#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AKAP9	10142	hgsc.bcm.edu	37	7	91631629	91631629	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr7:91631629G>A	ENST00000359028.2	+	9	2659	c.2434G>A	c.(2434-2436)Gaa>Aaa	p.E812K	AKAP9_ENST00000356239.3_Missense_Mutation_p.E800K|AKAP9_ENST00000358100.2_Missense_Mutation_p.E812K			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	812	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.E800K(1)|p.E812K(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TGTTAGCCAAGAAGAAAGATT	0.333			T	BRAF	papillary thyroid																																p.E800K			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2398A	7						.						69.0	77.0	74.0					7																	91631629		2203	4296	6499	91469565	SO:0001583	missense	10142	exon8			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.2434G>A	7.37:g.91631629G>A	ENSP00000351922:p.Glu812Lys	Somatic		Capture	SOLID	Phase_I	91469565	NM_147185	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37		.	.	.	.	.	.	.	.	.	.	G	15.13	2.741964	0.49151	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	T;T;T	0.04706	3.59;3.59;3.57	5.55	5.55	0.83447	.	0.165679	0.28778	N	0.014176	T	0.18718	0.0449	M	0.65975	2.015	0.42420	D	0.992637	D;D;D;P	0.63880	0.988;0.993;0.993;0.909	P;P;P;P	0.60541	0.755;0.876;0.876;0.61	T	0.00020	-1.2354	10	0.87932	D	0	.	18.0566	0.89365	0.0:0.0:1.0:0.0	.	812;800;800;812	Q99996;Q99996-2;Q99996-3;A4D1E4	AKAP9_HUMAN;.;.;.	K	800;812;812;812;812	ENSP00000348573:E800K;ENSP00000351922:E812K;ENSP00000350813:E812K	ENSP00000348573:E800K	E	+	1	0	AKAP9	91469565	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	3.835000	0.55805	2.768000	0.95171	0.655000	0.94253	GAA		AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751	
CNTNAP2	26047	hgsc.bcm.edu	37	7	147926773	147926773	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr7:147926773C>T	ENST00000361727.3	+	20	3799	c.3283C>T	c.(3283-3285)Cga>Tga	p.R1095*	CNTNAP2_ENST00000538075.1_Nonsense_Mutation_p.R154*	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	1095	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.R1095*(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GGGTGGCACCCGAGAGCCATA	0.448										HNSCC(39;0.1)																											p.R1095X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3283T	7						.						108.0	101.0	104.0					7																	147926773		2203	4300	6503	147557706	SO:0001587	stop_gained	26047	exon20			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.3283C>T	7.37:g.147926773C>T	ENSP00000354778:p.Arg1095*	Somatic		Capture	SOLID	Phase_I	147557706	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Nonsense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	C	39	7.690872	0.98434	.	.	ENSG00000174469	ENST00000361727;ENST00000538075	.	.	.	5.66	-1.49	0.08718	.	0.271225	0.34133	N	0.004228	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	16.5713	0.84613	0.3188:0.6811:0.0:0.0	.	.	.	.	X	1095;154	.	ENSP00000354778:R1095X	R	+	1	2	CNTNAP2	147557706	0.034000	0.19679	0.539000	0.28077	0.610000	0.37248	1.513000	0.35823	-0.503000	0.06586	0.455000	0.32223	CGA		CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
ADAM20	8748	hgsc.bcm.edu	37	14	70990285	70990285	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr14:70990285G>A	ENST00000256389.3	-	2	1584	c.1340C>T	c.(1339-1341)cCg>cTg	p.P447L	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	397	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P447L(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		ATATGGAGGCGGTTGAATACA	0.423																																					p.P447L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1340T	14						.						178.0	118.0	138.0					14																	70990285		2203	4300	6503	70060038	SO:0001583	missense	8748	exon2			AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.1340C>T	14.37:g.70990285G>A	ENSP00000256389:p.Pro447Leu	Somatic		Capture	SOLID	Phase_I	70060038	NM_003814	Q6GTZ1|Q9UKJ9	Missense_Mutation	SNP	ENST00000256389.3	37	CCDS32111.1	.	.	.	.	.	.	.	.	.	.	G	5.612	0.297729	0.10622	.	.	ENSG00000134007	ENST00000256389	T	0.00882	5.58	4.54	-1.19	0.09585	.	2.601280	0.02003	N	0.046465	T	0.00815	0.0027	N	0.14661	0.345	0.09310	N	1	B	0.14805	0.011	B	0.08055	0.003	T	0.47275	-0.9130	10	0.33940	T	0.23	.	5.7307	0.18038	0.2159:0.0:0.2594:0.5247	.	397	O43506	ADA20_HUMAN	L	447	ENSP00000256389:P447L	ENSP00000256389:P447L	P	-	2	0	ADAM20	70060038	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.364000	0.07583	-0.184000	0.10567	-1.185000	0.01705	CCG		ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395004.2		
SYN3	8224	hgsc.bcm.edu	37	22	32909719	32909719	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr22:32909719C>T	ENST00000358763.2	-	14	1945	c.1703G>A	c.(1702-1704)cGc>cAc	p.R568H	SYN3_ENST00000332840.5_Missense_Mutation_p.R568H|SYN3_ENST00000467095.1_5'UTR	NM_001135774.1	NP_001129246.1	O14994	SYN3_HUMAN	synapsin III	568	E.				neurotransmitter secretion (GO:0007269)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)	p.R568H(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						CCTCAGGTTGCGGATGGTTTC	0.572																																					p.R567H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1700A	22						.						160.0	115.0	130.0					22																	32909719		2203	4300	6503	31239719	SO:0001583	missense	8224	exon14			AF046873	CCDS13908.1	22q12.3	2008-05-14			ENSG00000185666	ENSG00000185666			11496	protein-coding gene	gene with protein product		602705				9539796	Standard	NM_003490		Approved		uc003amx.3	O14994	OTTHUMG00000031004	ENST00000358763.2:c.1703G>A	22.37:g.32909719C>T	ENSP00000351614:p.Arg568His	Somatic		Capture	SOLID	Phase_I	31239719	NM_001135774	B1B1F9	Missense_Mutation	SNP	ENST00000358763.2	37	CCDS13908.1	.	.	.	.	.	.	.	.	.	.	C	35	5.518069	0.96416	.	.	ENSG00000185666	ENST00000358763;ENST00000332840;ENST00000445154	T;T	0.53640	0.61;0.61	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.69797	0.3151	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	T	0.72141	-0.4380	10	0.87932	D	0	-4.6075	19.5608	0.95371	0.0:1.0:0.0:0.0	.	567;568	Q17R54;O14994	.;SYN3_HUMAN	H	568;568;174	ENSP00000351614:R568H;ENSP00000330219:R568H	ENSP00000330219:R568H	R	-	2	0	SYN3	31239719	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.469000	0.80959	2.698000	0.92095	0.561000	0.74099	CGC		SYN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075892.4		
NFAM1	150372	hgsc.bcm.edu	37	22	42828276	42828276	+	Missense_Mutation	SNP	C	C	T	rs138744630	byFrequency	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr22:42828276C>T	ENST00000329021.5	-	1	125	c.88G>A	c.(88-90)Gtg>Atg	p.V30M		NM_145912.5	NP_666017.1	Q8NET5	NFAM1_HUMAN	NFAT activating protein with ITAM motif 1	30					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cytokine production (GO:0001819)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of B cell differentiation (GO:0045577)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)	p.V30M(1)		large_intestine(1)|lung(3)	4						AGCAGCAGCACGCCAAGGAGG	0.672													G|||	2	0.000399361	0.0015	0.0	5008	,	,		13444	0.0		0.0	False		,,,				2504	0.0				p.V30M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G88A	22						.	G	MET/VAL	3,4375		0,3,2186	16.0	19.0	18.0		88	-3.1	0.0	22	dbSNP_134	18	0,8562		0,0,4281	yes	missense	NFAM1	NM_145912.5	21	0,3,6467	TT,TC,CC		0.0,0.0685,0.0232	benign	30/271	42828276	3,12937	2189	4281	6470	41158220	SO:0001583	missense	150372	exon1			BC038241	CCDS14034.1	22q13.2	2005-02-01			ENSG00000235568	ENSG00000235568			29872	protein-coding gene	gene with protein product		608740				12615919	Standard	NM_145912		Approved	CNAIP	uc003bcn.4	Q8NET5	OTTHUMG00000150923	ENST00000329021.5:c.88G>A	22.37:g.42828276C>T	ENSP00000333680:p.Val30Met	Somatic		Capture	SOLID	Phase_I	41158220	NM_145912	B0QYD0|Q20WL2|Q5JZ96|Q8IUY8|Q8TEM8	Missense_Mutation	SNP	ENST00000329021.5	37	CCDS14034.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.720128	0.48728	6.85E-4	0.0	ENSG00000235568	ENST00000329021	T	0.33438	1.41	3.18	-3.09	0.05331	.	0.000000	0.30437	U	0.009627	T	0.10165	0.0249	N	0.08118	0	0.09310	N	1	B	0.32128	0.357	B	0.18871	0.023	T	0.09271	-1.0682	10	0.48119	T	0.1	-0.1179	6.0185	0.19616	0.242:0.3179:0.4401:0.0	.	30	Q8NET5	NFAM1_HUMAN	M	30	ENSP00000333680:V30M	ENSP00000333680:V30M	V	-	1	0	NFAM1	41158220	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.906000	0.04071	-1.310000	0.02312	-1.168000	0.01747	GTG		NFAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320541.1	NM_145912	
B3GNT3	10331	hgsc.bcm.edu	37	19	17922476	17922476	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr19:17922476T>G	ENST00000318683.6	+	3	811	c.664T>G	c.(664-666)Ttc>Gtc	p.F222V	B3GNT3_ENST00000595387.1_Missense_Mutation_p.F222V	NM_014256.3	NP_055071.2	Q9Y2A9	B3GN3_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3	222					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)|galactosyltransferase activity (GO:0008378)	p.F222V(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	21						CAACATGGTCTTCTACCTGCA	0.572																																					p.F222V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T664G	19						.						103.0	80.0	88.0					19																	17922476		2203	4300	6503	17783476	SO:0001583	missense	10331	exon3			AB015630	CCDS12364.1	19p13.1	2013-02-19				ENSG00000179913		"""Beta 3-glycosyltransferases"""	13528	protein-coding gene	gene with protein product	"""putative type II membrane protein"", ""beta-1,3-N-acetylglucosaminyltransferase bGnT-3"", ""transmembrane protein 3"""	605863		TMEM3		10072769, 11042166	Standard	NM_014256		Approved	B3GN-T3, beta3Gn-T3, HP10328, B3GNT-3	uc002nhl.1	Q9Y2A9		ENST00000318683.6:c.664T>G	19.37:g.17922476T>G	ENSP00000321874:p.Phe222Val	Somatic		Capture	SOLID	Phase_I	17783476	NM_014256	B2RAS4|Q6NWU9|Q6NXU9|Q8WWR6|Q9C0J2	Missense_Mutation	SNP	ENST00000318683.6	37	CCDS12364.1	.	.	.	.	.	.	.	.	.	.	T	11.20	1.569251	0.28003	.	.	ENSG00000179913	ENST00000318683	T	0.41400	1.0	5.31	-5.34	0.02705	.	0.795762	0.10951	N	0.616056	T	0.12603	0.0306	N	0.01109	-1.01	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28332	-1.0047	10	0.32370	T	0.25	.	8.7885	0.34837	0.2946:0.0:0.5751:0.1303	.	222	Q9Y2A9	B3GN3_HUMAN	V	222	ENSP00000321874:F222V	ENSP00000321874:F222V	F	+	1	0	B3GNT3	17783476	0.000000	0.05858	0.159000	0.22649	0.788000	0.44548	-0.099000	0.11007	-1.554000	0.01700	0.454000	0.30748	TTC		B3GNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466877.1	NM_014256	
KIR3DL2	3812	hgsc.bcm.edu	37	19	55365348	55365348	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr19:55365348G>A	ENST00000326321.3	+	4	535	c.502G>A	c.(502-504)Gtt>Att	p.V168I	KIR3DL2_ENST00000270442.5_Missense_Mutation_p.V168I|KIR3DL1_ENST00000402254.2_Intron	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	168	Ig-like C2-type 2.				cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.V168I(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		CTCACGCCTCGTTGGACAGAT	0.512																																					p.V168I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G502A	19						.																																			60057160	SO:0001583	missense	3812	exon4			L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.502G>A	19.37:g.55365348G>A	ENSP00000325525:p.Val168Ile	Somatic		Capture	SOLID	Phase_I	60057160	NM_006737	Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Missense_Mutation	SNP	ENST00000326321.3	37	CCDS12906.1	.	.	.	.	.	.	.	.	.	.	g	1.603	-0.525953	0.04141	.	.	ENSG00000240403	ENST00000326321;ENST00000270442	T;T	0.03004	4.08;4.08	2.06	-4.0	0.04057	Immunoglobulin-like fold (1);	.	.	.	.	T	0.01353	0.0044	N	0.02275	-0.615	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.45381	-0.9265	9	0.41790	T	0.15	.	2.7398	0.05250	0.5071:0.0:0.27:0.2229	.	168;168	Q95366;P43630	.;KI3L2_HUMAN	I	168	ENSP00000325525:V168I;ENSP00000270442:V168I	ENSP00000270442:V168I	V	+	1	0	KIR3DL2	60057160	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.408000	0.01042	-0.716000	0.04962	-1.051000	0.02340	GTT		KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141241.1		
XKR6	286046	hgsc.bcm.edu	37	8	10782302	10782302	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr8:10782302C>T	ENST00000416569.2	-	2	829	c.803G>A	c.(802-804)cGg>cAg	p.R268Q	XKR6_ENST00000304437.2_5'UTR	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	268						integral component of membrane (GO:0016021)		p.R268Q(2)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		TTCCTTCCGCCGCTGGCTCTG	0.597																																					p.R268Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G803A	8						.						103.0	90.0	94.0					8																	10782302		2203	4300	6503	10819712	SO:0001583	missense	286046	exon2			BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.803G>A	8.37:g.10782302C>T	ENSP00000416707:p.Arg268Gln	Somatic		Capture	SOLID	Phase_I	10819712	NM_173683	Q8TBA0	Missense_Mutation	SNP	ENST00000416569.2	37	CCDS5978.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	21.1|21.1	4.098619|4.098619	0.76870|0.76870	.|.	.|.	ENSG00000171044|ENSG00000171044	ENST00000382461|ENST00000416569	.|T	.|0.63913	.|-0.07	4.71|4.71	4.71|4.71	0.59529|0.59529	.|.	.|0.000000	.|0.64402	.|U	.|0.000003	T|T	0.61652|0.61652	0.2364|0.2364	N|N	0.20445|0.20445	0.575|0.575	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.63381	.|0.914	T|T	0.55964|0.55964	-0.8057|-0.8057	5|10	.|0.10111	.|T	.|0.7	1.7456|1.7456	16.6436|16.6436	0.85155|0.85155	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|268	.|Q5GH73	.|XKR6_HUMAN	S|Q	45|268	.|ENSP00000416707:R268Q	.|ENSP00000416707:R268Q	G|R	-|-	1|2	0|0	XKR6|XKR6	10819712|10819712	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.639000|7.639000	0.83342|0.83342	2.156000|2.156000	0.67533|0.67533	0.457000|0.457000	0.33378|0.33378	GGC|CGG		XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383958.1	NM_173683	
SNX27	81609	hgsc.bcm.edu	37	1	151630869	151630869	+	Silent	SNP	C	C	T			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr1:151630869C>T	ENST00000458013.2	+	3	822	c.702C>T	c.(700-702)gcC>gcT	p.A234A	SNX27_ENST00000368843.3_Silent_p.A234A|SNX27_ENST00000368838.1_Silent_p.A141A			Q96L92	SNX27_HUMAN	sorting nexin family member 27	234	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)	p.A234A(1)		central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			AATTAGATGCCCGACGTCGGG	0.408																																					p.A234A	Colon(46;291 966 40145 41237 41888)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C702T	1						.						103.0	101.0	102.0					1																	151630869		2203	4300	6503	149897493	SO:0001819	synonymous_variant	81609	exon3			AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.702C>T	1.37:g.151630869C>T		Somatic		Capture	SOLID	Phase_I	149897493	NM_030918	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Silent	SNP	ENST00000458013.2	37																																																																																					SNX27-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000036624.3	NM_030918	
OR6K2	81448	hgsc.bcm.edu	37	1	158669588	158669588	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr1:158669588G>C	ENST00000359610.2	-	1	898	c.855C>G	c.(853-855)ttC>ttG	p.F285L		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	285						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F285L(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					TGGGGTTGAAGAAGGGAGACA	0.413																																					p.F285L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C855G	1						.						90.0	87.0	88.0					1																	158669588		2203	4300	6503	156936212	SO:0001583	missense	81448	exon1			BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.855C>G	1.37:g.158669588G>C	ENSP00000352626:p.Phe285Leu	Somatic		Capture	SOLID	Phase_I	156936212	NM_001005279	B9EH33|Q6IFR6	Missense_Mutation	SNP	ENST00000359610.2	37	CCDS30902.1	.	.	.	.	.	.	.	.	.	.	G	2.299	-0.360602	0.05103	.	.	ENSG00000196171	ENST00000359610	T	0.35789	1.29	4.94	0.457	0.16661	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43110	D	0.000613	T	0.03695	0.0105	N	0.04705	-0.18	0.20563	N	0.999883	B	0.20052	0.041	B	0.24006	0.05	T	0.41980	-0.9478	10	0.07990	T	0.79	-13.8805	4.6112	0.12404	0.4096:0.2585:0.332:0.0	.	285	Q8NGY2	OR6K2_HUMAN	L	285	ENSP00000352626:F285L	ENSP00000352626:F285L	F	-	3	2	OR6K2	156936212	0.000000	0.05858	0.999000	0.59377	0.978000	0.69477	-1.619000	0.02048	0.208000	0.20626	0.655000	0.94253	TTC		OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059061.1	NM_001005279	
ABL2	27	hgsc.bcm.edu	37	1	179077641	179077641	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr1:179077641G>A	ENST00000502732.1	-	12	2964	c.2761C>T	c.(2761-2763)Ccc>Tcc	p.P921S	ABL2_ENST00000504405.1_Missense_Mutation_p.P782S|ABL2_ENST00000344730.3_Missense_Mutation_p.P803S|ABL2_ENST00000507173.1_Missense_Mutation_p.P797S|ABL2_ENST00000511413.1_Missense_Mutation_p.P818S|ABL2_ENST00000408940.3_Missense_Mutation_p.P885S|ABL2_ENST00000367623.4_Missense_Mutation_p.P900S|ABL2_ENST00000512653.1_Missense_Mutation_p.P906S	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	921	F-actin-binding. {ECO:0000250}.|Pro-rich.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)	p.P885S(1)		breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	GGGAGGACGGGGGCAGCCTTG	0.582			T	ETV6	AML																																p.P782S			Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2344T	1						.						78.0	74.0	76.0					1																	179077641		2203	4300	6503	177344264	SO:0001583	missense	27	exon12			M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.2761C>T	1.37:g.179077641G>A	ENSP00000427562:p.Pro921Ser	Somatic		Capture	SOLID	Phase_I	177344264	NM_001168239	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	ENST00000502732.1	37	CCDS30947.1	.	.	.	.	.	.	.	.	.	.	G	0.026	-1.368995	0.01225	.	.	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000344730;ENST00000512653;ENST00000504405;ENST00000367623;ENST00000507173;ENST00000511413	T;T;T;T;T;T;T;T	0.72942	-0.69;-0.7;-0.67;-0.7;-0.67;-0.69;-0.66;-0.67	5.1	-1.88	0.07713	.	0.283763	0.24245	U	0.040240	T	0.36358	0.0964	N	0.04508	-0.205	0.09310	N	1	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.11108	-1.0601	10	0.25751	T	0.34	.	1.865	0.03196	0.1276:0.4096:0.2369:0.2258	.	900;797;818;782;921;906;885;803	P42684-6;P42684-7;P42684-5;P42684-4;P42684;P42684-3;D1MPS6;P42684-10	.;.;.;.;ABL2_HUMAN;.;.;.	S	921;885;803;906;782;900;797;818	ENSP00000427562:P921S;ENSP00000386152:P885S;ENSP00000339209:P803S;ENSP00000423578:P906S;ENSP00000426831:P782S;ENSP00000356595:P900S;ENSP00000423413:P797S;ENSP00000424697:P818S	ENSP00000339209:P803S	P	-	1	0	ABL2	177344264	0.004000	0.15560	0.000000	0.03702	0.122000	0.20287	0.163000	0.16520	-0.278000	0.09180	-0.165000	0.13383	CCC		ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085174.3	NM_005158	
KIAA1804	84451	hgsc.bcm.edu	37	1	233497916	233497916	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr1:233497916C>T	ENST00000366624.3	+	5	1690	c.1429C>T	c.(1429-1431)Cgg>Tgg	p.R477W	MLK4_ENST00000366623.3_Missense_Mutation_p.R477W	NM_032435.2	NP_115811.2												p.R477W(2)									CGTGCTGGAGCGGGAACTTAA	0.532																																					p.R477W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1429T	1						.						64.0	62.0	62.0					1																	233497916		2203	4300	6503	231564539	SO:0001583	missense	84451	exon5																														ENST00000366624.3:c.1429C>T	1.37:g.233497916C>T	ENSP00000355583:p.Arg477Trp	Somatic		Capture	SOLID	Phase_I	231564539	NM_032435		Missense_Mutation	SNP	ENST00000366624.3	37	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455729	0.84209	.	.	ENSG00000143674	ENST00000366623;ENST00000366624	T;T	0.12774	2.65;2.65	4.88	4.88	0.63580	.	0.000000	0.64402	D	0.000001	T	0.40145	0.1105	M	0.80183	2.485	0.80722	D	1	D;D	0.71674	0.998;0.971	D;P	0.66351	0.943;0.823	T	0.37502	-0.9703	10	0.66056	D	0.02	.	18.2298	0.89931	0.0:1.0:0.0:0.0	.	477;477	Q5TCX8;Q5TCX8-2	M3KL4_HUMAN;.	W	477	ENSP00000355582:R477W;ENSP00000355583:R477W	ENSP00000355582:R477W	R	+	1	2	RP5-862P8.2	231564539	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	3.760000	0.55235	2.525000	0.85131	0.655000	0.94253	CGG		MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
SRRM1	10250	hgsc.bcm.edu	37	1	24981534	24981534	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr1:24981534A>G	ENST00000323848.9	+	9	1544	c.1229A>G	c.(1228-1230)aAa>aGa	p.K410R	SRRM1_ENST00000447431.2_Missense_Mutation_p.K410R|SRRM1_ENST00000537199.1_Missense_Mutation_p.K292E|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000374389.4_Missense_Mutation_p.K405R	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	410	Arg-rich.|Necessary for speckles and matrix localization.|Pro-rich.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.K410R(1)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CCACCACCCAAAACTCGGCAT	0.512																																					p.K410R	Ovarian(68;897 1494 3282 17478)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1229G	1						.						108.0	102.0	104.0					1																	24981534		2203	4300	6503	24854121	SO:0001583	missense	10250	exon9			AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.1229A>G	1.37:g.24981534A>G	ENSP00000326261:p.Lys410Arg	Somatic		Capture	SOLID	Phase_I	24854121	NM_005839	O60585|Q5VVN4	Missense_Mutation	SNP	ENST00000323848.9	37	CCDS255.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.92|18.92	3.726304|3.726304	0.69074|0.69074	.|.	.|.	ENSG00000133226|ENSG00000133226	ENST00000537199|ENST00000323848;ENST00000447431;ENST00000374389	T|T;T;T	0.54071|0.50277	0.59|0.83;0.79;0.75	5.84|5.84	4.7|4.7	0.59300|0.59300	.|.	0.000000|0.000000	0.64402|0.64402	D|D	0.000005|0.000005	T|T	0.40886|0.40886	0.1135|0.1135	L|L	0.38175|0.38175	1.15|1.15	0.22571|0.22571	N|N	0.998972|0.998972	.|D;P	.|0.52996	.|0.957;0.928	.|P;B	.|0.45946	.|0.498;0.302	T|T	0.20273|0.20273	-1.0280|-1.0280	8|10	0.87932|0.23302	D|T	0|0.38	-4.0339|-4.0339	12.056|12.056	0.53536|0.53536	0.8706:0.0:0.0:0.1294|0.8706:0.0:0.0:0.1294	.|.	.|410;410	.|E9PCT1;Q8IYB3	.|.;SRRM1_HUMAN	E|R	292|410;410;405	ENSP00000441776:K292E|ENSP00000326261:K410R;ENSP00000391430:K410R;ENSP00000363510:K405R	ENSP00000441776:K292E|ENSP00000326261:K410R	K|K	+|+	1|2	0|0	SRRM1|SRRM1	24854121|24854121	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.213000|7.213000	0.77950|0.77950	1.008000|1.008000	0.39264|0.39264	0.528000|0.528000	0.53228|0.53228	AAA|AAA		SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
TARBP1	6894	hgsc.bcm.edu	37	1	234582611	234582611	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr1:234582611C>A	ENST00000040877.1	-	12	2071	c.2072G>T	c.(2071-2073)tGc>tTc	p.C691F		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	691					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)	p.C691F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			CAGCTGGAGGCATCTGTCAGT	0.443																																					p.C691F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2072T	1						.						169.0	146.0	153.0					1																	234582611		2203	4300	6503	232649234	SO:0001583	missense	6894	exon12				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.2072G>T	1.37:g.234582611C>A	ENSP00000040877:p.Cys691Phe	Somatic		Capture	SOLID	Phase_I	232649234	NM_005646	Q9H581	Missense_Mutation	SNP	ENST00000040877.1	37	CCDS1601.1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.500301	0.64298	.	.	ENSG00000059588	ENST00000040877	T	0.07567	3.18	5.2	5.2	0.72013	.	0.136561	0.64402	D	0.000006	T	0.11707	0.0285	L	0.60455	1.87	0.39453	D	0.967432	P	0.49961	0.93	B	0.41571	0.36	T	0.05852	-1.0860	10	0.35671	T	0.21	-21.7959	15.7522	0.77994	0.0:1.0:0.0:0.0	.	691	Q13395	TARB1_HUMAN	F	691	ENSP00000040877:C691F	ENSP00000040877:C691F	C	-	2	0	TARBP1	232649234	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.834000	0.62774	2.716000	0.92895	0.655000	0.94253	TGC		TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1	NM_005646	
CKAP5	9793	hgsc.bcm.edu	37	11	46782198	46782198	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr11:46782198C>T	ENST00000529230.1	-	33	4404	c.4358G>A	c.(4357-4359)cGc>cAc	p.R1453H	CKAP5_ENST00000354558.3_Missense_Mutation_p.R1453H|CKAP5_ENST00000312055.5_Missense_Mutation_p.R1453H|SNORD67_ENST00000390833.1_RNA|CKAP5_ENST00000415402.1_Missense_Mutation_p.R1453H|SNORD67_ENST00000516618.1_RNA			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	1453					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)		p.R1453H(1)		breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						TGGTCCCTTGCGTAACATGTT	0.483																																					p.R1453H	Ovarian(4;85 273 2202 4844 13323)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4358A	11						.						233.0	192.0	206.0					11																	46782198		2201	4299	6500	46738774	SO:0001583	missense	9793	exon33				CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.4358G>A	11.37:g.46782198C>T	ENSP00000432768:p.Arg1453His	Somatic		Capture	SOLID	Phase_I	46738774	NM_001008938	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.807005	0.90623	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558;ENST00000526876	T;T;T;T	0.50277	0.75;0.77;0.77;0.77	6.03	6.03	0.97812	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.60051	0.2239	L	0.32530	0.975	0.80722	D	1	D;D;P	0.89917	1.0;0.965;0.941	D;P;P	0.65684	0.937;0.681;0.482	T	0.56595	-0.7953	10	0.48119	T	0.1	-10.0088	20.5666	0.99351	0.0:1.0:0.0:0.0	.	1453;1453;1453	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	H	1453;1453;1453;1453;176	ENSP00000432768:R1453H;ENSP00000395302:R1453H;ENSP00000310227:R1453H;ENSP00000346566:R1453H	ENSP00000310227:R1453H	R	-	2	0	CKAP5	46738774	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.835000	0.69368	2.854000	0.98071	0.655000	0.94253	CGC		CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
UTRN	7402	hgsc.bcm.edu	37	6	145073029	145073029	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr6:145073029C>A	ENST00000367545.3	+	55	8296	c.8296C>A	c.(8296-8298)Ccc>Acc	p.P2766T	UTRN_ENST00000367526.4_Missense_Mutation_p.P321T	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2766					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.P2766T(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TGACCTGCATCCCTCTCTAAA	0.403																																					p.P2766T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C8296A	6						.						104.0	94.0	98.0					6																	145073029		2203	4300	6503	145114722	SO:0001583	missense	7402	exon55			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.8296C>A	6.37:g.145073029C>A	ENSP00000356515:p.Pro2766Thr	Somatic		Capture	SOLID	Phase_I	145114722	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.288912	0.40494	.	.	ENSG00000152818	ENST00000367545;ENST00000367526	T;T	0.46451	0.87;0.87	5.99	4.23	0.50019	.	0.000000	0.49916	D	0.000140	T	0.34803	0.0910	L	0.36672	1.1	0.35536	D	0.802649	D	0.55385	0.971	P	0.56343	0.796	T	0.34750	-0.9816	10	0.66056	D	0.02	.	12.7663	0.57393	0.0:0.8683:0.0:0.1317	.	2766	P46939	UTRO_HUMAN	T	2766;321	ENSP00000356515:P2766T;ENSP00000356496:P321T	ENSP00000356496:P321T	P	+	1	0	UTRN	145114722	1.000000	0.71417	0.764000	0.31436	0.003000	0.03518	7.142000	0.77339	0.882000	0.36016	-0.140000	0.14226	CCC		UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
TMEM132E	124842	hgsc.bcm.edu	37	17	32959756	32959756	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr17:32959756G>A	ENST00000321639.5	+	7	1574	c.1246G>A	c.(1246-1248)Gga>Aga	p.G416R		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	416						integral component of membrane (GO:0016021)		p.G416R(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GTTTGTGAGTGGAAAAGAGTC	0.572																																					p.G416R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1246A	17						.						178.0	140.0	153.0					17																	32959756		2203	4300	6503	29983869	SO:0001583	missense	124842	exon7			BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.1246G>A	17.37:g.32959756G>A	ENSP00000316532:p.Gly416Arg	Somatic		Capture	SOLID	Phase_I	29983869	NM_207313	Q8WUF4|Q8WVA5	Missense_Mutation	SNP	ENST00000321639.5	37	CCDS11283.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.970319	0.92919	.	.	ENSG00000181291	ENST00000321639	T	0.35048	1.33	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.65729	0.2719	M	0.86573	2.825	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73509	-0.3960	10	0.87932	D	0	-12.9424	16.6219	0.84932	0.0:0.0:1.0:0.0	.	416	Q6IEE7	T132E_HUMAN	R	416	ENSP00000316532:G416R	ENSP00000316532:G416R	G	+	1	0	TMEM132E	29983869	1.000000	0.71417	0.995000	0.50966	0.965000	0.64279	9.657000	0.98554	2.388000	0.81334	0.551000	0.68910	GGA		TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	NM_207313	
CCDC103	388389	hgsc.bcm.edu	37	17	42980015	42980015	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr17:42980015G>A	ENST00000417826.2	+	4	654	c.559G>A	c.(559-561)Gag>Aag	p.E187K	FAM187A_ENST00000331733.4_5'UTR|CCDC103_ENST00000410006.2_Missense_Mutation_p.E187K|EFTUD2_ENST00000426333.2_5'Flank|AC015936.3_ENST00000441312.1_RNA|FAM187A_ENST00000412523.2_Intron	NM_001258399.1|NM_213607.2	NP_001245328.1|NP_998772.1	Q8IW40	CC103_HUMAN	coiled-coil domain containing 103	187					axonemal dynein complex assembly (GO:0070286)|cell projection organization (GO:0030030)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|outer dynein arm assembly (GO:0036158)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein homodimerization activity (GO:0042803)	p.E187K(1)		endometrium(1)|kidney(1)|large_intestine(3)|prostate(1)|skin(1)	7		Prostate(33;0.109)				GAGCCGGGCAGAGAGAGAGAG	0.647																																					p.E187K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G559A	17						.						37.0	39.0	38.0					17																	42980015		2203	4300	6503	40335541	SO:0001583	missense	388389	exon4			AK023156	CCDS11490.1, CCDS58554.1	17q21.31	2013-02-22			ENSG00000167131	ENSG00000167131			32700	protein-coding gene	gene with protein product		614677				22581229	Standard	NM_213607		Approved	FLJ13094, FLJ34211, PR46b, CILD17	uc031ray.1	Q8IW40	OTTHUMG00000154264	ENST00000417826.2:c.559G>A	17.37:g.42980015G>A	ENSP00000391692:p.Glu187Lys	Somatic		Capture	SOLID	Phase_I	40335541	NM_213607	A8K145|B8ZZU0	Missense_Mutation	SNP	ENST00000417826.2	37	CCDS11490.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.147083	0.77888	.	.	ENSG00000167131	ENST00000357776;ENST00000417826;ENST00000410006	T;T;T	0.60797	0.16;0.16;0.16	5.64	5.64	0.86602	.	0.000000	0.53938	U	0.000058	T	0.76183	0.3952	M	0.72894	2.215	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	T	0.76884	-0.2794	10	0.72032	D	0.01	3.1677	18.0636	0.89384	0.0:0.0:1.0:0.0	.	187	Q8IW40	CC103_HUMAN	K	187	ENSP00000350420:E187K;ENSP00000391692:E187K;ENSP00000387252:E187K	ENSP00000350420:E187K	E	+	1	0	CCDC103	40335541	1.000000	0.71417	0.953000	0.39169	0.078000	0.17371	6.205000	0.72148	2.937000	0.99478	0.650000	0.86243	GAG		CCDC103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334578.1	NM_213607	
NFATC3	4775	hgsc.bcm.edu	37	16	68156207	68156207	+	Silent	SNP	T	T	C			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr16:68156207T>C	ENST00000346183.3	+	2	445	c.421T>C	c.(421-423)Ttg>Ctg	p.L141L	NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000575270.1_Silent_p.L141L|NFATC3_ENST00000349223.5_Silent_p.L141L|RP11-67A1.2_ENST00000548144.1_RNA|NFATC3_ENST00000329524.4_Silent_p.L141L	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	141					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.L141L(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		ACGGGAATTTTTGGAAAGGCC	0.438																																					p.L141L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T421C	16						.						83.0	84.0	84.0					16																	68156207		2198	4300	6498	66713708	SO:0001819	synonymous_variant	4775	exon2			L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.421T>C	16.37:g.68156207T>C		Somatic		Capture	SOLID	Phase_I	66713708	NM_173163	O75211|Q14516|Q99840|Q99841|Q99842	Silent	SNP	ENST00000346183.3	37	CCDS10860.1																																																																																				NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2	NM_004555	
SMAD4	4089	hgsc.bcm.edu	37	18	48604787	48604787	+	Missense_Mutation	SNP	G	G	T	rs377767385		TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr18:48604787G>T	ENST00000342988.3	+	12	2147	c.1609G>T	c.(1609-1611)Gac>Tac	p.D537Y	SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Missense_Mutation_p.D537Y|SMAD4_ENST00000588745.1_Missense_Mutation_p.D441Y	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	537	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.D537Y(3)|p.?(2)|p.L536fs*11(1)|p.L536fs*14(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CCAGCTCCTAGACGAAGTACT	0.488																																					p.D537Y												SMAD4,large_intestine,NS,Substitution - Missense,0	.	43	Whole gene deletion(36)|Substitution - Missense(3)|Deletion - Frameshift(2)|Unknown(2)	pancreas(26)|large_intestine(7)|lung(3)|breast(3)|stomach(2)|upper_aerodigestive_tract(1)|oesophagus(1)	c.G1609T	18						.						79.0	82.0	81.0					18																	48604787		2203	4300	6503	46858785	SO:0001583	missense	4089	exon12			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1609G>T	18.37:g.48604787G>T	ENSP00000341551:p.Asp537Tyr	Somatic		Capture	SOLID	Phase_I	46858785	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.860918	0.71834	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	D;D	0.98090	-4.71;-4.71	6.07	6.07	0.98685	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (1);	0.000000	0.85682	D	0.000000	D	0.99133	0.9701	M	0.93420	3.415	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99323	1.0907	10	0.87932	D	0	.	19.4308	0.94765	0.0:0.0:1.0:0.0	.	537	Q13485	SMAD4_HUMAN	Y	537	ENSP00000341551:D537Y;ENSP00000381452:D537Y	ENSP00000341551:D537Y	D	+	1	0	SMAD4	46858785	1.000000	0.71417	0.972000	0.41901	0.957000	0.61999	9.633000	0.98432	2.885000	0.99019	0.655000	0.94253	GAC		SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
ACKR2	1238	hgsc.bcm.edu	37	3	42906467	42906467	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr3:42906467G>A	ENST00000422265.1	+	3	648	c.473G>A	c.(472-474)cGg>cAg	p.R158Q	RP11-141M3.5_ENST00000471537.1_RNA|ACKR2_ENST00000273145.2_Missense_Mutation_p.R158Q|KRBOX1_ENST00000426937.1_Intron|CYP8B1_ENST00000437102.1_Intron|ACKR2_ENST00000442925.1_Missense_Mutation_p.R158Q	NM_001296.4	NP_001287.2	O00590	ACKR2_HUMAN	atypical chemokine receptor 2	158					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|multicellular organismal development (GO:0007275)|neutrophil activation (GO:0042119)|receptor-mediated endocytosis (GO:0006898)	actin filament (GO:0005884)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-X-C chemokine receptor activity (GO:0016494)|chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)	p.R158Q(1)									CTGAGGACCCGGGCCAAGAGC	0.507																																					p.R158Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G473A	3						.						77.0	80.0	79.0					3																	42906467		2203	4300	6503	42881471	SO:0001583	missense	1238	exon3			U94888	CCDS2706.1	3p21.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144648	ENSG00000144648		"""GPCR / Class A : Chemokine receptors : Atypical"""	1565	protein-coding gene	gene with protein product		602648	"""chemokine binding protein 2"""	CMKBR9, CCBP2		9364936, 9405404, 16148	Standard	NM_001296		Approved	CCR10, D6, CCR9	uc003cme.3	O00590	OTTHUMG00000133040	ENST00000422265.1:c.473G>A	3.37:g.42906467G>A	ENSP00000416996:p.Arg158Gln	Somatic		Capture	SOLID	Phase_I	42881471	NM_001296	B2R8Y8|O00537|Q53YA1|Q86UN9|Q96A02	Missense_Mutation	SNP	ENST00000422265.1	37	CCDS2706.1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.331196	0.24167	.	.	ENSG00000144648	ENST00000442925;ENST00000422265;ENST00000273145	T;T;T	0.72282	-0.64;-0.64;-0.64	5.02	0.735	0.18300	GPCR, rhodopsin-like superfamily (1);	0.327353	0.21462	N	0.074150	T	0.54334	0.1852	L	0.49699	1.58	0.09310	N	0.999996	P	0.38078	0.617	B	0.30029	0.11	T	0.42258	-0.9462	9	.	.	.	.	6.6831	0.23131	0.0754:0.4651:0.3401:0.1194	.	158	O00590	CCBP2_HUMAN	Q	158	ENSP00000396150:R158Q;ENSP00000416996:R158Q;ENSP00000273145:R158Q	.	R	+	2	0	CCBP2	42881471	0.000000	0.05858	0.513000	0.27749	0.323000	0.28346	-0.484000	0.06528	0.109000	0.17891	0.563000	0.77884	CGG		ACKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256645.2	NM_001296	
LRMP	4033	hgsc.bcm.edu	37	12	25254244	25254244	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr12:25254244C>T	ENST00000354454.3	+	15	1703	c.874C>T	c.(874-876)Cct>Tct	p.P292S	LRMP_ENST00000547044.1_Missense_Mutation_p.P292S|RP11-713N11.4_ENST00000555862.1_RNA|LRMP_ENST00000548766.1_Missense_Mutation_p.P292S	NM_006152.3	NP_006143.2	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein	348					immune system process (GO:0002376)|single fertilization (GO:0007338)|vesicle fusion (GO:0006906)|vesicle targeting (GO:0006903)	chromosome (GO:0005694)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P292S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					GTCTTTCAATCCTCTTGAAGA	0.333																																					p.P292S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C874T	12						.						71.0	71.0	71.0					12																	25254244		2203	4300	6503	25145511	SO:0001583	missense	4033	exon15				CCDS8701.1	12p12.1	2012-05-16			ENSG00000118308	ENSG00000118308			6690	protein-coding gene	gene with protein product		602003				8021504	Standard	NM_006152		Approved	JAW1	uc010sja.2	Q12912	OTTHUMG00000170192	ENST00000354454.3:c.874C>T	12.37:g.25254244C>T	ENSP00000346442:p.Pro292Ser	Somatic		Capture	SOLID	Phase_I	25145511	NM_006152	A0AVM2|B4E077|Q8N301	Missense_Mutation	SNP	ENST00000354454.3	37	CCDS8701.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.852430	0.00563	.	.	ENSG00000118308	ENST00000354454;ENST00000536173;ENST00000548766;ENST00000547044	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	5.51	0.213	0.15244	.	0.399073	0.28847	N	0.013944	T	0.11452	0.0279	N	0.11201	0.11	0.09310	N	0.999998	B	0.10296	0.003	B	0.11329	0.006	T	0.21655	-1.0239	10	0.02654	T	1	-4.6117	1.0607	0.01600	0.15:0.3481:0.1459:0.356	.	348	Q12912	LRMP_HUMAN	S	292;239;292;292	ENSP00000346442:P292S;ENSP00000444056:P239S;ENSP00000446496:P292S;ENSP00000450246:P292S	ENSP00000346442:P292S	P	+	1	0	LRMP	25145511	0.018000	0.18449	0.956000	0.39512	0.180000	0.23129	0.745000	0.26259	0.367000	0.24454	0.462000	0.41574	CCT		LRMP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407870.1	NM_006152	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	Somatic		Capture	SOLID	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
TUBA1C	84790	hgsc.bcm.edu	37	12	49663626	49663626	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr12:49663626G>A	ENST00000301072.6	+	3	517	c.242G>A	c.(241-243)gGc>gAc	p.G81D	TUBA1C_ENST00000549183.1_Missense_Mutation_p.G81D|RP11-161H23.5_ENST00000550468.2_RNA|TUBA1C_ENST00000541364.1_Missense_Mutation_p.G151D	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	81					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.G81D(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						GTTCGCACTGGCACTTACCGC	0.592																																					p.G81D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G242A	12						.						106.0	101.0	103.0					12																	49663626		2203	4300	6503	47949893	SO:0001583	missense	84790	exon3			BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.242G>A	12.37:g.49663626G>A	ENSP00000301072:p.Gly81Asp	Somatic		Capture	SOLID	Phase_I	47949893	NM_032704		Missense_Mutation	SNP	ENST00000301072.6	37	CCDS8782.1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.841545	0.71488	.	.	ENSG00000167553	ENST00000541364;ENST00000301072;ENST00000549183;ENST00000321665	T;T;T	0.67345	-0.26;-0.26;-0.26	4.32	4.32	0.51571	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.85682	D	0.000000	D	0.86506	0.5949	H	0.96748	3.875	0.80722	D	1	P;P	0.52463	0.953;0.812	P;P	0.60682	0.878;0.564	D	0.91037	0.4868	10	0.87932	D	0	.	16.7781	0.85557	0.0:0.0:1.0:0.0	.	151;81	F5H5D3;Q9BQE3	.;TBA1C_HUMAN	D	151;81;81;81	ENSP00000443475:G151D;ENSP00000301072:G81D;ENSP00000448211:G81D	ENSP00000301072:G81D	G	+	2	0	TUBA1C	47949893	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.391000	0.97249	2.679000	0.91253	0.555000	0.69702	GGC		TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
KRT81	3887	hgsc.bcm.edu	37	12	52681407	52681407	+	Silent	SNP	C	C	T	rs557990688		TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr12:52681407C>T	ENST00000327741.5	-	6	1067	c.999G>A	c.(997-999)acG>acA	p.T333T	KRT86_ENST00000544024.1_Intron|KRT86_ENST00000423955.2_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	333	Coil 2.|Rod.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.T333T(1)		breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCACCTCGGCCGTCAGCCTTT	0.587													.|||	1	0.000199681	0.0	0.0014	5008	,	,		19855	0.0		0.0	False		,,,				2504	0.0				p.T333T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G999A	12						.						95.0	82.0	87.0					12																	52681407		2203	4300	6503	50967674	SO:0001819	synonymous_variant	3887	exon6			X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.999G>A	12.37:g.52681407C>T		Somatic		Capture	SOLID	Phase_I	50967674	NM_002281	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Silent	SNP	ENST00000327741.5	37	CCDS31805.1																																																																																				KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395128.2	NM_002281	
MYF5	4617	hgsc.bcm.edu	37	12	81112717	81112717	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr12:81112717C>T	ENST00000228644.3	+	3	807	c.655C>T	c.(655-657)Caa>Taa	p.Q219*		NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5	219					camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)	p.Q219*(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						CTCCTCAGAGCAACCTGGGTT	0.493																																					p.Q219X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C655T	12						.						106.0	102.0	103.0					12																	81112717		2203	4300	6503	79636848	SO:0001587	stop_gained	4617	exon3				CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.655C>T	12.37:g.81112717C>T	ENSP00000228644:p.Gln219*	Somatic		Capture	SOLID	Phase_I	79636848	NM_005593	Q6ISR9	Nonsense_Mutation	SNP	ENST00000228644.3	37	CCDS9020.1	.	.	.	.	.	.	.	.	.	.	C	36	5.847927	0.97023	.	.	ENSG00000111049	ENST00000228644	.	.	.	6.06	6.06	0.98353	.	0.240656	0.42548	D	0.000684	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-0.035	19.3923	0.94587	0.0:1.0:0.0:0.0	.	.	.	.	X	219	.	ENSP00000228644:Q219X	Q	+	1	0	MYF5	79636848	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.154000	0.50693	2.882000	0.98803	0.655000	0.94253	CAA		MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407757.1	NM_005593	
ATP10A	57194	hgsc.bcm.edu	37	15	25926044	25926044	+	Silent	SNP	G	G	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr15:25926044G>A	ENST00000356865.6	-	19	3702	c.3591C>T	c.(3589-3591)aaC>aaT	p.N1197N		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1197					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.N1197N(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		ACAGGTCCACGTTCGAGTCAT	0.557																																					p.N1197N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3591T	15						.						114.0	109.0	111.0					15																	25926044		2203	4300	6503	23477137	SO:0001819	synonymous_variant	57194	exon19			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.3591C>T	15.37:g.25926044G>A		Somatic		Capture	SOLID	Phase_I	23477137	NM_024490	Q4G0S9|Q969I4	Silent	SNP	ENST00000356865.6	37	CCDS32178.1																																																																																				ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
EPHA5	2044	hgsc.bcm.edu	37	4	66467878	66467878	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr4:66467878T>C	ENST00000273854.3	-	3	991	c.391A>G	c.(391-393)Aaa>Gaa	p.K131E	EPHA5_ENST00000432638.2_Missense_Mutation_p.K131E|EPHA5_ENST00000511294.1_Missense_Mutation_p.K131E|EPHA5_ENST00000354839.4_Missense_Mutation_p.K131E	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	131	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.K131E(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						AGGGTAAATTTGAGTTCTATG	0.433										TSP Lung(17;0.13)																											p.K131E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A391G	4						.						85.0	89.0	88.0					4																	66467878		2203	4300	6503	66150473	SO:0001583	missense	2044	exon3			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.391A>G	4.37:g.66467878T>C	ENSP00000273854:p.Lys131Glu	Somatic		Capture	SOLID	Phase_I	66150473	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248964	0.80024	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.03745	3.82;3.82;3.82;3.82	5.67	5.67	0.87782	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.64402	D	0.000004	T	0.17238	0.0414	M	0.66378	2.025	0.58432	D	0.999998	D;D;D;D	0.76494	0.999;0.985;0.998;0.996	D;D;D;D	0.91635	0.999;0.963;0.998;0.964	T	0.00089	-1.2089	10	0.87932	D	0	.	15.9044	0.79412	0.0:0.0:0.0:1.0	.	131;131;131;131	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	E	131	ENSP00000273854:K131E;ENSP00000389208:K131E;ENSP00000346899:K131E;ENSP00000427638:K131E	ENSP00000273854:K131E	K	-	1	0	EPHA5	66150473	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	8.040000	0.89188	2.162000	0.67917	0.528000	0.53228	AAA		EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
TMPRSS11A	339967	hgsc.bcm.edu	37	4	68810250	68810250	+	Missense_Mutation	SNP	G	G	A	rs187902089	byFrequency	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr4:68810250G>A	ENST00000334830.7	-	3	985	c.239C>T	c.(238-240)aCg>aTg	p.T80M	UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11A_ENST00000396188.2_Missense_Mutation_p.T80M|TMPRSS11A_ENST00000508048.1_Missense_Mutation_p.T79M			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	80	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.T80M(1)		breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						ATTTTCGGTCGTCTCTCGTAA	0.333													G|||	3	0.000599042	0.0023	0.0	5008	,	,		18220	0.0		0.0	False		,,,				2504	0.0				p.T80M	NSCLC(26;2 894 10941 14480 22546)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C239T	4						.	G	MET/THR,MET/THR	0,4406		0,0,2203	172.0	174.0	174.0		239,239	-0.5	0.1	4		174	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	TMPRSS11A	NM_001114387.1,NM_182606.3	81,81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign,benign	80/419,80/422	68810250	2,13004	2203	4300	6503	68492845	SO:0001583	missense	339967	exon3			AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.239C>T	4.37:g.68810250G>A	ENSP00000334611:p.Thr80Met	Somatic		Capture	SOLID	Phase_I	68492845	NM_182606	J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Missense_Mutation	SNP	ENST00000334830.7	37	CCDS3519.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	4.509	0.094364	0.08632	0.0	2.33E-4	ENSG00000187054	ENST00000508048;ENST00000334830;ENST00000396188;ENST00000513536	T;T;T;T	0.39787	1.06;1.06;1.06;1.06	5.28	-0.487	0.12060	SEA (1);	0.704877	0.13093	N	0.414366	T	0.13713	0.0332	N	0.02736	-0.51	0.22240	N	0.999269	B;B	0.18610	0.029;0.029	B;B	0.12156	0.007;0.007	T	0.16305	-1.0407	10	0.27082	T	0.32	.	0.9486	0.01371	0.5034:0.1596:0.1827:0.1543	.	80;80	B5MDI9;Q6ZMR5	.;TM11A_HUMAN	M	79;80;80;60	ENSP00000426911:T79M;ENSP00000334611:T80M;ENSP00000379491:T80M;ENSP00000427621:T60M	ENSP00000334611:T80M	T	-	2	0	TMPRSS11A	68492845	0.184000	0.23200	0.098000	0.21074	0.312000	0.27988	0.074000	0.14662	0.085000	0.17107	-0.302000	0.09304	ACG		TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251433.3	NM_182606	
FBXO8	26269	hgsc.bcm.edu	37	4	175183938	175183938	+	Silent	SNP	C	C	T			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr4:175183938C>T	ENST00000393674.2	-	2	1168	c.306G>A	c.(304-306)gcG>gcA	p.A102A	FBXO8_ENST00000503293.1_Silent_p.A61A	NM_012180.2	NP_036312.2	Q9NRD0	FBX8_HUMAN	F-box protein 8	102	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell junction (GO:0030054)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.A102A(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|urinary_tract(1)	14		Prostate(90;0.00201)|Melanoma(52;0.012)|Renal(120;0.0183)|all_neural(102;0.0887)|all_hematologic(60;0.107)		all cancers(43;7.29e-18)|Epithelial(43;1.85e-15)|OV - Ovarian serous cystadenocarcinoma(60;5.62e-09)|GBM - Glioblastoma multiforme(59;0.00115)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.1)		GTTCATCATTCGCAAGGTCCT	0.388																																					p.A102A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G306A	4						.						86.0	76.0	79.0					4																	175183938		2203	4300	6503	175420513	SO:0001819	synonymous_variant	26269	exon2			AF174596	CCDS3820.1	4q34.1	2008-02-05	2004-06-15			ENSG00000164117		"""F-boxes /  ""other"""""	13587	protein-coding gene	gene with protein product		605649	"""F-box only protein 8"""			10531035, 10531037	Standard	NM_012180		Approved	FBX8, FBS	uc003itp.3	Q9NRD0		ENST00000393674.2:c.306G>A	4.37:g.175183938C>T		Somatic		Capture	SOLID	Phase_I	175420513	NM_012180	B2RB40|D3DP41|G5E9Z0|Q6UWN4|Q8IWE1|Q9NRP5|Q9UKC4	Silent	SNP	ENST00000393674.2	37	CCDS3820.1	.	.	.	.	.	.	.	.	.	.	C	3.728	-0.056095	0.07362	.	.	ENSG00000164117	ENST00000296517	.	.	.	5.63	-11.3	0.00108	.	.	.	.	.	T	0.26846	0.0657	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41466	-0.9507	5	0.13470	T	0.59	.	3.0214	0.06077	0.1881:0.2461:0.3821:0.1836	.	.	.	.	Q	16	.	ENSP00000296517:R16Q	R	-	2	0	FBXO8	175420513	0.000000	0.05858	0.004000	0.12327	0.778000	0.44026	-1.846000	0.01676	-4.071000	0.00076	-2.689000	0.00140	CGA		FBXO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362085.2	NM_012180	
TIMP1	7076	hgsc.bcm.edu	37	X	47444707	47444707	+	Missense_Mutation	SNP	G	G	A	rs140600134		TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chrX:47444707G>A	ENST00000218388.4	+	4	475	c.305G>A	c.(304-306)cGc>cAc	p.R102H	TIMP1_ENST00000377017.1_Missense_Mutation_p.R38H|TIMP1_ENST00000456754.2_Missense_Mutation_p.R102H|MIR4769_ENST00000584126.1_RNA|SYN1_ENST00000340666.4_Intron|TIMP1_ENST00000377018.2_Missense_Mutation_p.A26T|SYN1_ENST00000295987.7_Intron	NM_003254.2	NP_003245.1	P01033	TIMP1_HUMAN	TIMP metallopeptidase inhibitor 1	102	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				aging (GO:0007568)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of trophoblast cell migration (GO:1901164)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell proliferation (GO:0008284)|regulation of integrin-mediated signaling pathway (GO:2001044)|response to cytokine (GO:0034097)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	cytokine activity (GO:0005125)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)	p.R102H(1)		endometrium(1)|large_intestine(2)	3						TCCCACAACCGCAGCGAGGAG	0.632																																					p.R102H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G305A	X						.		HIS/ARG,,	0,3835		0,0,1632,571	55.0	48.0	51.0		305,,	1.8	1.0	X	dbSNP_134	51	1,6727		0,1,2427,1872	no	missense,intron,intron	SYN1,TIMP1	NM_003254.2,NM_006950.3,NM_133499.2	29,,	0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095	probably-damaging,,	102/208,,	47444707	1,10562	2203	4300	6503	47329651	SO:0001583	missense	7076	exon4				CCDS14281.1	Xp11.3-p11.23	2008-07-29	2005-08-08		ENSG00000102265	ENSG00000102265			11820	protein-coding gene	gene with protein product		305370	"""tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor)"""	TIMP, CLGI			Standard	XM_005272645		Approved	EPO	uc004dif.3	P01033	OTTHUMG00000021447	ENST00000218388.4:c.305G>A	X.37:g.47444707G>A	ENSP00000218388:p.Arg102His	Somatic		Capture	SOLID	Phase_I	47329651	NM_003254	Q14252|Q9UCU1	Missense_Mutation	SNP	ENST00000218388.4	37	CCDS14281.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	23.1|23.1	4.379827|4.379827	0.82682|0.82682	0.0|0.0	1.49E-4|1.49E-4	ENSG00000102265|ENSG00000102265	ENST00000377018|ENST00000218388;ENST00000456754;ENST00000377017	.|D;D;D	.|0.94376	.|-3.41;-3.41;-3.41	5.01|5.01	1.76|1.76	0.24704|0.24704	.|Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);	.|0.147317	.|0.31909	.|N	.|0.006865	D|D	0.93374|0.93374	0.7887|0.7887	L|L	0.57536|0.57536	1.79|1.79	0.24761|0.24761	N|N	0.992929|0.992929	P|D	0.51537|0.71674	0.946|0.998	B|P	0.37387|0.62382	0.248|0.901	D|D	0.85652|0.85652	0.1283|0.1283	8|10	0.87932|0.45353	D|T	0|0.12	.|.	5.4077|5.4077	0.16330|0.16330	0.4296:0.0:0.5704:0.0|0.4296:0.0:0.5704:0.0	.|.	26|102	B4DJK3|P01033	.|TIMP1_HUMAN	T|H	26|102;102;38	.|ENSP00000218388:R102H;ENSP00000406671:R102H;ENSP00000366216:R38H	ENSP00000366217:A26T|ENSP00000218388:R102H	A|R	+|+	1|2	0|0	TIMP1|TIMP1	47329651|47329651	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.187000|1.187000	0.32090|0.32090	0.461000|0.461000	0.27071|0.27071	0.591000|0.591000	0.81541|0.81541	GCA|CGC		TIMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056423.1	NM_003254	
VSIG4	11326	hgsc.bcm.edu	37	X	65242693	65242693	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chrX:65242693C>T	ENST00000374737.4	-	7	1060	c.952G>A	c.(952-954)Gaa>Aaa	p.E318K	VSIG4_ENST00000412866.2_Missense_Mutation_p.E224K|VSIG4_ENST00000455586.2_Missense_Mutation_p.E318K	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	318					complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.E318K(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTGGCTGCTTCGTAGACATGC	0.473													C|||	2	0.000529801	0.0015	0.0	3775	,	,		14284	0.0		0.0	False		,,,				2504	0.0				p.E224K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G670A	X						.						93.0	86.0	88.0					X																	65242693		2203	4300	6503	65159418	SO:0001583	missense	11326	exon6			AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.952G>A	X.37:g.65242693C>T	ENSP00000363869:p.Glu318Lys	Somatic		Capture	SOLID	Phase_I	65159418	NM_001184831	Q6UXI4	Missense_Mutation	SNP	ENST00000374737.4	37	CCDS14383.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.82|13.82	2.351334|2.351334	0.41700|0.41700	.|.	.|.	ENSG00000155659|ENSG00000155659	ENST00000374737;ENST00000455586;ENST00000412866|ENST00000427538	T;T;T|.	0.41065|.	1.56;1.01;1.63|.	4.71|4.71	3.84|3.84	0.44239|0.44239	.|.	0.340529|.	0.21244|.	N|.	0.077776|.	T|T	0.53334|0.53334	0.1790|0.1790	M|M	0.69823|0.69823	2.125|2.125	0.26363|0.26363	N|N	0.97701|0.97701	D;D;D;D|.	0.89917|.	0.996;0.998;0.997;1.0|.	P;P;P;D|.	0.66351|.	0.611;0.833;0.839;0.943|.	T|T	0.46638|0.46638	-0.9177|-0.9177	10|5	0.48119|.	T|.	0.1|.	-6.4465|-6.4465	8.154|8.154	0.31158|0.31158	0.0:0.883:0.0:0.117|0.0:0.883:0.0:0.117	.|.	224;308;224;318|.	C9J1L3;C9JH67;Q9Y279-3;Q9Y279|.	.;.;.;VSIG4_HUMAN|.	K|Q	318;318;224|244	ENSP00000363869:E318K;ENSP00000411581:E318K;ENSP00000394143:E224K|.	ENSP00000363869:E318K|.	E|R	-|-	1|2	0|0	VSIG4|VSIG4	65159418|65159418	0.995000|0.995000	0.38212|0.38212	0.944000|0.944000	0.38274|0.38274	0.077000|0.077000	0.17291|0.17291	0.628000|0.628000	0.24522|0.24522	1.068000|1.068000	0.40764|0.40764	0.509000|0.509000	0.49947|0.49947	GAA|CGA		VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056986.1	NM_007268	
CPXCR1	53336	hgsc.bcm.edu	37	X	88009103	88009103	+	Missense_Mutation	SNP	C	C	T	rs191294021		TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chrX:88009103C>T	ENST00000276127.4	+	3	947	c.688C>T	c.(688-690)Cgt>Tgt	p.R230C	CPXCR1_ENST00000373111.1_Missense_Mutation_p.R230C	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	230							metal ion binding (GO:0046872)	p.R230C(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						ATGTAGATTCCGTGCTATTGT	0.378													C|||	1	0.000264901	0.0008	0.0	3775	,	,		13600	0.0		0.0	False		,,,				2504	0.0				p.R230C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C688T	X						.						66.0	53.0	58.0					X																	88009103		2203	4300	6503	87895759	SO:0001583	missense	53336	exon3			AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.688C>T	X.37:g.88009103C>T	ENSP00000276127:p.Arg230Cys	Somatic		Capture	SOLID	Phase_I	87895759	NM_001184771	B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	ENST00000276127.4	37	CCDS14458.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	9.956	1.221395	0.22457	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.26223	1.75;1.75	3.57	2.71	0.32032	.	0.914662	0.09093	N	0.849544	T	0.15478	0.0373	N	0.14661	0.345	0.09310	N	1	D	0.63880	0.993	B	0.43783	0.431	T	0.09250	-1.0683	9	.	.	.	-0.6198	6.2592	0.20891	0.0:0.8593:0.0:0.1407	.	230	Q8N123	CPXCR_HUMAN	C	230	ENSP00000276127:R230C;ENSP00000362203:R230C	.	R	+	1	0	CPXCR1	87895759	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.134000	0.15932	0.885000	0.36088	-0.215000	0.12644	CGT		CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048	
GLUD2	2747	hgsc.bcm.edu	37	X	120182923	120182923	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chrX:120182923C>T	ENST00000328078.1	+	1	1462	c.1385C>T	c.(1384-1386)tCt>tTt	p.S462F		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	462					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)	p.S462F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						GAAAGGGATTCTAACTACCAC	0.418																																					p.S462F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1385T	X						.						164.0	145.0	151.0					X																	120182923		2203	4300	6503	120010604	SO:0001583	missense	2747	exon1			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.1385C>T	X.37:g.120182923C>T	ENSP00000327589:p.Ser462Phe	Somatic		Capture	SOLID	Phase_I	120010604	NM_012084	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	C	15.95	2.984794	0.53934	.	.	ENSG00000182890	ENST00000328078	D	0.96041	-3.89	2.14	2.14	0.27477	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.052175	0.85682	N	0.000000	D	0.97692	0.9243	M	0.92833	3.35	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.97373	0.9977	10	0.87932	D	0	-7.638	9.6173	0.39698	0.0:1.0:0.0:0.0	.	462	P49448	DHE4_HUMAN	F	462	ENSP00000327589:S462F	ENSP00000327589:S462F	S	+	2	0	GLUD2	120010604	0.999000	0.42202	0.990000	0.47175	0.964000	0.63967	4.990000	0.63876	1.126000	0.42016	0.472000	0.43445	TCT		GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
KCNH7	90134	hgsc.bcm.edu	37	2	163292022	163292022	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr2:163292022T>C	ENST00000332142.5	-	8	1739	c.1640A>G	c.(1639-1641)tAt>tGt	p.Y547C	KCNH7_ENST00000328032.4_Missense_Mutation_p.Y540C	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	547					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.Y547C(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	AGCAGCGCCATATTCTGAATA	0.458																																					p.Y540C	GBM(196;1492 2208 17507 24132 45496)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1619G	2						.						80.0	77.0	78.0					2																	163292022		2203	4300	6503	163000268	SO:0001583	missense	90134	exon7			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.1640A>G	2.37:g.163292022T>C	ENSP00000331727:p.Tyr547Cys	Somatic		Capture	SOLID	Phase_I	163000268	NM_173162	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.343841	0.82022	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.98493	-4.96;-4.96	5.9	5.9	0.94986	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99257	0.9741	H	0.94306	3.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.99056	1.0829	10	0.62326	D	0.03	.	16.3322	0.83039	0.0:0.0:0.0:1.0	.	540;547	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	C	547;540	ENSP00000331727:Y547C;ENSP00000333781:Y540C	ENSP00000333781:Y540C	Y	-	2	0	KCNH7	163000268	1.000000	0.71417	0.999000	0.59377	0.924000	0.55760	8.040000	0.89188	2.251000	0.74343	0.528000	0.53228	TAT		KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272	
ATG16L1	55054	hgsc.bcm.edu	37	2	234198609	234198609	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr2:234198609G>A	ENST00000392017.4	+	13	1570	c.1313G>A	c.(1312-1314)cGc>cAc	p.R438H	SCARNA6_ENST00000515982.1_RNA|ATG16L1_ENST00000392018.1_Missense_Mutation_p.R455H|ATG16L1_ENST00000347464.5_Missense_Mutation_p.R275H|ATG16L1_ENST00000373525.5_Missense_Mutation_p.R259H|ATG16L1_ENST00000392020.4_Missense_Mutation_p.R419H	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)	438					autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)	p.R438H(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		TGGGATCTACGCAGCAAAGTC	0.493																																					p.R419H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1256A	2						.						103.0	93.0	96.0					2																	234198609		2203	4300	6503	233863348	SO:0001583	missense	55054	exon12			AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.1313G>A	2.37:g.234198609G>A	ENSP00000375872:p.Arg438His	Somatic		Capture	SOLID	Phase_I	233863348	NM_017974	A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	Missense_Mutation	SNP	ENST00000392017.4	37	CCDS2503.2	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027325	0.93518	.	.	ENSG00000085978	ENST00000392017;ENST00000347464;ENST00000373525;ENST00000392020;ENST00000392018;ENST00000334050	T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06	5.9	5.01	0.66863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.051121	0.85682	D	0.000000	T	0.45074	0.1324	M	0.78637	2.42	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.996;0.996;0.993;0.985	D;D;D;P;P	0.66497	0.915;0.921;0.944;0.835;0.844	T	0.27157	-1.0082	10	0.42905	T	0.14	.	14.4791	0.67567	0.0697:0.0:0.9303:0.0	.	392;419;259;438;275	B7ZLM5;Q676U5-2;Q676U5-4;Q676U5;A3EXL0	.;.;.;A16L1_HUMAN;.	H	438;275;259;419;455;97	ENSP00000375872:R438H;ENSP00000318259:R275H;ENSP00000362625:R259H;ENSP00000375875:R419H;ENSP00000375873:R455H	ENSP00000334016:R97H	R	+	2	0	ATG16L1	233863348	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.889000	0.87307	2.788000	0.95919	0.650000	0.86243	CGC		ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257069.2	NM_017974	
MBOAT2	129642	hgsc.bcm.edu	37	2	9098695	9098695	+	Missense_Mutation	SNP	G	G	A	rs142344615		TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr2:9098695G>A	ENST00000305997.3	-	2	350	c.152C>T	c.(151-153)aCt>aTt	p.T51I	MBOAT2_ENST00000486484.1_5'UTR	NM_138799.2	NP_620154.2	Q6ZWT7	MBOA2_HUMAN	membrane bound O-acyltransferase domain containing 2	51					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.T51I(1)	MBOAT2/PRKCE(2)	endometrium(2)|kidney(1)|large_intestine(9)|lung(2)|skin(1)	15	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AAAAGAGCTAGTTTTGCTTGA	0.338																																					p.T51I	Ovarian(194;1699 3813 22401)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C152T	2						.						77.0	78.0	78.0					2																	9098695		2203	4300	6503	9016146	SO:0001583	missense	129642	exon2			BC016005	CCDS1660.1	2p25	2008-02-05	2006-06-29	2006-06-29	ENSG00000143797	ENSG00000143797			25193	protein-coding gene	gene with protein product		611949	"""O-acyltransferase (membrane bound) domain containing 2"""	OACT2			Standard	NM_138799		Approved	FLJ14415, FLJ90298	uc002qzg.1	Q6ZWT7	OTTHUMG00000090363	ENST00000305997.3:c.152C>T	2.37:g.9098695G>A	ENSP00000302177:p.Thr51Ile	Somatic		Capture	SOLID	Phase_I	9016146	NM_138799	A9EDR2|Q8NCE7|Q96KY4	Missense_Mutation	SNP	ENST00000305997.3	37	CCDS1660.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.074770	0.76415	.	.	ENSG00000143797	ENST00000305997	T	0.10668	2.85	6.03	6.03	0.97812	.	0.048017	0.85682	D	0.000000	T	0.23330	0.0564	L	0.55103	1.725	0.80722	D	1	P;P	0.51933	0.901;0.949	P;P	0.52957	0.573;0.714	T	0.00075	-1.2121	10	0.28530	T	0.3	-18.9371	20.5568	0.99304	0.0:0.0:1.0:0.0	.	51;51	B7Z3I3;Q6ZWT7	.;MBOA2_HUMAN	I	51	ENSP00000302177:T51I	ENSP00000302177:T51I	T	-	2	0	MBOAT2	9016146	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.441000	0.80485	2.861000	0.98227	0.655000	0.94253	ACT		MBOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206735.1	NM_138799	
SEPT2	4735	hgsc.bcm.edu	37	2	242283192	242283192	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr2:242283192G>C	ENST00000391973.2	+	9	1250	c.722G>C	c.(721-723)gGa>gCa	p.G241A	SEPT2_ENST00000402092.2_Missense_Mutation_p.G241A|SEPT2_ENST00000407971.1_Missense_Mutation_p.G201A|SEPT2_ENST00000401990.1_Missense_Mutation_p.G251A|SEPT2_ENST00000360051.3_Missense_Mutation_p.G241A|SEPT2_ENST00000391971.2_Missense_Mutation_p.G241A	NM_006155.1	NP_006146.1	Q15019	SEPT2_HUMAN	septin 2	241	Septin-type G.				cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|neuron projection development (GO:0031175)|regulation of L-glutamate transport (GO:0002036)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|synapse (GO:0045202)	enzyme regulator activity (GO:0030234)|GTP binding (GO:0005525)	p.G241A(1)		central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		TCTGTGGTTGGATCCAATCAG	0.512																																					p.G241A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G722C	2						.						340.0	347.0	344.0					2																	242283192		2203	4300	6503	241931865	SO:0001583	missense	4735	exon10			D28540	CCDS2548.1, CCDS63195.1, CCDS74682.1	2q37.3	2013-01-21	2005-01-11	2005-01-12	ENSG00000168385	ENSG00000168385		"""Septins"""	7729	protein-coding gene	gene with protein product		601506	"""neural precursor cell expressed, developmentally down-regulated 5"""	DIFF6, NEDD5		8697812	Standard	XM_005247011		Approved	KIAA0158, hNedd5, Pnutl3	uc002wbd.3	Q15019	OTTHUMG00000133394	ENST00000391973.2:c.722G>C	2.37:g.242283192G>C	ENSP00000375834:p.Gly241Ala	Somatic		Capture	SOLID	Phase_I	241931865	NM_001008491	B4DGE8|Q14132|Q53QU3|Q8IUK9|Q96CB0	Missense_Mutation	SNP	ENST00000391973.2	37	CCDS2548.1	.	.	.	.	.	.	.	.	.	.	G	34	5.332952	0.95758	.	.	ENSG00000168385	ENST00000391973;ENST00000360051;ENST00000391971;ENST00000401990;ENST00000407971;ENST00000402092;ENST00000391972;ENST00000421717	T;T;T;T;T;T;T	0.58210	1.34;1.34;1.34;1.34;0.35;1.34;0.35	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.74642	0.3743	M	0.81112	2.525	0.80722	D	1	D;D;P	0.67145	0.996;0.969;0.828	D;P;P	0.64042	0.921;0.564;0.631	T	0.76531	-0.2925	10	0.87932	D	0	.	20.3789	0.98926	0.0:0.0:1.0:0.0	.	276;201;241	Q15019-2;B5MCX3;Q15019	.;.;SEPT2_HUMAN	A	241;241;241;251;201;241;276;96	ENSP00000375834:G241A;ENSP00000353157:G241A;ENSP00000375832:G241A;ENSP00000385109:G251A;ENSP00000384525:G201A;ENSP00000385172:G241A;ENSP00000408296:G96A	ENSP00000353157:G241A	G	+	2	0	SEPT2	241931865	1.000000	0.71417	0.557000	0.28306	0.944000	0.59088	9.553000	0.98118	2.826000	0.97356	0.563000	0.77884	GGA		SEPT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323177.3	NM_006155	
BAG1	573	hgsc.bcm.edu	37	9	33255912	33255912	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr9:33255912T>A	ENST00000379704.2	-	6	987	c.554A>T	c.(553-555)aAt>aTt	p.N185I	BAG1_ENST00000472232.3_Missense_Mutation_p.N300I|BAG1_ENST00000467389.2_5'UTR			Q99933	BAG1_HUMAN	BCL2-associated athanogene	300	Interaction with HSPA8.|Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|chaperone cofactor-dependent protein refolding (GO:0070389)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor signaling protein activity (GO:0005057)	p.N300I(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(29;0.00506)			GTCTTTGAAATTTTCTGGCAG	0.338																																					p.N185I	GBM(77;1066 1502 5858 12192)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A554T	9						.						146.0	133.0	137.0					9																	33255912		2202	4298	6500	33245912	SO:0001583	missense	573	exon6			AF022224	CCDS35004.1, CCDS55301.1	9p12	2010-12-09			ENSG00000107262	ENSG00000107262			937	protein-coding gene	gene with protein product		601497				7834747	Standard	NM_004323		Approved		uc003zsj.3	Q99933	OTTHUMG00000019766	ENST00000379704.2:c.554A>T	9.37:g.33255912T>A	ENSP00000369026:p.Asn185Ile	Somatic		Capture	SOLID	Phase_I	33245912	NM_001172415	O75315|Q14414|Q53H32|Q5VZE8|Q5VZE9|Q5VZF0|Q96TG2|Q9Y2V4	Missense_Mutation	SNP	ENST00000379704.2	37	CCDS55301.1	.	.	.	.	.	.	.	.	.	.	T	18.97	3.734935	0.69189	.	.	ENSG00000107262	ENST00000472232;ENST00000379700;ENST00000379704	D;D	0.88354	-2.37;-2.37	4.78	3.58	0.41010	BAG domain (3);	0.143965	0.64402	D	0.000007	D	0.90386	0.6991	L	0.56769	1.78	0.44395	D	0.997303	D;D	0.60160	0.969;0.987	P;P	0.57620	0.513;0.824	D	0.90691	0.4613	10	0.87932	D	0	-2.8431	9.971	0.41754	0.0:0.0:0.1691:0.8309	.	229;300	Q99933-3;Q99933	.;BAG1_HUMAN	I	300;185;185	ENSP00000420514:N300I;ENSP00000369026:N185I	ENSP00000369022:N185I	N	-	2	0	BAG1	33245912	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.388000	0.52509	2.022000	0.59522	0.533000	0.62120	AAT		BAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052042.3	NM_004323	
TNC	3371	hgsc.bcm.edu	37	9	117798501	117798501	+	Silent	SNP	C	C	T	rs200409463		TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr9:117798501C>T	ENST00000350763.4	-	21	5943	c.5532G>A	c.(5530-5532)acG>acA	p.T1844T	TNC_ENST00000345230.3_Silent_p.T1207T|TNC_ENST00000535648.1_Silent_p.T1389T|TNC_ENST00000340094.3_Silent_p.T1480T|TNC_ENST00000542877.1_Silent_p.T1481T|TNC_ENST00000537320.1_Silent_p.T1207T|TNC_ENST00000423613.2_Silent_p.T1571T|TNC_ENST00000341037.4_Silent_p.T1662T|TNC_ENST00000346706.3_Silent_p.T1298T	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1844	Fibronectin type-III 14. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.T1844T(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TCCCGGACACCGTGCGTGTAA	0.517																																					p.T1844T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5532A	9						.						157.0	130.0	139.0					9																	117798501		2203	4300	6503	116838322	SO:0001819	synonymous_variant	3371	exon21				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5532G>A	9.37:g.117798501C>T		Somatic		Capture	SOLID	Phase_I	116838322	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Silent	SNP	ENST00000350763.4	37	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	C	6.488	0.458154	0.12342	.	.	ENSG00000041982	ENST00000544972	.	.	.	5.38	-8.71	0.00848	.	.	.	.	.	T	0.49626	0.1568	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58115	-0.7693	4	.	.	.	.	10.219	0.43186	0.0:0.1848:0.3055:0.5097	.	.	.	.	S	407	.	.	G	-	1	0	TNC	116838322	0.000000	0.05858	0.152000	0.22495	0.877000	0.50540	-2.828000	0.00745	-1.821000	0.01213	-0.878000	0.02970	GGT		TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
GFRA1	2674	hgsc.bcm.edu	37	10	117849328	117849328	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr10:117849328T>G	ENST00000355422.6	-	9	1671	c.1121A>C	c.(1120-1122)aAg>aCg	p.K374T	GFRA1_ENST00000369236.1_Missense_Mutation_p.K369T|GFRA1_ENST00000439649.3_Missense_Mutation_p.K369T|GFRA1_ENST00000544592.1_Missense_Mutation_p.K253T	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	374					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)	p.K369T(1)		endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		GGGCTTGTTCTTAACCCGGAG	0.547																																					p.K369T	Ovarian(128;329 1725 45498 46808 50759)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1106C	10						.						69.0	69.0	69.0					10																	117849328		2203	4300	6503	117839318	SO:0001583	missense	2674	exon8			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.1121A>C	10.37:g.117849328T>G	ENSP00000347591:p.Lys374Thr	Somatic		Capture	SOLID	Phase_I	117839318	NM_001145453	A8KA21|O15507|O43912	Missense_Mutation	SNP	ENST00000355422.6	37	CCDS44481.1	.	.	.	.	.	.	.	.	.	.	T	13.08	2.128847	0.37533	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000544592;ENST00000369234	T;T	0.47528	1.45;0.84	6.17	3.87	0.44632	.	0.342580	0.35870	N	0.002935	T	0.36853	0.0982	L	0.43152	1.355	0.38955	D	0.958426	P;B	0.43094	0.799;0.131	B;B	0.40901	0.343;0.062	T	0.17137	-1.0379	10	0.23891	T	0.37	-17.0835	8.4142	0.32662	0.0:0.1944:0.0:0.8056	.	374;369	P56159;P56159-2	GFRA1_HUMAN;.	T	374;369;369;253;369	ENSP00000358239:K369T;ENSP00000442179:K253T	ENSP00000347591:K369T	K	-	2	0	GFRA1	117839318	1.000000	0.71417	0.997000	0.53966	0.722000	0.41435	1.490000	0.35573	1.166000	0.42689	0.533000	0.62120	AAG		GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793	
MYPN	84665	hgsc.bcm.edu	37	10	69926073	69926073	+	Silent	SNP	C	C	T			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr10:69926073C>T	ENST00000358913.5	+	10	2111	c.1623C>T	c.(1621-1623)aaC>aaT	p.N541N	MYPN_ENST00000540630.1_Silent_p.N541N|MYPN_ENST00000354393.2_Silent_p.N266N	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	541					sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)	p.N541N(1)		breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						TCAGCAACAACGGGTCTCTTC	0.547																																					p.N541N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1623T	10						.						84.0	69.0	74.0					10																	69926073		2203	4300	6503	69596079	SO:0001819	synonymous_variant	84665	exon10			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.1623C>T	10.37:g.69926073C>T		Somatic		Capture	SOLID	Phase_I	69596079	NM_032578	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Silent	SNP	ENST00000358913.5	37	CCDS7275.1																																																																																				MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
KAT6B	23522	hgsc.bcm.edu	37	10	76789361	76789361	+	Silent	SNP	G	G	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr10:76789361G>A	ENST00000287239.4	+	18	5268	c.4779G>A	c.(4777-4779)caG>caA	p.Q1593Q	KAT6B_ENST00000372724.1_Silent_p.Q1301Q|KAT6B_ENST00000372711.1_Silent_p.Q1410Q|KAT6B_ENST00000372714.1_Silent_p.Q1301Q|KAT6B_ENST00000372725.1_Silent_p.Q1301Q	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1593	Interaction with RUNX1 and RUNX2.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.Q1593Q(1)									ATTGCCAACAGTCGGACCACA	0.557																																					p.Q1593Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4779A	10						.						140.0	126.0	131.0					10																	76789361		2203	4300	6503	76459367	SO:0001819	synonymous_variant	23522	exon18			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.4779G>A	10.37:g.76789361G>A		Somatic		Capture	SOLID	Phase_I	76459367	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Silent	SNP	ENST00000287239.4	37	CCDS7345.1																																																																																				KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
SEC23IP	11196	hgsc.bcm.edu	37	10	121663616	121663616	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr10:121663616G>A	ENST00000369075.3	+	4	1000	c.928G>A	c.(928-930)Gtg>Atg	p.V310M	SEC23IP_ENST00000543134.1_Missense_Mutation_p.V99M	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	310	Interaction with SEC23A.				acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.V310M(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		TCCGGAGAGCGTGGTTCTTGG	0.493																																					p.V310M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G928A	10						.						108.0	99.0	102.0					10																	121663616		2203	4300	6503	121653606	SO:0001583	missense	11196	exon4			AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.928G>A	10.37:g.121663616G>A	ENSP00000358071:p.Val310Met	Somatic		Capture	SOLID	Phase_I	121653606	NM_007190	D3DRD2|Q8IXH5|Q9BUK5	Missense_Mutation	SNP	ENST00000369075.3	37	CCDS7618.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.3|24.3	4.518354|4.518354	0.85495|0.85495	.|.	.|.	ENSG00000107651|ENSG00000107651	ENST00000442952|ENST00000369075;ENST00000543134;ENST00000446561	.|T;T;T	.|0.48201	.|1.31;1.37;0.82	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.72463|0.72463	0.3463|0.3463	M|M	0.86178|0.86178	2.8|2.8	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.68192	.|0.956;0.945	T|T	0.74688|0.74688	-0.3581|-0.3581	5|10	.|0.48119	.|T	.|0.1	-16.5517|-16.5517	19.3947|19.3947	0.94603|0.94603	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|99;310	.|F5H0L8;Q9Y6Y8	.|.;S23IP_HUMAN	H|M	75|310;99;44	.|ENSP00000358071:V310M;ENSP00000438773:V99M;ENSP00000396906:V44M	.|ENSP00000358071:V310M	R|V	+|+	2|1	0|0	SEC23IP|SEC23IP	121653606|121653606	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.885000|0.885000	0.51271|0.51271	9.254000|9.254000	0.95512|0.95512	2.644000|2.644000	0.89710|0.89710	0.563000|0.563000	0.77884|0.77884	CGT|GTG		SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050688.1		
APC	324	hgsc.bcm.edu	37	5	112174544	112174544	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr5:112174544A>T	ENST00000457016.1	+	16	3633	c.3253A>T	c.(3253-3255)Aaa>Taa	p.K1085*	APC_ENST00000508376.2_Nonsense_Mutation_p.K1085*|APC_ENST00000257430.4_Nonsense_Mutation_p.K1085*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1085	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.K1085fs*34(1)|p.K1085*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CACTGATGATAAACACCTCAA	0.393		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.K1067X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	3	Substitution - Nonsense(1)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(2)|skin(1)	c.A3199T	5	GRCh37	CI012706|CI972533	APC	I		.						83.0	79.0	80.0					5																	112174544		2202	4300	6502	112202443	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3253A>T	5.37:g.112174544A>T	ENSP00000413133:p.Lys1085*	Somatic		Capture	SOLID	Phase_I	112202443	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	A	38	7.244952	0.98161	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.8674	15.4753	0.75474	1.0:0.0:0.0:0.0	.	.	.	.	X	1085;1067;1085;1085;1085	.	ENSP00000257430:K1085X	K	+	1	0	APC	112202443	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	5.708000	0.68377	2.146000	0.66826	0.533000	0.62120	AAA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHGC5	56097	hgsc.bcm.edu	37	5	140869933	140869933	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr5:140869933G>C	ENST00000252087.1	+	1	1126	c.1126G>C	c.(1126-1128)Gac>Cac	p.D376H	PCDHGA11_ENST00000518882.1_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	376	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D376H(2)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAATGTGCGAGACCGGGACTC	0.517																																					p.D376H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1126C	5						.						135.0	137.0	136.0					5																	140869933		2203	4300	6503	140850117	SO:0001583	missense	56097	exon1			AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.1126G>C	5.37:g.140869933G>C	ENSP00000252087:p.Asp376His	Somatic		Capture	SOLID	Phase_I	140850117	NM_018929	Q9Y5C2	Missense_Mutation	SNP	ENST00000252087.1	37	CCDS4263.1	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711854	0.68730	.	.	ENSG00000240764	ENST00000252087	D	0.83163	-1.69	5.56	5.56	0.83823	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000011	D	0.95680	0.8595	H	0.99487	4.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97253	0.9899	10	0.87932	D	0	.	19.3074	0.94169	0.0:0.0:1.0:0.0	.	376;376	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	H	376	ENSP00000252087:D376H	ENSP00000252087:D376H	D	+	1	0	PCDHGC5	140850117	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.610000	0.98337	2.890000	0.99128	0.655000	0.94253	GAC		PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929	
ZNF366	167465	hgsc.bcm.edu	37	5	71757093	71757093	+	Silent	SNP	C	C	T			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr5:71757093C>T	ENST00000318442.5	-	2	721	c.231G>A	c.(229-231)agG>agA	p.R77R		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	77					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)	p.R77R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		TCTTCCGTTTCCTAGACCCTG	0.572																																					p.R77R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G231A	5						.						168.0	176.0	173.0					5																	71757093		2203	4300	6503	71792849	SO:0001819	synonymous_variant	167465	exon2			AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.231G>A	5.37:g.71757093C>T		Somatic		Capture	SOLID	Phase_I	71792849	NM_152625	Q5HYI9|Q7RTV4	Silent	SNP	ENST00000318442.5	37	CCDS4015.1																																																																																				ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3		
FAT2	2196	hgsc.bcm.edu	37	5	150925224	150925224	+	Silent	SNP	G	G	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr5:150925224G>A	ENST00000261800.5	-	9	5476	c.5464C>T	c.(5464-5466)Cta>Tta	p.L1822L		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1822	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L1822L(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACAATGGTTAGGGTTCCCATG	0.438																																					p.L1822L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5464T	5						.						55.0	57.0	56.0					5																	150925224		2203	4300	6503	150905417	SO:0001819	synonymous_variant	2196	exon9			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.5464C>T	5.37:g.150925224G>A		Somatic		Capture	SOLID	Phase_I	150905417	NM_001447	O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	CCDS4317.1																																																																																				FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
TBC1D9B	23061	hgsc.bcm.edu	37	5	179302062	179302062	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-A008-01A-01W-A005-10	TCGA-AG-A008-10A-01W-A005-10	g.chr5:179302062G>A	ENST00000356834.3	-	12	2063	c.2026C>T	c.(2026-2028)Ctc>Ttc	p.L676F	TBC1D9B_ENST00000355235.3_Missense_Mutation_p.L676F	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	676	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.L676F(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATGACGCTGAGGAAGAGGGTC	0.607																																					p.L676F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2026T	5						.						103.0	94.0	97.0					5																	179302062		2203	4300	6503	179234668	SO:0001583	missense	23061	exon12			AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.2026C>T	5.37:g.179302062G>A	ENSP00000349291:p.Leu676Phe	Somatic		Capture	SOLID	Phase_I	179234668	NM_198868	D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Missense_Mutation	SNP	ENST00000356834.3	37	CCDS43408.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.364011	0.82353	.	.	ENSG00000197226	ENST00000356834;ENST00000355235	T;T	0.12672	2.66;2.66	5.29	5.29	0.74685	Rab-GAP/TBC domain (4);	0.079970	0.51477	D	0.000083	T	0.35248	0.0925	M	0.70787	2.145	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.03555	-1.1025	10	0.56958	D	0.05	-31.8058	12.31	0.54924	0.0776:0.0:0.9224:0.0	.	676;676;676	A1L3A9;Q66K14-2;Q66K14	.;.;TBC9B_HUMAN	F	676	ENSP00000349291:L676F;ENSP00000347375:L676F	ENSP00000347375:L676F	L	-	1	0	TBC1D9B	179234668	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.690000	0.74567	2.469000	0.83416	0.491000	0.48974	CTC		TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253501.3	NM_015043	
