000400546.1	+	6	878	c.629C>A	c.(628-630)gCa>gAa	p.A210E	NCAM2_ENST00000284894.7_Missense_Mutation_p.A68E|NCAM2_ENST00000535285.1_Missense_Mutation_p.A235E	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	210	Ig-like C2-type 3.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A210E(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GTGCCGCCAGCAATCTCAATG	0.428																																					p.A210E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C629A	21						.						120.0	118.0	118.0					21																	22696712		1943	4132	6075	21618583	SO:0001583	missense	4685	exon6				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.629C>A	21.37:g.22696712C>A	ENSP00000383392:p.Ala210Glu	Somatic		Unspecified	Illumina	Phase_I	21618583	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.276875	0.40294	.	.	ENSG00000154654	ENST00000400546;ENST00000284894;ENST00000535285	T;T;T	0.34667	1.35;1.35;1.35	5.3	3.5	0.40072	Immunoglobulin-like (1);	0.270198	0.42294	D	0.000731	T	0.13670	0.0331	N	0.02842	-0.48	0.39279	D	0.964523	B;B;B	0.15473	0.002;0.013;0.007	B;B;B	0.08055	0.002;0.003;0.002	T	0.06972	-1.0797	10	0.28530	T	0.3	-8.9064	5.7357	0.18065	0.1554:0.6809:0.0:0.1637	.	235;68;210	B7Z841;B7Z5K2;O15394	.;.;NCAM2_HUMAN	E	210;68;235	ENSP00000383392:A210E;ENSP00000284894:A68E;ENSP00000441887:A235E	ENSP00000284894:A68E	A	+	2	0	NCAM2	21618583	0.463000	0.25799	0.997000	0.53966	0.990000	0.78478	0.551000	0.23361	0.638000	0.30545	0.591000	0.81541	GCA		NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
DNAH3	55567	broad.mit.edu	37	16	21145625	21145625	+	Missense_Mutation	SNP	G	G	A	rs372982554		TCGA-AG-4008-01	TCGA-AG-4008-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr16:21145625G>A	ENST00000261383.3	-	7	1036	c.1037C>T	c.(1036-1038)aCg>aTg	p.T346M	DNAH3_ENST00000415178.1_Missense_Mutation_p.T346M	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	346	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.T346M(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GGGGTTCACCGTGTGCAGATG	0.527																																					p.T346M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1037T	16						.	G	MET/THR	0,4402		0,0,2201	112.0	104.0	106.0		1037	2.4	0.4	16		106	1,8599	1.2+/-3.3	0,1,4299	no	missense	DNAH3	NM_017539.1	81	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	346/4117	21145625	1,13001	2201	4300	6501	21053126	SO:0001583	missense	55567	exon7			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.1037C>T	16.37:g.21145625G>A	ENSP00000261383:p.Thr346Met	Somatic		Unspecified	Illumina	Phase_I	21053126	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.637575	0.29157	0.0	1.16E-4	ENSG00000158486	ENST00000261383;ENST00000415178;ENST00000396036	T;T	0.23950	1.88;2.04	5.85	2.43	0.29744	.	0.660669	0.14636	N	0.307503	T	0.40767	0.1130	M	0.64404	1.975	0.22888	N	0.998606	P;D	0.65815	0.848;0.995	B;P	0.57283	0.214;0.817	T	0.18366	-1.0339	10	0.62326	D	0.03	.	11.7556	0.51874	0.2321:0.0:0.7679:0.0	.	346;317	Q8TD57;Q8TD57-2	DYH3_HUMAN;.	M	346;346;317	ENSP00000261383:T346M;ENSP00000394245:T346M	ENSP00000261383:T346M	T	-	2	0	DNAH3	21053126	0.892000	0.30473	0.436000	0.26797	0.730000	0.41778	1.521000	0.35910	0.836000	0.34901	-0.140000	0.14226	ACG		DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
BOC	91653	broad.mit.edu	37	3	112993524	112993524	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr3:112993524C>T	ENST00000495514.1	+	9	2241	c.1537C>T	c.(1537-1539)Cgc>Tgc	p.R513C	BOC_ENST00000497495.1_3'UTR|BOC_ENST00000273395.4_Missense_Mutation_p.R513C|BOC_ENST00000355385.3_Missense_Mutation_p.R513C			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	513	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.R513C(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			GGTGAAACACCGCAAGGTATG	0.617																																					p.R513C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1537T	3						.						37.0	39.0	38.0					3																	112993524		2203	4300	6503	114476214	SO:0001583	missense	91653	exon9			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.1537C>T	3.37:g.112993524C>T	ENSP00000418663:p.Arg513Cys	Somatic		Unspecified	Illumina	Phase_I	114476214	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.702645	0.88924	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.59364	0.27;0.27;0.27	5.8	5.8	0.92144	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.055251	0.64402	D	0.000001	T	0.76506	0.3997	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.76992	-0.2753	10	0.72032	D	0.01	.	20.0693	0.97712	0.0:1.0:0.0:0.0	.	513;513	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	C	513	ENSP00000418663:R513C;ENSP00000273395:R513C;ENSP00000347546:R513C	ENSP00000273395:R513C	R	+	1	0	BOC	114476214	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	4.655000	0.61476	2.758000	0.94735	0.563000	0.77884	CGC		BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
ILDR1	286676	broad.mit.edu	37	3	121725902	121725902	+	Silent	SNP	G	G	A			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr3:121725902G>A	ENST00000344209.5	-	2	291	c.165C>T	c.(163-165)gaC>gaT	p.D55D	ILDR1_ENST00000462014.1_Silent_p.D67D|ILDR1_ENST00000460554.1_5'UTR|ILDR1_ENST00000393631.1_Silent_p.D55D|ILDR1_ENST00000273691.3_Silent_p.D55D	NM_001199799.1	NP_001186728.1	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor 1	55	Ig-like V-type.				positive regulation of peptide hormone secretion (GO:0090277)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-density lipoprotein particle receptor activity (GO:0070506)	p.D55D(2)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(114;0.156)		TCACCACCACGTCCTGGAGCT	0.542																																					p.D55D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C165T	3						.						164.0	126.0	139.0					3																	121725902		2203	4300	6503	123208592	SO:0001819	synonymous_variant	286676	exon2			BC044240	CCDS3008.1, CCDS56270.1, CCDS56271.1	3q21.1	2013-10-11			ENSG00000145103	ENSG00000145103			28741	protein-coding gene	gene with protein product		609739	"""deafness, autosomal recessive 42"""	DFNB42		15641023, 21255762	Standard	NM_175924		Approved	MGC50831	uc003ees.3	Q86SU0	OTTHUMG00000159481	ENST00000344209.5:c.165C>T	3.37:g.121725902G>A		Somatic		Unspecified	Illumina	Phase_I	123208592	NM_175924	Q6ZP61|Q7Z578	Silent	SNP	ENST00000344209.5	37	CCDS56271.1																																																																																				ILDR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355666.1	NM_175924	
SEMA3G	56920	broad.mit.edu	37	3	52469644	52469644	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr3:52469644G>A	ENST00000231721.2	-	16	2323	c.2324C>T	c.(2323-2325)aCg>aTg	p.T775M		NM_020163.1	NP_064548.1	Q9NS98	SEM3G_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G	775					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.T775M(1)		kidney(1)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)	18				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		CTCCCGGGGCGTCCGATTGTG	0.697																																					p.T775M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2324T	3						.						58.0	66.0	64.0					3																	52469644		2201	4299	6500	52444684	SO:0001583	missense	56920	exon16				CCDS2856.1	3p21.1	2013-01-11			ENSG00000010319	ENSG00000010319		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30400	protein-coding gene	gene with protein product						11214971	Standard	XM_005265327		Approved	FLJ00014, sem2	uc003dea.1	Q9NS98	OTTHUMG00000158570	ENST00000231721.2:c.2324C>T	3.37:g.52469644G>A	ENSP00000231721:p.Thr775Met	Somatic		Unspecified	Illumina	Phase_I	52444684	NM_020163	Q7L9D9|Q9H7Q3	Missense_Mutation	SNP	ENST00000231721.2	37	CCDS2856.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.445884	0.43429	.	.	ENSG00000010319	ENST00000231721	T	0.77098	-1.07	4.98	4.04	0.47022	.	0.970881	0.08494	N	0.937494	T	0.78761	0.4334	L	0.56769	1.78	0.25366	N	0.988747	D	0.63880	0.993	P	0.52856	0.711	T	0.66582	-0.5887	10	0.36615	T	0.2	.	4.6992	0.12818	0.1405:0.2227:0.6368:0.0	.	775	Q9NS98	SEM3G_HUMAN	M	775	ENSP00000231721:T775M	ENSP00000231721:T775M	T	-	2	0	SEMA3G	52444684	0.989000	0.36119	0.913000	0.36048	0.341000	0.28922	5.479000	0.66813	2.315000	0.78130	0.650000	0.86243	ACG		SEMA3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351354.1	NM_020163	
MECOM	2122	broad.mit.edu	37	3	168808021	168808021	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr3:168808021C>T	ENST00000464456.1	-	13	3777	c.2577G>A	c.(2575-2577)atG>atA	p.M859I	MECOM_ENST00000264674.3_Missense_Mutation_p.M933I|MECOM_ENST00000468789.1_Missense_Mutation_p.M868I|MECOM_ENST00000433243.2_Missense_Mutation_p.M869I|MECOM_ENST00000494292.1_Missense_Mutation_p.M1047I|MECOM_ENST00000460814.1_Missense_Mutation_p.M859I|MECOM_ENST00000392736.3_Missense_Mutation_p.M868I|MECOM_ENST00000472280.1_Missense_Mutation_p.M869I	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M868I(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						GACTGCCATTCATTCTTTCAA	0.318																																					p.M933I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2799A	3						.						67.0	69.0	69.0					3																	168808021		2203	4299	6502	170290715	SO:0001583	missense	2122	exon15			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.2577G>A	3.37:g.168808021C>T	ENSP00000419770:p.Met859Ile	Somatic		Unspecified	Illumina	Phase_I	170290715	NM_001105077	Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000464456.1	37	CCDS54669.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.269993	0.23221	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	T;T;T;T;T;T;T;T	0.05139	3.54;3.54;3.49;3.64;3.49;3.54;3.49;3.64	5.2	5.2	0.72013	.	0.420710	0.22758	N	0.055985	T	0.06096	0.0158	L	0.36672	1.1	0.41047	D	0.985272	B;B;B;B;B	0.15473	0.013;0.0;0.002;0.0;0.0	B;B;B;B;B	0.08055	0.003;0.001;0.002;0.002;0.0	T	0.36359	-0.9751	10	0.16896	T	0.51	-12.2337	12.4667	0.55762	0.0:0.9229:0.0:0.0771	.	1056;860;1047;933;868	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	I	933;868;859;869;1047;868;859;869	ENSP00000264674:M933I;ENSP00000376493:M868I;ENSP00000419770:M859I;ENSP00000420048:M869I;ENSP00000417899:M1047I;ENSP00000419995:M868I;ENSP00000420466:M859I;ENSP00000394302:M869I	ENSP00000264674:M933I	M	-	3	0	MECOM	170290715	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	1.716000	0.37981	2.571000	0.86741	0.650000	0.86243	ATG		MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991	
WSCD2	9671	broad.mit.edu	37	12	108634175	108634175	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr12:108634175C>T	ENST00000332082.4	+	9	2017	c.1199C>T	c.(1198-1200)aCg>aTg	p.T400M	WSCD2_ENST00000261400.3_Missense_Mutation_p.T400M|WSCD2_ENST00000547525.1_Missense_Mutation_p.T400M|WSCD2_ENST00000549903.1_Missense_Mutation_p.T400M			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	400						integral component of membrane (GO:0016021)		p.T400M(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						TGCATCAAGACGCACGAAAGC	0.602																																					p.T400M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1199T	12						.						130.0	140.0	137.0					12																	108634175		2060	4210	6270	107158305	SO:0001583	missense	9671	exon8				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.1199C>T	12.37:g.108634175C>T	ENSP00000331933:p.Thr400Met	Somatic		Unspecified	Illumina	Phase_I	107158305	NM_014653	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	ENST00000332082.4	37	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.045715	0.93685	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.38401	1.14;4.25;1.14;4.25	4.9	4.9	0.64082	.	0.097827	0.64402	D	0.000001	T	0.64271	0.2583	M	0.90759	3.145	0.80722	D	1	D;D	0.76494	0.999;0.997	P;P	0.60173	0.87;0.745	T	0.72364	-0.4316	10	0.56958	D	0.05	-17.6089	17.3052	0.87192	0.0:1.0:0.0:0.0	.	400;400	Q2TBF2-2;Q2TBF2	.;WSCD2_HUMAN	M	400	ENSP00000448047:T400M;ENSP00000261400:T400M;ENSP00000331933:T400M;ENSP00000447272:T400M	ENSP00000261400:T400M	T	+	2	0	WSCD2	107158305	1.000000	0.71417	0.961000	0.40146	0.987000	0.75469	7.192000	0.77771	2.551000	0.86045	0.644000	0.83932	ACG		WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653	
HECTD4	283450	broad.mit.edu	37	12	112708081	112708081	+	Missense_Mutation	SNP	T	T	C	rs552018424		TCGA-AG-4008-01	TCGA-AG-4008-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr12:112708081T>C	ENST00000430131.2	-	11	1974	c.829A>G	c.(829-831)Atg>Gtg	p.M277V	HECTD4_ENST00000377560.5_Missense_Mutation_p.M527V|HECTD4_ENST00000550722.1_Missense_Mutation_p.M565V|RN7SKP71_ENST00000364558.1_RNA			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	277					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.M277V(1)|p.M527V(1)									CCATTAACCATGGCCTTCTCC	0.398																																					p.M527V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1579G	12						.						249.0	223.0	232.0					12																	112708081		2203	4300	6503	111192464	SO:0001583	missense	283450	exon11			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.829A>G	12.37:g.112708081T>C	ENSP00000404379:p.Met277Val	Somatic		Unspecified	Illumina	Phase_I	111192464	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	T	16.47	3.131681	0.56828	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.40756	1.02;1.02;1.03	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.33789	0.0875	N	0.08118	0	0.43885	D	0.996507	B;B;B	0.34399	0.452;0.323;0.452	P;B;P	0.44623	0.455;0.354;0.455	T	0.29731	-1.0002	10	0.27785	T	0.31	.	15.6267	0.76863	0.0:0.0:0.0:1.0	.	277;277;277	Q9Y4D8-2;Q9Y4D8;Q9Y4D8-3	.;K0614_HUMAN;.	V	527;277;565	ENSP00000366783:M527V;ENSP00000404379:M277V;ENSP00000449784:M565V	ENSP00000366783:M527V	M	-	1	0	C12orf51	111192464	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.665000	0.83852	2.089000	0.63090	0.379000	0.24179	ATG		HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
CHD4	1108	broad.mit.edu	37	12	6692269	6692269	+	Silent	SNP	G	G	A			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr12:6692269G>A	ENST00000357008.2	-	27	4234	c.4071C>T	c.(4069-4071)gaC>gaT	p.D1357D	CHD4_ENST00000309577.6_Silent_p.D1385D|RP5-940J5.6_ENST00000501075.2_RNA|SCARNA11_ENST00000516089.1_RNA|CHD4_ENST00000544484.1_Silent_p.D1382D|CHD4_ENST00000540960.1_5'UTR|CHD4_ENST00000544040.1_Silent_p.D1350D	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1357					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.D1385D(1)|p.D1357D(1)		central_nervous_system(2)	2						CGGACTGGTCGTCCTGCCAAT	0.587																																					p.D1357D	Colon(32;586 792 4568 16848 45314)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C4071T	12						.						85.0	85.0	85.0					12																	6692269		2203	4300	6503	6562530	SO:0001819	synonymous_variant	1108	exon27			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.4071C>T	12.37:g.6692269G>A		Somatic		Unspecified	Illumina	Phase_I	6562530	NM_001273	Q8IXZ5	Silent	SNP	ENST00000357008.2	37	CCDS8552.1																																																																																				CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
PZP	5858	broad.mit.edu	37	12	9318699	9318699	+	Missense_Mutation	SNP	G	G	A	rs200058002		TCGA-AG-4008-01	TCGA-AG-4008-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr12:9318699G>A	ENST00000261336.2	-	18	2235	c.2207C>T	c.(2206-2208)aCg>aTg	p.T736M	PZP_ENST00000539983.1_5'UTR|PZP_ENST00000381997.2_Missense_Mutation_p.T605M	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	736					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.T605M(1)|p.T736M(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GCTTCGCACCGTTTCAGGGAC	0.448																																					p.T736M	Melanoma(125;1402 1695 4685 34487 38571)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2207T	12						.	G	MET/THR	0,4406		0,0,2203	143.0	135.0	138.0		2207	1.5	0.0	12		138	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PZP	NM_002864.2	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	736/1483	9318699	1,13005	2203	4300	6503	9209966	SO:0001583	missense	5858	exon18			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.2207C>T	12.37:g.9318699G>A	ENSP00000261336:p.Thr736Met	Somatic		Unspecified	Illumina	Phase_I	9209966	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.298198	0.40694	0.0	1.16E-4	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.38722	1.4;1.12	3.58	1.47	0.22746	.	0.243635	0.20220	U	0.096705	T	0.43299	0.1241	L	0.29908	0.895	0.21020	N	0.999806	D;D;D	0.76494	0.999;0.986;0.999	P;P;P	0.62885	0.908;0.8;0.908	T	0.20306	-1.0279	10	0.62326	D	0.03	.	6.5659	0.22511	0.2768:0.0:0.7232:0.0	.	736;605;736	B2R950;P20742-2;P20742	.;.;PZP_HUMAN	M	736;605	ENSP00000261336:T736M;ENSP00000371427:T605M	ENSP00000261336:T736M	T	-	2	0	PZP	9209966	0.960000	0.32886	0.002000	0.10522	0.335000	0.28730	2.324000	0.43831	0.192000	0.20272	0.460000	0.39030	ACG		PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
KRAS	3845	broad.mit.edu	37	12	25398284	25398285	+	Missense_Mutation	DNP	CC	CC	AA	rs121913530|rs121913529		TCGA-AG-4008-01	TCGA-AG-4008-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr12:25398284_25398285CC>AA	ENST00000256078.4	-	2	97_98	c.34_35GG>TT	c.(34-36)GGt>TTt	p.G12F	KRAS_ENST00000556131.1_Missense_Mutation_p.G12F|KRAS_ENST00000311936.3_Missense_Mutation_p.G12F|KRAS_ENST00000557334.1_Missense_Mutation_p.G12F	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12C(3001)|p.G12A(1407)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAACT	0.347	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	.	.	20892	Substitution - Missense(20889)|Insertion - In frame(2)|Deletion - Frameshift(1)	large_intestine(11786)|pancreas(3650)|lung(3132)|ovary(556)|biliary_tract(494)|endometrium(373)|haematopoietic_and_lymphoid_tissue(212)|stomach(145)|thyroid(97)|prostate(70)|small_intestine(56)|upper_aerodigestive_tract(47)|urinary_tract(47)|soft_tissue(42)|cervix(41)|skin(35)|liver(22)|breast(20)|testis(16)|oesophagus(11)|central_nervous_system(8)|peritoneum(6)|kidney(5)|eye(4)|NS(4)|autonomic_ganglia(3)|gastrointestinal_tract_(site_indeterminate)(3)|thymus(3)|penis(1)|adrenal_gland(1)|salivary_gland(1)|bone(1)	c.34_35TT	12	GRCh37	CM076251	KRAS	M	rs121913530	.																																			25289552	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34_35delinsAA	12.37:g.25398284_25398285delinsAA	ENSP00000256078:p.Gly12Phe	Somatic		Unspecified	Illumina	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	DNP	ENST00000256078.4	37	CCDS8703.1																																																																																				KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
TESPA1	9840	broad.mit.edu	37	12	55356419	55356419	+	Silent	SNP	C	C	T	rs200398984	byFrequency	TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr12:55356419C>T	ENST00000449076.1	-	9	1395	c.1263G>A	c.(1261-1263)acG>acA	p.T421T	TESPA1_ENST00000316577.8_Silent_p.T421T|TESPA1_ENST00000524959.1_5'Flank|TESPA1_ENST00000531122.1_Silent_p.T283T|TESPA1_ENST00000524622.1_Silent_p.T283T|TESPA1_ENST00000532804.1_Silent_p.T283T	NM_001136030.2	NP_001129502.1	A2RU30	TESP1_HUMAN	thymocyte expressed, positive selection associated 1	421					COP9 signalosome assembly (GO:0010387)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.T421T(2)|p.T283T(2)									GATGGGTTTCCGTATTGGTGG	0.493																																					p.T421T												.	.	4	Substitution - coding silent(4)	large_intestine(2)|endometrium(2)	c.G1263A	12						.	C	,	0,3904		0,0,1952	148.0	151.0	150.0		1263,1263	2.3	0.0	12		150	11,8261		0,11,4125	no	coding-synonymous,coding-synonymous	KIAA0748	NM_001098815.1,NM_001136030.1	,	0,11,6077	TT,TC,CC		0.133,0.0,0.0903	,	421/522,421/522	55356419	11,12165	1952	4136	6088	53642686	SO:0001819	synonymous_variant	9840	exon9			AB018291	CCDS44913.1, CCDS58240.1	12q13.2	2012-03-21	2012-03-21	2012-03-21	ENSG00000135426	ENSG00000135426			29109	protein-coding gene	gene with protein product		615664	"""KIAA0748"""	KIAA0748		9872452	Standard	NM_001136030		Approved		uc001sgn.4	A2RU30	OTTHUMG00000165407	ENST00000449076.1:c.1263G>A	12.37:g.55356419C>T		Somatic		Unspecified	Illumina	Phase_I	53642686	NM_001098815	B4DPM3|B4E048|B7Z9K7|O94849|Q4G0P2|Q9P0C4	Silent	SNP	ENST00000449076.1	37	CCDS44913.1																																																																																				TESPA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383822.1	NM_001098815	
TPCN1	53373	broad.mit.edu	37	12	113731118	113731118	+	Silent	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr12:113731118C>T	ENST00000335509.6	+	27	2612	c.2298C>T	c.(2296-2298)agC>agT	p.S766S	TPCN1_ENST00000546787.1_3'UTR|TPCN1_ENST00000550785.1_Silent_p.S838S|TPCN1_ENST00000541517.1_Silent_p.S838S|TPCN1_ENST00000392569.4_Silent_p.S698S	NM_017901.4	NP_060371.2	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1	766					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|voltage-gated calcium channel activity (GO:0005245)	p.S766S(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(1)	40						GGACCAAGAGCGACCTGAGCC	0.602																																					p.S766S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2298T	12						.						215.0	209.0	211.0					12																	113731118		2203	4300	6503	112215501	SO:0001819	synonymous_variant	53373	exon27			AB032995	CCDS31908.1, CCDS44985.1	12q24.21	2011-07-05			ENSG00000186815	ENSG00000186815		"""Voltage-gated ion channels / Two-pore channels"""	18182	protein-coding gene	gene with protein product		609666				10574461, 10753632, 16382101	Standard	XM_005253905		Approved	KIAA1169, FLJ20612, TPC1	uc001tux.3	Q9ULQ1	OTTHUMG00000169625	ENST00000335509.6:c.2298C>T	12.37:g.113731118C>T		Somatic		Unspecified	Illumina	Phase_I	112215501	NM_017901	A7E258|Q86XS9|Q8NC20	Silent	SNP	ENST00000335509.6	37	CCDS31908.1																																																																																				TPCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405156.3	NM_017901	
MAPKBP1	23005	broad.mit.edu	37	15	42106934	42106934	+	Frame_Shift_Del	DEL	G	G	-	rs141101616		TCGA-AG-4008-01	TCGA-AG-4008-01			G	-	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr15:42106934delG	ENST00000456763.2	+	11	1381	c.1185delG	c.(1183-1185)gtgfs	p.V395fs	MAPKBP1_ENST00000221214.6_Intron|MAPKBP1_ENST00000260357.7_Frame_Shift_Del_p.V277fs|MAPKBP1_ENST00000514566.1_Frame_Shift_Del_p.V389fs|MAPKBP1_ENST00000457542.2_Frame_Shift_Del_p.V389fs	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	395								p.E390fs*6(1)		breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		TCTGGAGTGTGGAGGTATGTG	0.498																																					p.V389fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1167delG	15						.						180.0	167.0	172.0					15																	42106934		2203	4300	6503	39894226	SO:0001589	frameshift_variant	23005	exon10			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.1185delG	15.37:g.42106934delG	ENSP00000393099:p.Val395fs	Somatic		Unspecified	Illumina	Phase_I	39894226	NM_014994	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Frame_Shift_Del	DEL	ENST00000456763.2	37	CCDS45239.1																																																																																				MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
JAKMIP1	152789	broad.mit.edu	37	4	6083355	6083355	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr4:6083355G>A	ENST00000282924.5	-	6	1567	c.1082C>T	c.(1081-1083)aCg>aTg	p.T361M	JAKMIP1_ENST00000409021.3_Missense_Mutation_p.T361M|JAKMIP1_ENST00000410077.2_Missense_Mutation_p.T196M|JAKMIP1_ENST00000409371.3_Missense_Mutation_p.T196M|JAKMIP1_ENST00000457227.2_5'UTR|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.T361M	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	361	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)	p.T361M(2)		NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GTTTTCCCGCGTGAGGTTCTT	0.532																																					p.T361M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1082T	4						.						183.0	158.0	166.0					4																	6083355		2203	4300	6503	6134256	SO:0001583	missense	152789	exon6			AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.1082C>T	4.37:g.6083355G>A	ENSP00000282924:p.Thr361Met	Somatic		Unspecified	Illumina	Phase_I	6134256	NM_144720	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000282924.5	37	CCDS3385.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.161084	0.57368	.	.	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000418227;ENST00000425341;ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T;T;T	0.36699	1.67;1.27;1.67;1.67;1.24	4.42	3.58	0.41010	.	0.196104	0.35124	N	0.003440	T	0.39279	0.1072	L	0.49126	1.545	0.30703	N	0.75007	B;D;B;B;D	0.64830	0.029;0.981;0.011;0.011;0.994	B;P;B;B;P	0.48454	0.016;0.578;0.01;0.01;0.578	T	0.49082	-0.8976	10	0.87932	D	0	.	11.8578	0.52449	0.0858:0.0:0.9142:0.0	.	196;361;196;361;361	B4DHZ8;F2Z2K5;Q96N16-5;Q96N16-2;Q96N16	.;.;.;.;JKIP1_HUMAN	M	361;196;361;361;253;361;361;196	ENSP00000386711:T361M;ENSP00000387042:T196M;ENSP00000282924:T361M;ENSP00000386925:T361M;ENSP00000386745:T196M	ENSP00000282924:T361M	T	-	2	0	JAKMIP1	6134256	0.999000	0.42202	0.845000	0.33349	0.722000	0.41435	4.475000	0.60210	0.995000	0.38917	0.561000	0.74099	ACG		JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720	
MEPE	56955	broad.mit.edu	37	4	88767462	88767462	+	Missense_Mutation	SNP	G	G	A	rs138152179		TCGA-AG-4008-01	TCGA-AG-4008-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr4:88767462G>A	ENST00000424957.3	+	4	1515	c.1442G>A	c.(1441-1443)cGg>cAg	p.R481Q	MEPE_ENST00000508016.1_3'UTR|MEPE_ENST00000560249.1_Missense_Mutation_p.R368Q|MEPE_ENST00000395102.4_Missense_Mutation_p.R512Q|MEPE_ENST00000361056.3_Missense_Mutation_p.R481Q|MEPE_ENST00000540395.1_Missense_Mutation_p.R368Q|MEPE_ENST00000497649.2_Missense_Mutation_p.R457Q	NM_001184694.1	NP_001171623.1	Q9NQ76	MEPE_HUMAN	matrix extracellular phosphoglycoprotein	481					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|regulation of bone remodeling (GO:0046850)|skeletal system development (GO:0001501)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.R481Q(1)|p.R481L(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		AATTCTACACGGAATAAGGGT	0.423																																					p.R368Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1103A	4						.	G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	84.0	84.0	84.0		1442,1103,1103,1103,1442	-0.1	0.0	4	dbSNP_134	84	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	MEPE	NM_001184694.1,NM_001184695.1,NM_001184696.1,NM_001184697.1,NM_020203.3	43,43,43,43,43	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign,benign,benign,benign,benign	481/526,368/413,368/413,368/413,481/526	88767462	2,13004	2203	4300	6503	88986486	SO:0001583	missense	56955	exon6			AJ276396	CCDS3625.1, CCDS54776.1	4q21.1	2008-08-29	2008-08-29		ENSG00000152595	ENSG00000152595			13361	protein-coding gene	gene with protein product		605912	"""matrix, extracellular phosphoglycoprotein with ASARM motif (bone)"""			10945470	Standard	NM_020203		Approved		uc003hqy.3	Q9NQ76	OTTHUMG00000130592	ENST00000424957.3:c.1442G>A	4.37:g.88767462G>A	ENSP00000416984:p.Arg481Gln	Somatic		Unspecified	Illumina	Phase_I	88986486	NM_001184697	A1A4X9|A8MTA3|D2CFR4|F5H5C5	Missense_Mutation	SNP	ENST00000424957.3	37	CCDS3625.1	.	.	.	.	.	.	.	.	.	.	G	9.311	1.055691	0.19907	4.54E-4	0.0	ENSG00000152595	ENST00000424957;ENST00000395102;ENST00000497649;ENST00000540395;ENST00000361056	T;T;T;T;T	0.48522	0.82;0.82;0.81;0.83;0.82	4.68	-0.129	0.13502	.	2.142430	0.02126	N	0.055974	T	0.34164	0.0888	L	0.28400	0.85	0.09310	N	1	B	0.20052	0.041	B	0.13407	0.009	T	0.08722	-1.0708	10	0.25751	T	0.34	5.0519	4.6795	0.12727	0.3356:0.1521:0.5123:0.0	.	481	Q9NQ76	MEPE_HUMAN	Q	481;512;457;368;481	ENSP00000416984:R481Q;ENSP00000378534:R512Q;ENSP00000422747:R457Q;ENSP00000443491:R368Q;ENSP00000354341:R481Q	ENSP00000354341:R481Q	R	+	2	0	MEPE	88986486	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.531000	0.23052	0.021000	0.15133	0.563000	0.77884	CGG		MEPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253038.1		
NDST3	9348	broad.mit.edu	37	4	119148099	119148099	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr4:119148099G>A	ENST00000296499.5	+	8	2184	c.1781G>A	c.(1780-1782)cGc>cAc	p.R594H	NDST3_ENST00000433996.2_Missense_Mutation_p.R513H	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	594	Heparan sulfate N-sulfotransferase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.R594H(1)		NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						ACTTGTGATCGCTTACCAAAA	0.348																																					p.R594H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1781A	4						.						78.0	84.0	82.0					4																	119148099		2203	4300	6503	119367547	SO:0001583	missense	9348	exon8			AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.1781G>A	4.37:g.119148099G>A	ENSP00000296499:p.Arg594His	Somatic		Unspecified	Illumina	Phase_I	119367547	NM_004784	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	ENST00000296499.5	37	CCDS3708.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220099	0.58560	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.58210	0.35;0.35	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.46308	0.1386	L	0.55743	1.74	0.40713	D	0.982599	P;B	0.37824	0.609;0.001	B;B	0.25506	0.061;0.001	T	0.50750	-0.8791	10	0.35671	T	0.21	.	19.0943	0.93244	0.0:0.0:1.0:0.0	.	513;594	B4DI67;O95803	.;NDST3_HUMAN	H	594;513	ENSP00000296499:R594H;ENSP00000396625:R513H	ENSP00000296499:R594H	R	+	2	0	NDST3	119367547	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.810000	0.86072	2.571000	0.86741	0.491000	0.48974	CGC		NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784	
MAGEB6	158809	broad.mit.edu	37	X	26212565	26212565	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chrX:26212565C>T	ENST00000379034.1	+	2	751	c.602C>T	c.(601-603)aCg>aTg	p.T201M		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	201	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.T201M(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						AAGGCGTGCACGTTGGCGCAA	0.483																																					p.T201M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C602T	X						.						83.0	70.0	75.0					X																	26212565		2202	4300	6502	26122486	SO:0001583	missense	158809	exon2			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.602C>T	X.37:g.26212565C>T	ENSP00000368320:p.Thr201Met	Somatic		Unspecified	Illumina	Phase_I	26122486	NM_173523	Q6GS19|Q9H219	Missense_Mutation	SNP	ENST00000379034.1	37	CCDS14217.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-4.099939	0.00002	.	.	ENSG00000176746	ENST00000379034	T	0.01804	4.63	2.88	-5.76	0.02376	.	0.624921	0.14149	N	0.338154	T	0.00496	0.0016	N	0.00252	-1.77	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.52034	-0.8629	10	0.38643	T	0.18	.	3.784	0.08692	0.6019:0.174:0.0996:0.1246	.	201	Q8N7X4	MAGB6_HUMAN	M	201	ENSP00000368320:T201M	ENSP00000368320:T201M	T	+	2	0	MAGEB6	26122486	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.470000	0.00065	-5.416000	0.00015	-4.040000	0.00012	ACG		MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	NM_173523	
NLGN4X	57502	broad.mit.edu	37	X	5821698	5821698	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chrX:5821698C>T	ENST00000381095.3	-	5	1648	c.1021G>A	c.(1021-1023)Ggg>Agg	p.G341R	NLGN4X_ENST00000381092.1_Missense_Mutation_p.G341R|NLGN4X_ENST00000275857.6_Missense_Mutation_p.G341R|NLGN4X_ENST00000538097.1_Missense_Mutation_p.G341R|NLGN4X_ENST00000381093.2_Missense_Mutation_p.G361R	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	341					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.G341R(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						ATCACCGGCCCGAAGGCTATG	0.587																																					p.G341R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1021A	X						.						183.0	126.0	146.0					X																	5821698		2203	4300	6503	5831698	SO:0001583	missense	57502	exon5			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1021G>A	X.37:g.5821698C>T	ENSP00000370485:p.Gly341Arg	Somatic		Unspecified	Illumina	Phase_I	5831698	NM_020742	Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.603652	0.46423	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.59224	0.28;0.28;0.28;0.28;0.28	3.93	3.93	0.45458	Carboxylesterase, type B (1);	.	.	.	.	T	0.73497	0.3594	M	0.72576	2.205	0.80722	D	1	D;D;D	0.89917	0.993;1.0;1.0	P;D;D	0.83275	0.657;0.996;0.945	T	0.75563	-0.3274	8	.	.	.	.	14.4946	0.67678	0.0:1.0:0.0:0.0	.	398;341;361	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	R	341;361;341;341;341	ENSP00000370485:G341R;ENSP00000370483:G361R;ENSP00000275857:G341R;ENSP00000370482:G341R;ENSP00000439203:G341R	.	G	-	1	0	NLGN4X	5831698	1.000000	0.71417	0.273000	0.24645	0.054000	0.15201	6.722000	0.74735	1.579000	0.49836	0.600000	0.82982	GGG		NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
ITIH6	347365	broad.mit.edu	37	X	54777771	54777771	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chrX:54777771G>A	ENST00000218436.6	-	12	3424	c.3395C>T	c.(3394-3396)cCg>cTg	p.P1132L		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	1132					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P1132L(1)									CTTGTGGCCCGGCCTTGGTGG	0.572																																					p.P1132L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3395T	X						.						59.0	50.0	53.0					X																	54777771		2203	4300	6503	54794496	SO:0001583	missense	347365	exon12			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.3395C>T	X.37:g.54777771G>A	ENSP00000218436:p.Pro1132Leu	Somatic		Unspecified	Illumina	Phase_I	54794496	NM_198510	A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663062	0.47572	.	.	ENSG00000102313	ENST00000218436	T	0.11604	2.76	3.58	1.7	0.24286	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	1.594190	0.03907	U	0.281200	T	0.09423	0.0232	L	0.41492	1.28	0.29785	N	0.833698	P	0.49090	0.919	B	0.38296	0.27	T	0.25082	-1.0142	10	0.59425	D	0.04	.	3.4161	0.07376	0.2301:0.0:0.5581:0.2118	.	1132	Q6UXX5	ITH5L_HUMAN	L	1132	ENSP00000218436:P1132L	ENSP00000218436:P1132L	P	-	2	0	ITIH5L	54794496	0.000000	0.05858	0.423000	0.26634	0.810000	0.45777	0.559000	0.23485	0.351000	0.24027	0.287000	0.19450	CCG		ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510	
GPR45	11250	broad.mit.edu	37	2	105858990	105858990	+	Silent	SNP	C	C	T	rs200019068		TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr2:105858990C>T	ENST00000258456.1	+	1	791	c.675C>T	c.(673-675)aaC>aaT	p.N225N		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.N225N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						TCCGCAAGAACGCCGTGCGCG	0.667																																					p.N225N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C675T	2						.						67.0	67.0	67.0					2																	105858990		2203	4300	6503	105225422	SO:0001819	synonymous_variant	11250	exon1			AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.675C>T	2.37:g.105858990C>T		Somatic		Unspecified	Illumina	Phase_I	105225422	NM_007227	Q6NWS4|Q6NXU6	Silent	SNP	ENST00000258456.1	37	CCDS2066.1																																																																																				GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253348.1	NM_007227	
PXDN	7837	broad.mit.edu	37	2	1652070	1652070	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr2:1652070C>T	ENST00000252804.4	-	17	3532	c.3482G>A	c.(3481-3483)cGg>cAg	p.R1161Q		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	1161					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.R1161Q(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GTCCCGGCCCCGCTGGATGTT	0.597																																					p.R1161Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3482A	2						.						74.0	84.0	81.0					2																	1652070		2036	4213	6249	1631077	SO:0001583	missense	7837	exon17			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.3482G>A	2.37:g.1652070C>T	ENSP00000252804:p.Arg1161Gln	Somatic		Unspecified	Illumina	Phase_I	1631077	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	37	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	C	33	5.281594	0.95489	.	.	ENSG00000130508	ENST00000252804	D	0.83419	-1.72	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.93609	0.7959	M	0.93062	3.375	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94595	0.7791	10	0.87932	D	0	-37.3055	19.6424	0.95763	0.0:1.0:0.0:0.0	.	1161	Q92626	PXDN_HUMAN	Q	1161	ENSP00000252804:R1161Q	ENSP00000252804:R1161Q	R	-	2	0	PXDN	1631077	1.000000	0.71417	0.955000	0.39395	0.974000	0.67602	7.734000	0.84928	2.645000	0.89757	0.650000	0.86243	CGG		PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
MAP3K19	80122	broad.mit.edu	37	2	135738422	135738422	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr2:135738422C>T	ENST00000375845.3	-	9	3919	c.3889G>A	c.(3889-3891)Gca>Aca	p.A1297T	MAP3K19_ENST00000392915.1_3'UTR|MAP3K19_ENST00000392918.3_Missense_Mutation_p.A431T|MAP3K19_ENST00000375844.3_Missense_Mutation_p.A479T|MAP3K19_ENST00000315513.3_Missense_Mutation_p.A158T|MAP3K19_ENST00000392917.3_Missense_Mutation_p.A429T|MAP3K19_ENST00000358371.4_Missense_Mutation_p.A1184T	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	1297	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A1297T(1)|p.A649T(1)									AAGTCTGCTGCATTTTCTGAG	0.517																																					p.A1297T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3889A	2						.						48.0	42.0	44.0					2																	135738422		2203	4300	6503	135454892	SO:0001583	missense	80122	exon9			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.3889G>A	2.37:g.135738422C>T	ENSP00000365005:p.Ala1297Thr	Somatic		Unspecified	Illumina	Phase_I	135454892	NM_025052	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	ENST00000375845.3	37	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353590	0.82243	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000437365;ENST00000315513	T;T;T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3	5.76	5.76	0.90799	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.44285	D	0.000465	T	0.75561	0.3866	L	0.45051	1.395	0.51767	D	0.999932	D;D;P;P;D	0.89917	0.997;1.0;0.947;0.947;1.0	P;D;P;P;D	0.87578	0.902;0.994;0.58;0.701;0.998	T	0.75462	-0.3309	10	0.52906	T	0.07	.	13.8592	0.63550	0.1525:0.8475:0.0:0.0	.	429;1184;431;479;1297	B7ZMH9;Q56UN5-3;Q56UN5-4;Q56UN5-5;Q56UN5	.;.;.;.;YSK4_HUMAN	T	1297;1184;479;431;429;687;158	ENSP00000365005:A1297T;ENSP00000351140:A1184T;ENSP00000365004:A479T;ENSP00000376650:A431T;ENSP00000376649:A429T;ENSP00000392827:A687T;ENSP00000321160:A158T	ENSP00000321160:A158T	A	-	1	0	YSK4	135454892	1.000000	0.71417	0.193000	0.23327	0.978000	0.69477	5.739000	0.68622	2.706000	0.92434	0.591000	0.81541	GCA		MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	
TTN	7273	broad.mit.edu	37	2	179427593	179427593	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-4008-01	TCGA-AG-4008-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr2:179427593T>A	ENST00000591111.1	-	276	78567	c.78343A>T	c.(78343-78345)Aca>Tca	p.T26115S	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.T25188S|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T18816S|TTN_ENST00000460472.2_Missense_Mutation_p.T18691S|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T18883S|TTN_ENST00000589042.1_Missense_Mutation_p.T27756S|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26115	Ig-like 126.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T18816S(1)|p.T18883S(1)|p.T18691S(1)|p.T25186S(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAAAAGCTGTTTTGGAGCCA	0.413																																					p.K18690N												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.A56070T	2						.						57.0	54.0	55.0					2																	179427593		1883	4125	6008	179135839	SO:0001583	missense	7273	exon154			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.78343A>T	2.37:g.179427593T>A	ENSP00000465570:p.Thr26115Ser	Somatic		Unspecified	Illumina	Phase_I	179135839	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	10.76	1.441954	0.25900	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	6.04	4.86	0.63082	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.40645	0.1125	N	0.02775	-0.495	0.37701	D	0.924222	B;B;B;B	0.17465	0.022;0.022;0.022;0.012	B;B;B;B	0.15052	0.012;0.012;0.012;0.008	T	0.38735	-0.9647	9	0.87932	D	0	.	7.3717	0.26804	0.1559:0.0712:0.0:0.7729	.	18691;18816;18883;26115	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	25188;18691;18883;18816;18689	ENSP00000343764:T25188S;ENSP00000434586:T18691S;ENSP00000340554:T18883S;ENSP00000352154:T18816S	ENSP00000340554:T18883S	T	-	1	0	TTN	179135839	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	4.520000	0.60524	1.066000	0.40716	0.459000	0.35465	ACA		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	broad.mit.edu	37	2	179434963	179434963	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4008-01	TCGA-AG-4008-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr2:179434963T>C	ENST00000591111.1	-	276	71197	c.70973A>G	c.(70972-70974)aAg>aGg	p.K23658R	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K22731R|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K16359R|TTN_ENST00000460472.2_Missense_Mutation_p.K16234R|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K16426R|TTN_ENST00000589042.1_Missense_Mutation_p.K25299R|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23658	Fibronectin type-III 71. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K16234R(1)|p.K16359R(1)|p.K22729R(1)|p.K16426R(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAATGGATTCTTGGCAACTAC	0.413																																					p.R16234G												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.A48700G	2						.						101.0	94.0	97.0					2																	179434963		1941	4138	6079	179143209	SO:0001583	missense	7273	exon154			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.70973A>G	2.37:g.179434963T>C	ENSP00000465570:p.Lys23658Arg	Somatic		Unspecified	Illumina	Phase_I	179143209	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	11.93	1.784611	0.31593	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	5.87	5.87	0.94306	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.32645	0.0836	N	0.16478	0.41	0.43953	D	0.996624	B;B;B;B	0.09022	0.002;0.002;0.002;0.002	B;B;B;B	0.06405	0.002;0.002;0.002;0.002	T	0.14448	-1.0472	9	0.87932	D	0	.	10.5981	0.45349	0.0:0.0714:0.0:0.9286	.	16234;16359;16426;23658	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	22731;16234;16426;16359;16232	ENSP00000343764:K22731R;ENSP00000434586:K16234R;ENSP00000340554:K16426R;ENSP00000352154:K16359R	ENSP00000340554:K16426R	K	-	2	0	TTN	179143209	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.529000	0.35996	2.236000	0.73375	0.528000	0.53228	AAG		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ADCY3	109	broad.mit.edu	37	2	25050913	25050913	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr2:25050913C>T	ENST00000260600.5	-	13	3141	c.2290G>A	c.(2290-2292)Gcc>Acc	p.A764T	ADCY3_ENST00000405392.1_Intron|RP11-443B20.1_ENST00000606114.1_RNA|ADCY3_ENST00000450524.1_5'UTR	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	764					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.A764T(1)		NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					ATGATGGTGGCGATGAGGGAC	0.607											OREG0014498	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A764T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2290A	2						.						108.0	83.0	91.0					2																	25050913		2203	4300	6503	24904417	SO:0001583	missense	109	exon13			AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.2290G>A	2.37:g.25050913C>T	ENSP00000260600:p.Ala764Thr	Somatic	776	Unspecified	Illumina	Phase_I	24904417	NM_004036	B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	ENST00000260600.5	37	CCDS1715.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.549702	0.86127	.	.	ENSG00000138031	ENST00000260600;ENST00000415879;ENST00000455323;ENST00000450524	T;T;T	0.72942	-0.7;-0.7;-0.7	5.38	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.82006	0.4943	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	0.993;1.0	P;D	0.74023	0.775;0.982	T	0.81773	-0.0779	10	0.36615	T	0.2	.	15.2141	0.73250	0.1419:0.8581:0.0:0.0	.	764;764	B7ZLX9;O60266	.;ADCY3_HUMAN	T	764;739;103;107	ENSP00000260600:A764T;ENSP00000402008:A103T;ENSP00000410972:A107T	ENSP00000260600:A764T	A	-	1	0	ADCY3	24904417	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.573000	0.82421	1.480000	0.48289	-0.181000	0.13052	GCC		ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2		
SRD5A2	6716	broad.mit.edu	37	2	31805728	31805728	+	RNA	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr2:31805728C>T	ENST00000405650.1	-	0	408							P31213	S5A2_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)						androgen biosynthetic process (GO:0006702)|androgen metabolic process (GO:0008209)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|male gonad development (GO:0008584)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|sterol 5-alpha reductase activity (GO:0009917)					Acute lymphoblastic leukemia(172;0.155)				Azelaic Acid(DB00548)|Dutasteride(DB01126)|Finasteride(DB01216)|Spironolactone(DB00421)	CCAGAAGTACCGTCCCAGGTG	0.687																																					p.R81Q												.	.	0			c.G242A	2						.						20.0	24.0	23.0					2																	31805728		1937	4141	6078	31659232			6716	exon1			M74047	CCDS74503.1	2p23.1	2013-01-31			ENSG00000049319	ENSG00000277893	1.3.99.5		11285	protein-coding gene	gene with protein product		607306				1522235	Standard	NM_000348		Approved		uc002rnw.1	P31213	OTTHUMG00000152057		2.37:g.31805728C>T		Somatic		Unspecified	Illumina	Phase_I	31659232	NM_000348	B2RE87|Q2M1R4|Q9BYE6	Silent	SNP	ENST00000405650.1	37																																																																																					SRD5A2-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000325124.1	NM_000348	
PNPT1	87178	broad.mit.edu	37	2	55883321	55883321	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-4008-01	TCGA-AG-4008-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr2:55883321A>C	ENST00000447944.2	-	17	1472	c.1386T>G	c.(1384-1386)atT>atG	p.I462M		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	462					cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)	p.I462M(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AATCTCGGGGAATAACAGGAT	0.323																																					p.I462M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1386G	2						.						89.0	85.0	87.0					2																	55883321		2203	4297	6500	55736825	SO:0001583	missense	87178	exon17			BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.1386T>G	2.37:g.55883321A>C	ENSP00000400646:p.Ile462Met	Somatic		Unspecified	Illumina	Phase_I	55736825	NM_033109	Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Missense_Mutation	SNP	ENST00000447944.2	37	CCDS1856.1	.	.	.	.	.	.	.	.	.	.	A	8.775	0.926829	0.18056	.	.	ENSG00000138035	ENST00000447944	T	0.67171	-0.25	4.82	3.66	0.41972	Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.69342	0.3100	L	0.49571	1.57	0.44660	D	0.997649	P	0.45827	0.867	P	0.60609	0.877	T	0.65142	-0.6240	10	0.30854	T	0.27	-10.9452	4.5499	0.12107	0.7015:0.0:0.1563:0.1422	.	462	Q8TCS8	PNPT1_HUMAN	M	462	ENSP00000400646:I462M	ENSP00000386075:I462M	I	-	3	3	PNPT1	55736825	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.136000	0.31467	0.802000	0.34089	0.460000	0.39030	ATT		PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251481.2	NM_033109	
EHBP1	23301	broad.mit.edu	37	2	63223863	63223863	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr2:63223863C>T	ENST00000263991.5	+	21	3760	c.3278C>T	c.(3277-3279)gCg>gTg	p.A1093V	EHBP1_ENST00000405289.1_Missense_Mutation_p.A1058V|EHBP1_ENST00000431489.1_Missense_Mutation_p.A1022V|EHBP1_ENST00000496857.1_3'UTR|EHBP1_ENST00000405015.3_Missense_Mutation_p.A1022V|EHBP1_ENST00000354487.3_Missense_Mutation_p.A1058V	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	1093						cytoplasm (GO:0005737)|membrane (GO:0016020)		p.A1093V(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			ACCCGTGCCGCGCTGGTGGAG	0.458																																					p.A1058V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3173T	2						.						98.0	92.0	94.0					2																	63223863		2203	4300	6503	63077367	SO:0001583	missense	23301	exon19			AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.3278C>T	2.37:g.63223863C>T	ENSP00000263991:p.Ala1093Val	Somatic		Unspecified	Illumina	Phase_I	63077367	NM_001142614	O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	ENST00000263991.5	37	CCDS1872.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676569	0.88445	.	.	ENSG00000115504	ENST00000405015;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289;ENST00000545092	T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4	5.41	5.41	0.78517	Domain of unknown function DUF3585 (1);	0.000000	0.85682	D	0.000000	T	0.45657	0.1353	N	0.21373	0.66	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	P;D;D	0.87578	0.854;0.946;0.998	T	0.19910	-1.0291	10	0.12103	T	0.63	.	19.2084	0.93744	0.0:1.0:0.0:0.0	.	1058;1022;1093	Q8NDI1-2;Q8NDI1-3;Q8NDI1	.;.;EHBP1_HUMAN	V	1022;1022;1093;1058;1058;64	ENSP00000384143:A1022V;ENSP00000403783:A1022V;ENSP00000263991:A1093V;ENSP00000346482:A1058V;ENSP00000385524:A1058V	ENSP00000263991:A1093V	A	+	2	0	EHBP1	63077367	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.818000	0.86416	2.556000	0.86216	0.650000	0.86243	GCG		EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251616.1	NM_015252	
WDR92	116143	broad.mit.edu	37	2	68365960	68365960	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr2:68365960C>A	ENST00000295121.6	-	5	663	c.547G>T	c.(547-549)Gtt>Ttt	p.V183F	RP11-474G23.1_ENST00000406334.3_3'UTR|WDR92_ENST00000406245.2_Missense_Mutation_p.V82F|WDR92_ENST00000492039.2_5'UTR|WDR92_ENST00000409164.1_Missense_Mutation_p.V183F	NM_138458.3	NP_612467.1	Q96MX6	WDR92_HUMAN	WD repeat domain 92	183					apoptotic process (GO:0006915)|histone lysine methylation (GO:0034968)		methylated histone binding (GO:0035064)	p.V183F(1)		endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|stomach(1)	12						CCAGCACAAACAACACGTTCT	0.353																																					p.V183F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G547T	2						.						238.0	230.0	233.0					2																	68365960		2203	4300	6503	68219464	SO:0001583	missense	116143	exon5			AK056303	CCDS1884.1, CCDS58712.1	2p14	2013-01-09			ENSG00000243667	ENSG00000243667		"""WD repeat domain containing"""	25176	protein-coding gene	gene with protein product		610729				16487927	Standard	NM_138458		Approved	FLJ31741, Monad	uc002see.2	Q96MX6	OTTHUMG00000152561	ENST00000295121.6:c.547G>T	2.37:g.68365960C>A	ENSP00000295121:p.Val183Phe	Somatic		Unspecified	Illumina	Phase_I	68219464	NM_138458	Q96CR6	Missense_Mutation	SNP	ENST00000295121.6	37	CCDS1884.1	.	.	.	.	.	.	.	.	.	.	C	31	5.082073	0.94050	.	.	ENSG00000243667	ENST00000295121;ENST00000406245;ENST00000409164	T;T;T	0.65916	1.62;1.62;-0.18	5.82	5.82	0.92795	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.52532	D	0.000074	T	0.81828	0.4905	M	0.85099	2.735	0.80722	D	1	D	0.76494	0.999	D	0.66602	0.945	D	0.83835	0.0254	10	0.87932	D	0	.	20.0991	0.97865	0.0:1.0:0.0:0.0	.	183	Q96MX6	WDR92_HUMAN	F	183;82;183	ENSP00000295121:V183F;ENSP00000384518:V82F;ENSP00000386746:V183F	ENSP00000295121:V183F	V	-	1	0	WDR92	68219464	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.605000	0.82844	2.752000	0.94435	0.655000	0.94253	GTT		WDR92-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251754.2	NM_138458	
BMP10	27302	broad.mit.edu	37	2	69093668	69093668	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr2:69093668G>A	ENST00000295379.1	-	2	528	c.370C>T	c.(370-372)Cga>Tga	p.R124*		NM_014482.1	NP_055297.1	O95393	BMP10_HUMAN	bone morphogenetic protein 10	124					activin receptor signaling pathway (GO:0032924)|adult heart development (GO:0007512)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heart trabecula formation (GO:0060347)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction (GO:0055117)|sarcomere organization (GO:0045214)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Z disc (GO:0030018)	hormone activity (GO:0005179)|receptor serine/threonine kinase binding (GO:0033612)	p.R124*(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(15)|ovary(2)	27						GGGTATTTTCGGAGCCCATTA	0.433																																					p.R124X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C370T	2						.						34.0	36.0	36.0					2																	69093668		2203	4300	6503	68947172	SO:0001587	stop_gained	27302	exon2			AF101441	CCDS1890.1	2p13.2	2014-09-17			ENSG00000163217	ENSG00000163217		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	20869	protein-coding gene	gene with protein product		608748				10072785	Standard	NM_014482		Approved		uc002sez.1	O95393	OTTHUMG00000129573	ENST00000295379.1:c.370C>T	2.37:g.69093668G>A	ENSP00000295379:p.Arg124*	Somatic		Unspecified	Illumina	Phase_I	68947172	NM_014482	Q53R17|Q6NTE0	Nonsense_Mutation	SNP	ENST00000295379.1	37	CCDS1890.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.003712	0.93287	.	.	ENSG00000163217	ENST00000295379	.	.	.	5.94	5.05	0.67936	.	0.050449	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3402	0.60540	0.0:0.0:0.7129:0.2871	.	.	.	.	X	124	.	ENSP00000295379:R124X	R	-	1	2	BMP10	68947172	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	1.579000	0.36536	1.484000	0.48361	0.557000	0.71058	CGA		BMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251768.1	NM_014482	
TRAF3IP1	26146	broad.mit.edu	37	2	239237875	239237875	+	Silent	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr2:239237875C>T	ENST00000373327.4	+	5	1029	c.807C>T	c.(805-807)cgC>cgT	p.R269R	TRAF3IP1_ENST00000391994.2_Silent_p.R269R|TRAF3IP1_ENST00000391993.3_Silent_p.R269R	NM_015650.3	NP_056465.2	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting protein 1	269	Abolishes microtubules-binding when missing.|Arg-rich.|DISC1-interaction domain.				cilium assembly (GO:0042384)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic heart tube development (GO:0035050)|intraciliary transport (GO:0042073)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube patterning (GO:0021532)|post-anal tail morphogenesis (GO:0036342)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)		p.R269R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(2)	23		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		accgagagcgcgaccgggaca	0.582																																					p.R269R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C807T	2						.						89.0	100.0	96.0					2																	239237875		2202	4300	6502	238902614	SO:0001819	synonymous_variant	26146	exon5			AF230877	CCDS33415.1, CCDS46557.1	2q37.3	2014-02-21			ENSG00000204104	ENSG00000204104		"""Intraflagellar transport homologs"""	17861	protein-coding gene	gene with protein product	"""microtubule interacting protein that associates with TRAF3"""	607380				10791955, 12935900	Standard	NM_015650		Approved	MIP-T3, DKFZP434F124, MIPT3, IFT54	uc002vye.3	Q8TDR0	OTTHUMG00000152872	ENST00000373327.4:c.807C>T	2.37:g.239237875C>T		Somatic		Unspecified	Illumina	Phase_I	238902614	NM_001139490	Q6PCT1|Q7L8N9|Q9NRD6|Q9Y4Q1	Silent	SNP	ENST00000373327.4	37	CCDS33415.1																																																																																				TRAF3IP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328312.1	NM_015650	
IARS	3376	broad.mit.edu	37	9	94985637	94985637	+	Missense_Mutation	SNP	T	T	G	rs556155	byFrequency	TCGA-AG-4008-01	TCGA-AG-4008-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr9:94985637T>G	ENST00000375643.3	-	32	3810	c.3544A>C	c.(3544-3546)Aag>Cag	p.K1182Q	IARS_ENST00000375629.3_3'UTR|IARS_ENST00000447699.2_Missense_Mutation_p.K1072Q|IARS_ENST00000443024.2_Missense_Mutation_p.K1182Q	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	1182			K -> E (in dbSNP:rs556155). {ECO:0000269|PubMed:17974005}.		gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)	p.K1182Q(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	CCTTGTGGCTTTGCATTCAGG	0.453																																					p.K1182Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3544C	9						.						112.0	104.0	107.0					9																	94985637		2203	4300	6503	94025458	SO:0001583	missense	3376	exon32			AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.3544A>C	9.37:g.94985637T>G	ENSP00000364794:p.Lys1182Gln	Somatic		Unspecified	Illumina	Phase_I	94025458	NM_013417	A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Missense_Mutation	SNP	ENST00000375643.3	37	CCDS6694.1	.	.	.	.	.	.	.	.	.	.	C	9.776	1.173983	0.21704	.	.	ENSG00000196305	ENST00000375643;ENST00000443024;ENST00000543028;ENST00000447699;ENST00000375660;ENST00000421189	T;T;T	0.44881	0.91;0.91;0.91	5.86	2.58	0.30949	.	0.608943	0.19546	N	0.111689	T	0.21841	0.0526	N	0.14661	0.345	0.53688	P	2.2999999999995246E-5	B;B;B	0.12630	0.006;0.0;0.0	B;B;B	0.12156	0.007;0.001;0.001	T	0.18745	-1.0327	9	0.22109	T	0.4	-1.4842	6.5975	0.22683	0.0:0.5393:0.0:0.4607	.	692;1182;975	F5H1M4;P41252;Q6P0M4	.;SYIC_HUMAN;.	Q	1182;1182;191;1072;1182;191	ENSP00000364794:K1182Q;ENSP00000406448:K1182Q;ENSP00000415020:K1072Q	ENSP00000364794:K1182Q	K	-	1	0	IARS	94025458	0.997000	0.39634	0.173000	0.22940	0.714000	0.41099	0.383000	0.20651	0.499000	0.27970	-0.128000	0.14901	AAG		IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053059.2	NM_002161	
JAKMIP3	282973	broad.mit.edu	37	10	133950773	133950773	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4008-01	TCGA-AG-4008-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr10:133950773G>A	ENST00000298622.4	+	7	1402	c.1264G>A	c.(1264-1266)Ggc>Agc	p.G422S		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	422						Golgi apparatus (GO:0005794)		p.G422S(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TGAGACCGCCGGCTACGTGAA	0.627																																					p.G422S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1264A	10						.						90.0	92.0	91.0					10																	133950773		2044	4184	6228	133800763	SO:0001583	missense	282973	exon7			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.1264G>A	10.37:g.133950773G>A	ENSP00000298622:p.Gly422Ser	Somatic		Unspecified	Illumina	Phase_I	133800763	NM_001105521	A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	ENST00000298622.4	37	CCDS44494.1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.643920	0.29246	.	.	ENSG00000188385	ENST00000298622	T	0.21734	1.99	5.08	5.08	0.68730	.	0.089418	0.42053	D	0.000770	T	0.24812	0.0602	L	0.44542	1.39	0.58432	D	0.999991	D	0.59767	0.986	P	0.47626	0.552	T	0.01566	-1.1323	10	0.23302	T	0.38	-25.0169	16.6701	0.85263	0.0:0.0:1.0:0.0	.	422	Q5VZ66	JKIP3_HUMAN	S	422	ENSP00000298622:G422S	ENSP00000298622:G422S	G	+	1	0	JAKMIP3	133800763	1.000000	0.71417	0.976000	0.42696	0.042000	0.13812	8.489000	0.90461	2.368000	0.80403	0.651000	0.88453	GGC		JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3	NM_194303	
PAM	5066	broad.mit.edu	37	5	102326074	102326074	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-4008-01	TCGA-AG-4008-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr5:102326074T>A	ENST00000438793.3	+	15	2052	c.1582T>A	c.(1582-1584)Ttc>Atc	p.F528I	PAM_ENST00000455264.2_Missense_Mutation_p.F528I|PAM_ENST00000304400.7_Missense_Mutation_p.F528I|PAM_ENST00000379787.4_5'UTR|PAM_ENST00000274392.9_Missense_Mutation_p.F431I|PAM_ENST00000346918.2_Missense_Mutation_p.F528I|PAM_ENST00000348126.2_Missense_Mutation_p.F421I	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	528	Peptidyl-alpha-hydroxyglycine alpha- amidating lyase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)	p.F528I(2)		endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	CCTGGTGATTTTCCACAGAGG	0.388																																					p.F528I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1582A	5						.						57.0	56.0	56.0					5																	102326074		2203	4300	6503	102353973	SO:0001583	missense	5066	exon15			AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.1582T>A	5.37:g.102326074T>A	ENSP00000396493:p.Phe528Ile	Somatic		Unspecified	Illumina	Phase_I	102353973	NM_138822	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	ENST00000438793.3	37	CCDS54885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	32|32	5.155652|5.155652	0.94686|0.94686	.|.	.|.	ENSG00000145730|ENSG00000145730	ENST00000438793;ENST00000346918;ENST00000348126;ENST00000304400;ENST00000274392;ENST00000455264|ENST00000379799	D;D;D;D;D;D|.	0.89939|.	-2.59;-2.59;-2.59;-2.59;-2.59;-2.59|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.78735|0.78735	0.4330|0.4330	M|M	0.85197|0.85197	2.74|2.74	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	0.999;0.999;0.998;0.996;1.0;0.999;0.995|.	D;D;D;D;D;D;D|.	0.75484|.	0.976;0.984;0.948;0.948;0.986;0.976;0.96|.	T|T	0.81339|0.81339	-0.0977|-0.0977	10|6	0.87932|.	D|.	0|.	-14.5741|-14.5741	15.1757|15.1757	0.72910|0.72910	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	431;101;528;528;528;528;421|.	F8WE90;Q13749;P19021;P19021-4;P19021-3;P19021-5;P19021-2|.	.;.;AMD_HUMAN;.;.;.;.|.	I|Y	528;528;421;528;431;528|300	ENSP00000396493:F528I;ENSP00000282992:F528I;ENSP00000314638:F421I;ENSP00000306100:F528I;ENSP00000274392:F431I;ENSP00000403461:F528I|.	ENSP00000274392:F431I|.	F|F	+|+	1|2	0|0	PAM|PAM	102353973|102353973	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.669000|6.669000	0.74462|0.74462	2.075000|2.075000	0.62263|0.62263	0.454000|0.454000	0.30748|0.30748	TTC|TTT		PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
REEP2	51308	broad.mit.edu	37	5	137780216	137780216	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4008-01	TCGA-AG-4008-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr5:137780216A>G	ENST00000254901.5	+	4	417	c.295A>G	c.(295-297)Aag>Gag	p.K99E	REEP2_ENST00000506158.1_Missense_Mutation_p.K61E|REEP2_ENST00000378339.2_Missense_Mutation_p.K99E	NM_016606.2	NP_057690.2	Q9BRK0	REEP2_HUMAN	receptor accessory protein 2	99					cell death (GO:0008219)|endoplasmic reticulum tubular network organization (GO:0071786)|protein transport into membrane raft (GO:0032596)|regulation of intracellular transport (GO:0032386)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)		p.K99E(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GCTGTCCAACAAGGAGAAGGT	0.602																																					p.K99E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A295G	5						.						139.0	111.0	120.0					5																	137780216		2203	4300	6503	137808115	SO:0001583	missense	51308	exon4			AK056193	CCDS4205.1, CCDS64259.1	5q31	2014-03-12	2006-02-07	2006-02-07	ENSG00000132563	ENSG00000132563		"""Receptor accessory proteins"""	17975	protein-coding gene	gene with protein product		609347	"""chromosome 5 open reading frame 19"""	C5orf19		16271481, 15550249, 24388663	Standard	NM_016606		Approved	SGC32445, SPG72	uc003lda.4	Q9BRK0	OTTHUMG00000129205	ENST00000254901.5:c.295A>G	5.37:g.137780216A>G	ENSP00000254901:p.Lys99Glu	Somatic		Unspecified	Illumina	Phase_I	137808115	NM_016606	Q53EM8|Q9NYF2	Missense_Mutation	SNP	ENST00000254901.5	37	CCDS4205.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.988253	0.93106	.	.	ENSG00000132563	ENST00000378339;ENST00000254901;ENST00000506158	D;D;D	0.88124	-2.34;-2.34;-1.52	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.89248	0.6661	M	0.73598	2.24	0.58432	D	0.999999	P;P	0.38420	0.63;0.63	P;P	0.44732	0.459;0.459	D	0.90395	0.4398	10	0.72032	D	0.01	-5.2119	14.0341	0.64634	1.0:0.0:0.0:0.0	.	99;99	A8K3D2;Q9BRK0	.;REEP2_HUMAN	E	99;99;61	ENSP00000367590:K99E;ENSP00000254901:K99E;ENSP00000422530:K61E	ENSP00000254901:K99E	K	+	1	0	REEP2	137808115	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.999000	0.76283	2.159000	0.67721	0.533000	0.62120	AAG		REEP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251284.1	NM_016606	
HSPA9	3313	broad.mit.edu	37	5	137906735	137906735	+	Silent	SNP	C	C	T			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr5:137906735C>T	ENST00000297185.3	-	4	449	c.324G>A	c.(322-324)caG>caA	p.Q108Q		NM_004134.6	NP_004125.3	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 (mortalin)	108					cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.Q108Q(1)		breast(2)|endometrium(1)|kidney(4)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TGGTGACAGCCTGTCGCTTGG	0.498																																					p.Q108Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G324A	5						.						109.0	99.0	102.0					5																	137906735		2203	4300	6503	137934634	SO:0001819	synonymous_variant	3313	exon4			L11066	CCDS4208.1	5q31.1	2011-09-02	2006-10-31	2006-10-31	ENSG00000113013	ENSG00000113013		"""Heat shock proteins / HSP70"""	5244	protein-coding gene	gene with protein product		600548	"""heat shock 70kDa protein 9B (mortalin-2)"""	HSPA9B		7684501	Standard	NM_004134		Approved	GRP75, PBP74, mot-2, mthsp75	uc003ldf.3	P38646	OTTHUMG00000129206	ENST00000297185.3:c.324G>A	5.37:g.137906735C>T		Somatic		Unspecified	Illumina	Phase_I	137934634	NM_004134	B2RCM1|P30036|P31932|Q1HB43|Q53H23|Q6GU03|Q9BWB7|Q9UC56	Silent	SNP	ENST00000297185.3	37	CCDS4208.1	.	.	.	.	.	.	.	.	.	.	C	8.846	0.943363	0.18281	.	.	ENSG00000113013	ENST00000541333	.	.	.	5.34	2.52	0.30459	.	.	.	.	.	T	0.53690	0.1812	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41431	-0.9509	5	0.22706	T	0.39	-10.1034	10.3089	0.43697	0.0:0.7674:0.0:0.2326	.	.	.	.	K	78	.	ENSP00000438817:R78K	R	-	2	0	HSPA9	137934634	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	0.649000	0.24843	0.726000	0.32339	0.655000	0.94253	AGG		HSPA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251285.1	NM_004134	
RASGRF2	5924	broad.mit.edu	37	5	80366384	80366384	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4008-01	TCGA-AG-4008-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr5:80366384T>C	ENST00000265080.4	+	4	684	c.617T>C	c.(616-618)aTc>aCc	p.I206T	RASGRF2_ENST00000502677.1_3'UTR	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	206	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I206T(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		GATCCAGACATCAAGAAGATT	0.448																																					p.I206T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T617C	5						.						130.0	133.0	132.0					5																	80366384		2203	4300	6503	80402140	SO:0001583	missense	5924	exon4			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.617T>C	5.37:g.80366384T>C	ENSP00000265080:p.Ile206Thr	Somatic		Unspecified	Illumina	Phase_I	80402140	NM_006909	B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	CCDS4052.1	.	.	.	.	.	.	.	.	.	.	T	18.39	3.612796	0.66672	.	.	ENSG00000113319	ENST00000265080	T	0.76968	-1.06	5.69	5.69	0.88448	.	.	.	.	.	T	0.78362	0.4271	L	0.46157	1.445	0.80722	D	1	P;P	0.48998	0.918;0.722	P;B	0.47827	0.558;0.164	T	0.81217	-0.1033	9	0.87932	D	0	.	16.2484	0.82467	0.0:0.0:0.0:1.0	.	206;206	D6RAS9;O14827	.;RGRF2_HUMAN	T	206	ENSP00000265080:I206T	ENSP00000265080:I206T	I	+	2	0	RASGRF2	80402140	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.997000	0.88414	2.291000	0.77112	0.533000	0.62120	ATC		RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909	
SLC4A9	83697	broad.mit.edu	37	5	139742515	139742515	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4008-01	TCGA-AG-4008-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-4008-01	TCGA-AG-4008-01	g.chr5:139742515C>A	ENST00000230993.6	+	7	933	c.898C>A	c.(898-900)Cgt>Agt	p.R300S	SLC4A9_ENST00000507527.1_Missense_Mutation_p.R300S|SLC4A9_ENST00000432095.2_Missense_Mutation_p.R276S|SLC4A9_ENST00000506757.2_Missense_Mutation_p.R276S|SLC4A9_ENST00000506545.1_Missense_Mutation_p.R276S	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	300					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)	p.R300C(2)|p.R274C(1)|p.R274S(1)|p.R300S(1)		endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGTCAGTTCGTCGGGCCAG	0.542											OREG0016461	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R276S												.	.	5	Substitution - Missense(5)	lung(3)|large_intestine(2)	c.C826A	5						.						171.0	172.0	171.0					5																	139742515		2042	4182	6224	139722699	SO:0001583	missense	83697	exon7			AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	ENST00000230993.6:c.898C>A	5.37:g.139742515C>A	ENSP00000230993:p.Arg300Ser	Somatic	1651	Unspecified	Illumina	Phase_I	139722699	NM_031467	B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Missense_Mutation	SNP	ENST00000230993.6	37	CCDS58973.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.728337	0.69074	.	.	ENSG00000113073	ENST00000230993;ENST00000506757;ENST00000432095;ENST00000506545;ENST00000507527	T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22	5.13	4.18	0.49190	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.165488	0.43579	D	0.000556	T	0.69851	0.3157	L	0.52364	1.645	0.39306	D	0.964995	D;D;P;P	0.63046	0.992;0.974;0.891;0.891	P;P;P;P	0.60236	0.855;0.871;0.616;0.616	T	0.72915	-0.4147	10	0.87932	D	0	.	6.1893	0.20516	0.1673:0.6794:0.0:0.1533	.	276;300;276;276	E9PDK1;Q96Q91;Q96Q91-2;Q96Q91-3	.;B3A4_HUMAN;.;.	S	300;276;276;276;300	ENSP00000230993:R300S;ENSP00000424424:R276S;ENSP00000410056:R276S;ENSP00000422855:R276S;ENSP00000427661:R300S	ENSP00000230993:R300S	R	+	1	0	SLC4A9	139722699	0.705000	0.27846	1.000000	0.80357	0.836000	0.47400	1.319000	0.33655	2.667000	0.90743	0.462000	0.41574	CGT		SLC4A9-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372823.1	NM_031467	
