#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
MEGF6	1953	broad.mit.edu	37	1	3512006	3512006	+	Missense_Mutation	SNP	A	A	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:3512006A>T	ENST00000356575.4	-	3	498	c.272T>A	c.(271-273)gTc>gAc	p.V91D		NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	91	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		CATGTAGTAGACGGTTCTAGA	0.617																																					Ovarian(73;978 3658)	uc001akl.2		NA																	0				large_intestine(1)	1						c.(271-273)GTC>GAC		EGF-like-domain, multiple 3 precursor							37.0	43.0	41.0					1																	3512006		2032	4188	6220	SO:0001583	missense	1953					extracellular region	calcium ion binding	g.chr1:3512006A>T	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.272T>A	1.37:g.3512006A>T	ENSP00000348982:p.Val91Asp		Somatic					p.V91D	NM_001409	NP_001400	WXS	Illumina HiSeq	Unspecified	O75095	MEGF6_HUMAN		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)	3	499	-	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)	91			EMI.		Q4AC86|Q5VV39	Missense_Mutation	SNP	ENST00000356575.4	37	c.272T>A	CCDS41237.1	.	.	.	.	.	.	.	.	.	.	a	8.971	0.973059	0.18736	.	.	ENSG00000162591	ENST00000356575	D	0.85629	-2.01	3.92	2.73	0.32206	EMI domain (1);	0.508797	0.16981	U	0.191709	T	0.79759	0.4501	L	0.53249	1.67	0.46317	D	0.998987	B	0.23735	0.09	B	0.23419	0.046	T	0.73579	-0.3938	10	0.51188	T	0.08	-4.8941	6.7191	0.23321	0.7735:0.0:0.0:0.2265	.	91	O75095	MEGF6_HUMAN	D	91	ENSP00000348982:V91D	ENSP00000348982:V91D	V	-	2	0	MEGF6	3501866	0.009000	0.17119	0.631000	0.29282	0.181000	0.23173	1.441000	0.35035	0.603000	0.29913	0.398000	0.26397	GTC		0.617	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	NM_001409		23	49	0	0	0	0	23	49				
VPS13D	55187	broad.mit.edu	37	1	12557603	12557603	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:12557603G>C	ENST00000358136.3	+	68	12842	c.12712G>C	c.(12712-12714)Ggg>Cgg	p.G4238R	VPS13D_ENST00000471923.1_5'UTR|VPS13D_ENST00000543710.1_Missense_Mutation_p.G42R|VPS13D_ENST00000496628.1_3'UTR|VPS13D_ENST00000543766.1_Missense_Mutation_p.G236R|VPS13D_ENST00000356315.4_Missense_Mutation_p.G4213R	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GGGGCCCCAGGGGCTGCTTCC	0.517																																						uc001atv.2		NA																	0				ovary(4)|pancreas(1)	5						c.(12712-12714)GGG>CGG		vacuolar protein sorting 13D isoform 1							70.0	71.0	71.0					1																	12557603		2203	4300	6503	SO:0001583	missense	55187				protein localization			g.chr1:12557603G>C	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.12712G>C	1.37:g.12557603G>C	ENSP00000350854:p.Gly4238Arg		Somatic				VPS13D_uc001atw.2_Missense_Mutation_p.G4213R|VPS13D_uc001atx.2_Missense_Mutation_p.G3425R|VPS13D_uc009vnl.2_RNA|VPS13D_uc010obd.1_Missense_Mutation_p.G236R	p.G4238R	NM_015378	NP_056193	WXS	Illumina HiSeq	Unspecified	Q5THJ4	VP13D_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)	68	12853	+	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	4237						Missense_Mutation	SNP	ENST00000358136.3	37	c.12712G>C	CCDS30588.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.495716|5.495716	0.96355|0.96355	.|.	.|.	ENSG00000048707|ENSG00000048707	ENST00000356315;ENST00000358136;ENST00000543766;ENST00000543710|ENST00000011700	T;T;T|.	0.00717|.	5.79;5.79;5.79|.	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	0.090231|.	0.85682|.	D|.	0.000000|.	T|T	0.73513|0.73513	0.3596|0.3596	L|L	0.58510|0.58510	1.815|1.815	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;0.999;0.999|.	D;D;D|.	0.77004|.	0.989;0.973;0.941|.	T|T	0.68610|0.68610	-0.5363|-0.5363	10|5	0.54805|.	T|.	0.06|.	.|.	19.545|19.545	0.95291|0.95291	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	236;4213;4237|.	F5GX56;Q5THJ4-2;Q5THJ4|.	.;.;VP13D_HUMAN|.	R|S	4213;4238;236;42|3059	ENSP00000348666:G4213R;ENSP00000350854:G4238R;ENSP00000441122:G236R|.	ENSP00000348666:G4213R|.	G|R	+|+	1|3	0|2	VPS13D|VPS13D	12480190|12480190	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	9.161000|9.161000	0.94739|0.94739	2.861000|2.861000	0.98227|0.98227	0.655000|0.655000	0.94253|0.94253	GGG|AGG		0.517	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378		42	84	0	0	0	0	42	84				
CELA2A	63036	broad.mit.edu	37	1	15788127	15788127	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:15788127G>T	ENST00000359621.4	+	3	226	c.201G>T	c.(199-201)tgG>tgT	p.W67C		NM_033440.2	NP_254275.1	P08217	CEL2A_HUMAN	chymotrypsin-like elastase family, member 2A	67	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|keratohyalin granule (GO:0036457)	serine hydrolase activity (GO:0017171)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(2)|prostate(1)	16						CCAACAGCTGGGTCCTGACGG	0.607																																						uc001awk.2		NA																	0				ovary(2)	2						c.(199-201)TGG>TGT		elastase 2A preproprotein							118.0	102.0	107.0					1																	15788127		2203	4300	6503	SO:0001583	missense	63036				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr1:15788127G>T		CCDS157.1	1p36.21	2009-07-09			ENSG00000142615	ENSG00000142615	3.4.21.71		24609	protein-coding gene	gene with protein product	"""elastase 2A"""	609443				3646943, 2834346	Standard	NM_033440		Approved	ELA2A	uc001awk.3	P08217	OTTHUMG00000002258	ENST00000359621.4:c.201G>T	1.37:g.15788127G>T	ENSP00000352639:p.Trp67Cys		Somatic					p.W67C	NM_033440	NP_254275	WXS	Illumina HiSeq	Unspecified	P08217	CEL2A_HUMAN			3	227	+			67			Peptidase S1.		B2R5I4|Q14243	Missense_Mutation	SNP	ENST00000359621.4	37	c.201G>T	CCDS157.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.235097	0.39498	.	.	ENSG00000142615	ENST00000375924;ENST00000359621	D	0.94537	-3.45	4.26	4.26	0.50523	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.52532	U	0.000062	D	0.97592	0.9211	H	0.94698	3.57	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97749	1.0213	10	0.87932	D	0	.	9.2216	0.37379	0.1036:0.0:0.8964:0.0	.	67	P08217	CEL2A_HUMAN	C	67	ENSP00000352639:W67C	ENSP00000352639:W67C	W	+	3	0	CELA2A	15660714	1.000000	0.71417	0.922000	0.36590	0.228000	0.25075	7.625000	0.83145	1.927000	0.55829	0.289000	0.19496	TGG		0.607	CELA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006445.1	NM_033440		51	100	1	0	4.26e-23	5.75e-23	51	100				
HSPG2	3339	broad.mit.edu	37	1	22168731	22168731	+	Splice_Site	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:22168731C>A	ENST00000374695.3	-	68	9132		c.e68+1			NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2						angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.?(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GCCATACTCACGGTAGGAAGA	0.652																																						uc001bfj.2		NA																	1	Unknown(1)		kidney(1)	ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9						c.e68+1		heparan sulfate proteoglycan 2 precursor	Becaplermin(DB00102)|Palifermin(DB00039)						54.0	52.0	53.0					1																	22168731		2203	4300	6503	SO:0001630	splice_region_variant	3339				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding	g.chr1:22168731C>A	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.9052+1G>T	1.37:g.22168731C>A			Somatic				HSPG2_uc009vqd.2_Splice_Site_p.R3019_splice	p.R3018_splice	NM_005529	NP_005520	WXS	Illumina HiSeq	Unspecified	P98160	PGBM_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	68	9092	-		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)						Q16287|Q5SZI3|Q9H3V5	Splice_Site	SNP	ENST00000374695.3	37	c.9052_splice	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	14.39	2.520096	0.44866	.	.	ENSG00000142798	ENST00000374695	.	.	.	4.95	3.97	0.46021	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4558	0.61197	0.0:0.8417:0.1583:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HSPG2	22041318	1.000000	0.71417	1.000000	0.80357	0.523000	0.34469	4.215000	0.58534	2.276000	0.75962	0.462000	0.41574	.		0.652	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	Intron	25	37	1	0	2.4e-15	3.03e-15	25	37				
IQCC	55721	broad.mit.edu	37	1	32672224	32672224	+	Missense_Mutation	SNP	A	A	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:32672224A>C	ENST00000291358.6	+	3	322	c.301A>C	c.(301-303)Atg>Ctg	p.M101L	DCDC2B_ENST00000409358.1_5'Flank|RP4-622L5.7_ENST00000421616.1_RNA|RP4-622L5.7_ENST00000373604.4_RNA|IQCC_ENST00000537469.1_Missense_Mutation_p.M181L	NM_018134.2	NP_060604.2	Q4KMZ1	IQCC_HUMAN	IQ motif containing C	101										endometrium(4)|large_intestine(1)|lung(3)|ovary(4)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CTGGGAGGAGATGGTGCTGAA	0.547																																						uc001bum.2		NA																	0				ovary(4)	4						c.(301-303)ATG>CTG		IQ motif containing C isoform 2							88.0	92.0	91.0					1																	32672224		2203	4300	6503	SO:0001583	missense	55721							g.chr1:32672224A>C	AL049795	CCDS355.1, CCDS53293.1	1p36.11-p34.2	2008-02-05			ENSG00000160051	ENSG00000160051			25545	protein-coding gene	gene with protein product							Standard	NM_018134		Approved	FLJ10547	uc001bum.2	Q4KMZ1	OTTHUMG00000005739	ENST00000291358.6:c.301A>C	1.37:g.32672224A>C	ENSP00000291358:p.Met101Leu		Somatic				IQCC_uc009vua.2_Missense_Mutation_p.M181L|IQCC_uc010ogz.1_Missense_Mutation_p.M1L|DCDC2B_uc001bun.2_5'Flank	p.M101L	NM_018134	NP_060604	WXS	Illumina HiSeq	Unspecified	Q4KMZ1	IQCC_HUMAN			3	348	+		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)	101					F5H7T8|Q4KMS3|Q4KMZ5|Q53FL2|Q5TFJ8|Q9NVS3	Missense_Mutation	SNP	ENST00000291358.6	37	c.301A>C	CCDS355.1	.	.	.	.	.	.	.	.	.	.	A	3.469	-0.108264	0.06924	.	.	ENSG00000160051	ENST00000537469;ENST00000291358	T;T	0.08193	3.12;3.12	4.09	-2.28	0.06826	.	0.722332	0.12818	N	0.436660	T	0.06508	0.0167	L	0.36672	1.1	0.09310	N	1	B;B	0.25441	0.126;0.126	B;B	0.28553	0.091;0.054	T	0.39683	-0.9602	10	0.27082	T	0.32	-0.0405	8.9101	0.35548	0.4581:0.0:0.5419:0.0	.	181;101	F5H7T8;Q4KMZ1	.;IQCC_HUMAN	L	181;101	ENSP00000442291:M181L;ENSP00000291358:M101L	ENSP00000291358:M101L	M	+	1	0	IQCC	32444811	0.006000	0.16342	0.011000	0.14972	0.143000	0.21401	0.334000	0.19787	-0.297000	0.08934	-0.912000	0.02778	ATG		0.547	IQCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015731.3	NM_018134		56	77	0	0	0	0	56	77				
CSMD2	114784	broad.mit.edu	37	1	34180272	34180272	+	Silent	SNP	G	G	A	rs145807635		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:34180272G>A	ENST00000373381.4	-	21	3497	c.3321C>T	c.(3319-3321)ccC>ccT	p.P1107P		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1067	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GACGGTACCCGGGGAAGCAGG	0.662																																						uc001bxn.1		NA																	0				ovary(6)|skin(5)|pancreas(1)	12						c.(3199-3201)CCC>CCT		CUB and Sushi multiple domains 2		G		0,4406		0,0,2203	86.0	95.0	92.0		3201	1.6	1.0	1	dbSNP_134	92	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	CSMD2	NM_052896.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		1067/3488	34180272	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34180272G>A	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.3321C>T	1.37:g.34180272G>A			Somatic				CSMD2_uc001bxm.1_Silent_p.P1107P	p.P1067P	NM_052896	NP_443128	WXS	Illumina HiSeq	Unspecified	Q7Z408	CSMD2_HUMAN			21	3230	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	1067			Sushi 6.|Extracellular (Potential).		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	37	c.3201C>T																																																																																					0.662	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896		96	122	0	0	0	0	96	122				
TIE1	7075	broad.mit.edu	37	1	43774729	43774729	+	Missense_Mutation	SNP	G	G	C	rs200472468		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:43774729G>C	ENST00000372476.3	+	8	1194	c.1115G>C	c.(1114-1116)tGt>tCt	p.C372S	TIE1_ENST00000433781.2_Missense_Mutation_p.C17S|TIE1_ENST00000441333.2_Intron	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	372	Ig-like C2-type 2.				angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CGGATCAACTGTGCAGCTGCA	0.607																																						uc001ciu.2		NA																	0				lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7						c.(1114-1116)TGT>TCT		tyrosine kinase with immunoglobulin-like and							78.0	72.0	74.0					1																	43774729		2203	4300	6503	SO:0001583	missense	7075				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:43774729G>C	BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.1115G>C	1.37:g.43774729G>C	ENSP00000361554:p.Cys372Ser		Somatic				TIE1_uc010okd.1_Missense_Mutation_p.C372S|TIE1_uc010oke.1_Missense_Mutation_p.C327S|TIE1_uc009vwq.2_Missense_Mutation_p.C328S|TIE1_uc010okf.1_Missense_Mutation_p.C17S|TIE1_uc010okg.1_Missense_Mutation_p.C17S|TIE1_uc010okc.1_Intron	p.C372S	NM_005424	NP_005415	WXS	Illumina HiSeq	Unspecified	P35590	TIE1_HUMAN			8	1194	+	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)	372			Ig-like C2-type 2.|Extracellular (Potential).		B5A949|B5A950	Missense_Mutation	SNP	ENST00000372476.3	37	c.1115G>C	CCDS482.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.974107	0.92919	.	.	ENSG00000066056	ENST00000372476;ENST00000433781	D;T	0.94537	-3.45;-0.01	5.13	5.13	0.70059	Immunoglobulin-like fold (1);	0.000000	0.43747	D	0.000521	D	0.97219	0.9091	M	0.78049	2.395	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0	D;D;D;D;D	0.91635	0.996;0.998;0.998;0.994;0.999	D	0.97880	1.0291	10	0.87932	D	0	.	18.6065	0.91268	0.0:0.0:1.0:0.0	.	17;327;372;17;372	E9PG63;B4DTW8;B5A952;B4DKW0;P35590	.;.;.;.;TIE1_HUMAN	S	372;17	ENSP00000361554:C372S;ENSP00000411728:C17S	ENSP00000361554:C372S	C	+	2	0	TIE1	43547316	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	9.430000	0.97488	2.396000	0.81511	0.563000	0.77884	TGT		0.607	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019011.1	NM_005424		37	75	0	0	0	0	37	75				
EIF2B3	8891	broad.mit.edu	37	1	45407189	45407189	+	Missense_Mutation	SNP	T	T	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:45407189T>G	ENST00000360403.2	-	4	569	c.443A>C	c.(442-444)aAa>aCa	p.K148T	EIF2B3_ENST00000480675.1_5'UTR|EIF2B3_ENST00000372183.3_Missense_Mutation_p.K148T	NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa	148					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					TGCTTTTTTTTTCCCCTTTTG	0.368																																					Colon(26;357 658 2581 11857 12657)	uc001cmt.1		NA																	0				ovary(1)	1						c.(442-444)AAA>ACA		eukaryotic translation initiation factor 2B,							152.0	142.0	145.0					1																	45407189		2203	4300	6503	SO:0001583	missense	8891				negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity	g.chr1:45407189T>G	AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585	ENST00000360403.2:c.443A>C	1.37:g.45407189T>G	ENSP00000353575:p.Lys148Thr		Somatic				EIF2B3_uc001cmu.1_Missense_Mutation_p.K148T|EIF2B3_uc001cmv.1_Missense_Mutation_p.K148T|EIF2B3_uc001cmw.2_Missense_Mutation_p.K148T	p.K148T	NM_020365	NP_065098	WXS	Illumina HiSeq	Unspecified	Q9NR50	EI2BG_HUMAN			4	570	-	Acute lymphoblastic leukemia(166;0.155)		148					B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Missense_Mutation	SNP	ENST00000360403.2	37	c.443A>C	CCDS517.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.368376	0.82463	.	.	ENSG00000070785	ENST00000360403;ENST00000372183;ENST00000372182	D;D;D	0.93366	-3.21;-2.71;-1.84	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.96537	0.8870	M	0.84683	2.71	0.80722	D	1	D;D;P	0.76494	0.999;0.984;0.946	D;P;P	0.72075	0.976;0.861;0.717	D	0.95753	0.8793	10	0.25106	T	0.35	-7.2339	15.4686	0.75422	0.0:0.0:0.0:1.0	.	148;148;148	Q9NR50-2;Q9NR50-3;Q9NR50	.;.;EI2BG_HUMAN	T	148	ENSP00000353575:K148T;ENSP00000361257:K148T;ENSP00000361256:K148T	ENSP00000353575:K148T	K	-	2	0	EIF2B3	45179776	1.000000	0.71417	0.999000	0.59377	0.813000	0.45954	5.715000	0.68430	2.063000	0.61619	0.482000	0.46254	AAA		0.368	EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023724.1	NM_020365		78	110	0	0	0	0	78	110				
ZFYVE9	9372	broad.mit.edu	37	1	52705124	52705124	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:52705124G>T	ENST00000371591.1	+	3	2166	c.2035G>T	c.(2035-2037)Gga>Tga	p.G679*	ZFYVE9_ENST00000357206.2_Nonsense_Mutation_p.G679*|ZFYVE9_ENST00000287727.3_Nonsense_Mutation_p.G679*	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	679					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						TGGTCAGTTTGGAATTTCTGC	0.478																																						uc001cto.2		NA																	0				ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						c.(2035-2037)GGA>TGA		zinc finger, FYVE domain containing 9 isoform 3							97.0	93.0	94.0					1																	52705124		2203	4299	6502	SO:0001587	stop_gained	9372				endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity	g.chr1:52705124G>T	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.2035G>T	1.37:g.52705124G>T	ENSP00000360647:p.Gly679*		Somatic				ZFYVE9_uc001ctn.2_Nonsense_Mutation_p.G679*|ZFYVE9_uc001ctp.2_Nonsense_Mutation_p.G679*	p.G679*	NM_004799	NP_004790	WXS	Illumina HiSeq	Unspecified	O95405	ZFYV9_HUMAN			4	2207	+			679					Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Nonsense_Mutation	SNP	ENST00000371591.1	37	c.2035G>T	CCDS563.1	.	.	.	.	.	.	.	.	.	.	G	38	7.029913	0.98013	.	.	ENSG00000157077	ENST00000357206;ENST00000361625;ENST00000287727;ENST00000371591	.	.	.	4.81	4.81	0.61882	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	18.4513	0.90704	0.0:0.0:1.0:0.0	.	.	.	.	X	679	.	ENSP00000287727:G679X	G	+	1	0	ZFYVE9	52477712	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.194000	0.94962	2.668000	0.90789	0.462000	0.41574	GGA		0.478	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324		78	123	1	0	1.13e-35	1.62e-35	78	123				
C1orf168	199920	broad.mit.edu	37	1	57258099	57258099	+	Silent	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:57258099T>C	ENST00000343433.6	-	2	467	c.387A>G	c.(385-387)aaA>aaG	p.K129K	C1orf168_ENST00000484327.1_5'UTR	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168	129										NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						CCACCATTACTTTTTCCTTAG	0.418																																						uc001cym.3		NA																	0				ovary(3)|skin(2)	5						c.(385-387)AAA>AAG		hypothetical protein LOC199920							144.0	143.0	143.0					1																	57258099		2203	4300	6503	SO:0001819	synonymous_variant	199920							g.chr1:57258099T>C	BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.387A>G	1.37:g.57258099T>C			Somatic				C1orf168_uc009vzu.1_RNA|C1orf168_uc009vzv.1_Silent_p.K129K	p.K129K	NM_001004303	NP_001004303	WXS	Illumina HiSeq	Unspecified	Q5VWT5	CA168_HUMAN			2	793	-			129					Q63HM3|Q6ZUY6	Silent	SNP	ENST00000343433.6	37	c.387A>G	CCDS30729.1																																																																																				0.418	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022751.2	NM_001004303		116	176	0	0	0	0	116	176				
LRRIQ3	127255	broad.mit.edu	37	1	74507186	74507186	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:74507186C>A	ENST00000395089.1	-	6	1428	c.1429G>T	c.(1429-1431)Gag>Tag	p.E477*	LRRIQ3_ENST00000354431.4_Nonsense_Mutation_p.E477*			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	477										NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						TGAATTGTCTCTTTATTTTCT	0.338																																						uc001dfy.3		NA																	0				ovary(2)	2						c.(1429-1431)GAG>TAG		leucine-rich repeats and IQ motif containing 3							136.0	127.0	130.0					1																	74507186		1820	4082	5902	SO:0001587	stop_gained	127255							g.chr1:74507186C>A	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.1429G>T	1.37:g.74507186C>A	ENSP00000378524:p.Glu477*		Somatic				LRRIQ3_uc001dfz.3_Intron	p.E477*	NM_001105659	NP_001099129	WXS	Illumina HiSeq	Unspecified	A6PVS8	LRIQ3_HUMAN			7	1621	-			477					A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Nonsense_Mutation	SNP	ENST00000395089.1	37	c.1429G>T	CCDS41350.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.414684	0.62511	.	.	ENSG00000162620	ENST00000395089;ENST00000354431	.	.	.	5.77	-3.88	0.04205	.	0.783810	0.11170	N	0.592089	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	6.7979	0.23734	0.1348:0.2673:0.0:0.598	.	.	.	.	X	477	.	ENSP00000346414:E477X	E	-	1	0	LRRIQ3	74279774	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.674000	0.05233	-0.526000	0.06383	0.585000	0.79938	GAG		0.338	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258		84	136	1	0	7.63e-38	1.1e-37	84	136				
ERICH3	127254	broad.mit.edu	37	1	75078365	75078365	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:75078365C>A	ENST00000326665.5	-	9	1347	c.1129G>T	c.(1129-1131)Gga>Tga	p.G377*	C1orf173_ENST00000420661.2_Nonsense_Mutation_p.G180*|RP4-612J11.1_ENST00000416017.1_RNA	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		377										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CGTTTGCCTCCAAGCCTGGAA	0.458																																						uc001dgg.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(1129-1131)GGA>TGA		hypothetical protein LOC127254							124.0	113.0	116.0					1																	75078365		2203	4300	6503	SO:0001587	stop_gained	127254							g.chr1:75078365C>A																												ENST00000326665.5:c.1129G>T	1.37:g.75078365C>A	ENSP00000322609:p.Gly377*		Somatic				uc001dgh.2_Intron|C1orf173_uc001dgi.3_Nonsense_Mutation_p.G171*	p.G377*	NM_001002912	NP_001002912	WXS	Illumina HiSeq	Unspecified	Q5RHP9	CA173_HUMAN			9	1348	-			377					Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Nonsense_Mutation	SNP	ENST00000326665.5	37	c.1129G>T	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	C	36	5.934984	0.97122	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-28.6055	19.649	0.95793	0.0:1.0:0.0:0.0	.	.	.	.	X	377;180	.	ENSP00000322609:G377X	G	-	1	0	C1orf173	74850953	0.993000	0.37304	0.997000	0.53966	0.953000	0.61014	3.000000	0.49481	2.808000	0.96608	0.655000	0.94253	GGA		0.458	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			28	53	1	0	3.73e-12	4.56e-12	28	53				
ACADM	34	broad.mit.edu	37	1	76211507	76211507	+	Missense_Mutation	SNP	C	C	T	rs373715782		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:76211507C>T	ENST00000370841.4	+	8	1053	c.616C>T	c.(616-618)Cgt>Tgt	p.R206C	ACADM_ENST00000541113.1_Missense_Mutation_p.R170C|ACADM_ENST00000420607.2_Missense_Mutation_p.R210C|ACADM_ENST00000543667.1_Missense_Mutation_p.R17C|ACADM_ENST00000370834.5_Missense_Mutation_p.R239C	NM_000016.4|NM_001127328.1	NP_000007.1|NP_001120800.1	P11310	ACADM_HUMAN	acyl-CoA dehydrogenase, C-4 to C-12 straight chain	206			R -> L (in ACADMD). {ECO:0000269|PubMed:10767181}.		cardiac muscle cell differentiation (GO:0055007)|carnitine biosynthetic process (GO:0045329)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|glycogen biosynthetic process (GO:0005978)|liver development (GO:0001889)|medium-chain fatty acid catabolic process (GO:0051793)|medium-chain fatty acid metabolic process (GO:0051791)|oxidation-reduction process (GO:0055114)|post-embryonic development (GO:0009791)|regulation of gluconeogenesis (GO:0006111)|response to cold (GO:0009409)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|identical protein binding (GO:0042802)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)			breast(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	18					Flavin adenine dinucleotide(DB03147)	TTTATTGGCACGTTCTGATCC	0.383																																						uc001dgw.3		NA																	0				breast(2)|ovary(1)|skin(1)	4	GRCh37	CM051829	ACADM	M		c.(616-618)CGT>TGT		medium-chain acyl-CoA dehydrogenase isoform a		C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	102.0	97.0	99.0		616,628	5.8	1.0	1		99	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ACADM	NM_000016.4,NM_001127328.1	180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	206/422,210/426	76211507	1,13005	2203	4300	6503	SO:0001583	missense	34				carnitine biosynthetic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|medium-chain fatty acid catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|identical protein binding|medium-chain-acyl-CoA dehydrogenase activity	g.chr1:76211507C>T	M16827	CCDS668.1, CCDS44165.1, CCDS65562.1, CCDS72807.1	1p31	2014-09-17	2010-04-30		ENSG00000117054	ENSG00000117054	1.3.99.3		89	protein-coding gene	gene with protein product		607008	"""acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain"""			3035565	Standard	NM_000016		Approved	MCAD, MCADH, ACAD1	uc009wbp.3	P11310	OTTHUMG00000009784	ENST00000370841.4:c.616C>T	1.37:g.76211507C>T	ENSP00000359878:p.Arg206Cys		Somatic				ACADM_uc010ord.1_Missense_Mutation_p.R120C|ACADM_uc009wbp.2_Missense_Mutation_p.R210C|ACADM_uc009wbr.2_Missense_Mutation_p.R239C|ACADM_uc010ore.1_Missense_Mutation_p.R170C|ACADM_uc010orf.1_Missense_Mutation_p.R17C|ACADM_uc001dgx.3_Missense_Mutation_p.R120C|ACADM_uc010org.1_Missense_Mutation_p.R76C|ACADM_uc009wbs.1_RNA	p.R206C	NM_000016	NP_000007	WXS	Illumina HiSeq	Unspecified	P11310	ACADM_HUMAN			8	1046	+			206		R -> L (in ACADMD).			Q5T4U4|Q9NYF1	Missense_Mutation	SNP	ENST00000370841.4	37	c.616C>T	CCDS668.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.482533	0.84747	0.0	1.16E-4	ENSG00000117054	ENST00000370841;ENST00000370834;ENST00000541113;ENST00000543667;ENST00000420607	D;D;D;D;D	0.99207	-4.23;-4.23;-4.23;-5.56;-4.23	5.83	5.83	0.93111	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (2);	0.000000	0.85682	D	0.000000	D	0.99548	0.9838	M	0.89534	3.04	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.71656	0.968;0.934;0.973;0.968;0.974	D	0.98683	1.0693	10	0.62326	D	0.03	.	19.7203	0.96139	0.0:1.0:0.0:0.0	.	170;120;239;210;206	B7Z9I1;B4DVE0;Q5T4U5;P11310-2;P11310	.;.;.;.;ACADM_HUMAN	C	206;239;170;17;210	ENSP00000359878:R206C;ENSP00000359871:R239C;ENSP00000442324:R170C;ENSP00000446176:R17C;ENSP00000409612:R210C	ENSP00000359871:R239C	R	+	1	0	ACADM	75984095	1.000000	0.71417	1.000000	0.80357	0.493000	0.33554	7.651000	0.83577	2.753000	0.94483	0.585000	0.79938	CGT		0.383	ACADM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026967.1			43	81	0	0	0	0	43	81				
MSH4	4438	broad.mit.edu	37	1	76365379	76365379	+	Silent	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:76365379G>T	ENST00000263187.3	+	19	2711	c.2607G>T	c.(2605-2607)acG>acT	p.T869T		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	869					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						CTCAAATTACGAGACAAATTT	0.279								Mismatch excision repair (MMR)																														uc001dhd.1		NA																	0				lung(3)|ovary(2)	5						c.(2605-2607)ACG>ACT	MMR	mutS homolog 4							76.0	76.0	76.0					1																	76365379		2203	4300	6503	SO:0001819	synonymous_variant	4438				chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding	g.chr1:76365379G>T	U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.2607G>T	1.37:g.76365379G>T			Somatic					p.T869T	NM_002440	NP_002431	WXS	Illumina HiSeq	Unspecified	O15457	MSH4_HUMAN			19	2648	+			869					Q5T4U6|Q8NEB3|Q9UNP8	Silent	SNP	ENST00000263187.3	37	c.2607G>T	CCDS670.1																																																																																				0.279	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1	NM_002440		49	57	1	0	2.43e-25	3.34e-25	49	57				
ST6GALNAC3	256435	broad.mit.edu	37	1	76877870	76877870	+	Missense_Mutation	SNP	A	A	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:76877870A>T	ENST00000328299.3	+	3	539	c.391A>T	c.(391-393)Acc>Tcc	p.T131S	ST6GALNAC3_ENST00000464140.1_3'UTR	NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3	131					glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						TGTGTCCCATACCAGCGTTCC	0.423																																						uc001dhh.2		NA																	0				ovary(3)|skin(2)	5						c.(391-393)ACC>TCC		sialyltransferase 7C isoform 1							130.0	124.0	126.0					1																	76877870		2203	4300	6503	SO:0001583	missense	256435				protein glycosylation	integral to Golgi membrane	sialyltransferase activity	g.chr1:76877870A>T		CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.391A>T	1.37:g.76877870A>T	ENSP00000329214:p.Thr131Ser		Somatic				ST6GALNAC3_uc001dhg.3_Missense_Mutation_p.T131S|ST6GALNAC3_uc010orh.1_Missense_Mutation_p.T66S	p.T131S	NM_152996	NP_694541	WXS	Illumina HiSeq	Unspecified	Q8NDV1	SIA7C_HUMAN			3	554	+			131			Lumenal (Potential).		Q6PCE0|Q6UX29|Q8N259	Missense_Mutation	SNP	ENST00000328299.3	37	c.391A>T	CCDS672.1	.	.	.	.	.	.	.	.	.	.	A	12.86	2.063819	0.36373	.	.	ENSG00000184005	ENST00000394994;ENST00000328299;ENST00000394993;ENST00000415813	T	0.26518	1.73	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.23014	0.0556	L	0.28649	0.875	0.80722	D	1	D;B;D	0.89917	1.0;0.384;0.999	D;B;D	0.91635	0.999;0.387;0.981	T	0.04635	-1.0937	10	0.07325	T	0.83	-17.4857	16.0034	0.80327	1.0:0.0:0.0:0.0	.	66;131;131	B4DM98;Q8NDV1;Q8NDV1-2	.;SIA7C_HUMAN;.	S	131;131;130;65	ENSP00000329214:T131S	ENSP00000329214:T131S	T	+	1	0	ST6GALNAC3	76650458	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.124000	0.77185	2.371000	0.80710	0.533000	0.62120	ACC		0.423	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026501.1	NM_152996		69	75	0	0	0	0	69	75				
DPYD	1806	broad.mit.edu	37	1	97658799	97658799	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:97658799G>A	ENST00000370192.3	-	20	2548	c.2448C>T	c.(2446-2448)tgC>tgT	p.C816C	DPYD-AS1_ENST00000422980.1_RNA	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	816					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	GAATGGCACTGCATACCTAGA	0.388																																						uc001drv.2		NA																	0				ovary(3)|skin(3)|breast(2)	8						c.(2446-2448)TGC>TGT		dihydropyrimidine dehydrogenase isoform 1	Capecitabine(DB01101)|Enfuvirtide(DB00109)						54.0	47.0	50.0					1																	97658799		2203	4300	6503	SO:0001819	synonymous_variant	1806				'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity	g.chr1:97658799G>A	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.2448C>T	1.37:g.97658799G>A			Somatic					p.C816C	NM_000110	NP_000101	WXS	Illumina HiSeq	Unspecified	Q12882	DPYD_HUMAN		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	20	2585	-		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)	816					A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Silent	SNP	ENST00000370192.3	37	c.2448C>T	CCDS30777.1																																																																																				0.388	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110		14	26	0	0	0	0	14	26				
VCAM1	7412	broad.mit.edu	37	1	101197026	101197026	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:101197026G>C	ENST00000294728.2	+	6	1578	c.1477G>C	c.(1477-1479)Gaa>Caa	p.E493Q	VCAM1_ENST00000347652.2_Missense_Mutation_p.E401Q|VCAM1_ENST00000370119.4_Missense_Mutation_p.E431Q|VCAM1_ENST00000370115.1_Intron	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	493	Ig-like C2-type 5.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	TGATGACATGGAATTCGAACC	0.373																																						uc001dti.2		NA																	0				central_nervous_system(1)	1						c.(1477-1479)GAA>CAA		vascular cell adhesion molecule 1 isoform a	Carvedilol(DB01136)						110.0	106.0	107.0					1																	101197026		2203	4300	6503	SO:0001583	missense	7412				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding	g.chr1:101197026G>C	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.1477G>C	1.37:g.101197026G>C	ENSP00000294728:p.Glu493Gln		Somatic				VCAM1_uc001dtj.2_Missense_Mutation_p.E401Q|VCAM1_uc010ouj.1_Missense_Mutation_p.E431Q	p.E493Q	NM_001078	NP_001069	WXS	Illumina HiSeq	Unspecified	P19320	VCAM1_HUMAN		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	6	1597	+		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)	493			Ig-like C2-type 5.|Extracellular (Potential).		A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	ENST00000294728.2	37	c.1477G>C	CCDS773.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310383	0.60414	.	.	ENSG00000162692	ENST00000370119;ENST00000347652;ENST00000294728	T;T;T	0.24723	1.84;1.84;1.84	5.42	5.42	0.78866	Immunoglobulin C2-set (1);Immunoglobulin-like fold (1);	0.650417	0.16748	N	0.201167	T	0.42517	0.1206	M	0.72118	2.19	0.80722	D	1	D;D;D	0.71674	0.994;0.998;0.99	D;D;D	0.69479	0.91;0.964;0.927	T	0.05289	-1.0894	10	0.38643	T	0.18	-11.9754	17.5785	0.87958	0.0:0.0:1.0:0.0	.	431;401;493	E9PDD1;P19320-2;P19320	.;.;VCAM1_HUMAN	Q	431;401;493	ENSP00000359137:E431Q;ENSP00000304611:E401Q;ENSP00000294728:E493Q	ENSP00000294728:E493Q	E	+	1	0	VCAM1	100969614	1.000000	0.71417	1.000000	0.80357	0.322000	0.28314	5.966000	0.70395	2.817000	0.96982	0.563000	0.77884	GAA		0.373	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078		37	70	0	0	0	0	37	70				
COL11A1	1301	broad.mit.edu	37	1	103431074	103431074	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:103431074G>T	ENST00000370096.3	-	38	3197	c.2885C>A	c.(2884-2886)cCt>cAt	p.P962H	COL11A1_ENST00000512756.1_Missense_Mutation_p.P846H|COL11A1_ENST00000353414.4_Missense_Mutation_p.P923H|COL11A1_ENST00000358392.2_Missense_Mutation_p.P974H	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	962	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TGGCCCAGGAGGGCCGGTCTT	0.388																																						uc001dul.2		NA																	0				ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(2884-2886)CCT>CAT		alpha 1 type XI collagen isoform A							95.0	109.0	104.0					1																	103431074		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103431074G>T	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2885C>A	1.37:g.103431074G>T	ENSP00000359114:p.Pro962His		Somatic				COL11A1_uc001duk.2_Missense_Mutation_p.P158H|COL11A1_uc001dum.2_Missense_Mutation_p.P974H|COL11A1_uc001dun.2_Missense_Mutation_p.P923H|COL11A1_uc009weh.2_Missense_Mutation_p.P846H	p.P962H	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	38	3203	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	962			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.2885C>A	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.054436	0.55218	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	5.45	4.54	0.55810	.	0.060652	0.64402	D	0.000002	T	0.54415	0.1857	M	0.72576	2.205	0.80722	D	1	D;D;D;D;D	0.65815	0.975;0.985;0.995;0.992;0.985	P;P;P;P;P	0.60473	0.62;0.789;0.875;0.754;0.789	T	0.60816	-0.7188	10	0.56958	D	0.05	.	14.1634	0.65461	0.0723:0.0:0.9277:0.0	.	846;923;974;962;182	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	H	962;974;923;182;846	ENSP00000359114:P962H;ENSP00000351163:P974H;ENSP00000302551:P923H;ENSP00000426533:P846H	ENSP00000302551:P923H	P	-	2	0	COL11A1	103203662	1.000000	0.71417	0.937000	0.37676	0.824000	0.46624	9.734000	0.98822	1.305000	0.44909	0.557000	0.71058	CCT		0.388	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		80	158	1	0	3.24e-39	4.7e-39	80	158				
SYPL2	284612	broad.mit.edu	37	1	110022063	110022063	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:110022063C>A	ENST00000369872.3	+	6	928	c.712C>A	c.(712-714)Ccg>Acg	p.P238T	SYPL2_ENST00000401021.3_Missense_Mutation_p.P174T	NM_001040709.1	NP_001035799.1	Q5VXT5	SYPL2_HUMAN	synaptophysin-like 2	238	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular calcium ion homeostasis (GO:0006874)|substantia nigra development (GO:0021762)	integral component of synaptic vesicle membrane (GO:0030285)	transporter activity (GO:0005215)			breast(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0436)|READ - Rectum adenocarcinoma(129;0.0698)|Epithelial(280;0.0808)|all cancers(265;0.0869)|LUSC - Lung squamous cell carcinoma(189;0.231)		CAAGGAGACCCCGTGGCATGG	0.577																																						uc001dxp.2		NA																	0				ovary(1)	1						c.(712-714)CCG>ACG		mitsugumin 29							108.0	117.0	114.0					1																	110022063		1974	4184	6158	SO:0001583	missense	284612					integral to membrane|synaptic vesicle	transporter activity	g.chr1:110022063C>A	AK131459	CCDS41365.1	1p13.3	2008-02-05			ENSG00000143028	ENSG00000143028			27638	protein-coding gene	gene with protein product	"""mitsugumin-29"""					12975309	Standard	NM_001040709		Approved	Mg29	uc001dxp.3	Q5VXT5	OTTHUMG00000010969	ENST00000369872.3:c.712C>A	1.37:g.110022063C>A	ENSP00000358888:p.Pro238Thr		Somatic				SYPL2_uc010ovk.1_Missense_Mutation_p.P174T	p.P238T	NM_001040709	NP_001035799	WXS	Illumina HiSeq	Unspecified	Q5VXT5	SYPL2_HUMAN		Colorectal(144;0.0129)|Lung(183;0.0436)|READ - Rectum adenocarcinoma(129;0.0698)|Epithelial(280;0.0808)|all cancers(265;0.0869)|LUSC - Lung squamous cell carcinoma(189;0.231)	6	1078	+		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)	238			Cytoplasmic (Potential).|MARVEL.		A8K0E8|A8KAL7|I0IT67|Q6ZMX1	Missense_Mutation	SNP	ENST00000369872.3	37	c.712C>A	CCDS41365.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.574539	0.45902	.	.	ENSG00000143028	ENST00000401021;ENST00000369872	T	0.30714	1.52	5.75	5.75	0.90469	Marvel (1);	0.101592	0.64402	D	0.000002	T	0.11324	0.0276	L	0.41906	1.305	0.27764	N	0.943719	P;P	0.34864	0.473;0.473	B;B	0.28553	0.091;0.091	T	0.08249	-1.0731	10	0.26408	T	0.33	.	13.666	0.62396	0.1547:0.8452:0.0:0.0	.	174;238	B4DYR7;Q5VXT5	.;SYPL2_HUMAN	T	174;238	ENSP00000358888:P238T	ENSP00000358888:P238T	P	+	1	0	SYPL2	109823586	0.001000	0.12720	1.000000	0.80357	0.998000	0.95712	0.411000	0.21115	2.717000	0.92951	0.655000	0.94253	CCG		0.577	SYPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030191.1	NM_001006603		37	85	1	0	9.46e-24	1.29e-23	37	85				
ADORA3	140	broad.mit.edu	37	1	112028408	112028408	+	Silent	SNP	T	T	G	rs145936359		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:112028408T>G	ENST00000369716.4	-	5	1060	c.927A>C	c.(925-927)gtA>gtC	p.V309V	ADORA3_ENST00000369717.4_Silent_p.V228V	NM_020683.6	NP_065734.5	P33765	AA3R_HUMAN	adenosine A3 receptor	0					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	AATGACTGATTACAGAGATGA	0.433																																						uc001ebf.2		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.(925-927)GTA>GTC		adenosine A3 receptor isoform 1	Adenosine(DB00640)|Aminophylline(DB01223)						165.0	152.0	156.0					1																	112028408		2203	4300	6503	SO:0001819	synonymous_variant	140				activation of adenylate cyclase activity|inflammatory response|regulation of heart contraction	integral to plasma membrane	adenosine receptor activity, G-protein coupled	g.chr1:112028408T>G	BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000369716.4:c.927A>C	1.37:g.112028408T>G			Somatic				ADORA3_uc001ebg.3_Silent_p.V228V	p.V309V	NM_020683	NP_065734	WXS	Illumina HiSeq	Unspecified	P33765	AA3R_HUMAN		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	5	1694	-		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)	Error:Variant_position_missing_in_P33765_after_alignment					A2A3P4|Q6UWU0|Q9BYZ1	Silent	SNP	ENST00000369716.4	37	c.927A>C	CCDS838.1	.	.	.	.	.	.	.	.	.	.	T	4.251	0.045655	0.08196	.	.	ENSG00000121933	ENST00000414219	.	.	.	4.7	-7.56	0.01322	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999972	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.8582	9.5658	0.39398	0.2279:0.0:0.5801:0.1921	.	.	.	.	S	169	.	.	X	-	2	2	ADORA3	111829931	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	-0.188000	0.09642	-1.034000	0.03295	-0.313000	0.08912	TAA		0.433	ADORA3-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157679.1	NM_000677, NM_020683		57	68	0	0	0	0	57	68				
NOTCH2NL	388677	broad.mit.edu	37	1	145273312	145273312	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:145273312G>C	ENST00000369340.3	+	4	610	c.166G>C	c.(166-168)Ggg>Cgg	p.G56R	RP11-458D21.5_ENST00000468030.1_Missense_Mutation_p.G56R|NOTCH2NL_ENST00000344859.3_Missense_Mutation_p.G56R|NOTCH2NL_ENST00000362074.6_Missense_Mutation_p.G56R			Q7Z3S9	NT2NL_HUMAN	notch 2 N-terminal like	56	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	27						ATGTGCCTCAGGGTTTACAGG	0.567																																						uc001emn.3		NA																	0				ovary(1)	1						c.(166-168)GGG>CGG		Notch homolog 2 N-terminal like protein							351.0	320.0	330.0					1																	145273312		2203	4300	6503	SO:0001583	missense	388677				cell differentiation|multicellular organismal development|Notch signaling pathway	cytoplasm|extracellular region	calcium ion binding	g.chr1:145273312G>C		CCDS72880.1	1q21.2	2010-06-24	2010-06-24		ENSG00000213240	ENSG00000213240			31862	protein-coding gene	gene with protein product			"""Notch homolog 2 (Drosophila) N-terminal like"""			14673143	Standard	NM_203458		Approved	N2N	uc001emn.4	Q7Z3S9	OTTHUMG00000013754	ENST00000369340.3:c.166G>C	1.37:g.145273312G>C	ENSP00000358346:p.Gly56Arg		Somatic				NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'UTR|NOTCH2NL_uc001emm.3_Missense_Mutation_p.G56R|NOTCH2NL_uc001emo.2_Missense_Mutation_p.G56R|NOTCH2NL_uc010oyh.1_RNA	p.G56R	NM_203458	NP_982283	WXS	Illumina HiSeq	Unspecified	Q7Z3S9	NT2NL_HUMAN			3	536	+			56			EGF-like 2.		Q5BKT8|Q5VTG9|Q5XG84|Q6P192|Q8NC23|Q8WUQ9|Q96FY1	Missense_Mutation	SNP	ENST00000369340.3	37	c.166G>C	CCDS909.1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.235203	0.58886	.	.	ENSG00000213240	ENST00000362074;ENST00000344859;ENST00000369340	D;D;D	0.98178	-4.77;-4.77;-4.77	2.75	2.75	0.32379	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.98548	0.9515	M	0.83384	2.64	0.38081	D	0.936686	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99293	1.0899	9	0.87932	D	0	.	11.2552	0.49050	0.0:0.0:1.0:0.0	.	56;56	Q7Z3S9-2;Q7Z3S9	.;NT2NL_HUMAN	R	56	ENSP00000354929:G56R;ENSP00000344557:G56R;ENSP00000358346:G56R	ENSP00000344557:G56R	G	+	1	0	NOTCH2NL	143984669	1.000000	0.71417	0.897000	0.35233	0.466000	0.32739	7.885000	0.87282	1.532000	0.49169	0.394000	0.25966	GGG		0.567	NOTCH2NL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038546.1	NM_203458		55	414	0	0	0	0	55	414				
PRUNE	58497	broad.mit.edu	37	1	151001309	151001309	+	Silent	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:151001309C>T	ENST00000271620.3	+	7	978	c.822C>T	c.(820-822)tgC>tgT	p.C274C	PRUNE_ENST00000368934.1_Intron|PRUNE_ENST00000368936.1_Silent_p.C92C|PRUNE_ENST00000368937.1_Intron|PRUNE_ENST00000368935.1_Intron|PRUNE_ENST00000467771.1_3'UTR|PRUNE_ENST00000271619.8_Intron	NM_021222.1	NP_067045.1	Q86TP1	PRUNE_HUMAN	prune exopolyphosphatase	274						cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ATGCTTTCTGCCAGGCTCACA	0.483																																						uc001ewh.1		NA																	0				ovary(1)	1						c.(820-822)TGC>TGT		prune							181.0	152.0	162.0					1																	151001309		2203	4300	6503	SO:0001819	synonymous_variant	58497					cytoplasm|focal adhesion|nucleus	inorganic diphosphatase activity|manganese ion binding|protein binding	g.chr1:151001309C>T	U67085	CCDS977.1	1q21.2	2013-04-29	2013-04-29		ENSG00000143363	ENSG00000143363	3.6.1.11		13420	protein-coding gene	gene with protein product			"""prune homolog (Drosophila)"""			10602478, 11687967, 18700747	Standard	NM_021222		Approved	DRES-17, HTCD37	uc001ewh.1	Q86TP1	OTTHUMG00000035062	ENST00000271620.3:c.822C>T	1.37:g.151001309C>T			Somatic				PRUNE_uc001ewi.1_Silent_p.C92C|PRUNE_uc010pco.1_Silent_p.C42C|PRUNE_uc001ewj.1_Intron|PRUNE_uc001ewk.1_Intron	p.C274C	NM_021222	NP_067045	WXS	Illumina HiSeq	Unspecified	Q86TP1	PRUNE_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)		7	958	+	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		274					B2RCH8|B4DFL7|Q5SZF9|Q659E5|Q6P4E0|Q8N654|Q96JU5|Q9C071|Q9C072|Q9UIV0	Silent	SNP	ENST00000271620.3	37	c.822C>T	CCDS977.1																																																																																				0.483	PRUNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084885.1	NM_021222		4	167	0	0	0	0	4	167				
IVL	3713	broad.mit.edu	37	1	152883976	152883976	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:152883976C>A	ENST00000368764.3	+	2	1767	c.1703C>A	c.(1702-1704)cCt>cAt	p.P568H	IVL_ENST00000392667.2_Missense_Mutation_p.P422H			P07476	INVO_HUMAN	involucrin	568					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTATTGCTTCCTGTAGAGCAC	0.572																																						uc001fau.2		NA																	0				ovary(3)	3						c.(1702-1704)CCT>CAT		involucrin							70.0	71.0	70.0					1																	152883976		2203	4300	6503	SO:0001583	missense	3713				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine|keratinization|response to UV-B	cornified envelope|cytoplasm	protein binding, bridging|structural molecule activity	g.chr1:152883976C>A	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.1703C>A	1.37:g.152883976C>A	ENSP00000357753:p.Pro568His		Somatic					p.P568H	NM_005547	NP_005538	WXS	Illumina HiSeq	Unspecified	P07476	INVO_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		2	1749	+	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		568					Q5T7P4	Missense_Mutation	SNP	ENST00000368764.3	37	c.1703C>A	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	C	13.14	2.149576	0.37923	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.29397	1.57;2.2	4.1	3.15	0.36227	.	.	.	.	.	T	0.30916	0.0780	M	0.65498	2.005	0.09310	N	1	D	0.76494	0.999	D	0.64042	0.921	T	0.12477	-1.0546	9	0.72032	D	0.01	.	4.632	0.12506	0.2119:0.6705:0.0:0.1176	.	568	P07476	INVO_HUMAN	H	568;422	ENSP00000357753:P568H;ENSP00000376435:P422H	ENSP00000357753:P568H	P	+	2	0	IVL	151150600	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.040000	0.12104	1.244000	0.43870	0.563000	0.77884	CCT		0.572	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547		65	87	1	0	4.66e-34	6.64e-34	65	87				
PEX19	5824	broad.mit.edu	37	1	160249948	160249948	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:160249948A>G	ENST00000368072.5	-	6	704	c.683T>C	c.(682-684)aTa>aCa	p.I228T	PEX19_ENST00000532508.1_5'UTR|DCAF8_ENST00000608310.1_Missense_Mutation_p.I81T|DCAF8_ENST00000556710.1_Missense_Mutation_p.I81T|PEX19_ENST00000440949.3_Missense_Mutation_p.I138T	NM_001193644.1|NM_002857.3	NP_001180573.1|NP_002848.1	P40855	PEX19_HUMAN	peroxisomal biogenesis factor 19	228					chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|establishment of protein localization to peroxisome (GO:0072663)|negative regulation of lipid binding (GO:1900131)|peroxisome fission (GO:0016559)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	ATPase binding (GO:0051117)|peroxisome membrane class-1 targeting sequence binding (GO:0036105)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(2)	11	all_cancers(52;1.27e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CTGCTCACATATTTTGCACAT	0.468																																						uc010pjc.1		NA																	0				skin(2)	2						c.(241-243)ATA>ACA		DDB1 and CUL4 associated factor 8							185.0	177.0	180.0					1																	160249948		2203	4300	6503	SO:0001583	missense	50717					CUL4 RING ubiquitin ligase complex	protein binding	g.chr1:160249948A>G	Y09048	CCDS1201.1	1q22	2008-07-18	2004-03-17	2004-03-19	ENSG00000162735	ENSG00000162735			9713	protein-coding gene	gene with protein product	"""housekeeping gene, 33kD"""	600279	"""peroxisomal farnesylated protein"""	PXF		9339377, 10051604	Standard	NM_002857		Approved	HK33, D1S2223E, PMP1, PMPI, PXMP1		P40855	OTTHUMG00000033112	ENST00000368072.5:c.683T>C	1.37:g.160249948A>G	ENSP00000357051:p.Ile228Thr		Somatic				PEX19_uc010pje.1_RNA|PEX19_uc001fvs.2_Missense_Mutation_p.I228T|PEX19_uc001fvt.2_Missense_Mutation_p.I138T	p.I81T	NM_015726	NP_056541	WXS	Illumina HiSeq	Unspecified	Q5TAQ9	DCAF8_HUMAN			4	514	-			Error:Variant_position_missing_in_Q5TAQ9_after_alignment					D3DVE7|Q5QNY4|Q8NI97	Missense_Mutation	SNP	ENST00000368072.5	37	c.242T>C	CCDS1201.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.381093	0.82792	.	.	ENSG00000132716;ENSG00000258465;ENSG00000258465;ENSG00000162735;ENSG00000162735;ENSG00000162735;ENSG00000162735	ENST00000555195;ENST00000556710;ENST00000485079;ENST00000368072;ENST00000429425;ENST00000440949;ENST00000392220	T;T	0.77098	-1.07;-1.07	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.85656	0.5747	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.79784	0.984;0.993	D	0.87914	0.2699	10	0.87932	D	0	-8.4959	15.118	0.72419	1.0:0.0:0.0:0.0	.	81;228	G3V3G9;P40855	.;PEX19_HUMAN	T	81;81;98;228;208;138;208	ENSP00000451989:I81T;ENSP00000451235:I81T	ENSP00000357051:I228T	I	-	2	0	RP11-574F21.3;PEX19;DCAF8	158516572	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.856000	0.86956	2.207000	0.71202	0.533000	0.62120	ATA		0.468	PEX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080642.2	NM_002857		137	208	0	0	0	0	137	208				
LMX1A	4009	broad.mit.edu	37	1	165218667	165218667	+	Silent	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:165218667C>T	ENST00000342310.3	-	4	856	c.474G>A	c.(472-474)gtG>gtA	p.V158V	LMX1A_ENST00000294816.2_Silent_p.V158V|LMX1A_ENST00000367893.4_Silent_p.V158V	NM_177398.3	NP_796372.1	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	158					axon guidance (GO:0007411)|central nervous system neuron differentiation (GO:0021953)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|dopaminergic neuron differentiation (GO:0071542)|midbrain development (GO:0030901)|negative regulation of neuron differentiation (GO:0045665)|regulation of cell growth (GO:0001558)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|central_nervous_system(3)|cervix(2)|endometrium(4)|large_intestine(6)|lung(10)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)	35	all_hematologic(923;0.248)					CTGCTGGGCTCACCAGGCTGA	0.612																																						uc001gcy.1		NA																	0				central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5						c.(472-474)GTG>GTA		LIM homeobox transcription factor 1, alpha							61.0	57.0	59.0					1																	165218667		2203	4300	6503	SO:0001819	synonymous_variant	4009					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:165218667C>T	AY078391	CCDS1247.1	1q24.1	2011-06-20			ENSG00000162761	ENSG00000162761		"""Homeoboxes / LIM class"""	6653	protein-coding gene	gene with protein product		600298		LMX1		7698771	Standard	NM_177398		Approved	LMX1.1	uc001gcz.2	Q8TE12	OTTHUMG00000034575	ENST00000342310.3:c.474G>A	1.37:g.165218667C>T			Somatic				LMX1A_uc001gcz.1_Silent_p.V158V	p.V158V	NM_177398	NP_796372	WXS	Illumina HiSeq	Unspecified	Q8TE12	LMX1A_HUMAN			3	695	-	all_hematologic(923;0.248)		158					B3KXP6|Q0VDB5|Q5VWG4|Q8TE11	Silent	SNP	ENST00000342310.3	37	c.474G>A	CCDS1247.1																																																																																				0.612	LMX1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083668.2	NM_177398		21	67	0	0	0	0	21	67				
F5	2153	broad.mit.edu	37	1	169510646	169510646	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:169510646G>A	ENST00000367797.3	-	13	3883	c.3682C>T	c.(3682-3684)Cag>Tag	p.Q1228*	F5_ENST00000367796.3_Nonsense_Mutation_p.Q1233*	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1228	35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	ATGGGCATCTGACCGAGGGCT	0.527																																						uc001ggg.1		NA																	0				ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(3682-3684)CAG>TAG		coagulation factor V precursor	Drotrecogin alfa(DB00055)						217.0	237.0	230.0					1																	169510646		2203	4300	6503	SO:0001587	stop_gained	2153				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity	g.chr1:169510646G>A	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.3682C>T	1.37:g.169510646G>A	ENSP00000356771:p.Gln1228*		Somatic					p.Q1228*	NM_000130	NP_000121	WXS	Illumina HiSeq	Unspecified	P12259	FA5_HUMAN			13	3827	-	all_hematologic(923;0.208)		1228			2-5.|35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Nonsense_Mutation	SNP	ENST00000367797.3	37	c.3682C>T	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	G	39	7.766888	0.98477	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	.	.	.	3.48	-0.211	0.13172	.	0.253211	0.20062	U	0.100072	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	7.1	0.25332	0.1081:0.3207:0.5712:0.0	.	.	.	.	X	1228;1233	.	ENSP00000356770:Q1233X	Q	-	1	0	F5	167777270	0.776000	0.28616	0.001000	0.08648	0.000000	0.00434	0.551000	0.23361	0.095000	0.17434	-0.319000	0.08680	CAG		0.527	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130		177	243	0	0	0	0	177	243				
SELL	6402	broad.mit.edu	37	1	169672410	169672410	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:169672410C>G	ENST00000236147.4	-	6	1137	c.977G>C	c.(976-978)aGt>aCt	p.S326T	SELL_ENST00000463108.1_5'UTR|C1orf112_ENST00000498289.1_Intron	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	313					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					ACATATTGGACTAGGATTTGA	0.383																																						uc001ggk.2		NA																	0					0						c.(937-939)AGT>ACT		selectin L precursor							84.0	79.0	80.0					1																	169672410		1883	4128	6011	SO:0001583	missense	6402				blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	integral to plasma membrane	glycosphingolipid binding|heparin binding|protease binding|sugar binding	g.chr1:169672410C>G	M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.977G>C	1.37:g.169672410C>G	ENSP00000236147:p.Ser326Thr		Somatic				C1orf112_uc001ggj.2_Intron|SELL_uc010pls.1_Missense_Mutation_p.S266T|SELL_uc001ggl.1_Missense_Mutation_p.S326T	p.S313T	NM_000655	NP_000646	WXS	Illumina HiSeq	Unspecified	P14151	LYAM1_HUMAN			6	1136	-	all_hematologic(923;0.208)		313			Extracellular (Potential).|Sushi 2.		B2R6Q8|P15023|Q9UJ43	Missense_Mutation	SNP	ENST00000236147.4	37	c.938G>C	CCDS53427.1	.	.	.	.	.	.	.	.	.	.	C	1.026	-0.683442	0.03353	.	.	ENSG00000188404	ENST00000236147	T	0.63744	-0.06	4.59	-2.06	0.07298	Complement control module (2);Sushi/SCR/CCP (3);	1.959210	0.02053	N	0.050167	T	0.15003	0.0362	N	0.13003	0.285	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.12156	0.005;0.007	T	0.03017	-1.1082	10	0.12430	T	0.62	0.5329	1.9113	0.03287	0.1119:0.3684:0.2196:0.3002	.	326;313	Q8WW79;P14151	.;LYAM1_HUMAN	T	326	ENSP00000236147:S326T	ENSP00000236147:S326T	S	-	2	0	SELL	167939034	0.000000	0.05858	0.008000	0.14137	0.837000	0.47467	-0.339000	0.07832	-0.510000	0.06523	-0.813000	0.03139	AGT		0.383	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084233.1	NM_000655		12	20	0	0	0	0	12	20				
ANKRD45	339416	broad.mit.edu	37	1	173579330	173579330	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:173579330A>G	ENST00000333279.2	-	6	815	c.755T>C	c.(754-756)gTa>gCa	p.V252A	RP3-436N22.3_ENST00000431459.1_RNA	NM_198493.2	NP_940895.1	Q5TZF3	ANR45_HUMAN	ankyrin repeat domain 45	268										NS(2)|endometrium(2)|large_intestine(4)|lung(3)|skin(1)	12						ATGGCTTGTTACAGATTTGGC	0.338																																						uc001gja.1		NA																	0					0						c.(754-756)GTA>GCA		ankyrin repeat domain 45							197.0	174.0	182.0					1																	173579330		2203	4300	6503	SO:0001583	missense	339416							g.chr1:173579330A>G		CCDS1309.1	1q25.1	2013-01-10			ENSG00000183831	ENSG00000183831		"""Ankyrin repeat domain containing"""	24786	protein-coding gene	gene with protein product	"""cancer/testis antigen 117"""						Standard	NM_198493		Approved	FLJ45235, CT117	uc001gja.1	Q5TZF3	OTTHUMG00000040546	ENST00000333279.2:c.755T>C	1.37:g.173579330A>G	ENSP00000331268:p.Val252Ala		Somatic					p.V252A	NM_198493	NP_940895	WXS	Illumina HiSeq	Unspecified	Q5TZF3	ANR45_HUMAN			6	816	-			268					A1A4G2|Q6ZST1	Missense_Mutation	SNP	ENST00000333279.2	37	c.755T>C	CCDS1309.1	.	.	.	.	.	.	.	.	.	.	A	11.51	1.659147	0.29515	.	.	ENSG00000183831	ENST00000333279	T	0.21361	2.01	5.03	3.9	0.45041	.	0.456404	0.19433	N	0.114370	T	0.06005	0.0156	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.27331	-1.0077	10	0.41790	T	0.15	-19.2395	7.8572	0.29489	0.9035:0.0:0.0965:0.0	.	268	Q5TZF3	ANR45_HUMAN	A	252	ENSP00000331268:V252A	ENSP00000331268:V252A	V	-	2	0	ANKRD45	171845953	0.024000	0.19004	0.012000	0.15200	0.081000	0.17604	3.685000	0.54678	1.015000	0.39444	0.533000	0.62120	GTA		0.338	ANKRD45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097580.2	NM_198493		54	113	0	0	0	0	54	113				
NPHS2	7827	broad.mit.edu	37	1	179533895	179533895	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:179533895C>A	ENST00000367615.4	-	2	376	c.308G>T	c.(307-309)tGg>tTg	p.W103L	NPHS2_ENST00000367616.4_Missense_Mutation_p.W103L	NM_014625.2	NP_055440.1	Q9NP85	PODO_HUMAN	nephrosis 2, idiopathic, steroid-resistant (podocin)	103					actin cytoskeleton reorganization (GO:0031532)|excretion (GO:0007588)|metanephric glomerular visceral epithelial cell development (GO:0072249)	cell-cell junction (GO:0005911)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)				NS(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	20						GACAAGAAGCCACTCACAGGC	0.403																																						uc001gmq.3		NA																	0					0						c.(307-309)TGG>TTG		podocin							69.0	72.0	71.0					1																	179533895		2203	4300	6503	SO:0001583	missense	7827				excretion	integral to plasma membrane	protein binding	g.chr1:179533895C>A	AJ279254	CCDS1331.1, CCDS72988.1	1q25-q31	2014-06-27			ENSG00000116218	ENSG00000116218			13394	protein-coding gene	gene with protein product		604766				8589695, 10742096	Standard	XM_005245483		Approved	SRN1, PDCN	uc001gmq.4	Q9NP85	OTTHUMG00000035252	ENST00000367615.4:c.308G>T	1.37:g.179533895C>A	ENSP00000356587:p.Trp103Leu		Somatic				NPHS2_uc009wxi.2_Missense_Mutation_p.W103L	p.W103L	NM_014625	NP_055440	WXS	Illumina HiSeq	Unspecified	Q9NP85	PODO_HUMAN			2	393	-			103					B1AM32|B1AM33|Q8N6Q5	Missense_Mutation	SNP	ENST00000367615.4	37	c.308G>T	CCDS1331.1	.	.	.	.	.	.	.	.	.	.	C	12.13	1.845701	0.32606	.	.	ENSG00000116218	ENST00000367615;ENST00000367616	D;D	0.99567	-6.18;-6.18	5.46	5.46	0.80206	.	0.134631	0.53938	D	0.000048	D	0.98915	0.9632	L	0.43598	1.365	0.58432	D	0.999998	P;B	0.50528	0.936;0.025	P;B	0.48425	0.577;0.008	D	0.99813	1.1042	10	0.49607	T	0.09	-9.7891	17.8888	0.88865	0.0:1.0:0.0:0.0	.	103;103	Q9NP85-2;Q9NP85	.;PODO_HUMAN	L	103	ENSP00000356587:W103L;ENSP00000356588:W103L	ENSP00000356587:W103L	W	-	2	0	NPHS2	177800518	1.000000	0.71417	1.000000	0.80357	0.116000	0.19942	5.568000	0.67385	2.567000	0.86603	0.561000	0.74099	TGG		0.403	NPHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085283.1			28	40	1	0	8.25e-16	1.05e-15	28	40				
RGS21	431704	broad.mit.edu	37	1	192321323	192321323	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:192321323G>T	ENST00000417209.2	+	4	409	c.235G>T	c.(235-237)Gaa>Taa	p.E79*		NM_001039152.3	NP_001034241.1	Q2M5E4	RGS21_HUMAN	regulator of G-protein signaling 21	79	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			NS(1)|endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	15						TGAATTCATTGAAGCTGATGC	0.383																																						uc001gsh.2		NA																	0				ovary(1)|skin(1)	2						c.(235-237)GAA>TAA		regulator of G-protein signaling 21							54.0	51.0	52.0					1																	192321323		1854	4108	5962	SO:0001587	stop_gained	431704				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr1:192321323G>T	AY643711	CCDS41448.1	1q31.2	2013-09-24	2007-08-14		ENSG00000253148	ENSG00000253148		"""Regulators of G-protein signaling"""	26839	protein-coding gene	gene with protein product		612407	"""regulator of G-protein signalling 21"""			15066150	Standard	NM_001039152		Approved		uc001gsh.3	Q2M5E4	OTTHUMG00000035594	ENST00000417209.2:c.235G>T	1.37:g.192321323G>T	ENSP00000428343:p.Glu79*		Somatic					p.E79*	NM_001039152	NP_001034241	WXS	Illumina HiSeq	Unspecified	Q2M5E4	RGS21_HUMAN			4	409	+			79			RGS.			Nonsense_Mutation	SNP	ENST00000417209.2	37	c.235G>T	CCDS41448.1	.	.	.	.	.	.	.	.	.	.	G	35	5.545559	0.96488	.	.	ENSG00000253148	ENST00000417209	.	.	.	5.77	3.85	0.44370	.	0.558342	0.12982	U	0.423157	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	7.5487	0.27783	0.169:0.1736:0.6574:0.0	.	.	.	.	X	79	.	ENSP00000428343:E79X	E	+	1	0	RGS21	190587946	0.158000	0.22850	1.000000	0.80357	0.997000	0.91878	0.455000	0.21843	1.442000	0.47568	0.557000	0.71058	GAA		0.383	RGS21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086387.2			14	34	1	0	2.32e-09	2.73e-09	14	34				
CFHR5	81494	broad.mit.edu	37	1	196965026	196965026	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:196965026G>A	ENST00000256785.4	+	5	896	c.787G>A	c.(787-789)Gtt>Att	p.V263I	CFHR5_ENST00000367414.5_Missense_Mutation_p.V287I			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	263	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)				NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						ACCCACTTGTGTTGGTAAATA	0.289																																						uc001gts.3		NA																	0				breast(1)|skin(1)	2						c.(787-789)GTT>ATT		complement factor H-related 5 precursor							71.0	77.0	75.0					1																	196965026		2201	4300	6501	SO:0001583	missense	81494				complement activation, alternative pathway	extracellular region		g.chr1:196965026G>A	AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.787G>A	1.37:g.196965026G>A	ENSP00000256785:p.Val263Ile		Somatic					p.V263I	NM_030787	NP_110414	WXS	Illumina HiSeq	Unspecified	Q9BXR6	FHR5_HUMAN			5	915	+			263			Sushi 4.		Q2NKK2	Missense_Mutation	SNP	ENST00000256785.4	37	c.787G>A	CCDS1387.1	.	.	.	.	.	.	.	.	.	.	G	0.553	-0.848685	0.02651	.	.	ENSG00000134389	ENST00000367414;ENST00000256785	T;T	0.28069	1.63;1.7	3.49	-3.73	0.04398	Complement control module (2);Sushi/SCR/CCP (1);	.	.	.	.	T	0.12050	0.0293	N	0.10874	0.06	0.09310	N	1	B	0.21147	0.052	B	0.23574	0.047	T	0.37430	-0.9706	9	0.02654	T	1	.	8.8402	0.35137	0.3878:0.0:0.6122:0.0	.	263	Q9BXR6	FHR5_HUMAN	I	287;263	ENSP00000356384:V287I;ENSP00000256785:V263I	ENSP00000256785:V263I	V	+	1	0	CFHR5	195231649	0.000000	0.05858	0.106000	0.21319	0.023000	0.10783	-0.831000	0.04405	-1.004000	0.03421	-0.513000	0.04457	GTT		0.289	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088814.2	NM_030787		28	35	0	0	0	0	28	35				
PFKFB2	5208	broad.mit.edu	37	1	207235301	207235301	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:207235301G>T	ENST00000367080.3	+	3	213	c.89G>T	c.(88-90)tGg>tTg	p.W30L	PFKFB2_ENST00000411990.2_5'UTR|PFKFB2_ENST00000545806.1_5'UTR|PFKFB2_ENST00000367079.2_Missense_Mutation_p.W30L	NM_006212.2	NP_006203.2	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2	30	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose catabolic process (GO:0006007)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|lactate metabolic process (GO:0006089)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	20	Prostate(682;0.19)					CTTCTAGCATGGGCCTCCTAC	0.443																																						uc001hfg.2		NA																	0				ovary(1)	1						c.(88-90)TGG>TTG		6-phosphofructo-2-kinase/fructose-2,							103.0	99.0	101.0					1																	207235301		2203	4300	6503	SO:0001583	missense	5208				fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity	g.chr1:207235301G>T		CCDS31003.1, CCDS31004.1	1q31-q32.2	2012-07-13			ENSG00000123836	ENSG00000123836	2.7.1.105, 3.1.3.46		8873	protein-coding gene	gene with protein product		171835					Standard	XM_005273162		Approved		uc001hfg.3	O60825	OTTHUMG00000036033	ENST00000367080.3:c.89G>T	1.37:g.207235301G>T	ENSP00000356047:p.Trp30Leu		Somatic				PFKFB2_uc010psc.1_5'UTR|PFKFB2_uc001hfh.2_Missense_Mutation_p.W30L|PFKFB2_uc009xcc.2_5'UTR	p.W30L	NM_006212	NP_006203	WXS	Illumina HiSeq	Unspecified	O60825	F262_HUMAN			3	198	+	Prostate(682;0.19)		30			6-phosphofructo-2-kinase.		O60824|Q5VVQ3|Q5VVQ4|Q9H3P1	Missense_Mutation	SNP	ENST00000367080.3	37	c.89G>T	CCDS31004.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.932623	0.52866	.	.	ENSG00000123836	ENST00000367080;ENST00000367079	.	.	.	5.0	5.0	0.66597	6-phosphofructo-2-kinase (1);	0.000000	0.85682	D	0.000000	T	0.64483	0.2602	L	0.54908	1.71	0.80722	D	1	P;B	0.38473	0.633;0.001	P;B	0.46208	0.507;0.012	T	0.57991	-0.7715	9	0.11485	T	0.65	.	17.4857	0.87687	0.0:0.0:1.0:0.0	.	30;30	Q5VVQ3;O60825	.;F262_HUMAN	L	30	.	ENSP00000356046:W30L	W	+	2	0	PFKFB2	205301924	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.575000	0.98187	2.595000	0.87683	0.655000	0.94253	TGG		0.443	PFKFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087838.1			54	107	1	0	5.11e-33	7.22e-33	54	107				
USH2A	7399	broad.mit.edu	37	1	215931940	215931940	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:215931940G>C	ENST00000307340.3	-	58	11772	c.11386C>G	c.(11386-11388)Cca>Gca	p.P3796A	USH2A_ENST00000366943.2_Missense_Mutation_p.P3796A	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3796	Fibronectin type-III 23. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTTTTACCTGGTGGTATCCAA	0.299										HNSCC(13;0.011)																												uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(11386-11388)CCA>GCA		usherin isoform B							121.0	124.0	123.0					1																	215931940		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215931940G>C	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11386C>G	1.37:g.215931940G>C	ENSP00000305941:p.Pro3796Ala	HNSCC(13;0.011)	Somatic					p.P3796A	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	58	11773	-			3796			Fibronectin type-III 23.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.11386C>G	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.229404	0.58777	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.74526	-0.85;-0.85	5.9	4.98	0.66077	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.169822	0.27715	N	0.018141	D	0.83737	0.5319	M	0.74258	2.255	0.54753	D	0.999985	D	0.62365	0.991	P	0.61070	0.883	D	0.84807	0.0788	10	0.59425	D	0.04	.	15.4045	0.74866	0.0674:0.0:0.9326:0.0	.	3796	O75445	USH2A_HUMAN	A	3796	ENSP00000305941:P3796A;ENSP00000355910:P3796A	ENSP00000305941:P3796A	P	-	1	0	USH2A	213998563	1.000000	0.71417	0.998000	0.56505	0.444000	0.32077	4.309000	0.59135	2.803000	0.96430	0.586000	0.80456	CCA		0.299	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		60	92	0	0	0	0	60	92				
USH2A	7399	broad.mit.edu	37	1	216373451	216373451	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:216373451A>G	ENST00000307340.3	-	17	3715	c.3329T>C	c.(3328-3330)tTc>tCc	p.F1110S	USH2A_ENST00000366942.3_Missense_Mutation_p.F1110S|USH2A_ENST00000366943.2_Missense_Mutation_p.F1110S|RP5-1099E6.3_ENST00000420867.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1110	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGTGTCTAAGAAGTATTGAAT	0.328										HNSCC(13;0.011)																												uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(3328-3330)TTC>TCC		usherin isoform B							44.0	44.0	44.0					1																	216373451		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216373451A>G	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3329T>C	1.37:g.216373451A>G	ENSP00000305941:p.Phe1110Ser	HNSCC(13;0.011)	Somatic				USH2A_uc001hkv.2_Missense_Mutation_p.F1110S	p.F1110S	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	17	3716	-			1110			Extracellular (Potential).|Fibronectin type-III 1.		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.3329T>C	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	A	18.46	3.627859	0.66901	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	D;T;T	0.85702	-2.02;0.51;0.32	6.02	4.88	0.63580	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.47093	D	0.000244	D	0.91415	0.7291	M	0.81682	2.555	0.54753	D	0.99998	D;D	0.67145	0.996;0.996	D;P	0.66351	0.943;0.676	D	0.91716	0.5385	10	0.66056	D	0.02	.	12.6065	0.56527	0.8756:0.0:0.0:0.1244	.	1110;1110	O75445-2;O75445	.;USH2A_HUMAN	S	1110	ENSP00000305941:F1110S;ENSP00000355910:F1110S;ENSP00000355909:F1110S	ENSP00000305941:F1110S	F	-	2	0	USH2A	214440074	1.000000	0.71417	0.621000	0.29145	0.726000	0.41606	4.629000	0.61290	1.077000	0.40990	0.533000	0.62120	TTC		0.328	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		29	46	0	0	0	0	29	46				
LEFTY2	7044	broad.mit.edu	37	1	226127684	226127684	+	Missense_Mutation	SNP	A	A	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:226127684A>T	ENST00000366820.5	-	2	617	c.269T>A	c.(268-270)cTg>cAg	p.L90Q	LEFTY2_ENST00000474493.1_5'UTR|LEFTY2_ENST00000420304.2_Missense_Mutation_p.L90Q|RP4-559A3.6_ENST00000513672.1_RNA	NM_003240.3	NP_003231.2	O00292	LFTY2_HUMAN	left-right determination factor 2	90					blood coagulation (GO:0007596)|cell growth (GO:0016049)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16	Breast(184;0.197)					CTCCGACGCCAGGAACCTGCC	0.697																																					Colon(172;116 2643 9098 43333)	uc001hpt.1		NA																	0					0						c.(268-270)CTG>CAG		endometrial bleeding associated factor							15.0	16.0	15.0					1																	226127684		2119	4118	6237	SO:0001583	missense	7044				cell growth|multicellular organismal development|platelet activation|platelet degranulation|transforming growth factor beta receptor signaling pathway	extracellular space|platelet alpha granule lumen	cytokine activity|growth factor activity|transforming growth factor beta receptor binding	g.chr1:226127684A>T	U81523	CCDS1549.1, CCDS53479.1	1q42.1	2008-07-18	2004-11-17	2004-11-17	ENSG00000143768	ENSG00000143768			3122	protein-coding gene	gene with protein product	"""transforming growth factor, beta-4 (endometrial bleeding-associated factor; LEFTY A)"""	601877	"""endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamily)"""	TGFB4, EBAF		9153275	Standard	NM_001172425		Approved	LEFTA, LEFTYA	uc001hpt.2	O00292	OTTHUMG00000037441	ENST00000366820.5:c.269T>A	1.37:g.226127684A>T	ENSP00000355785:p.Leu90Gln		Somatic				LEFTY2_uc010pvk.1_Missense_Mutation_p.L90Q|LEFTY2_uc009xek.1_Intron	p.L90Q	NM_003240	NP_003231	WXS	Illumina HiSeq	Unspecified	O00292	LFTY2_HUMAN			2	349	-	Breast(184;0.197)		90					B3KNH4|B4E332|E9PDM4|O75611|Q5TE89|Q8NBQ9	Missense_Mutation	SNP	ENST00000366820.5	37	c.269T>A	CCDS1549.1	.	.	.	.	.	.	.	.	.	.	a	23.3	4.402614	0.83230	.	.	ENSG00000143768	ENST00000420304;ENST00000366820	T;T	0.66638	-0.22;-0.15	4.53	3.39	0.38822	Transforming growth factor-beta, N-terminal (1);	0.519852	0.19901	N	0.103506	T	0.76471	0.3992	M	0.74881	2.28	0.35823	D	0.82474	D;D	0.76494	0.998;0.999	D;D	0.74348	0.948;0.983	T	0.78001	-0.2375	10	0.27785	T	0.31	.	8.1158	0.30942	0.9046:0.0:0.0954:0.0	.	90;90	E9PDM4;O00292	.;LFTY2_HUMAN	Q	90	ENSP00000388009:L90Q;ENSP00000355785:L90Q	ENSP00000355785:L90Q	L	-	2	0	LEFTY2	224194307	1.000000	0.71417	0.986000	0.45419	0.989000	0.77384	3.784000	0.55416	1.805000	0.52779	0.459000	0.35465	CTG		0.697	LEFTY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091152.1	NM_003240		9	18	0	0	0	0	9	18				
PGBD5	79605	broad.mit.edu	37	1	230472906	230472906	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:230472906G>T	ENST00000525115.1	-	4	839	c.816C>A	c.(814-816)ttC>ttA	p.F272L	PGBD5_ENST00000391860.1_Missense_Mutation_p.F226L|PGBD5_ENST00000530424.1_5'Flank|PGBD5_ENST00000321327.2_Missense_Mutation_p.F371L			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	272						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		TGGGCCCCGTGAAAATGATGT	0.597																																						uc010pwb.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(814-816)TTC>TTA		piggyBac transposable element derived 5							101.0	92.0	95.0					1																	230472906		2203	4300	6503	SO:0001583	missense	79605					integral to membrane		g.chr1:230472906G>T	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.816C>A	1.37:g.230472906G>T	ENSP00000431404:p.Phe272Leu		Somatic				PGBD5_uc001htv.2_Missense_Mutation_p.F371L	p.F272L	NM_024554	NP_078830	WXS	Illumina HiSeq	Unspecified	Q8N414	PGBD5_HUMAN		GBM - Glioblastoma multiforme(131;0.201)	4	816	-	Breast(184;0.0397)	Prostate(94;0.167)	272					A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	ENST00000525115.1	37	c.816C>A		.	.	.	.	.	.	.	.	.	.	g	21.1	4.090260	0.76756	.	.	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	T;T;T	0.16597	2.33;2.33;2.33	5.21	2.28	0.28536	.	0.000000	0.85682	D	0.000000	T	0.25419	0.0618	L	0.27053	0.805	0.58432	D	0.999994	D	0.76494	0.999	D	0.79108	0.992	T	0.00747	-1.1583	10	0.59425	D	0.04	-35.3065	10.5127	0.44870	0.2147:0.0:0.7853:0.0	.	272	Q8N414	PGBD5_HUMAN	L	226;371;272	ENSP00000375733:F226L;ENSP00000322530:F371L;ENSP00000431404:F272L	ENSP00000322530:F371L	F	-	3	2	PGBD5	228539529	1.000000	0.71417	0.997000	0.53966	0.704000	0.40688	4.121000	0.57904	0.192000	0.20272	0.585000	0.79938	TTC		0.597	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554		43	64	1	0	4.44e-20	5.89e-20	43	64				
TBCE	6905	broad.mit.edu	37	1	235600733	235600733	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:235600733G>T	ENST00000366601.3	+	12	1236	c.1060G>T	c.(1060-1062)Gcg>Tcg	p.A354S	TBCE_ENST00000472011.1_3'UTR|TBCE_ENST00000543662.1_Missense_Mutation_p.A405S|TBCE_ENST00000406207.1_Missense_Mutation_p.A354S			Q15813	TBCE_HUMAN	tubulin folding cofactor E	354	LRRCT.				'de novo' posttranslational protein folding (GO:0051084)|adult locomotory behavior (GO:0008344)|cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|microtubule cytoskeleton organization (GO:0000226)|muscle atrophy (GO:0014889)|peripheral nervous system neuron axonogenesis (GO:0048936)|post-chaperonin tubulin folding pathway (GO:0007023)|post-embryonic development (GO:0009791)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	chaperone binding (GO:0051087)			NS(1)|endometrium(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	14	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)			AGCAGAGACGGCGCGACTACT	0.468																																						uc001hwz.1		NA																	0					0						c.(1060-1062)GCG>TCG		beta-tubulin cofactor E							97.0	89.0	92.0					1																	235600733		2203	4300	6503	SO:0001583	missense	6905				'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|nucleus|plasma membrane	chaperone binding	g.chr1:235600733G>T	U61232	CCDS1605.1, CCDS73052.1	1q42.3	2014-02-04	2006-11-21		ENSG00000116957	ENSG00000116957			11582	protein-coding gene	gene with protein product		604934	"""tubulin-specific chaperone e"", ""Kenny-Caffey syndrome"", ""hypoparathyroidism, growth and mental retardation, and dysmorphism"""	KCS, HRD		8706133, 9806825, 12389028	Standard	NM_001079515		Approved	KCS1, pac2	uc001hxa.1	Q15813	OTTHUMG00000039987	ENST00000366601.3:c.1060G>T	1.37:g.235600733G>T	ENSP00000355560:p.Ala354Ser		Somatic				TBCE_uc010pxq.1_RNA|TBCE_uc001hxa.1_Missense_Mutation_p.A354S|TBCE_uc010pxr.1_Missense_Mutation_p.A405S|TBCE_uc001hxb.1_Missense_Mutation_p.A241S	p.A354S	NM_003193	NP_003184	WXS	Illumina HiSeq	Unspecified	Q15813	TBCE_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)		12	1183	+	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	354			LRRCT.		A8K8C2|B7Z3P1	Missense_Mutation	SNP	ENST00000366601.3	37	c.1060G>T	CCDS1605.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.679494	0.00751	.	.	ENSG00000116957	ENST00000366601;ENST00000406207;ENST00000543662	T;T;T	0.07114	3.22;3.22;3.22	4.48	0.611	0.17586	.	1.130590	0.06439	N	0.725536	T	0.05640	0.0148	N	0.19112	0.55	0.09310	N	1	B;B;B	0.19583	0.014;0.037;0.001	B;B;B	0.18263	0.014;0.021;0.017	T	0.46317	-0.9200	10	0.21540	T	0.41	0.0575	5.9985	0.19507	0.3354:0.488:0.1766:0.0	.	405;354;354	B7Z3P1;A8K8C2;Q15813	.;.;TBCE_HUMAN	S	354;354;405	ENSP00000355560:A354S;ENSP00000384571:A354S;ENSP00000439170:A405S	ENSP00000355560:A354S	A	+	1	0	TBCE	233667356	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.129000	0.15830	-0.050000	0.13356	-0.238000	0.12139	GCG		0.468	TBCE-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000096458.3	NM_003193		52	67	1	0	1.86e-20	2.47e-20	52	67				
RYR2	6262	broad.mit.edu	37	1	237947941	237947941	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:237947941G>A	ENST00000366574.2	+	90	13246	c.12929G>A	c.(12928-12930)tGc>tAc	p.C4310Y	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.C4316Y|RYR2_ENST00000542537.1_Missense_Mutation_p.C4294Y	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4310					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CGCATCATTTGCAGCCTGCTG	0.498																																						uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(12928-12930)TGC>TAC		cardiac muscle ryanodine receptor							78.0	76.0	77.0					1																	237947941		1916	4129	6045	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237947941G>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12929G>A	1.37:g.237947941G>A	ENSP00000355533:p.Cys4310Tyr		Somatic				RYR2_uc010pya.1_Missense_Mutation_p.C725Y	p.C4310Y	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		90	13049	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4310			Helical; Name=M4; (Potential).		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.12929G>A	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	3.609	-0.080044	0.07141	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	T;D;T	0.96104	-0.31;-3.91;-0.31	5.11	4.18	0.49190	.	0.271361	0.30820	N	0.008814	D	0.91469	0.7307	L	0.44542	1.39	0.39830	D	0.972957	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	D	0.86823	0.2006	10	0.06757	T	0.87	-5.2246	15.3061	0.73992	0.0:0.1453:0.8547:0.0	.	1284;4310	B4DGV4;Q92736	.;RYR2_HUMAN	Y	4310;4316;4294;1284	ENSP00000355533:C4310Y;ENSP00000353174:C4316Y;ENSP00000443798:C4294Y	ENSP00000353174:C4316Y	C	+	2	0	RYR2	236014564	0.960000	0.32886	0.022000	0.16811	0.670000	0.39368	2.256000	0.43231	1.339000	0.45563	0.655000	0.94253	TGC		0.498	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		28	53	0	0	0	0	28	53				
PLD5	200150	broad.mit.edu	37	1	242451748	242451748	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:242451748C>A	ENST00000536534.2	-	3	652	c.411G>T	c.(409-411)atG>atT	p.M137I	PLD5_ENST00000442594.2_Missense_Mutation_p.M45I|PLD5_ENST00000427495.1_Missense_Mutation_p.M75I			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	137						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TGAGTAAATTCATCCAGCCTT	0.403																																						uc001hzn.1		NA																	0				ovary(6)	6						c.(409-411)ATG>ATT		RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							85.0	77.0	80.0					1																	242451748		2203	4296	6499	SO:0001583	missense	200150					integral to membrane	catalytic activity	g.chr1:242451748C>A	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.411G>T	1.37:g.242451748C>A	ENSP00000440896:p.Met137Ile		Somatic				PLD5_uc001hzl.3_Missense_Mutation_p.M75I|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Missense_Mutation_p.M45I	p.M137I			WXS	Illumina HiSeq	Unspecified	Q8N7P1	PLD5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0329)		3	538	-	Melanoma(84;0.242)		137					A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	ENST00000536534.2	37	c.411G>T	CCDS1621.2	.	.	.	.	.	.	.	.	.	.	C	11.44	1.640302	0.29157	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534;ENST00000459864	T;T;T;T	0.43294	2.72;2.72;2.72;0.95	4.33	4.33	0.51752	.	0.313205	0.37761	N	0.001950	T	0.31918	0.0812	L	0.33339	1.005	0.35753	D	0.819561	P;B;P	0.41265	0.744;0.41;0.744	B;B;B	0.38327	0.271;0.062;0.201	T	0.41698	-0.9494	10	0.30078	T	0.28	-27.8439	13.9007	0.63802	0.0:1.0:0.0:0.0	.	45;137;75	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	I	75;45;137;75	ENSP00000401285:M75I;ENSP00000414188:M45I;ENSP00000440896:M137I;ENSP00000438191:M75I	ENSP00000401285:M75I	M	-	3	0	PLD5	240518371	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.641000	0.54360	2.134000	0.65973	0.591000	0.81541	ATG		0.403	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666		37	57	1	0	7.61e-30	1.06e-29	37	57				
OR2W5	441932	broad.mit.edu	37	1	247655010	247655010	+	RNA	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:247655010T>C	ENST00000522351.1	+	0	641							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			GAAACCATGCTGGTAGAAGCG	0.592																																						uc001icz.1		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(580-582)CTG>CCG		olfactory receptor, family 2, subfamily W,							137.0	140.0	139.0					1																	247655010		2203	4300	6503			441932				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247655010T>C			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247655010T>C			Somatic					p.L194P	NM_001004698	NP_001004698	WXS	Illumina HiSeq	Unspecified	A6NFC9	OR2W5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)		1	581	+	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	194					B9EH85	Missense_Mutation	SNP	ENST00000522351.1	37	c.581T>C																																																																																					0.592	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	NM_001004698		98	134	0	0	0	0	98	134				
OR2T33	391195	broad.mit.edu	37	1	248436753	248436753	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:248436753C>T	ENST00000318021.2	-	1	385	c.364G>A	c.(364-366)Gcg>Acg	p.A122T		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CAGACAGCCGCATAGCGGTCA	0.612																																						uc010pzi.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(364-366)GCG>ACG		olfactory receptor, family 2, subfamily T,							42.0	39.0	40.0					1																	248436753		2202	4297	6499	SO:0001583	missense	391195				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248436753C>T		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.364G>A	1.37:g.248436753C>T	ENSP00000324687:p.Ala122Thr		Somatic					p.A122T	NM_001004695	NP_001004695	WXS	Illumina HiSeq	Unspecified	Q8NG76	O2T33_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	364	-	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		122			Cytoplasmic (Potential).		B2RNN0	Missense_Mutation	SNP	ENST00000318021.2	37	c.364G>A	CCDS31109.1	.	.	.	.	.	.	.	.	.	.	-	5.391	0.257267	0.10239	.	.	ENSG00000177212	ENST00000318021	T	0.02121	4.44	2.7	2.7	0.31948	GPCR, rhodopsin-like superfamily (1);	0.549627	0.13490	U	0.384078	T	0.02119	0.0066	N	0.25380	0.74	0.21675	N	0.999593	B	0.18968	0.032	B	0.19946	0.027	T	0.41142	-0.9525	10	0.72032	D	0.01	.	6.8131	0.23814	0.1957:0.6126:0.1917:0.0	.	122	Q8NG76	O2T33_HUMAN	T	122	ENSP00000324687:A122T	ENSP00000324687:A122T	A	-	1	0	OR2T33	246503376	0.000000	0.05858	0.173000	0.22940	0.001000	0.01503	-0.075000	0.11431	1.437000	0.47472	0.494000	0.49563	GCG		0.612	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695		16	62	0	0	0	0	16	62				
OR2T33	391195	broad.mit.edu	37	1	248436759	248436759	+	Missense_Mutation	SNP	G	G	T	rs375842071		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:248436759G>T	ENST00000318021.2	-	1	379	c.358C>A	c.(358-360)Cgc>Agc	p.R120S		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GCCGCATAGCGGTCATAGGCC	0.592																																						uc010pzi.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(358-360)CGC>AGC		olfactory receptor, family 2, subfamily T,							39.0	36.0	37.0					1																	248436759		2201	4278	6479	SO:0001583	missense	391195				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248436759G>T		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.358C>A	1.37:g.248436759G>T	ENSP00000324687:p.Arg120Ser		Somatic					p.R120S	NM_001004695	NP_001004695	WXS	Illumina HiSeq	Unspecified	Q8NG76	O2T33_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	358	-	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		120			Cytoplasmic (Potential).		B2RNN0	Missense_Mutation	SNP	ENST00000318021.2	37	c.358C>A	CCDS31109.1	.	.	.	.	.	.	.	.	.	.	-	11.24	1.579180	0.28180	.	.	ENSG00000177212	ENST00000318021	T	0.77620	-1.11	2.7	2.7	0.31948	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35970	U	0.002879	D	0.91280	0.7251	H	0.98559	4.265	0.35528	D	0.801994	D	0.61697	0.99	P	0.61874	0.895	D	0.96273	0.9200	10	0.87932	D	0	.	13.8042	0.63220	0.0:0.0:1.0:0.0	.	120	Q8NG76	O2T33_HUMAN	S	120	ENSP00000324687:R120S	ENSP00000324687:R120S	R	-	1	0	OR2T33	246503382	1.000000	0.71417	0.469000	0.27204	0.023000	0.10783	2.405000	0.44548	1.437000	0.47472	0.494000	0.49563	CGC		0.592	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695		18	60	1	0	6.34e-27	8.77e-27	18	60				
OR2M7	391196	broad.mit.edu	37	1	248487331	248487331	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:248487331G>T	ENST00000317965.2	-	1	568	c.540C>A	c.(538-540)gaC>gaA	p.D180E		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGGAAGGGAAGTCACAGCAGA	0.438																																						uc010pzk.1		NA																	0				skin(2)	2						c.(538-540)GAC>GAA		olfactory receptor, family 2, subfamily M,							192.0	197.0	196.0					1																	248487331		2203	4298	6501	SO:0001583	missense	391196				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248487331G>T	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.540C>A	1.37:g.248487331G>T	ENSP00000324557:p.Asp180Glu		Somatic					p.D180E	NM_001004691	NP_001004691	WXS	Illumina HiSeq	Unspecified	Q8NG81	OR2M7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	540	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		180			Extracellular (Potential).		B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	37	c.540C>A	CCDS31111.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.180201	0.00308	.	.	ENSG00000177186	ENST00000317965	T	0.00048	8.82	1.54	-2.48	0.06423	GPCR, rhodopsin-like superfamily (1);	0.240961	0.21255	U	0.077564	T	0.00073	0.0002	N	0.11756	0.17	0.09310	N	1	B	0.18013	0.025	B	0.26864	0.074	T	0.46978	-0.9152	10	0.02654	T	1	.	0.464	0.00521	0.435:0.167:0.1415:0.2565	.	180	Q8NG81	OR2M7_HUMAN	E	180	ENSP00000324557:D180E	ENSP00000324557:D180E	D	-	3	2	OR2M7	246553954	0.000000	0.05858	0.252000	0.24328	0.157000	0.22087	-3.145000	0.00584	-0.744000	0.04778	-1.271000	0.01417	GAC		0.438	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691		97	230	1	0	1.01e-60	1.5e-60	97	230				
OR2T6	254879	broad.mit.edu	37	1	248551581	248551581	+	Silent	SNP	A	A	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr1:248551581A>T	ENST00000355728.2	+	1	672	c.672A>T	c.(670-672)acA>acT	p.T224T		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTCTCATCACAGTGCATCAGA	0.498																																						uc001iei.1		NA																	0				ovary(2)|skin(1)	3						c.(670-672)ACA>ACT		olfactory receptor, family 2, subfamily T,							293.0	229.0	250.0					1																	248551581		2203	4300	6503	SO:0001819	synonymous_variant	254879				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248551581A>T	AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.672A>T	1.37:g.248551581A>T			Somatic					p.T224T	NM_001005471	NP_001005471	WXS	Illumina HiSeq	Unspecified	Q8NHC8	OR2T6_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	672	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		224			Helical; Name=5; (Potential).		A6NE36	Silent	SNP	ENST00000355728.2	37	c.672A>T	CCDS31114.1																																																																																				0.498	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471		75	63	0	0	0	0	75	63				
SLC39A12	221074	broad.mit.edu	37	10	18254530	18254530	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:18254530G>T	ENST00000377369.2	+	4	935	c.662G>T	c.(661-663)tGt>tTt	p.C221F	SLC39A12_ENST00000377374.4_Missense_Mutation_p.C221F|SLC39A12_ENST00000539911.1_Missense_Mutation_p.C87F|SLC39A12_ENST00000377371.3_Missense_Mutation_p.C221F	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	221					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						CAGGGTGTTTGTCTGGGACAA	0.443																																						uc001ipo.2		NA																	0				ovary(1)|breast(1)	2						c.(661-663)TGT>TTT		solute carrier family 39 (zinc transporter),							86.0	82.0	83.0					10																	18254530		2203	4300	6503	SO:0001583	missense	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18254530G>T		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.662G>T	10.37:g.18254530G>T	ENSP00000366586:p.Cys221Phe		Somatic				SLC39A12_uc001ipn.2_Missense_Mutation_p.C221F|SLC39A12_uc001ipp.2_Missense_Mutation_p.C221F|SLC39A12_uc010qck.1_Missense_Mutation_p.C87F	p.C221F	NM_001145195	NP_001138667	WXS	Illumina HiSeq	Unspecified	Q504Y0	S39AC_HUMAN			4	935	+			221			Helical; (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	37	c.662G>T	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.286034	0.80803	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.78364	-0.9;-1.17;-0.92;-0.73	6.02	6.02	0.97574	.	0.097714	0.64402	D	0.000001	D	0.89501	0.6733	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.89509	0.3770	10	0.87932	D	0	-14.1236	20.5407	0.99260	0.0:0.0:1.0:0.0	.	221;221;221	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	F	221;221;221;87;141	ENSP00000366586:C221F;ENSP00000366591:C221F;ENSP00000366588:C221F;ENSP00000440445:C87F	ENSP00000366586:C221F	C	+	2	0	SLC39A12	18294536	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.778000	0.75043	2.865000	0.98341	0.655000	0.94253	TGT		0.443	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		48	51	1	0	2.08e-19	2.74e-19	48	51				
PTF1A	256297	broad.mit.edu	37	10	23482812	23482812	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:23482812C>A	ENST00000376504.3	+	2	1168	c.964C>A	c.(964-966)Cca>Aca	p.P322T		NM_178161.2	NP_835455.1	Q7RTS3	PTF1A_HUMAN	pancreas specific transcription factor, 1a	322					amacrine cell differentiation (GO:0035881)|cerebellum development (GO:0021549)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|exocrine pancreas development (GO:0031017)|neuron fate commitment (GO:0048663)|pancreas development (GO:0031016)|regulation of neural retina development (GO:0061074)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|retinoic acid receptor signaling pathway (GO:0048384)|tissue development (GO:0009888)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(1)	7						AGAAAACGAACCACCATTTGA	0.398																																						uc001irp.2		NA																	0				pancreas(1)|skin(1)	2						c.(964-966)CCA>ACA		pancreas specific transcription factor, 1a							82.0	92.0	88.0					10																	23482812		2203	4300	6503	SO:0001583	missense	256297				endocrine pancreas development|exocrine pancreas development|regulation of transcription, DNA-dependent|tissue development|transcription, DNA-dependent	cytoplasm|transcription factor complex		g.chr10:23482812C>A	BK000272	CCDS7143.1	10p12.31	2013-05-21			ENSG00000168267	ENSG00000168267		"""Basic helix-loop-helix proteins"""	23734	protein-coding gene	gene with protein product		607194				8703005	Standard	NM_178161		Approved	PTF1-p48, bHLHa29	uc001irp.3	Q7RTS3	OTTHUMG00000017815	ENST00000376504.3:c.964C>A	10.37:g.23482812C>A	ENSP00000365687:p.Pro322Thr		Somatic					p.P322T	NM_178161	NP_835455	WXS	Illumina HiSeq	Unspecified	Q7RTS3	PTF1A_HUMAN			2	964	+			322					Q9HC25	Missense_Mutation	SNP	ENST00000376504.3	37	c.964C>A	CCDS7143.1	.	.	.	.	.	.	.	.	.	.	C	17.92	3.506009	0.64410	.	.	ENSG00000168267	ENST00000376504	D	0.95069	-3.6	5.93	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.96065	0.8718	L	0.51422	1.61	0.46499	D	0.999073	D	0.89917	1.0	D	0.69307	0.963	D	0.96573	0.9424	10	0.87932	D	0	-8.7007	16.6663	0.85253	0.0:0.87:0.13:0.0	.	322	Q7RTS3	PTF1A_HUMAN	T	322	ENSP00000365687:P322T	ENSP00000365687:P322T	P	+	1	0	PTF1A	23522818	1.000000	0.71417	0.996000	0.52242	0.969000	0.65631	5.729000	0.68538	1.458000	0.47871	0.561000	0.74099	CCA		0.398	PTF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047210.1	NM_178161		57	113	1	0	9.16e-17	1.18e-16	57	113				
KIAA1217	56243	broad.mit.edu	37	10	24802317	24802317	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:24802317A>T	ENST00000376454.3	+	10	2161	c.2131A>T	c.(2131-2133)Aga>Tga	p.R711*	KIAA1217_ENST00000430453.2_Nonsense_Mutation_p.R597*|KIAA1217_ENST00000396445.1_Nonsense_Mutation_p.R394*|KIAA1217_ENST00000376462.1_Nonsense_Mutation_p.R631*|KIAA1217_ENST00000376451.2_Nonsense_Mutation_p.R394*|KIAA1217_ENST00000396446.1_Nonsense_Mutation_p.R394*|KIAA1217_ENST00000307544.6_Nonsense_Mutation_p.R394*|KIAA1217_ENST00000376452.3_Nonsense_Mutation_p.R676*|KIAA1217_ENST00000458595.1_Nonsense_Mutation_p.R676*	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	711					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						GGAGCAAGAGAGACAAAAATA	0.473											OREG0020076	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc001iru.3		NA																	0				ovary(5)|skin(2)	7						c.(2131-2133)AGA>TGA		sickle tail isoform 1							130.0	122.0	125.0					10																	24802317		2203	4300	6503	SO:0001587	stop_gained	56243				embryonic skeletal system development	cytoplasm		g.chr10:24802317A>T	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.2131A>T	10.37:g.24802317A>T	ENSP00000365637:p.Arg711*		Somatic	OREG0020076	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	774	KIAA1217_uc001irs.2_Nonsense_Mutation_p.R631*|KIAA1217_uc001irt.3_Nonsense_Mutation_p.R676*|KIAA1217_uc010qcy.1_Nonsense_Mutation_p.R676*|KIAA1217_uc010qcz.1_Nonsense_Mutation_p.R676*|KIAA1217_uc001irv.1_Nonsense_Mutation_p.R526*|KIAA1217_uc010qda.1_RNA|KIAA1217_uc001irw.2_Nonsense_Mutation_p.R394*|KIAA1217_uc001irz.2_Nonsense_Mutation_p.R394*|KIAA1217_uc001irx.2_Nonsense_Mutation_p.R394*|KIAA1217_uc001iry.2_Nonsense_Mutation_p.R394*	p.R711*	NM_019590	NP_062536	WXS	Illumina HiSeq	Unspecified	Q5T5P2	SKT_HUMAN			10	2534	+			711					A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Nonsense_Mutation	SNP	ENST00000376454.3	37	c.2131A>T	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	A	34	5.384746	0.95967	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000430453;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	.	.	.	5.81	3.42	0.39159	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.8133	0.57651	0.6051:0.3949:0.0:0.0	.	.	.	.	X	631;676;676;394;711;676;526;597;394;394;394;394;394	.	ENSP00000302343:R394X	R	+	1	2	KIAA1217	24842323	1.000000	0.71417	0.862000	0.33874	0.395000	0.30598	2.637000	0.46553	0.428000	0.26173	0.528000	0.53228	AGA		0.473	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590		34	53	0	0	0	0	34	53				
GPR158	57512	broad.mit.edu	37	10	25883321	25883322	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:25883321_25883322CC>AA	ENST00000376351.3	+	9	2352_2353	c.1993_1994CC>AA	c.(1993-1995)CCa>AAa	p.P665K	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	665					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						GCTTTTGATTCCAAAGGTATTC	0.337																																						uc001isj.2		NA																	0				ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						c.(1993-1995)CCA>AAA		G protein-coupled receptor 158 precursor																																				SO:0001583	missense	57512					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:25883321_25883322CC>AA	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	Exception_encountered	10.37:g.25883321_25883322delinsAA	ENSP00000365529:p.Pro665Lys		Somatic				GPR158_uc001isk.2_Missense_Mutation_p.P40K	p.P665K	NM_020752	NP_065803	WXS	Illumina HiSeq	Unspecified	Q5T848	GP158_HUMAN			9	2053_2054	+			665			Cytoplasmic (Potential).		Q6QR81|Q9ULT3	Missense_Mutation	DNP	ENST00000376351.3	37	c.1993_1994CC>AA	CCDS31166.1																																																																																				0.337	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110		44	98	0	0	0	0	44	98				
ARMC4	55130	broad.mit.edu	37	10	28284017	28284017	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:28284017C>A	ENST00000305242.5	-	2	147	c.55G>T	c.(55-57)Gga>Tga	p.G19*		NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	19					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						TCGAGGATTCCAGTTCCATGT	0.453																																						uc009xky.2		NA																	0				ovary(4)|skin(2)	6						c.(55-57)GGA>TGA		armadillo repeat containing 4							71.0	68.0	69.0					10																	28284017		2203	4300	6503	SO:0001587	stop_gained	55130						binding	g.chr10:28284017C>A	AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.55G>T	10.37:g.28284017C>A	ENSP00000306410:p.Gly19*		Somatic				ARMC4_uc001itz.2_Nonsense_Mutation_p.G19*	p.G19*	NM_018076	NP_060546	WXS	Illumina HiSeq	Unspecified	Q5T2S8	ARMC4_HUMAN			2	153	-			19					A8K906|B7Z7I1|Q9H0C0	Nonsense_Mutation	SNP	ENST00000305242.5	37	c.55G>T	CCDS7157.1	.	.	.	.	.	.	.	.	.	.	C	14.32	2.501046	0.44455	.	.	ENSG00000169126	ENST00000305242	.	.	.	4.98	0.35	0.16037	.	0.719592	0.12888	N	0.430834	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-11.0108	10.3565	0.43967	0.0:0.7821:0.1248:0.0931	.	.	.	.	X	19	.	ENSP00000306410:G19X	G	-	1	0	ARMC4	28324023	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.190000	0.17057	0.055000	0.16094	0.585000	0.79938	GGA		0.453	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076		33	48	1	0	1.46e-13	1.81e-13	33	48				
HNRNPF	3185	broad.mit.edu	37	10	43882406	43882406	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:43882406G>A	ENST00000544000.1	-	4	1334	c.927C>T	c.(925-927)ttC>ttT	p.F309F	HNRNPF_ENST00000443950.2_Silent_p.F309F|HNRNPF_ENST00000498176.1_5'Flank|HNRNPF_ENST00000356053.3_Silent_p.F309F|HNRNPF_ENST00000357065.4_Silent_p.F309F|HNRNPF_ENST00000337970.3_Silent_p.F309F	NM_001098207.1	NP_001091677.1	P52597	HNRPF_HUMAN	heterogeneous nuclear ribonucleoprotein F	309	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|urinary_tract(1)	19						TGAGAGGAGAGAAGAAGTTGT	0.522																																						uc009xmh.1		NA																	0					0						c.(925-927)TTC>TTT		heterogeneous nuclear ribonucleoprotein F							73.0	64.0	67.0					10																	43882406		2203	4300	6503	SO:0001819	synonymous_variant	3185				regulation of RNA splicing	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding	g.chr10:43882406G>A		CCDS7204.1	10q11.21	2013-02-12		2008-04-18	ENSG00000169813	ENSG00000169813		"""RNA binding motif (RRM) containing"""	5039	protein-coding gene	gene with protein product		601037		HNRPF		7499401	Standard	NM_001098208		Approved		uc001jas.2	P52597	OTTHUMG00000018029	ENST00000544000.1:c.927C>T	10.37:g.43882406G>A			Somatic				HNRNPF_uc001jar.2_Silent_p.F309F|HNRNPF_uc001jas.2_Silent_p.F309F|HNRNPF_uc001jat.2_Silent_p.F309F|HNRNPF_uc001jav.2_Silent_p.F309F|HNRNPF_uc001jau.2_Silent_p.F309F|uc010qfa.1_Missense_Mutation_p.E30K	p.F309F	NM_001098208	NP_001091678	WXS	Illumina HiSeq	Unspecified	P52597	HNRPF_HUMAN			3	1414	-			309			RRM 3.		B3KM84|Q5T0N2|Q96AU2	Silent	SNP	ENST00000544000.1	37	c.927C>T	CCDS7204.1																																																																																				0.522	HNRNPF-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047705.2			55	69	0	0	0	0	55	69				
ALOX5	240	broad.mit.edu	37	10	45941034	45941034	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:45941034C>A	ENST00000374391.2	+	14	1977	c.1924C>A	c.(1924-1926)Ctc>Atc	p.L642I	ALOX5_ENST00000542434.1_Missense_Mutation_p.L585I|RP11-67C2.2_ENST00000435635.1_RNA	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	642	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	CCGCAAGAACCTCGAGGCCAT	0.542																																						uc001jce.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1924-1926)CTC>ATC		arachidonate 5-lipoxygenase	Diethylcarbamazine(DB00711)|Hydrocortisone(DB00741)|Leflunomide(DB01097)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Minocycline(DB01017)|Montelukast(DB00471)|Quinacrine(DB01103)|Vitamin E(DB00163)|Zileuton(DB00744)						103.0	97.0	99.0					10																	45941034		2203	4300	6503	SO:0001583	missense	240				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	cytosol|nuclear envelope lumen|nuclear matrix|nuclear membrane	arachidonate 5-lipoxygenase activity|iron ion binding|lipoxygenase activity|protein binding	g.chr10:45941034C>A	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.1924C>A	10.37:g.45941034C>A	ENSP00000363512:p.Leu642Ile		Somatic				ALOX5_uc009xmt.2_Missense_Mutation_p.L610I|ALOX5_uc010qfg.1_Missense_Mutation_p.L585I	p.L642I	NM_000698	NP_000689	WXS	Illumina HiSeq	Unspecified	P09917	LOX5_HUMAN			14	2023	+		Lung SC(717;0.0257)	642			Lipoxygenase.		B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	37	c.1924C>A	CCDS7212.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.432496	0.83776	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	D;D	0.83992	-1.79;-1.79	5.14	5.14	0.70334	Lipoxygenase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.90937	0.7151	M	0.78637	2.42	0.45354	D	0.998347	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.999	D	0.91456	0.5185	10	0.72032	D	0.01	-32.2223	16.4898	0.84197	0.0:1.0:0.0:0.0	.	585;610;642	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	I	585;642	ENSP00000437634:L585I;ENSP00000363512:L642I	ENSP00000363512:L642I	L	+	1	0	ALOX5	45261040	1.000000	0.71417	0.994000	0.49952	0.574000	0.36063	3.893000	0.56243	2.837000	0.97791	0.655000	0.94253	CTC		0.542	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1			47	83	1	0	2.43e-25	3.34e-25	47	83				
DKK1	22943	broad.mit.edu	37	10	54074250	54074250	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:54074250C>T	ENST00000373970.3	+	1	195	c.56C>T	c.(55-57)gCg>gTg	p.A19V	PRKG1-AS1_ENST00000420193.1_RNA	NM_012242.2	NP_036374.1	O94907	DKK1_HUMAN	dickkopf WNT signaling pathway inhibitor 1	19					cell morphogenesis involved in differentiation (GO:0000904)|embryonic limb morphogenesis (GO:0030326)|endoderm formation (GO:0001706)|extracellular negative regulation of signal transduction (GO:1900116)|face morphogenesis (GO:0060325)|forebrain development (GO:0030900)|hair follicle development (GO:0001942)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:1901296)|negative regulation of cardiac muscle cell differentiation (GO:2000726)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of heart induction by negative regulation of canonical Wnt signaling pathway (GO:0090082)|regulation of endodermal cell fate specification (GO:0042663)|regulation of receptor internalization (GO:0002090)|response to retinoic acid (GO:0032526)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)|low-density lipoprotein particle receptor binding (GO:0050750)|receptor antagonist activity (GO:0048019)|signal transducer activity (GO:0004871)			kidney(2)|large_intestine(4)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	16						ATGGTAGCGGCGGCTCTCGGC	0.607											OREG0020191	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc001jjr.2		NA																	0				ovary(1)|lung(1)|kidney(1)	3						c.(55-57)GCG>GTG		dickkopf homolog 1 precursor							38.0	45.0	43.0					10																	54074250		2197	4297	6494	SO:0001583	missense	22943				negative regulation of peptidyl-serine phosphorylation|negative regulation of protein complex assembly|negative regulation of transcription from RNA polymerase II promoter|positive regulation of heart induction by negative regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization	extracellular space|plasma membrane	growth factor activity|low-density lipoprotein particle receptor binding|receptor antagonist activity|signal transducer activity	g.chr10:54074250C>T		CCDS7246.1	10q11.2	2013-05-15	2013-05-15		ENSG00000107984	ENSG00000107984			2891	protein-coding gene	gene with protein product		605189	"""dickkopf (Xenopus laevis) homolog 1"", ""dickkopf 1 homolog (Xenopus laevis)"""				Standard	NM_012242		Approved	SK, DKK-1	uc001jjr.3	O94907	OTTHUMG00000018247	ENST00000373970.3:c.56C>T	10.37:g.54074250C>T	ENSP00000363081:p.Ala19Val		Somatic	OREG0020191	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	997	uc001jjq.1_5'Flank|uc009xox.1_5'Flank	p.A19V	NM_012242	NP_036374	WXS	Illumina HiSeq	Unspecified	O94907	DKK1_HUMAN			1	210	+			19					B2RC19	Missense_Mutation	SNP	ENST00000373970.3	37	c.56C>T	CCDS7246.1	.	.	.	.	.	.	.	.	.	.	C	3.161	-0.172111	0.06421	.	.	ENSG00000107984	ENST00000373970	T	0.42131	0.98	4.68	0.633	0.17712	.	0.789789	0.11408	N	0.567120	T	0.19087	0.0458	N	0.14661	0.345	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.29488	-1.0010	10	0.02654	T	1	-5.617	6.911	0.24335	0.0:0.5006:0.0:0.4994	.	19	O94907	DKK1_HUMAN	V	19	ENSP00000363081:A19V	ENSP00000363081:A19V	A	+	2	0	DKK1	53744256	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.172000	0.09868	0.144000	0.18951	-0.119000	0.15052	GCG		0.607	DKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048100.1			32	67	0	0	0	0	32	67				
PCDH15	65217	broad.mit.edu	37	10	56106124	56106124	+	Splice_Site	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:56106124C>A	ENST00000320301.6	-	6	989		c.e6+1		PCDH15_ENST00000373957.3_Splice_Site|PCDH15_ENST00000361849.3_Splice_Site|PCDH15_ENST00000373965.2_Splice_Site|PCDH15_ENST00000395440.1_Splice_Site|PCDH15_ENST00000395445.1_Splice_Site|PCDH15_ENST00000395442.1_Splice_Site|PCDH15_ENST00000395433.1_Splice_Site|AC013737.1_ENST00000583830.1_RNA|PCDH15_ENST00000395432.2_Splice_Site|PCDH15_ENST00000395438.1_Splice_Site|PCDH15_ENST00000395446.1_Splice_Site|PCDH15_ENST00000437009.1_Splice_Site|PCDH15_ENST00000395430.1_Splice_Site|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000373955.1_Splice_Site|PCDH15_ENST00000414778.1_Splice_Site	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15						equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TATTTACATACCGGATCATCT	0.308										HNSCC(58;0.16)																												uc001jju.1		NA																	0				pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.e6+1		protocadherin 15 isoform CD1-4 precursor							101.0	98.0	99.0					10																	56106124		2203	4300	6503	SO:0001630	splice_region_variant	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:56106124C>A	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.594+1G>T	10.37:g.56106124C>A		HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Splice_Site_p.P203_splice|PCDH15_uc010qhr.1_Splice_Site_p.P198_splice|PCDH15_uc010qhs.1_Splice_Site_p.P203_splice|PCDH15_uc010qht.1_Splice_Site_p.P198_splice|PCDH15_uc010qhu.1_Splice_Site_p.P198_splice|PCDH15_uc001jjv.1_Splice_Site_p.P176_splice|PCDH15_uc010qhv.1_Splice_Site_p.P198_splice|PCDH15_uc010qhw.1_Splice_Site_p.P198_splice|PCDH15_uc010qhx.1_Splice_Site_p.P198_splice|PCDH15_uc010qhy.1_Splice_Site_p.P203_splice|PCDH15_uc010qhz.1_Splice_Site_p.P198_splice|PCDH15_uc010qia.1_Splice_Site_p.P176_splice|PCDH15_uc010qib.1_Splice_Site_p.P176_splice|PCDH15_uc001jjw.2_Splice_Site_p.P198_splice	p.P198_splice	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			6	989	-		Melanoma(3;0.117)|Lung SC(717;0.238)						A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Splice_Site	SNP	ENST00000320301.6	37	c.594_splice	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.206285	0.79127	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4375	0.87555	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PCDH15	55776130	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.137000	0.77295	2.411000	0.81874	0.650000	0.86243	.		0.308	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	Intron	40	59	1	0	8.16e-20	1.08e-19	40	59				
IPMK	253430	broad.mit.edu	37	10	59955934	59955934	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:59955934T>C	ENST00000373935.3	-	6	1476	c.1154A>G	c.(1153-1155)gAt>gGt	p.D385G		NM_152230.4	NP_689416.1	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase	385					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|neural tube formation (GO:0001841)|small molecule metabolic process (GO:0044281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol tetrakisphosphate 3-kinase activity (GO:0000824)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)|inositol-1,4,5-trisphosphate 6-kinase activity (GO:0000823)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)	22						ATGAGCAAAATCTATCATTCG	0.363																																						uc001jkb.2		NA																	0				ovary(1)	1						c.(1153-1155)GAT>GGT		inositol polyphosphate multikinase							126.0	122.0	124.0					10																	59955934		2203	4300	6503	SO:0001583	missense	253430					nucleus	ATP binding|inositol trisphosphate 6-kinase activity	g.chr10:59955934T>C	AF432853	CCDS7250.1	10q21.1	2010-11-29		2004-07-22	ENSG00000151151	ENSG00000151151			20739	protein-coding gene	gene with protein product		609851				12223481, 12027805	Standard	NM_152230		Approved		uc001jkb.3	Q8NFU5	OTTHUMG00000018268	ENST00000373935.3:c.1154A>G	10.37:g.59955934T>C	ENSP00000363046:p.Asp385Gly		Somatic					p.D385G	NM_152230	NP_689416	WXS	Illumina HiSeq	Unspecified	Q8NFU5	IPMK_HUMAN			6	1477	-			385						Missense_Mutation	SNP	ENST00000373935.3	37	c.1154A>G	CCDS7250.1	.	.	.	.	.	.	.	.	.	.	T	19.42	3.823961	0.71143	.	.	ENSG00000151151	ENST00000373935	T	0.73681	-0.77	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.83986	0.5373	M	0.66939	2.045	0.47123	D	0.99932	D	0.89917	1.0	D	0.97110	1.0	D	0.83981	0.0332	9	.	.	.	-7.9519	13.0268	0.58819	0.0:0.0:0.0:1.0	.	385	Q8NFU5	IPMK_HUMAN	G	385	ENSP00000363046:D385G	.	D	-	2	0	IPMK	59625940	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.774000	0.75012	2.330000	0.79161	0.477000	0.44152	GAT		0.363	IPMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048142.1	NM_152230		95	143	0	0	0	0	95	143				
LRIT1	26103	broad.mit.edu	37	10	85992071	85992071	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:85992071A>G	ENST00000372105.3	-	4	1505	c.1484T>C	c.(1483-1485)gTg>gCg	p.V495A		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	495	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						GACACACGCCACATACTTGGT	0.567																																						uc001kcz.1		NA																	0					0						c.(1483-1485)GTG>GCG		retina specific protein PAL							58.0	52.0	54.0					10																	85992071		2203	4300	6503	SO:0001583	missense	26103					integral to endoplasmic reticulum membrane		g.chr10:85992071A>G	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.1484T>C	10.37:g.85992071A>G	ENSP00000361177:p.Val495Ala		Somatic					p.V495A	NM_015613	NP_056428	WXS	Illumina HiSeq	Unspecified	Q9P2V4	LRIT1_HUMAN			4	1506	-			495			Fibronectin type-III.|Lumenal (Potential).		Q0QD41|Q9Y4N7	Missense_Mutation	SNP	ENST00000372105.3	37	c.1484T>C	CCDS7373.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.959493	0.74016	.	.	ENSG00000148602	ENST00000372105	T	0.57436	0.4	5.71	5.71	0.89125	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.114346	0.56097	D	0.000035	T	0.62270	0.2414	M	0.69823	2.125	0.45979	D	0.998797	P	0.50819	0.939	P	0.54664	0.758	T	0.60383	-0.7274	10	0.08837	T	0.75	.	14.9655	0.71188	1.0:0.0:0.0:0.0	.	495	Q9P2V4	LRIT1_HUMAN	A	495	ENSP00000361177:V495A	ENSP00000361177:V495A	V	-	2	0	LRIT1	85982051	1.000000	0.71417	0.998000	0.56505	0.528000	0.34623	8.956000	0.93066	2.177000	0.69029	0.460000	0.39030	GTG		0.567	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613		14	29	0	0	0	0	14	29				
LRIT1	26103	broad.mit.edu	37	10	85992310	85992310	+	Silent	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:85992310C>A	ENST00000372105.3	-	4	1266	c.1245G>T	c.(1243-1245)ctG>ctT	p.L415L		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	415						integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						AGAGCTCTCCCAGGGCATCCA	0.607																																						uc001kcz.1		NA																	0					0						c.(1243-1245)CTG>CTT		retina specific protein PAL							80.0	70.0	73.0					10																	85992310		2203	4300	6503	SO:0001819	synonymous_variant	26103					integral to endoplasmic reticulum membrane		g.chr10:85992310C>A	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.1245G>T	10.37:g.85992310C>A			Somatic					p.L415L	NM_015613	NP_056428	WXS	Illumina HiSeq	Unspecified	Q9P2V4	LRIT1_HUMAN			4	1267	-			415			Lumenal (Potential).		Q0QD41|Q9Y4N7	Silent	SNP	ENST00000372105.3	37	c.1245G>T	CCDS7373.1																																																																																				0.607	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613		48	90	1	0	4.86e-25	6.65e-25	48	90				
KIF20B	9585	broad.mit.edu	37	10	91479299	91479299	+	Missense_Mutation	SNP	A	A	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:91479299A>C	ENST00000371728.3	+	13	1623	c.1558A>C	c.(1558-1560)Att>Ctt	p.I520L	KIF20B_ENST00000260753.4_Missense_Mutation_p.I520L|KIF20B_ENST00000416354.1_Missense_Mutation_p.I520L|KIF20B_ENST00000394289.2_Missense_Mutation_p.I520L	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	520					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						AAGAGCCACCATTTCATGGGA	0.343																																						uc001kgs.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(1558-1560)ATT>CTT		M-phase phosphoprotein 1							43.0	46.0	45.0					10																	91479299		2202	4300	6502	SO:0001583	missense	9585				cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding	g.chr10:91479299A>C	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.1558A>C	10.37:g.91479299A>C	ENSP00000360793:p.Ile520Leu		Somatic				KIF20B_uc001kgr.1_Missense_Mutation_p.I520L	p.I520L	NM_016195	NP_057279	WXS	Illumina HiSeq	Unspecified	Q96Q89	KI20B_HUMAN			13	1630	+			520					A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37	c.1558A>C		.	.	.	.	.	.	.	.	.	.	A	14.96	2.692357	0.48202	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	5.59	3.26	0.37387	.	0.397184	0.21933	N	0.066992	T	0.36248	0.0960	L	0.60455	1.87	0.21473	N	0.999676	P;B	0.40197	0.706;0.383	B;B	0.40534	0.332;0.095	T	0.28933	-1.0028	10	0.49607	T	0.09	-4.1221	4.3688	0.11237	0.6396:0.0:0.2251:0.1353	.	520;520	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	L	520	ENSP00000260753:I520L;ENSP00000411545:I520L;ENSP00000377830:I520L;ENSP00000360793:I520L	ENSP00000260753:I520L	I	+	1	0	KIF20B	91469279	0.012000	0.17670	0.540000	0.28089	0.982000	0.71751	0.447000	0.21710	0.414000	0.25790	0.477000	0.44152	ATT		0.343	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195		21	35	0	0	0	0	21	35				
ZNF518A	9849	broad.mit.edu	37	10	97918677	97918677	+	RNA	SNP	A	A	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:97918677A>T	ENST00000534948.1	+	0	3455							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		AACAAGTGTCATCAATACCAC	0.393																																						uc001klp.2		NA																	0				ovary(1)	1						c.(2596-2598)TCA>TCT		zinc finger protein 518							63.0	62.0	62.0					10																	97918677		1862	4109	5971			9849				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:97918677A>T	AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97918677A>T			Somatic				ZNF518A_uc001klo.1_Silent_p.S336S|ZNF518A_uc001klq.2_Silent_p.S866S|ZNF518A_uc001klr.2_Silent_p.S866S	p.S866S	NM_014803	NP_055618	WXS	Illumina HiSeq	Unspecified	Q6AHZ1	Z518A_HUMAN		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)	6	3455	+		Colorectal(252;0.0815)	866					A0PJI5|O15044|Q32MP4	Silent	SNP	ENST00000534948.1	37	c.2598A>T																																																																																					0.393	ZNF518A-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014803		33	45	0	0	0	0	33	45				
SFXN2	118980	broad.mit.edu	37	10	104486494	104486494	+	Missense_Mutation	SNP	G	G	T	rs201929596		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:104486494G>T	ENST00000369893.5	+	2	268	c.101G>T	c.(100-102)cGc>cTc	p.R34L	SFXN2_ENST00000602785.1_3'UTR	NM_178858.4	NP_849189.1	Q96NB2	SFXN2_HUMAN	sideroflexin 2	34					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)	p.R34H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|prostate(1)	13		Colorectal(252;0.207)		Epithelial(162;4.53e-09)|all cancers(201;1.2e-07)|BRCA - Breast invasive adenocarcinoma(275;0.218)		ACGGACCCCCGCACTGTCTTT	0.587																																						uc001kwb.2		NA																	1	Substitution - Missense(1)		large_intestine(1)		0						c.(100-102)CGC>CTC		sideroflexin 2							83.0	83.0	83.0					10																	104486494		2203	4300	6503	SO:0001583	missense	118980				iron ion homeostasis	integral to membrane	cation transmembrane transporter activity	g.chr10:104486494G>T	AF462052	CCDS7539.1	10q24.32	2006-03-13			ENSG00000156398	ENSG00000156398		"""Sideroflexins"""	16086	protein-coding gene	gene with protein product		615570					Standard	NM_178858		Approved		uc001kwb.2	Q96NB2	OTTHUMG00000018967	ENST00000369893.5:c.101G>T	10.37:g.104486494G>T	ENSP00000358909:p.Arg34Leu		Somatic				SFXN2_uc001kwc.2_RNA|SFXN2_uc001kwd.2_RNA	p.R34L	NM_178858	NP_849189	WXS	Illumina HiSeq	Unspecified	Q96NB2	SFXN2_HUMAN		Epithelial(162;4.53e-09)|all cancers(201;1.2e-07)|BRCA - Breast invasive adenocarcinoma(275;0.218)	2	267	+		Colorectal(252;0.207)	34					Q5JSM6	Missense_Mutation	SNP	ENST00000369893.5	37	c.101G>T	CCDS7539.1	.	.	.	.	.	.	.	.	.	.	G	8.154	0.788085	0.16258	.	.	ENSG00000156398	ENST00000369893	T	0.27256	1.68	5.63	5.63	0.86233	.	0.102918	0.64402	D	0.000005	T	0.25791	0.0628	L	0.43923	1.385	0.80722	D	1	B	0.13145	0.007	B	0.21708	0.036	T	0.08953	-1.0697	10	0.12430	T	0.62	6.0E-4	19.6913	0.96002	0.0:0.0:1.0:0.0	.	34	Q96NB2	SFXN2_HUMAN	L	34	ENSP00000358909:R34L	ENSP00000358909:R34L	R	+	2	0	SFXN2	104476484	1.000000	0.71417	0.999000	0.59377	0.627000	0.37826	6.611000	0.74183	2.654000	0.90174	0.561000	0.74099	CGC		0.587	SFXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050096.2	XM_058359		47	87	1	0	1.19e-25	1.65e-25	47	87				
ATRNL1	26033	broad.mit.edu	37	10	117075091	117075091	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:117075091G>T	ENST00000355044.3	+	18	3008	c.2882G>T	c.(2881-2883)tGc>tTc	p.C961F	ATRNL1_ENST00000423111.2_Missense_Mutation_p.C58F|ATRNL1_ENST00000303745.7_5'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	961	PSI 5.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TGTGGCTGGTGCAATGATCCT	0.443																																						uc001lcg.2		NA																	0				ovary(5)|lung(1)|central_nervous_system(1)	7						c.(2881-2883)TGC>TTC		attractin-like 1 precursor							130.0	114.0	119.0					10																	117075091		2203	4300	6503	SO:0001583	missense	26033					integral to membrane	sugar binding	g.chr10:117075091G>T	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2882G>T	10.37:g.117075091G>T	ENSP00000347152:p.Cys961Phe		Somatic				ATRNL1_uc010qsm.1_Missense_Mutation_p.C136F|ATRNL1_uc010qsn.1_RNA	p.C961F	NM_207303	NP_997186	WXS	Illumina HiSeq	Unspecified	Q5VV63	ATRN1_HUMAN		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)	18	3268	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)	961			PSI 5.|Extracellular (Potential).		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	c.2882G>T	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.508076	0.85282	.	.	ENSG00000107518	ENST00000355044;ENST00000423111	T;D	0.98550	1.47;-4.99	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.99165	0.9711	M	0.90814	3.15	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	D	0.99494	1.0951	10	0.87932	D	0	-12.1219	19.0432	0.93010	0.0:0.0:1.0:0.0	.	58;961	B4DH41;Q5VV63	.;ATRN1_HUMAN	F	961;58	ENSP00000347152:C961F;ENSP00000409624:C58F	ENSP00000347152:C961F	C	+	2	0	ATRNL1	117065081	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.731000	0.98807	2.510000	0.84645	0.455000	0.32223	TGC		0.443	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349		30	70	1	0	1.27e-14	1.59e-14	30	70				
PDZD8	118987	broad.mit.edu	37	10	119044034	119044034	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:119044034T>C	ENST00000334464.5	-	5	2449	c.2210A>G	c.(2209-2211)gAa>gGa	p.E737G	PDZD8_ENST00000482496.1_5'UTR	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	737					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		AGCCACATCTTCAAGTTTTAA	0.448																																						uc001lde.1		NA																	0					0						c.(2209-2211)GAA>GGA		PDZ domain containing 8							127.0	113.0	118.0					10																	119044034		2203	4300	6503	SO:0001583	missense	118987				intracellular signal transduction		metal ion binding	g.chr10:119044034T>C	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.2210A>G	10.37:g.119044034T>C	ENSP00000334642:p.Glu737Gly		Somatic					p.E737G	NM_173791	NP_776152	WXS	Illumina HiSeq	Unspecified	Q8NEN9	PDZD8_HUMAN		all cancers(201;0.0121)	5	2409	-		Colorectal(252;0.19)	737					Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	37	c.2210A>G	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	T	15.17	2.754806	0.49362	.	.	ENSG00000165650	ENST00000334464	D	0.86497	-2.13	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.89466	0.6723	L	0.34521	1.04	0.49798	D	0.999823	D	0.89917	1.0	D	0.69307	0.963	D	0.88464	0.3057	10	0.33940	T	0.23	-20.1835	16.4381	0.83884	0.0:0.0:0.0:1.0	.	737	Q8NEN9	PDZD8_HUMAN	G	737	ENSP00000334642:E737G	ENSP00000334642:E737G	E	-	2	0	PDZD8	119034024	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.139000	0.71728	2.280000	0.76307	0.533000	0.62120	GAA		0.448	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791		55	54	0	0	0	0	55	54				
GPR123	84435	broad.mit.edu	37	10	134885501	134885501	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr10:134885501G>T	ENST00000607359.1	+	2	260	c.260G>T	c.(259-261)tGg>tTg	p.W87L				Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	0					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		TCATGGGCGTGGGTCTTCAGA	0.652																																						uc001llw.2		NA																	0					0						c.(259-261)TGG>TTG		RecName: Full=Probable G-protein coupled receptor 123;							30.0	33.0	32.0					10																	134885501		1555	3572	5127	SO:0001583	missense	84435					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:134885501G>T	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000607359.1:c.260G>T	10.37:g.134885501G>T	ENSP00000475778:p.Trp87Leu		Somatic					p.W87L			WXS	Illumina HiSeq	Unspecified	Q86SQ6	GP123_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)	2	260	+		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)	Error:Variant_position_missing_in_Q86SQ6_after_alignment					A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	ENST00000607359.1	37	c.260G>T		.	.	.	.	.	.	.	.	.	.	g	1.813	-0.474060	0.04414	.	.	ENSG00000197177	ENST00000368577;ENST00000392609	.	.	.	0.75	-0.387	0.12463	.	.	.	.	.	T	0.33527	0.0866	.	.	.	.	.	.	B	0.06786	0.001	B	0.01281	0.0	T	0.30736	-0.9968	5	0.87932	D	0	.	.	.	.	.	87	Q86SQ6-1	.	L	87	.	ENSP00000357566:W87L	W	+	2	0	GPR123	134735491	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.764000	0.04735	-0.148000	0.11234	0.197000	0.17608	TGG		0.652	GPR123-004	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316904.2			3	5	1	0	0.004672	0.00491766	3	5				
OR51L1	119682	broad.mit.edu	37	11	5020434	5020434	+	Silent	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:5020434G>C	ENST00000321543.1	+	1	222	c.222G>C	c.(220-222)ggG>ggC	p.G74G		NM_001004755.1	NP_001004755.1	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L, member 1	74						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(19)|skin(2)|stomach(1)	31		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATGACCTGGGGATGTCCCTGT	0.458																																						uc010qyu.1		NA																	0				skin(1)	1						c.(220-222)GGG>GGC		olfactory receptor, family 51, subfamily L,							204.0	171.0	182.0					11																	5020434		2201	4298	6499	SO:0001819	synonymous_variant	119682				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5020434G>C	AB065799	CCDS31369.1	11p15.4	2012-08-09			ENSG00000176798	ENSG00000176798		"""GPCR / Class A : Olfactory receptors"""	14759	protein-coding gene	gene with protein product							Standard	NM_001004755		Approved		uc010qyu.2	Q8NGJ5	OTTHUMG00000066605	ENST00000321543.1:c.222G>C	11.37:g.5020434G>C			Somatic					p.G74G	NM_001004755	NP_001004755	WXS	Illumina HiSeq	Unspecified	Q8NGJ5	O51L1_HUMAN		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	222	+		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)	74			Helical; Name=2; (Potential).		Q6IFE5	Silent	SNP	ENST00000321543.1	37	c.222G>C	CCDS31369.1																																																																																				0.458	OR51L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142812.1	NM_001004755		96	169	0	0	0	0	96	169				
OR52N5	390075	broad.mit.edu	37	11	5799430	5799430	+	Silent	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:5799430G>C	ENST00000317093.2	-	1	467	c.435C>G	c.(433-435)ctC>ctG	p.L145L	TRIM5_ENST00000380027.1_Intron	NM_001001922.2	NP_001001922.2	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N, member 5	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(1)|lung(17)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		TAGGGTTGGTGAGTGTGGTAG	0.507																																						uc010qzn.1		NA																	0				skin(2)	2						c.(433-435)CTC>CTG		olfactory receptor, family 52, subfamily N,							145.0	115.0	125.0					11																	5799430		2125	4094	6219	SO:0001819	synonymous_variant	390075				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5799430G>C	AB065535	CCDS31397.1	11p15.4	2012-08-09			ENSG00000181009	ENSG00000181009		"""GPCR / Class A : Olfactory receptors"""	15231	protein-coding gene	gene with protein product							Standard	NM_001001922		Approved	OR52N5Q	uc010qzn.2	Q8NH56	OTTHUMG00000168799	ENST00000317093.2:c.435C>G	11.37:g.5799430G>C			Somatic				TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	p.L145L	NM_001001922	NP_001001922	WXS	Illumina HiSeq	Unspecified	Q8NH56	O52N5_HUMAN		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)	1	435	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	145			Cytoplasmic (Potential).		B9EH12|Q6IFG2	Silent	SNP	ENST00000317093.2	37	c.435C>G	CCDS31397.1																																																																																				0.507	OR52N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401141.1	NM_001001922		61	66	0	0	0	0	61	66				
NLRP14	338323	broad.mit.edu	37	11	7079072	7079072	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:7079072G>C	ENST00000299481.4	+	7	2802	c.2456G>C	c.(2455-2457)aGa>aCa	p.R819T		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	819					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TATCTAGAGAGACTGTCGTGA	0.408																																						uc001mfb.1		NA																	0				ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8						c.(2455-2457)AGA>ACA		NLR family, pyrin domain containing 14							203.0	180.0	188.0					11																	7079072		2201	4296	6497	SO:0001583	missense	338323				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	g.chr11:7079072G>C	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2456G>C	11.37:g.7079072G>C	ENSP00000299481:p.Arg819Thr		Somatic					p.R819T	NM_176822	NP_789792	WXS	Illumina HiSeq	Unspecified	Q86W24	NAL14_HUMAN		Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	7	2779	+			819			LRR 4.		Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	c.2456G>C	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	G	5.037	0.192566	0.09599	.	.	ENSG00000158077	ENST00000299481	T	0.38401	1.14	4.89	2.82	0.32997	.	0.142496	0.32703	N	0.005758	T	0.27349	0.0671	N	0.11651	0.15	0.31168	N	0.703595	D	0.59767	0.986	P	0.55455	0.776	T	0.12578	-1.0542	10	0.41790	T	0.15	.	5.9888	0.19450	0.108:0.2475:0.6446:0.0	.	819	Q86W24	NAL14_HUMAN	T	819	ENSP00000299481:R819T	ENSP00000299481:R819T	R	+	2	0	NLRP14	7035648	0.990000	0.36364	0.791000	0.31998	0.987000	0.75469	0.479000	0.22228	1.209000	0.43321	0.585000	0.79938	AGA		0.408	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		46	102	0	0	0	0	46	102				
RPS13	6207	broad.mit.edu	37	11	17095985	17095985	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:17095985C>G	ENST00000525634.1	-	6	596	c.451G>C	c.(451-453)Gca>Cca	p.A151P	RPS13_ENST00000228140.2_Silent_p.S139S|AC116533.1_ENST00000408395.1_RNA|RPS13_ENST00000526895.1_5'UTR|SNORD14B_ENST00000364533.1_RNA|SNORD14A_ENST00000606526.1_RNA			P62277	RS13_HUMAN	ribosomal protein S13	151					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of RNA splicing (GO:0033119)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribosome (GO:0005840)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)	5						CAAATTTATGCGACCAGGGCA	0.318																																						uc001mmp.2		NA																	0					0						c.(451-453)GCA>CCA		ribosomal protein S13							44.0	43.0	43.0					11																	17095985		2200	4293	6493	SO:0001583	missense	6207				endocrine pancreas development|negative regulation of RNA splicing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	mRNA binding|protein binding|structural constituent of ribosome	g.chr11:17095985C>G	X79239	CCDS7823.1	11p	2011-04-05			ENSG00000110700	ENSG00000110700		"""S ribosomal proteins"""	10386	protein-coding gene	gene with protein product	"""40S ribosomal protein S13"""	180476				8332508, 9582194	Standard	NM_001017		Approved	S13	uc001mmp.3	P62277	OTTHUMG00000165988	ENST00000525634.1:c.451G>C	11.37:g.17095985C>G	ENSP00000435777:p.Ala151Pro		Somatic					p.A151P	NM_001017	NP_001008	WXS	Illumina HiSeq	Unspecified	P62277	RS13_HUMAN			6	483	-			151					B2R549|P19116|Q02546|Q29200|Q498Y0	Missense_Mutation	SNP	ENST00000525634.1	37	c.451G>C	CCDS7823.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.765652	0.90020	.	.	ENSG00000110700	ENST00000525634	.	.	.	5.71	5.71	0.89125	.	0.054448	0.64402	D	0.000001	D	0.84602	0.5508	H	0.94183	3.505	0.80722	D	1	D	0.63046	0.992	P	0.61940	0.896	D	0.88133	0.2839	9	0.87932	D	0	-18.6488	12.7703	0.57417	0.0:0.9248:0.0:0.0752	.	151	P62277	RS13_HUMAN	P	151	.	ENSP00000435777:A151P	A	-	1	0	RPS13	17052561	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.729000	0.84864	2.709000	0.92574	0.655000	0.94253	GCA		0.318	RPS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387320.2	NM_001017		17	37	0	0	0	0	17	37				
SLC17A6	57084	broad.mit.edu	37	11	22363186	22363186	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:22363186C>A	ENST00000263160.3	+	2	636	c.199C>A	c.(199-201)Ctg>Atg	p.L67M		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	67					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						GTGCTTCGGCCTGCCCCGCCG	0.627																																						uc001mqk.2		NA																	0				ovary(3)|breast(1)	4						c.(199-201)CTG>ATG		solute carrier family 17 (sodium-dependent							53.0	45.0	47.0					11																	22363186		2203	4300	6503	SO:0001583	missense	57084				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity	g.chr11:22363186C>A	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.199C>A	11.37:g.22363186C>A	ENSP00000263160:p.Leu67Met		Somatic					p.L67M	NM_020346	NP_065079	WXS	Illumina HiSeq	Unspecified	Q9P2U8	VGLU2_HUMAN			2	612	+			67			Cytoplasmic (Potential).		A6NKS2	Missense_Mutation	SNP	ENST00000263160.3	37	c.199C>A	CCDS7856.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.007032	0.54361	.	.	ENSG00000091664	ENST00000263160	T	0.59364	0.27	6.01	6.01	0.97437	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.51787	0.1695	L	0.37561	1.115	0.58432	D	0.999999	B	0.32338	0.365	B	0.30401	0.115	T	0.44483	-0.9325	10	0.36615	T	0.2	.	20.5211	0.99222	0.0:1.0:0.0:0.0	.	67	Q9P2U8	VGLU2_HUMAN	M	67	ENSP00000263160:L67M	ENSP00000263160:L67M	L	+	1	2	SLC17A6	22319762	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.067000	0.50010	2.861000	0.98227	0.650000	0.86243	CTG		0.627	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346		19	21	1	0	2.89e-11	3.47e-11	19	21				
BDNF	627	broad.mit.edu	37	11	27679873	27679873	+	Missense_Mutation	SNP	T	T	C	rs370382246		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:27679873T>C	ENST00000525528.1	-	1	1332	c.239A>G	c.(238-240)aAt>aGt	p.N80S	BDNF_ENST00000438929.1_Missense_Mutation_p.N162S|BDNF_ENST00000314915.6_Missense_Mutation_p.N88S|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000356660.4_Missense_Mutation_p.N80S|BDNF_ENST00000530861.1_Missense_Mutation_p.N80S|BDNF_ENST00000395981.3_Missense_Mutation_p.N80S|BDNF_ENST00000439476.2_Missense_Mutation_p.N80S|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000532997.1_Missense_Mutation_p.N80S|BDNF_ENST00000395986.2_Missense_Mutation_p.N95S|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000533246.1_Missense_Mutation_p.N80S|BDNF-AS_ENST00000532965.1_RNA|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000584049.1_5'UTR|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000420794.1_Missense_Mutation_p.N80S|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000525950.1_Missense_Mutation_p.N80S|BDNF_ENST00000533131.1_Missense_Mutation_p.N80S|BDNF_ENST00000395978.3_Missense_Mutation_p.N80S|BDNF_ENST00000418212.1_Missense_Mutation_p.N80S|BDNF_ENST00000395980.2_Missense_Mutation_p.N80S|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000395983.3_Missense_Mutation_p.N80S	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor	80					axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						GTTTTCTTCATTGGGCCGAAC	0.493													T|||	1	0.000199681	0.0	0.0	5008	,	,		19715	0.0		0.0	False		,,,				2504	0.001					uc010rdu.1		NA																	0					0						c.(238-240)AAT>AGT		brain-derived neurotrophic factor isoform a		T	SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN	0,4404		0,0,2202	197.0	189.0	191.0		239,239,239,239,326,485,239,239,239,239,239,239,263,239,239,284,239	-1.2	0.0	11		191	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	BDNF	NM_001143805.1,NM_001143806.1,NM_001143807.1,NM_001143808.1,NM_001143809.1,NM_001143810.1,NM_001143811.1,NM_001143812.1,NM_001143813.1,NM_001143814.1,NM_001143816.1,NM_001709.4,NM_170731.4,NM_170732.4,NM_170733.3,NM_170734.3,NM_170735.5	46,46,46,46,46,46,46,46,46,46,46,46,46,46,46,46,46	0,1,6500	CC,CT,TT		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	80/248,80/248,80/248,80/248,109/277,162/330,80/248,80/248,80/248,80/248,80/248,80/248,88/256,80/248,80/248,95/263,80/248	27679873	1,13001	2202	4299	6501	SO:0001583	missense	627					extracellular region	growth factor activity	g.chr11:27679873T>C	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.239A>G	11.37:g.27679873T>C	ENSP00000437138:p.Asn80Ser		Somatic				BDNFOS_uc001mrm.2_RNA|BDNFOS_uc009yij.2_RNA|BDNFOS_uc009yik.2_RNA|BDNFOS_uc009yil.2_RNA|BDNFOS_uc001mrp.2_RNA|BDNFOS_uc009yim.2_RNA|BDNFOS_uc009yin.2_RNA|BDNFOS_uc009yio.2_RNA|BDNFOS_uc009yip.2_RNA|BDNFOS_uc001mrn.2_RNA|BDNFOS_uc009yiq.2_RNA|BDNFOS_uc001mro.2_RNA|BDNFOS_uc009yir.2_RNA|BDNFOS_uc009yis.2_Intron|BDNFOS_uc009yit.2_RNA|BDNFOS_uc009yiu.2_RNA|BDNFOS_uc009yiv.2_RNA|BDNFOS_uc009yiw.2_RNA|BDNFOS_uc009yix.2_RNA|BDNFOS_uc009yiy.2_RNA|BDNFOS_uc009yiz.2_RNA|BDNFOS_uc001mrq.3_RNA|BDNFOS_uc001mrr.3_RNA|BDNFOS_uc009yja.2_RNA|BDNFOS_uc009yjb.2_RNA|BDNF_uc010rdv.1_Missense_Mutation_p.N80S|BDNF_uc001mrt.2_Missense_Mutation_p.N95S|BDNF_uc010rdw.1_Missense_Mutation_p.N80S|BDNF_uc009yjd.2_Missense_Mutation_p.N80S|BDNF_uc001mru.2_Missense_Mutation_p.N80S|BDNF_uc010rdx.1_Missense_Mutation_p.N80S|BDNF_uc010rdy.1_Missense_Mutation_p.N80S|BDNF_uc009yjg.2_Missense_Mutation_p.N80S|BDNF_uc009yje.2_Missense_Mutation_p.N162S|BDNF_uc009yjf.2_Missense_Mutation_p.N109S|BDNF_uc001mrv.2_Missense_Mutation_p.N80S|BDNF_uc001mrw.3_Missense_Mutation_p.N80S|BDNF_uc001mrx.2_Missense_Mutation_p.N80S|BDNF_uc001mry.3_Missense_Mutation_p.N80S|BDNF_uc001mrz.3_Missense_Mutation_p.N80S|BDNF_uc001msa.2_Missense_Mutation_p.N88S	p.N80S	NM_001143816	NP_001137288	WXS	Illumina HiSeq	Unspecified	P23560	BDNF_HUMAN			2	1090	-			80					A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Missense_Mutation	SNP	ENST00000525528.1	37	c.239A>G	CCDS7866.1	.	.	.	.	.	.	.	.	.	.	T	2.023	-0.424372	0.04734	0.0	1.16E-4	ENSG00000176697	ENST00000439476;ENST00000525528;ENST00000395986;ENST00000533131;ENST00000356660;ENST00000418212;ENST00000533246;ENST00000530861;ENST00000395983;ENST00000438929;ENST00000395980;ENST00000532997;ENST00000395981;ENST00000395978;ENST00000525950;ENST00000314915;ENST00000420794;ENST00000528035	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83	6.16	-1.24	0.09435	.	1.261320	0.05281	N	0.519365	T	0.10121	0.0248	N	0.00729	-1.24	0.25357	N	0.988814	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001	B;B;B;B;B	0.09377	0.004;0.0;0.001;0.001;0.002	T	0.36212	-0.9757	10	0.87932	D	0	-12.2886	13.2	0.59763	0.0:0.7374:0.0:0.2626	.	109;162;88;80;95	P23560-5;P23560-4;P23560-2;P23560;P23560-3	.;.;.;BDNF_HUMAN;.	S	80;80;95;80;80;80;80;80;80;162;80;80;80;80;80;88;80;80	ENSP00000389345:N80S;ENSP00000437138:N80S;ENSP00000379309:N95S;ENSP00000432727:N80S;ENSP00000349084:N80S;ENSP00000400502:N80S;ENSP00000432376:N80S;ENSP00000435564:N80S;ENSP00000379307:N80S;ENSP00000414303:N162S;ENSP00000379304:N80S;ENSP00000435805:N80S;ENSP00000379305:N80S;ENSP00000379302:N80S;ENSP00000432035:N80S;ENSP00000320002:N88S;ENSP00000389564:N80S	ENSP00000320002:N88S	N	-	2	0	BDNF	27636449	0.162000	0.22906	0.000000	0.03702	0.234000	0.25298	0.726000	0.25984	-0.272000	0.09259	0.528000	0.53228	AAT		0.493	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388135.1	NM_170735		116	149	0	0	0	0	116	149				
HIPK3	10114	broad.mit.edu	37	11	33358705	33358705	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:33358705G>T	ENST00000303296.4	+	4	1611	c.1306G>T	c.(1306-1308)Gaa>Taa	p.E436*	HIPK3_ENST00000379016.3_Nonsense_Mutation_p.E436*|HIPK3_ENST00000534262.1_3'UTR|HIPK3_ENST00000525975.1_Nonsense_Mutation_p.E436*|HIPK3_ENST00000456517.1_Nonsense_Mutation_p.E436*	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	436	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						TTTTTGCAAAGAAACAGATAT	0.313																																						uc001mul.1		NA																	0				large_intestine(1)|skin(1)|stomach(1)|ovary(1)|pancreas(1)	5						c.(1306-1308)GAA>TAA		homeodomain interacting protein kinase 3 isoform							66.0	66.0	66.0					11																	33358705		2201	4295	6496	SO:0001587	stop_gained	10114				anti-apoptosis|apoptosis|negative regulation of JUN kinase activity|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	ATP binding|protein serine/threonine kinase activity	g.chr11:33358705G>T	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.1306G>T	11.37:g.33358705G>T	ENSP00000304226:p.Glu436*		Somatic				HIPK3_uc001mum.1_Nonsense_Mutation_p.E436*|HIPK3_uc009yjv.1_Nonsense_Mutation_p.E436*|HIPK3_uc009yjw.1_RNA	p.E436*	NM_005734	NP_005725	WXS	Illumina HiSeq	Unspecified	Q9H422	HIPK3_HUMAN			4	1576	+			436			Protein kinase.		O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Nonsense_Mutation	SNP	ENST00000303296.4	37	c.1306G>T	CCDS7884.1	.	.	.	.	.	.	.	.	.	.	G	37	6.431486	0.97564	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000456517	.	.	.	4.88	4.88	0.63580	.	0.000000	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.3941	0.90493	0.0:0.0:1.0:0.0	.	.	.	.	X	436	.	ENSP00000304226:E436X	E	+	1	0	HIPK3	33315281	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.813000	0.99286	2.410000	0.81850	0.563000	0.77884	GAA		0.313	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734		24	30	1	0	4.27e-12	5.2e-12	24	30				
OR4C13	283092	broad.mit.edu	37	11	49974253	49974253	+	Silent	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:49974253T>C	ENST00000555099.1	+	1	311	c.279T>C	c.(277-279)aaT>aaC	p.N93N		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						TCTTATTCAATGGATGTATGA	0.418																																						uc010rhz.1		NA																	0				skin(3)|ovary(1)	4						c.(277-279)AAT>AAC		olfactory receptor, family 4, subfamily C,							140.0	137.0	138.0					11																	49974253		2201	4296	6497	SO:0001819	synonymous_variant	283092				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:49974253T>C	AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.279T>C	11.37:g.49974253T>C			Somatic					p.N93N	NM_001001955	NP_001001955	WXS	Illumina HiSeq	Unspecified	Q8NGP0	OR4CD_HUMAN			1	279	+			93			Extracellular (Potential).		A6NJJ3|B9EH30|Q6IF48|Q96R68	Silent	SNP	ENST00000555099.1	37	c.279T>C	CCDS31495.1																																																																																				0.418	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391103.1	NM_001001955		121	160	0	0	0	0	121	160				
OR4A16	81327	broad.mit.edu	37	11	55110931	55110931	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:55110931T>A	ENST00000314721.2	+	1	305	c.255T>A	c.(253-255)tgT>tgA	p.C85*		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C85C(1)		NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						ACTTACTCTGTGATAAAATCG	0.448																																						uc010rie.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|pancreas(1)	3						c.(253-255)TGT>TGA		olfactory receptor, family 4, subfamily A,							203.0	184.0	190.0					11																	55110931		2201	4296	6497	SO:0001587	stop_gained	81327				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55110931T>A	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.255T>A	11.37:g.55110931T>A	ENSP00000325128:p.Cys85*		Somatic					p.C85*	NM_001005274	NP_001005274	WXS	Illumina HiSeq	Unspecified	Q8NH70	O4A16_HUMAN			1	255	+			85			Extracellular (Potential).		Q6IFL3	Nonsense_Mutation	SNP	ENST00000314721.2	37	c.255T>A	CCDS31499.1	.	.	.	.	.	.	.	.	.	.	t	5.231	0.228023	0.09916	.	.	ENSG00000181961	ENST00000314721	.	.	.	2.57	2.57	0.30868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	5.687	0.17809	0.0:0.0:0.2812:0.7188	.	.	.	.	X	85	.	ENSP00000325128:C85X	C	+	3	2	OR4A16	54867507	0.000000	0.05858	0.099000	0.21106	0.030000	0.12068	-2.549000	0.00930	1.186000	0.42985	0.346000	0.21813	TGT		0.448	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274		138	213	0	0	0	0	138	213				
OR4A15	81328	broad.mit.edu	37	11	55135423	55135423	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:55135423C>G	ENST00000314706.3	+	1	64	c.64C>G	c.(64-66)Ctg>Gtg	p.L22V		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						GCTCCGACACCTGAGTCCAAC	0.413																																						uc010rif.1		NA																	0				ovary(1)|skin(1)	2						c.(64-66)CTG>GTG		olfactory receptor, family 4, subfamily A,							60.0	54.0	56.0					11																	55135423		2201	4296	6497	SO:0001583	missense	81328				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55135423C>G	AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.64C>G	11.37:g.55135423C>G	ENSP00000325065:p.Leu22Val		Somatic					p.L22V	NM_001005275	NP_001005275	WXS	Illumina HiSeq	Unspecified	Q8NGL6	O4A15_HUMAN			1	64	+			22			Extracellular (Potential).		Q6IFL4|Q96R65	Missense_Mutation	SNP	ENST00000314706.3	37	c.64C>G	CCDS31500.1	.	.	.	.	.	.	.	.	.	.	c	7.502	0.652832	0.14580	.	.	ENSG00000181958	ENST00000314706	T	0.17528	2.27	2.24	2.24	0.28232	.	.	.	.	.	T	0.08179	0.0204	N	0.08118	0	0.09310	N	1	B	0.28026	0.198	B	0.24155	0.051	T	0.25676	-1.0125	9	0.37606	T	0.19	.	8.0837	0.30760	0.0:1.0:0.0:0.0	.	22	Q8NGL6	O4A15_HUMAN	V	22	ENSP00000325065:L22V	ENSP00000325065:L22V	L	+	1	2	OR4A15	54891999	0.001000	0.12720	0.006000	0.13384	0.020000	0.10135	0.088000	0.14979	1.577000	0.49804	0.492000	0.49549	CTG		0.413	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391161.1	NM_001005275		22	53	0	0	0	0	22	53				
OR5D18	219438	broad.mit.edu	37	11	55587238	55587238	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:55587238G>T	ENST00000333976.4	+	1	153	c.133G>T	c.(133-135)Ggg>Tgg	p.G45W		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G45W(1)		NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				AGGGAATATTGGGTTGATTGT	0.458																																						uc010rin.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(133-135)GGG>TGG		olfactory receptor, family 5, subfamily D,							199.0	183.0	189.0					11																	55587238		2200	4296	6496	SO:0001583	missense	219438				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55587238G>T	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.133G>T	11.37:g.55587238G>T	ENSP00000335025:p.Gly45Trp		Somatic					p.G45W	NM_001001952	NP_001001952	WXS	Illumina HiSeq	Unspecified	Q8NGL1	OR5DI_HUMAN			1	133	+		all_epithelial(135;0.208)	45			Helical; Name=1; (Potential).		Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	ENST00000333976.4	37	c.133G>T	CCDS31510.1	.	.	.	.	.	.	.	.	.	.	.	13.15	2.150852	0.37923	.	.	ENSG00000186119	ENST00000333976	T	0.01084	5.36	4.94	4.03	0.46877	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40144	N	0.001175	T	0.06600	0.0169	M	0.87180	2.865	0.30865	N	0.733075	D	0.89917	1.0	D	0.79108	0.992	T	0.01416	-1.1360	10	0.87932	D	0	-17.8881	7.4201	0.27067	0.091:0.1685:0.7404:0.0	.	45	Q8NGL1	OR5DI_HUMAN	W	45	ENSP00000335025:G45W	ENSP00000335025:G45W	G	+	1	0	OR5D18	55343814	0.000000	0.05858	0.999000	0.59377	0.329000	0.28539	-0.068000	0.11561	1.269000	0.44280	-0.162000	0.13425	GGG		0.458	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952		123	144	1	0	1.06e-61	1.58e-61	123	144				
OR5D16	390144	broad.mit.edu	37	11	55606809	55606809	+	Silent	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:55606809T>A	ENST00000378396.1	+	1	582	c.582T>A	c.(580-582)tcT>tcA	p.S194S		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				ACCCTGACTCTTATCTCAGCC	0.393																																						uc010rio.1		NA																	0				ovary(4)|skin(1)	5						c.(580-582)TCT>TCA		olfactory receptor, family 5, subfamily D,							185.0	162.0	170.0					11																	55606809		2201	4296	6497	SO:0001819	synonymous_variant	390144				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55606809T>A	AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.582T>A	11.37:g.55606809T>A			Somatic					p.S194S	NM_001005496	NP_001005496	WXS	Illumina HiSeq	Unspecified	Q8NGK9	OR5DG_HUMAN			1	582	+		all_epithelial(135;0.208)	194			Extracellular (Potential).		Q6IF65|Q96RB4	Silent	SNP	ENST00000378396.1	37	c.582T>A	CCDS31512.1																																																																																				0.393	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496		68	117	0	0	0	0	68	117				
OR5I1	10798	broad.mit.edu	37	11	55703661	55703661	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:55703661G>T	ENST00000301532.3	-	1	215	c.216C>A	c.(214-216)gaC>gaA	p.D72E		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	72					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						AATAGCAAAGGTCTACAAATG	0.383																																						uc010ris.1		NA																	0				ovary(1)	1						c.(214-216)GAC>GAA		olfactory receptor, family 5, subfamily I,							53.0	54.0	53.0					11																	55703661		2197	4295	6492	SO:0001583	missense	10798				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55703661G>T	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.216C>A	11.37:g.55703661G>T	ENSP00000301532:p.Asp72Glu		Somatic					p.D72E	NM_006637	NP_006628	WXS	Illumina HiSeq	Unspecified	Q13606	OR5I1_HUMAN			1	216	-			72			Helical; Name=2; (Potential).		Q6IEU4	Missense_Mutation	SNP	ENST00000301532.3	37	c.216C>A	CCDS7949.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.697463	0.48202	.	.	ENSG00000167825	ENST00000301532	T	0.01152	5.26	4.95	1.54	0.23209	GPCR, rhodopsin-like superfamily (1);	0.131736	0.34268	N	0.004120	T	0.02533	0.0077	L	0.33624	1.015	0.28707	N	0.903774	D	0.64830	0.994	D	0.72625	0.978	T	0.34453	-0.9828	10	0.87932	D	0	.	5.7322	0.18047	0.461:0.0:0.539:0.0	.	72	Q13606	OR5I1_HUMAN	E	72	ENSP00000301532:D72E	ENSP00000301532:D72E	D	-	3	2	OR5I1	55460237	0.000000	0.05858	0.967000	0.41034	0.427000	0.31564	-1.370000	0.02575	0.606000	0.29965	-0.156000	0.13503	GAC		0.383	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637		29	39	1	0	3.74e-18	4.85e-18	29	39				
OR5F1	338674	broad.mit.edu	37	11	55761243	55761243	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:55761243G>A	ENST00000278409.1	-	1	858	c.859C>T	c.(859-861)Cct>Tct	p.P287S		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	287					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					TAGATCAGAGGATTCAACATG	0.438																																						uc010riv.1		NA																	0				ovary(1)|pancreas(1)	2						c.(859-861)CCT>TCT		olfactory receptor, family 5, subfamily F,							74.0	75.0	75.0					11																	55761243		2201	4296	6497	SO:0001583	missense	338674				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55761243G>A	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.859C>T	11.37:g.55761243G>A	ENSP00000278409:p.Pro287Ser		Somatic					p.P287S	NM_003697	NP_003688	WXS	Illumina HiSeq	Unspecified	O95221	OR5F1_HUMAN			1	859	-	Esophageal squamous(21;0.00448)		287			Helical; Name=7; (Potential).		Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	c.859C>T	CCDS31515.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.457755	0.43634	.	.	ENSG00000149133	ENST00000278409	T	0.63417	-0.04	2.99	2.99	0.34606	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.79545	0.4464	M	0.84846	2.72	0.43846	D	0.996435	D	0.89917	1.0	D	0.91635	0.999	T	0.83277	-0.0040	9	0.87932	D	0	.	12.8727	0.57975	0.0:0.0:1.0:0.0	.	287	O95221	OR5F1_HUMAN	S	287	ENSP00000278409:P287S	ENSP00000278409:P287S	P	-	1	0	OR5F1	55517819	1.000000	0.71417	0.988000	0.46212	0.335000	0.28730	6.682000	0.74528	1.417000	0.47077	0.289000	0.19496	CCT		0.438	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697		25	52	0	0	0	0	25	52				
OR8K5	219453	broad.mit.edu	37	11	55927515	55927515	+	Silent	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:55927515G>C	ENST00000313447.1	-	1	278	c.279C>G	c.(277-279)tcC>tcG	p.S93S		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				ATGCATAATAGGAAATAGTAT	0.398																																						uc010rja.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(277-279)TCC>TCG		olfactory receptor, family 8, subfamily K,							97.0	96.0	96.0					11																	55927515		2201	4296	6497	SO:0001819	synonymous_variant	219453				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55927515G>C	BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.279C>G	11.37:g.55927515G>C			Somatic					p.S93S	NM_001004058	NP_001004058	WXS	Illumina HiSeq	Unspecified	Q8NH50	OR8K5_HUMAN			1	279	-	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)	93			Extracellular (Potential).		Q6IFB5	Silent	SNP	ENST00000313447.1	37	c.279C>G	CCDS31521.1																																																																																				0.398	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391543.1	NM_001004058		67	77	0	0	0	0	67	77				
OR5M9	390162	broad.mit.edu	37	11	56230837	56230837	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:56230837C>A	ENST00000279791.1	-	1	40	c.41G>T	c.(40-42)gGg>gTg	p.G14V		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					ACAGGTCAGCCCCAGGAGAGT	0.413																																						uc010rjj.1		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(40-42)GGG>GTG		olfactory receptor, family 5, subfamily M,							31.0	32.0	32.0					11																	56230837		2201	4296	6497	SO:0001583	missense	390162				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56230837C>A	AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.41G>T	11.37:g.56230837C>A	ENSP00000279791:p.Gly14Val		Somatic					p.G14V	NM_001004743	NP_001004743	WXS	Illumina HiSeq	Unspecified	Q8NGP3	OR5M9_HUMAN			1	41	-	Esophageal squamous(21;0.00448)		14			Extracellular (Potential).		Q6IEW5|Q96RB9	Missense_Mutation	SNP	ENST00000279791.1	37	c.41G>T	CCDS31531.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.716302	0.68844	.	.	ENSG00000150269	ENST00000279791	T	0.00659	5.94	4.79	4.79	0.61399	.	0.000000	0.44285	D	0.000468	T	0.06508	0.0167	M	0.90977	3.165	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.01238	-1.1409	10	0.87932	D	0	-9.6325	15.6896	0.77439	0.0:1.0:0.0:0.0	.	14	Q8NGP3	OR5M9_HUMAN	V	14	ENSP00000279791:G14V	ENSP00000279791:G14V	G	-	2	0	OR5M9	55987413	0.994000	0.37717	0.645000	0.29479	0.632000	0.37999	4.107000	0.57811	2.349000	0.79799	0.549000	0.68633	GGG		0.413	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391638.1	NM_001004743		16	26	1	0	5.01e-05	5.45e-05	16	26				
OR5AP2	338675	broad.mit.edu	37	11	56409494	56409494	+	Missense_Mutation	SNP	A	A	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:56409494A>T	ENST00000302981.1	-	1	421	c.422T>A	c.(421-423)cTc>cAc	p.L141H	OR5AP2_ENST00000544374.1_Missense_Mutation_p.L142H	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	141						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						CCCAGACACGAGAACTGGGTA	0.483																																						uc001njb.1		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(421-423)CTC>CAC		olfactory receptor, family 5, subfamily AP,							66.0	69.0	68.0					11																	56409494		2201	4296	6497	SO:0001583	missense	338675				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56409494A>T	AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.422T>A	11.37:g.56409494A>T	ENSP00000303111:p.Leu141His		Somatic					p.L141H	NM_001002925	NP_001002925	WXS	Illumina HiSeq	Unspecified	Q8NGF4	O5AP2_HUMAN			1	422	-			141			Helical; Name=4; (Potential).		B2RNM8	Missense_Mutation	SNP	ENST00000302981.1	37	c.422T>A	CCDS31534.1	.	.	.	.	.	.	.	.	.	.	A	8.979	0.974941	0.18736	.	.	ENSG00000172464	ENST00000544374;ENST00000302981	T;T	0.01379	4.96;4.96	4.82	3.7	0.42460	GPCR, rhodopsin-like superfamily (1);	0.517985	0.16312	N	0.219973	T	0.04003	0.0112	L	0.46670	1.46	0.36819	D	0.886297	D	0.63046	0.992	P	0.58391	0.838	T	0.52193	-0.8608	10	0.54805	T	0.06	.	10.1212	0.42621	0.9205:0.0:0.0795:0.0	.	141	Q8NGF4	O5AP2_HUMAN	H	142;141	ENSP00000442701:L142H;ENSP00000303111:L141H	ENSP00000303111:L141H	L	-	2	0	OR5AP2	56166070	0.989000	0.36119	0.886000	0.34754	0.004000	0.04260	3.331000	0.52075	0.879000	0.35944	0.519000	0.50382	CTC		0.483	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391613.1	NM_001002925		25	54	0	0	0	0	25	54				
P2RX3	5024	broad.mit.edu	37	11	57118349	57118349	+	Silent	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:57118349C>T	ENST00000263314.2	+	8	853	c.819C>T	c.(817-819)agC>agT	p.S273S		NM_002559.3	NP_002550.2	P56373	P2RX3_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 3	273					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of synaptic plasticity (GO:0048167)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to cold (GO:0009409)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)|transport (GO:0006810)|urinary bladder smooth muscle contraction (GO:0014832)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)			endometrium(4)|kidney(2)|large_intestine(4)|lung(15)|prostate(1)	26						AGAAAAGCAGCGTGTCCCCAG	0.542																																						uc001nju.2		NA																	0					0						c.(817-819)AGC>AGT		purinergic receptor P2X3							87.0	78.0	81.0					11																	57118349		2201	4296	6497	SO:0001819	synonymous_variant	5024				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity	g.chr11:57118349C>T	Y07683	CCDS7953.1	11q12	2012-01-17			ENSG00000109991	ENSG00000109991		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8534	protein-coding gene	gene with protein product		600843				9221902	Standard	NM_002559		Approved	P2X3	uc001nju.3	P56373	OTTHUMG00000167025	ENST00000263314.2:c.819C>T	11.37:g.57118349C>T			Somatic					p.S273S	NM_002559	NP_002550	WXS	Illumina HiSeq	Unspecified	P56373	P2RX3_HUMAN			8	895	+			273			Extracellular (Potential).		Q6DK37|Q9UQB6	Silent	SNP	ENST00000263314.2	37	c.819C>T	CCDS7953.1																																																																																				0.542	P2RX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392465.1	NM_002559		49	68	0	0	0	0	49	68				
SERPING1	710	broad.mit.edu	37	11	57379319	57379319	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:57379319G>T	ENST00000278407.4	+	7	1386	c.1159G>T	c.(1159-1161)Gag>Tag	p.E387*	SERPING1_ENST00000340687.6_Nonsense_Mutation_p.E350*|SERPING1_ENST00000403558.1_Nonsense_Mutation_p.E430*|SERPING1_ENST00000378324.2_Nonsense_Mutation_p.E335*|SERPING1_ENST00000378323.4_Nonsense_Mutation_p.E392*	NM_000062.2	NP_000053.2	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G (C1 inhibitor), member 1	387					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(1)	27						GGAGAAACTGGAGATGTCCAA	0.502																																						uc001nkp.1		NA																	0				central_nervous_system(1)	1						c.(1159-1161)GAG>TAG		serpin peptidase inhibitor, clade G, member 1							138.0	129.0	132.0					11																	57379319		2201	4296	6497	SO:0001587	stop_gained	710	Hereditary_Angioedema			blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity	g.chr11:57379319G>T	X54486	CCDS7962.1	11q12.1	2014-09-17	2008-07-31		ENSG00000149131	ENSG00000149131		"""Serine (or cysteine) peptidase inhibitors"""	1228	protein-coding gene	gene with protein product	"""plasma protease C1 inhibitor"", ""angioedema, hereditary"""	606860	"""serine (or cysteine) proteinase inhibitor, clade G (C1 inhibitor), member 1, (angioedema, hereditary)"""	C1NH		2026152, 24172014	Standard	NM_000062		Approved	C1IN, C1-INH, HAE1, HAE2	uc001nkp.1	P05155	OTTHUMG00000150304	ENST00000278407.4:c.1159G>T	11.37:g.57379319G>T	ENSP00000278407:p.Glu387*		Somatic				SERPING1_uc001nkq.1_Nonsense_Mutation_p.E350*|SERPING1_uc010rju.1_Nonsense_Mutation_p.E335*|SERPING1_uc010rjv.1_Nonsense_Mutation_p.E392*|SERPING1_uc001nkr.1_Nonsense_Mutation_p.E387*|SERPING1_uc009ymi.1_Nonsense_Mutation_p.E396*|SERPING1_uc009ymj.1_Intron|SERPING1_uc001nks.1_Nonsense_Mutation_p.E78*	p.E387*	NM_000062	NP_000053	WXS	Illumina HiSeq	Unspecified	P05155	IC1_HUMAN			7	1350	+			387					A6NMU0|A8KAI9|B2R6L5|B4E1F0|B4E1H2|Q16304|Q547W3|Q59EI5|Q7Z455|Q96FE0|Q9UC49|Q9UCF9	Nonsense_Mutation	SNP	ENST00000278407.4	37	c.1159G>T	CCDS7962.1	.	.	.	.	.	.	.	.	.	.	G	38	6.859210	0.97893	.	.	ENSG00000149131	ENST00000278407;ENST00000340687;ENST00000378323;ENST00000378324;ENST00000403558	.	.	.	4.69	4.69	0.59074	.	0.420068	0.25804	N	0.028186	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	14.8817	0.70537	0.0:0.0:1.0:0.0	.	.	.	.	X	387;350;392;335;430	.	ENSP00000278407:E387X	E	+	1	0	SERPING1	57135895	1.000000	0.71417	0.998000	0.56505	0.817000	0.46193	1.128000	0.31369	2.320000	0.78422	0.561000	0.74099	GAG		0.502	SERPING1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317465.1	NM_000062		58	104	1	0	1.73e-40	2.51e-40	58	104				
OR1S2	219958	broad.mit.edu	37	11	57970930	57970930	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:57970930A>G	ENST00000302592.6	-	1	723	c.724T>C	c.(724-726)Tca>Cca	p.S242P		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				TGTGTGGATGATACTCCCAGG	0.453																																						uc010rkb.1		NA																	0				ovary(1)	1						c.(724-726)TCA>CCA		olfactory receptor, family 1, subfamily S,							157.0	130.0	139.0					11																	57970930		2201	4296	6497	SO:0001583	missense	219958				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57970930A>G	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.724T>C	11.37:g.57970930A>G	ENSP00000305469:p.Ser242Pro		Somatic					p.S242P	NM_001004459	NP_001004459	WXS	Illumina HiSeq	Unspecified	Q8NGQ3	OR1S2_HUMAN			1	724	-		Breast(21;0.0589)	242			Cytoplasmic (Potential).		Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	c.724T>C	CCDS31545.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.900975	0.00517	.	.	ENSG00000197887	ENST00000302592	T	0.36878	1.23	4.75	4.75	0.60458	GPCR, rhodopsin-like superfamily (1);	0.176599	0.27460	N	0.019268	T	0.11110	0.0271	N	0.00683	-1.26	0.09310	N	1	B	0.23891	0.093	B	0.33568	0.166	T	0.38929	-0.9638	10	0.08837	T	0.75	.	6.0097	0.19569	0.8223:0.0:0.1777:0.0	.	242	Q8NGQ3	OR1S2_HUMAN	P	242	ENSP00000305469:S242P	ENSP00000305469:S242P	S	-	1	0	OR1S2	57727506	0.000000	0.05858	0.848000	0.33437	0.066000	0.16364	-0.556000	0.05992	2.119000	0.64992	0.533000	0.62120	TCA		0.453	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459		31	67	0	0	0	0	31	67				
OR4D6	219983	broad.mit.edu	37	11	59224737	59224737	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:59224737T>A	ENST00000300127.2	+	1	327	c.304T>A	c.(304-306)Ttt>Att	p.F102I		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	102			F -> S (in dbSNP:rs17153770).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						GGCACAGATCTTTTTCTTCCA	0.463																																						uc010rku.1		NA																	0				ovary(1)	1						c.(304-306)TTT>ATT		olfactory receptor, family 4, subfamily D,							161.0	159.0	160.0					11																	59224737		2201	4295	6496	SO:0001583	missense	219983				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59224737T>A	AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.304T>A	11.37:g.59224737T>A	ENSP00000300127:p.Phe102Ile		Somatic					p.F102I	NM_001004708	NP_001004708	WXS	Illumina HiSeq	Unspecified	Q8NGJ1	OR4D6_HUMAN			1	304	+			102			Helical; Name=3; (Potential).		B2RNP7|Q6IFF5|Q96R74	Missense_Mutation	SNP	ENST00000300127.2	37	c.304T>A	CCDS31562.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.884452	0.91814	.	.	ENSG00000166884	ENST00000300127	T	0.00406	7.55	5.47	5.47	0.80525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000042	T	0.01489	0.0048	M	0.86805	2.84	0.46416	D	0.999036	D	0.89917	1.0	D	0.97110	1.0	T	0.56817	-0.7916	10	0.87932	D	0	-16.3324	14.5353	0.67955	0.0:0.0:0.0:1.0	.	102	Q8NGJ1	OR4D6_HUMAN	I	102	ENSP00000300127:F102I	ENSP00000300127:F102I	F	+	1	0	OR4D6	58981313	0.872000	0.30054	0.997000	0.53966	0.996000	0.88848	4.099000	0.57755	2.295000	0.77249	0.528000	0.53228	TTT		0.463	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394234.1	NM_001004708		116	155	0	0	0	0	116	155				
VPS37C	55048	broad.mit.edu	37	11	60906239	60906239	+	Silent	SNP	C	C	A	rs144092595		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:60906239C>A	ENST00000301765.5	-	2	295	c.63G>T	c.(61-63)gcG>gcT	p.A21A		NM_017966.4	NP_060436.4	A5D8V6	VP37C_HUMAN	vacuolar protein sorting 37 homolog C (S. cerevisiae)	21					endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7						GCTGGTCAATCGCCTCCGAGT	0.552																																						uc001nqv.1		NA																	0					0						c.(61-63)GCG>GCT		vacuolar protein sorting 37C							109.0	97.0	101.0					11																	60906239		2203	4299	6502	SO:0001819	synonymous_variant	55048				cellular membrane organization|endosome transport|protein transport	late endosome membrane		g.chr11:60906239C>A	AK097326	CCDS31573.1	11q12.2	2008-02-05	2006-04-04			ENSG00000167987			26097	protein-coding gene	gene with protein product		610038	"""vacuolar protein sorting 37C (yeast)"""			15509564	Standard	XM_005274077		Approved	FLJ20847	uc001nqv.1	A5D8V6		ENST00000301765.5:c.63G>T	11.37:g.60906239C>A			Somatic				VPS37C_uc001nqw.1_Silent_p.A21A	p.A21A	NM_017966	NP_060436	WXS	Illumina HiSeq	Unspecified	A5D8V6	VP37C_HUMAN			2	123	-			21					Q8N3K4	Silent	SNP	ENST00000301765.5	37	c.63G>T	CCDS31573.1																																																																																				0.552	VPS37C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396467.1	NM_017966		54	104	1	0	2.45e-32	3.45e-32	54	104				
AHNAK	79026	broad.mit.edu	37	11	62299641	62299641	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:62299641G>C	ENST00000378024.4	-	5	2522	c.2248C>G	c.(2248-2250)Ccc>Gcc	p.P750A	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	750					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TTCATCTTGGGCATCTTCAAG	0.517																																						uc001ntl.2		NA																	0				ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(2248-2250)CCC>GCC		AHNAK nucleoprotein isoform 1							213.0	209.0	210.0					11																	62299641		2202	4299	6501	SO:0001583	missense	79026				nervous system development	nucleus	protein binding	g.chr11:62299641G>C	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.2248C>G	11.37:g.62299641G>C	ENSP00000367263:p.Pro750Ala		Somatic				AHNAK_uc001ntk.1_Intron	p.P750A	NM_001620	NP_001611	WXS	Illumina HiSeq	Unspecified	Q09666	AHNK_HUMAN			5	2548	-		Melanoma(852;0.155)	750					A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	c.2248C>G	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.009544	0.54361	.	.	ENSG00000124942	ENST00000378024	T	0.05580	3.42	5.32	5.32	0.75619	.	0.000000	0.39407	N	0.001361	T	0.33469	0.0864	H	0.94808	3.585	0.34132	D	0.665348	D	0.89917	1.0	D	0.91635	0.999	T	0.58086	-0.7698	10	0.51188	T	0.08	-5.4304	12.0355	0.53423	0.0801:0.0:0.9199:0.0	.	750	Q09666	AHNK_HUMAN	A	750	ENSP00000367263:P750A	ENSP00000367263:P750A	P	-	1	0	AHNAK	62056217	0.597000	0.26874	1.000000	0.80357	0.964000	0.63967	-2.561000	0.00921	2.492000	0.84095	0.455000	0.32223	CCC		0.517	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		152	263	0	0	0	0	152	263				
GANAB	23193	broad.mit.edu	37	11	62398539	62398539	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:62398539G>A	ENST00000356638.3	-	10	1129	c.1113C>T	c.(1111-1113)tcC>tcT	p.S371S	GANAB_ENST00000534779.1_Silent_p.S279S|GANAB_ENST00000540933.1_Silent_p.S274S|GANAB_ENST00000534422.1_5'Flank|GANAB_ENST00000346178.4_Silent_p.S393S	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	371					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	CATCAGAGATGGAGGGCCCCA	0.512																																					Melanoma(23;1005 1074 15747 18937)	uc001nub.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(1111-1113)TCC>TCT		neutral alpha-glucosidase AB isoform 2							230.0	210.0	217.0					11																	62398539		2202	4299	6501	SO:0001819	synonymous_variant	23193				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|Golgi apparatus|melanosome	carbohydrate binding|glucan 1,3-alpha-glucosidase activity|protein binding	g.chr11:62398539G>A	AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.1113C>T	11.37:g.62398539G>A			Somatic				GANAB_uc001nua.2_Silent_p.S393S|GANAB_uc001nuc.2_Silent_p.S274S|GANAB_uc010rma.1_Silent_p.S279S|GANAB_uc010rmb.1_Silent_p.S257S	p.S371S	NM_198334	NP_938148	WXS	Illumina HiSeq	Unspecified	Q14697	GANAB_HUMAN			10	1146	-			371					A6NC20|Q8WTS9|Q9P0X0	Silent	SNP	ENST00000356638.3	37	c.1113C>T	CCDS8026.1																																																																																				0.512	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	NM_198334		173	225	0	0	0	0	173	225				
STIP1	10963	broad.mit.edu	37	11	63967640	63967640	+	Splice_Site	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:63967640G>T	ENST00000305218.4	+	10	1267		c.e10-1		STIP1_ENST00000358794.5_Splice_Site|STIP1_ENST00000538945.1_Splice_Site	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1						response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						TTCTTCCCCAGGGGACTATCC	0.498																																						uc001nyk.1		NA																	0				ovary(2)|liver(1)	3						c.e10-1		stress-induced-phosphoprotein 1							133.0	146.0	142.0					11																	63967640		2201	4297	6498	SO:0001630	splice_region_variant	10963				axon guidance|response to stress	Golgi apparatus|nucleus		g.chr11:63967640G>T	BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.1121-1G>T	11.37:g.63967640G>T			Somatic				STIP1_uc010rnb.1_Splice_Site_p.G350_splice	p.G374_splice	NM_006819	NP_006810	WXS	Illumina HiSeq	Unspecified	P31948	STIP1_HUMAN			10	1268	+								B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Splice_Site	SNP	ENST00000305218.4	37	c.1121_splice	CCDS8058.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.992249	0.74703	.	.	ENSG00000168439	ENST00000358794;ENST00000305218;ENST00000538945	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6974	0.88285	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STIP1	63724216	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	8.879000	0.92398	2.650000	0.89964	0.561000	0.74099	.		0.498	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396289.2	NM_006819	Intron	150	203	1	0	2.46e-106	3.73e-106	150	203				
KAT5	10524	broad.mit.edu	37	11	65480261	65480261	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:65480261A>G	ENST00000377046.3	+	3	376	c.104A>G	c.(103-105)aAg>aGg	p.K35R	KAT5_ENST00000352980.4_Missense_Mutation_p.K35R|KAT5_ENST00000530446.1_Missense_Mutation_p.K68R|KAT5_ENST00000341318.4_Missense_Mutation_p.K68R|KAT5_ENST00000525204.1_3'UTR|KAT5_ENST00000534650.1_5'UTR	NM_006388.3	NP_006379.2	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5	35					androgen receptor signaling pathway (GO:0030521)|cellular response to estradiol stimulus (GO:0071392)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|double-strand break repair (GO:0006302)|histone acetylation (GO:0016573)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of growth (GO:0040008)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|repressing transcription factor binding (GO:0070491)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)	21						CTGAGCGTGAAGGACATCAGT	0.562																																						uc001ofi.2		NA																	0					0						c.(103-105)AAG>AGG		K(lysine) acetyltransferase 5 isoform 2							128.0	117.0	121.0					11																	65480261		2201	4297	6498	SO:0001583	missense	10524				androgen receptor signaling pathway|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|double-strand break repair|interspecies interaction between organisms|negative regulation of interleukin-2 production|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nucleolus|perinuclear region of cytoplasm|Piccolo NuA4 histone acetyltransferase complex	androgen receptor binding|histone acetyltransferase activity|metal ion binding|repressing transcription factor binding|transcription coactivator activity	g.chr11:65480261A>G	U74667	CCDS8109.1, CCDS8110.1, CCDS31610.1, CCDS55771.1	11q13	2013-01-10	2008-07-04	2008-07-04	ENSG00000172977	ENSG00000172977		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	5275	protein-coding gene	gene with protein product	"""Tat interacting protein, 60kDa"", ""K-acetyltransferase 5"""	601409	"""HIV-1 Tat interactive protein, 60kDa"""	HTATIP		8607265	Standard	NM_006388		Approved	TIP60, PLIP, cPLA2, HTATIP1, ESA1, ZC2HC5	uc001ofk.3	Q92993	OTTHUMG00000166617	ENST00000377046.3:c.104A>G	11.37:g.65480261A>G	ENSP00000366245:p.Lys35Arg		Somatic				KAT5_uc001ofj.2_Missense_Mutation_p.K35R|KAT5_uc001ofk.2_Missense_Mutation_p.K68R|KAT5_uc010roo.1_Missense_Mutation_p.K68R|KAT5_uc001ofl.2_5'UTR	p.K35R	NM_006388	NP_006379	WXS	Illumina HiSeq	Unspecified	Q92993	KAT5_HUMAN			3	354	+			35					B4E3C7|C9JL99|O95624|Q13430|Q17RW5|Q561W3|Q6GSE8|Q9BWK7	Missense_Mutation	SNP	ENST00000377046.3	37	c.104A>G	CCDS31610.1	.	.	.	.	.	.	.	.	.	.	A	10.46	1.355694	0.24598	.	.	ENSG00000172977	ENST00000377046;ENST00000352980;ENST00000341318;ENST00000530446;ENST00000528198;ENST00000531880	T;T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25;1.25	4.5	4.5	0.54988	Chromo domain-like (1);Chromo domain/shadow (1);	0.000000	0.85682	D	0.000000	T	0.21468	0.0517	N	0.13198	0.31	0.80722	D	1	B;B;B;B	0.26845	0.083;0.161;0.067;0.027	B;B;B;B	0.35727	0.137;0.209;0.084;0.123	T	0.07597	-1.0764	10	0.10111	T	0.7	-19.2025	8.158	0.31180	0.7962:0.2038:0.0:0.0	.	68;68;35;35	B4E3C7;Q92993-3;Q92993-2;Q92993	.;.;.;KAT5_HUMAN	R	35;35;68;68;29;29	ENSP00000366245:K35R;ENSP00000344955:K35R;ENSP00000340330:K68R;ENSP00000434765:K68R;ENSP00000436000:K29R;ENSP00000436012:K29R	ENSP00000340330:K68R	K	+	2	0	KAT5	65236837	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.165000	0.71891	1.907000	0.55213	0.459000	0.35465	AAG		0.562	KAT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390866.2	NM_006388		39	78	0	0	0	0	39	78				
ADRBK1	156	broad.mit.edu	37	11	67049153	67049153	+	Silent	SNP	G	G	T	rs377123753		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:67049153G>T	ENST00000308595.5	+	10	1070	c.780G>T	c.(778-780)gcG>gcT	p.A260A	ADRBK1_ENST00000526285.1_Silent_p.A260A	NM_001619.3	NP_001610.2	P25098	ARBK1_HUMAN	adrenergic, beta, receptor kinase 1	260	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|cardiac muscle contraction (GO:0060048)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of striated muscle contraction (GO:0045988)|negative regulation of the force of heart contraction by chemical signal (GO:0003108)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of catecholamine secretion (GO:0033605)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)	22			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	TGTCATACGCGTTCCACACGC	0.672																																						uc009yrn.1		NA																	0				large_intestine(1)	1						c.(778-780)GCG>GCT		beta-adrenergic receptor kinase 1	Adenosine triphosphate(DB00171)	G		0,4400		0,0,2200	93.0	82.0	86.0		780	-10.0	0.0	11		86	1,8589	1.2+/-3.3	0,1,4294	no	coding-synonymous	ADRBK1	NM_001619.3		0,1,6494	TT,TG,GG		0.0116,0.0,0.0077		260/690	67049153	1,12989	2200	4295	6495	SO:0001819	synonymous_variant	156				activation of phospholipase C activity|cardiac muscle contraction|desensitization of G-protein coupled receptor protein signaling pathway|muscarinic acetylcholine receptor signaling pathway|negative regulation of striated muscle contraction|negative regulation of the force of heart contraction by chemical signal|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of catecholamine secretion|tachykinin receptor signaling pathway	cytosol|soluble fraction	alpha-2A adrenergic receptor binding|ATP binding|beta-adrenergic receptor kinase activity|Edg-2 lysophosphatidic acid receptor binding|G-protein coupled receptor kinase activity|signal transducer activity	g.chr11:67049153G>T	X61157	CCDS8156.1	11q13	2013-01-10			ENSG00000173020	ENSG00000173020		"""Pleckstrin homology (PH) domain containing"""	289	protein-coding gene	gene with protein product		109635				2037065	Standard	NM_001619		Approved	GRK2, BARK1	uc009yrn.1	P25098	OTTHUMG00000167104	ENST00000308595.5:c.780G>T	11.37:g.67049153G>T			Somatic				ADRBK1_uc009yrm.1_Silent_p.A260A	p.A260A	NM_001619	NP_001610	WXS	Illumina HiSeq	Unspecified	P25098	ARBK1_HUMAN	BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		10	1046	+			260			Protein kinase.		B0ZBE1|Q13837|Q6GTT3	Silent	SNP	ENST00000308595.5	37	c.780G>T	CCDS8156.1																																																																																				0.672	ADRBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393153.1	NM_001619		47	64	1	0	4.17e-34	5.95e-34	47	64				
SHANK2	22941	broad.mit.edu	37	11	70333070	70333070	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:70333070C>A	ENST00000423696.2	-	15	2227	c.2191G>T	c.(2191-2193)Gag>Tag	p.E731*	SHANK2_ENST00000409161.1_Nonsense_Mutation_p.E514*|SHANK2_ENST00000338508.4_Nonsense_Mutation_p.E1111*|SHANK2_ENST00000449833.2_Nonsense_Mutation_p.E515*			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	731					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CCCACATCCTCATCCCCCAGG	0.692																																						uc001oqc.2		NA																	0				ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(3328-3330)GAG>TAG		SH3 and multiple ankyrin repeat domains 2							19.0	25.0	23.0					11																	70333070		2177	4258	6435	SO:0001587	stop_gained	22941				intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding	g.chr11:70333070C>A	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.2191G>T	11.37:g.70333070C>A	ENSP00000394536:p.Glu731*		Somatic				SHANK2_uc010rqn.1_Nonsense_Mutation_p.E522*|SHANK2_uc001opz.2_Nonsense_Mutation_p.E515*|uc009ysn.1_Intron|SHANK2_uc001opy.2_Intron	p.E1110*	NM_012309	NP_036441	WXS	Illumina HiSeq	Unspecified	Q9UPX8	SHAN2_HUMAN	LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)		21	3406	-			731					C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Nonsense_Mutation	SNP	ENST00000423696.2	37	c.3328G>T		.	.	.	.	.	.	.	.	.	.	C	38	7.263507	0.98171	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	.	.	.	4.88	4.88	0.63580	.	0.101059	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	18.0342	0.89294	0.0:1.0:0.0:0.0	.	.	.	.	X	515;514;389;1111;731;749;734	.	ENSP00000294018:E734X	E	-	1	0	SHANK2	70010718	1.000000	0.71417	0.999000	0.59377	0.943000	0.58893	7.297000	0.78799	2.261000	0.74972	0.561000	0.74099	GAG		0.692	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309		39	654	1	0	4.05e-12	4.94e-12	39	654				
SHANK2	22941	broad.mit.edu	37	11	70333674	70333674	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:70333674G>A	ENST00000423696.2	-	15	1623	c.1587C>T	c.(1585-1587)tgC>tgT	p.C529C	SHANK2_ENST00000409161.1_Silent_p.C312C|SHANK2_ENST00000338508.4_Silent_p.C909C|SHANK2_ENST00000449833.2_Silent_p.C313C			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	529	Pro-rich.				adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GGGACTTGGGGCAGTTGTAAG	0.622																																						uc001oqc.2		NA																	0				ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(2722-2724)TGC>TGT		SH3 and multiple ankyrin repeat domains 2							57.0	54.0	55.0					11																	70333674		2200	4294	6494	SO:0001819	synonymous_variant	22941				intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding	g.chr11:70333674G>A	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.1587C>T	11.37:g.70333674G>A			Somatic				SHANK2_uc010rqn.1_Silent_p.C320C|SHANK2_uc001opz.2_Silent_p.C313C|uc009ysn.1_Intron|SHANK2_uc001opy.2_Intron	p.C908C	NM_012309	NP_036441	WXS	Illumina HiSeq	Unspecified	Q9UPX8	SHAN2_HUMAN	LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)		21	2802	-			529			Pro-rich.		C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Silent	SNP	ENST00000423696.2	37	c.2724C>T																																																																																					0.622	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309		29	279	0	0	0	0	29	279				
ME3	10873	broad.mit.edu	37	11	86161369	86161369	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:86161369C>A	ENST00000393324.3	-	8	1244	c.991G>T	c.(991-993)Gtg>Ttg	p.V331L	RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000359636.2_Missense_Mutation_p.V331L|ME3_ENST00000543262.1_Missense_Mutation_p.V331L	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	331					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				AAAACAAACACGTGATTGGAA	0.502																																						uc001pbz.2		NA																	0				ovary(1)	1						c.(991-993)GTG>TTG		mitochondrial malic enzyme 3 precursor	NADH(DB00157)						109.0	95.0	99.0					11																	86161369		2202	4299	6501	SO:0001583	missense	10873				aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding	g.chr11:86161369C>A	X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.991G>T	11.37:g.86161369C>A	ENSP00000376998:p.Val331Leu		Somatic				ME3_uc001pca.2_Missense_Mutation_p.V331L|ME3_uc009yvk.2_Missense_Mutation_p.V331L|ME3_uc010rtr.1_RNA	p.V331L	NM_001014811	NP_001014811	WXS	Illumina HiSeq	Unspecified	Q16798	MAON_HUMAN			8	1245	-		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)	331					B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	c.991G>T	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170896	0.57584	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.83	4.92	0.64577	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.312106	0.31589	N	0.007396	T	0.35941	0.0949	L	0.55834	1.745	0.80722	D	1	B	0.16802	0.019	B	0.25884	0.064	T	0.18241	-1.0343	9	.	.	.	-4.9152	7.0246	0.24932	0.0:0.7153:0.0:0.2847	.	331	Q16798	MAON_HUMAN	L	331	ENSP00000352657:V331L;ENSP00000440246:V331L;ENSP00000376998:V331L;ENSP00000431182:V331L	.	V	-	1	0	ME3	85839017	1.000000	0.71417	0.935000	0.37517	0.866000	0.49608	4.051000	0.57412	1.480000	0.48289	0.655000	0.94253	GTG		0.502	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2			21	13	1	0	1.96e-10	2.33e-10	21	13				
NAALAD2	10003	broad.mit.edu	37	11	89892474	89892474	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:89892474G>T	ENST00000534061.1	+	8	1188	c.958G>T	c.(958-960)Gga>Tga	p.G320*	NAALAD2_ENST00000321955.4_Intron|NAALAD2_ENST00000375944.3_Intron|NAALAD2_ENST00000525171.1_Intron	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	320	NAALADase.				neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TTATAGTATCGGACCTGGCTT	0.358																																						uc001pdf.3		NA																	0				pancreas(1)|skin(1)	2						c.(958-960)GGA>TGA		N-acetylated alpha-linked acidic dipeptidase 2							129.0	125.0	126.0					11																	89892474		2201	4299	6500	SO:0001587	stop_gained	10003				proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity	g.chr11:89892474G>T	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.958G>T	11.37:g.89892474G>T	ENSP00000432481:p.Gly320*		Somatic				NAALAD2_uc009yvx.2_Intron|NAALAD2_uc009yvy.2_Intron|NAALAD2_uc001pdd.2_3'UTR|NAALAD2_uc001pde.2_Intron	p.G320*	NM_005467	NP_005458	WXS	Illumina HiSeq	Unspecified	Q9Y3Q0	NALD2_HUMAN			8	1067	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)	320			Extracellular (Potential).|NAALADase.		B3KQR4|Q4KKV4|Q4VAM9	Nonsense_Mutation	SNP	ENST00000534061.1	37	c.958G>T	CCDS8288.1	.	.	.	.	.	.	.	.	.	.	G	36	5.839790	0.97009	.	.	ENSG00000077616	ENST00000534061	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-15.339	18.613	0.91293	0.0:0.0:1.0:0.0	.	.	.	.	X	320	.	.	G	+	1	0	NAALAD2	89532122	1.000000	0.71417	0.955000	0.39395	0.341000	0.28922	7.931000	0.87625	2.834000	0.97654	0.586000	0.80456	GGA		0.358	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467		51	24	1	0	7.77e-23	1.05e-22	51	24				
HEPHL1	341208	broad.mit.edu	37	11	93844770	93844770	+	Splice_Site	SNP	C	C	A	rs560509955		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:93844770C>A	ENST00000315765.9	+	19	3284	c.3276C>A	c.(3274-3276)aaC>aaA	p.N1092K		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	1092	Plastocyanin-like 6.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				TGCCATCTAACGGTAATGATA	0.448																																						uc001pep.2		NA																	0				ovary(3)	3						c.(3274-3276)AAC>AAA		hephaestin-like 1 precursor							49.0	47.0	48.0					11																	93844770		1961	4152	6113	SO:0001630	splice_region_variant	341208				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity	g.chr11:93844770C>A	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.3277+1C>A	11.37:g.93844770C>A			Somatic				uc001pen.1_Intron	p.N1092K	NM_001098672	NP_001092142	WXS	Illumina HiSeq	Unspecified	Q6MZM0	HPHL1_HUMAN			19	3433	+		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)	1092			Extracellular (Potential).|Plastocyanin-like 6.		Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	37	c.3276C>A	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	C	9.405	1.079087	0.20227	.	.	ENSG00000181333	ENST00000315765	D	0.99150	-5.49	5.51	-11.0	0.00169	.	.	.	.	.	D	0.92277	0.7550	N	0.08118	0	0.09310	N	0.999992	B	0.02656	0.0	B	0.04013	0.001	D	0.85757	0.1347	9	0.09084	T	0.74	.	4.6609	0.12641	0.1919:0.4671:0.1022:0.2388	.	1092	Q6MZM0	HPHL1_HUMAN	K	1092	ENSP00000313699:N1092K	ENSP00000313699:N1092K	N	+	3	2	HEPHL1	93484418	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-4.024000	0.00311	-3.002000	0.00275	-0.290000	0.09829	AAC		0.448	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947	Missense_Mutation	10	5	1	0	3.86e-05	4.21e-05	10	5				
CWF19L2	143884	broad.mit.edu	37	11	107299911	107299911	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:107299911T>A	ENST00000282251.5	-	8	1074	c.1047A>T	c.(1045-1047)agA>agT	p.R349S	CWF19L2_ENST00000433523.1_Missense_Mutation_p.R349S	NM_152434.2	NP_689647.2	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control (S. pombe)	349							catalytic activity (GO:0003824)			endometrium(4)|kidney(2)|large_intestine(13)|lung(21)	40		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		GGTTAGATTCTCTTCTACACG	0.348																																						uc010rvp.1		NA																	0					0						c.(1045-1047)AGA>AGT		CWF19-like 2, cell cycle control							103.0	107.0	106.0					11																	107299911		2201	4298	6499	SO:0001583	missense	143884						catalytic activity	g.chr11:107299911T>A	AK056905	CCDS8336.2	11q23.1	2005-09-22			ENSG00000152404	ENSG00000152404			26508	protein-coding gene	gene with protein product						14702039	Standard	NM_152434		Approved	FLJ32343	uc010rvp.2	Q2TBE0	OTTHUMG00000152975	ENST00000282251.5:c.1047A>T	11.37:g.107299911T>A	ENSP00000282251:p.Arg349Ser		Somatic				CWF19L2_uc001pjh.3_RNA|CWF19L2_uc009yxo.2_RNA	p.R349S	NM_152434	NP_689647	WXS	Illumina HiSeq	Unspecified	Q2TBE0	C19L2_HUMAN		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)	8	1077	-		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)	349					A4FU66|A4FU67|A4FU68|Q6PHW1|Q96MI1	Missense_Mutation	SNP	ENST00000282251.5	37	c.1047A>T	CCDS8336.2	.	.	.	.	.	.	.	.	.	.	T	8.460	0.855063	0.17106	.	.	ENSG00000152404	ENST00000282251;ENST00000433523	T;T	0.21191	2.02;2.02	5.45	2.89	0.33648	.	0.745739	0.13530	N	0.380977	T	0.23133	0.0559	M	0.73598	2.24	0.09310	N	0.999997	B	0.18310	0.027	B	0.15870	0.014	T	0.17930	-1.0353	10	0.44086	T	0.13	-8.8418	6.5237	0.22289	0.1372:0.0783:0.0:0.7845	.	349	Q2TBE0	C19L2_HUMAN	S	349	ENSP00000282251:R349S;ENSP00000387533:R349S	ENSP00000282251:R349S	R	-	3	2	CWF19L2	106805121	0.388000	0.25197	0.004000	0.12327	0.064000	0.16182	0.345000	0.19979	0.951000	0.37770	0.482000	0.46254	AGA		0.348	CWF19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328825.2	NM_152434		55	27	0	0	0	0	55	27				
BARX2	8538	broad.mit.edu	37	11	129306871	129306871	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:129306871C>T	ENST00000281437.4	+	2	509	c.413C>T	c.(412-414)aCc>aTc	p.T138I	BARX2_ENST00000526127.1_5'UTR	NM_003658.4	NP_003649.2	Q9UMQ3	BARX2_HUMAN	BARX homeobox 2	138					cartilage condensation (GO:0001502)|catagen (GO:0042637)|myotube differentiation (GO:0014902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	20	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)		CGGAGTCGCACCATCTTCACC	0.627																																						uc001qfc.3		NA																	0					0						c.(412-414)ACC>ATC		BarH-like homeobox 2							36.0	41.0	39.0					11																	129306871		2201	4297	6498	SO:0001583	missense	8538							g.chr11:129306871C>T	AF031924	CCDS8481.1	11q24.3	2011-06-20	2007-07-09		ENSG00000043039	ENSG00000043039		"""Homeoboxes / ANTP class : NKL subclass"""	956	protein-coding gene	gene with protein product		604823	"""BarH-like homeobox 2"""			10644443	Standard	NM_003658		Approved		uc001qfc.4	Q9UMQ3	OTTHUMG00000165776	ENST00000281437.4:c.413C>T	11.37:g.129306871C>T	ENSP00000281437:p.Thr138Ile		Somatic					p.T138I	NM_003658	NP_003649	WXS	Illumina HiSeq	Unspecified	Q9UMQ3	BARX2_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)	2	463	+	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	138			Homeobox.		O43518|Q6NT51	Missense_Mutation	SNP	ENST00000281437.4	37	c.413C>T	CCDS8481.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.981377	0.93044	.	.	ENSG00000043039	ENST00000281437	D	0.97303	-4.33	5.76	5.76	0.90799	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.097704	0.64402	N	0.000001	D	0.98532	0.9510	M	0.83852	2.665	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99470	1.0945	10	0.87932	D	0	.	18.5398	0.91023	0.0:1.0:0.0:0.0	.	138	Q9UMQ3	BARX2_HUMAN	I	138	ENSP00000281437:T138I	ENSP00000281437:T138I	T	+	2	0	BARX2	128812081	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.405000	0.80007	2.713000	0.92767	0.655000	0.94253	ACC		0.627	BARX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386153.1	NM_003658		10	6	0	0	0	0	10	6				
ADAMTS15	170689	broad.mit.edu	37	11	130343610	130343610	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:130343610G>T	ENST00000299164.2	+	8	2747	c.2747G>T	c.(2746-2748)cGc>cTc	p.R916L		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	916	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		TTTCAGAGGCGCTCACTCAAG	0.697																																						uc010scd.1		NA																	0				large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5						c.(2746-2748)CGC>CTC		a disintegrin-like and metalloprotease							24.0	31.0	28.0					11																	130343610		2200	4295	6495	SO:0001583	missense	170689				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr11:130343610G>T	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.2747G>T	11.37:g.130343610G>T	ENSP00000299164:p.Arg916Leu		Somatic					p.R916L	NM_139055	NP_620686	WXS	Illumina HiSeq	Unspecified	Q8TE58	ATS15_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)	8	2747	+	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	916			TSP type-1 3.		Q32MI6	Missense_Mutation	SNP	ENST00000299164.2	37	c.2747G>T	CCDS8488.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.052543	0.75960	.	.	ENSG00000166106	ENST00000299164	T	0.80824	-1.42	5.43	4.52	0.55395	.	.	.	.	.	D	0.93096	0.7802	H	0.97491	4.015	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95059	0.8194	9	0.87932	D	0	.	14.0792	0.64909	0.0727:0.0:0.9273:0.0	.	916	Q8TE58	ATS15_HUMAN	L	916	ENSP00000299164:R916L	ENSP00000299164:R916L	R	+	2	0	ADAMTS15	129848820	1.000000	0.71417	0.856000	0.33681	0.570000	0.35934	9.420000	0.97426	1.304000	0.44892	0.557000	0.71058	CGC		0.697	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	NM_139055		38	12	1	0	2.45e-15	3.1e-15	38	12				
OPCML	4978	broad.mit.edu	37	11	132527042	132527042	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:132527042T>A	ENST00000331898.7	-	2	918	c.340A>T	c.(340-342)Acc>Tcc	p.T114S	OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000374778.4_Missense_Mutation_p.T73S|OPCML_ENST00000541867.1_Missense_Mutation_p.T114S|OPCML_ENST00000524381.1_Missense_Mutation_p.T107S	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	114	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)			endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		ACAGAGCAGGTGTACGGACCT	0.507																																						uc001qgs.2		NA																	0				ovary(2)|skin(1)	3						c.(340-342)ACC>TCC		opioid binding protein/cell adhesion							250.0	197.0	215.0					11																	132527042		2201	4297	6498	SO:0001583	missense	4978				cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity	g.chr11:132527042T>A	BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.340A>T	11.37:g.132527042T>A	ENSP00000330862:p.Thr114Ser		Somatic				OPCML_uc001qgu.2_Missense_Mutation_p.T107S|OPCML_uc010sck.1_Missense_Mutation_p.T114S|OPCML_uc001qgt.2_Missense_Mutation_p.T114S|OPCML_uc010scl.1_Missense_Mutation_p.T73S	p.T114S	NM_002545	NP_002536	WXS	Illumina HiSeq	Unspecified	Q14982	OPCM_HUMAN		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)	2	390	-	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)	114			Ig-like C2-type 1.		B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	ENST00000331898.7	37	c.340A>T	CCDS8492.1	.	.	.	.	.	.	.	.	.	.	T	27.5	4.835018	0.91117	.	.	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000416724;ENST00000541867	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.83	5.83	0.93111	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.191120	0.47093	D	0.000248	T	0.58836	0.2150	M	0.80422	2.495	0.37309	D	0.909023	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.73380	0.964;0.98;0.964;0.964	T	0.68922	-0.5281	10	0.87932	D	0	-26.978	16.1846	0.81942	0.0:0.0:0.0:1.0	.	114;107;114;114	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	S	114;107;73;81;114	ENSP00000330862:T114S;ENSP00000434750:T107S;ENSP00000363910:T73S;ENSP00000445496:T114S	ENSP00000330862:T114S	T	-	1	0	OPCML	132032252	1.000000	0.71417	0.942000	0.38095	0.950000	0.60333	4.616000	0.61197	2.229000	0.72834	0.533000	0.62120	ACC		0.507	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374689.3	NM_001012393		65	30	0	0	0	0	65	30				
CD163	9332	broad.mit.edu	37	12	7636217	7636217	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:7636217C>G	ENST00000359156.4	-	12	3036	c.2834G>C	c.(2833-2835)tGg>tCg	p.W945S	CD163_ENST00000432237.2_Missense_Mutation_p.W945S|CD163_ENST00000541972.1_Missense_Mutation_p.W933S|CD163_ENST00000396620.3_Missense_Mutation_p.W978S|CD163_ENST00000539632.1_5'UTR	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	945	SRCR 9. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.W945*(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	ACCTCCATGCCAGATCTCCAC	0.478																																						uc001qsz.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|pancreas(1)|skin(1)	8						c.(2833-2835)TGG>TCG		CD163 antigen isoform a							105.0	85.0	92.0					12																	7636217		2203	4300	6503	SO:0001583	missense	9332				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity	g.chr12:7636217C>G	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.2834G>C	12.37:g.7636217C>G	ENSP00000352071:p.Trp945Ser		Somatic				CD163_uc001qta.3_Missense_Mutation_p.W945S|CD163_uc009zfw.2_Missense_Mutation_p.W978S	p.W945S	NM_004244	NP_004235	WXS	Illumina HiSeq	Unspecified	Q86VB7	C163A_HUMAN			12	2962	-			945			SRCR 9.|Extracellular (Potential).		C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	c.2834G>C	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.073853	0.55646	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	5.31	5.31	0.75309	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	0.222665	0.35124	N	0.003426	T	0.52008	0.1708	M	0.69248	2.105	0.49915	D	0.999835	D;D;D	0.89917	1.0;0.993;1.0	D;P;D	0.97110	1.0;0.808;0.999	T	0.52238	-0.8602	10	0.66056	D	0.02	.	11.8682	0.52505	0.1746:0.8254:0.0:0.0	.	978;945;945	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	S	945;933;978;945	ENSP00000352071:W945S;ENSP00000444071:W933S;ENSP00000379863:W978S;ENSP00000403885:W945S	ENSP00000352071:W945S	W	-	2	0	CD163	7527484	0.000000	0.05858	1.000000	0.80357	0.990000	0.78478	-0.351000	0.07711	2.660000	0.90430	0.555000	0.69702	TGG		0.478	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416		35	41	0	0	0	0	35	41				
TAS2R7	50837	broad.mit.edu	37	12	10954553	10954553	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:10954553A>G	ENST00000240687.2	-	1	673	c.617T>C	c.(616-618)cTc>cCc	p.L206P		NM_023919.2	NP_076408.1	Q9NYW3	TA2R7_HUMAN	taste receptor, type 2, member 7	206					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			kidney(1)|large_intestine(1)|lung(3)|skin(2)|stomach(3)	10						CCGCAGGGAGAGGATCAAGAG	0.498																																						uc001qyv.2		NA																	0				skin(1)	1						c.(616-618)CTC>CCC		taste receptor, type 2, member 7							134.0	127.0	129.0					12																	10954553		2203	4300	6503	SO:0001583	missense	50837				sensory perception of taste	integral to membrane	taste receptor activity	g.chr12:10954553A>G	AF227133	CCDS8631.1	12p13	2012-08-22			ENSG00000121377	ENSG00000121377		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14913	protein-coding gene	gene with protein product		604793				10761934, 10766242	Standard	NM_023919		Approved	T2R7, TRB4	uc001qyv.3	Q9NYW3	OTTHUMG00000168505	ENST00000240687.2:c.617T>C	12.37:g.10954553A>G	ENSP00000240687:p.Leu206Pro		Somatic					p.L206P	NM_023919	NP_076408	WXS	Illumina HiSeq	Unspecified	Q9NYW3	TA2R7_HUMAN			1	674	-			206			Helical; Name=5; (Potential).		Q645Y1	Missense_Mutation	SNP	ENST00000240687.2	37	c.617T>C	CCDS8631.1	.	.	.	.	.	.	.	.	.	.	A	10.35	1.326316	0.24080	.	.	ENSG00000121377	ENST00000240687	T	0.39406	1.08	5.37	4.23	0.50019	GPCR, rhodopsin-like superfamily (1);	0.568737	0.15471	N	0.260636	T	0.65196	0.2668	M	0.90198	3.095	0.23101	N	0.998295	D	0.67145	0.996	D	0.70016	0.967	T	0.57740	-0.7759	10	0.52906	T	0.07	.	5.5614	0.17146	0.7395:0.1731:0.0874:0.0	.	206	Q9NYW3	TA2R7_HUMAN	P	206	ENSP00000240687:L206P	ENSP00000240687:L206P	L	-	2	0	TAS2R7	10845820	0.000000	0.05858	0.589000	0.28718	0.018000	0.09664	0.675000	0.25232	1.056000	0.40484	0.528000	0.53228	CTC		0.498	TAS2R7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399931.1			24	32	0	0	0	0	24	32				
TAS2R19	259294	broad.mit.edu	37	12	11174609	11174609	+	Missense_Mutation	SNP	A	A	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:11174609A>C	ENST00000390673.2	-	1	610	c.562T>G	c.(562-564)Ttt>Gtt	p.F188V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176888.1	NP_795369.1	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	188					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						CTCAGAGTAAAGGGTATGAGG	0.393																																						uc010shj.1		NA																	0				skin(1)	1						c.(562-564)TTT>GTT		taste receptor, type 2, member 19							169.0	157.0	161.0					12																	11174609		2203	4300	6503	SO:0001583	missense	259294				sensory perception of taste	integral to membrane	G-protein coupled receptor activity	g.chr12:11174609A>C	AX097730, AF494234	CCDS8640.1	12p13.2	2012-08-22			ENSG00000212124	ENSG00000212124		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19108	protein-coding gene	gene with protein product		613961	"""taste receptor, type 2, member 48"", ""taste receptor, type 2, member 23"""	TAS2R48, TAS2R23			Standard	NM_176888		Approved	T2R19, T2R23	uc010shj.2	P59542	OTTHUMG00000162687	ENST00000390673.2:c.562T>G	12.37:g.11174609A>C	ENSP00000375091:p.Phe188Val		Somatic				PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	p.F188V	NM_176888	NP_795369	WXS	Illumina HiSeq	Unspecified	P59542	T2R19_HUMAN			1	562	-			188			Helical; Name=5; (Potential).		Q3MIJ4|Q645X8	Missense_Mutation	SNP	ENST00000390673.2	37	c.562T>G	CCDS8640.1	.	.	.	.	.	.	.	.	.	.	A	13.04	2.118958	0.37436	.	.	ENSG00000212124	ENST00000390673	T	0.01051	5.4	2.69	2.69	0.31865	.	0.204031	0.30762	U	0.008928	T	0.05456	0.0144	M	0.92555	3.32	0.09310	N	1	P	0.45986	0.87	P	0.55508	0.777	T	0.07731	-1.0757	10	0.87932	D	0	.	4.5302	0.12001	0.8412:0.0:0.1588:0.0	.	188	P59542	T2R19_HUMAN	V	188	ENSP00000375091:F188V	ENSP00000375091:F188V	F	-	1	0	TAS2R19	11065876	0.002000	0.14202	0.004000	0.12327	0.001000	0.01503	1.053000	0.30442	1.242000	0.43836	0.333000	0.21579	TTT		0.393	TAS2R19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370080.1	NM_176888		110	153	0	0	0	0	110	153				
PRB2	653247	broad.mit.edu	37	12	11546131	11546131	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:11546131G>A	ENST00000389362.4	-	3	916	c.881C>T	c.(880-882)tCc>tTc	p.S294F	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	294	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			AGAACTTCGGGACTTGCTGCC	0.602																																						uc010shk.1		NA																	0					0						c.(880-882)TCC>TTC		proline-rich protein BstNI subfamily 2							184.0	228.0	213.0					12																	11546131		2196	4300	6496	SO:0001583	missense	653247							g.chr12:11546131G>A	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.881C>T	12.37:g.11546131G>A	ENSP00000374013:p.Ser294Phe		Somatic					p.S294F	NM_006248	NP_006239	WXS	Illumina HiSeq	Unspecified			OV - Ovarian serous cystadenocarcinoma(49;0.185)		3	916	-		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)						O00599|P02811|P04281	Missense_Mutation	SNP	ENST00000389362.4	37	c.881C>T	CCDS41757.2	.	.	.	.	.	.	.	.	.	.	.	5.237	0.229151	0.09916	.	.	ENSG00000121335	ENST00000389362	T	0.04970	3.52	0.676	-0.646	0.11472	.	.	.	.	.	T	0.09468	0.0233	L	0.42245	1.32	0.09310	N	1	P	0.42518	0.782	P	0.51895	0.683	T	0.27297	-1.0078	9	0.54805	T	0.06	.	3.6484	0.08194	0.0:0.0:0.5672:0.4328	.	294	P02812	PRB2_HUMAN	F	294	ENSP00000374013:S294F	ENSP00000374013:S294F	S	-	2	0	PRB2	11437398	0.000000	0.05858	0.003000	0.11579	0.169000	0.22640	0.031000	0.13710	-0.186000	0.10533	0.109000	0.15622	TCC		0.602	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248		20	731	0	0	0	0	20	731				
PDE3A	5139	broad.mit.edu	37	12	20806882	20806882	+	Splice_Site	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:20806882G>C	ENST00000359062.3	+	15	2967	c.2927G>C	c.(2926-2928)gGt>gCt	p.G976A	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	976	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	TATTTCTAGGGTGATGAAGAG	0.428																																						uc001reh.1		NA																	0				ovary(3)|upper_aerodigestive_tract(1)	4						c.(2926-2928)GGT>GCT		phosphodiesterase 3A	Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)						60.0	59.0	60.0					12																	20806882		2203	4300	6503	SO:0001630	splice_region_variant	5139				lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr12:20806882G>C		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2926-1G>C	12.37:g.20806882G>C			Somatic					p.G976A	NM_000921	NP_000912	WXS	Illumina HiSeq	Unspecified	Q14432	PDE3A_HUMAN			15	2949	+	Esophageal squamous(101;0.125)	Breast(259;0.134)	976			Catalytic (By similarity).		O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	c.2927G>C	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852801	0.71719	.	.	ENSG00000172572	ENST00000359062	D	0.85171	-1.95	5.31	5.31	0.75309	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.050128	0.85682	D	0.000000	D	0.91593	0.7344	M	0.67517	2.055	0.80722	D	1	D	0.69078	0.997	D	0.68483	0.958	D	0.92126	0.5708	10	0.87932	D	0	.	19.3412	0.94342	0.0:0.0:1.0:0.0	.	976	Q14432	PDE3A_HUMAN	A	976	ENSP00000351957:G976A	ENSP00000351957:G976A	G	+	2	0	PDE3A	20698149	1.000000	0.71417	1.000000	0.80357	0.506000	0.33950	9.358000	0.97109	2.657000	0.90304	0.655000	0.94253	GGT		0.428	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		Missense_Mutation	45	89	0	0	0	0	45	89				
KMT2D	8085	broad.mit.edu	37	12	49433007	49433007	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:49433007G>A	ENST00000301067.7	-	33	8363	c.8364C>T	c.(8362-8364)agC>agT	p.S2788S	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2788					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AGCCTCACCGGCTGTTCACAT	0.567																																						uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		0				kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(8362-8364)AGC>AGT		myeloid/lymphoid or mixed-lineage leukemia 2							50.0	55.0	54.0					12																	49433007		1869	4106	5975	SO:0001819	synonymous_variant	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49433007G>A	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.8364C>T	12.37:g.49433007G>A		HNSCC(34;0.089)	Somatic					p.S2788S	NM_003482	NP_003473	WXS	Illumina HiSeq	Unspecified	O14686	MLL2_HUMAN			33	8364	-			2788					O14687	Silent	SNP	ENST00000301067.7	37	c.8364C>T	CCDS44873.1																																																																																				0.567	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			4	148	0	0	0	0	4	148				
GALNT6	11226	broad.mit.edu	37	12	51753071	51753071	+	Missense_Mutation	SNP	C	C	A	rs373677203		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:51753071C>A	ENST00000543196.2	-	7	1418	c.1213G>T	c.(1213-1215)Gta>Tta	p.V405L	GALNT6_ENST00000356317.3_Missense_Mutation_p.V405L			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	405	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						ACATGGCCTACGACAGAGCAG	0.592																																						uc001ryk.2		NA																	0				ovary(2)	2						c.(1213-1215)GTA>TTA		polypeptide N-acetylgalactosaminyltransferase 6							126.0	121.0	123.0					12																	51753071		2203	4300	6503	SO:0001583	missense	11226				protein O-linked glycosylation	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:51753071C>A	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.1213G>T	12.37:g.51753071C>A	ENSP00000444171:p.Val405Leu		Somatic				GALNT6_uc009zma.1_RNA|GALNT6_uc001ryl.1_Missense_Mutation_p.V405L|GALNT6_uc001ryj.1_5'UTR	p.V405L	NM_007210	NP_009141	WXS	Illumina HiSeq	Unspecified	Q8NCL4	GALT6_HUMAN			7	1438	-			405			Catalytic subdomain B.|Lumenal (Potential).		Q8IYH4|Q9H6G2|Q9UIV5	Missense_Mutation	SNP	ENST00000543196.2	37	c.1213G>T	CCDS8813.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.992661	0.93167	.	.	ENSG00000139629	ENST00000543196;ENST00000356317;ENST00000546163	T;T	0.67171	-0.25;-0.25	4.16	4.16	0.48862	.	0.058058	0.64402	D	0.000002	D	0.87633	0.6226	H	0.97051	3.93	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91759	0.5418	10	0.87932	D	0	.	16.4374	0.83880	0.0:1.0:0.0:0.0	.	405	Q8NCL4	GALT6_HUMAN	L	405;405;386	ENSP00000444171:V405L;ENSP00000348668:V405L	ENSP00000348668:V405L	V	-	1	0	GALNT6	50039338	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.856000	0.69518	2.614000	0.88457	0.561000	0.74099	GTA		0.592	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210		121	172	1	0	2.56e-62	3.83e-62	121	172				
OR6C74	254783	broad.mit.edu	37	12	55641868	55641868	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:55641868T>A	ENST00000343870.4	+	1	887	c.797T>A	c.(796-798)gTg>gAg	p.V266E		NM_001005490.1	NP_001005490.1	A6NCV1	O6C74_HUMAN	olfactory receptor, family 6, subfamily C, member 74	266						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|large_intestine(3)|lung(7)|prostate(1)	12						AAAGAAAGAGTGTCATTAAAT	0.383																																						uc010spg.1		NA																	0				central_nervous_system(1)	1						c.(796-798)GTG>GAG		olfactory receptor, family 6, subfamily C,							72.0	76.0	75.0					12																	55641868		2203	4300	6503	SO:0001583	missense	254783				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55641868T>A		CCDS31816.1	12q13.13	2012-08-09			ENSG00000197706	ENSG00000197706		"""GPCR / Class A : Olfactory receptors"""	31303	protein-coding gene	gene with protein product							Standard	NM_001005490		Approved		uc010spg.2	A6NCV1	OTTHUMG00000165162	ENST00000343870.4:c.797T>A	12.37:g.55641868T>A	ENSP00000342836:p.Val266Glu		Somatic					p.V266E	NM_001005490	NP_001005490	WXS	Illumina HiSeq	Unspecified	A6NCV1	O6C74_HUMAN			1	797	+			266			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000343870.4	37	c.797T>A	CCDS31816.1	.	.	.	.	.	.	.	.	.	.	t	15.91	2.973244	0.53614	.	.	ENSG00000197706	ENST00000343870	T	0.00069	8.77	5.48	4.33	0.51752	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000260	T	0.00271	0.0008	L	0.45285	1.41	0.09310	N	1	D	0.67145	0.996	D	0.74023	0.982	T	0.51068	-0.8752	10	0.72032	D	0.01	.	6.0137	0.19589	0.1445:0.0787:0.0:0.7768	.	266	A6NCV1	O6C74_HUMAN	E	266	ENSP00000342836:V266E	ENSP00000342836:V266E	V	+	2	0	OR6C74	53928135	0.037000	0.19845	0.793000	0.32043	0.979000	0.70002	0.368000	0.20399	1.006000	0.39211	0.455000	0.32223	GTG		0.383	OR6C74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382312.1			69	79	0	0	0	0	69	79				
TMEM19	55266	broad.mit.edu	37	12	72090220	72090220	+	Silent	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:72090220A>G	ENST00000266673.5	+	3	843	c.249A>G	c.(247-249)ctA>ctG	p.L83L	RP11-293I14.2_ENST00000548802.1_3'UTR|TMEM19_ENST00000549735.1_Silent_p.L83L	NM_018279.3	NP_060749.2	Q96HH6	TMM19_HUMAN	transmembrane protein 19	83						integral component of membrane (GO:0016021)				large_intestine(1)|lung(8)	9		Breast(359;0.0889)		GBM - Glioblastoma multiforme(134;0.044)		TTTCAGGGCTAGTCGTTGGAT	0.303																																						uc001sws.2		NA																	0					0						c.(247-249)CTA>CTG		transmembrane protein 19							128.0	130.0	129.0					12																	72090220		2203	4300	6503	SO:0001819	synonymous_variant	55266					integral to membrane		g.chr12:72090220A>G	BC008596	CCDS9002.1	12q15	2004-03-04				ENSG00000139291			25605	protein-coding gene	gene with protein product						12477932	Standard	NM_018279		Approved	FLJ10936	uc001sws.3	Q96HH6	OTTHUMG00000169558	ENST00000266673.5:c.249A>G	12.37:g.72090220A>G			Somatic				TMEM19_uc001swr.1_Silent_p.L69L|TMEM19_uc009zru.1_RNA	p.L83L	NM_018279	NP_060749	WXS	Illumina HiSeq	Unspecified	Q96HH6	TMM19_HUMAN		GBM - Glioblastoma multiforme(134;0.044)	3	832	+		Breast(359;0.0889)	83					B2RDL2|Q53FY3|Q9NV41	Silent	SNP	ENST00000266673.5	37	c.249A>G	CCDS9002.1																																																																																				0.303	TMEM19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404801.1	NM_018279		45	99	0	0	0	0	45	99				
TBC1D15	64786	broad.mit.edu	37	12	72278758	72278758	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:72278758A>G	ENST00000550746.1	+	5	575	c.511A>G	c.(511-513)Aaa>Gaa	p.K171E	TBC1D15_ENST00000319106.8_Missense_Mutation_p.K179E|TBC1D15_ENST00000393309.3_Intron|TBC1D15_ENST00000485960.2_Missense_Mutation_p.K171E	NM_001146213.1|NM_022771.4	NP_001139685.2|NP_073608.4	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15	171					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	Rab GTPase activator activity (GO:0005097)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AGGAGATAGCAAACTACTGAT	0.358																																						uc001swu.2		NA																	0					0						c.(577-579)AAA>GAA		TBC1 domain family, member 15 isoform 1							187.0	181.0	183.0					12																	72278758		2203	4300	6503	SO:0001583	missense	64786						protein binding|Rab GTPase activator activity	g.chr12:72278758A>G	AL157464	CCDS31858.1, CCDS53814.1, CCDS55849.1	12q15	2013-07-09			ENSG00000121749	ENSG00000121749			25694	protein-coding gene	gene with protein product		612662				16055087	Standard	NM_022771		Approved	FLJ12085, DKFZp761D0223	uc001swu.3	Q8TC07	OTTHUMG00000158553	ENST00000550746.1:c.511A>G	12.37:g.72278758A>G	ENSP00000448182:p.Lys171Glu		Somatic				TBC1D15_uc009zrv.2_Missense_Mutation_p.K72E|TBC1D15_uc010stt.1_Missense_Mutation_p.K179E|TBC1D15_uc001swv.2_Missense_Mutation_p.K193E|TBC1D15_uc001sww.2_Intron	p.K193E	NM_022771	NP_073608	WXS	Illumina HiSeq	Unspecified	Q8TC07	TBC15_HUMAN			5	586	+			171					B4DMT9|B9A6L6|J3KNI9|Q9HA83	Missense_Mutation	SNP	ENST00000550746.1	37	c.577A>G	CCDS31858.1	.	.	.	.	.	.	.	.	.	.	A	15.99	2.996774	0.54147	.	.	ENSG00000121749	ENST00000482439;ENST00000550746;ENST00000491063;ENST00000319106;ENST00000485960	T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43	5.49	5.49	0.81192	Domain of unknown function DUF3548 (1);	0.151927	0.64402	D	0.000017	T	0.20007	0.0481	L	0.29908	0.895	0.80722	D	1	B;B;B	0.18166	0.016;0.013;0.026	B;B;B	0.18561	0.015;0.009;0.022	T	0.07947	-1.0746	10	0.10377	T	0.69	-25.3519	10.0126	0.41995	0.9248:0.0:0.0752:0.0	.	179;171;171	E9PH93;Q8TC07-2;Q8TC07	.;.;TBC15_HUMAN	E	72;171;72;179;171	ENSP00000449643:K72E;ENSP00000448182:K171E;ENSP00000418091:K72E;ENSP00000318262:K179E;ENSP00000420678:K171E	ENSP00000318262:K179E	K	+	1	0	TBC1D15	70565025	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.339000	0.59322	2.068000	0.61886	0.482000	0.46254	AAA		0.358	TBC1D15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351266.2	NM_022771		51	96	0	0	0	0	51	96				
NAV3	89795	broad.mit.edu	37	12	78400963	78400963	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:78400963A>G	ENST00000397909.2	+	8	1818	c.1645A>G	c.(1645-1647)Aaa>Gaa	p.K549E	NAV3_ENST00000536525.2_Missense_Mutation_p.K549E|NAV3_ENST00000228327.6_Missense_Mutation_p.K549E|NAV3_ENST00000266692.7_Missense_Mutation_p.K549E			Q8IVL0	NAV3_HUMAN	neuron navigator 3	549						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CACAGCAAGCAAAGAGTCTGA	0.463										HNSCC(70;0.22)																												uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(1645-1647)AAA>GAA		neuron navigator 3							67.0	67.0	67.0					12																	78400963		1896	4121	6017	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78400963A>G	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.1645A>G	12.37:g.78400963A>G	ENSP00000381007:p.Lys549Glu	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.K549E	p.K549E	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			8	1818	+			549					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.1645A>G		.	.	.	.	.	.	.	.	.	.	A	16.31	3.087639	0.55968	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T;T	0.13901	2.55;2.55;2.55;2.55;2.55	5.29	5.29	0.74685	.	0.000000	0.42053	U	0.000768	T	0.13286	0.0322	L	0.52759	1.655	0.80722	D	1	P;B	0.43788	0.817;0.021	B;B	0.33750	0.169;0.013	T	0.03453	-1.1035	10	0.44086	T	0.13	-18.0726	15.2308	0.73386	1.0:0.0:0.0:0.0	.	549;549	Q8IVL0;Q8IVL0-2	NAV3_HUMAN;.	E	549	ENSP00000446628:K549E;ENSP00000446132:K549E;ENSP00000381007:K549E;ENSP00000228327:K549E;ENSP00000266692:K549E	ENSP00000228327:K549E	K	+	1	0	NAV3	76925094	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	4.600000	0.61083	2.007000	0.58848	0.528000	0.53228	AAA		0.463	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		43	61	0	0	0	0	43	61				
SLC6A15	55117	broad.mit.edu	37	12	85255560	85255560	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:85255560G>A	ENST00000266682.5	-	12	2585	c.2044C>T	c.(2044-2046)Ccg>Tcg	p.P682S	SLC6A15_ENST00000552192.1_Missense_Mutation_p.P575S|SLC6A15_ENST00000309283.7_3'UTR	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	682					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)			kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						ATCTCGCTCGGTATTTTTCCG	0.438																																						uc001szv.2		NA																	0				pancreas(2)|ovary(1)	3						c.(2044-2046)CCG>TCG		solute carrier family 6, member 15 isoform 1							119.0	117.0	118.0					12																	85255560		2203	4300	6503	SO:0001583	missense	55117				cellular nitrogen compound metabolic process|leucine transport|proline transport	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity	g.chr12:85255560G>A	AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.2044C>T	12.37:g.85255560G>A	ENSP00000266682:p.Pro682Ser		Somatic				SLC6A15_uc010sul.1_Missense_Mutation_p.P575S|SLC6A15_uc001szw.1_3'UTR	p.P682S	NM_182767	NP_877499	WXS	Illumina HiSeq	Unspecified	Q9H2J7	S6A15_HUMAN			12	2537	-			682			Cytoplasmic (Potential).		A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Missense_Mutation	SNP	ENST00000266682.5	37	c.2044C>T	CCDS9026.1	.	.	.	.	.	.	.	.	.	.	G	4.759	0.141099	0.09083	.	.	ENSG00000072041	ENST00000266682;ENST00000552192;ENST00000548267	T;T	0.75154	-0.72;-0.91	5.85	-10.7	0.00240	.	0.581510	0.20107	N	0.099114	T	0.55940	0.1952	L	0.46157	1.445	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.12604	-1.0541	10	0.42905	T	0.14	.	9.6522	0.39904	0.0905:0.139:0.7009:0.0696	.	682	Q9H2J7	S6A15_HUMAN	S	682;575;160	ENSP00000266682:P682S;ENSP00000450145:P575S	ENSP00000266682:P682S	P	-	1	0	SLC6A15	83779691	0.998000	0.40836	0.057000	0.19452	0.010000	0.07245	0.747000	0.26290	-1.524000	0.01764	-1.306000	0.01317	CCG		0.438	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767		90	148	0	0	0	0	90	148				
LRRIQ1	84125	broad.mit.edu	37	12	85450746	85450746	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:85450746G>T	ENST00000393217.2	+	8	2236	c.2175G>T	c.(2173-2175)atG>atT	p.M725I		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	725										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		CTGATAGCATGACCTGCTGTG	0.358																																						uc001tac.2		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(2173-2175)ATG>ATT		leucine-rich repeats and IQ motif containing 1							201.0	218.0	212.0					12																	85450746		2203	4299	6502	SO:0001583	missense	84125							g.chr12:85450746G>T	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.2175G>T	12.37:g.85450746G>T	ENSP00000376910:p.Met725Ile		Somatic				LRRIQ1_uc001tab.1_Missense_Mutation_p.M725I|LRRIQ1_uc001taa.1_Missense_Mutation_p.M700I	p.M725I	NM_001079910	NP_001073379	WXS	Illumina HiSeq	Unspecified	Q96JM4	LRIQ1_HUMAN		GBM - Glioblastoma multiforme(134;0.212)	8	2286	+			725					Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	c.2175G>T	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	G	1.215	-0.628656	0.03610	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.49432	0.78	5.55	-4.75	0.03239	.	0.766339	0.11702	N	0.537852	T	0.16854	0.0405	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.17776	-1.0358	10	0.20046	T	0.44	.	0.4169	0.00450	0.2728:0.171:0.2969:0.2592	.	725;700	Q96JM4;C9JI57	LRIQ1_HUMAN;.	I	725;700;725	ENSP00000376910:M725I	ENSP00000256007:M725I	M	+	3	0	LRRIQ1	83974877	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	0.127000	0.15790	-0.515000	0.06479	-0.282000	0.10007	ATG		0.358	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		236	352	1	0	2.42e-132	3.69e-132	236	352				
MYO1H	283446	broad.mit.edu	37	12	109872840	109872840	+	Splice_Site	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:109872840A>G	ENST00000431443.2	+	20	2045		c.e20-1		MYO1H_ENST00000310903.5_Splice_Site	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH							myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						TTTCACTTCTAGAACCAAAAT	0.373																																						uc010sxn.1		NA																	0					0						c.e20-2		myosin 1H							96.0	87.0	90.0					12																	109872840		1818	4076	5894	SO:0001630	splice_region_variant	283446					myosin complex	motor activity	g.chr12:109872840A>G		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.2046-1A>G	12.37:g.109872840A>G			Somatic					p.K672_splice	NM_001101421	NP_001094891	WXS	Illumina HiSeq	Unspecified	Q8N1T3	MYO1H_HUMAN			20	2016	+								F5H3C6	Splice_Site	SNP	ENST00000431443.2	37	c.2016_splice		.	.	.	.	.	.	.	.	.	.	A	18.57	3.651865	0.67472	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	.	.	.	4.63	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2927	0.54827	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYO1H	108357223	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	8.443000	0.90320	1.854000	0.53819	0.533000	0.62120	.		0.373	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597	Intron	16	27	0	0	0	0	16	27				
TBX5	6910	broad.mit.edu	37	12	114836427	114836427	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:114836427G>C	ENST00000310346.4	-	5	1127	c.461C>G	c.(460-462)tCc>tGc	p.S154C	TBX5_ENST00000526441.1_Missense_Mutation_p.S154C|TBX5_ENST00000405440.2_Missense_Mutation_p.S154C|TBX5_ENST00000349716.5_Missense_Mutation_p.S104C|TBX5_ENST00000552726.1_5'UTR	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	154					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		TTTCTGGAAGGAGACGAGCTG	0.622																																					NSCLC(152;1358 1980 4050 23898 40356)	uc001tvo.2		NA																	0				ovary(6)|pancreas(1)|skin(1)	8						c.(460-462)TCC>TGC		T-box 5 isoform 1							102.0	77.0	86.0					12																	114836427		2203	4300	6503	SO:0001583	missense	6910				cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr12:114836427G>C	U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.461C>G	12.37:g.114836427G>C	ENSP00000309913:p.Ser154Cys		Somatic				TBX5_uc001tvp.2_Missense_Mutation_p.S154C|TBX5_uc001tvq.2_Missense_Mutation_p.S104C|TBX5_uc010syv.1_Missense_Mutation_p.S154C	p.S154C	NM_181486	NP_852259	WXS	Illumina HiSeq	Unspecified	Q99593	TBX5_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0893)	5	956	-	Medulloblastoma(191;0.163)|all_neural(191;0.178)		154			T-box.		A6ND77|O15301|Q96TB0|Q9Y4I2	Missense_Mutation	SNP	ENST00000310346.4	37	c.461C>G	CCDS9173.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803713	0.90623	.	.	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000448888;ENST00000405440;ENST00000526441	D;D;D;D	0.90563	-2.69;-2.69;-2.69;-2.69	4.35	4.35	0.52113	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.93514	0.7930	M	0.69248	2.105	0.80722	D	1	D;D	0.56746	0.977;0.965	P;P	0.57720	0.634;0.826	D	0.94262	0.7503	10	0.66056	D	0.02	.	17.429	0.87534	0.0:0.0:1.0:0.0	.	154;154	Q99593-2;Q99593	.;TBX5_HUMAN	C	104;154;51;154;154	ENSP00000337723:S104C;ENSP00000309913:S154C;ENSP00000384152:S154C;ENSP00000433292:S154C	ENSP00000309913:S154C	S	-	2	0	TBX5	113320810	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.597000	0.98273	2.392000	0.81423	0.655000	0.94253	TCC		0.622	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	NM_080717		9	19	0	0	0	0	9	19				
FBXO21	23014	broad.mit.edu	37	12	117603318	117603318	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:117603318T>C	ENST00000330622.5	-	9	1297	c.1298A>G	c.(1297-1299)tAc>tGc	p.Y433C	FBXO21_ENST00000427718.2_Missense_Mutation_p.Y433C			O94952	FBX21_HUMAN	F-box protein 21	433					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|pancreas(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	29	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		CAGGTGGAAGTAAAGCCTGGC	0.512																																					GBM(168;452 2038 13535 17701 43680)	uc001twk.2		NA																	0				kidney(1)	1						c.(1297-1299)TAC>TGC		F-box only protein 21 isoform 1							125.0	123.0	124.0					12																	117603318		2203	4300	6503	SO:0001583	missense	23014				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity	g.chr12:117603318T>C	AB020682	CCDS9184.1, CCDS44989.1	12q24.23	2004-06-15	2004-06-15					"""F-boxes /  ""other"""""	13592	protein-coding gene	gene with protein product		609095	"""F-box only protein 21"""			10048485, 10531035	Standard	NM_033624		Approved	FBX21, KIAA0875	uc001twk.3	O94952	OTTHUMG00000169495	ENST00000330622.5:c.1298A>G	12.37:g.117603318T>C	ENSP00000328187:p.Tyr433Cys		Somatic				FBXO21_uc001twj.2_Missense_Mutation_p.Y433C|FBXO21_uc009zwq.2_Missense_Mutation_p.Y373C|FBXO21_uc001twl.1_Missense_Mutation_p.Y46C	p.Y433C	NM_033624	NP_296373	WXS	Illumina HiSeq	Unspecified	O94952	FBX21_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0291)	9	1337	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		433					B3KMF0|Q5BJG0|Q9H087	Missense_Mutation	SNP	ENST00000330622.5	37	c.1298A>G	CCDS9184.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.572977	0.86542	.	.	ENSG00000135108	ENST00000427718;ENST00000257563;ENST00000535590;ENST00000330622;ENST00000548840	T;T	0.45668	0.89;0.89	6.08	6.08	0.98989	F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.52725	0.1752	L	0.27053	0.805	0.80722	D	1	D;B;D;D	0.89917	1.0;0.296;1.0;1.0	D;B;D;D	0.87578	0.99;0.067;0.996;0.998	T	0.50972	-0.8764	10	0.39692	T	0.17	-4.8151	16.6438	0.85155	0.0:0.0:0.0:1.0	.	289;183;433;433	Q8IUQ5;B3KQC8;O94952;O94952-1	.;.;FBX21_HUMAN;.	C	433;349;289;433;85	ENSP00000414468:Y433C;ENSP00000328187:Y433C	ENSP00000257563:Y349C	Y	-	2	0	FBXO21	116087701	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.691000	0.84191	2.333000	0.79357	0.533000	0.62120	TAC		0.512	FBXO21-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404409.1	NM_033624		94	132	0	0	0	0	94	132				
GOLGA3	2802	broad.mit.edu	37	12	133363016	133363016	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:133363016T>C	ENST00000450791.2	-	14	3215	c.3032A>G	c.(3031-3033)cAg>cGg	p.Q1011R	GOLGA3_ENST00000537452.1_Missense_Mutation_p.Q1011R|GOLGA3_ENST00000204726.3_Missense_Mutation_p.Q1011R|GOLGA3_ENST00000545875.1_Missense_Mutation_p.Q1011R|GOLGA3_ENST00000456883.2_Missense_Mutation_p.Q1011R			Q08378	GOGA3_HUMAN	golgin A3	1011					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GAGGGCCTCCTGCAGGCGGCG	0.652																																						uc001ukz.1		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(3031-3033)CAG>CGG		Golgi autoantigen, golgin subfamily a, 3							24.0	23.0	23.0					12																	133363016		2203	4300	6503	SO:0001583	missense	2802				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity	g.chr12:133363016T>C	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.3032A>G	12.37:g.133363016T>C	ENSP00000410378:p.Gln1011Arg		Somatic				GOLGA3_uc001ula.1_Missense_Mutation_p.Q1011R|GOLGA3_uc001ulb.2_Missense_Mutation_p.Q1011R	p.Q1011R	NM_005895	NP_005886	WXS	Illumina HiSeq	Unspecified	Q08378	GOGA3_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)	15	3591	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)	1011			Potential.		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	37	c.3032A>G	CCDS9281.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.959426	0.74016	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.37058	1.68;1.68;1.7;1.22;1.22	5.71	4.56	0.56223	.	0.051228	0.85682	N	0.000000	T	0.58278	0.2111	M	0.75264	2.295	0.80722	D	1	D;D;D	0.76494	0.996;0.996;0.999	D;D;D	0.85130	0.986;0.986;0.997	T	0.59752	-0.7395	10	0.54805	T	0.06	.	11.73	0.51730	0.0:0.0693:0.0:0.9307	.	1011;1011;1011	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	R	1011	ENSP00000204726:Q1011R;ENSP00000410378:Q1011R;ENSP00000409303:Q1011R;ENSP00000442143:Q1011R;ENSP00000442603:Q1011R	ENSP00000204726:Q1011R	Q	-	2	0	GOLGA3	131873089	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	8.028000	0.88798	0.982000	0.38575	-0.290000	0.09829	CAG		0.652	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895		10	28	0	0	0	0	10	28				
RNF6	6049	broad.mit.edu	37	13	26793609	26793609	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr13:26793609G>C	ENST00000381588.4	-	3	930	c.178C>G	c.(178-180)Ctt>Gtt	p.L60V	RNF6_ENST00000381570.3_Missense_Mutation_p.L60V|RNF6_ENST00000399762.2_De_novo_Start_InFrame|RNF6_ENST00000346166.3_Missense_Mutation_p.L60V|RNF6_ENST00000468480.1_5'UTR	NM_005977.3	NP_005968.1	Q9Y252	RNF6_HUMAN	ring finger protein (C3H2C3 type) 6	60					negative regulation of axon extension (GO:0030517)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K27-linked ubiquitination (GO:0044314)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(3)|ovary(2)|prostate(2)|skin(2)	23	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		GTGCCTAAAAGATTATGGTCT	0.383																																						uc001uqo.2		NA																	0				ovary(1)|skin(1)	2						c.(178-180)CTT>GTT		ring finger protein 6							96.0	90.0	92.0					13																	26793609		2203	4300	6503	SO:0001583	missense	6049				negative regulation of axon extension|positive regulation of transcription, DNA-dependent|protein K27-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|regulation of androgen receptor signaling pathway|ubiquitin-dependent protein catabolic process	axon|cytoplasm|PML body	androgen receptor binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr13:26793609G>C	AJ010346	CCDS9316.1	13q12.2	2013-01-09			ENSG00000127870	ENSG00000127870		"""RING-type (C3HC4) zinc fingers"""	10069	protein-coding gene	gene with protein product	"""RING-H2 protein RNF-6"""	604242				10331950	Standard	NM_005977		Approved	DKFZp686P0776	uc001uqq.3	Q9Y252	OTTHUMG00000016614	ENST00000381588.4:c.178C>G	13.37:g.26793609G>C	ENSP00000371000:p.Leu60Val		Somatic				RNF6_uc001uqn.1_Missense_Mutation_p.L60V|RNF6_uc010aak.2_Missense_Mutation_p.L60V|RNF6_uc001uqp.2_Missense_Mutation_p.L60V|RNF6_uc001uqq.2_Missense_Mutation_p.L60V|RNF6_uc010tdk.1_Translation_Start_Site	p.L60V	NM_183044	NP_898865	WXS	Illumina HiSeq	Unspecified	Q9Y252	RNF6_HUMAN		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)	3	469	-	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)	60					B4DDP0|Q5W0H0|Q9BZP5|Q9UF41	Missense_Mutation	SNP	ENST00000381588.4	37	c.178C>G	CCDS9316.1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812021	0.70797	.	.	ENSG00000127870	ENST00000346166;ENST00000381588;ENST00000381570	T;T;T	0.06608	3.28;3.28;3.28	5.08	5.08	0.68730	.	0.000000	0.64402	D	0.000001	T	0.27098	0.0664	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.994;0.996	T	0.00761	-1.1577	10	0.87932	D	0	-17.311	16.8229	0.85923	0.0:0.0:1.0:0.0	.	60;60	Q9Y252;Q9BZP5	RNF6_HUMAN;.	V	60	ENSP00000342121:L60V;ENSP00000371000:L60V;ENSP00000370982:L60V	ENSP00000342121:L60V	L	-	1	0	RNF6	25691609	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.144000	0.71762	2.640000	0.89533	0.655000	0.94253	CTT		0.383	RNF6-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044246.2	NM_005977		58	73	0	0	0	0	58	73				
MTIF3	219402	broad.mit.edu	37	13	28011271	28011271	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr13:28011271G>A	ENST00000381116.1	-	6	834	c.600C>T	c.(598-600)gaC>gaT	p.D200D	MTIF3_ENST00000381120.3_Silent_p.D200D|MTIF3_ENST00000431572.2_Silent_p.D200D|MTIF3_ENST00000405591.2_Silent_p.D200D|MTIF3_ENST00000461838.1_5'UTR			Q9H2K0	IF3M_HUMAN	mitochondrial translational initiation factor 3	200					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	7		Lung SC(185;0.0161)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.108)|OV - Ovarian serous cystadenocarcinoma(117;0.157)		TTTCTGACACGTCTACATTTT	0.393																																						uc001urh.2		NA																	0				ovary(1)|skin(1)	2						c.(598-600)GAC>GAT		mitochondrial translational initiation factor 3							133.0	119.0	123.0					13																	28011271		2202	4300	6502	SO:0001819	synonymous_variant	219402				regulation of translational initiation|ribosome disassembly	mitochondrion	ribosomal small subunit binding|translation initiation factor activity	g.chr13:28011271G>A	BC046166	CCDS9322.1	13q12.2	2007-05-03			ENSG00000122033	ENSG00000122033			29788	protein-coding gene	gene with protein product						12095986	Standard	NM_152912		Approved	IF-3mt, IF3(mt)	uc001uri.3	Q9H2K0	OTTHUMG00000016633	ENST00000381116.1:c.600C>T	13.37:g.28011271G>A			Somatic				MTIF3_uc001uri.2_Silent_p.D200D|MTIF3_uc001urj.2_Silent_p.D200D|MTIF3_uc001urk.2_Silent_p.D200D	p.D200D	NM_152912	NP_690876	WXS	Illumina HiSeq	Unspecified	Q9H2K0	IF3M_HUMAN	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.108)|OV - Ovarian serous cystadenocarcinoma(117;0.157)	2	1824	-		Lung SC(185;0.0161)	200					Q05BL8|Q5W0V0|Q86X68	Silent	SNP	ENST00000381116.1	37	c.600C>T	CCDS9322.1																																																																																				0.393	MTIF3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044300.1	NM_152912		26	46	0	0	0	0	26	46				
SERTM1	400120	broad.mit.edu	37	13	37269514	37269514	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr13:37269514C>A	ENST00000315190.3	+	2	745	c.299C>A	c.(298-300)tCc>tAc	p.S100Y		NM_203451.2	NP_982276.2	A2A2V5	SRTM1_HUMAN	serine-rich and transmembrane domain containing 1	100						integral component of membrane (GO:0016021)											TCTCAGAGGTCCACTTTTTCA	0.473																																						uc001uvt.3		NA																	0				skin(1)	1						c.(298-300)TCC>TAC		hypothetical protein LOC400120							65.0	66.0	66.0					13																	37269514		2203	4300	6503	SO:0001583	missense	400120					integral to membrane		g.chr13:37269514C>A		CCDS9358.1	13q13.3	2011-08-10	2011-08-10	2011-08-09	ENSG00000180440	ENSG00000180440			33792	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 36"""	C13orf36			Standard	NM_203451		Approved		uc001uvt.4	A2A2V5	OTTHUMG00000016735	ENST00000315190.3:c.299C>A	13.37:g.37269514C>A	ENSP00000325776:p.Ser100Tyr		Somatic					p.S100Y	NM_203451	NP_982276	WXS	Illumina HiSeq	Unspecified	A2A2V5	CM036_HUMAN			2	745	+			100					Q8N469	Missense_Mutation	SNP	ENST00000315190.3	37	c.299C>A	CCDS9358.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.367944	0.61513	.	.	ENSG00000180440	ENST00000315190	.	.	.	5.18	5.18	0.71444	.	0.116340	0.64402	D	0.000011	T	0.62804	0.2458	N	0.14661	0.345	0.58432	D	0.99999	D	0.62365	0.991	D	0.78314	0.991	T	0.70156	-0.4949	9	0.87932	D	0	-14.7582	17.6906	0.88268	0.0:1.0:0.0:0.0	.	100	A2A2V5	SRTM1_HUMAN	Y	100	.	ENSP00000325776:S100Y	S	+	2	0	SERTM1	36167514	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	7.093000	0.76937	2.398000	0.81561	0.557000	0.71058	TCC		0.473	SERTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044518.2	NM_203451		32	86	1	0	7.11e-15	8.97e-15	32	86				
ESD	2098	broad.mit.edu	37	13	47351749	47351749	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr13:47351749C>A	ENST00000378720.3	-	9	792	c.610G>T	c.(610-612)Gct>Tct	p.A204S	ESD_ENST00000378697.1_Missense_Mutation_p.A175S|ESD_ENST00000495654.1_5'Flank	NM_001984.1	NP_001975.1	P10768	ESTD_HUMAN	esterase D	204					formaldehyde catabolic process (GO:0046294)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carboxylic ester hydrolase activity (GO:0052689)|hydrolase activity, acting on ester bonds (GO:0016788)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)|S-formylglutathione hydrolase activity (GO:0018738)			endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	9		all_lung(13;3.54e-08)|Lung NSC(96;9.1e-06)|Breast(56;0.000148)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)		GBM - Glioblastoma multiforme(144;2.66e-05)	Glutathione(DB00143)	AGGTGGGTAGCATCATAAGCC	0.343																																						uc001vbn.2		NA																	0				ovary(1)	1						c.(610-612)GCT>TCT		esterase D/formylglutathione hydrolase	Glutathione(DB00143)						87.0	88.0	88.0					13																	47351749		2203	4300	6503	SO:0001583	missense	2098					cytoplasmic membrane-bounded vesicle	carboxylesterase activity|S-formylglutathione hydrolase activity	g.chr13:47351749C>A	M13450	CCDS9404.1	13q14.1-q14.2	2014-05-13	2010-05-07		ENSG00000139684	ENSG00000139684	3.1.2.12		3465	protein-coding gene	gene with protein product	"""S-formylglutathione hydrolase"""	133280	"""esterase D/formylglutathione hydrolase"""				Standard	NM_001984		Approved		uc001vbn.3	P10768	OTTHUMG00000016878	ENST00000378720.3:c.610G>T	13.37:g.47351749C>A	ENSP00000367992:p.Ala204Ser		Somatic				ESD_uc001vbo.2_Missense_Mutation_p.A204S|ESD_uc001vbp.1_Missense_Mutation_p.A62S	p.A204S	NM_001984	NP_001975	WXS	Illumina HiSeq	Unspecified	P10768	ESTD_HUMAN		GBM - Glioblastoma multiforme(144;2.66e-05)	9	793	-		all_lung(13;3.54e-08)|Lung NSC(96;9.1e-06)|Breast(56;0.000148)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	204					Q5TBU8|Q5TBV0|Q5TBV2|Q9BVJ2	Missense_Mutation	SNP	ENST00000378720.3	37	c.610G>T	CCDS9404.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.0|22.0	4.227477|4.227477	0.79576|0.79576	.|.	.|.	ENSG00000139684|ENSG00000139684	ENST00000378720;ENST00000378697|ENST00000412582	T;T|.	0.32515|.	1.45;1.45|.	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69975|0.69975	0.3171|0.3171	L|L	0.48174|0.48174	1.505|1.505	0.80722|0.80722	D|D	1|1	B|.	0.28324|.	0.207|.	P|.	0.49140|.	0.601|.	T|T	0.63804|0.63804	-0.6554|-0.6554	10|5	0.38643|.	T|.	0.18|.	-17.6745|-17.6745	19.5254|19.5254	0.95203|0.95203	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	204|.	P10768|.	ESTD_HUMAN|.	S|I	204;175|151	ENSP00000367992:A204S;ENSP00000367969:A175S|.	ENSP00000367969:A175S|.	A|M	-|-	1|3	0|0	ESD|ESD	46249750|46249750	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.515000|0.515000	0.34225|0.34225	7.703000|7.703000	0.84585|0.84585	2.857000|2.857000	0.98124|0.98124	0.650000|0.650000	0.86243|0.86243	GCT|ATG		0.343	ESD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044826.1			71	120	1	0	4.83e-46	7.13e-46	71	120				
ATP7B	540	broad.mit.edu	37	13	52520593	52520593	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr13:52520593G>T	ENST00000242839.4	-	13	3043	c.2887C>A	c.(2887-2889)Cag>Aag	p.Q963K	ATP7B_ENST00000400366.3_Missense_Mutation_p.Q852K|ATP7B_ENST00000400370.3_Missense_Mutation_p.Q533K|ATP7B_ENST00000417240.2_Missense_Mutation_p.Q235K|ATP7B_ENST00000418097.2_Intron|ATP7B_ENST00000482841.1_5'UTR|ATP7B_ENST00000344297.5_Missense_Mutation_p.Q756K|ATP7B_ENST00000448424.2_Missense_Mutation_p.Q885K	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	963					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	ACCTCTGTCTGGGAGATGTGC	0.537									Wilson disease																													uc001vfw.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3	GRCh37	CD033174|CM032849	ATP7B	D|M		c.(2887-2889)CAG>AAG		ATPase, Cu++ transporting, beta polypeptide							78.0	86.0	83.0					13																	52520593		2014	4186	6200	SO:0001583	missense	540	Wilson_disease	Familial Cancer Database		ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding	g.chr13:52520593G>T	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.2887C>A	13.37:g.52520593G>T	ENSP00000242839:p.Gln963Lys		Somatic				ATP7B_uc010adv.2_Missense_Mutation_p.Q533K|ATP7B_uc001vfx.2_Missense_Mutation_p.Q756K|ATP7B_uc001vfy.2_Missense_Mutation_p.Q852K|ATP7B_uc010tgt.1_Intron|ATP7B_uc010tgu.1_Missense_Mutation_p.Q915K|ATP7B_uc010tgv.1_Missense_Mutation_p.Q885K|ATP7B_uc001vfv.2_Missense_Mutation_p.Q235K|ATP7B_uc010tgs.1_Missense_Mutation_p.Q235K	p.Q963K	NM_000053	NP_000044	WXS	Illumina HiSeq	Unspecified	P35670	ATP7B_HUMAN		GBM - Glioblastoma multiforme(99;5.25e-08)	13	3044	-		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)	963			Extracellular (Potential).		Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Missense_Mutation	SNP	ENST00000242839.4	37	c.2887C>A	CCDS41892.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.760849	0.31137	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000344297;ENST00000417240;ENST00000448424;ENST00000400370	D;D;D;D;D;D	0.96104	-2.61;-2.61;-3.91;-2.61;-2.61;-2.61	5.15	4.3	0.51218	ATPase, P-type, ATPase-associated domain (1);	0.602886	0.18098	N	0.151774	D	0.84642	0.5517	N	0.02011	-0.69	0.80722	D	1	B;B;B;B;B;B;B	0.17268	0.021;0.001;0.0;0.019;0.019;0.001;0.0	B;B;B;B;B;B;B	0.12156	0.005;0.006;0.001;0.0;0.007;0.003;0.006	T	0.78648	-0.2122	10	0.21014	T	0.42	-7.39	8.5151	0.33242	0.0:0.1249:0.5765:0.2987	.	885;915;235;533;852;756;963	E7ET55;B7ZLR4;E7EQQ2;F5H562;P35670-3;P35670-2;P35670	.;.;.;.;.;.;ATP7B_HUMAN	K	963;852;756;235;885;533	ENSP00000242839:Q963K;ENSP00000383217:Q852K;ENSP00000342559:Q756K;ENSP00000390360:Q235K;ENSP00000416738:Q885K;ENSP00000383221:Q533K	ENSP00000242839:Q963K	Q	-	1	0	ATP7B	51418594	0.973000	0.33851	0.995000	0.50966	0.819000	0.46315	2.473000	0.45145	1.402000	0.46780	0.650000	0.86243	CAG		0.537	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053		24	39	1	0	3.29e-13	4.07e-13	24	39				
KLHL1	57626	broad.mit.edu	37	13	70413204	70413204	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr13:70413204G>T	ENST00000377844.4	-	6	2077	c.1318C>A	c.(1318-1320)Cca>Aca	p.P440T	KLHL1_ENST00000545028.1_Missense_Mutation_p.P247T	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	440					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CTTCTTTCTGGCAATAGATGG	0.353																																						uc001vip.2		NA																	0					0						c.(1318-1320)CCA>ACA		kelch-like 1 protein							143.0	136.0	139.0					13																	70413204		2201	4299	6500	SO:0001583	missense	57626				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr13:70413204G>T	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1318C>A	13.37:g.70413204G>T	ENSP00000367075:p.Pro440Thr		Somatic				KLHL1_uc010thm.1_Missense_Mutation_p.P379T	p.P440T	NM_020866	NP_065917	WXS	Illumina HiSeq	Unspecified	Q9NR64	KLHL1_HUMAN		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)	6	2112	-		Breast(118;0.000162)	440					A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	37	c.1318C>A	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.601455	0.87055	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.73363	-0.74;-0.51	5.23	5.23	0.72850	Galactose oxidase, beta-propeller (1);	0.000000	0.64402	D	0.000014	D	0.89458	0.6721	M	0.91090	3.175	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	D	0.91549	0.5255	10	0.87932	D	0	.	19.1731	0.93588	0.0:0.0:1.0:0.0	.	440;440	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	T	440;247	ENSP00000367075:P440T;ENSP00000439602:P247T	ENSP00000367075:P440T	P	-	1	0	KLHL1	69311205	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.752000	0.98900	2.613000	0.88420	0.655000	0.94253	CCA		0.353	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866		69	86	1	0	1.26e-45	1.85e-45	69	86				
SLITRK1	114798	broad.mit.edu	37	13	84454928	84454928	+	Missense_Mutation	SNP	C	C	A	rs372764349		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr13:84454928C>A	ENST00000377084.2	-	1	1600	c.715G>T	c.(715-717)Gtg>Ttg	p.V239L		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	239	LRRCT 1.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TCGCAGACCACTCGGCCGATC	0.527																																						uc001vlk.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(715-717)GTG>TTG		slit and trk like 1 protein precursor							58.0	60.0	59.0					13																	84454928		2203	4300	6503	SO:0001583	missense	114798					integral to membrane		g.chr13:84454928C>A	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.715G>T	13.37:g.84454928C>A	ENSP00000366288:p.Val239Leu		Somatic					p.V239L	NM_052910	NP_443142	WXS	Illumina HiSeq	Unspecified	Q96PX8	SLIK1_HUMAN		GBM - Glioblastoma multiforme(99;0.07)	1	1601	-	Medulloblastoma(90;0.18)	Breast(118;0.212)	239			Extracellular (Potential).|LRRCT 1.		Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	c.715G>T	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.505540	0.64410	.	.	ENSG00000178235	ENST00000377084	T	0.48836	0.8	4.71	4.71	0.59529	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.45955	0.1368	L	0.42008	1.315	0.58432	D	0.999999	B	0.33299	0.407	B	0.40285	0.325	T	0.30387	-0.9980	10	0.20046	T	0.44	-11.2057	16.3895	0.83528	0.0:1.0:0.0:0.0	.	239	Q96PX8	SLIK1_HUMAN	L	239	ENSP00000366288:V239L	ENSP00000366288:V239L	V	-	1	0	SLITRK1	83352929	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.651000	0.83577	2.456000	0.83038	0.555000	0.69702	GTG		0.527	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		36	53	1	0	2.64e-12	3.24e-12	36	53				
ERCC5	2073	broad.mit.edu	37	13	103519118	103519118	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr13:103519118G>T	ENST00000355739.4	+	11	3879	c.2456G>T	c.(2455-2457)cGg>cTg	p.R819L	BIVM-ERCC5_ENST00000602836.1_Silent_p.A1244A|ERCC5_ENST00000375954.1_Missense_Mutation_p.R52L	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	819	I-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TTTGGAGCGCGGCATGTCTAT	0.428			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													uc001vpw.2		NA	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	Mis|N|F	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""			E		skin basal cell|skin squamous cell|melanoma			0				ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						c.(2455-2457)CGG>CTG	Direct_reversal_of_damage|NER	XPG-complementing protein							57.0	59.0	58.0					13																	103519118		2203	4300	6503	SO:0001583	missense	2073	Xeroderma_Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding	g.chr13:103519118G>T	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.2456G>T	13.37:g.103519118G>T	ENSP00000347978:p.Arg819Leu		Somatic				ERCC5_uc001vpu.1_Missense_Mutation_p.R1273L|ERCC5_uc010tjc.1_RNA|ERCC5_uc010tjd.1_Missense_Mutation_p.R651L	p.R819L	NM_000123	NP_000114	WXS	Illumina HiSeq	Unspecified	P28715	ERCC5_HUMAN			11	2899	+	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)		819			I-domain.		A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	c.2456G>T	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	G	35	5.559059	0.96514	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955;ENST00000375954	T;T	0.70282	0.76;-0.47	5.77	5.77	0.91146	XPG/RAD2 endonuclease (2);	0.000000	0.85682	D	0.000000	D	0.85124	0.5625	M	0.77313	2.365	0.80722	D	1	D;D	0.76494	0.999;0.993	D;D	0.77557	0.99;0.969	D	0.84739	0.0750	10	0.51188	T	0.08	-20.1542	19.9859	0.97351	0.0:0.0:1.0:0.0	.	819;1244	P28715;Q59FZ7	ERCC5_HUMAN;.	L	1244;819;651;52	ENSP00000347978:R819L;ENSP00000365121:R52L	ENSP00000347978:R819L	R	+	2	0	ERCC5	102317119	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.731000	0.98807	2.729000	0.93468	0.655000	0.94253	CGG		0.428	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1			32	46	1	0	3.11e-16	3.99e-16	32	46				
TTC5	91875	broad.mit.edu	37	14	20768960	20768960	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr14:20768960C>A	ENST00000258821.3	-	3	258	c.202G>T	c.(202-204)Gca>Tca	p.A68S		NM_138376.2	NP_612385.2	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5	68					DNA repair (GO:0006281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)		AGAACTTGTGCCTTGCCCTGG	0.438																																						uc001vwt.2		NA																	0				ovary(1)	1						c.(202-204)GCA>TCA		tetratricopeptide repeat domain 5							118.0	119.0	119.0					14																	20768960		2203	4300	6503	SO:0001583	missense	91875				DNA repair	cytoplasm|nucleus	binding	g.chr14:20768960C>A	BC008647	CCDS9546.1	14q11.2	2013-01-11			ENSG00000136319	ENSG00000136319		"""Tetratricopeptide (TTC) repeat domain containing"""	19274	protein-coding gene	gene with protein product						11511361	Standard	NM_138376		Approved	Strap	uc001vwt.3	Q8N0Z6	OTTHUMG00000029506	ENST00000258821.3:c.202G>T	14.37:g.20768960C>A	ENSP00000258821:p.Ala68Ser		Somatic				TTC5_uc001vwu.2_5'UTR	p.A68S	NM_138376	NP_612385	WXS	Illumina HiSeq	Unspecified	Q8N0Z6	TTC5_HUMAN	Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)	3	259	-	all_cancers(95;0.00092)		68			TPR 1.		A8MQ18|Q96HF9	Missense_Mutation	SNP	ENST00000258821.3	37	c.202G>T	CCDS9546.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.18|18.18	3.567761|3.567761	0.65651|0.65651	.|.	.|.	ENSG00000136319|ENSG00000136319	ENST00000258821|ENST00000423949	T|.	0.41758|.	0.99|.	5.16|5.16	5.16|5.16	0.70880|0.70880	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72692|0.72692	0.3492|0.3492	M|M	0.63428|0.63428	1.95|1.95	0.80722|0.80722	D|D	1|1	P|.	0.44044|.	0.825|.	B|.	0.35655|.	0.207|.	T|T	0.70605|0.70605	-0.4826|-0.4826	10|5	0.48119|.	T|.	0.1|.	.|.	17.5864|17.5864	0.87982|0.87982	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	68|.	Q8N0Z6|.	TTC5_HUMAN|.	S|V	68|67	ENSP00000258821:A68S|.	ENSP00000258821:A68S|.	A|G	-|-	1|2	0|0	TTC5|TTC5	19838800|19838800	1.000000|1.000000	0.71417|0.71417	0.950000|0.950000	0.38849|0.38849	0.325000|0.325000	0.28411|0.28411	6.275000|6.275000	0.72594|0.72594	2.690000|2.690000	0.91761|0.91761	0.655000|0.655000	0.94253|0.94253	GCA|GGC		0.438	TTC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073529.4	NM_138376		236	181	1	0	4.91e-105	7.44e-105	236	181				
NDRG2	57447	broad.mit.edu	37	14	21491405	21491405	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr14:21491405C>T	ENST00000556147.1	-	2	1010	c.70G>A	c.(70-72)Gcc>Acc	p.A24T	NDRG2_ENST00000298684.5_Missense_Mutation_p.A24T|AL161668.5_ENST00000533984.1_lincRNA|NDRG2_ENST00000554277.1_5'Flank|NDRG2_ENST00000397847.2_Missense_Mutation_p.A24T|NDRG2_ENST00000554143.1_Missense_Mutation_p.A24T|NDRG2_ENST00000553503.1_Missense_Mutation_p.A24T|NDRG2_ENST00000397858.1_Missense_Mutation_p.A24T|NDRG2_ENST00000397844.2_Missense_Mutation_p.A24T|NDRG2_ENST00000403829.3_Missense_Mutation_p.A34T|NDRG2_ENST00000554104.1_5'Flank|NDRG2_ENST00000397856.3_Missense_Mutation_p.A24T|NDRG2_ENST00000555158.1_Missense_Mutation_p.A24T|NDRG2_ENST00000397855.3_Missense_Mutation_p.A24T|NDRG2_ENST00000397853.3_Missense_Mutation_p.A24T|NDRG2_ENST00000298687.5_Missense_Mutation_p.A24T|NDRG2_ENST00000360463.3_Missense_Mutation_p.A24T|NDRG2_ENST00000350792.3_Missense_Mutation_p.A24T|NDRG2_ENST00000397851.2_Missense_Mutation_p.A24T			Q9UN36	NDRG2_HUMAN	NDRG family member 2	24					cell differentiation (GO:0030154)|negative regulation of cytokine production (GO:0001818)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of platelet-derived growth factor production (GO:0090361)|regulation of vascular endothelial growth factor production (GO:0010574)|substantia nigra development (GO:0021762)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)				breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	23	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		ATAACCTTGGCCGCCTCAGGC	0.537																																						uc001vyy.2		NA																	0				ovary(1)|breast(1)	2						c.(70-72)GCC>ACC		N-myc downstream-regulated gene 2 isoform a							96.0	85.0	89.0					14																	21491405		2203	4300	6503	SO:0001583	missense	57447				cell differentiation|nervous system development	centrosome|cytosol|Golgi apparatus|nucleus|perinuclear region of cytoplasm		g.chr14:21491405C>T	AB033074	CCDS9564.1, CCDS9565.1, CCDS61384.1, CCDS61386.1, CCDS73613.1	14q11.2	2008-07-09			ENSG00000165795	ENSG00000165795			14460	protein-coding gene	gene with protein product		605272				10831399	Standard	NM_201535		Approved	KIAA1248, SYLD	uc001vyx.3	Q9UN36	OTTHUMG00000029619	ENST00000556147.1:c.70G>A	14.37:g.21491405C>T	ENSP00000451712:p.Ala24Thr		Somatic				NDRG2_uc010tll.1_Missense_Mutation_p.A34T|NDRG2_uc001vyt.2_5'Flank|NDRG2_uc001vyu.2_Missense_Mutation_p.A24T|NDRG2_uc001vyv.2_Missense_Mutation_p.A24T|NDRG2_uc001vyw.2_Missense_Mutation_p.A24T|NDRG2_uc001vzb.2_5'UTR|NDRG2_uc001vyx.2_Missense_Mutation_p.A24T|NDRG2_uc001vza.2_Missense_Mutation_p.A24T|NDRG2_uc001vyz.2_Missense_Mutation_p.A24T|NDRG2_uc001vzc.2_Missense_Mutation_p.A24T|NDRG2_uc001vze.2_Missense_Mutation_p.A24T|NDRG2_uc001vzd.2_Missense_Mutation_p.A24T|NDRG2_uc001vzg.2_Missense_Mutation_p.A24T|NDRG2_uc001vzf.2_Missense_Mutation_p.A24T|NDRG2_uc010aig.2_Missense_Mutation_p.A24T	p.A24T	NM_201540	NP_963834	WXS	Illumina HiSeq	Unspecified	Q9UN36	NDRG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)	3	220	-	all_cancers(95;0.00185)		24					B3KUE3|B4DE86|B7WP11|B7WPD5|D3DS07|D3DS10|Q567T1|Q68DW2|Q86U08|Q86U46|Q96FD3|Q96FT0|Q96JU0|Q96PN0|Q9BQH5|Q9ULH2	Missense_Mutation	SNP	ENST00000556147.1	37	c.70G>A	CCDS9565.1	.	.	.	.	.	.	.	.	.	.	C	10.93	1.489974	0.26686	.	.	ENSG00000165795	ENST00000298687;ENST00000350792;ENST00000554770;ENST00000397858;ENST00000555158;ENST00000553503;ENST00000397853;ENST00000360463;ENST00000556147;ENST00000554143;ENST00000397851;ENST00000397847;ENST00000397856;ENST00000397855;ENST00000298684;ENST00000397844;ENST00000403829;ENST00000556008;ENST00000556974;ENST00000555026;ENST00000553867;ENST00000557169;ENST00000555869;ENST00000557182;ENST00000555733;ENST00000555384;ENST00000554094;ENST00000553442;ENST00000556420;ENST00000553784;ENST00000557149;ENST00000555142;ENST00000557264;ENST00000557676;ENST00000556924;ENST00000556329;ENST00000554398;ENST00000554472;ENST00000554483;ENST00000555657;ENST00000557274;ENST00000556457;ENST00000556688;ENST00000554561;ENST00000554419;ENST00000553563;ENST00000554489;ENST00000556561;ENST00000554893;ENST00000554833;ENST00000554415	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.51817	2.28;1.56;2.28;1.56;1.56;2.28;1.56;2.28;1.56;2.28;2.28;1.56;2.25;2.25;1.56;1.56;1.56;1.56;1.56;2.28;2.26;2.26;0.69;2.28;2.28;2.25;2.25;2.25;2.28;2.26;2.26;2.26;2.25;2.26;2.25;2.28;2.28;2.26;2.25;2.25;2.28;2.28;2.25;2.28;1.89;2.25;2.28;1.93;1.96;1.96	5.28	5.28	0.74379	.	0.867272	0.10280	N	0.693590	T	0.30696	0.0773	N	0.14661	0.345	0.35981	D	0.836049	B;B;B;B;B	0.21821	0.013;0.061;0.023;0.021;0.023	B;B;B;B;B	0.16289	0.003;0.015;0.007;0.007;0.007	T	0.10382	-1.0632	10	0.07325	T	0.83	-8.5566	14.4082	0.67096	0.0:1.0:0.0:0.0	.	34;24;24;24;24	B4DE86;Q9UN36-3;Q9UN36-5;Q9UN36;Q9UN36-4	.;.;.;NDRG2_HUMAN;.	T	24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;34;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24;24	ENSP00000298687:A24T;ENSP00000344620:A24T;ENSP00000380956:A24T;ENSP00000452038:A24T;ENSP00000452306:A24T;ENSP00000380951:A24T;ENSP00000353649:A24T;ENSP00000451712:A24T;ENSP00000452006:A24T;ENSP00000380949:A24T;ENSP00000380945:A24T;ENSP00000380954:A24T;ENSP00000380953:A24T;ENSP00000298684:A24T;ENSP00000380943:A24T;ENSP00000385889:A34T;ENSP00000451966:A24T;ENSP00000452362:A24T;ENSP00000451274:A24T;ENSP00000450691:A24T;ENSP00000452334:A24T;ENSP00000451105:A24T;ENSP00000450545:A24T;ENSP00000452482:A24T;ENSP00000451094:A24T;ENSP00000452278:A24T;ENSP00000450493:A24T;ENSP00000451951:A24T;ENSP00000451059:A24T;ENSP00000452592:A24T;ENSP00000450513:A24T;ENSP00000451471:A24T;ENSP00000452548:A24T;ENSP00000450504:A24T;ENSP00000452262:A24T;ENSP00000451185:A24T;ENSP00000451348:A24T;ENSP00000451472:A24T;ENSP00000452247:A24T;ENSP00000452344:A24T;ENSP00000450852:A24T;ENSP00000451981:A24T;ENSP00000451163:A24T;ENSP00000452179:A24T;ENSP00000451541:A24T;ENSP00000452302:A24T;ENSP00000450825:A24T;ENSP00000450450:A24T;ENSP00000452458:A24T;ENSP00000452274:A24T	ENSP00000298684:A24T	A	-	1	0	NDRG2	20561245	0.789000	0.28775	0.910000	0.35882	0.009000	0.06853	1.275000	0.33144	2.439000	0.82584	0.655000	0.94253	GCC		0.537	NDRG2-013	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411717.1			3	43	0	0	0	0	3	43				
MYH7	4625	broad.mit.edu	37	14	23886825	23886825	+	Silent	SNP	G	G	A	rs201895208		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr14:23886825G>A	ENST00000355349.3	-	31	4402	c.4240C>T	c.(4240-4242)Ctg>Ttg	p.L1414L	MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1414			L -> M (in CMH1). {ECO:0000269|PubMed:18403758}.		adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GTCTTCTCCAGCGAGGAGCAC	0.617																																						uc001wjx.2		NA																	0				ovary(3)|skin(1)	4	GRCh37	CM081706	MYH7	M		c.(4240-4242)CTG>TTG		myosin, heavy chain 7, cardiac muscle, beta							109.0	101.0	104.0					14																	23886825		2203	4300	6503	SO:0001819	synonymous_variant	4625				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr14:23886825G>A	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4240C>T	14.37:g.23886825G>A			Somatic					p.L1414L	NM_000257	NP_000248	WXS	Illumina HiSeq	Unspecified	P12883	MYH7_HUMAN		GBM - Glioblastoma multiforme(265;0.00725)	31	4346	-	all_cancers(95;2.54e-05)		1414		L -> M (in CMH1).	Potential.		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	37	c.4240C>T	CCDS9601.1																																																																																				0.617	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		128	81	0	0	0	0	128	81				
SSTR1	6751	broad.mit.edu	37	14	38679295	38679295	+	Missense_Mutation	SNP	T	T	A	rs149523434		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr14:38679295T>A	ENST00000267377.2	+	3	1318	c.701T>A	c.(700-702)cTg>cAg	p.L234Q		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	234					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	GGCTTCCTGCTGCCCGTGGGG	0.622																																						uc001wul.1		NA																	0				central_nervous_system(3)|ovary(1)|lung(1)	5						c.(700-702)CTG>CAG		somatostatin receptor 1	Octreotide(DB00104)						50.0	50.0	50.0					14																	38679295		2203	4300	6503	SO:0001583	missense	6751				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	somatostatin receptor activity	g.chr14:38679295T>A		CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.701T>A	14.37:g.38679295T>A	ENSP00000267377:p.Leu234Gln		Somatic				SSTR1_uc010amu.1_Intron	p.L234Q	NM_001049	NP_001040	WXS	Illumina HiSeq	Unspecified	P30872	SSR1_HUMAN	Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	3	1318	+	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		234			Helical; Name=5; (Potential).			Missense_Mutation	SNP	ENST00000267377.2	37	c.701T>A	CCDS9666.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.179245	0.57800	.	.	ENSG00000139874	ENST00000267377	T	0.46819	0.86	4.82	4.82	0.62117	GPCR, rhodopsin-like superfamily (1);	0.121832	0.34362	N	0.004027	T	0.76256	0.3962	H	0.96720	3.87	0.48452	D	0.999655	D	0.54601	0.967	P	0.62491	0.903	D	0.83807	0.0239	10	0.54805	T	0.06	.	13.7174	0.62705	0.0:0.0:0.0:1.0	.	234	P30872	SSR1_HUMAN	Q	234	ENSP00000267377:L234Q	ENSP00000267377:L234Q	L	+	2	0	SSTR1	37749046	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.864000	0.56024	2.034000	0.60081	0.459000	0.35465	CTG		0.622	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2			32	66	0	0	0	0	32	66				
PTGER2	5732	broad.mit.edu	37	14	52781369	52781369	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr14:52781369G>A	ENST00000245457.5	+	1	257	c.103G>A	c.(103-105)Ggg>Agg	p.G35R	PTGER2_ENST00000557436.1_Intron	NM_000956.3	NP_000947.2	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	35					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to prostaglandin E stimulus (GO:0071380)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)|response to lipopolysaccharide (GO:0032496)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Dinoprostone(DB00917)|Misoprostol(DB00929)	GTTCTCGGCCGGGGTGCTGGG	0.682																																						uc001wzr.2		NA																	0				lung(1)|breast(1)	2						c.(103-105)GGG>AGG		prostaglandin E receptor 2 (subtype EP2), 53kDa	Alprostadil(DB00770)|Iloprost(DB01088)						19.0	24.0	22.0					14																	52781369		2200	4299	6499	SO:0001583	missense	5732					integral to plasma membrane	prostaglandin E receptor activity	g.chr14:52781369G>A		CCDS9708.1	14q22	2012-08-08	2002-08-29		ENSG00000125384	ENSG00000125384		"""GPCR / Class A : Prostanoid receptors"""	9594	protein-coding gene	gene with protein product		176804	"""prostaglandin E receptor 2 (subtype EP2), 53kD"""			8250933, 7759114	Standard	NM_000956		Approved	EP2	uc001wzr.3	P43116	OTTHUMG00000140300	ENST00000245457.5:c.103G>A	14.37:g.52781369G>A	ENSP00000245457:p.Gly35Arg		Somatic					p.G35R	NM_000956	NP_000947	WXS	Illumina HiSeq	Unspecified	P43116	PE2R2_HUMAN			1	354	+	Breast(41;0.0639)|all_epithelial(31;0.0729)		35			Helical; Name=1; (Potential).		D3DSC0|Q52LG8	Missense_Mutation	SNP	ENST00000245457.5	37	c.103G>A	CCDS9708.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.719075	0.89205	.	.	ENSG00000125384	ENST00000245457	T	0.53857	0.6	5.02	4.13	0.48395	.	0.000000	0.85682	D	0.000000	T	0.72471	0.3464	M	0.82823	2.61	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.76391	-0.2976	10	0.87932	D	0	-16.8091	11.5608	0.50776	0.089:0.0:0.911:0.0	.	35	P43116	PE2R2_HUMAN	R	35	ENSP00000245457:G35R	ENSP00000245457:G35R	G	+	1	0	PTGER2	51851119	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.780000	0.85658	1.254000	0.44035	0.467000	0.42956	GGG		0.682	PTGER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276890.1			25	8	0	0	0	0	25	8				
YLPM1	56252	broad.mit.edu	37	14	75230942	75230942	+	Silent	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr14:75230942G>T	ENST00000552421.1	+	1	874	c.750G>T	c.(748-750)ccG>ccT	p.P250P	YLPM1_ENST00000325680.7_Silent_p.P250P|YLPM1_ENST00000238571.3_Silent_p.P250P			P49750	YLPM1_HUMAN	YLP motif containing 1	250					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CACCACCACCGTCCGCCCCCC	0.567																																						uc001xqj.3		NA																	0				ovary(2)|pancreas(1)	3						c.(748-750)CCG>CCT		YLP motif containing 1							71.0	74.0	73.0					14																	75230942		1893	4118	6011	SO:0001819	synonymous_variant	56252				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck		g.chr14:75230942G>T	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.750G>T	14.37:g.75230942G>T			Somatic					p.P250P	NM_019589	NP_062535	WXS	Illumina HiSeq	Unspecified	P49750	YLPM1_HUMAN	KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)	1	874	+			90			Pro-rich.		P49752|Q96I64|Q9P1V7	Silent	SNP	ENST00000552421.1	37	c.750G>T																																																																																					0.567	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	NM_019589		101	54	1	0	8.65e-51	1.28e-50	101	54				
MLH3	27030	broad.mit.edu	37	14	75500173	75500173	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr14:75500173C>G	ENST00000556740.1	-	6	3699	c.3664G>C	c.(3664-3666)Gtg>Ctg	p.V1222L	MLH3_ENST00000544985.1_3'UTR|MLH3_ENST00000556257.1_Intron|MLH3_ENST00000380968.2_Missense_Mutation_p.V168L|MLH3_ENST00000355774.2_Missense_Mutation_p.V1222L|MLH3_ENST00000238662.7_Intron			Q9UHC1	MLH3_HUMAN	mutL homolog 3	1222					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		TGCTGATCCACCAGCACGAGC	0.478								Mismatch excision repair (MMR)																														uc001xrd.1		NA																	0				ovary(1)|skin(1)	2						c.(3664-3666)GTG>CTG	MMR	mutL homolog 3 isoform 1							72.0	59.0	63.0					14																	75500173		2203	4300	6503	SO:0001583	missense	27030				mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding	g.chr14:75500173C>G	AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.3664G>C	14.37:g.75500173C>G	ENSP00000452316:p.Val1222Leu		Somatic				MLH3_uc001xre.1_Intron|MLH3_uc010tuy.1_RNA	p.V1222L	NM_001040108	NP_001035197	WXS	Illumina HiSeq	Unspecified	Q9UHC1	MLH3_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00688)	7	3880	-			1222					P49751|Q56DK9|Q9P292|Q9UHC0	Missense_Mutation	SNP	ENST00000556740.1	37	c.3664G>C	CCDS32123.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.3|24.3	4.517763|4.517763	0.85495|0.85495	.|.	.|.	ENSG00000119684|ENSG00000119684	ENST00000355774;ENST00000380968;ENST00000556740|ENST00000553713	T;T;T|.	0.77750|.	-1.12;-1.12;-1.12|.	5.68|5.68	5.68|5.68	0.88126|0.88126	MutL, C-terminal, dimerisation (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77585|0.77585	0.4152|0.4152	M|M	0.74258|0.74258	2.255|2.255	0.80722|0.80722	D|D	1|1	D|.	0.54397|.	0.966|.	D|.	0.65443|.	0.935|.	T|T	0.75994|0.75994	-0.3121|-0.3121	10|5	0.56958|.	D|.	0.05|.	-11.4015|-11.4015	19.8028|19.8028	0.96515|0.96515	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1222|.	Q9UHC1|.	MLH3_HUMAN|.	L|C	1222;168;1222|245	ENSP00000348020:V1222L;ENSP00000370355:V168L;ENSP00000452316:V1222L|.	ENSP00000348020:V1222L|.	V|W	-|-	1|3	0|0	MLH3|MLH3	74569926|74569926	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.553000|0.553000	0.35397|0.35397	4.384000|4.384000	0.59607|0.59607	2.686000|2.686000	0.91538|0.91538	0.637000|0.637000	0.83480|0.83480	GTG|TGG		0.478	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415006.1	NM_014381		25	71	0	0	0	0	25	71				
GALC	2581	broad.mit.edu	37	14	88434807	88434807	+	Silent	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr14:88434807T>C	ENST00000261304.2	-	8	886	c.780A>G	c.(778-780)gcA>gcG	p.A260A	GALC_ENST00000393569.2_Silent_p.A234A|GALC_ENST00000544807.2_Silent_p.A204A|GALC_ENST00000393568.4_Silent_p.A237A	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase	260					carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)			endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TTGCATCTTTTGCTGAATGGG	0.413																																						uc001xvt.2		NA																	0					0						c.(778-780)GCA>GCG		galactosylceramidase isoform a precursor							72.0	68.0	69.0					14																	88434807		1832	4091	5923	SO:0001819	synonymous_variant	2581				carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity	g.chr14:88434807T>C	L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.780A>G	14.37:g.88434807T>C			Somatic				GALC_uc010tvw.1_RNA|GALC_uc010tvx.1_Silent_p.A234A|GALC_uc010tvy.1_Silent_p.A237A|GALC_uc010tvz.1_Silent_p.A204A|GALC_uc001xvu.1_Silent_p.A260A	p.A260A	NM_000153	NP_000144	WXS	Illumina HiSeq	Unspecified	P54803	GALC_HUMAN			8	1179	-			260					B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Silent	SNP	ENST00000261304.2	37	c.780A>G	CCDS9878.2																																																																																				0.413	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071559.2			73	94	0	0	0	0	73	94				
ZC3H14	79882	broad.mit.edu	37	14	89041117	89041117	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr14:89041117G>T	ENST00000251038.5	+	7	1167	c.942G>T	c.(940-942)gaG>gaT	p.E314D	ZC3H14_ENST00000557605.1_3'UTR|ZC3H14_ENST00000557607.1_Missense_Mutation_p.E159D|ZC3H14_ENST00000336693.4_Missense_Mutation_p.E280D|ZC3H14_ENST00000302216.8_Missense_Mutation_p.E314D|ZC3H14_ENST00000556945.1_Missense_Mutation_p.E314D|ZC3H14_ENST00000555755.1_Missense_Mutation_p.E314D|ZC3H14_ENST00000359301.3_Missense_Mutation_p.E280D|ZC3H14_ENST00000393514.5_Missense_Mutation_p.E314D	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14	314						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						ATGGAGAAGAGGAGGAAGAAG	0.413																																						uc001xww.2		NA																	0				ovary(2)|skin(1)	3						c.(940-942)GAG>GAT		zinc finger CCCH-type containing 14 isoform 1							76.0	71.0	73.0					14																	89041117		2203	4300	6503	SO:0001583	missense	79882					cytoplasm|cytoplasm|nuclear speck	protein binding|RNA binding|zinc ion binding	g.chr14:89041117G>T	AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	ENST00000251038.5:c.942G>T	14.37:g.89041117G>T	ENSP00000251038:p.Glu314Asp		Somatic				ZC3H14_uc010twd.1_Missense_Mutation_p.E314D|ZC3H14_uc010twe.1_Missense_Mutation_p.E314D|ZC3H14_uc001xwx.2_Missense_Mutation_p.E314D|ZC3H14_uc010twf.1_Missense_Mutation_p.E159D|ZC3H14_uc001xwy.2_Missense_Mutation_p.E280D|ZC3H14_uc010twg.1_Missense_Mutation_p.E159D|ZC3H14_uc001xxa.2_5'Flank	p.E314D	NM_024824	NP_079100	WXS	Illumina HiSeq	Unspecified	Q6PJT7	ZC3HE_HUMAN			7	1167	+			314					A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Missense_Mutation	SNP	ENST00000251038.5	37	c.942G>T	CCDS32133.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.67|17.67	3.447911|3.447911	0.63178|0.63178	.|.	.|.	ENSG00000100722|ENSG00000100722	ENST00000251038;ENST00000393530;ENST00000353091;ENST00000359301;ENST00000302216;ENST00000380684;ENST00000556945;ENST00000557607;ENST00000555755;ENST00000393514;ENST00000336693|ENST00000556000	.|.	.|.	.|.	5.8|5.8	4.91|4.91	0.64330|0.64330	.|.	0.049087|.	0.85682|.	D|.	0.000000|.	T|T	0.45135|0.45135	0.1327|0.1327	L|L	0.43152|0.43152	1.355|1.355	0.32211|0.32211	N|N	0.576468|0.576468	P;B;P;B;B;B|.	0.47106|.	0.628;0.009;0.89;0.022;0.009;0.022|.	B;B;P;B;B;B|.	0.45881|.	0.318;0.016;0.496;0.012;0.016;0.012|.	T|T	0.54390|0.54390	-0.8301|-0.8301	9|5	0.17832|.	T|.	0.49|.	-18.0374|-18.0374	8.5334|8.5334	0.33349|0.33349	0.1349:0.0:0.7384:0.1267|0.1349:0.0:0.7384:0.1267	.|.	314;295;314;314;314;314|.	G3V256;F8W848;G3V5R4;Q6PJT7-2;Q6PJT7-3;Q6PJT7|.	.;.;.;.;.;ZC3HE_HUMAN|.	D|M	314;314;314;280;314;295;314;159;314;314;280|230	.|.	ENSP00000251038:E314D|.	E|R	+|+	3|2	2|0	ZC3H14|ZC3H14	88110870|88110870	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	0.668000|0.668000	0.25127|0.25127	1.461000|1.461000	0.47929|0.47929	0.655000|0.655000	0.94253|0.94253	GAG|AGG		0.413	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410387.1	NM_024824		27	55	1	0	2.45e-14	3.07e-14	27	55				
FAM181A	90050	broad.mit.edu	37	14	94394802	94394802	+	Silent	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr14:94394802G>T	ENST00000267594.5	+	3	664	c.357G>T	c.(355-357)cgG>cgT	p.R119R	FAM181A_ENST00000557719.1_Silent_p.R57R|FAM181A_ENST00000556222.1_Silent_p.R57R|FAM181A-AS1_ENST00000554742.1_RNA|FAM181A_ENST00000557000.2_Silent_p.R57R	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	Q8N9Y4	F181A_HUMAN	family with sequence similarity 181, member A	119								p.R119L(1)		cervix(1)|endometrium(2)|large_intestine(8)|lung(4)|prostate(1)|skin(2)	18						GGCTCCCGCGGGGCCTTCCTG	0.657																																						uc001ybz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(355-357)CGG>CGT		hypothetical protein LOC90050							25.0	27.0	26.0					14																	94394802		2203	4299	6502	SO:0001819	synonymous_variant	90050							g.chr14:94394802G>T	BC009073	CCDS9914.1, CCDS55939.1	14q32.12	2011-11-30	2008-07-22	2008-07-22	ENSG00000140067	ENSG00000140067			20491	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 152"""	C14orf152			Standard	NM_138344		Approved		uc021saz.1	Q8N9Y4	OTTHUMG00000171297	ENST00000267594.5:c.357G>T	14.37:g.94394802G>T			Somatic				C14orf86_uc001yby.2_5'Flank|FAM181A_uc010aus.1_Silent_p.R57R|FAM181A_uc001yca.1_Silent_p.R57R	p.R119R	NM_138344	NP_612353	WXS	Illumina HiSeq	Unspecified	Q8N9Y4	F181A_HUMAN			3	664	+			119					B2RD39|Q96GY1	Silent	SNP	ENST00000267594.5	37	c.357G>T	CCDS9914.1																																																																																				0.657	FAM181A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412840.1	NM_138344		21	33	1	0	7.42e-09	8.61e-09	21	33				
OR4M2	390538	broad.mit.edu	37	15	22368976	22368976	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr15:22368976C>T	ENST00000332663.2	+	1	499	c.401C>T	c.(400-402)aCc>aTc	p.T134I	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CACTATGCTACCATCATGAAT	0.507																																						uc010tzu.1		NA																	0				ovary(1)	1						c.(400-402)ACC>ATC		olfactory receptor, family 4, subfamily M,							312.0	263.0	280.0					15																	22368976		2203	4300	6503	SO:0001583	missense	390538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22368976C>T	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.401C>T	15.37:g.22368976C>T	ENSP00000329467:p.Thr134Ile		Somatic				LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	p.T134I	NM_001004719	NP_001004719	WXS	Illumina HiSeq	Unspecified	Q8NGB6	OR4M2_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	1	401	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	134			Cytoplasmic (Potential).		B9EH16|Q6IEY2	Missense_Mutation	SNP	ENST00000332663.2	37	c.401C>T	CCDS32172.1	.	.	.	.	.	.	.	.	.	.	.	10.53	1.375029	0.24857	.	.	ENSG00000182974	ENST00000332663	T	0.00902	5.56	2.5	1.5	0.22942	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000124	T	0.00875	0.0029	L	0.31120	0.905	0.26366	N	0.976971	B	0.26512	0.151	B	0.30646	0.118	T	0.46938	-0.9155	10	0.59425	D	0.04	-9.4202	3.7195	0.08450	0.0:0.5813:0.2638:0.1549	.	134	Q8NGB6	OR4M2_HUMAN	I	134	ENSP00000329467:T134I	ENSP00000329467:T134I	T	+	2	0	OR4M2	19870340	0.000000	0.05858	0.998000	0.56505	0.878000	0.50629	0.082000	0.14847	0.352000	0.24053	0.448000	0.29417	ACC		0.507	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1			91	801	0	0	0	0	91	801				
OR4N4	283694	broad.mit.edu	37	15	22382664	22382664	+	Silent	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr15:22382664C>A	ENST00000328795.4	+	1	283	c.192C>A	c.(190-192)ggC>ggA	p.G64G	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TATTTCTGGGCAACTTGGCCT	0.463																																						uc001yuc.1		NA																	0				ovary(4)|skin(1)	5						c.(190-192)GGC>GGA		olfactory receptor, family 4, subfamily N,							145.0	147.0	146.0					15																	22382664		2201	4296	6497	SO:0001819	synonymous_variant	283694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22382664C>A	AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.192C>A	15.37:g.22382664C>A			Somatic				LOC727924_uc001yub.1_RNA|OR4N4_uc010tzv.1_Silent_p.G64G	p.G64G	NM_001005241	NP_001005241	WXS	Illumina HiSeq	Unspecified	Q8N0Y3	OR4N4_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	7	1173	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	64			Helical; Name=2; (Potential).		Q6IEY3|Q6IF56	Silent	SNP	ENST00000328795.4	37	c.192C>A	CCDS32173.1																																																																																				0.463	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1			67	578	1	0	1.77e-45	2.6e-45	67	578				
OR4N4	283694	broad.mit.edu	37	15	22382712	22382712	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr15:22382712G>A	ENST00000328795.4	+	1	331	c.240G>A	c.(238-240)agG>agA	p.R80R	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TGGCTCCCAGGATGTTGGTGG	0.512																																						uc001yuc.1		NA																	0				ovary(4)|skin(1)	5						c.(238-240)AGG>AGA		olfactory receptor, family 4, subfamily N,							146.0	137.0	140.0					15																	22382712		2203	4300	6503	SO:0001819	synonymous_variant	283694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22382712G>A	AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.240G>A	15.37:g.22382712G>A			Somatic				LOC727924_uc001yub.1_RNA|OR4N4_uc010tzv.1_Silent_p.R80R	p.R80R	NM_001005241	NP_001005241	WXS	Illumina HiSeq	Unspecified	Q8N0Y3	OR4N4_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	7	1221	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	80			Extracellular (Potential).		Q6IEY3|Q6IF56	Silent	SNP	ENST00000328795.4	37	c.240G>A	CCDS32173.1																																																																																				0.512	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1			22	606	0	0	0	0	22	606				
NPAP1	23742	broad.mit.edu	37	15	24921415	24921415	+	Missense_Mutation	SNP	C	C	T	rs139493881		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr15:24921415C>T	ENST00000329468.2	+	1	875	c.401C>T	c.(400-402)gCg>gTg	p.A134V		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	134					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											CGTGAGCCGGCGGTCAAGGCC	0.632																																						uc001ywo.2		NA																	0				ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(400-402)GCG>GTG		hypothetical protein LOC23742							45.0	39.0	41.0					15																	24921415		2203	4299	6502	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24921415C>T	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.401C>T	15.37:g.24921415C>T	ENSP00000333735:p.Ala134Val		Somatic					p.A134V	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	875	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	134						Missense_Mutation	SNP	ENST00000329468.2	37	c.401C>T	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	7.096	0.573212	0.13623	.	.	ENSG00000185823	ENST00000329468	T	0.04809	3.55	2.1	-4.21	0.03812	.	2.648510	0.02197	N	0.061887	T	0.02848	0.0085	N	0.17474	0.49	0.09310	N	1	P	0.41159	0.74	B	0.39379	0.298	T	0.24012	-1.0172	10	0.25106	T	0.35	.	0.8223	0.01113	0.1926:0.3894:0.1927:0.2253	.	134	Q9NZP6	CO002_HUMAN	V	134	ENSP00000333735:A134V	ENSP00000333735:A134V	A	+	2	0	C15orf2	22472508	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.111000	0.03303	-1.182000	0.02727	-0.516000	0.04426	GCG		0.632	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		71	16	0	0	0	0	71	16				
NPAP1	23742	broad.mit.edu	37	15	24922323	24922323	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr15:24922323C>A	ENST00000329468.2	+	1	1783	c.1309C>A	c.(1309-1311)Ctc>Atc	p.L437I		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	437	Pro-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											TACTGGACCCCTCATCCTGCC	0.537																																						uc001ywo.2		NA																	0				ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(1309-1311)CTC>ATC		hypothetical protein LOC23742							134.0	122.0	126.0					15																	24922323		2203	4300	6503	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24922323C>A	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1309C>A	15.37:g.24922323C>A	ENSP00000333735:p.Leu437Ile		Somatic					p.L437I	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	1783	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	437			Pro-rich.			Missense_Mutation	SNP	ENST00000329468.2	37	c.1309C>A	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	8.372	0.835546	0.16820	.	.	ENSG00000185823	ENST00000329468	T	0.06294	3.32	2.36	1.39	0.22231	.	1.388340	0.04994	N	0.467876	T	0.05181	0.0138	L	0.29908	0.895	0.09310	N	1	B	0.31968	0.349	B	0.22753	0.041	T	0.39981	-0.9587	10	0.38643	T	0.18	.	6.1556	0.20335	0.3013:0.6987:0.0:0.0	.	437	Q9NZP6	CO002_HUMAN	I	437	ENSP00000333735:L437I	ENSP00000333735:L437I	L	+	1	0	C15orf2	22473416	0.000000	0.05858	0.000000	0.03702	0.093000	0.18481	-0.767000	0.04720	0.520000	0.28426	0.313000	0.20887	CTC		0.537	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		114	21	1	0	2.13e-42	3.11e-42	114	21				
OCA2	4948	broad.mit.edu	37	15	28230301	28230301	+	Missense_Mutation	SNP	T	T	A	rs201484597		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr15:28230301T>A	ENST00000354638.3	-	13	1428	c.1273A>T	c.(1273-1275)Atg>Ttg	p.M425L	OCA2_ENST00000382996.2_Missense_Mutation_p.M425L|OCA2_ENST00000353809.5_Missense_Mutation_p.M401L	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	425			Missing (in OCA2; mild).		cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		ATGATGATCATGGCCCACACC	0.577									Oculocutaneous Albinism																													uc001zbh.3		NA																	0				ovary(3)|breast(1)|pancreas(1)	5						c.(1273-1275)ATG>TTG		oculocutaneous albinism II							136.0	97.0	110.0					15																	28230301		2203	4300	6503	SO:0001583	missense	4948	Oculocutaneous_Albinism	Familial Cancer Database		eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding	g.chr15:28230301T>A		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1273A>T	15.37:g.28230301T>A	ENSP00000346659:p.Met425Leu		Somatic				OCA2_uc010ayv.2_Missense_Mutation_p.M401L	p.M425L	NM_000275	NP_000266	WXS	Illumina HiSeq	Unspecified	Q04671	P_HUMAN		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)	13	1383	-		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)	425		Missing (in OCA2; mild).	Helical; (Potential).		Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	37	c.1273A>T	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	T	16.67	3.186444	0.57909	.	.	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996	D;D;D	0.89343	-2.5;-2.5;-2.5	5.35	5.35	0.76521	Divalent ion symporter (1);	0.000000	0.85682	D	0.000000	T	0.68265	0.2982	N	0.00473	-1.45	0.49483	D	0.999795	B;B	0.22146	0.063;0.065	B;B	0.31101	0.026;0.124	T	0.70619	-0.4822	10	0.02654	T	1	-42.4502	14.8134	0.70013	0.0:0.0:0.0:1.0	.	401;425	Q04671-2;Q04671	.;P_HUMAN	L	425;401;425	ENSP00000346659:M425L;ENSP00000261276:M401L;ENSP00000372457:M425L	ENSP00000261276:M401L	M	-	1	0	OCA2	25903896	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.529000	0.67135	2.139000	0.66308	0.533000	0.62120	ATG		0.577	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275		37	2	0	0	0	0	37	2				
FBN1	2200	broad.mit.edu	37	15	48752447	48752447	+	Silent	SNP	G	G	A	rs111756438		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr15:48752447G>A	ENST00000316623.5	-	43	5747	c.5292C>T	c.(5290-5292)ccC>ccT	p.P1764P		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1764					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ACTCACCAACGGGTAAACCGG	0.393																																						uc001zwx.1		NA																	0				ovary(2)|large_intestine(1)	3						c.(5290-5292)CCC>CCT		fibrillin 1 precursor							90.0	78.0	82.0					15																	48752447		2198	4296	6494	SO:0001819	synonymous_variant	2200				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding	g.chr15:48752447G>A	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.5292C>T	15.37:g.48752447G>A			Somatic				FBN1_uc010beo.1_RNA	p.P1764P	NM_000138	NP_000129	WXS	Illumina HiSeq	Unspecified	P35555	FBN1_HUMAN		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)	43	5620	-		all_lung(180;0.00279)	1764					B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	ENST00000316623.5	37	c.5292C>T	CCDS32232.1																																																																																				0.393	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1			58	13	0	0	0	0	58	13				
FAM227B	196951	broad.mit.edu	37	15	49663561	49663561	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr15:49663561G>T	ENST00000299338.6	-	12	1351	c.1048C>A	c.(1048-1050)Cca>Aca	p.P350T		NM_152647.2	NP_689860.2	Q96M60	F227B_HUMAN	family with sequence similarity 227, member B	350																	TATGCTCTTGGGTTGTTCAGA	0.289																																						uc001zxl.2		NA																	0				ovary(1)	1						c.(1048-1050)CCA>ACA		hypothetical protein LOC196951							113.0	120.0	118.0					15																	49663561		2196	4292	6488	SO:0001583	missense	196951							g.chr15:49663561G>T		CCDS32237.1	15q21.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000166262	ENSG00000166262			26543	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 33"""	C15orf33			Standard	NM_152647		Approved	FLJ32800	uc001zxl.2	Q96M60	OTTHUMG00000172328	ENST00000299338.6:c.1048C>A	15.37:g.49663561G>T	ENSP00000299338:p.Pro350Thr		Somatic					p.P350T	NM_152647	NP_689860	WXS	Illumina HiSeq	Unspecified	Q96M60	CO033_HUMAN		all cancers(107;3.45e-08)|GBM - Glioblastoma multiforme(94;0.000124)	12	1342	-		all_lung(180;0.00187)	350					Q86WS2	Missense_Mutation	SNP	ENST00000299338.6	37	c.1048C>A	CCDS32237.1	.	.	.	.	.	.	.	.	.	.	G	5.102	0.204416	0.09704	.	.	ENSG00000166262	ENST00000299338	.	.	.	4.19	2.23	0.28157	.	0.137352	0.34156	N	0.004205	T	0.39989	0.1099	L	0.52364	1.645	0.09310	N	1	P	0.51351	0.944	P	0.50617	0.646	T	0.29488	-1.0010	9	0.07990	T	0.79	-10.1506	10.5462	0.45062	0.0:0.3818:0.6182:0.0	.	350	Q96M60	CO033_HUMAN	T	350	.	ENSP00000299338:P350T	P	-	1	0	C15orf33	47450853	0.013000	0.17824	0.008000	0.14137	0.015000	0.08874	1.026000	0.30103	0.677000	0.31305	0.650000	0.86243	CCA		0.289	FAM227B-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417872.1	NM_152647		188	49	1	0	3.3e-99	4.99e-99	188	49				
SLC27A2	11001	broad.mit.edu	37	15	50515307	50515307	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr15:50515307A>G	ENST00000267842.5	+	5	1350	c.1118A>G	c.(1117-1119)aAt>aGt	p.N373S	SLC27A2_ENST00000544960.1_Missense_Mutation_p.N138S|SLC27A2_ENST00000380902.4_Missense_Mutation_p.N320S|Y_RNA_ENST00000363735.1_RNA	NM_003645.3	NP_003636.2	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid transporter), member 2	373					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)|very long-chain fatty acid catabolic process (GO:0042760)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of peroxisomal membrane (GO:0005779)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|phytanate-CoA ligase activity (GO:0050197)|pristanate-CoA ligase activity (GO:0070251)|receptor binding (GO:0005102)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		GGATTTATGAATTATGCGAGA	0.393																																						uc001zxw.2		NA																	0				ovary(1)|skin(1)	2						c.(1117-1119)AAT>AGT		solute carrier family 27 (fatty acid							141.0	129.0	133.0					15																	50515307		2196	4295	6491	SO:0001583	missense	11001				bile acid biosynthetic process|fatty acid alpha-oxidation	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity|phytanate-CoA ligase activity|pristanate-CoA ligase activity	g.chr15:50515307A>G	D88308	CCDS10133.1, CCDS53943.1	15q21.2	2013-05-22			ENSG00000140284	ENSG00000140284		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10996	protein-coding gene	gene with protein product		603247		FACVL1		9730624	Standard	NM_003645		Approved	FATP2, hFACVL1, VLACS, VLCS, HsT17226, ACSVL1	uc001zxw.3	O14975	OTTHUMG00000131643	ENST00000267842.5:c.1118A>G	15.37:g.50515307A>G	ENSP00000267842:p.Asn373Ser		Somatic				SLC27A2_uc010bes.2_Missense_Mutation_p.N320S|SLC27A2_uc001zxx.2_Missense_Mutation_p.N138S	p.N373S	NM_003645	NP_003636	WXS	Illumina HiSeq	Unspecified	O14975	S27A2_HUMAN		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)	5	1350	+		all_lung(180;0.00177)	373			Cytoplasmic (Potential).		A8K2J7|Q53FY6|Q6PF09	Missense_Mutation	SNP	ENST00000267842.5	37	c.1118A>G	CCDS10133.1	.	.	.	.	.	.	.	.	.	.	A	16.27	3.076345	0.55753	.	.	ENSG00000140284	ENST00000380902;ENST00000267842;ENST00000544960	T;T;T	0.47869	0.83;0.83;0.83	5.93	5.93	0.95920	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.76407	0.3983	M	0.93854	3.465	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.951	T	0.82857	-0.0250	10	0.87932	D	0	.	14.3464	0.66668	1.0:0.0:0.0:0.0	.	320;373	Q6PF09;O14975	.;S27A2_HUMAN	S	320;373;138	ENSP00000370289:N320S;ENSP00000267842:N373S;ENSP00000444549:N138S	ENSP00000267842:N373S	N	+	2	0	SLC27A2	48302599	1.000000	0.71417	0.966000	0.40874	0.060000	0.15804	8.728000	0.91484	2.281000	0.76405	0.533000	0.62120	AAT		0.393	SLC27A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254539.2	NM_003645		52	75	0	0	0	0	52	75				
UNC13C	440279	broad.mit.edu	37	15	54557618	54557618	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr15:54557618C>A	ENST00000260323.11	+	9	3742	c.3742C>A	c.(3742-3744)Caa>Aaa	p.Q1248K	UNC13C_ENST00000545554.1_Missense_Mutation_p.Q1248K|UNC13C_ENST00000537900.1_Missense_Mutation_p.Q1246K	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1248	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TGTTACAGTTCAAGTTGGAAA	0.323																																						uc002ack.2		NA																	0				ovary(5)|pancreas(2)	7						c.(3742-3744)CAA>AAA		unc-13 homolog C							53.0	50.0	51.0					15																	54557618		1802	4064	5866	SO:0001583	missense	440279				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr15:54557618C>A	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3742C>A	15.37:g.54557618C>A	ENSP00000260323:p.Gln1248Lys		Somatic				UNC13C_uc002acl.2_Missense_Mutation_p.Q78K	p.Q1248K	NM_001080534	NP_001074003	WXS	Illumina HiSeq	Unspecified	Q8NB66	UN13C_HUMAN		GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)	8	3742	+			1248			C2 1.		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	c.3742C>A	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.368024	0.82463	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.68479	-0.33;-0.33;-0.33	4.88	4.88	0.63580	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.71247	0.3317	N	0.21282	0.65	0.58432	D	0.999997	P;D	0.69078	0.843;0.997	P;D	0.67725	0.54;0.953	T	0.75442	-0.3316	10	0.62326	D	0.03	.	17.3549	0.87333	0.0:1.0:0.0:0.0	.	1248;1248	F5H090;Q8NB66	.;UN13C_HUMAN	K	1248;1248;1246	ENSP00000260323:Q1248K;ENSP00000438156:Q1248K;ENSP00000442569:Q1246K	ENSP00000260323:Q1248K	Q	+	1	0	UNC13C	52344910	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.762000	0.85270	2.404000	0.81709	0.591000	0.81541	CAA		0.323	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		10	11	1	0	0.000442599	0.000473429	10	11				
NOX5	79400	broad.mit.edu	37	15	69335139	69335139	+	Silent	SNP	G	G	T	rs367755214		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr15:69335139G>T	ENST00000388866.3	+	10	1682	c.1641G>T	c.(1639-1641)tcG>tcT	p.S547S	NOX5_ENST00000448182.3_Silent_p.S501S|RP11-809H16.4_ENST00000559495.1_RNA|NOX5_ENST00000530406.2_Silent_p.S519S|NOX5_ENST00000455873.3_Silent_p.S512S|NOX5_ENST00000260364.5_Silent_p.S529S	NM_001184779.1|NM_024505.3	NP_001171708.1|NP_078781.3	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	547	C-terminal catalytic region.|FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cytokine secretion (GO:0050663)|cytokinesis (GO:0000910)|endothelial cell proliferation (GO:0001935)|oxidation-reduction process (GO:0055114)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|proton transport (GO:0015992)|regulation of fusion of sperm to egg plasma membrane (GO:0043012)|regulation of proton transport (GO:0010155)|superoxide anion generation (GO:0042554)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|hydrogen ion channel activity (GO:0015252)|NADP binding (GO:0050661)|superoxide-generating NADPH oxidase activity (GO:0016175)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35						GTCAAAGGTCGTCCAAGGTAG	0.527																																						uc002ars.1		NA																	0				breast(1)|pancreas(1)	2						c.(1639-1641)TCG>TCT		NADPH oxidase, EF-hand calcium binding domain 5							134.0	117.0	123.0					15																	69335139		2200	4298	6498	SO:0001819	synonymous_variant	79400				angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity	g.chr15:69335139G>T	AF317889	CCDS32276.1, CCDS32276.2, CCDS53953.1, CCDS53954.1	15q22.31	2013-01-10			ENSG00000255346	ENSG00000255346		"""EF-hand domain containing"""	14874	protein-coding gene	gene with protein product		606572				11483596	Standard	NM_001184779		Approved	NOX5A, NOX5B	uc002ars.2	Q96PH1	OTTHUMG00000133320	ENST00000388866.3:c.1641G>T	15.37:g.69335139G>T			Somatic				NOX5_uc002arp.1_Silent_p.S529S|NOX5_uc002arq.1_Silent_p.S501S|NOX5_uc010bid.1_Silent_p.S512S|NOX5_uc002arr.1_Silent_p.S519S|NOX5_uc010bie.1_Silent_p.S347S|NOX5_uc010bif.1_RNA	p.S547S	NM_024505	NP_078781	WXS	Illumina HiSeq	Unspecified	Q96PH1	NOX5_HUMAN			10	1661	+			547			FAD-binding FR-type.|Cytoplasmic (Potential).|C-terminal catalytic region.		B2RBJ4|Q08AN2|Q08AN3|Q8TEQ1|Q8TER4|Q96PH2|Q96PJ8|Q96PJ9|Q9H6E0|Q9HAM8	Silent	SNP	ENST00000388866.3	37	c.1641G>T	CCDS32276.2																																																																																				0.527	NOX5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257124.2	NM_024505		40	7	1	0	3.62e-18	4.69e-18	40	7				
KIAA1024	23251	broad.mit.edu	37	15	79749833	79749833	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr15:79749833G>C	ENST00000305428.3	+	2	1419	c.1344G>C	c.(1342-1344)aaG>aaC	p.K448N		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	448						integral component of membrane (GO:0016021)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						ACCTGGAGAAGCATGAACCAG	0.488																																						uc002bew.1		NA																	0				pancreas(2)|ovary(1)|central_nervous_system(1)	4						c.(1342-1344)AAG>AAC		hypothetical protein LOC23251							61.0	60.0	61.0					15																	79749833		2196	4293	6489	SO:0001583	missense	23251					integral to membrane		g.chr15:79749833G>C	AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.1344G>C	15.37:g.79749833G>C	ENSP00000307461:p.Lys448Asn		Somatic				KIAA1024_uc010unk.1_Missense_Mutation_p.K448N	p.K448N	NM_015206	NP_056021	WXS	Illumina HiSeq	Unspecified	Q9UPX6	K1024_HUMAN			2	1419	+			448					A7MD43	Missense_Mutation	SNP	ENST00000305428.3	37	c.1344G>C	CCDS32306.1	.	.	.	.	.	.	.	.	.	.	G	7.969	0.748728	0.15710	.	.	ENSG00000169330	ENST00000305428	T	0.35605	1.3	5.14	1.3	0.21679	.	0.327612	0.31784	N	0.007079	T	0.28995	0.0720	M	0.62723	1.935	0.42114	D	0.991393	B	0.17038	0.02	B	0.14578	0.011	T	0.06643	-1.0815	9	.	.	.	.	5.6471	0.17596	0.3777:0.1466:0.4757:0.0	.	448	Q9UPX6	K1024_HUMAN	N	448	ENSP00000307461:K448N	.	K	+	3	2	KIAA1024	77536888	0.988000	0.35896	0.915000	0.36163	0.509000	0.34042	0.533000	0.23082	0.350000	0.24002	0.491000	0.48974	AAG		0.488	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206		64	19	0	0	0	0	64	19				
C15orf32	145858	broad.mit.edu	37	15	93015432	93015432	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr15:93015432C>A	ENST00000333334.2	+	1	549	c.54C>A	c.(52-54)gaC>gaA	p.D18E	C15orf32_ENST00000556865.1_Missense_Mutation_p.D18E|RP11-763K15.1_ENST00000554440.1_lincRNA	NM_153040.2	NP_694585.1	Q32M92	CO032_HUMAN	chromosome 15 open reading frame 32	18										endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	12	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0493)|OV - Ovarian serous cystadenocarcinoma(32;0.125)			ACCCGGCTGACCCCCAGAGTG	0.527																																						uc002brc.1		NA																	0				ovary(1)	1						c.(52-54)GAC>GAA		hypothetical protein LOC145858							54.0	57.0	56.0					15																	93015432		2198	4298	6496	SO:0001583	missense	145858							g.chr15:93015432C>A		CCDS10373.1, CCDS73784.1	15q26.1	2014-09-10			ENSG00000183643	ENSG00000183643			26549	protein-coding gene	gene with protein product							Standard	NM_153040		Approved	FLJ32831	uc002brc.1	Q32M92	OTTHUMG00000149844	ENST00000333334.2:c.54C>A	15.37:g.93015432C>A	ENSP00000330267:p.Asp18Glu		Somatic				C15orf32_uc010bod.1_RNA	p.D18E	NM_153040	NP_694585	WXS	Illumina HiSeq	Unspecified	Q32M92	CO032_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0493)|OV - Ovarian serous cystadenocarcinoma(32;0.125)		1	526	+	Lung NSC(78;0.0893)|all_lung(78;0.125)		18					C5HTZ8|Q96M45	Missense_Mutation	SNP	ENST00000333334.2	37	c.54C>A	CCDS10373.1	.	.	.	.	.	.	.	.	.	.	C	8.831	0.939929	0.18281	.	.	ENSG00000183643	ENST00000333334	T	0.54866	0.55	2.29	-0.766	0.11020	.	.	.	.	.	T	0.32224	0.0822	N	0.14661	0.345	0.09310	N	1	P	0.44344	0.833	B	0.42030	0.373	T	0.19484	-1.0304	9	0.87932	D	0	.	4.9454	0.13987	0.0:0.4583:0.0:0.5417	.	18	Q32M92	CO032_HUMAN	E	18	ENSP00000330267:D18E	ENSP00000330267:D18E	D	+	3	2	C15orf32	90816436	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.269000	0.08596	-0.197000	0.10350	-0.253000	0.11424	GAC		0.527	C15orf32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313527.2	NM_153040		74	16	1	0	9.21e-24	1.25e-23	74	16				
JMJD8	339123	broad.mit.edu	37	16	732421	732421	+	3'UTR	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr16:732421C>T	ENST00000293882.4	-	0	1377				JMJD8_ENST00000412368.2_3'UTR|JMJD8_ENST00000454700.1_3'UTR|JMJD8_ENST00000609261.1_3'UTR|LA16c-313D11.9_ENST00000567091.1_RNA|STUB1_ENST00000219548.4_Missense_Mutation_p.P282S|STUB1_ENST00000565677.1_Missense_Mutation_p.P210S|STUB1_ENST00000564370.1_Missense_Mutation_p.P210S|LA16c-313D11.9_ENST00000571933.1_RNA			Q96S16	JMJD8_HUMAN	jumonji domain containing 8							extracellular vesicular exosome (GO:0070062)				breast(1)	1						ACAGCTCATCCCCAACTTGGC	0.592																																						uc002cit.2		NA																	0					0						c.(844-846)CCC>TCC		STIP1 homology and U-box containing protein 1							91.0	83.0	86.0					16																	732421		2201	4300	6501	SO:0001624	3_prime_UTR_variant	10273				cellular response to misfolded protein|DNA repair|misfolded or incompletely synthesized protein catabolic process|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein K63-linked ubiquitination|protein maturation|regulation of glucocorticoid metabolic process|ubiquitin-dependent SMAD protein catabolic process	cytoplasm|nuclear inclusion body|ubiquitin conjugating enzyme complex|ubiquitin ligase complex	Hsp70 protein binding|Hsp90 protein binding|kinase binding|misfolded protein binding|protein binding, bridging|protein homodimerization activity|SMAD binding|TPR domain binding|ubiquitin-ubiquitin ligase activity	g.chr16:732421C>T		CCDS45369.1	16p13.3	2008-07-28	2008-07-28	2008-07-28		ENSG00000161999			14148	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 20"""	C16orf20			Standard	NM_001005920		Approved		uc002ciw.1	Q96S16		ENST00000293882.4:c.*373G>A	16.37:g.732421C>T			Somatic				STUB1_uc002ciu.2_Missense_Mutation_p.P210S|STUB1_uc010bqz.2_RNA|STUB1_uc002civ.2_RNA|JMJD8_uc002ciw.1_3'UTR|JMJD8_uc002cix.1_3'UTR|JMJD8_uc002ciy.1_3'UTR	p.P282S	NM_005861	NP_005852	WXS	Illumina HiSeq	Unspecified	Q9UNE7	CHIP_HUMAN			7	1255	+		Hepatocellular(780;0.00335)	282			U-box.		B2RNS7|D3DU58|Q4PKE3|Q4VBY1|Q6GMW5|Q71RB8	Missense_Mutation	SNP	ENST00000293882.4	37	c.844C>T		.	.	.	.	.	.	.	.	.	.	C	22.4	4.284600	0.80803	.	.	ENSG00000103266	ENST00000219548	T	0.34667	1.35	4.94	4.94	0.65067	Zinc finger, RING/FYVE/PHD-type (1);U box domain (2);	0.063890	0.64402	D	0.000004	T	0.55577	0.1929	M	0.80422	2.495	0.80722	D	1	D	0.56287	0.975	P	0.53760	0.734	T	0.62426	-0.6857	10	0.54805	T	0.06	-20.8639	17.1542	0.86785	0.0:1.0:0.0:0.0	.	282	Q9UNE7	CHIP_HUMAN	S	282	ENSP00000219548:P282S	ENSP00000219548:P282S	P	+	1	0	STUB1	672422	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	7.751000	0.85126	2.296000	0.77279	0.561000	0.74099	CCC		0.592	JMJD8-201	KNOWN	basic	protein_coding	protein_coding		NM_001005920		47	64	0	0	0	0	47	64				
PTX4	390667	broad.mit.edu	37	16	1536306	1536306	+	Missense_Mutation	SNP	G	G	T	rs375359582		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr16:1536306G>T	ENST00000447419.2	-	3	1096	c.1071C>A	c.(1069-1071)gaC>gaA	p.D357E	PTX4_ENST00000440447.2_3'UTR|PTX4_ENST00000293922.1_Missense_Mutation_p.D352E			Q96A99	PTX4_HUMAN	pentraxin 4, long	357	Pentaxin.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						GCCACTGGCCGTCCAGCAGCA	0.672																																						uc010uvf.1		NA																	0					0						c.(1054-1056)GAC>GAA		neuronal pentraxin II-like							30.0	34.0	32.0					16																	1536306		2199	4298	6497	SO:0001583	missense	390667					extracellular region	metal ion binding	g.chr16:1536306G>T		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.1071C>A	16.37:g.1536306G>T	ENSP00000445277:p.Asp357Glu		Somatic					p.D352E	NM_001013658	NP_001013680	WXS	Illumina HiSeq	Unspecified	Q96A99	PTX4_HUMAN			3	1056	-			357			Pentaxin.			Missense_Mutation	SNP	ENST00000447419.2	37	c.1056C>A		.	.	.	.	.	.	.	.	.	.	G	12.94	2.087356	0.36855	.	.	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.68479	-0.33;-0.33	5.58	-6.71	0.01760	.	0.000000	0.85682	D	0.000000	T	0.78886	0.4354	M	0.84326	2.69	0.31541	N	0.659906	D	0.76494	0.999	D	0.79108	0.992	T	0.80982	-0.1139	10	0.72032	D	0.01	.	16.7801	0.85561	0.8089:0.0:0.1911:0.0	.	352	Q96A99-2	.	E	357;352	ENSP00000445277:D357E;ENSP00000293922:D352E	ENSP00000293922:D352E	D	-	3	2	PTX4	1476307	0.000000	0.05858	0.028000	0.17463	0.391000	0.30476	-0.729000	0.04920	-1.521000	0.01771	-0.123000	0.14984	GAC		0.672	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432526.1	NM_001013658		28	31	1	0	2.13e-12	2.62e-12	28	31				
CREBBP	1387	broad.mit.edu	37	16	3778856	3778856	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr16:3778856G>A	ENST00000262367.5	-	31	7001	c.6192C>T	c.(6190-6192)ccC>ccT	p.P2064P	CREBBP_ENST00000382070.3_Silent_p.P2026P	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	2064					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GCAGAGCGCTGGGTGAGATGC	0.642			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																															uc002cvv.2		NA		Dom/Rec	yes		16	16p13.3	1387	T|N|F|Mis|O	CREB binding protein (CBP)	yes	Rubinstein-Taybi syndrome	L	MLL|MORF|RUNXBP2		ALL|AML|DLBCL|B-NHL 		0				haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127						c.(6190-6192)CCC>CCT		CREB binding protein isoform a							27.0	32.0	30.0					16																	3778856		2196	4298	6494	SO:0001819	synonymous_variant	1387	Rubinstein-Taybi_syndrome			cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding	g.chr16:3778856G>A	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.6192C>T	16.37:g.3778856G>A			Somatic				CREBBP_uc002cvw.2_Silent_p.P2026P	p.P2064P	NM_004380	NP_004371	WXS	Illumina HiSeq	Unspecified	Q92793	CBP_HUMAN		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)	31	6396	-		Ovarian(90;0.0266)	2064					D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	ENST00000262367.5	37	c.6192C>T	CCDS10509.1																																																																																				0.642	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380		23	41	0	0	0	0	23	41				
GLYR1	84656	broad.mit.edu	37	16	4855258	4855258	+	Silent	SNP	C	C	A	rs138196315		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr16:4855258C>A	ENST00000321919.9	-	16	1717	c.1641G>T	c.(1639-1641)gtG>gtT	p.V547V	GLYR1_ENST00000436648.5_Silent_p.V466V|GLYR1_ENST00000381983.3_Silent_p.V530V|ROGDI_ENST00000322048.7_5'Flank|GLYR1_ENST00000591451.1_Silent_p.V541V	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	547					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						AGGCTCGGTACACGGCGGACA	0.592																																						uc002cxx.3		NA																	0					0						c.(1639-1641)GTG>GTT		cytokine-like nuclear factor n-pac							126.0	106.0	113.0					16																	4855258		2197	4300	6497	SO:0001819	synonymous_variant	84656				pentose-phosphate shunt	nucleus	coenzyme binding|DNA binding|methylated histone residue binding|phosphogluconate dehydrogenase (decarboxylating) activity	g.chr16:4855258C>A	AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.1641G>T	16.37:g.4855258C>A			Somatic				ROGDI_uc002cxv.2_5'Flank|ROGDI_uc010bua.2_5'Flank|ROGDI_uc002cxw.2_5'Flank|ROGDI_uc010bub.1_5'Flank|ROGDI_uc010uxu.1_5'Flank|GLYR1_uc002cxy.2_RNA|GLYR1_uc002cxz.1_Silent_p.V461V|GLYR1_uc002cya.2_Silent_p.V541V|GLYR1_uc010uxv.1_Silent_p.V466V	p.V547V	NM_032569	NP_115958	WXS	Illumina HiSeq	Unspecified	Q49A26	GLYR1_HUMAN			16	1678	-			547					B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Silent	SNP	ENST00000321919.9	37	c.1641G>T	CCDS10524.1																																																																																				0.592	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251717.2	NM_032569		11	26	1	0	6.72e-11	8.04e-11	11	26				
ACSM5	54988	broad.mit.edu	37	16	20430642	20430642	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr16:20430642G>A	ENST00000331849.4	+	4	655	c.508G>A	c.(508-510)Gac>Aac	p.D170N	ACSM5_ENST00000575584.1_Missense_Mutation_p.D170N	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	170					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						TATCACCAGTGACTCCCTAGC	0.582																																						uc002dhe.2		NA																	0				ovary(2)	2						c.(508-510)GAC>AAC		acyl-CoA synthetase medium-chain family member 5							92.0	76.0	82.0					16																	20430642		2203	4300	6503	SO:0001583	missense	54988				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding	g.chr16:20430642G>A		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.508G>A	16.37:g.20430642G>A	ENSP00000327916:p.Asp170Asn		Somatic				ACSM5_uc002dhd.1_Missense_Mutation_p.D170N	p.D170N	NM_017888	NP_060358	WXS	Illumina HiSeq	Unspecified	Q6NUN0	ACSM5_HUMAN			4	655	+			170					Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	37	c.508G>A	CCDS10585.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.721522	0.89298	.	.	ENSG00000183549	ENST00000331849	T	0.52057	0.68	4.65	4.65	0.58169	AMP-dependent synthetase/ligase (1);	0.000000	0.64402	D	0.000005	T	0.65729	0.2719	M	0.68317	2.08	0.48288	D	0.999628	D	0.69078	0.997	D	0.64776	0.929	T	0.67791	-0.5579	10	0.52906	T	0.07	-26.923	17.6834	0.88250	0.0:0.0:1.0:0.0	.	170	Q6NUN0	ACSM5_HUMAN	N	170	ENSP00000327916:D170N	ENSP00000327916:D170N	D	+	1	0	ACSM5	20338143	1.000000	0.71417	0.992000	0.48379	0.821000	0.46438	7.372000	0.79612	2.561000	0.86390	0.650000	0.86243	GAC		0.582	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888		39	55	0	0	0	0	39	55				
ACSM3	6296	broad.mit.edu	37	16	20787221	20787221	+	Silent	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr16:20787221C>A	ENST00000289416.5	+	3	755	c.280C>A	c.(280-282)Cga>Aga	p.R94R	ACSM3_ENST00000450120.2_Silent_p.R49R|ACSM3_ENST00000440284.2_Silent_p.R94R	NM_005622.3	NP_005613.2	Q53FZ2	ACSM3_HUMAN	acyl-CoA synthetase medium-chain family member 3	94					cholesterol homeostasis (GO:0042632)|fatty acid biosynthetic process (GO:0006633)|regulation of blood pressure (GO:0008217)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	21						AGAAGAGATGCGATGGAGTTT	0.413																																						uc002dhr.2		NA																	0				ovary(1)	1						c.(280-282)CGA>AGA		SA hypertension-associated homolog isoform 1							123.0	133.0	129.0					16																	20787221		2201	4300	6501	SO:0001819	synonymous_variant	6296				regulation of blood pressure	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding	g.chr16:20787221C>A	D16350	CCDS10589.1, CCDS45435.1	16p13.11	2006-02-08	2005-09-08	2005-09-08	ENSG00000005187	ENSG00000005187		"""Acyl-CoA synthetase family"""	10522	protein-coding gene	gene with protein product		145505	"""SA (rat hypertension-associated) homolog"", ""SA hypertension-associated homolog (rat)"""	SAH		7843754, 7907320, 11470804	Standard	NM_005622		Approved	SA	uc002dhr.3	Q53FZ2	OTTHUMG00000131552	ENST00000289416.5:c.280C>A	16.37:g.20787221C>A			Somatic				ACSM3_uc002dhq.2_Silent_p.R94R|ACSM3_uc010vba.1_Silent_p.R86R	p.R94R	NM_005622	NP_005613	WXS	Illumina HiSeq	Unspecified	Q53FZ2	ACSM3_HUMAN			3	467	+			94					O60363|Q13732|Q15425|Q7KYM6|Q9BUA2	Silent	SNP	ENST00000289416.5	37	c.280C>A	CCDS10589.1																																																																																				0.413	ACSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254414.2	NM_005622		111	144	1	0	5.67e-43	8.3e-43	111	144				
ZP2	7783	broad.mit.edu	37	16	21213115	21213115	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr16:21213115C>T	ENST00000574002.1	-	14	1898	c.1416G>A	c.(1414-1416)atG>atA	p.M472I	AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000219593.4_Missense_Mutation_p.M472I|ZP2_ENST00000574091.1_Missense_Mutation_p.M463I			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	472	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		TGTTTAGTAGCATGTCATTCC	0.413																																						uc002dii.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1414-1416)ATG>ATA		zona pellucida glycoprotein 2 preproprotein							172.0	156.0	161.0					16																	21213115		2200	4300	6500	SO:0001583	missense	7783				binding of sperm to zona pellucida|intracellular protein transport	endoplasmic reticulum|Golgi apparatus|integral to membrane|multivesicular body|plasma membrane|proteinaceous extracellular matrix|stored secretory granule	acrosin binding|coreceptor activity	g.chr16:21213115C>T	M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.1416G>A	16.37:g.21213115C>T	ENSP00000460971:p.Met472Ile		Somatic				ZP2_uc010bwn.1_Missense_Mutation_p.M502I	p.M472I	NM_003460	NP_003451	WXS	Illumina HiSeq	Unspecified	Q05996	ZP2_HUMAN		GBM - Glioblastoma multiforme(48;0.0573)	13	1416	-			472			Extracellular (Potential).|ZP.		B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	ENST00000574002.1	37	c.1416G>A	CCDS10596.1	.	.	.	.	.	.	.	.	.	.	C	1.407	-0.576679	0.03854	.	.	ENSG00000103310	ENST00000219593	D	0.81739	-1.53	5.48	2.29	0.28610	Zona pellucida sperm-binding protein (3);	0.558435	0.18591	N	0.136727	T	0.66489	0.2794	L	0.36672	1.1	0.09310	N	1	B;B	0.13594	0.004;0.008	B;B	0.15052	0.012;0.012	T	0.49312	-0.8953	10	0.24483	T	0.36	-3.2861	5.317	0.15860	0.0:0.5647:0.2382:0.1971	.	463;472	Q4VAP1;Q05996	.;ZP2_HUMAN	I	472	ENSP00000219593:M472I	ENSP00000219593:M472I	M	-	3	0	ZP2	21120616	0.000000	0.05858	0.076000	0.20297	0.412000	0.31113	0.144000	0.16135	1.308000	0.44962	0.467000	0.42956	ATG		0.413	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207365.2			83	120	0	0	0	0	83	120				
PRKCB	5579	broad.mit.edu	37	16	23847649	23847649	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr16:23847649C>G	ENST00000321728.7	+	1	328	c.153C>G	c.(151-153)agC>agG	p.S51R	PRKCB_ENST00000303531.7_Missense_Mutation_p.S51R|PRKCB_ENST00000498058.1_Missense_Mutation_p.S51R	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	51					apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	CCTTCTGCAGCCACTGCACCG	0.687																																						uc002dmd.2		NA																	0				ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9						c.(151-153)AGC>AGG		protein kinase C, beta isoform 1	Vitamin E(DB00163)						84.0	79.0	81.0					16																	23847649		2197	4300	6497	SO:0001583	missense	5579				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding	g.chr16:23847649C>G	M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.153C>G	16.37:g.23847649C>G	ENSP00000318315:p.Ser51Arg		Somatic				PRKCB_uc002dme.2_Missense_Mutation_p.S51R	p.S51R	NM_212535	NP_997700	WXS	Illumina HiSeq	Unspecified	P05771	KPCB_HUMAN			1	350	+			51			Phorbol-ester/DAG-type 1.		C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	ENST00000321728.7	37	c.153C>G	CCDS10618.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.942882	0.73672	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	D;D	0.84516	-1.86;-1.86	3.78	2.79	0.32731	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);Diacylglycerol/phorbol-ester binding (1);	0.000000	0.85682	U	0.000000	D	0.90553	0.7039	M	0.77103	2.36	0.58432	D	0.999999	D;D	0.71674	0.995;0.998	D;D	0.74674	0.972;0.984	D	0.89885	0.4033	10	0.87932	D	0	.	9.6909	0.40127	0.0:0.8901:0.0:0.1099	.	51;51	P05771-2;P05771	.;KPCB_HUMAN	R	51	ENSP00000318315:S51R;ENSP00000305355:S51R	ENSP00000305355:S51R	S	+	3	2	PRKCB	23755150	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.939000	0.63526	0.667000	0.31107	0.467000	0.42956	AGC		0.687	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2	NM_212535		45	73	0	0	0	0	45	73				
ARHGAP17	55114	broad.mit.edu	37	16	24980015	24980015	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr16:24980015C>A	ENST00000289968.6	-	5	420	c.351G>T	c.(349-351)aaG>aaT	p.K117N	ARHGAP17_ENST00000441763.2_Missense_Mutation_p.K117N|ARHGAP17_ENST00000303665.5_Missense_Mutation_p.K117N|ARHGAP17_ENST00000575975.1_5'UTR	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	117	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		CCACGATCTCCTTCTCAACAA	0.537																																						uc002dnb.2		NA																	0					0						c.(349-351)AAG>AAT		nadrin isoform 1							132.0	111.0	118.0					16																	24980015		2197	4300	6497	SO:0001583	missense	55114				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding	g.chr16:24980015C>A	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.351G>T	16.37:g.24980015C>A	ENSP00000289968:p.Lys117Asn		Somatic				ARHGAP17_uc002dnc.2_Missense_Mutation_p.K117N|ARHGAP17_uc010vcf.1_Translation_Start_Site|ARHGAP17_uc002dnf.2_Missense_Mutation_p.K25N|ARHGAP17_uc002dng.1_Missense_Mutation_p.K117N	p.K117N	NM_001006634	NP_001006635	WXS	Illumina HiSeq	Unspecified	Q68EM7	RHG17_HUMAN		GBM - Glioblastoma multiforme(48;0.0407)	5	444	-			117			BAR.		A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	ENST00000289968.6	37	c.351G>T	CCDS32409.1	.	.	.	.	.	.	.	.	.	.	C	17.86	3.492878	0.64074	.	.	ENSG00000140750	ENST00000289968;ENST00000303665;ENST00000441763;ENST00000455311	T;T;T	0.63417	-0.04;-0.04;-0.04	5.85	-2.89	0.05665	BAR (3);	0.000000	0.46442	D	0.000282	T	0.70613	0.3244	M	0.73217	2.22	0.44024	D	0.996743	D;D;D;D	0.71674	0.992;0.998;0.996;0.998	P;D;P;D	0.69142	0.888;0.962;0.866;0.962	T	0.69101	-0.5234	10	0.32370	T	0.25	.	11.9557	0.52981	0.0:0.4589:0.0:0.5411	.	117;117;117;117	Q68EM7-4;C9IZD3;Q68EM7-2;Q68EM7	.;.;.;RHG17_HUMAN	N	117	ENSP00000289968:K117N;ENSP00000303130:K117N;ENSP00000406950:K117N	ENSP00000289968:K117N	K	-	3	2	ARHGAP17	24887516	0.527000	0.26306	0.979000	0.43373	0.959000	0.62525	-0.210000	0.09345	-0.388000	0.07797	0.643000	0.83706	AAG		0.537	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3	NM_018054		86	109	1	0	2.58e-40	3.74e-40	86	109				
RBL2	5934	broad.mit.edu	37	16	53503839	53503839	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr16:53503839C>G	ENST00000262133.6	+	15	2124	c.1987C>G	c.(1987-1989)Cca>Gca	p.P663A	RBL2_ENST00000544545.1_Intron|RBL2_ENST00000379935.4_3'UTR	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	663	Pocket; binds E1A.|Spacer.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CATAACATCTCCAACCACATT	0.453																																						uc002ehi.3		NA																	0				ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						c.(1987-1989)CCA>GCA		retinoblastoma-like 2 (p130)							100.0	102.0	101.0					16																	53503839		2198	4300	6498	SO:0001583	missense	5934				cell cycle|chromatin modification|regulation of cell cycle|regulation of lipid kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr16:53503839C>G	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.1987C>G	16.37:g.53503839C>G	ENSP00000262133:p.Pro663Ala		Somatic				RBL2_uc010vgv.1_Missense_Mutation_p.P589A|RBL2_uc002ehj.2_Missense_Mutation_p.P373A|RBL2_uc010vgw.1_Intron	p.P663A	NM_005611	NP_005602	WXS	Illumina HiSeq	Unspecified	Q08999	RBL2_HUMAN			15	2105	+			663			Spacer.|Pocket; binds E1A.		B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	37	c.1987C>G	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	C	16.98	3.270441	0.59540	.	.	ENSG00000103479	ENST00000262133;ENST00000379935	D	0.92595	-3.07	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.95959	0.8684	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.80764	0.994;0.965;0.994	D	0.95679	0.8730	10	0.72032	D	0.01	-11.0297	20.2032	0.98269	0.0:1.0:0.0:0.0	.	663;373;663	Q8NE70;E9PG04;Q08999	.;.;RBL2_HUMAN	A	663;373	ENSP00000262133:P663A	ENSP00000262133:P663A	P	+	1	0	RBL2	52061340	1.000000	0.71417	1.000000	0.80357	0.186000	0.23388	4.650000	0.61440	2.785000	0.95823	0.650000	0.86243	CCA		0.453	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611		69	58	0	0	0	0	69	58				
CIRH1A	84916	broad.mit.edu	37	16	69184450	69184450	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr16:69184450G>T	ENST00000314423.7	+	7	926	c.749G>T	c.(748-750)aGt>aTt	p.S250I	CIRH1A_ENST00000352319.4_Missense_Mutation_p.S250I|CIRH1A_ENST00000563094.1_Missense_Mutation_p.S250I|CIRH1A_ENST00000569615.2_3'UTR			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	250					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		CAAGAAGACAGTTTCGTGGTG	0.488											OREG0023906	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(69;1156 1278 4951 8715 52012)	uc002ews.3		NA																	0					0						c.(748-750)AGT>ATT		cirhin							163.0	161.0	162.0					16																	69184450		2198	4300	6498	SO:0001583	missense	84916					nucleolus	protein binding	g.chr16:69184450G>T	AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.749G>T	16.37:g.69184450G>T	ENSP00000327179:p.Ser250Ile		Somatic	OREG0023906	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1112	CIRH1A_uc002ewr.2_Missense_Mutation_p.S250I|CIRH1A_uc002ewt.3_Missense_Mutation_p.S167I|CIRH1A_uc010cfi.2_Missense_Mutation_p.S167I|CIRH1A_uc010cfj.1_Missense_Mutation_p.S69I	p.S250I	NM_032830	NP_116219	WXS	Illumina HiSeq	Unspecified	Q969X6	CIR1A_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.125)	7	845	+			250			WD 6.		Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Missense_Mutation	SNP	ENST00000314423.7	37	c.749G>T	CCDS10872.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298395	0.81025	.	.	ENSG00000141076	ENST00000314423;ENST00000352319	T;T	0.33865	1.61;1.39	5.86	4.89	0.63831	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.036479	0.85682	N	0.000000	T	0.57666	0.2069	M	0.70842	2.15	0.58432	D	0.999995	D;P;D	0.89917	1.0;0.915;0.999	D;P;D	0.79108	0.992;0.519;0.974	T	0.55811	-0.8082	10	0.22706	T	0.39	.	15.906	0.79430	0.0:0.0:0.8635:0.1365	.	250;250;250	Q969X6-2;Q969X6;Q969X6-3	.;CIR1A_HUMAN;.	I	250	ENSP00000327179:S250I;ENSP00000339164:S250I	ENSP00000327179:S250I	S	+	2	0	CIRH1A	67741951	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.872000	0.92352	1.442000	0.47568	0.508000	0.49915	AGT		0.488	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268950.2	NM_032830		485	93	1	0	1.38e-241	2.11e-241	485	93				
ZNF23	7571	broad.mit.edu	37	16	71483245	71483245	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr16:71483245T>C	ENST00000393539.2	-	6	1496	c.683A>G	c.(682-684)gAg>gGg	p.E228G	ZNF23_ENST00000417828.1_Missense_Mutation_p.E228G|AC010547.9_ENST00000561908.1_3'UTR|ZNF23_ENST00000564528.1_Missense_Mutation_p.E170G|ZNF23_ENST00000497160.1_3'UTR|ZNF23_ENST00000358700.2_3'UTR|ZNF23_ENST00000539742.1_5'UTR|ZNF23_ENST00000357254.4_Missense_Mutation_p.E228G|ZNF23_ENST00000428724.2_Missense_Mutation_p.E170G	NM_145911.1	NP_666016.1	P17027	ZNF23_HUMAN	zinc finger protein 23	228					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(14)|stomach(1)|urinary_tract(1)	29		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		TTTCCCACACTCCACACATTT	0.453																																						uc002faf.2		NA																	0					0						c.(682-684)GAG>GGG		zinc finger protein 23							123.0	119.0	120.0					16																	71483245		2198	4300	6498	SO:0001583	missense	7571				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:71483245T>C	X52347	CCDS10900.1	16q22.2	2013-03-28	2012-07-12		ENSG00000167377	ENSG00000167377		"""Zinc fingers, C2H2-type"""	13023	protein-coding gene	gene with protein product		194527	"""zinc finger protein 359"""	ZNF359			Standard	NM_145911		Approved	KOX16, Zfp612, ZNF612	uc002faf.3	P17027	OTTHUMG00000176797	ENST00000393539.2:c.683A>G	16.37:g.71483245T>C	ENSP00000377171:p.Glu228Gly		Somatic				ZNF23_uc002fad.2_Missense_Mutation_p.E170G|ZNF23_uc002fae.2_Missense_Mutation_p.E170G|ZNF23_uc010vmf.1_Missense_Mutation_p.E170G|ZNF23_uc002fag.2_Missense_Mutation_p.E170G|ZNF23_uc002fah.2_Missense_Mutation_p.E228G|ZNF23_uc002fai.2_Missense_Mutation_p.E267G	p.E228G	NM_145911	NP_666016	WXS	Illumina HiSeq	Unspecified	P17027	ZNF23_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0686)	6	1497	-		Ovarian(137;0.00768)	228			C2H2-type 3.		Q8NDP5|Q96IT3|Q9UG42	Missense_Mutation	SNP	ENST00000393539.2	37	c.683A>G	CCDS10900.1	.	.	.	.	.	.	.	.	.	.	T	15.68	2.905154	0.52333	.	.	ENSG00000167377	ENST00000393539;ENST00000357254;ENST00000417828;ENST00000428724;ENST00000539742;ENST00000358700	T;T;T;T	0.07444	3.19;3.19;3.19;3.19	3.7	3.7	0.42460	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.174821	0.27691	N	0.018249	T	0.27134	0.0665	M	0.78916	2.43	0.20873	N	0.999833	D;D	0.89917	0.999;1.0	D;D	0.91635	0.982;0.999	T	0.01824	-1.1266	10	0.87932	D	0	-21.7936	10.9981	0.47589	0.0:0.0:0.0:1.0	.	228;228	B3KR55;P17027	.;ZNF23_HUMAN	G	228;228;228;170;170;28	ENSP00000377171:E228G;ENSP00000349796:E228G;ENSP00000395712:E228G;ENSP00000387673:E170G	ENSP00000349796:E228G	E	-	2	0	ZNF23	70040746	0.016000	0.18221	1.000000	0.80357	0.995000	0.86356	1.996000	0.40776	1.922000	0.55676	0.459000	0.35465	GAG		0.453	ZNF23-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268985.23	NM_145911		51	592	0	0	0	0	51	592				
BCAR1	9564	broad.mit.edu	37	16	75269450	75269450	+	Silent	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr16:75269450C>A	ENST00000162330.5	-	5	1473	c.1347G>T	c.(1345-1347)ccG>ccT	p.P449P	BCAR1_ENST00000538440.2_Silent_p.P449P|BCAR1_ENST00000393420.6_Silent_p.P467P|BCAR1_ENST00000535626.2_Silent_p.P301P|BCAR1_ENST00000393422.2_Silent_p.P467P|BCAR1_ENST00000420641.3_Silent_p.P467P|BCAR1_ENST00000566982.1_5'UTR|BCAR1_ENST00000546196.1_Silent_p.P420P|BCAR1_ENST00000542031.2_Silent_p.P447P|BCAR1_ENST00000418647.3_Silent_p.P495P	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	449	Ser-rich.				actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		GTTCCCGGCCCGGCCCTGCCA	0.697																																						uc002fdv.2		NA																	0				central_nervous_system(5)|breast(2)|prostate(1)	8						c.(1345-1347)CCG>CCT		breast cancer anti-estrogen resistance 1							11.0	15.0	14.0					16																	75269450		2184	4286	6470	SO:0001819	synonymous_variant	9564				actin filament organization|B cell receptor signaling pathway|blood coagulation|cell adhesion|cell division|cell migration|cell proliferation|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|integrin-mediated signaling pathway|nerve growth factor receptor signaling pathway|platelet-derived growth factor receptor signaling pathway|positive regulation of cell migration|regulation of apoptosis|regulation of cell growth|T cell receptor signaling pathway	cytosol|focal adhesion|membrane fraction|ruffle	protein kinase binding|protein phosphatase binding|SH3 domain binding|signal transducer activity	g.chr16:75269450C>A	AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.1347G>T	16.37:g.75269450C>A			Somatic				BCAR1_uc002fdt.2_5'UTR|BCAR1_uc002fdu.2_Silent_p.P239P|BCAR1_uc010cgu.2_Silent_p.P438P|BCAR1_uc010vna.1_Silent_p.P447P|BCAR1_uc010vnb.1_Silent_p.P495P|BCAR1_uc002fdw.2_Silent_p.P449P|BCAR1_uc010vnc.1_Silent_p.P301P|BCAR1_uc010vnd.1_Silent_p.P467P|BCAR1_uc002fdx.2_Silent_p.P467P	p.P449P	NM_014567	NP_055382	WXS	Illumina HiSeq	Unspecified	P56945	BCAR1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	5	1470	-			449			Ser-rich.		B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Silent	SNP	ENST00000162330.5	37	c.1347G>T	CCDS10915.1																																																																																				0.697	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269017.1	NM_014567		17	3	1	0	7.08e-05	7.65e-05	17	3				
C16orf46	123775	broad.mit.edu	37	16	81094970	81094970	+	Silent	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr16:81094970C>T	ENST00000299578.5	-	4	1219	c.984G>A	c.(982-984)caG>caA	p.Q328Q	C16orf46_ENST00000444657.3_5'Flank|C16orf46_ENST00000378611.4_Silent_p.Q328Q|RP11-303E16.8_ENST00000564536.1_RNA	NM_152337.2	NP_689550.2	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46	328						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|large_intestine(3)|lung(9)|prostate(1)|stomach(1)|urinary_tract(1)	18						CTCCCCGTTTCTGCAGAAGCT	0.542																																						uc002fgc.3		NA																	0					0						c.(982-984)CAG>CAA		chromosome 16 open reading frame 46 isoform 2							105.0	103.0	104.0					16																	81094970		2202	4300	6502	SO:0001819	synonymous_variant	123775							g.chr16:81094970C>T	BC064143	CCDS10932.1, CCDS42201.1	16q23.2	2012-10-09			ENSG00000166455	ENSG00000166455			26525	protein-coding gene	gene with protein product							Standard	NM_152337		Approved	FLJ32702	uc002fgc.4	Q6P387	OTTHUMG00000137629	ENST00000299578.5:c.984G>A	16.37:g.81094970C>T			Somatic				C16orf46_uc010chf.2_Silent_p.Q328Q|C16orf46_uc010vno.1_Silent_p.Q55Q	p.Q328Q	NM_152337	NP_689550	WXS	Illumina HiSeq	Unspecified	Q6P387	CP046_HUMAN			4	1243	-			328					Q96MA7	Silent	SNP	ENST00000299578.5	37	c.984G>A	CCDS10932.1																																																																																				0.542	C16orf46-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269054.2	NM_152337		72	120	0	0	0	0	72	120				
TSR1	55720	broad.mit.edu	37	17	2238189	2238189	+	Splice_Site	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr17:2238189T>A	ENST00000301364.5	-	5	1637	c.558A>T	c.(556-558)acA>acT	p.T186T	SGSM2_ENST00000268989.3_5'Flank|SGSM2_ENST00000426855.2_5'Flank|TSR1_ENST00000576112.2_Splice_Site_p.A170A|SGSM2_ENST00000574563.1_5'Flank	NM_018128.4	NP_060598.3	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)	186	Bms1-type G.				ribosome assembly (GO:0042255)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	20						GGACAGCTAGTGCTGTAAGCG	0.453																																						uc002fuj.2		NA																	0				ovary(1)	1						c.(556-558)ACA>ACT		TSR1, 20S rRNA accumulation							73.0	73.0	73.0					17																	2238189		2203	4298	6501	SO:0001630	splice_region_variant	55720				ribosome assembly	nucleolus	protein binding	g.chr17:2238189T>A	AK026565	CCDS32525.1	17p13.3	2006-04-20	2006-04-20			ENSG00000167721			25542	protein-coding gene	gene with protein product		611214	"""TSR1, 20S rRNA accumulation, homolog (yeast)"""			10718198	Standard	NM_018128		Approved	FLJ10534	uc002fuj.3	Q2NL82		ENST00000301364.5:c.557-1A>T	17.37:g.2238189T>A			Somatic				SGSM2_uc002fum.3_5'Flank|SGSM2_uc010vqw.1_5'Flank|SGSM2_uc002fun.3_5'Flank	p.T186T	NM_018128	NP_060598	WXS	Illumina HiSeq	Unspecified	Q2NL82	TSR1_HUMAN			5	1515	-			186					Q8WUY5|Q9NVT0|Q9P2E6	Silent	SNP	ENST00000301364.5	37	c.558A>T	CCDS32525.1																																																																																				0.453	TSR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438180.2	NM_018128	Silent	80	98	0	0	0	0	80	98				
NEURL4	84461	broad.mit.edu	37	17	7230998	7230998	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr17:7230998C>T	ENST00000399464.2	-	2	503	c.488G>A	c.(487-489)cGc>cAc	p.R163H	NEURL4_ENST00000570460.1_Missense_Mutation_p.R163H|NEURL4_ENST00000315614.7_Missense_Mutation_p.R163H	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	163	NHR 1. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AGCAACTGTGCGCTCCACGCC	0.642																																						uc002gga.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(487-489)CGC>CAC		neuralized homolog 4 isoform 1							72.0	86.0	81.0					17																	7230998		2160	4257	6417	SO:0001583	missense	84461						protein binding	g.chr17:7230998C>T		CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.488G>A	17.37:g.7230998C>T	ENSP00000382390:p.Arg163His		Somatic				NEURL4_uc002ggb.1_Missense_Mutation_p.R163H|NEURL4_uc002ggc.1_5'Flank	p.R163H	NM_032442	NP_115818	WXS	Illumina HiSeq	Unspecified	Q96JN8	NEUL4_HUMAN			2	495	-			163			NHR 1.		Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	ENST00000399464.2	37	c.488G>A	CCDS42251.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.040067	0.93630	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.73575	-0.76;-0.76	5.48	5.48	0.80851	Concanavalin A-like lectin/glucanase (1);NEUZ (2);	0.000000	0.85682	D	0.000000	D	0.88370	0.6418	M	0.88704	2.975	0.58432	D	0.999993	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.99	D	0.89944	0.4075	10	0.72032	D	0.01	-15.7243	16.6242	0.84937	0.0:1.0:0.0:0.0	.	163;163	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	H	163	ENSP00000319826:R163H;ENSP00000382390:R163H	ENSP00000319826:R163H	R	-	2	0	NEURL4	7171722	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.010000	0.57117	2.731000	0.93534	0.650000	0.86243	CGC		0.642	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2	NM_032442		65	95	0	0	0	0	65	95				
TP53	7157	broad.mit.edu	37	17	7578523	7578523	+	Missense_Mutation	SNP	T	T	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr17:7578523T>G	ENST00000269305.4	-	5	596	c.407A>C	c.(406-408)cAa>cCa	p.Q136P	TP53_ENST00000420246.2_Missense_Mutation_p.Q136P|TP53_ENST00000359597.4_Missense_Mutation_p.Q136P|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.Q136P|TP53_ENST00000455263.2_Missense_Mutation_p.Q136P|TP53_ENST00000445888.2_Missense_Mutation_p.Q136P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	136	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> E (in sporadic cancers; somatic mutation).|Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in a sporadic cancer; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Q136P(3)|p.C135fs*9(3)|p.N131fs*27(2)|p.Q136R(2)|p.V73fs*9(1)|p.F134_T140>S(1)|p.C135_T140delCQLAKT(1)|p.C42fs*9(1)|p.Y126fs*11(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.C3fs*9(1)|p.Q136L(1)|p.Q136_K139delQLAK(1)|p.C135_A138delCQLA(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTTGGCCAGTTGGCAAAACAT	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		29	Deletion - Frameshift(9)|Whole gene deletion(8)|Substitution - Missense(6)|Deletion - In frame(5)|Complex - deletion inframe(1)	p.Q136*(28)|p.0?(7)|p.Q136H(5)|p.Q136Q(4)|p.Q136P(3)|p.Q136E(3)|p.Q136fs*13(2)|p.N131fs*27(2)|p.Q136fs*34(2)|p.Q136R(2)|p.V73fs*9(1)|p.F134_T140>S(1)|p.C135_T140delCQLAKT(1)|p.Q136K(1)|p.Y126fs*11(1)|p.C135_A138delCQLA(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.Q136_K139delQLAK(1)|p.C135_Q136insX(1)|p.C135_Q136insXXXXXX(1)	urinary_tract(10)|bone(4)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|upper_aerodigestive_tract(1)|large_intestine(1)|stomach(1)|oesophagus(1)|lung(1)|ovary(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(406-408)CAA>CCA	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							52.0	52.0	52.0					17																	7578523		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578523T>G	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.407A>C	17.37:g.7578523T>G	ENSP00000269305:p.Gln136Pro	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Missense_Mutation_p.Q136P|TP53_uc002gih.2_Missense_Mutation_p.Q136P|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Q4P|TP53_uc010cng.1_Missense_Mutation_p.Q4P|TP53_uc002gii.1_Missense_Mutation_p.Q4P|TP53_uc010cnh.1_Missense_Mutation_p.Q136P|TP53_uc010cni.1_Missense_Mutation_p.Q136P|TP53_uc002gij.2_Missense_Mutation_p.Q136P|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.Q43P|TP53_uc002gio.2_Missense_Mutation_p.Q4P|TP53_uc010vug.1_Missense_Mutation_p.Q97P	p.Q136P	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	5	601	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	136		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in a sporadic cancer; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> E (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.407A>C	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.411236	0.83340	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99807	-6.85;-6.85;-6.85;-6.85;-6.85;-6.85;-6.85;-6.85;-6.85	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99697	0.9885	M	0.78223	2.4	0.80722	D	1	D;D;B;D;D;D;D	0.89917	0.997;0.998;0.093;1.0;1.0;0.999;1.0	D;D;B;D;D;D;D	0.87578	0.984;0.993;0.101;0.995;0.998;0.996;0.994	D	0.97346	0.9960	10	0.87932	D	0	-25.5387	13.8301	0.63375	0.0:0.0:0.0:1.0	.	97;136;136;43;136;136;136	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	P	136;136;136;136;136;136;125;43;4;43;4;136	ENSP00000410739:Q136P;ENSP00000352610:Q136P;ENSP00000269305:Q136P;ENSP00000398846:Q136P;ENSP00000391127:Q136P;ENSP00000391478:Q136P;ENSP00000425104:Q4P;ENSP00000423862:Q43P;ENSP00000424104:Q136P	ENSP00000269305:Q136P	Q	-	2	0	TP53	7519248	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	7.993000	0.88291	2.206000	0.71126	0.533000	0.62120	CAA		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		24	39	0	0	0	0	24	39				
PER1	5187	broad.mit.edu	37	17	8044494	8044495	+	Missense_Mutation	DNP	TT	TT	AA			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr17:8044494_8044495TT>AA	ENST00000317276.4	-	23	4001_4002	c.3764_3765AA>TT	c.(3763-3765)cAA>cTT	p.Q1255L	PER1_ENST00000578089.1_5'Flank|PER1_ENST00000581082.1_Missense_Mutation_p.Q1232L	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	1255	CRY binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TGGCCCCGCCTTGGGCCTCCTC	0.639			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																														uc002gkd.2		NA		Dom	yes		17	17p13.1-17p12	5187	T	period homolog 1 (Drosophila)			L	ETV6		AML|CMML		0				lung(2)|breast(2)|skin(2)|large_intestine(1)|ovary(1)|kidney(1)	9						c.(3763-3765)CAA>CTT	Other_conserved_DNA_damage_response_genes	period 1																																				SO:0001583	missense	5187				circadian rhythm|entrainment of circadian clock|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity	g.chr17:8044494_8044495TT>AA	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.3764_3765delinsAA	17.37:g.8044494_8044495delinsAA	ENSP00000314420:p.Gln1255Leu		Somatic				PER1_uc010cns.2_Missense_Mutation_p.Q129L|PER1_uc010vuq.1_RNA	p.Q1255L	NM_002616	NP_002607	WXS	Illumina HiSeq	Unspecified	O15534	PER1_HUMAN			23	4002_4003	-			1255			CRY binding domain (By similarity).		B2RPA8|B4DI49|D3DTR3	Missense_Mutation	DNP	ENST00000317276.4	37	c.3764_3765AA>TT	CCDS11131.1																																																																																				0.639	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2			179	268	0	0	0	0	179	268				
PIK3R6	146850	broad.mit.edu	37	17	8732225	8732225	+	Silent	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr17:8732225G>T	ENST00000311434.9	-	11	1211	c.972C>A	c.(970-972)ctC>ctA	p.L324L	PIK3R6_ENST00000434064.2_5'UTR	NM_001010855.2	NP_001010855.1	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	324					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of MAP kinase activity (GO:0043406)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)										GGTCCGGCCGGAGGCCCTGCA	0.657																																						uc002glq.1		NA																	0					0						c.(970-972)CTC>CTA		phosphoinositide-3-kinase, regulatory subunit 6							25.0	27.0	27.0					17																	8732225		1990	4164	6154	SO:0001819	synonymous_variant	146850				platelet activation	cytosol		g.chr17:8732225G>T	AK091819	CCDS73985.1	17p13.1	2013-01-31	2008-02-04	2008-02-04	ENSG00000174083	ENSG00000276231			27101	protein-coding gene	gene with protein product		611462	"""chromosome 17 open reading frame 38"""	C17orf38		16476736	Standard	NM_001010855		Approved	FLJ34500, HsT41028, p87PIKAP	uc002glq.1	Q5UE93	OTTHUMG00000132861	ENST00000311434.9:c.972C>A	17.37:g.8732225G>T			Somatic				PIK3R6_uc002glr.1_RNA|PIK3R6_uc002gls.1_RNA	p.L324L	NM_001010855	NP_001010855	WXS	Illumina HiSeq	Unspecified	Q5UE93	PI3R6_HUMAN			11	1212	-			324					Q658R3	Silent	SNP	ENST00000311434.9	37	c.972C>A																																																																																					0.657	PIK3R6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001010855		14	23	1	0	1.58e-08	1.83e-08	14	23				
MAP2K3	5606	broad.mit.edu	37	17	21204272	21204272	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr17:21204272C>G	ENST00000342679.4	+	5	615	c.366C>G	c.(364-366)taC>taG	p.Y122*	MAP2K3_ENST00000361818.5_Nonsense_Mutation_p.Y93*|MAP2K3_ENST00000316920.6_Nonsense_Mutation_p.Y93*	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	122	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		ACTGTTTCTACACTGTCACCT	0.592																																						uc002gys.2		NA																	0					0						c.(364-366)TAC>TAG		mitogen-activated protein kinase kinase 3							201.0	165.0	177.0					17																	21204272		2203	4300	6503	SO:0001587	stop_gained	5606				activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr17:21204272C>G	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.366C>G	17.37:g.21204272C>G	ENSP00000345083:p.Tyr122*		Somatic				MAP2K3_uc002gyt.2_Nonsense_Mutation_p.Y93*|MAP2K3_uc002gyu.2_Nonsense_Mutation_p.Y93*	p.Y122*	NM_145109	NP_659731	WXS	Illumina HiSeq	Unspecified	P46734	MP2K3_HUMAN		COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)	5	631	+			122			Protein kinase.		B3KSK7|Q99441|Q9UE71|Q9UE72	Nonsense_Mutation	SNP	ENST00000342679.4	37	c.366C>G	CCDS11217.1	.	.	.	.	.	.	.	.	.	.	C	19.91	3.915367	0.73098	.	.	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000526076;ENST00000316920	.	.	.	5.22	1.57	0.23409	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-33.6248	9.8041	0.40781	0.0:0.6255:0.0:0.3745	.	.	.	.	X	122;93;93;93;126	.	ENSP00000319139:Y126X	Y	+	3	2	MAP2K3	21144865	0.925000	0.31364	0.999000	0.59377	0.993000	0.82548	0.090000	0.15025	0.563000	0.29222	0.655000	0.94253	TAC		0.592	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	NM_145109		4	183	0	0	0	0	4	183				
KCNJ12	3768	broad.mit.edu	37	17	21319071	21319071	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr17:21319071G>T	ENST00000583088.1	+	3	1312	c.417G>T	c.(415-417)gaG>gaT	p.E139D	KCNJ12_ENST00000331718.5_Missense_Mutation_p.E139D	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	139				E -> K (in Ref. 2; AAC50615). {ECO:0000305}.	muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	TCTCCATCGAGACGCAGACCA	0.672										Prostate(3;0.18)																												uc002gyv.1		NA																	0				ovary(3)|skin(1)	4						c.(415-417)GAG>GAT		potassium inwardly-rectifying channel, subfamily	Dofetilide(DB00204)						44.0	42.0	43.0					17																	21319071		2203	4299	6502	SO:0001583	missense	3768				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity	g.chr17:21319071G>T	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.417G>T	17.37:g.21319071G>T	ENSP00000463778:p.Glu139Asp	Prostate(3;0.18)	Somatic					p.E139D	NM_021012	NP_066292	WXS	Illumina HiSeq	Unspecified	Q14500	IRK12_HUMAN		Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	3	1122	+			139	E -> K (in Ref. 2; AAC50615).				O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	37	c.417G>T	CCDS11219.1	.	.	.	.	.	.	.	.	.	.	G	19.07	3.755829	0.69648	.	.	ENSG00000184185	ENST00000331718	D	0.96522	-4.04	5.23	4.26	0.50523	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.98754	0.9581	H	0.97758	4.07	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.99222	1.0879	10	0.87932	D	0	.	13.5775	0.61883	0.0753:0.0:0.9247:0.0	.	139	Q14500	IRK12_HUMAN	D	139	ENSP00000328150:E139D	ENSP00000328150:E139D	E	+	3	2	KCNJ12	21259664	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.411000	0.44600	1.211000	0.43351	0.591000	0.81541	GAG		0.672	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012		7	22	1	0	0.000442599	0.000473429	7	22				
ATAD5	79915	broad.mit.edu	37	17	29220783	29220783	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr17:29220783T>A	ENST00000321990.4	+	21	5290	c.4912T>A	c.(4912-4914)Tgt>Agt	p.C1638S		NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1638					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AGGAAAAAAATGTTCTGCCCT	0.378																																						uc002hfs.1		NA																	0				ovary(3)	3						c.(4912-4914)TGT>AGT		ATPase family, AAA domain containing 5							125.0	138.0	134.0					17																	29220783		2203	4300	6503	SO:0001583	missense	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29220783T>A		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.4912T>A	17.37:g.29220783T>A	ENSP00000313171:p.Cys1638Ser		Somatic					p.C1638S	NM_024857	NP_079133	WXS	Illumina HiSeq	Unspecified	Q96QE3	ATAD5_HUMAN			21	5258	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	1638					Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	c.4912T>A	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	T	4.434	0.080362	0.08533	.	.	ENSG00000176208	ENST00000321990	T	0.05382	3.45	6.08	-0.286	0.12862	.	0.541698	0.21869	N	0.067904	T	0.06096	0.0158	M	0.62723	1.935	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.35624	-0.9781	10	0.28530	T	0.3	.	4.2227	0.10565	0.5527:0.0645:0.1057:0.2772	.	1638	Q96QE3	ATAD5_HUMAN	S	1638	ENSP00000313171:C1638S	ENSP00000313171:C1638S	C	+	1	0	ATAD5	26244909	0.006000	0.16342	0.000000	0.03702	0.715000	0.41141	0.006000	0.13152	-0.362000	0.08113	-0.403000	0.06358	TGT		0.378	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		106	180	0	0	0	0	106	180				
MYO1D	4642	broad.mit.edu	37	17	31107692	31107692	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr17:31107692C>T	ENST00000318217.5	-	2	510	c.206G>A	c.(205-207)cGt>cAt	p.R69H	MYO1D_ENST00000583621.1_Missense_Mutation_p.R69H|MYO1D_ENST00000579584.1_Missense_Mutation_p.R69H|MYO1D_ENST00000394649.4_De_novo_Start_OutOfFrame	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	69	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			ATACAGCTCACGGCCTTTATA	0.448																																						uc002hho.1		NA																	0				large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(205-207)CGT>CAT		myosin ID							129.0	107.0	114.0					17																	31107692		2203	4300	6503	SO:0001583	missense	4642					myosin complex	actin binding|ATP binding|calmodulin binding	g.chr17:31107692C>T	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.206G>A	17.37:g.31107692C>T	ENSP00000324527:p.Arg69His		Somatic				MYO1D_uc002hhp.1_Missense_Mutation_p.R69H|MYO1D_uc010wcb.1_Missense_Mutation_p.R69H	p.R69H	NM_015194	NP_056009	WXS	Illumina HiSeq	Unspecified	O94832	MYO1D_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.0362)		2	218	-			69			Myosin head-like.		A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	37	c.206G>A	CCDS32615.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.635586	0.87760	.	.	ENSG00000176658	ENST00000318217	D	0.87966	-2.32	4.34	4.34	0.51931	Myosin head, motor domain (2);	0.000000	0.38217	U	0.001769	D	0.92896	0.7740	M	0.77712	2.385	0.38490	D	0.94794	D	0.89917	1.0	D	0.97110	1.0	D	0.94360	0.7587	10	0.72032	D	0.01	.	14.7061	0.69191	0.0:1.0:0.0:0.0	.	69	O94832	MYO1D_HUMAN	H	69	ENSP00000324527:R69H	ENSP00000324527:R69H	R	-	2	0	MYO1D	28131805	0.999000	0.42202	0.081000	0.20488	0.952000	0.60782	7.548000	0.82154	2.401000	0.81631	0.591000	0.81541	CGT		0.448	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1			67	73	0	0	0	0	67	73				
UNC45B	146862	broad.mit.edu	37	17	33501357	33501357	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr17:33501357C>G	ENST00000268876.5	+	14	2030	c.1933C>G	c.(1933-1935)Ctc>Gtc	p.L645V	UNC45B_ENST00000433649.1_Missense_Mutation_p.L643V|UNC45B_ENST00000394570.2_Missense_Mutation_p.L643V|UNC45B_ENST00000591048.1_Missense_Mutation_p.L564V|UNC45B_ENST00000378449.1_Missense_Mutation_p.L564V	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	645					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				TAGTGCCATCCTCACTGACCA	0.597																																						uc002hja.2		NA																	0				ovary(3)|central_nervous_system(2)|breast(1)	6						c.(1933-1935)CTC>GTC		cardiomyopathy associated 4 isoform 1							88.0	83.0	85.0					17																	33501357		2203	4300	6503	SO:0001583	missense	146862				cell differentiation|muscle organ development	cytosol	binding	g.chr17:33501357C>G	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.1933C>G	17.37:g.33501357C>G	ENSP00000268876:p.Leu645Val		Somatic				UNC45B_uc002hjb.2_Missense_Mutation_p.L643V|UNC45B_uc002hjc.2_Missense_Mutation_p.L643V|UNC45B_uc010cto.2_Missense_Mutation_p.L564V	p.L645V	NM_173167	NP_775259	WXS	Illumina HiSeq	Unspecified	Q8IWX7	UN45B_HUMAN			14	2030	+		Ovarian(249;0.17)	645					Q495Q8|Q495Q9	Missense_Mutation	SNP	ENST00000268876.5	37	c.1933C>G	CCDS11292.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.721225	0.48728	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T	0.64260	-0.09;-0.09;0.49	5.03	5.03	0.67393	Armadillo-like helical (1);Armadillo-type fold (1);	0.208913	0.42053	D	0.000775	T	0.77896	0.4199	M	0.76838	2.35	0.41839	D	0.990113	D;P;P	0.67145	0.996;0.889;0.823	D;P;P	0.75484	0.986;0.661;0.538	T	0.79907	-0.1605	10	0.59425	D	0.04	-16.3407	12.9006	0.58123	0.0:0.9196:0.0:0.0804	.	564;643;645	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	V	645;645;643;564	ENSP00000268876:L645V;ENSP00000412840:L643V;ENSP00000367710:L564V	ENSP00000268876:L645V	L	+	1	0	UNC45B	30525470	0.792000	0.28813	1.000000	0.80357	0.923000	0.55619	1.455000	0.35190	2.606000	0.88127	0.591000	0.81541	CTC		0.597	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167		4	108	0	0	0	0	4	108				
SMCHD1	23347	broad.mit.edu	37	18	2751280	2751280	+	Silent	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr18:2751280T>C	ENST00000320876.6	+	33	4508	c.4170T>C	c.(4168-4170)ttT>ttC	p.F1390F	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Silent_p.F1390F	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1390					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						TGACAGATTTTATGATTAGTG	0.303																																						uc002klm.3		NA																	0					0						c.(4168-4170)TTT>TTC		structural maintenance of chromosomes flexible							66.0	60.0	62.0					18																	2751280		1818	4066	5884	SO:0001819	synonymous_variant	23347				chromosome organization		ATP binding	g.chr18:2751280T>C	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.4170T>C	18.37:g.2751280T>C			Somatic				SMCHD1_uc002klk.3_RNA|SMCHD1_uc002kll.3_RNA	p.F1390F	NM_015295	NP_056110	WXS	Illumina HiSeq	Unspecified	A6NHR9	SMHD1_HUMAN			33	4359	+			1390					O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Silent	SNP	ENST00000320876.6	37	c.4170T>C	CCDS45822.1																																																																																				0.303	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2			17	334	0	0	0	0	17	334				
ARHGAP28	79822	broad.mit.edu	37	18	6882171	6882172	+	Missense_Mutation	DNP	TG	TG	GT			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr18:6882171_6882172TG>GT	ENST00000383472.4	+	11	1430_1431	c.1326_1327TG>GT	c.(1324-1329)gcTGat>gcGTat	p.D443Y	ARHGAP28_ENST00000531294.1_Missense_Mutation_p.D279Y|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.D391Y|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.D443Y|ARHGAP28_ENST00000418986.1_Missense_Mutation_p.D284Y|ARHGAP28_ENST00000419673.2_Missense_Mutation_p.D284Y|ARHGAP28_ENST00000532996.1_Missense_Mutation_p.D266Y|ARHGAP28_ENST00000314319.3_Missense_Mutation_p.D284Y			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	443	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				AGTTTAATGCTGATAAATTTAA	0.396																																						uc010wzi.1		NA																	0				pancreas(1)	1						c.(793-798)GCTGAT>GCGTAT		SubName: Full=Putative uncharacterized protein ARHGAP28;																																				SO:0001583	missense	79822				signal transduction	intracellular		g.chr18:6882171_6882172TG>GT	BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		Exception_encountered	18.37:g.6882171_6882172delinsGT	ENSP00000372964:p.Asp443Tyr		Somatic				ARHGAP28_uc002knc.2_Missense_Mutation_p.D391Y|ARHGAP28_uc002knd.2_Missense_Mutation_p.D284Y|ARHGAP28_uc002kne.2_Missense_Mutation_p.D284Y|ARHGAP28_uc002knf.2_Missense_Mutation_p.D275Y	p.D266Y			WXS	Illumina HiSeq	Unspecified	B4DXL2	B4DXL2_HUMAN			10	1033_1034	+		Colorectal(10;0.168)	266					A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	DNP	ENST00000383472.4	37	c.795_796TG>GT																																																																																					0.396	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442123.3	XM_371108		131	80	0	0	0	0	131	80				
LAMA1	284217	broad.mit.edu	37	18	7015791	7015791	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr18:7015791T>C	ENST00000389658.3	-	22	3149	c.3056A>G	c.(3055-3057)cAc>cGc	p.H1019R		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1019	Laminin EGF-like 11. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ACCCTGTGTGTGAGGGGGGCA	0.542																																						uc002knm.2		NA																	0				ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21						c.(3055-3057)CAC>CGC		laminin, alpha 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						134.0	117.0	123.0					18																	7015791		2203	4300	6503	SO:0001583	missense	284217				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding	g.chr18:7015791T>C	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.3056A>G	18.37:g.7015791T>C	ENSP00000374309:p.His1019Arg		Somatic				LAMA1_uc010wzj.1_Missense_Mutation_p.H495R	p.H1019R	NM_005559	NP_005550	WXS	Illumina HiSeq	Unspecified	P25391	LAMA1_HUMAN			22	3150	-		Colorectal(10;0.172)	1019			Laminin EGF-like 11.			Missense_Mutation	SNP	ENST00000389658.3	37	c.3056A>G	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	T	14.91	2.676147	0.47886	.	.	ENSG00000101680	ENST00000389658	T	0.61274	0.12	5.36	5.36	0.76844	EGF-like, laminin (4);	0.212175	0.38959	N	0.001519	T	0.67906	0.2943	L	0.42632	1.34	0.38088	D	0.936865	D	0.71674	0.998	D	0.70016	0.967	T	0.68652	-0.5352	10	0.33940	T	0.23	.	15.6451	0.77042	0.0:0.0:0.0:1.0	.	1019	P25391	LAMA1_HUMAN	R	1019	ENSP00000374309:H1019R	ENSP00000374309:H1019R	H	-	2	0	LAMA1	7005791	1.000000	0.71417	0.887000	0.34795	0.049000	0.14656	6.124000	0.71620	2.158000	0.67659	0.523000	0.50628	CAC		0.542	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		70	259	0	0	0	0	70	259				
PPP4R1	9989	broad.mit.edu	37	18	9563520	9563520	+	Silent	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr18:9563520T>A	ENST00000400556.3	-	12	1675	c.1602A>T	c.(1600-1602)ctA>ctT	p.L534L	PPP4R1_ENST00000400555.3_Silent_p.L517L	NM_001042388.2	NP_001035847.1	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	534					dephosphorylation (GO:0016311)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase 4 complex (GO:0030289)	protein phosphatase type 4 regulator activity (GO:0030362)			large_intestine(1)|skin(2)	3						TGGAAGCACGTAGTGCAGCGG	0.403																																					Melanoma(188;1232 2082 5061 11948 35994)	uc002koe.1		NA																	0				skin(1)	1						c.(1600-1602)CTA>CTT		protein phosphatase 4, regulatory subunit 1							128.0	118.0	121.0					18																	9563520		1930	4138	6068	SO:0001819	synonymous_variant	9989				protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity	g.chr18:9563520T>A	AF111106	CCDS42412.1, CCDS42413.1	18p11.22	2010-06-18			ENSG00000154845	ENSG00000154845		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	9320	protein-coding gene	gene with protein product		604908				10026142	Standard	NM_001042388		Approved	PP4R1	uc002koe.2	Q8TF05	OTTHUMG00000137466	ENST00000400556.3:c.1602A>T	18.37:g.9563520T>A			Somatic				PPP4R1_uc002kof.2_5'UTR|PPP4R1_uc010wzo.1_Silent_p.L380L|PPP4R1_uc002kod.1_Silent_p.L517L|PPP4R1_uc010wzp.1_RNA	p.L534L	NM_001042388	NP_001035847	WXS	Illumina HiSeq	Unspecified	Q8TF05	PP4R1_HUMAN			12	1720	-			534			HEAT 10.		Q99774|Q9UNQ7	Silent	SNP	ENST00000400556.3	37	c.1602A>T	CCDS42412.1																																																																																				0.403	PPP4R1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268571.1	NM_005134		47	163	0	0	0	0	47	163				
ANKRD30B	374860	broad.mit.edu	37	18	14852103	14852103	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr18:14852103G>A	ENST00000358984.4	+	36	3983	c.3803G>A	c.(3802-3804)cGa>cAa	p.R1268Q		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1268										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						CAAAGAGACCGATGTGAAACA	0.388																																						uc010dlo.2		NA																	0				ovary(1)|skin(1)	2						c.(3802-3804)CGA>CAA		ankyrin repeat domain 30B							50.0	39.0	42.0					18																	14852103		692	1591	2283	SO:0001583	missense	374860							g.chr18:14852103G>A	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3803G>A	18.37:g.14852103G>A	ENSP00000351875:p.Arg1268Gln		Somatic				ANKRD30B_uc010xal.1_Missense_Mutation_p.R410Q	p.R1268Q	NM_001145029	NP_001138501	WXS	Illumina HiSeq	Unspecified	Q9BXX2	AN30B_HUMAN			36	3983	+			1353					B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	c.3803G>A	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	G	1.238	-0.622182	0.03636	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.14266	2.52	1.39	0.108	0.14548	.	.	.	.	.	T	0.04588	0.0125	N	0.12182	0.205	0.09310	N	0.999996	B;P	0.42941	0.403;0.794	B;B	0.20767	0.009;0.031	T	0.35151	-0.9800	9	0.48119	T	0.1	.	5.4755	0.16694	0.0:0.0:0.2953:0.7047	.	1353;1268	Q9BXX2;F8WAG3	AN30B_HUMAN;.	Q	1268;662;688	ENSP00000351875:R1268Q	ENSP00000277669:R688Q	R	+	2	0	ANKRD30B	14842103	0.006000	0.16342	0.011000	0.14972	0.009000	0.06853	1.487000	0.35540	0.022000	0.15160	0.173000	0.16961	CGA		0.388	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029		7	32	0	0	0	0	7	32				
ROCK1	6093	broad.mit.edu	37	18	18600198	18600198	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr18:18600198C>A	ENST00000399799.2	-	12	2215	c.1275G>T	c.(1273-1275)caG>caT	p.Q425H		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	425	Interaction with FHOD1.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					GCAAACTTTCCTGCTTTAATT	0.269																																						uc002kte.2		NA																	0				lung(2)|breast(2)|central_nervous_system(1)	5						c.(1273-1275)CAG>CAT		Rho-associated, coiled-coil containing protein							63.0	57.0	59.0					18																	18600198		2202	4292	6494	SO:0001583	missense	6093				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity	g.chr18:18600198C>A		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.1275G>T	18.37:g.18600198C>A	ENSP00000382697:p.Gln425His		Somatic					p.Q425H	NM_005406	NP_005397	WXS	Illumina HiSeq	Unspecified	Q13464	ROCK1_HUMAN			12	2216	-	Melanoma(1;0.165)		425			Interaction with FHOD1.|Potential.		B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	37	c.1275G>T	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	C	14.32	2.500321	0.44455	.	.	ENSG00000067900	ENST00000399799	T	0.68025	-0.3	5.8	3.05	0.35203	.	0.231806	0.37530	N	0.002055	T	0.49012	0.1532	N	0.22421	0.69	0.37788	D	0.927276	B	0.02656	0.0	B	0.04013	0.001	T	0.45833	-0.9234	10	0.41790	T	0.15	.	9.1098	0.36720	0.0:0.7762:0.0:0.2238	.	425	Q13464	ROCK1_HUMAN	H	425	ENSP00000382697:Q425H	ENSP00000382697:Q425H	Q	-	3	2	ROCK1	16854196	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.650000	0.37292	0.793000	0.33875	0.563000	0.77884	CAG		0.269	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406		21	48	1	0	7.45e-12	9.03e-12	21	48				
NPC1	4864	broad.mit.edu	37	18	21124402	21124402	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr18:21124402C>A	ENST00000269228.5	-	13	2590	c.2036G>T	c.(2035-2037)gGg>gTg	p.G679V	NPC1_ENST00000540608.1_5'UTR|NPC1_ENST00000412552.2_Missense_Mutation_p.G361V	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	679	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CAAGGGCAACCCAATGTAGCT	0.547																																						uc002kum.3		NA																	0				ovary(2)	2						c.(2035-2037)GGG>GTG		Niemann-Pick disease, type C1 precursor							146.0	110.0	122.0					18																	21124402		2203	4300	6503	SO:0001583	missense	4864				autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity	g.chr18:21124402C>A	AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.2036G>T	18.37:g.21124402C>A	ENSP00000269228:p.Gly679Val		Somatic				NPC1_uc010xaz.1_Missense_Mutation_p.G412V|NPC1_uc010xba.1_Missense_Mutation_p.G524V	p.G679V	NM_000271	NP_000262	WXS	Illumina HiSeq	Unspecified	O15118	NPC1_HUMAN			13	2310	-	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)		679			SSD.|Helical; (Potential).		B4DET3|Q9P130	Missense_Mutation	SNP	ENST00000269228.5	37	c.2036G>T	CCDS11878.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.759461	0.89932	.	.	ENSG00000141458	ENST00000269228;ENST00000412552;ENST00000540608	D;D	0.95069	-3.6;-3.6	5.85	5.85	0.93711	Sterol-sensing domain (1);	0.000000	0.85682	D	0.000000	D	0.98381	0.9462	H	0.96518	3.835	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	D	0.98939	1.0790	10	0.87932	D	0	-24.8908	20.1634	0.98142	0.0:1.0:0.0:0.0	.	690;679	Q59GR1;O15118	.;NPC1_HUMAN	V	679;361;524	ENSP00000269228:G679V;ENSP00000408606:G361V	ENSP00000269228:G679V	G	-	2	0	NPC1	19378400	1.000000	0.71417	0.916000	0.36221	0.650000	0.38633	7.813000	0.86123	2.773000	0.95371	0.655000	0.94253	GGG		0.547	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254823.2	NM_000271		161	53	1	0	1.12e-49	1.65e-49	161	53				
ASXL3	80816	broad.mit.edu	37	18	31318971	31318971	+	Missense_Mutation	SNP	G	G	A	rs369560043		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr18:31318971G>A	ENST00000269197.5	+	11	1603	c.1603G>A	c.(1603-1605)Gat>Aat	p.D535N		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	535					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AGTTGTTATCGATCAGTTAGA	0.393																																						uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(1603-1605)GAT>AAT		additional sex combs like 3		G	ASN/ASP	0,3886		0,0,1943	95.0	89.0	91.0		1603	5.5	1.0	18		91	1,8297		0,1,4148	no	missense	ASXL3	NM_030632.1	23	0,1,6091	AA,AG,GG		0.0121,0.0,0.0082	probably-damaging	535/2249	31318971	1,12183	1943	4149	6092	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31318971G>A	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.1603G>A	18.37:g.31318971G>A	ENSP00000269197:p.Asp535Asn		Somatic				ASXL3_uc002kxq.2_Missense_Mutation_p.D242N	p.D535N	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			11	1658	+			535					Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.1603G>A	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.722535	0.30503	0.0	1.21E-4	ENSG00000141431	ENST00000269197	T	0.18174	2.23	5.47	5.47	0.80525	.	0.065413	0.64402	D	0.000007	T	0.15912	0.0383	L	0.47716	1.5	0.35149	D	0.769595	P	0.34662	0.462	B	0.21917	0.037	T	0.14172	-1.0482	10	0.30854	T	0.27	.	17.8761	0.88825	0.0:0.0:1.0:0.0	.	535	Q9C0F0	ASXL3_HUMAN	N	535	ENSP00000269197:D535N	ENSP00000269197:D535N	D	+	1	0	ASXL3	29572969	1.000000	0.71417	0.996000	0.52242	0.583000	0.36354	5.080000	0.64437	2.729000	0.93468	0.467000	0.42956	GAT		0.393	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			14	57	0	0	0	0	14	57				
ASXL3	80816	broad.mit.edu	37	18	31326256	31326256	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr18:31326256G>T	ENST00000269197.5	+	12	6444	c.6444G>T	c.(6442-6444)caG>caT	p.Q2148H		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	2148					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AGCAACAACAGCAGCTCTGTG	0.433																																						uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(6442-6444)CAG>CAT		additional sex combs like 3							118.0	125.0	122.0					18																	31326256		1922	4134	6056	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31326256G>T	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.6444G>T	18.37:g.31326256G>T	ENSP00000269197:p.Gln2148His		Somatic				ASXL3_uc002kxq.2_Missense_Mutation_p.Q1855H	p.Q2148H	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			12	6499	+			2148					Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.6444G>T	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876535	0.51801	.	.	ENSG00000141431	ENST00000269197	T	0.22134	1.97	6.17	3.41	0.39046	.	.	.	.	.	T	0.24005	0.0581	N	0.24115	0.695	0.36474	D	0.86746	D	0.61080	0.989	P	0.55667	0.781	T	0.16719	-1.0393	9	0.56958	D	0.05	.	11.1429	0.48413	0.2013:0.0:0.7987:0.0	.	2148	Q9C0F0	ASXL3_HUMAN	H	2148	ENSP00000269197:Q2148H	ENSP00000269197:Q2148H	Q	+	3	2	ASXL3	29580254	1.000000	0.71417	0.993000	0.49108	0.992000	0.81027	1.772000	0.38552	0.920000	0.36970	0.655000	0.94253	CAG		0.433	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			225	117	1	0	1.76e-104	2.66e-104	225	117				
SYT4	6860	broad.mit.edu	37	18	40850486	40850486	+	Silent	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr18:40850486G>T	ENST00000255224.3	-	4	1466	c.1098C>A	c.(1096-1098)ggC>ggA	p.G366G	SYT4_ENST00000586678.1_5'UTR|SYT4_ENST00000590752.1_Silent_p.G348G	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	366	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						TATCTTCAAGGCCCTCACAAG	0.433																																					NSCLC(85;81 1419 2855 22820 35912)	uc002law.2		NA																	0				skin(5)	5						c.(1096-1098)GGC>GGA		synaptotagmin IV							97.0	98.0	98.0					18																	40850486		2203	4300	6503	SO:0001819	synonymous_variant	6860					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity	g.chr18:40850486G>T	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.1098C>A	18.37:g.40850486G>T			Somatic				SYT4_uc010dng.2_RNA|SYT4_uc010xcm.1_Silent_p.G348G|SYT4_uc010dnh.2_RNA	p.G366G	NM_020783	NP_065834	WXS	Illumina HiSeq	Unspecified	Q9H2B2	SYT4_HUMAN			4	1467	-			366			C2 2.|Cytoplasmic (Potential).		B4DEU3|Q9P2K4	Silent	SNP	ENST00000255224.3	37	c.1098C>A	CCDS11922.1																																																																																				0.433	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783		54	35	1	0	1.67e-32	2.36e-32	54	35				
CDC34	997	broad.mit.edu	37	19	532007	532007	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:532007G>A	ENST00000215574.4	+	1	294	c.76G>A	c.(76-78)Gag>Aag	p.E26K		NM_004359.1	NP_004350.1	P49427	UB2R1_HUMAN	cell division cycle 34	26					cellular protein modification process (GO:0006464)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of inclusion body assembly (GO:0090261)|positive regulation of neuron apoptotic process (GO:0043525)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|response to growth factor (GO:0070848)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(1)	2		all_cancers(10;1.94e-35)|all_epithelial(18;5.94e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGAGCCGGTCGAGGGATTCCG	0.672																																						uc002lov.2		NA																	0					0						c.(76-78)GAG>AAG		ubiquitin-conjugating enzyme Cdc34							47.0	41.0	43.0					19																	532007		2187	4294	6481	SO:0001583	missense	997				DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|negative regulation of cAMP-mediated signaling|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination	cytoplasm|nucleus	ATP binding|protein binding|ubiquitin-protein ligase activity	g.chr19:532007G>A	L22005	CCDS12030.1	19p13.3	2013-01-17	2013-01-17					"""Ubiquitin-conjugating enzymes E2"""	1734	protein-coding gene	gene with protein product		116948	"""cell division cycle 34"", ""cell division cycle 34 homolog (S. cerevisiae)"""			8248134, 16210246	Standard	NM_004359		Approved	E2-CDC34, UBE2R1, UBC3	uc002lov.3	P49427		ENST00000215574.4:c.76G>A	19.37:g.532007G>A	ENSP00000215574:p.Glu26Lys		Somatic					p.E26K	NM_004359	NP_004350	WXS	Illumina HiSeq	Unspecified	P49427	UB2R1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	1	275	+		all_cancers(10;1.94e-35)|all_epithelial(18;5.94e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)	26					A8K689	Missense_Mutation	SNP	ENST00000215574.4	37	c.76G>A	CCDS12030.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.483025	0.84747	.	.	ENSG00000099804	ENST00000215574	T	0.37915	1.17	3.87	3.87	0.44632	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	U	0.000000	T	0.57917	0.2086	M	0.66506	2.035	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.64466	-0.6401	10	0.87932	D	0	.	15.2116	0.73227	0.0:0.0:1.0:0.0	.	26	P49427	UB2R1_HUMAN	K	26	ENSP00000215574:E26K	ENSP00000215574:E26K	E	+	1	0	CDC34	483007	1.000000	0.71417	0.305000	0.25099	0.360000	0.29518	8.472000	0.90407	1.878000	0.54408	0.306000	0.20318	GAG		0.672	CDC34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451889.2	NM_004359		3	3	0	0	0	0	3	3				
UBXN6	80700	broad.mit.edu	37	19	4454069	4454069	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:4454069C>A	ENST00000301281.6	-	2	229	c.105G>T	c.(103-105)aaG>aaT	p.K35N	CTB-50L17.9_ENST00000592034.1_RNA|UBXN6_ENST00000394765.3_5'UTR	NM_025241.2	NP_079517.1	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6	35						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	12						GCTGGTTGGGCTTCTCTTTGT	0.657																																						uc002man.1		NA																	0					0						c.(103-105)AAG>AAT		UBX domain protein 6							104.0	121.0	115.0					19																	4454069		2203	4300	6503	SO:0001583	missense	80700					microtubule organizing center|nucleus	protein binding	g.chr19:4454069C>A	AF272893	CCDS12129.1, CCDS54201.1	19p13	2008-07-25	2008-07-25	2008-07-25		ENSG00000167671		"""UBX domain containing"""	14928	protein-coding gene	gene with protein product		611946	"""UBX domain-containing 1"", ""UBX domain containing 1"""	UBXD1		11342112	Standard	NM_025241		Approved	UBXDC2	uc002man.2	Q9BZV1		ENST00000301281.6:c.105G>T	19.37:g.4454069C>A	ENSP00000301281:p.Lys35Asn		Somatic				UBXN6_uc010dty.1_5'UTR|UBXN6_uc002mam.1_5'UTR	p.K35N	NM_025241	NP_079517	WXS	Illumina HiSeq	Unspecified	Q9BZV1	UBXN6_HUMAN			2	201	-			35					D6W626|Q96AH1|Q96IK9|Q9BZV0	Missense_Mutation	SNP	ENST00000301281.6	37	c.105G>T	CCDS12129.1	.	.	.	.	.	.	.	.	.	.	C	10.47	1.359747	0.24598	.	.	ENSG00000167671	ENST00000301281	T	0.48836	0.8	4.13	-2.4	0.06583	.	0.571460	0.16252	N	0.222644	T	0.36991	0.0987	L	0.56769	1.78	0.09310	N	0.999998	P	0.35656	0.514	B	0.32090	0.14	T	0.24476	-1.0159	10	0.48119	T	0.1	-26.459	9.5971	0.39580	0.0:0.481:0.0:0.519	.	35	Q9BZV1	UBXN6_HUMAN	N	35	ENSP00000301281:K35N	ENSP00000301281:K35N	K	-	3	2	UBXN6	4405069	0.083000	0.21467	0.000000	0.03702	0.001000	0.01503	0.574000	0.23714	-0.362000	0.08113	-0.678000	0.03780	AAG		0.657	UBXN6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458447.3	NM_025241		143	34	1	0	3.37e-63	5.05e-63	143	34				
MUC16	94025	broad.mit.edu	37	19	9071035	9071035	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:9071035T>C	ENST00000397910.4	-	3	16614	c.16411A>G	c.(16411-16413)Atc>Gtc	p.I5471V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5473	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTCTGAGAGATATTAGGAGTT	0.507																																						uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(16411-16413)ATC>GTC		mucin 16							134.0	132.0	133.0					19																	9071035		2025	4180	6205	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9071035T>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16411A>G	19.37:g.9071035T>C	ENSP00000381008:p.Ile5471Val		Somatic					p.I5471V	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	16615	-			5473			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.16411A>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	1.396	-0.579462	0.03854	.	.	ENSG00000181143	ENST00000397910	T	0.21543	2.0	2.06	-4.12	0.03916	.	.	.	.	.	T	0.08358	0.0208	N	0.08118	0	.	.	.	B	0.19073	0.033	B	0.14023	0.01	T	0.26155	-1.0111	8	0.87932	D	0	.	2.9191	0.05762	0.4027:0.0:0.258:0.3393	.	5471	B5ME49	.	V	5471	ENSP00000381008:I5471V	ENSP00000381008:I5471V	I	-	1	0	MUC16	8932035	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.209000	0.09358	-1.803000	0.01242	-0.848000	0.03037	ATC		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		140	21	0	0	0	0	140	21				
CYP4F12	66002	broad.mit.edu	37	19	15807871	15807871	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:15807871G>A	ENST00000550308.1	+	13	1931	c.1551G>A	c.(1549-1551)gaG>gaA	p.E517E	CYP4F12_ENST00000324632.10_Silent_p.E517E	NM_023944.3	NP_076433	Q9HCS2	CP4FC_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 12	517					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|leukotriene B4 catabolic process (GO:0036101)|long-chain fatty acid metabolic process (GO:0001676)|negative regulation of blood coagulation (GO:0030195)|oxidation-reduction process (GO:0055114)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|very long-chain fatty acid metabolic process (GO:0000038)|vitamin E metabolic process (GO:0042360)|vitamin K biosynthetic process (GO:0042371)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)			NS(1)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	41	Acute lymphoblastic leukemia(2;0.0367)				Fingolimod(DB08868)	TGCGGGTGGAGCCCCTGAATG	0.567																																						uc002nbl.2		NA																	0				skin(3)|ovary(2)|central_nervous_system(2)	7						c.(1549-1551)GAG>GAA		cytochrome P450, family 4, subfamily F,							60.0	65.0	63.0					19																	15807871		2185	4298	6483	SO:0001819	synonymous_variant	66002							g.chr19:15807871G>A	AB035130	CCDS42517.1	19p13.1	2008-02-05	2003-01-14		ENSG00000186204	ENSG00000186204		"""Cytochrome P450s"""	18857	protein-coding gene	gene with protein product		611485	"""cytochrome P450, subfamily IVF, polypeptide 12"""			11162607	Standard	NM_023944		Approved		uc002nbl.3	Q9HCS2	OTTHUMG00000164477	ENST00000550308.1:c.1551G>A	19.37:g.15807871G>A			Somatic					p.E517E	NM_023944	NP_076433	WXS	Illumina HiSeq	Unspecified					13	1612	+	Acute lymphoblastic leukemia(2;0.0367)							E7ET51|O60389|Q5JPJ7|Q9HCS1	Silent	SNP	ENST00000550308.1	37	c.1551G>A	CCDS42517.1																																																																																				0.567	CYP4F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378938.9			45	81	0	0	0	0	45	81				
ISYNA1	51477	broad.mit.edu	37	19	18545774	18545774	+	Silent	SNP	G	G	A	rs564672040		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:18545774G>A	ENST00000338128.8	-	11	1843	c.1626C>T	c.(1624-1626)acC>acT	p.T542T	ISYNA1_ENST00000545187.1_Silent_p.T392T|ISYNA1_ENST00000578963.1_Silent_p.T414T|ISYNA1_ENST00000317018.6_Silent_p.T340T|ISYNA1_ENST00000457269.4_Silent_p.T488T	NM_001170938.1|NM_016368.4	NP_001164409.1|NP_057452.1	Q9NPH2	INO1_HUMAN	inositol-3-phosphate synthase 1	542					inositol biosynthetic process (GO:0006021)|inositol phosphate metabolic process (GO:0043647)|phospholipid biosynthetic process (GO:0008654)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-3-phosphate synthase activity (GO:0004512)			breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	12						TGGCATCACCGGTGCAGCCAT	0.647													G|||	1	0.000199681	0.0	0.0	5008	,	,		14590	0.0		0.0	False		,,,				2504	0.001					uc002njd.1		NA																	0				ovary(1)|pancreas(1)	2						c.(1624-1626)ACC>ACT		inositol-3-phosphate synthase 1							54.0	59.0	57.0					19																	18545774		2203	4300	6503	SO:0001819	synonymous_variant	51477				inositol biosynthetic process|phospholipid biosynthetic process	cytoplasm	binding|inositol-3-phosphate synthase activity	g.chr19:18545774G>A		CCDS12379.1, CCDS54234.1, CCDS62603.1	19p13.11	2014-09-04			ENSG00000105655	ENSG00000105655	5.5.1.4		29821	protein-coding gene	gene with protein product	"""myo-inositol 1-phosphate synthase"""	611670				15024000, 12941308	Standard	NM_016368		Approved	Ino1, INOS, IPS	uc002njd.2	Q9NPH2	OTTHUMG00000179027	ENST00000338128.8:c.1626C>T	19.37:g.18545774G>A			Somatic				ISYNA1_uc002nja.1_Silent_p.T414T|ISYNA1_uc002njb.1_Silent_p.T460T|ISYNA1_uc002njc.1_Silent_p.T392T|ISYNA1_uc010xqh.1_Silent_p.T340T|ISYNA1_uc002nje.1_Silent_p.T488T|ISYNA1_uc002njf.1_Silent_p.T392T	p.T542T	NM_016368	NP_057452	WXS	Illumina HiSeq	Unspecified	Q9NPH2	INO1_HUMAN			11	1676	-			542					B3KRT1|G5E9U0|Q6NXT5|Q7Z525|Q9BT65|Q9H2Y2|Q9NSU0|Q9NVW7	Silent	SNP	ENST00000338128.8	37	c.1626C>T	CCDS12379.1																																																																																				0.647	ISYNA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444469.2	NM_016368		4	142	0	0	0	0	4	142				
ZNF208	7757	broad.mit.edu	37	19	22155761	22155761	+	Missense_Mutation	SNP	G	G	T	rs372192464		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:22155761G>T	ENST00000397126.4	-	4	2223	c.2075C>A	c.(2074-2076)cCc>cAc	p.P692H	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	692					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ACATTTGTAGGGTTTCTCTCC	0.383																																						uc002nqp.2		NA																	0				ovary(5)|skin(2)	7						c.(1774-1776)CCC>CAC		zinc finger protein 208							37.0	38.0	38.0					19																	22155761		1996	4187	6183	SO:0001583	missense	7757							g.chr19:22155761G>T	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2075C>A	19.37:g.22155761G>T	ENSP00000380315:p.Pro692His		Somatic				ZNF208_uc002nqo.1_Intron	p.P592H	NM_007153	NP_009084	WXS	Illumina HiSeq	Unspecified					5	1924	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Missense_Mutation	SNP	ENST00000397126.4	37	c.1775C>A	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.152400	0.38021	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.17528	2.27	2.43	-0.0799	0.13708	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34019	0.0883	.	.	.	0.27150	N	0.961431	D	0.89917	1.0	D	0.97110	1.0	T	0.15607	-1.0431	8	0.87932	D	0	.	4.8766	0.13658	0.13:0.0:0.6619:0.2081	.	592	O43345	ZN208_HUMAN	H	692;592	ENSP00000380315:P692H	ENSP00000380315:P692H	P	-	2	0	ZNF208	21947601	0.948000	0.32251	0.019000	0.16419	0.170000	0.22686	2.386000	0.44380	-0.451000	0.07097	0.280000	0.19369	CCC		0.383	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		47	99	1	0	4.33e-22	5.81e-22	47	99				
ZNF98	148198	broad.mit.edu	37	19	22574982	22574982	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:22574982C>T	ENST00000357774.5	-	4	1176	c.1055G>A	c.(1054-1056)tGt>tAt	p.C352Y		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	352					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				ACATTCTTCACATTTGTAGAA	0.393																																						uc002nqt.2		NA																	0				ovary(1)|skin(1)	2						c.(1054-1056)TGT>TAT		zinc finger protein 98							26.0	24.0	24.0					19																	22574982		2093	4227	6320	SO:0001583	missense	148198				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22574982C>T		CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.1055G>A	19.37:g.22574982C>T	ENSP00000350418:p.Cys352Tyr		Somatic					p.C352Y	NM_001098626	NP_001092096	WXS	Illumina HiSeq	Unspecified	A6NK75	ZNF98_HUMAN			4	1177	-		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)	352			C2H2-type 7.			Missense_Mutation	SNP	ENST00000357774.5	37	c.1055G>A	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	13.59	2.281474	0.40394	.	.	ENSG00000197360	ENST00000357774	D	0.85088	-1.94	1.28	1.28	0.21552	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94032	0.8088	H	0.97315	3.98	0.37600	D	0.92053	D	0.89917	1.0	D	0.97110	1.0	D	0.93915	0.7200	9	0.72032	D	0.01	.	9.428	0.38592	0.0:1.0:0.0:0.0	.	352	A6NK75	ZNF98_HUMAN	Y	352	ENSP00000350418:C352Y	ENSP00000350418:C352Y	C	-	2	0	ZNF98	22366822	0.997000	0.39634	0.025000	0.17156	0.049000	0.14656	5.355000	0.66046	0.676000	0.31285	0.305000	0.20034	TGT		0.393	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626		14	38	0	0	0	0	14	38				
ZNF99	7652	broad.mit.edu	37	19	22941189	22941189	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:22941189G>T	ENST00000596209.1	-	4	1612	c.1522C>A	c.(1522-1524)Cct>Act	p.P508T	ZNF99_ENST00000397104.3_Missense_Mutation_p.P417T	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	508					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CATTTGCAAGGTTTCTCTTCC	0.353																																						uc010xrh.1		NA																	0				ovary(1)|skin(1)	2						c.(1249-1251)CCT>ACT		zinc finger protein 99							43.0	45.0	45.0					19																	22941189		2069	4222	6291	SO:0001583	missense	7652							g.chr19:22941189G>T	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1522C>A	19.37:g.22941189G>T	ENSP00000472969:p.Pro508Thr		Somatic					p.P417T	NM_001080409	NP_001073878	WXS	Illumina HiSeq	Unspecified					5	1249	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)						M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	c.1249C>A	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	-	10.11	1.259124	0.23051	.	.	ENSG00000213973	ENST00000397104	T	0.24350	1.86	1.16	1.16	0.20824	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43299	0.1241	M	0.75615	2.305	0.33030	D	0.530057	D	0.63046	0.992	P	0.60682	0.878	T	0.57522	-0.7797	9	0.87932	D	0	.	9.2264	0.37410	0.0:0.0:1.0:0.0	.	417	A8MXY4	ZNF99_HUMAN	T	417	ENSP00000380293:P417T	ENSP00000380293:P417T	P	-	1	0	ZNF99	22733029	0.258000	0.24033	0.006000	0.13384	0.091000	0.18340	1.416000	0.34759	0.597000	0.29811	0.194000	0.17425	CCT		0.353	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124		50	65	1	0	7.05e-20	9.31e-20	50	65				
CCNE1	898	broad.mit.edu	37	19	30312979	30312979	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:30312979A>G	ENST00000262643.3	+	9	1061	c.782A>G	c.(781-783)gAc>gGc	p.D261G	CCNE1_ENST00000444983.2_Missense_Mutation_p.D246G|CCNE1_ENST00000357943.5_Missense_Mutation_p.D218G	NM_001238.2	NP_001229.1	P24864	CCNE1_HUMAN	cyclin E1	261					androgen receptor signaling pathway (GO:0030521)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|Wnt signaling pathway (GO:0016055)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|skin(1)	20	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			TATCTAAATGACTTACATGAA	0.473			A		serous ovarian																																	uc002nsn.2		NA		Dom	yes		19	19q12	898		cyclin E1			E					0				lung(2)	2						c.(781-783)GAC>GGC		cyclin E1 isoform 1							158.0	150.0	153.0					19																	30312979		2203	4300	6503	SO:0001583	missense	898				androgen receptor signaling pathway|cell division|positive regulation of transcription, DNA-dependent|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm	androgen receptor binding|protein kinase binding|transcription coactivator activity	g.chr19:30312979A>G	M73812	CCDS12419.1	19q12	2014-07-03			ENSG00000105173	ENSG00000105173			1589	protein-coding gene	gene with protein product	"""cyclin Es"", ""cyclin Et"""	123837		CCNE		1833066	Standard	NM_001238		Approved		uc002nsn.3	P24864	OTTHUMG00000177626	ENST00000262643.3:c.782A>G	19.37:g.30312979A>G	ENSP00000262643:p.Asp261Gly		Somatic				CCNE1_uc002nso.2_Missense_Mutation_p.D246G|CCNE1_uc002nsp.2_Missense_Mutation_p.D8G	p.D261G	NM_001238	NP_001229	WXS	Illumina HiSeq	Unspecified	P24864	CCNE1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)		9	965	+	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		261					A8K684|Q14091|Q8NFG1|Q92501|Q9UD21	Missense_Mutation	SNP	ENST00000262643.3	37	c.782A>G	CCDS12419.1	.	.	.	.	.	.	.	.	.	.	A	15.04	2.715942	0.48622	.	.	ENSG00000105173	ENST00000262643;ENST00000357943;ENST00000444983	T;T;T	0.27104	1.69;1.69;1.69	6.08	6.08	0.98989	Cyclin, C-terminal (1);Cyclin-like (1);	0.041887	0.85682	D	0.000000	T	0.31606	0.0802	M	0.65975	2.015	0.58432	D	0.999999	B	0.32396	0.369	B	0.31751	0.135	T	0.06023	-1.0850	10	0.52906	T	0.07	.	15.8323	0.78764	1.0:0.0:0.0:0.0	.	261	P24864	CCNE1_HUMAN	G	261;218;246	ENSP00000262643:D261G;ENSP00000350625:D218G;ENSP00000410179:D246G	ENSP00000262643:D261G	D	+	2	0	CCNE1	35004819	1.000000	0.71417	0.105000	0.21289	0.840000	0.47671	9.332000	0.96446	2.333000	0.79357	0.482000	0.46254	GAC		0.473	CCNE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438138.1	NM_001238		99	120	0	0	0	0	99	120				
SIGLEC9	27180	broad.mit.edu	37	19	51631242	51631242	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:51631242G>T	ENST00000250360.3	+	5	1119	c.1052G>T	c.(1051-1053)gGg>gTg	p.G351V	SIGLEC9_ENST00000440804.3_Missense_Mutation_p.G351V	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	351					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GGGGTGGTCGGGGGAGCTGGA	0.552																																						uc002pvu.2		NA																	0				skin(1)	1						c.(1051-1053)GGG>GTG		sialic acid binding Ig-like lectin 9 precursor							139.0	141.0	140.0					19																	51631242		2203	4300	6503	SO:0001583	missense	27180				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding	g.chr19:51631242G>T	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.1052G>T	19.37:g.51631242G>T	ENSP00000250360:p.Gly351Val		Somatic				SIGLEC9_uc010yct.1_Missense_Mutation_p.G351V	p.G351V	NM_014441	NP_055256	WXS	Illumina HiSeq	Unspecified	Q9Y336	SIGL9_HUMAN		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)	5	1119	+		all_neural(266;0.0529)	351			Helical; (Potential).		Q6GTU4|Q9BYI9	Missense_Mutation	SNP	ENST00000250360.3	37	c.1052G>T	CCDS12825.1	.	.	.	.	.	.	.	.	.	.	.	10.05	1.245541	0.22796	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	T;T	0.12879	2.64;3.58	2.43	-2.16	0.07080	.	3.529040	0.00892	N	0.002243	T	0.27027	0.0662	M	0.72353	2.195	0.09310	N	1	D	0.65815	0.995	P	0.60173	0.87	T	0.38779	-0.9645	10	0.16420	T	0.52	.	4.331	0.11064	0.0:0.208:0.3326:0.4594	.	351	Q9Y336	SIGL9_HUMAN	V	351	ENSP00000413861:G351V;ENSP00000250360:G351V	ENSP00000250360:G351V	G	+	2	0	SIGLEC9	56323054	0.000000	0.05858	0.000000	0.03702	0.176000	0.22953	-0.158000	0.10070	-0.514000	0.06488	0.121000	0.15741	GGG		0.552	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441		83	233	1	0	1.47e-35	2.11e-35	83	233				
ZNF845	91664	broad.mit.edu	37	19	53856114	53856114	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:53856114G>T	ENST00000595091.1	+	5	2405	c.2186G>T	c.(2185-2187)aGt>aTt	p.S729I	ZNF845_ENST00000458035.1_Missense_Mutation_p.S729I			Q96IR2	ZN845_HUMAN	zinc finger protein 845	729				Missing (in Ref. 1; BAG58121). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						AAGGCCTTCAGTCAGAAGTCA	0.418																																						uc010ydv.1		NA																	0					0						c.(2185-2187)AGT>ATT		zinc finger protein 845							68.0	64.0	65.0					19																	53856114		692	1591	2283	SO:0001583	missense	91664				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53856114G>T	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.2186G>T	19.37:g.53856114G>T	ENSP00000470005:p.Ser729Ile		Somatic				ZNF845_uc010ydw.1_Missense_Mutation_p.S729I	p.S729I	NM_138374	NP_612383	WXS	Illumina HiSeq	Unspecified	Q96IR2	ZN845_HUMAN			4	2303	+			729	Missing (in Ref. 1; BAG58121).		C2H2-type 19.			Missense_Mutation	SNP	ENST00000595091.1	37	c.2186G>T	CCDS46170.1	.	.	.	.	.	.	.	.	.	.	G	7.122	0.578122	0.13686	.	.	ENSG00000213799	ENST00000458035	T	0.19938	2.11	2.07	-4.13	0.03904	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24353	0.0590	L	0.43757	1.38	0.09310	N	1	D	0.89917	1.0	D	0.74674	0.984	T	0.16129	-1.0413	9	0.14656	T	0.56	.	2.0004	0.03466	0.2606:0.3194:0.3077:0.1124	.	729	Q96IR2	ZN845_HUMAN	I	729	ENSP00000388311:S729I	ENSP00000388311:S729I	S	+	2	0	ZNF845	58547926	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.990000	0.01479	-0.948000	0.03668	-0.464000	0.05259	AGT		0.418	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908		55	102	1	0	5.39e-20	7.14e-20	55	102				
LAIR1	3903	broad.mit.edu	37	19	54868568	54868568	+	Silent	SNP	C	C	T	rs201544849		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:54868568C>T	ENST00000391742.2	-	5	575	c.423G>A	c.(421-423)acG>acA	p.T141T	LAIR1_ENST00000474878.1_Silent_p.T123T|LAIR1_ENST00000348231.4_Silent_p.T124T|LAIR1_ENST00000434277.2_Silent_p.T140T|LAIR1_ENST00000391743.3_Silent_p.T123T|LAIR1_ENST00000313038.6_Silent_p.T134T|LAIR1_ENST00000463489.1_5'UTR			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	141					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		ACGGCCTCTGCGTGGGTCCTG	0.592																																						uc002qfk.1		NA																	0				ovary(4)	4						c.(421-423)ACG>ACA		leukocyte-associated immunoglobulin-like							71.0	60.0	64.0					19																	54868568		2203	4300	6503	SO:0001819	synonymous_variant	3903					integral to membrane|plasma membrane	protein binding|receptor activity	g.chr19:54868568C>T	AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.423G>A	19.37:g.54868568C>T			Somatic				LAIR1_uc002qfl.1_Silent_p.T124T|LAIR1_uc002qfm.1_Silent_p.T140T|LAIR1_uc002qfn.1_Silent_p.T123T|LAIR1_uc010yex.1_Silent_p.T134T|LAIR1_uc002qfo.2_Silent_p.T123T	p.T141T	NM_002287	NP_002278	WXS	Illumina HiSeq	Unspecified	Q6GTX8	LAIR1_HUMAN		GBM - Glioblastoma multiforme(193;0.0573)	5	733	-	Ovarian(34;0.19)		141			Extracellular (Potential).			Silent	SNP	ENST00000391742.2	37	c.423G>A	CCDS12891.1																																																																																				0.592	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140506.1			14	19	0	0	0	0	14	19				
LILRA2	11027	broad.mit.edu	37	19	55087544	55087544	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:55087544T>A	ENST00000251377.3	+	7	1356	c.1223T>A	c.(1222-1224)cTc>cAc	p.L408H	LILRA2_ENST00000251376.3_Missense_Mutation_p.L408H|LILRA2_ENST00000391737.1_Missense_Mutation_p.L396H|LILRA2_ENST00000391738.3_Missense_Mutation_p.L408H|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396321.2_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	408	Ig-like C2-type 4.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CTGCTGTCTCTCCCCAGTGAC	0.622																																						uc002qgg.3		NA																	0				ovary(1)	1						c.(1222-1224)CTC>CAC		leukocyte immunoglobulin-like receptor,							102.0	91.0	94.0					19																	55087544		2203	4300	6503	SO:0001583	missense	11027				defense response	integral to membrane	antigen binding|receptor activity	g.chr19:55087544T>A	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.1223T>A	19.37:g.55087544T>A	ENSP00000251377:p.Leu408His		Somatic				LILRA2_uc010ern.2_Missense_Mutation_p.L408H|LILRA2_uc002qgf.2_Missense_Mutation_p.L408H|LILRA2_uc010yfe.1_Missense_Mutation_p.L408H|LILRA2_uc010yff.1_Missense_Mutation_p.L396H|LILRA2_uc010ero.2_Missense_Mutation_p.L396H|LILRA2_uc010yfg.1_Intron	p.L408H	NM_001130917	NP_001124389	WXS	Illumina HiSeq	Unspecified	Q8N149	LIRA2_HUMAN		GBM - Glioblastoma multiforme(193;0.0963)	6	1312	+			408			Ig-like C2-type 4.|Extracellular (Potential).		O75020	Missense_Mutation	SNP	ENST00000251377.3	37	c.1223T>A	CCDS46179.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.443375	0.00178	.	.	ENSG00000239998	ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	T;T;T;T	0.00745	5.75;5.75;5.75;5.75	2.42	-4.84	0.03151	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	5.648040	0.00550	N	0.000251	T	0.00328	0.0010	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.44019	-0.9355	10	0.02654	T	1	.	3.4401	0.07460	0.2113:0.0:0.2665:0.5222	.	396;408;408	A8MZH0;Q8N149;Q8N149-2	.;LIRA2_HUMAN;.	H	408;408;408;396	ENSP00000251377:L408H;ENSP00000375618:L408H;ENSP00000251376:L408H;ENSP00000375617:L396H	ENSP00000251376:L408H	L	+	2	0	LILRA2	59779356	0.000000	0.05858	0.001000	0.08648	0.026000	0.11368	-7.379000	0.00037	-1.386000	0.02098	-2.157000	0.00329	CTC		0.622	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2			79	114	0	0	0	0	79	114				
LILRA1	11024	broad.mit.edu	37	19	55106644	55106644	+	Silent	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:55106644C>A	ENST00000251372.3	+	5	620	c.438C>A	c.(436-438)gtC>gtA	p.V146V	LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRA1_ENST00000453777.1_Silent_p.V146V|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396321.2_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	146	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		TCCATTGTGTCTCACAGGTGG	0.567																																						uc002qgh.1		NA																	0				skin(2)|ovary(1)	3						c.(436-438)GTC>GTA		leukocyte immunoglobulin-like receptor,							154.0	143.0	147.0					19																	55106644		2203	4300	6503	SO:0001819	synonymous_variant	11024				cell surface receptor linked signaling pathway|defense response|regulation of immune response	integral to membrane|plasma membrane	antigen binding|transmembrane receptor activity	g.chr19:55106644C>A	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.438C>A	19.37:g.55106644C>A			Somatic				LILRA2_uc010yfg.1_Intron|LILRA1_uc010yfh.1_Silent_p.V146V	p.V146V	NM_006863	NP_006854	WXS	Illumina HiSeq	Unspecified	O75019	LIRA1_HUMAN		GBM - Glioblastoma multiforme(193;0.0348)	5	620	+			146			Ig-like C2-type 2.|Extracellular (Potential).		O75018|Q3MJA6	Silent	SNP	ENST00000251372.3	37	c.438C>A	CCDS12901.1																																																																																				0.567	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863		79	110	1	0	1.4e-30	1.96e-30	79	110				
KIR3DL1	3811	broad.mit.edu	37	19	55341657	55341657	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:55341657C>A	ENST00000391728.4	+	9	1295	c.1262C>A	c.(1261-1263)cCc>cAc	p.P421H	KIR3DL1_ENST00000541392.1_Missense_Mutation_p.P404H|KIR3DL1_ENST00000358178.4_Missense_Mutation_p.P326H|KIR3DL1_ENST00000326542.7_Missense_Mutation_p.P404H|KIR3DL1_ENST00000402254.2_Intron|KIR3DL1_ENST00000538269.1_Missense_Mutation_p.P421H|KIR2DS4_ENST00000339924.8_RNA	NM_013289.2	NP_037421.2	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1	421					immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CCCAAGACACCCCCTACAGAT	0.512																																						uc002qhk.3		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5						c.(1261-1263)CCC>CAC		killer cell immunoglobulin-like receptor, three							263.0	250.0	254.0					19																	55341657		2173	4170	6343	SO:0001583	missense	3811				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity	g.chr19:55341657C>A	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000391728.4:c.1262C>A	19.37:g.55341657C>A	ENSP00000375608:p.Pro421His		Somatic				KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Missense_Mutation_p.P346H|KIR3DL1_uc010esf.2_Missense_Mutation_p.P326H|KIR3DL1_uc010yfo.1_Missense_Mutation_p.P363H|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_5'Flank|KIR2DS4_uc002qhm.1_5'Flank	p.P421H	NM_013289	NP_037421	WXS	Illumina HiSeq	Unspecified	P43629	KI3L1_HUMAN		GBM - Glioblastoma multiforme(193;0.0192)	9	1325	+			421			Cytoplasmic (Potential).		O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000391728.4	37	c.1262C>A	CCDS42621.1	.	.	.	.	.	.	.	.	.	.	-	9.558	1.117592	0.20877	.	.	ENSG00000167633	ENST00000538269;ENST00000541392;ENST00000355608;ENST00000391728;ENST00000326542;ENST00000358178	T;T;T;T;T	0.00493	7.18;7.0;7.18;7.0;7.15	0.569	0.569	0.17340	.	.	.	.	.	T	0.02012	0.0063	M	0.93978	3.48	0.09310	N	1	D;D;D	0.76494	0.996;0.999;0.996	D;D;D	0.66196	0.942;0.942;0.942	T	0.22730	-1.0208	8	0.72032	D	0.01	.	.	.	.	.	404;326;421	Q15702;Q14946;P43629	.;.;KI3L1_HUMAN	H	421;404;399;421;404;326	ENSP00000443350:P421H;ENSP00000442355:P404H;ENSP00000375608:P421H;ENSP00000326868:P404H;ENSP00000350901:P326H	ENSP00000326868:P404H	P	+	2	0	KIR3DL1	60033469	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	0.025000	0.13577	0.567000	0.29293	0.184000	0.17185	CCC		0.512	KIR3DL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141238.1	NM_013289		196	35	1	0	2.92e-67	4.38e-67	196	35				
NLRP11	204801	broad.mit.edu	37	19	56300317	56300317	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:56300317G>C	ENST00000589093.1	-	9	2804	c.2711C>G	c.(2710-2712)gCc>gGc	p.A904G	NLRP11_ENST00000589824.2_Missense_Mutation_p.A850G|NLRP11_ENST00000592953.1_Missense_Mutation_p.A805G|NLRP11_ENST00000443188.1_Missense_Mutation_p.A904G|NLRP11_ENST00000360133.3_Missense_Mutation_p.A850G			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	904							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)	p.A904V(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		TCGACAGCAGGCACTGGTTAA	0.458																																						uc010ygf.1		NA																	1	Substitution - Missense(1)		skin(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(2710-2712)GCC>GGC		NLR family, pyrin domain containing 11							122.0	107.0	112.0					19																	56300317		2203	4300	6503	SO:0001583	missense	204801						ATP binding	g.chr19:56300317G>C	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.2711C>G	19.37:g.56300317G>C	ENSP00000466285:p.Ala904Gly		Somatic				NLRP11_uc002qlz.2_Missense_Mutation_p.A751G|NLRP11_uc002qmb.2_Missense_Mutation_p.A805G|NLRP11_uc002qmc.2_RNA	p.A904G	NM_145007	NP_659444	WXS	Illumina HiSeq	Unspecified	P59045	NAL11_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	11	3422	-		Colorectal(82;0.0002)	904					C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	ENST00000589093.1	37	c.2711C>G	CCDS12935.1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.878254	0.33162	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.40756	1.02;1.02	2.91	0.758	0.18432	.	.	.	.	.	T	0.32041	0.0816	L	0.31926	0.97	0.09310	N	1	P;P	0.45044	0.849;0.694	B;P	0.46452	0.411;0.517	T	0.13764	-1.0497	9	0.23891	T	0.37	.	5.023	0.14370	0.2879:0.0:0.7121:0.0	.	904;850	P59045;P59045-2	NAL11_HUMAN;.	G	904;850	ENSP00000409898:A904G;ENSP00000353251:A850G	ENSP00000353251:A850G	A	-	2	0	NLRP11	60992129	0.121000	0.22262	0.002000	0.10522	0.012000	0.07955	0.442000	0.21628	0.283000	0.22279	0.585000	0.79938	GCC		0.458	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007		21	53	0	0	0	0	21	53				
NLRP4	147945	broad.mit.edu	37	19	56390176	56390176	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:56390176T>A	ENST00000301295.6	+	9	3135	c.2713T>A	c.(2713-2715)Tta>Ata	p.L905I	NLRP4_ENST00000346986.5_Missense_Mutation_p.L849I|NLRP4_ENST00000587891.1_Missense_Mutation_p.L830I	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	905					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		AGAATGTGGGTTAACGAGCAC	0.532																																						uc002qmd.3		NA																	0				ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15						c.(2713-2715)TTA>ATA		NLR family, pyrin domain containing 4							113.0	89.0	97.0					19																	56390176		2203	4300	6503	SO:0001583	missense	147945						ATP binding	g.chr19:56390176T>A	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.2713T>A	19.37:g.56390176T>A	ENSP00000301295:p.Leu905Ile		Somatic				NLRP4_uc002qmf.2_Missense_Mutation_p.L830I|NLRP4_uc010etf.2_Missense_Mutation_p.L680I	p.L905I	NM_134444	NP_604393	WXS	Illumina HiSeq	Unspecified	Q96MN2	NALP4_HUMAN		GBM - Glioblastoma multiforme(193;0.0606)	9	3135	+		Colorectal(82;0.0002)|Ovarian(87;0.221)	905					Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	c.2713T>A	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	T	11.35	1.612722	0.28712	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.53423	0.69;0.62	3.92	-6.39	0.01951	.	.	.	.	.	T	0.49338	0.1551	L	0.55834	1.745	0.09310	N	1	D;P;P	0.54397	0.966;0.955;0.925	P;P;B	0.51266	0.664;0.548;0.346	T	0.53927	-0.8369	9	0.31617	T	0.26	.	16.4322	0.83853	0.0:0.778:0.0:0.222	.	849;830;905	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	I	905;849	ENSP00000301295:L905I;ENSP00000344787:L849I	ENSP00000301295:L905I	L	+	1	2	NLRP4	61081988	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.031000	0.03578	-1.616000	0.01572	-0.361000	0.07541	TTA		0.532	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444		17	20	0	0	0	0	17	20				
NLRP5	126206	broad.mit.edu	37	19	56539074	56539074	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:56539074C>A	ENST00000390649.3	+	7	1475	c.1475C>A	c.(1474-1476)gCc>gAc	p.A492D		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	492	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GAGAGCGTCGCCCCCTTCAAC	0.632																																						uc002qmj.2		NA																	0				ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7						c.(1474-1476)GCC>GAC		NACHT, LRR and PYD containing protein 5							31.0	34.0	33.0					19																	56539074		2131	4236	6367	SO:0001583	missense	126206					mitochondrion|nucleolus	ATP binding	g.chr19:56539074C>A	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1475C>A	19.37:g.56539074C>A	ENSP00000375063:p.Ala492Asp		Somatic				NLRP5_uc002qmi.2_Missense_Mutation_p.A473D	p.A492D	NM_153447	NP_703148	WXS	Illumina HiSeq	Unspecified	P59047	NALP5_HUMAN		GBM - Glioblastoma multiforme(193;0.0326)	7	1475	+		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)	492			NACHT.		A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	c.1475C>A	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	C	5.662	0.306727	0.10733	.	.	ENSG00000171487	ENST00000390649	T	0.73681	-0.77	2.66	1.61	0.23674	.	0.939026	0.08727	N	0.902612	T	0.64327	0.2588	L	0.39898	1.24	0.09310	N	1	P	0.43352	0.804	B	0.41860	0.368	T	0.50276	-0.8847	10	0.20519	T	0.43	.	7.5471	0.27772	0.0:0.7337:0.2663:0.0	.	492	P59047	NALP5_HUMAN	D	492	ENSP00000375063:A492D	ENSP00000375063:A492D	A	+	2	0	NLRP5	61230886	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.506000	0.22658	0.681000	0.31386	-0.273000	0.10243	GCC		0.632	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447		26	32	1	0	1.43e-11	1.72e-11	26	32				
ZIM3	114026	broad.mit.edu	37	19	57647166	57647166	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:57647166G>C	ENST00000269834.1	-	5	924	c.539C>G	c.(538-540)tCa>tGa	p.S180*	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	180					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TTGAAGGCGTGACTTTGAACT	0.398																																						uc002qnz.1		NA																	0				pancreas(1)|skin(1)	2						c.(538-540)TCA>TGA		zinc finger, imprinted 3							155.0	149.0	151.0					19																	57647166		2203	4300	6503	SO:0001587	stop_gained	114026				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57647166G>C	AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.539C>G	19.37:g.57647166G>C	ENSP00000269834:p.Ser180*		Somatic					p.S180*	NM_052882	NP_443114	WXS	Illumina HiSeq	Unspecified	Q96PE6	ZIM3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	5	925	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)	180			C2H2-type 1.		Q14CA6	Nonsense_Mutation	SNP	ENST00000269834.1	37	c.539C>G	CCDS33125.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.644196	0.87859	.	.	ENSG00000141946	ENST00000269834	.	.	.	2.08	0.963	0.19649	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	9.7057	0.40214	0.0:0.2168:0.7831:0.0	.	.	.	.	X	180	.	ENSP00000269834:S180X	S	-	2	0	ZIM3	62338978	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.595000	0.24029	0.389000	0.25086	0.313000	0.20887	TCA		0.398	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1			232	171	0	0	0	0	232	171				
ZNF264	9422	broad.mit.edu	37	19	57723577	57723577	+	Missense_Mutation	SNP	A	A	C	rs139216855		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:57723577A>C	ENST00000263095.6	+	4	1526	c.1112A>C	c.(1111-1113)tAt>tCt	p.Y371S	ZNF264_ENST00000536056.1_Missense_Mutation_p.Y371S	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	371					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		GAGAAGCCCTATGAGTGCAGT	0.517																																						uc002qob.2		NA																	0				ovary(2)	2						c.(1111-1113)TAT>TCT		zinc finger protein 264							78.0	84.0	82.0					19																	57723577		2203	4300	6503	SO:0001583	missense	9422				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57723577A>C	AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.1112A>C	19.37:g.57723577A>C	ENSP00000263095:p.Tyr371Ser		Somatic					p.Y371S	NM_003417	NP_003408	WXS	Illumina HiSeq	Unspecified	O43296	ZN264_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)	4	1525	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	371			C2H2-type 7.		A8K8Y9|Q9P1V0	Missense_Mutation	SNP	ENST00000263095.6	37	c.1112A>C	CCDS33127.1	.	.	.	.	.	.	.	.	.	.	A	14.47	2.543859	0.45280	.	.	ENSG00000083844	ENST00000263095;ENST00000536056	T;T	0.25579	1.79;1.79	2.35	1.26	0.21427	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46054	0.1373	M	0.83312	2.635	0.26344	N	0.977311	D	0.71674	0.998	D	0.63703	0.917	T	0.25984	-1.0116	9	0.87932	D	0	.	5.9761	0.19379	0.5842:0.0:0.0:0.4158	.	371	O43296	ZN264_HUMAN	S	371	ENSP00000263095:Y371S;ENSP00000440376:Y371S	ENSP00000263095:Y371S	Y	+	2	0	ZNF264	62415389	0.006000	0.16342	0.988000	0.46212	0.970000	0.65996	1.230000	0.32612	0.307000	0.22880	0.402000	0.26972	TAT		0.517	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465080.1			52	138	0	0	0	0	52	138				
NTSR2	23620	broad.mit.edu	37	2	11802111	11802111	+	Missense_Mutation	SNP	G	G	A	rs371327070		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:11802111G>A	ENST00000306928.5	-	2	914	c.880C>T	c.(880-882)Cgc>Tgc	p.R294C		NM_012344.3	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	294					cell surface receptor signaling pathway (GO:0007166)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of membrane potential (GO:0042391)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(7)|lung(7)|prostate(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	TGGACGCTGCGCTGGAGGCTG	0.582																																						uc002rbq.3		NA																	0					0						c.(880-882)CGC>TGC		neurotensin receptor 2	Levocabastine(DB01106)	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	64.0	70.0	68.0		880	-0.2	0.0	2		68	0,8600		0,0,4300	no	missense	NTSR2	NM_012344.3	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	294/411	11802111	1,13005	2203	4300	6503	SO:0001583	missense	23620				sensory perception	integral to plasma membrane		g.chr2:11802111G>A	Y10148	CCDS1681.1	2p25.1	2012-08-08			ENSG00000169006	ENSG00000169006		"""GPCR / Class A : Neurotensin receptors"""	8040	protein-coding gene	gene with protein product		605538				8647296, 9851594	Standard	NM_012344		Approved	NTR2	uc002rbq.4	O95665	OTTHUMG00000119083	ENST00000306928.5:c.880C>T	2.37:g.11802111G>A	ENSP00000303686:p.Arg294Cys		Somatic					p.R294C	NM_012344	NP_036476	WXS	Illumina HiSeq	Unspecified	O95665	NTR2_HUMAN		Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	2	954	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		294			Cytoplasmic (Potential).		Q53QQ5|Q57Z87|Q8IY58|Q8TBH6	Missense_Mutation	SNP	ENST00000306928.5	37	c.880C>T	CCDS1681.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.915835	0.52546	2.27E-4	0.0	ENSG00000169006	ENST00000306928	T	0.45276	0.9	4.31	-0.16	0.13375	GPCR, rhodopsin-like superfamily (1);	1.909800	0.02568	N	0.097535	T	0.47875	0.1469	L	0.54965	1.715	0.18873	N	0.999984	D	0.69078	0.997	P	0.48770	0.589	T	0.46133	-0.9213	10	0.72032	D	0.01	-7.5527	8.7853	0.34816	0.0:0.4475:0.3964:0.1561	.	294	O95665	NTR2_HUMAN	C	294	ENSP00000303686:R294C	ENSP00000303686:R294C	R	-	1	0	NTSR2	11719562	0.958000	0.32768	0.010000	0.14722	0.984000	0.73092	0.645000	0.24782	-0.145000	0.11294	0.455000	0.32223	CGC		0.582	NTSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239297.1			82	123	0	0	0	0	82	123				
DPYSL5	56896	broad.mit.edu	37	2	27169818	27169819	+	Silent	DNP	TC	TC	CA	rs373724609		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:27169818_27169819TC>CA	ENST00000288699.6	+	13	1808_1809	c.1650_1651TC>CA	c.(1648-1653)gcTCgg>gcCAgg	p.550_551AR>AR	DPYSL5_ENST00000401478.1_Silent_p.550_551AR>AR	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	550					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGCTTCAGCTCGGATCCTCGC	0.604																																						uc002rhu.3		NA																	0				ovary(2)	2						c.(1648-1653)GCTCGG>GCCAGG		dihydropyrimidinase-like 5																																				SO:0001819	synonymous_variant	56896				axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides	g.chr2:27169818_27169819TC>CA	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	Exception_encountered	2.37:g.27169818_27169819delinsCA			Somatic				DPYSL5_uc002rhv.3_Silent_p.550_551AR>AR	p.550_551AR>AR	NM_020134	NP_064519	WXS	Illumina HiSeq	Unspecified	Q9BPU6	DPYL5_HUMAN			13	1808_1809	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		550_551					Q8TCL6|Q9NQC4|Q9NRY9	Silent	DNP	ENST00000288699.6	37	c.1650_1651TC>CA	CCDS1730.1																																																																																				0.604	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	NM_020134		5	36	0	0	0	0	5	36				
GALNT14	79623	broad.mit.edu	37	2	31167748	31167748	+	Missense_Mutation	SNP	C	C	A	rs201375957		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:31167748C>A	ENST00000349752.5	-	8	1442	c.803G>T	c.(802-804)cGc>cTc	p.R268L	GALNT14_ENST00000420311.2_Missense_Mutation_p.R233L|GALNT14_ENST00000324589.5_Missense_Mutation_p.R273L|GALNT14_ENST00000406653.1_Missense_Mutation_p.R248L|GALNT14_ENST00000486564.1_5'UTR|GALNT14_ENST00000356174.3_Missense_Mutation_p.R235L	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	268					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					GGGGTCCAGGCGCCGAGCCTT	0.587																																						uc002rnr.2		NA																	0				upper_aerodigestive_tract(2)|skin(1)	3						c.(802-804)CGC>CTC		N-acetylgalactosaminyltransferase 14							63.0	63.0	63.0					2																	31167748		2203	4300	6503	SO:0001583	missense	79623					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:31167748C>A	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.803G>T	2.37:g.31167748C>A	ENSP00000288988:p.Arg268Leu		Somatic				GALNT14_uc002rnq.2_Missense_Mutation_p.R248L|GALNT14_uc002rns.2_Missense_Mutation_p.R273L|GALNT14_uc010ymr.1_Missense_Mutation_p.R233L|GALNT14_uc010ezo.1_Missense_Mutation_p.R235L|GALNT14_uc010ezp.1_Intron	p.R268L	NM_024572	NP_078848	WXS	Illumina HiSeq	Unspecified	Q96FL9	GLT14_HUMAN			8	1422	-	Acute lymphoblastic leukemia(172;0.155)		268			Lumenal (Potential).		B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	c.803G>T	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	C	25.8	4.675270	0.88445	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.73225	0.3560	M	0.76433	2.335	0.80722	D	1	D;D;P;D;D	0.71674	0.989;0.996;0.771;0.998;0.997	D;P;B;D;D	0.74023	0.951;0.905;0.419;0.982;0.958	T	0.76719	-0.2856	10	0.87932	D	0	.	18.5157	0.90935	0.0:1.0:0.0:0.0	.	233;235;273;268;248	F5H263;Q96FL9-2;Q96FL9-3;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	L	268;273;248;235;233;235	ENSP00000288988:R268L;ENSP00000314500:R273L;ENSP00000385435:R248L;ENSP00000348497:R235L;ENSP00000415514:R233L;ENSP00000406399:R235L	ENSP00000314500:R273L	R	-	2	0	GALNT14	31021252	1.000000	0.71417	0.998000	0.56505	0.942000	0.58702	4.771000	0.62318	2.544000	0.85801	0.313000	0.20887	CGC		0.587	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572		51	80	1	0	4.96e-28	6.9e-28	51	80				
FAM161A	84140	broad.mit.edu	37	2	62081004	62081004	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:62081004G>T	ENST00000405894.3	-	1	274	c.173C>A	c.(172-174)gCt>gAt	p.A58D	FAM161A_ENST00000404929.1_Missense_Mutation_p.A58D	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	58					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CGATGCCCCAGCGGGCTGAGC	0.682																																						uc010ypo.1		NA																	0				large_intestine(2)|ovary(1)	3						c.(172-174)GCT>GAT		hypothetical protein LOC84140							43.0	43.0	43.0					2																	62081004		1568	3582	5150	SO:0001583	missense	84140				response to stimulus|visual perception	centrosome		g.chr2:62081004G>T		CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.173C>A	2.37:g.62081004G>T	ENSP00000385893:p.Ala58Asp		Somatic				FAM161A_uc002sbm.3_Missense_Mutation_p.A58D|FAM161A_uc002sbn.3_Translation_Start_Site|FAM161A_uc010fcm.1_RNA|FAM161A_uc010fcn.1_Translation_Start_Site	p.A58D	NM_032180	NP_115556	WXS	Illumina HiSeq	Unspecified	Q3B820	F161A_HUMAN			1	275	-			58					B4DJV7|Q9H8R2	Missense_Mutation	SNP	ENST00000405894.3	37	c.173C>A	CCDS42687.2	.	.	.	.	.	.	.	.	.	.	G	16.71	3.198073	0.58126	.	.	ENSG00000170264	ENST00000404929;ENST00000405894	T;T	0.63744	-0.06;-0.06	4.36	2.46	0.29980	.	.	.	.	.	T	0.45458	0.1343	N	0.14661	0.345	0.09310	N	1	P;P	0.39782	0.561;0.688	B;B	0.43103	0.231;0.408	T	0.35871	-0.9771	9	0.87932	D	0	.	4.4417	0.11577	0.1171:0.0:0.635:0.2479	.	58;58	Q3B820;Q3B820-3	F161A_HUMAN;.	D	58	ENSP00000385158:A58D;ENSP00000385893:A58D	ENSP00000303170:A58D	A	-	2	0	FAM161A	61934508	0.007000	0.16637	0.001000	0.08648	0.004000	0.04260	0.886000	0.28241	0.703000	0.31848	0.655000	0.94253	GCT		0.682	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325537.2	NM_032180		22	34	1	0	7.32e-31	1.03e-30	22	34				
CYP26B1	56603	broad.mit.edu	37	2	72361927	72361927	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:72361927T>A	ENST00000001146.2	-	4	1027	c.824A>T	c.(823-825)aAg>aTg	p.K275M	CYP26B1_ENST00000412253.1_Missense_Mutation_p.K84M|CYP26B1_ENST00000546307.1_Missense_Mutation_p.K200M	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	275					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						CCCGTGCTCCTTGCTGCTCTC	0.622																																						uc002sih.1		NA																	0				skin(2)	2						c.(823-825)AAG>ATG		cytochrome P450, family 26, subfamily b,							131.0	105.0	114.0					2																	72361927		2203	4300	6503	SO:0001583	missense	56603				cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding	g.chr2:72361927T>A		CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.824A>T	2.37:g.72361927T>A	ENSP00000001146:p.Lys275Met		Somatic				CYP26B1_uc010yra.1_Missense_Mutation_p.K258M|CYP26B1_uc010yrb.1_Missense_Mutation_p.K200M	p.K275M	NM_019885	NP_063938	WXS	Illumina HiSeq	Unspecified	Q9NR63	CP26B_HUMAN			4	824	-			275					B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Missense_Mutation	SNP	ENST00000001146.2	37	c.824A>T	CCDS1919.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.640680	0.87859	.	.	ENSG00000003137	ENST00000001146;ENST00000412253;ENST00000546307	T;T;T	0.69306	-0.39;-0.39;-0.39	5.02	3.84	0.44239	.	0.000000	0.85682	D	0.000000	T	0.75280	0.3828	M	0.66297	2.02	0.53005	D	0.999969	P;P;P	0.51537	0.946;0.941;0.674	P;P;P	0.61275	0.886;0.84;0.684	T	0.75628	-0.3252	10	0.46703	T	0.11	-30.4642	10.3935	0.44188	0.0:0.0838:0.0:0.9162	.	200;258;275	B7Z2K6;B7Z2P4;Q9NR63	.;.;CP26B_HUMAN	M	275;84;200	ENSP00000001146:K275M;ENSP00000401465:K84M;ENSP00000443304:K200M	ENSP00000001146:K275M	K	-	2	0	CYP26B1	72215435	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.132000	0.64758	2.020000	0.59435	0.482000	0.46254	AAG		0.622	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1	NM_019885		19	43	0	0	0	0	19	43				
LOXL3	84695	broad.mit.edu	37	2	74763560	74763560	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:74763560C>A	ENST00000264094.3	-	6	1022	c.951G>T	c.(949-951)gaG>gaT	p.E317D	LOXL3_ENST00000409986.1_Missense_Mutation_p.E172D|LOXL3_ENST00000393937.2_Missense_Mutation_p.E172D|LOXL3_ENST00000409549.1_Missense_Mutation_p.E317D|LOXL3_ENST00000409249.1_Missense_Mutation_p.E317D	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	317	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						CTACCCGGCCCTCTCCAGGGT	0.622																																						uc002smp.1		NA																	0					0						c.(949-951)GAG>GAT		lysyl oxidase-like 3 precursor							38.0	35.0	36.0					2																	74763560		2202	4300	6502	SO:0001583	missense	84695					extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity	g.chr2:74763560C>A	AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.951G>T	2.37:g.74763560C>A	ENSP00000264094:p.Glu317Asp		Somatic				LOXL3_uc002smo.1_Translation_Start_Site|LOXL3_uc010ffm.1_Missense_Mutation_p.E317D|LOXL3_uc002smq.1_Missense_Mutation_p.E172D|LOXL3_uc010ffn.1_Missense_Mutation_p.E172D	p.E317D	NM_032603	NP_115992	WXS	Illumina HiSeq	Unspecified	P58215	LOXL3_HUMAN			6	1023	-			317			SRCR 3.		D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Missense_Mutation	SNP	ENST00000264094.3	37	c.951G>T	CCDS1953.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.95|17.95	3.514189|3.514189	0.64522|0.64522	.|.	.|.	ENSG00000115318|ENSG00000115318	ENST00000264094;ENST00000409249;ENST00000393937;ENST00000409549;ENST00000409986|ENST00000420535	T;T;T;T;T|.	0.39592|.	1.07;1.07;1.07;1.07;1.07|.	4.9|4.9	3.08|3.08	0.35506|0.35506	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77598|0.77598	0.4154|0.4154	M|M	0.92970|0.92970	3.365|3.365	0.41362|0.41362	D|D	0.987436|0.987436	D;D;D;D|.	0.89917|.	0.998;0.994;1.0;0.992|.	D;D;D;D|.	0.83275|.	0.982;0.973;0.996;0.987|.	T|T	0.77948|0.77948	-0.2396|-0.2396	10|5	0.66056|.	D|.	0.02|.	.|.	6.5088|6.5088	0.22210|0.22210	0.0:0.6992:0.0:0.3008|0.0:0.6992:0.0:0.3008	.|.	172;317;172;317|.	B9A025;E7END4;Q6IPL7;P58215|.	.;.;.;LOXL3_HUMAN|.	D|W	317;317;172;317;172|44	ENSP00000264094:E317D;ENSP00000387103:E317D;ENSP00000377512:E172D;ENSP00000386696:E317D;ENSP00000386545:E172D|.	ENSP00000264094:E317D|.	E|G	-|-	3|1	2|0	LOXL3|LOXL3	74617068|74617068	0.992000|0.992000	0.36948|0.36948	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	0.369000|0.369000	0.20416|0.20416	0.748000|0.748000	0.32831|0.32831	0.563000|0.563000	0.77884|0.77884	GAG|GGG		0.622	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252215.1	NM_032603		33	41	1	0	1.08e-15	1.38e-15	33	41				
LRRTM4	80059	broad.mit.edu	37	2	77745800	77745800	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:77745800A>G	ENST00000409093.1	-	3	1531	c.1195T>C	c.(1195-1197)Ttt>Ctt	p.F399L	LRRTM4_ENST00000409884.1_Missense_Mutation_p.F399L|LRRTM4_ENST00000409088.3_Missense_Mutation_p.F399L|LRRTM4_ENST00000409911.1_Missense_Mutation_p.F400L|LRRTM4_ENST00000409282.1_Missense_Mutation_p.F400L			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	399					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		GGTGTTTCAAAGGTGGATTGG	0.493																																						uc002snr.2		NA																	0				pancreas(3)|ovary(1)	4						c.(1195-1197)TTT>CTT		leucine rich repeat transmembrane neuronal 4							135.0	132.0	133.0					2																	77745800		1892	4111	6003	SO:0001583	missense	80059					integral to membrane		g.chr2:77745800A>G	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1195T>C	2.37:g.77745800A>G	ENSP00000386357:p.Phe399Leu		Somatic				LRRTM4_uc002snq.2_Missense_Mutation_p.F399L|LRRTM4_uc002sns.2_Missense_Mutation_p.F399L|LRRTM4_uc002snt.2_Missense_Mutation_p.F400L	p.F399L	NM_001134745	NP_001128217	WXS	Illumina HiSeq	Unspecified	Q86VH4	LRRT4_HUMAN		Colorectal(11;0.059)	3	1610	-			399			Extracellular (Potential).		Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	c.1195T>C	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	A	0.009	-1.836538	0.00579	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86;-0.86	5.68	1.68	0.24146	.	1.173350	0.05903	N	0.630339	T	0.58075	0.2097	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.37776	-0.9691	10	0.21014	T	0.42	.	9.7083	0.40229	0.3556:0.0:0.6444:0.0	.	400;399;399	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	L	400;399;399;399;400	ENSP00000387228:F400L;ENSP00000387297:F399L;ENSP00000386357:F399L;ENSP00000386236:F399L;ENSP00000386286:F400L	ENSP00000386236:F399L	F	-	1	0	LRRTM4	77599308	0.866000	0.29940	0.068000	0.19968	0.498000	0.33706	1.062000	0.30555	0.017000	0.15025	-0.256000	0.11100	TTT		0.493	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993		37	70	0	0	0	0	37	70				
LRRTM1	347730	broad.mit.edu	37	2	80530391	80530391	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:80530391C>A	ENST00000295057.3	-	2	1210	c.554G>T	c.(553-555)cGc>cTc	p.R185L	CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000361291.4_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.R185L|CTNNA2_ENST00000541047.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	185					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						CTTGAGGCTGCGGCAGTCCTG	0.607										HNSCC(69;0.2)																												uc002sok.1		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(553-555)CGC>CTC		leucine rich repeat transmembrane neuronal 1							59.0	64.0	62.0					2																	80530391		2203	4300	6503	SO:0001583	missense	347730					axon|endoplasmic reticulum membrane|growth cone|integral to membrane		g.chr2:80530391C>A	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.554G>T	2.37:g.80530391C>A	ENSP00000295057:p.Arg185Leu	HNSCC(69;0.2)	Somatic				CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	p.R185L	NM_178839	NP_849161	WXS	Illumina HiSeq	Unspecified	Q86UE6	LRRT1_HUMAN			2	824	-			185			Lumenal (Potential).		A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	c.554G>T	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186419	0.78789	.	.	ENSG00000162951	ENST00000295057;ENST00000409148;ENST00000416268	T;T;T	0.80033	-1.33;-1.33;4.32	4.73	4.73	0.59995	.	0.000000	0.85682	U	0.000000	D	0.86024	0.5834	L	0.45352	1.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85420	0.1142	9	.	.	.	.	17.681	0.88243	0.0:1.0:0.0:0.0	.	185	Q86UE6	LRRT1_HUMAN	L	185	ENSP00000295057:R185L;ENSP00000386646:R185L;ENSP00000415368:R185L	.	R	-	2	0	LRRTM1	80383902	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.814000	0.86154	2.124000	0.65301	0.655000	0.94253	CGC		0.607	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839		41	44	1	0	3.05e-18	3.97e-18	41	44				
LRRTM1	347730	broad.mit.edu	37	2	80530685	80530685	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:80530685C>A	ENST00000295057.3	-	2	916	c.260G>T	c.(259-261)gGg>gTg	p.G87V	CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000361291.4_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.G87V|CTNNA2_ENST00000541047.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	87					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						CTGCATTAACCCCGTGAACTG	0.622										HNSCC(69;0.2)																												uc002sok.1		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(259-261)GGG>GTG		leucine rich repeat transmembrane neuronal 1							102.0	102.0	102.0					2																	80530685		2203	4300	6503	SO:0001583	missense	347730					axon|endoplasmic reticulum membrane|growth cone|integral to membrane		g.chr2:80530685C>A	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.260G>T	2.37:g.80530685C>A	ENSP00000295057:p.Gly87Val	HNSCC(69;0.2)	Somatic				CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	p.G87V	NM_178839	NP_849161	WXS	Illumina HiSeq	Unspecified	Q86UE6	LRRT1_HUMAN			2	530	-			87			Lumenal (Potential).		A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	c.260G>T	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	C	12.68	2.009674	0.35415	.	.	ENSG00000162951	ENST00000295057;ENST00000409148;ENST00000416268;ENST00000452811;ENST00000415098	T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01	4.78	4.78	0.61160	.	0.000000	0.85682	U	0.000000	T	0.82121	0.4968	M	0.88105	2.93	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	D	0.85741	0.1337	9	.	.	.	.	17.8107	0.88614	0.0:1.0:0.0:0.0	.	87	Q86UE6	LRRT1_HUMAN	V	87	ENSP00000295057:G87V;ENSP00000386646:G87V;ENSP00000415368:G87V;ENSP00000389473:G87V;ENSP00000404557:G87V	.	G	-	2	0	LRRTM1	80384196	1.000000	0.71417	1.000000	0.80357	0.007000	0.05969	7.805000	0.86005	2.191000	0.70037	0.543000	0.68304	GGG		0.622	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839		66	112	1	0	9.08e-34	1.29e-33	66	112				
SLC35F5	80255	broad.mit.edu	37	2	114492205	114492205	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:114492205C>A	ENST00000245680.2	-	9	1291	c.878G>T	c.(877-879)gGa>gTa	p.G293V		NM_025181.2	NP_079457.2	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	293	EamA.				transport (GO:0006810)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)	20						AAATCTATCTCCACTGTTACT	0.303																																						uc002tku.1		NA																	0					0						c.(877-879)GGA>GTA		solute carrier family 35, member F5							67.0	67.0	67.0					2																	114492205		2202	4299	6501	SO:0001583	missense	80255				transport	integral to membrane		g.chr2:114492205C>A	AF529364	CCDS2119.1	2q14.1	2013-05-22			ENSG00000115084	ENSG00000115084		"""Solute carriers"""	23617	protein-coding gene	gene with protein product							Standard	XM_005263799		Approved	FLJ22004	uc002tku.1	Q8WV83	OTTHUMG00000131361	ENST00000245680.2:c.878G>T	2.37:g.114492205C>A	ENSP00000245680:p.Gly293Val		Somatic				SLC35F5_uc002tkt.2_RNA	p.G293V	NM_025181	NP_079457	WXS	Illumina HiSeq	Unspecified	Q8WV83	S35F5_HUMAN			9	1302	-			293			DUF6.		Q9H6P8|Q9H7D8	Missense_Mutation	SNP	ENST00000245680.2	37	c.878G>T	CCDS2119.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.09|18.09	3.546607|3.546607	0.65198|0.65198	.|.	.|.	ENSG00000115084|ENSG00000115084	ENST00000245680;ENST00000409106|ENST00000447673	T;T|.	0.76060|.	-0.99;-0.99|.	5.87|5.87	5.0|5.0	0.66597|0.66597	Drug/metabolite transporter (1);|.	0.121410|.	0.56097|.	D|.	0.000023|.	T|T	0.42108|0.42108	0.1188|0.1188	N|N	0.13352|0.13352	0.335|0.335	0.80722|0.80722	D|D	1|1	P|.	0.49307|.	0.922|.	P|.	0.54100|.	0.742|.	T|T	0.31558|0.31558	-0.9939|-0.9939	10|5	0.12430|.	T|.	0.62|.	-15.3647|-15.3647	13.8141|13.8141	0.63281|0.63281	0.0:0.9291:0.0:0.0709|0.0:0.9291:0.0:0.0709	.|.	293|.	Q8WV83|.	S35F5_HUMAN|.	V|C	293;287|42	ENSP00000245680:G293V;ENSP00000386754:G287V|.	ENSP00000245680:G293V|.	G|W	-|-	2|3	0|0	SLC35F5|SLC35F5	114208675|114208675	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.086000|5.086000	0.64474|0.64474	1.626000|1.626000	0.50381|0.50381	0.655000|0.655000	0.94253|0.94253	GGA|TGG		0.303	SLC35F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254150.1	NM_025181		51	43	1	0	3.28e-27	4.55e-27	51	43				
DPP10	57628	broad.mit.edu	37	2	116510867	116510867	+	Silent	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:116510867T>C	ENST00000410059.1	+	11	1548	c.1068T>C	c.(1066-1068)tgT>tgC	p.C356C	DPP10_ENST00000310323.8_Silent_p.C349C|DPP10_ENST00000393147.2_Silent_p.C360C|DPP10_ENST00000409163.1_Silent_p.C306C	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	356						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CAGGTGCTTGTAGTAAAGTGA	0.368																																						uc002tla.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						c.(1066-1068)TGT>TGC		dipeptidyl peptidase 10 isoform long							106.0	98.0	101.0					2																	116510867		2203	4300	6503	SO:0001819	synonymous_variant	57628				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity	g.chr2:116510867T>C	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1068T>C	2.37:g.116510867T>C			Somatic				DPP10_uc002tlb.1_Silent_p.C306C|DPP10_uc002tlc.1_Silent_p.C352C|DPP10_uc002tle.2_Silent_p.C360C|DPP10_uc002tlf.1_Silent_p.C349C	p.C356C	NM_020868	NP_065919	WXS	Illumina HiSeq	Unspecified	Q8N608	DPP10_HUMAN			11	1525	+			356			Extracellular (Potential).		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Silent	SNP	ENST00000410059.1	37	c.1068T>C	CCDS46400.1																																																																																				0.368	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868		29	66	0	0	0	0	29	66				
CNTNAP5	129684	broad.mit.edu	37	2	125192236	125192236	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:125192236G>T	ENST00000431078.1	+	5	1069	c.705G>T	c.(703-705)aaG>aaT	p.K235N		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	235	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		AACTCCAGAAGGGGAGGCTCG	0.532																																						uc002tno.2		NA																	0				ovary(10)	10						c.(703-705)AAG>AAT		contactin associated protein-like 5 precursor							57.0	59.0	58.0					2																	125192236		2077	4213	6290	SO:0001583	missense	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125192236G>T	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.705G>T	2.37:g.125192236G>T	ENSP00000399013:p.Lys235Asn		Somatic				CNTNAP5_uc010flu.2_Missense_Mutation_p.K235N	p.K235N	NM_130773	NP_570129	WXS	Illumina HiSeq	Unspecified	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	5	1069	+			235			Laminin G-like 1.|Extracellular (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	c.705G>T	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	G	11.31	1.601613	0.28534	.	.	ENSG00000155052	ENST00000431078	T	0.78003	-1.14	5.48	-2.12	0.07165	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.125811	0.34178	N	0.004196	T	0.56529	0.1991	L	0.28740	0.885	0.37504	D	0.91689	B	0.11235	0.004	B	0.18263	0.021	T	0.38672	-0.9650	10	0.09590	T	0.72	.	6.6536	0.22975	0.5281:0.0:0.3512:0.1207	.	235	Q8WYK1	CNTP5_HUMAN	N	235	ENSP00000399013:K235N	ENSP00000399013:K235N	K	+	3	2	CNTNAP5	124908706	0.407000	0.25352	0.946000	0.38457	0.854000	0.48673	-0.216000	0.09266	-0.513000	0.06496	0.655000	0.94253	AAG		0.532	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			16	36	1	0	6.5e-13	8.05e-13	16	36				
CNTNAP5	129684	broad.mit.edu	37	2	125284872	125284872	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:125284872C>A	ENST00000431078.1	+	10	1849	c.1485C>A	c.(1483-1485)gaC>gaA	p.D495E		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	495	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GGTGCCCCGACAATCTCACCG	0.448																																						uc002tno.2		NA																	0				ovary(10)	10						c.(1483-1485)GAC>GAA		contactin associated protein-like 5 precursor							96.0	92.0	93.0					2																	125284872		1924	4135	6059	SO:0001583	missense	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125284872C>A	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1485C>A	2.37:g.125284872C>A	ENSP00000399013:p.Asp495Glu		Somatic				CNTNAP5_uc010flu.2_Missense_Mutation_p.D496E	p.D495E	NM_130773	NP_570129	WXS	Illumina HiSeq	Unspecified	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	10	1849	+			495			Laminin G-like 2.|Extracellular (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	c.1485C>A	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.420533	0.25639	.	.	ENSG00000155052	ENST00000431078	T	0.78246	-1.16	5.67	4.75	0.60458	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.48286	D	0.000195	T	0.67202	0.2868	L	0.39692	1.235	0.31867	N	0.620259	P	0.37636	0.603	B	0.41135	0.348	T	0.64584	-0.6373	10	0.09338	T	0.73	.	8.8137	0.34983	0.0:0.7701:0.1519:0.078	.	495	Q8WYK1	CNTP5_HUMAN	E	495	ENSP00000399013:D495E	ENSP00000399013:D495E	D	+	3	2	CNTNAP5	125001342	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.130000	0.31393	2.685000	0.91497	0.650000	0.86243	GAC		0.448	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			23	75	1	0	0.000229342	0.000246257	23	75				
CYP27C1	339761	broad.mit.edu	37	2	127950815	127950815	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:127950815G>T	ENST00000335247.7	-	7	987	c.857C>A	c.(856-858)gCc>gAc	p.A286D	CYP27C1_ENST00000409327.1_Missense_Mutation_p.A286D	NM_001001665.3	NP_001001665.3	Q4G0S4	C27C1_HUMAN	cytochrome P450, family 27, subfamily C, polypeptide 1	286						membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	16	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.071)		GAACTCCTTGGCCCGAGGGAA	0.537																																						uc002tod.2		NA																	0					0						c.(856-858)GCC>GAC		cytochrome P450, family 27, subfamily C,							96.0	91.0	93.0					2																	127950815		2203	4300	6503	SO:0001583	missense	339761					membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen	g.chr2:127950815G>T	AC027142	CCDS33285.1	2q14.3	2008-05-14	2007-05-18		ENSG00000186684	ENSG00000186684		"""Cytochrome P450s"""	33480	protein-coding gene	gene with protein product							Standard	NM_001001665		Approved	FLJ16008	uc002tod.2	Q4G0S4	OTTHUMG00000153400	ENST00000335247.7:c.857C>A	2.37:g.127950815G>T	ENSP00000334128:p.Ala286Asp		Somatic					p.A286D	NM_001001665	NP_001001665	WXS	Illumina HiSeq	Unspecified	Q4G0S4	C27C1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.071)	7	988	-	Colorectal(110;0.1)		286					Q6ZNI7	Missense_Mutation	SNP	ENST00000335247.7	37	c.857C>A	CCDS33285.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.020556	0.35606	.	.	ENSG00000186684	ENST00000335247;ENST00000409327	T;T	0.70869	-0.52;-0.52	4.11	3.2	0.36748	.	0.155910	0.42294	D	0.000737	D	0.83138	0.5189	M	0.88181	2.935	0.09310	N	1	D	0.53151	0.958	P	0.58266	0.836	T	0.77091	-0.2716	10	0.87932	D	0	-11.8731	13.189	0.59700	0.0:0.0:0.8388:0.1612	.	286	Q4G0S4	C27C1_HUMAN	D	286	ENSP00000334128:A286D;ENSP00000387198:A286D	ENSP00000334128:A286D	A	-	2	0	CYP27C1	127667285	0.988000	0.35896	0.222000	0.23844	0.003000	0.03518	6.811000	0.75221	0.804000	0.34136	-0.516000	0.04426	GCC		0.537	CYP27C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331046.1	NM_001001665		81	77	1	0	1.39e-53	2.07e-53	81	77				
LCT	3938	broad.mit.edu	37	2	136564931	136564931	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:136564931C>T	ENST00000264162.2	-	9	3950	c.3940G>A	c.(3940-3942)Gtc>Atc	p.V1314I	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1314	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GACCAGGCGACATACCCTCGA	0.527																																						uc002tuu.1		NA																	0				ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(3940-3942)GTC>ATC		lactase-phlorizin hydrolase preproprotein							132.0	119.0	123.0					2																	136564931		2203	4300	6503	SO:0001583	missense	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136564931C>T	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.3940G>A	2.37:g.136564931C>T	ENSP00000264162:p.Val1314Ile		Somatic					p.V1314I	NM_002299	NP_002290	WXS	Illumina HiSeq	Unspecified	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	9	3951	-			1314			3.|Extracellular (Potential).|4 X approximate repeats.		Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	c.3940G>A	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	C	5.438	0.265922	0.10294	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.50277	0.75	5.87	-1.89	0.07689	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.872746	0.10316	N	0.689338	T	0.19208	0.0461	N	0.04018	-0.295	0.09310	N	1	B	0.10296	0.003	B	0.17722	0.019	T	0.25467	-1.0131	10	0.14656	T	0.56	0.0017	4.6318	0.12506	0.3686:0.431:0.0724:0.128	.	1314	P09848	LPH_HUMAN	I	1314;746	ENSP00000264162:V1314I	ENSP00000264162:V1314I	V	-	1	0	LCT	136281401	0.000000	0.05858	0.008000	0.14137	0.488000	0.33401	-0.091000	0.11146	-0.375000	0.07955	-0.262000	0.10625	GTC		0.527	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		49	23	0	0	0	0	49	23				
LRP1B	53353	broad.mit.edu	37	2	141777503	141777503	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:141777503T>C	ENST00000389484.3	-	12	2929	c.1958A>G	c.(1957-1959)gAt>gGt	p.D653G		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	653					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATTAACTGGATCCACCACAAT	0.333										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(1957-1959)GAT>GGT		low density lipoprotein-related protein 1B							80.0	81.0	81.0					2																	141777503		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141777503T>C	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1958A>G	2.37:g.141777503T>C	ENSP00000374135:p.Asp653Gly	TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Intron	p.D653G	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	12	2930	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	653			Extracellular (Potential).|LDL-receptor class B 6.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.1958A>G	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.820707	0.90873	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.98889	-5.21	5.33	5.33	0.75918	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	U	0.000000	D	0.99321	0.9762	M	0.93720	3.45	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.99191	1.0870	10	0.46703	T	0.11	.	15.5767	0.76397	0.0:0.0:0.0:1.0	.	653	Q9NZR2	LRP1B_HUMAN	G	653;591	ENSP00000374135:D653G	ENSP00000374135:D653G	D	-	2	0	LRP1B	141493973	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.945000	0.87732	2.129000	0.65627	0.455000	0.32223	GAT		0.333	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		49	17	0	0	0	0	49	17				
PSMD14	10213	broad.mit.edu	37	2	162247657	162247657	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:162247657A>G	ENST00000409682.3	+	9	1317	c.613A>G	c.(613-615)Att>Gtt	p.I205V		NM_005805.5	NP_005796.1	O00487	PSDE_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 14	205					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K63-linked deubiquitination (GO:0070536)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, lid subcomplex (GO:0008541)	endopeptidase activator activity (GO:0061133)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|proteasome binding (GO:0070628)|ubiquitin thiolesterase activity (GO:0004221)			breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	12						CTCCATTACTATTAACTATCG	0.249																																						uc002ubu.2		NA																	0				breast(1)	1						c.(613-615)ATT>GTT		proteasome 26S subunit, non-ATPase 14							18.0	17.0	17.0					2																	162247657		1750	3974	5724	SO:0001583	missense	10213				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K63-linked deubiquitination|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of proteasomal protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	endopeptidase activator activity|metal ion binding|metallopeptidase activity|proteasome binding|ubiquitin thiolesterase activity	g.chr2:162247657A>G	U86782	CCDS46437.1	2q14.3	2008-05-22			ENSG00000115233	ENSG00000115233		"""Proteasome (prosome, macropain) subunits"""	16889	protein-coding gene	gene with protein product		607173				9374539	Standard	NM_005805		Approved	POH1, pad1, Rpn11	uc002ubu.3	O00487	OTTHUMG00000153882	ENST00000409682.3:c.613A>G	2.37:g.162247657A>G	ENSP00000386541:p.Ile205Val		Somatic					p.I205V	NM_005805	NP_005796	WXS	Illumina HiSeq	Unspecified	O00487	PSDE_HUMAN			9	1080	+			205					B3KNW2|O00176	Missense_Mutation	SNP	ENST00000409682.3	37	c.613A>G	CCDS46437.1	.	.	.	.	.	.	.	.	.	.	A	16.21	3.059167	0.55325	.	.	ENSG00000115233	ENST00000409682	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.65739	0.2720	M	0.76574	2.34	0.80722	D	1	P	0.36110	0.537	B	0.41135	0.348	T	0.63462	-0.6632	9	0.18710	T	0.47	.	15.3496	0.74373	1.0:0.0:0.0:0.0	.	205	O00487	PSDE_HUMAN	V	205	.	ENSP00000386541:I205V	I	+	1	0	PSMD14	161955903	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.310000	0.96267	2.034000	0.60081	0.482000	0.46254	ATT		0.249	PSMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332833.1	NM_005805		3	2	0	0	0	0	3	2				
IFIH1	64135	broad.mit.edu	37	2	163133239	163133239	+	Silent	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:163133239C>G	ENST00000263642.2	-	11	2657	c.2262G>C	c.(2260-2262)ctG>ctC	p.L754L		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	754	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						CAGCTCCAATCAGATGGTGGG	0.393																																						uc002uce.2		NA																	0				ovary(1)	1						c.(2260-2262)CTG>CTC		interferon induced with helicase C domain 1							204.0	203.0	203.0					2																	163133239		2203	4300	6503	SO:0001819	synonymous_variant	64135				detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding	g.chr2:163133239C>G	AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.2262G>C	2.37:g.163133239C>G			Somatic					p.L754L	NM_022168	NP_071451	WXS	Illumina HiSeq	Unspecified	Q9BYX4	IFIH1_HUMAN			11	2484	-			754			Helicase C-terminal.		Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Silent	SNP	ENST00000263642.2	37	c.2262G>C	CCDS2217.1																																																																																				0.393	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255078.2	NM_022168		88	39	0	0	0	0	88	39				
FIGN	55137	broad.mit.edu	37	2	164467857	164467857	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:164467857C>A	ENST00000333129.3	-	3	799	c.485G>T	c.(484-486)aGt>aTt	p.S162I	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	162					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						ACTTGAATAACTAGGTTCTGT	0.517																																						uc002uck.1		NA																	0				large_intestine(2)|ovary(1)|skin(1)	4						c.(484-486)AGT>ATT		fidgetin							79.0	78.0	78.0					2																	164467857		1955	4154	6109	SO:0001583	missense	55137					nuclear matrix	ATP binding|nucleoside-triphosphatase activity	g.chr2:164467857C>A	AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.485G>T	2.37:g.164467857C>A	ENSP00000333836:p.Ser162Ile		Somatic					p.S162I	NM_018086	NP_060556	WXS	Illumina HiSeq	Unspecified	Q5HY92	FIGN_HUMAN			3	796	-			162					B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	ENST00000333129.3	37	c.485G>T	CCDS2221.2	.	.	.	.	.	.	.	.	.	.	C	14.42	2.530587	0.45073	.	.	ENSG00000182263	ENST00000333129	T	0.43294	0.95	6.07	6.07	0.98685	.	0.041258	0.85682	D	0.000000	T	0.44519	0.1297	L	0.46157	1.445	0.54753	D	0.999985	D	0.55385	0.971	B	0.44278	0.445	T	0.17018	-1.0383	10	0.33940	T	0.23	-12.2506	20.6593	0.99626	0.0:1.0:0.0:0.0	.	162	Q5HY92	FIGN_HUMAN	I	162	ENSP00000333836:S162I	ENSP00000333836:S162I	S	-	2	0	FIGN	164176103	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.958000	0.63660	2.885000	0.99019	0.655000	0.94253	AGT		0.517	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	NM_018086		41	20	1	0	2.25e-16	2.89e-16	41	20				
GRB14	2888	broad.mit.edu	37	2	165381587	165381587	+	Splice_Site	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:165381587T>C	ENST00000263915.3	-	5	1143	c.605A>G	c.(604-606)tAt>tGt	p.Y202C	GRB14_ENST00000543549.1_Splice_Site_p.Y115C	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	202					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						TGGAAAAAAATACTGTCAAAA	0.284																																						uc002ucl.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)|lung(1)	7						c.(604-606)TAT>TGT		growth factor receptor-bound protein 14							61.0	68.0	66.0					2																	165381587		2202	4296	6498	SO:0001630	splice_region_variant	2888				blood coagulation|leukocyte migration	cytosol|endosome membrane|Golgi membrane|microsome|plasma membrane	SH3/SH2 adaptor activity	g.chr2:165381587T>C		CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.604-1A>G	2.37:g.165381587T>C			Somatic				GRB14_uc010zcv.1_Missense_Mutation_p.Y115C|GRB14_uc002ucm.2_RNA	p.Y202C	NM_004490	NP_004481	WXS	Illumina HiSeq	Unspecified	Q14449	GRB14_HUMAN			5	1146	-			202					B7Z7F9|Q7Z6I1	Missense_Mutation	SNP	ENST00000263915.3	37	c.605A>G	CCDS2222.1	.	.	.	.	.	.	.	.	.	.	T	13.42	2.232861	0.39498	.	.	ENSG00000115290	ENST00000263915;ENST00000543549;ENST00000446413;ENST00000424693	T;T;T;T	0.42900	1.92;1.94;1.52;0.96	6.01	6.01	0.97437	.	0.358725	0.34580	N	0.003849	T	0.38401	0.1039	L	0.36672	1.1	0.35837	D	0.825732	B;P	0.40144	0.002;0.704	B;B	0.42738	0.001;0.396	T	0.53436	-0.8439	10	0.66056	D	0.02	-16.9995	11.0923	0.48123	0.0:0.0769:0.0:0.923	.	115;202	B7Z7F9;Q14449	.;GRB14_HUMAN	C	202;115;157;144	ENSP00000263915:Y202C;ENSP00000443699:Y115C;ENSP00000416786:Y157C;ENSP00000401702:Y144C	ENSP00000263915:Y202C	Y	-	2	0	GRB14	165089833	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	2.790000	0.47821	2.299000	0.77371	0.533000	0.62120	TAT		0.284	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255180.2		Missense_Mutation	42	15	0	0	0	0	42	15				
SCN1A	6323	broad.mit.edu	37	2	166854615	166854615	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:166854615C>A	ENST00000303395.4	-	23	4408	c.4409G>T	c.(4408-4410)gGg>gTg	p.G1470V	AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.G1459V|SCN1A_ENST00000409050.1_Missense_Mutation_p.G1442V|SCN1A_ENST00000423058.2_Missense_Mutation_p.G1470V|AC010127.3_ENST00000597623.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1470			G -> W (in EIEE6; dbSNP:rs121917924). {ECO:0000269|PubMed:17561957}.		adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GAAGAAGGACCCAAAGATGAT	0.338																																						uc010zcz.1		NA																	0				ovary(6)|skin(6)|large_intestine(1)	13						c.(4375-4377)GGG>GTG		sodium channel, voltage-gated, type I, alpha	Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)						90.0	82.0	85.0					2																	166854615		2203	4292	6495	SO:0001583	missense	6323					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166854615C>A	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4409G>T	2.37:g.166854615C>A	ENSP00000303540:p.Gly1470Val		Somatic				SCN1A_uc002udo.3_Missense_Mutation_p.G1339V|SCN1A_uc010fpk.2_Missense_Mutation_p.G1311V	p.G1459V	NM_006920	NP_008851	WXS	Illumina HiSeq	Unspecified	P35498	SCN1A_HUMAN			23	4394	-			1470			Helical; Name=S6 of repeat III; (By similarity).|III.		E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	c.4376G>T	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.842969	0.91197	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.98717	-5.09;-5.09;-5.09;-5.09	5.3	5.3	0.74995	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99339	0.9768	M	0.91818	3.245	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.97110	0.968;1.0;1.0	D	0.98971	1.0801	10	0.87932	D	0	.	18.9458	0.92621	0.0:1.0:0.0:0.0	.	1459;1442;1470	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	V	1470;1470;1459;1442	ENSP00000407030:G1470V;ENSP00000303540:G1470V;ENSP00000364554:G1459V;ENSP00000386312:G1442V	ENSP00000303540:G1470V	G	-	2	0	SCN1A	166562861	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.708000	0.84633	2.466000	0.83321	0.467000	0.42956	GGG		0.338	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920		43	13	1	0	4.16e-14	5.19e-14	43	13				
TTN	7273	broad.mit.edu	37	2	179454011	179454011	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:179454011C>A	ENST00000591111.1	-	254	57742	c.57518G>T	c.(57517-57519)aGa>aTa	p.R19173I	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R11941I|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R18246I|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R11874I|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R20814I|TTN_ENST00000460472.2_Missense_Mutation_p.R11749I			Q8WZ42	TITIN_HUMAN	titin	19173	Ig-like 108.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R11749T(1)|p.R18244T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTGGTGATCTTGTTAAGTC	0.453																																						uc010zfg.1		NA																	2	Substitution - Missense(2)	p.R11749T(1)|p.R18244T(1)	ovary(2)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(54736-54738)AGA>ATA		titin isoform N2-A							165.0	166.0	166.0					2																	179454011		1932	4131	6063	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179454011C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.57518G>T	2.37:g.179454011C>A	ENSP00000465570:p.Arg19173Ile		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R11941I|TTN_uc010zfi.1_Missense_Mutation_p.R11874I|TTN_uc010zfj.1_Missense_Mutation_p.R11749I	p.R18246I	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		253	54961	-			19173					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.54737G>T		.	.	.	.	.	.	.	.	.	.	C	11.53	1.666035	0.29604	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	6.02	6.02	0.97574	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67126	0.2860	N	0.21282	0.65	0.51233	D	0.999913	D;D;D;D	0.58970	0.984;0.984;0.984;0.984	P;P;P;P	0.60541	0.876;0.876;0.876;0.876	T	0.69691	-0.5077	9	0.87932	D	0	.	10.8017	0.46493	0.0:0.8605:0.0:0.1395	.	11749;11874;11941;19173	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	18246;11749;11941;11874;11747	ENSP00000343764:R18246I;ENSP00000434586:R11749I;ENSP00000340554:R11941I;ENSP00000352154:R11874I	ENSP00000340554:R11941I	R	-	2	0	TTN	179162257	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.339000	0.43965	2.857000	0.98124	0.650000	0.86243	AGA		0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		93	226	1	0	1.42e-38	2.06e-38	93	226				
TTN	7273	broad.mit.edu	37	2	179537203	179537203	+	Nonsense_Mutation	SNP	C	C	A	rs372366633		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:179537203C>A	ENST00000591111.1	-	150	33963	c.33739G>T	c.(33739-33741)Gaa>Taa	p.E11247*	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Nonsense_Mutation_p.E10320*|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.E11621*|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	11247	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGGTACTTCAGGCACTTTA	0.373																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(30958-30960)GAA>TAA		titin isoform N2-A							170.0	170.0	170.0					2																	179537203		1824	4079	5903	SO:0001587	stop_gained	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179537203C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.33739G>T	2.37:g.179537203C>A	ENSP00000465570:p.Glu11247*		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Nonsense_Mutation_p.E6981*|TTN_uc010fre.1_Intron|TTN_uc010zfk.1_5'Flank|TTN_uc002una.1_RNA|TTN_uc010frf.1_RNA	p.E10320*	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		149	31182	-			11247					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37	c.30958G>T		.	.	.	.	.	.	.	.	.	.	C	60	49.730006	0.99987	.	.	ENSG00000155657	ENST00000342992	.	.	.	5.19	4.26	0.50523	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	9.5524	0.39317	0.0:0.7484:0.133:0.1185	.	.	.	.	X	10320	.	ENSP00000343764:E10320X	E	-	1	0	TTN	179245448	0.005000	0.15991	0.993000	0.49108	0.914000	0.54420	1.451000	0.35145	2.572000	0.86782	0.585000	0.79938	GAA		0.373	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		115	370	1	0	1.19e-50	1.76e-50	115	370				
TTN	7273	broad.mit.edu	37	2	179553841	179553841	+	Silent	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:179553841G>C	ENST00000591111.1	-	123	31307	c.31083C>G	c.(31081-31083)ccC>ccG	p.P10361P	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Silent_p.P9434P|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Silent_p.P10678P|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTCTGGGACGGGTTTCTTAG	0.433																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(28300-28302)CCC>CCG		titin isoform N2-A							78.0	80.0	79.0					2																	179553841		1865	4089	5954	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179553841G>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.31083C>G	2.37:g.179553841G>C			Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.P6095P|TTN_uc010fre.1_Silent_p.P545P	p.P9434P	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		122	28526	-			10361					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.28302C>G																																																																																					0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		90	69	0	0	0	0	90	69				
TTN	7273	broad.mit.edu	37	2	179583701	179583701	+	Splice_Site	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:179583701C>G	ENST00000591111.1	-	82	23500		c.e82-1		TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Splice_Site|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Splice_Site|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGGTGGTTCTAGATATTGC	0.438																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.e81-1		titin isoform N2-A							50.0	47.0	48.0					2																	179583701		1871	4107	5978	SO:0001630	splice_region_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179583701C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.23276-1G>C	2.37:g.179583701C>G			Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Splice_Site_p.E3493_splice	p.E6832_splice	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		81	20719	-								A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Splice_Site	SNP	ENST00000591111.1	37	c.20495_splice		.	.	.	.	.	.	.	.	.	.	C	17.00	3.275944	0.59649	.	.	ENSG00000155657	ENST00000342992	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2245	0.98337	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TTN	179291946	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	5.773000	0.68898	2.861000	0.98227	0.650000	0.86243	.		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	Intron	23	17	0	0	0	0	23	17				
TTN	7273	broad.mit.edu	37	2	179590292	179590292	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:179590292G>T	ENST00000591111.1	-	69	19912	c.19688C>A	c.(19687-19689)gCc>gAc	p.A6563D	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A5636D|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.A6880D|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12166	Ig-like 47.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATAGGCTGGGCGCCTTCTAT	0.428																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(16906-16908)GCC>GAC		titin isoform N2-A							103.0	94.0	97.0					2																	179590292		1845	4107	5952	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179590292G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.19688C>A	2.37:g.179590292G>T	ENSP00000465570:p.Ala6563Asp		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.A2297D	p.A5636D	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		68	17131	-			6563					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.16907C>A		.	.	.	.	.	.	.	.	.	.	G	13.64	2.298910	0.40694	.	.	ENSG00000155657	ENST00000342992	T	0.66638	-0.22	5.86	4.05	0.47172	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.56124	0.1964	L	0.28054	0.825	0.80722	D	1	B	0.21381	0.055	B	0.27608	0.081	T	0.58725	-0.7586	9	0.87932	D	0	.	13.4852	0.61361	0.1328:0.0:0.8672:0.0	.	6563	Q8WZ42	TITIN_HUMAN	D	5636	ENSP00000343764:A5636D	ENSP00000343764:A5636D	A	-	2	0	TTN	179298537	1.000000	0.71417	0.966000	0.40874	0.994000	0.84299	6.320000	0.72876	1.623000	0.50342	0.650000	0.86243	GCC		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		68	53	1	0	3.31e-33	4.69e-33	68	53				
TTN	7273	broad.mit.edu	37	2	179659844	179659844	+	Nonsense_Mutation	SNP	G	G	T	rs375448572		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:179659844G>T	ENST00000591111.1	-	7	1274	c.1050C>A	c.(1048-1050)taC>taA	p.Y350*	TTN_ENST00000360870.5_Nonsense_Mutation_p.Y350*|TTN_ENST00000342175.6_Nonsense_Mutation_p.Y350*|TTN_ENST00000342992.6_Nonsense_Mutation_p.Y350*|TTN_ENST00000359218.5_Nonsense_Mutation_p.Y350*|TTN_ENST00000589042.1_Nonsense_Mutation_p.Y350*|TTN_ENST00000460472.2_Nonsense_Mutation_p.Y350*			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGAGGCCACGTAGCCCTCTT	0.557																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(1048-1050)TAC>TAA		titin isoform N2-A							104.0	93.0	97.0					2																	179659844		2203	4300	6503	SO:0001587	stop_gained	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179659844G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.1050C>A	2.37:g.179659844G>T	ENSP00000465570:p.Tyr350*		Somatic				TTN_uc010zfh.1_Nonsense_Mutation_p.Y350*|TTN_uc010zfi.1_Nonsense_Mutation_p.Y350*|TTN_uc010zfj.1_Nonsense_Mutation_p.Y350*|TTN_uc002unb.2_Nonsense_Mutation_p.Y350*|TTN_uc010frg.1_Nonsense_Mutation_p.Y24*	p.Y350*	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		7	1274	-			350					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37	c.1050C>A		.	.	.	.	.	.	.	.	.	.	G	37	6.197262	0.97367	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	.	.	.	6.16	-5.93	0.02254	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.4857	0.87687	0.6933:0.0:0.3067:0.0	.	.	.	.	X	350	.	ENSP00000340554:Y350X	Y	-	3	2	TTN	179368089	0.000000	0.05858	0.598000	0.28837	0.783000	0.44284	-0.297000	0.08276	-1.096000	0.03046	-0.142000	0.14014	TAC		0.557	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		49	102	1	0	2.69e-26	3.72e-26	49	102				
DNAH7	56171	broad.mit.edu	37	2	196723252	196723252	+	Silent	SNP	A	A	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:196723252A>T	ENST00000312428.6	-	43	8113	c.8013T>A	c.(8011-8013)ggT>ggA	p.G2671G		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2671	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TTGGCAAGGCACCTGCCAGGT	0.458																																						uc002utj.3		NA																	0				skin(10)|ovary(2)	12						c.(8011-8013)GGT>GGA		dynein, axonemal, heavy chain 7							82.0	77.0	79.0					2																	196723252		1968	4157	6125	SO:0001819	synonymous_variant	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196723252A>T	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.8013T>A	2.37:g.196723252A>T			Somatic					p.G2671G	NM_018897	NP_061720	WXS	Illumina HiSeq	Unspecified	Q8WXX0	DYH7_HUMAN			43	8114	-			2671			Stalk (By similarity).		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	c.8013T>A	CCDS42794.1																																																																																				0.458	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		31	20	0	0	0	0	31	20				
ABCA12	26154	broad.mit.edu	37	2	215917308	215917308	+	Splice_Site	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:215917308G>A	ENST00000272895.7	-	5	629	c.410C>T	c.(409-411)gCc>gTc	p.A137V		NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	137					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AAATACTGTGGCTGTAATCAA	0.428																																					Ovarian(66;664 1488 5121 34295)	uc002vew.2		NA																	0				ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11						c.(409-411)GCC>GTC		ATP-binding cassette, sub-family A, member 12							90.0	88.0	88.0					2																	215917308		2203	4300	6503	SO:0001630	splice_region_variant	26154				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity	g.chr2:215917308G>A	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.410-1C>T	2.37:g.215917308G>A			Somatic				ABCA12_uc010zjn.1_5'UTR	p.A137V	NM_173076	NP_775099	WXS	Illumina HiSeq	Unspecified	Q86UK0	ABCAC_HUMAN		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)	5	630	-		Renal(323;0.127)	137					Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	c.410C>T	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	4.249	0.045178	0.08196	.	.	ENSG00000144452	ENST00000272895	D	0.88586	-2.4	5.35	3.3	0.37823	.	1.039400	0.07583	N	0.920636	T	0.78329	0.4266	N	0.12182	0.205	0.19775	N	0.99995	B	0.09022	0.002	B	0.06405	0.002	T	0.65869	-0.6063	10	0.44086	T	0.13	.	5.2468	0.15500	0.2873:0.0:0.7127:0.0	.	137	Q86UK0	ABCAC_HUMAN	V	137	ENSP00000272895:A137V	ENSP00000272895:A137V	A	-	2	0	ABCA12	215625553	0.743000	0.28239	0.623000	0.29173	0.036000	0.12997	1.263000	0.33004	1.251000	0.43983	-0.259000	0.10710	GCC		0.428	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	Missense_Mutation	35	13	0	0	0	0	35	13				
TRIP12	9320	broad.mit.edu	37	2	230652326	230652326	+	Silent	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:230652326T>C	ENST00000283943.5	-	32	4843	c.4665A>G	c.(4663-4665)gcA>gcG	p.A1555A	TRIP12_ENST00000389044.4_Silent_p.A1603A|TRIP12_ENST00000389045.3_Silent_p.A1285A	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1555	K-box.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CCCGATCAAATGCAGTTACAT	0.378																																						uc002vpw.1		NA																	0				ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9						c.(4663-4665)GCA>GCG		thyroid hormone receptor interactor 12							104.0	100.0	102.0					2																	230652326		2203	4300	6503	SO:0001819	synonymous_variant	9320				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity	g.chr2:230652326T>C	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.4665A>G	2.37:g.230652326T>C			Somatic				TRIP12_uc002vpx.1_Silent_p.A1603A|TRIP12_uc002vpy.1_Silent_p.A1285A	p.A1555A	NM_004238	NP_004229	WXS	Illumina HiSeq	Unspecified	Q14669	TRIPC_HUMAN		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)	32	4774	-		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)	1555			K-box.		D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	ENST00000283943.5	37	c.4665A>G	CCDS33391.1																																																																																				0.378	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238		53	20	0	0	0	0	53	20				
MMP24	10893	broad.mit.edu	37	20	33867551	33867551	+	IGR	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr20:33867551C>T	ENST00000246186.6	+	0	4412				MMP24-AS1_ENST00000433764.1_RNA|EIF6_ENST00000374450.3_Splice_Site|MMP24-AS1_ENST00000566203.2_RNA|MMP24-AS1_ENST00000424358.1_RNA|EIF6_ENST00000374443.3_Splice_Site|EIF6_ENST00000462894.1_5'Flank|MMP24-AS1_ENST00000435366.1_RNA|RP4-614O4.11_ENST00000444717.1_RNA|MMP24-AS1_ENST00000438751.1_RNA|MMP24-AS1_ENST00000455178.1_RNA|MMP24-AS1_ENST00000456790.1_RNA|MMP24-AS1_ENST00000454184.1_RNA|EDEM2_ENST00000540582.1_5'Flank|MMP24-AS1_ENST00000456350.1_RNA|EIF6_ENST00000374436.3_Splice_Site	NM_006690.3	NP_006681.1	Q9Y5R2	MMP24_HUMAN	matrix metallopeptidase 24 (membrane-inserted)						cell-cell adhesion (GO:0098609)|cell-cell adhesion mediated by cadherin (GO:0044331)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|glial cell differentiation (GO:0010001)|neuronal stem cell maintenance (GO:0097150)|positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|large_intestine(1)|lung(2)|prostate(2)|skin(5)	14			BRCA - Breast invasive adenocarcinoma(18;0.00252)		Marimastat(DB00786)	CAGTCCCCGCCTGCCAAGGGA	0.587																																						uc002xbv.1		NA																	0				pancreas(1)	1						c.e5-1		eukaryotic translation initiation factor 6							147.0	116.0	126.0					20																	33867551		2203	4300	6503	SO:0001628	intergenic_variant	3692				mature ribosome assembly	cytoplasm|nucleolus	protein binding|ribosome binding|translation initiation factor activity	g.chr20:33867551C>T	AF131284	CCDS46593.1	20q11.2	2008-07-16	2005-08-08		ENSG00000125966	ENSG00000125966			7172	protein-coding gene	gene with protein product	"""membrane-type 5 matrix metalloproteinase"""	604871	"""matrix metalloproteinase 24 (membrane-inserted)"""			10363975	Standard	NM_006690		Approved	MT5-MMP	uc002xbu.2	Q9Y5R2	OTTHUMG00000032330		20.37:g.33867551C>T			Somatic				EDEM2_uc010zuv.1_5'Flank|EIF6_uc002xbx.1_Splice_Site_p.A183_splice|EIF6_uc002xbz.1_Splice_Site_p.A164_splice|EIF6_uc002xby.1_Splice_Site	p.A183_splice	NM_181468	NP_852133	WXS	Illumina HiSeq	Unspecified	P56537	IF6_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00252)		5	763	-								B7ZBG8|Q9H440	Splice_Site	SNP	ENST00000246186.6	37	c.547_splice	CCDS46593.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789241	0.70337	.	.	ENSG00000242372	ENST00000374436;ENST00000374443;ENST00000374450	.	.	.	4.65	4.65	0.58169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4363	0.87553	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EIF6	33330965	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	4.893000	0.63199	2.534000	0.85438	0.555000	0.69702	.		0.587	MMP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078851.4	NM_006690		36	50	0	0	0	0	36	50				
ABHD16B	140701	broad.mit.edu	37	20	62493607	62493607	+	Silent	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr20:62493607C>G	ENST00000369916.3	+	1	1042	c.714C>G	c.(712-714)ccC>ccG	p.P238P	C20ORF135_ENST00000601296.1_5'Flank|TPD52L2_ENST00000369927.4_5'Flank	NM_080622.3	NP_542189.1	Q9H3Z7	ABHGB_HUMAN	abhydrolase domain containing 16B	238							hydrolase activity (GO:0016787)			endometrium(2)|kidney(1)|lung(3)	6						ACTTCCCGCCCGCGCACCTGG	0.687																																						uc002ygx.1		NA																	0					0						c.(712-714)CCC>CCG		hypothetical protein LOC140701							38.0	31.0	33.0					20																	62493607		2203	4297	6500	SO:0001819	synonymous_variant	140701						hydrolase activity	g.chr20:62493607C>G		CCDS13539.1	20q13.33	2013-01-17	2010-12-09	2010-12-09	ENSG00000183260	ENSG00000183260		"""Abhydrolase domain containing"""	16128	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 135"""	C20orf135			Standard	NM_080622		Approved	dJ591C20.1	uc002ygx.1	Q9H3Z7	OTTHUMG00000033010	ENST00000369916.3:c.714C>G	20.37:g.62493607C>G			Somatic				TPD52L2_uc002ygy.2_5'Flank|TPD52L2_uc002ygz.2_5'Flank|TPD52L2_uc002yha.2_5'Flank|TPD52L2_uc002yhb.2_5'Flank|TPD52L2_uc002yhc.2_5'Flank|TPD52L2_uc002yhd.2_5'Flank|TPD52L2_uc011abk.1_5'Flank|TPD52L2_uc011abl.1_5'Flank	p.P238P	NM_080622	NP_542189	WXS	Illumina HiSeq	Unspecified	Q9H3Z7	ABHGB_HUMAN			1	1042	+	all_cancers(38;1.77e-12)|all_epithelial(29;3.12e-14)|Lung NSC(23;5.92e-10)|all_lung(23;2.08e-09)		238						Silent	SNP	ENST00000369916.3	37	c.714C>G	CCDS13539.1																																																																																				0.687	ABHD16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080254.1			10	19	0	0	0	0	10	19				
KRTAP20-2	337976	broad.mit.edu	37	21	32007617	32007617	+	Missense_Mutation	SNP	G	G	A	rs551484598	byFrequency	TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr21:32007617G>A	ENST00000330798.2	+	1	63	c.35G>A	c.(34-36)cGt>cAt	p.R12H		NM_181616.1	NP_853647.1	Q3LI61	KR202_HUMAN	keratin associated protein 20-2	12						intermediate filament (GO:0005882)				central_nervous_system(1)|endometrium(3)|kidney(1)|lung(2)|ovary(1)	8						GGTGGTCTGCGTTATGGCTAT	0.522													G|||	3	0.000599042	0.0	0.0014	5008	,	,		17636	0.0		0.0	False		,,,				2504	0.002					uc011adg.1		NA																	0				central_nervous_system(1)	1						c.(34-36)CGT>CAT		keratin associated protein 20-2							191.0	156.0	168.0					21																	32007617		2203	4300	6503	SO:0001583	missense	337976					intermediate filament		g.chr21:32007617G>A	AP001708	CCDS13604.1	21q22.1	2006-03-13			ENSG00000184032	ENSG00000184032		"""Keratin associated proteins"""	18944	protein-coding gene	gene with protein product						12359730	Standard	NM_181616		Approved	KAP20.2	uc011adg.2	Q3LI61	OTTHUMG00000057786	ENST00000330798.2:c.35G>A	21.37:g.32007617G>A	ENSP00000330746:p.Arg12His		Somatic					p.R12H	NM_181616	NP_853647	WXS	Illumina HiSeq	Unspecified	Q3LI61	KR202_HUMAN			1	35	+			12						Missense_Mutation	SNP	ENST00000330798.2	37	c.35G>A	CCDS13604.1	.	.	.	.	.	.	.	.	.	.	G	9.598	1.127897	0.20959	.	.	ENSG00000184032	ENST00000330798	T	0.09630	2.96	3.45	3.45	0.39498	.	0.000000	0.40908	U	0.000993	T	0.07773	0.0195	.	.	.	0.09310	N	1	P	0.50710	0.938	B	0.35770	0.21	T	0.30179	-0.9987	9	0.87932	D	0	.	10.6113	0.45423	0.0:0.0:1.0:0.0	.	12	Q3LI61	KR202_HUMAN	H	12	ENSP00000330746:R12H	ENSP00000330746:R12H	R	+	2	0	KRTAP20-2	30929488	0.000000	0.05858	0.009000	0.14445	0.016000	0.09150	0.136000	0.15974	1.940000	0.56252	0.655000	0.94253	CGT		0.522	KRTAP20-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128238.3			50	74	0	0	0	0	50	74				
SYNJ1	8867	broad.mit.edu	37	21	34011284	34011284	+	Silent	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr21:34011284T>A	ENST00000322229.7	-	30	3848	c.3849A>T	c.(3847-3849)ccA>ccT	p.P1283P	SYNJ1_ENST00000433931.2_Silent_p.P1322P|SYNJ1_ENST00000357345.3_Silent_p.P1267P|SYNJ1_ENST00000382499.2_Silent_p.P1322P|SYNJ1_ENST00000382491.3_Silent_p.P1236P			O43426	SYNJ1_HUMAN	synaptojanin 1	1283	Pro-rich.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						GTGGTTGTGGTGGGGTTTCCA	0.507																																						uc002yqh.2		NA																	0				ovary(4)|skin(1)	5						c.(3964-3966)CCA>CCT		synaptojanin 1 isoform a							184.0	195.0	191.0					21																	34011284		2203	4300	6503	SO:0001819	synonymous_variant	8867						inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding	g.chr21:34011284T>A	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.3849A>T	21.37:g.34011284T>A			Somatic				SYNJ1_uc011ads.1_Silent_p.P1236P|SYNJ1_uc002yqf.2_Silent_p.P1267P|SYNJ1_uc002yqg.2_Silent_p.P1236P|SYNJ1_uc002yqi.2_Silent_p.P1322P|SYNJ1_uc002yqe.3_5'UTR	p.P1322P	NM_003895	NP_003886	WXS	Illumina HiSeq	Unspecified	O43426	SYNJ1_HUMAN			31	3966	-			1283			Pro-rich.		O43425|O94984|Q4KMR1	Silent	SNP	ENST00000322229.7	37	c.3966A>T	CCDS54484.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.330|9.330	1.060259|1.060259	0.19987|0.19987	.|.	.|.	ENSG00000159082|ENSG00000159082	ENST00000418301|ENST00000438952	.|.	.|.	.|.	5.34|5.34	-10.7|-10.7	0.00240|0.00240	.|.	.|.	.|.	.|.	.|.	T|T	0.42787|0.42787	0.1218|0.1218	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.58589|0.58589	-0.7610|-0.7610	4|4	.|.	.|.	.|.	.|.	5.8898|5.8898	0.18904|0.18904	0.119:0.2211:0.4844:0.1755|0.119:0.2211:0.4844:0.1755	.|.	.|.	.|.	.|.	L|S	104|159	.|.	.|.	H|T	-|-	2|1	0|0	SYNJ1|SYNJ1	32933155|32933155	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.996000|0.996000	0.88848|0.88848	-5.713000|-5.713000	0.00103|0.00103	-4.259000|-4.259000	0.00061|0.00061	-0.256000|-0.256000	0.11100|0.11100	CAC|ACC		0.507	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding				142	238	0	0	0	0	142	238				
KRTAP12-2	353323	broad.mit.edu	37	21	46086539	46086539	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr21:46086539T>C	ENST00000360770.3	-	1	305	c.265A>G	c.(265-267)Agc>Ggc	p.S89G	TSPEAR_ENST00000323084.4_Intron	NM_181684.2	NP_859012.1	P59991	KR122_HUMAN	keratin associated protein 12-2	89	23 X 5 AA approximate repeats.					keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(1)|lung(3)	5						GGCCTGCAGCTCACAGGCACA	0.632																																						uc002zfu.2		NA																	0					0						c.(265-267)AGC>GGC		keratin associated protein 12-2							73.0	83.0	79.0					21																	46086539		2191	4274	6465	SO:0001583	missense	353323					keratin filament		g.chr21:46086539T>C	AJ566389	CCDS42965.1	21q22.3	2006-03-13			ENSG00000221864	ENSG00000221864		"""Keratin associated proteins"""	20530	protein-coding gene	gene with protein product							Standard	NM_181684		Approved	KRTAP12.2, KAP12.2	uc002zfu.3	P59991	OTTHUMG00000057636	ENST00000360770.3:c.265A>G	21.37:g.46086539T>C	ENSP00000354001:p.Ser89Gly		Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.S89G	NM_181684	NP_859012	WXS	Illumina HiSeq	Unspecified	P59991	KR122_HUMAN			1	306	-			89			14.|23 X 5 AA approximate repeats.		A6NIS1|A6NMS9|Q0VAS4	Missense_Mutation	SNP	ENST00000360770.3	37	c.265A>G	CCDS42965.1	.	.	.	.	.	.	.	.	.	.	t	13.72	2.322496	0.41096	.	.	ENSG00000221864	ENST00000360770;ENST00000539483	T	0.02197	4.4	3.2	-0.904	0.10530	.	.	.	.	.	T	0.02767	0.0083	M	0.70903	2.155	0.19775	N	0.999955	B	0.30179	0.271	B	0.28305	0.088	T	0.44757	-0.9307	9	0.66056	D	0.02	.	0.4118	0.00442	0.3681:0.1236:0.1885:0.3197	.	89	P59991	KR122_HUMAN	G	89;39	ENSP00000354001:S89G	ENSP00000354001:S89G	S	-	1	0	KRTAP12-2	44910967	0.511000	0.26179	0.993000	0.49108	0.871000	0.50021	1.305000	0.33493	0.308000	0.22923	0.379000	0.24179	AGC		0.632	KRTAP12-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128039.1	NM_181684		31	44	0	0	0	0	31	44				
PCNT	5116	broad.mit.edu	37	21	47821491	47821491	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr21:47821491G>A	ENST00000359568.5	+	26	4925	c.4818G>A	c.(4816-4818)caG>caA	p.Q1606Q	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1606					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AGAAACAGCAGATGAGTAGCT	0.453																																						uc002zji.3		NA																	0				ovary(4)|breast(2)|pancreas(2)	8						c.(4816-4818)CAG>CAA		pericentrin							81.0	78.0	79.0					21																	47821491		2203	4300	6503	SO:0001819	synonymous_variant	5116				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding	g.chr21:47821491G>A	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.4818G>A	21.37:g.47821491G>A			Somatic				PCNT_uc002zjj.2_Silent_p.Q1488Q	p.Q1606Q	NM_006031	NP_006022	WXS	Illumina HiSeq	Unspecified	O95613	PCNT_HUMAN			26	4925	+	Breast(49;0.112)		1606			Potential.		O43152|Q7Z7C9	Silent	SNP	ENST00000359568.5	37	c.4818G>A	CCDS33592.1																																																																																				0.453	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		51	93	0	0	0	0	51	93				
DIP2A	23181	broad.mit.edu	37	21	47910617	47910617	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr21:47910617G>A	ENST00000417564.2	+	3	289	c.268G>A	c.(268-270)Gag>Aag	p.E90K	DIP2A_ENST00000318711.7_Missense_Mutation_p.E90K|DIP2A_ENST00000400274.1_Missense_Mutation_p.E90K|DIP2A_ENST00000457905.3_Missense_Mutation_p.E90K|DIP2A_ENST00000435722.3_Missense_Mutation_p.E90K|DIP2A_ENST00000466639.1_Missense_Mutation_p.E90K|DIP2A_ENST00000427143.2_Intron			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	90	DMAP-interaction.				multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		CTCGAGGGATGAGCGCTTCCG	0.592																																						uc002zjo.2		NA																	0				ovary(2)	2						c.(268-270)GAG>AAG		disco-interacting protein 2A isoform a							22.0	24.0	23.0					21																	47910617		1955	4123	6078	SO:0001583	missense	23181				multicellular organismal development	nucleus	catalytic activity|transcription factor binding	g.chr21:47910617G>A	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.268G>A	21.37:g.47910617G>A	ENSP00000392066:p.Glu90Lys		Somatic				DIP2A_uc011afy.1_Intron|DIP2A_uc011afz.1_Missense_Mutation_p.E90K|DIP2A_uc002zjl.2_Missense_Mutation_p.E90K|DIP2A_uc002zjm.2_Missense_Mutation_p.E90K|DIP2A_uc010gql.2_Missense_Mutation_p.E90K|DIP2A_uc002zjn.2_Missense_Mutation_p.E90K	p.E90K	NM_015151	NP_055966	WXS	Illumina HiSeq	Unspecified	Q14689	DIP2A_HUMAN		Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)	3	451	+	Breast(49;0.0933)		90					A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	c.268G>A	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.300396	0.81136	.	.	ENSG00000160305	ENST00000400274;ENST00000318711;ENST00000358985;ENST00000457905;ENST00000466639;ENST00000435722;ENST00000417564	T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76	5.28	5.28	0.74379	DMAP1-binding (1);	0.000000	0.64402	D	0.000001	T	0.62527	0.2435	L	0.53249	1.67	0.80722	D	1	P;D;P;P;D	0.71674	0.929;0.998;0.815;0.835;0.998	P;D;P;P;D	0.87578	0.852;0.991;0.698;0.624;0.998	T	0.55198	-0.8178	10	0.13853	T	0.58	-28.4505	17.4953	0.87716	0.0:0.0:1.0:0.0	.	90;90;90;90;90	E9PER1;Q14689-3;Q14689;Q14689-4;Q14689-2	.;.;DIP2A_HUMAN;.;.	K	90	ENSP00000383133:E90K;ENSP00000323633:E90K;ENSP00000393434:E90K;ENSP00000430249:E90K;ENSP00000415089:E90K;ENSP00000392066:E90K	ENSP00000323633:E90K	E	+	1	0	DIP2A	46735045	1.000000	0.71417	0.953000	0.39169	0.532000	0.34746	8.491000	0.90468	2.457000	0.83068	0.655000	0.94253	GAG		0.592	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151		6	7	0	0	0	0	6	7				
C22orf39	128977	broad.mit.edu	37	22	19431847	19431847	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr22:19431847G>C	ENST00000399562.4	-	3	802	c.370C>G	c.(370-372)Ccg>Gcg	p.P124A	HIRA_ENST00000541063.1_Intron|C22orf39_ENST00000399568.1_Intron|C22orf39_ENST00000333059.5_Missense_Mutation_p.P87A|C22orf39_ENST00000542103.1_Intron|HIRA_ENST00000546308.1_Intron	NM_173793.4	NP_776154.3	Q6P5X5	CV039_HUMAN	chromosome 22 open reading frame 39	124												Colorectal(54;0.0993)					CTCTGCCTCGGGGCCCACACC	0.622																																						uc002zpk.1		NA																	0					0						c.(259-261)CCG>GCG		hypothetical protein LOC128977							46.0	46.0	46.0					22																	19431847		2203	4300	6503	SO:0001583	missense	128977							g.chr22:19431847G>C		CCDS33599.1, CCDS33599.2, CCDS54498.1	22q11.21	2008-10-31			ENSG00000242259	ENSG00000242259			27012	protein-coding gene	gene with protein product							Standard	NM_173793		Approved	MGC74441	uc002zpk.2	Q6P5X5	OTTHUMG00000150137	ENST00000399562.4:c.370C>G	22.37:g.19431847G>C	ENSP00000382474:p.Pro124Ala		Somatic				HIRA_uc010gro.1_Intron|HIRA_uc010grp.2_Intron|C22orf39_uc002zpi.2_Intron|C22orf39_uc002zpj.2_5'Flank	p.P87A	NM_173793	NP_776154	WXS	Illumina HiSeq	Unspecified	Q6P5X5	CV039_HUMAN			3	268	-	Colorectal(54;0.0993)		87					A8MTW6|D3DX18|F5H3A8|J3KNP9	Missense_Mutation	SNP	ENST00000399562.4	37	c.259C>G	CCDS33599.2	.	.	.	.	.	.	.	.	.	.	G	12.91	2.079241	0.36662	.	.	ENSG00000242259	ENST00000399562;ENST00000333059	.	.	.	5.04	1.86	0.25419	.	0.836170	0.10347	N	0.685546	T	0.31009	0.0783	L	0.36672	1.1	0.09310	N	1	B	0.25850	0.136	B	0.21151	0.033	T	0.19128	-1.0315	9	0.37606	T	0.19	-1.1047	8.6445	0.33996	0.3154:0.0:0.6846:0.0	.	87	Q6P5X5	CV039_HUMAN	A	87;124	.	ENSP00000333064:P124A	P	-	1	0	C22orf39	17811847	0.478000	0.25917	0.140000	0.22221	0.984000	0.73092	1.232000	0.32636	0.806000	0.34183	0.591000	0.81541	CCG		0.622	C22orf39-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316494.3	NM_173793		26	44	0	0	0	0	26	44				
CDC45	8318	broad.mit.edu	37	22	19471512	19471512	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr22:19471512G>A	ENST00000407835.1	+	6	726	c.470G>A	c.(469-471)cGc>cAc	p.R157H	CDC45_ENST00000483431.1_3'UTR|CDC45_ENST00000263201.1_Missense_Mutation_p.R157H|CDC45_ENST00000404724.3_Missense_Mutation_p.R111H|CDC45_ENST00000437685.2_Missense_Mutation_p.R157H			O75419	CDC45_HUMAN	cell division cycle 45	157					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	19						TCTGAGAAGCGCACACGGTTA	0.532																																						uc002zpr.2		NA																	0				lung(1)	1						c.(469-471)CGC>CAC		CDC45-like							115.0	100.0	105.0					22																	19471512		2203	4300	6503	SO:0001583	missense	8318				DNA replication checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	centrosome|nucleoplasm	protein binding	g.chr22:19471512G>A	AF053074	CCDS13762.1, CCDS54499.1, CCDS54500.1	22q11.21	2013-01-17	2013-01-17	2010-03-24	ENSG00000093009	ENSG00000093009			1739	protein-coding gene	gene with protein product	"""human CDC45"""	603465	"""CDC45 (cell division cycle 45, S.cerevisiae, homolog)-like"", ""CDC45 cell division cycle 45-like (S. cerevisiae)"", ""cell division cycle 45 homolog (S. cerevisiae)"""	CDC45L2, CDC45L		9660782, 9724329, 17608804	Standard	NM_001178010		Approved		uc011aha.2	O75419	OTTHUMG00000150386	ENST00000407835.1:c.470G>A	22.37:g.19471512G>A	ENSP00000385240:p.Arg157His		Somatic				CDC45_uc011agz.1_Missense_Mutation_p.R152H|CDC45_uc011aha.1_Missense_Mutation_p.R157H|CDC45_uc002zps.2_Missense_Mutation_p.R157H|CDC45_uc002zpt.2_Missense_Mutation_p.R111H	p.R157H	NM_003504	NP_003495	WXS	Illumina HiSeq	Unspecified	O75419	CDC45_HUMAN			5	546	+			157					B4DDB4|B4DDU3|E9PDH7|O60856|Q20WK8|Q6UW54|Q9UP68	Missense_Mutation	SNP	ENST00000407835.1	37	c.470G>A	CCDS13762.1	.	.	.	.	.	.	.	.	.	.	G	35	5.513468	0.96402	.	.	ENSG00000093009	ENST00000407835;ENST00000438587;ENST00000437685;ENST00000263201;ENST00000404724	T;T;T;T;T	0.25912	2.0;2.0;1.95;2.0;1.77	5.68	5.68	0.88126	.	0.054321	0.64402	D	0.000001	T	0.58595	0.2133	M	0.84846	2.72	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.79108	0.99;0.992;0.99;0.99;0.99	T	0.63409	-0.6644	10	0.72032	D	0.01	-12.3749	19.7974	0.96491	0.0:0.0:1.0:0.0	.	157;152;111;157;157	E9PDH7;B4E092;B4DDB4;B4DDU3;O75419	.;.;.;.;CDC45_HUMAN	H	157;145;157;157;111	ENSP00000385240:R157H;ENSP00000397434:R145H;ENSP00000405726:R157H;ENSP00000263201:R157H;ENSP00000384978:R111H	ENSP00000263201:R157H	R	+	2	0	CDC45	17851512	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.673000	0.90976	0.650000	0.86243	CGC		0.532	CDC45-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317903.1	NM_003504		5	113	0	0	0	0	5	113				
MYO18B	84700	broad.mit.edu	37	22	26423401	26423401	+	Silent	SNP	G	G	C	rs545198222		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr22:26423401G>C	ENST00000407587.2	+	43	7633	c.7464G>C	c.(7462-7464)ggG>ggC	p.G2488G	MYO18B_ENST00000335473.7_Silent_p.G2487G|MYO18B_ENST00000536101.1_Silent_p.G2487G			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2487						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TTCTCTCGGGGATCAAGACCA	0.547																																						uc003abz.1		NA																	0				ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						c.(7459-7461)GGG>GGC		myosin XVIIIB							71.0	74.0	73.0					22																	26423401		1997	4159	6156	SO:0001819	synonymous_variant	84700					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity	g.chr22:26423401G>C	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.7464G>C	22.37:g.26423401G>C			Somatic				MYO18B_uc003aca.1_Silent_p.G2368G|MYO18B_uc010guy.1_Silent_p.G2369G|MYO18B_uc010guz.1_Silent_p.G2367G|MYO18B_uc011aka.1_Silent_p.G1641G|MYO18B_uc011akb.1_Silent_p.G2000G|MYO18B_uc010gva.1_Silent_p.G470G|MYO18B_uc010gvb.1_RNA	p.G2487G	NM_032608	NP_115997	WXS	Illumina HiSeq	Unspecified	Q8IUG5	MY18B_HUMAN			43	7711	+			2487					B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	37	c.7461G>C		.	.	.	.	.	.	.	.	.	.	G	0.596	-0.831027	0.02713	.	.	ENSG00000133454	ENST00000543971	T	0.20598	2.06	4.93	0.961	0.19638	.	0.400513	0.19296	N	0.117741	T	0.25680	0.0625	.	.	.	0.37725	D	0.925051	.	.	.	.	.	.	T	0.10268	-1.0637	7	0.51188	T	0.08	.	6.241	0.20791	0.0874:0.1332:0.6432:0.1361	.	.	.	.	A	437	ENSP00000444262:G437A	ENSP00000444262:G437A	G	+	2	0	MYO18B	24753401	0.114000	0.22134	0.909000	0.35828	0.141000	0.21300	0.470000	0.22084	0.442000	0.26555	0.561000	0.74099	GGA		0.547	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		20	34	0	0	0	0	20	34				
MCM5	4174	broad.mit.edu	37	22	35804507	35804507	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr22:35804507G>T	ENST00000216122.4	+	6	857	c.703G>T	c.(703-705)Gca>Tca	p.A235S	MCM5_ENST00000382011.5_Missense_Mutation_p.A192S	NM_006739.3	NP_006730.2	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	235					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29						GCTGCCTGATGCAGTCCCCCA	0.617																																						uc003anu.3		NA																	0				ovary(1)	1						c.(703-705)GCA>TCA		minichromosome maintenance complex component 5							66.0	54.0	58.0					22																	35804507		2203	4300	6503	SO:0001583	missense	4174				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding	g.chr22:35804507G>T		CCDS13915.1	22q13.1-q13.2	2007-04-04	2007-04-04		ENSG00000100297	ENSG00000100297			6948	protein-coding gene	gene with protein product		602696	"""minichromosome maintenance deficient (S. cerevisiae) 5 (cell division cycle 46)"", ""MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)"""	CDC46		8751386, 10591208	Standard	NM_006739		Approved		uc003anu.4	P33992	OTTHUMG00000150961	ENST00000216122.4:c.703G>T	22.37:g.35804507G>T	ENSP00000216122:p.Ala235Ser		Somatic				MCM5_uc010gwr.2_Missense_Mutation_p.A44S|MCM5_uc003anv.3_Missense_Mutation_p.A192S|MCM5_uc010gws.1_RNA|MCM5_uc003anw.1_5'Flank	p.A235S	NM_006739	NP_006730	WXS	Illumina HiSeq	Unspecified	P33992	MCM5_HUMAN			6	797	+			235					O60785|Q14578|Q9BTJ4|Q9BWL8	Missense_Mutation	SNP	ENST00000216122.4	37	c.703G>T	CCDS13915.1	.	.	.	.	.	.	.	.	.	.	G	11.73	1.727115	0.30593	.	.	ENSG00000100297	ENST00000216122;ENST00000382011;ENST00000444582;ENST00000444778	T;T;T	0.02323	4.34;4.34;4.34	4.59	4.59	0.56863	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	T	0.03220	0.0094	L	0.31476	0.935	0.80722	D	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.09377	0.004;0.002;0.004	T	0.53823	-0.8384	10	0.16896	T	0.51	-15.2872	17.9772	0.89131	0.0:0.0:1.0:0.0	.	235;192;235	B1AHB0;B1AHB1;P33992	.;.;MCM5_HUMAN	S	235;192;144;92	ENSP00000216122:A235S;ENSP00000371441:A192S;ENSP00000408705:A92S	ENSP00000216122:A235S	A	+	1	0	MCM5	34134507	1.000000	0.71417	0.593000	0.28771	0.981000	0.71138	9.117000	0.94347	2.534000	0.85438	0.655000	0.94253	GCA		0.617	MCM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320661.3			42	48	1	0	9.85e-19	1.29e-18	42	48				
SSTR3	6753	broad.mit.edu	37	22	37603211	37603211	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr22:37603211G>A	ENST00000328544.3	-	2	1165	c.632C>T	c.(631-633)gCc>gTc	p.A211V	SSTR3_ENST00000402501.1_Missense_Mutation_p.A211V	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	211					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	GCCCAGTGCGGCCGTGTAGAT	0.692																																						uc003ara.2		NA																	0				lung(1)	1						c.(631-633)GCC>GTC		somatostatin receptor 3							16.0	18.0	18.0					22																	37603211		2190	4280	6470	SO:0001583	missense	6753				G-protein signaling, coupled to cyclic nucleotide second messenger|induction of apoptosis by hormones|negative regulation of cell proliferation	integral to plasma membrane|nonmotile primary cilium	somatostatin receptor activity	g.chr22:37603211G>A		CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.632C>T	22.37:g.37603211G>A	ENSP00000330138:p.Ala211Val		Somatic				SSTR3_uc003arb.2_Missense_Mutation_p.A211V	p.A211V	NM_001051	NP_001042	WXS	Illumina HiSeq	Unspecified	P32745	SSR3_HUMAN			2	694	-			211			Helical; Name=5; (Potential).		A8K550|Q53ZR7	Missense_Mutation	SNP	ENST00000328544.3	37	c.632C>T	CCDS13944.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489737	0.64074	.	.	ENSG00000183473	ENST00000328544;ENST00000402501	T;T	0.71934	-0.61;-0.61	5.66	5.66	0.87406	GPCR, rhodopsin-like superfamily (1);	0.183408	0.47455	D	0.000240	T	0.77758	0.4178	L	0.33137	0.985	0.41740	D	0.989603	P	0.51653	0.947	P	0.62885	0.908	T	0.78735	-0.2088	10	0.59425	D	0.04	.	19.7356	0.96200	0.0:0.0:1.0:0.0	.	211	P32745	SSR3_HUMAN	V	211	ENSP00000330138:A211V;ENSP00000384904:A211V	ENSP00000330138:A211V	A	-	2	0	SSTR3	35933157	1.000000	0.71417	0.973000	0.42090	0.967000	0.64934	4.785000	0.62418	2.677000	0.91161	0.551000	0.68910	GCC		0.692	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318802.1			18	32	0	0	0	0	18	32				
TRIOBP	11078	broad.mit.edu	37	22	38119740	38119740	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr22:38119740C>G	ENST00000406386.3	+	7	1432	c.1177C>G	c.(1177-1179)Ccc>Gcc	p.P393A		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	393					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					AGCCTCCTCTCCCAACAGAAC	0.562																																						uc003atr.2		NA																	0				central_nervous_system(1)	1						c.(1177-1179)CCC>GCC		TRIO and F-actin binding protein isoform 6							132.0	134.0	134.0					22																	38119740		1907	4130	6037	SO:0001583	missense	11078				actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding	g.chr22:38119740C>G	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1177C>G	22.37:g.38119740C>G	ENSP00000384312:p.Pro393Ala		Somatic				TRIOBP_uc003atu.2_Missense_Mutation_p.P221A|TRIOBP_uc003atq.1_Missense_Mutation_p.P393A|TRIOBP_uc003ats.1_Missense_Mutation_p.P221A	p.P393A	NM_001039141	NP_001034230	WXS	Illumina HiSeq	Unspecified	Q9H2D6	TARA_HUMAN			7	1448	+	Melanoma(58;0.0574)		393					B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	c.1177C>G	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940150	0.52972	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.40476	1.03	3.42	3.42	0.39159	.	.	.	.	.	T	0.32734	0.0839	L	0.44542	1.39	0.80722	D	1	B	0.26363	0.147	B	0.19148	0.024	T	0.11767	-1.0574	9	0.25751	T	0.34	.	12.3941	0.55374	0.0:1.0:0.0:0.0	.	393	Q9H2D6	TARA_HUMAN	A	393	ENSP00000384312:P393A	ENSP00000384312:P393A	P	+	1	0	TRIOBP	36449686	0.301000	0.24444	0.243000	0.24186	0.114000	0.19823	1.438000	0.35002	1.754000	0.51921	0.196000	0.17591	CCC		0.562	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2			96	102	0	0	0	0	96	102				
EP300	2033	broad.mit.edu	37	22	41574850	41574850	+	Missense_Mutation	SNP	A	A	C	rs202225885		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr22:41574850A>C	ENST00000263253.7	+	31	8354	c.7135A>C	c.(7135-7137)Aat>Cat	p.N2379H	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	2379					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						GCTTGCTAGCAATCCAGGCAT	0.537			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																													uc003azl.3		NA		Rec	yes		22	22q13	2033	T| N|F|Mis|O	300 kd E1A-Binding protein gene			"""L, E"""	MLL|RUNXBP2		colorectal|breast|pancreatic|AML|ALL|DLBCL		0				haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						c.(7135-7137)AAT>CAT		E1A binding protein p300		A	HIS/ASN	0,4406		0,0,2203	49.0	50.0	50.0		7135	3.4	1.0	22		50	1,8599	1.2+/-3.3	0,1,4299	yes	missense	EP300	NM_001429.3	68	0,1,6502	CC,CA,AA		0.0116,0.0,0.0077	possibly-damaging	2379/2415	41574850	1,13005	2203	4300	6503	SO:0001583	missense	2033	Rubinstein-Taybi_syndrome	Familial Cancer Database	Broad Thumb-Hallux syndrome	apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding	g.chr22:41574850A>C	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.7135A>C	22.37:g.41574850A>C	ENSP00000263253:p.Asn2379His		Somatic					p.N2379H	NM_001429	NP_001420	WXS	Illumina HiSeq	Unspecified	Q09472	EP300_HUMAN			31	7530	+			2379					B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	37	c.7135A>C	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	A	11.69	1.714598	0.30413	0.0	1.16E-4	ENSG00000100393	ENST00000263253	D	0.83673	-1.75	5.65	3.44	0.39384	.	0.000000	0.49916	D	0.000125	T	0.74183	0.3683	L	0.36672	1.1	0.35039	D	0.759586	P	0.44877	0.845	B	0.41271	0.352	T	0.76113	-0.3078	10	0.46703	T	0.11	-4.0134	8.8056	0.34936	0.7397:0.1333:0.0:0.127	.	2379	Q09472	EP300_HUMAN	H	2379	ENSP00000263253:N2379H	ENSP00000263253:N2379H	N	+	1	0	EP300	39904796	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.887000	0.56197	0.371000	0.24564	0.533000	0.62120	AAT		0.537	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429		43	51	0	0	0	0	43	51				
GRM7	2917	broad.mit.edu	37	3	7494344	7494344	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:7494344C>A	ENST00000357716.4	+	6	1499	c.1225C>A	c.(1225-1227)Cag>Aag	p.Q409K	GRM7_ENST00000389336.4_Missense_Mutation_p.Q409K|GRM7_ENST00000486284.1_Missense_Mutation_p.Q409K|GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000402647.2_Missense_Mutation_p.Q409K|GRM7_ENST00000403881.1_Missense_Mutation_p.Q409K	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	409					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						GGGTAAAGTCCAGTTCGTGAT	0.483																																						uc003bqm.2		NA																	0				ovary(4)|lung(3)	7						c.(1225-1227)CAG>AAG		glutamate receptor, metabotropic 7 isoform a	L-Glutamic Acid(DB00142)						130.0	111.0	118.0					3																	7494344		2203	4300	6503	SO:0001583	missense	2917				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding	g.chr3:7494344C>A	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1225C>A	3.37:g.7494344C>A	ENSP00000350348:p.Gln409Lys		Somatic				GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.Q409K|GRM7_uc003bql.2_Missense_Mutation_p.Q409K|GRM7_uc003bqn.1_5'UTR|GRM7_uc010hch.1_5'UTR	p.Q409K	NM_000844	NP_000835	WXS	Illumina HiSeq	Unspecified	Q14831	GRM7_HUMAN			6	1499	+			409			Extracellular (Potential).		Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	c.1225C>A	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.387846	0.82902	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492;ENST00000445087	D;D;D;D;D;D	0.86030	-2.06;-2.06;-2.06;-2.06;-2.06;-2.06	5.88	5.88	0.94601	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.93818	0.8023	M	0.91459	3.21	0.80722	D	1	P;D;D	0.62365	0.811;0.963;0.991	P;D;P	0.71414	0.879;0.973;0.804	D	0.92755	0.6219	10	0.33940	T	0.23	.	18.8061	0.92038	0.0:1.0:0.0:0.0	.	409;409;409	Q14831-5;Q14831;Q14831-2	.;GRM7_HUMAN;.	K	409;409;409;409;409;409;409;66	ENSP00000350348:Q409K;ENSP00000417536:Q409K;ENSP00000373987:Q409K;ENSP00000385664:Q409K;ENSP00000384585:Q409K;ENSP00000395035:Q66K	ENSP00000350348:Q409K	Q	+	1	0	GRM7	7469344	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	7.818000	0.86416	2.782000	0.95742	0.655000	0.94253	CAG		0.483	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844		27	18	1	0	3.73e-12	4.56e-12	27	18				
GRM7	2917	broad.mit.edu	37	3	7494377	7494377	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:7494377C>G	ENST00000357716.4	+	6	1532	c.1258C>G	c.(1258-1260)Cac>Gac	p.H420D	GRM7_ENST00000389336.4_Missense_Mutation_p.H420D|GRM7_ENST00000486284.1_Missense_Mutation_p.H420D|GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000402647.2_Missense_Mutation_p.H420D|GRM7_ENST00000403881.1_Missense_Mutation_p.H420D	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	420					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						TGCTATGGCTCACGCCCTTCA	0.488																																						uc003bqm.2		NA																	0				ovary(4)|lung(3)	7						c.(1258-1260)CAC>GAC		glutamate receptor, metabotropic 7 isoform a	L-Glutamic Acid(DB00142)						121.0	101.0	107.0					3																	7494377		2203	4300	6503	SO:0001583	missense	2917				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding	g.chr3:7494377C>G	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1258C>G	3.37:g.7494377C>G	ENSP00000350348:p.His420Asp		Somatic				GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.H420D|GRM7_uc003bql.2_Missense_Mutation_p.H420D|GRM7_uc003bqn.1_Missense_Mutation_p.H3D|GRM7_uc010hch.1_5'UTR	p.H420D	NM_000844	NP_000835	WXS	Illumina HiSeq	Unspecified	Q14831	GRM7_HUMAN			6	1532	+			420			Extracellular (Potential).		Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	c.1258C>G	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.373710	0.82573	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492;ENST00000445087	D;D;D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84;-1.84;-1.84	5.88	5.88	0.94601	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.94631	0.8269	M	0.93720	3.45	0.80722	D	1	D;D;D;D	0.69078	0.96;0.997;0.991;0.974	D;D;D;P	0.80764	0.948;0.994;0.991;0.813	D	0.95354	0.8449	10	0.87932	D	0	.	18.8061	0.92038	0.0:1.0:0.0:0.0	.	420;175;420;420	Q14831-5;Q59G95;Q14831;Q14831-2	.;.;GRM7_HUMAN;.	D	420;420;420;420;420;420;420;77	ENSP00000350348:H420D;ENSP00000417536:H420D;ENSP00000373987:H420D;ENSP00000385664:H420D;ENSP00000384585:H420D;ENSP00000395035:H77D	ENSP00000350348:H420D	H	+	1	0	GRM7	7469377	1.000000	0.71417	0.322000	0.25334	0.724000	0.41520	7.810000	0.86072	2.782000	0.95742	0.655000	0.94253	CAC		0.488	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844		18	12	0	0	0	0	18	12				
ATP2B2	491	broad.mit.edu	37	3	10428194	10428194	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:10428194C>A	ENST00000352432.4	-	6	979	c.910G>T	c.(910-912)Gtg>Ttg	p.V304L	ATP2B2_ENST00000383800.4_Intron|ATP2B2_ENST00000397077.1_Intron|ATP2B2_ENST00000343816.4_Missense_Mutation_p.V304L|ATP2B2_ENST00000360273.2_Missense_Mutation_p.V304L			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	304					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						CCCTTCTTCACACCTGTGTGA	0.507																																					Ovarian(125;1619 1709 15675 19819 38835)	uc003bvt.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(910-912)GTG>TTG		plasma membrane calcium ATPase 2 isoform 1							215.0	151.0	172.0					3																	10428194		2203	4300	6503	SO:0001583	missense	491				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding	g.chr3:10428194C>A	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.910G>T	3.37:g.10428194C>A	ENSP00000324172:p.Val304Leu		Somatic				ATP2B2_uc003bvv.2_Intron|ATP2B2_uc003bvw.2_Intron|ATP2B2_uc010hdo.2_Intron	p.V304L	NM_001001331	NP_001001331	WXS	Illumina HiSeq	Unspecified	Q01814	AT2B2_HUMAN			7	1349	-			304			Cytoplasmic (Potential).		O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	c.910G>T	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.543144	0.45280	.	.	ENSG00000157087	ENST00000352432;ENST00000360273;ENST00000343816;ENST00000342354	D;D;D	0.91686	-2.89;-2.89;-2.89	5.27	5.27	0.74061	ATPase, P-type, ATPase-associated domain (1);	2.152520	0.02454	N	0.085936	D	0.88422	0.6432	N	0.14661	0.345	0.35951	D	0.833924	B	0.02656	0.0	B	0.06405	0.002	T	0.57148	-0.7861	10	0.20519	T	0.43	-15.5843	18.8924	0.92410	0.0:1.0:0.0:0.0	.	304	Q01814	AT2B2_HUMAN	L	304	ENSP00000324172:V304L;ENSP00000353414:V304L;ENSP00000344677:V304L	ENSP00000342954:V304L	V	-	1	0	ATP2B2	10403194	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.070000	0.41491	2.466000	0.83321	0.555000	0.69702	GTG		0.507	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683		50	23	1	0	1.78e-24	2.43e-24	50	23				
XCR1	2829	broad.mit.edu	37	3	46062615	46062615	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:46062615G>A	ENST00000309285.3	-	2	1181	c.825C>T	c.(823-825)ctC>ctT	p.L275L	XCR1_ENST00000542109.1_Silent_p.L275L	NM_001024644.1	NP_001019815.1	P46094	XCR1_HUMAN	chemokine (C motif) receptor 1	275					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol (GO:0051209)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		GGGAGAAGGCGAGGTTGCGGC	0.567																																						uc003cpe.2		NA																	0				ovary(1)	1						c.(823-825)CTC>CTT		XC chemokine receptor 1							78.0	84.0	82.0					3																	46062615		2203	4300	6503	SO:0001819	synonymous_variant	2829				chemotaxis|G-protein signaling, coupled to cyclic nucleotide second messenger|inflammatory response	integral to plasma membrane	chemokine receptor activity	g.chr3:46062615G>A		CCDS2736.1	3p21.3-p21.1	2012-11-19	2006-01-13	2002-08-23	ENSG00000173578	ENSG00000173578		"""GPCR / Class A : Chemokine receptors : X-C motif"""	1625	protein-coding gene	gene with protein product		600552	"""chemokine (C motif) XC receptor 1"""	GPR5, CCXCR1		7832990, 10400311	Standard	NM_005283		Approved		uc003cpf.3	P46094	OTTHUMG00000133449	ENST00000309285.3:c.825C>T	3.37:g.46062615G>A			Somatic				uc003cpd.1_5'Flank|XCR1_uc003cpf.2_Silent_p.L275L	p.L275L	NM_005283	NP_005274	WXS	Illumina HiSeq	Unspecified	P46094	XCR1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)	3	1049	-			275			Helical; Name=7; (Potential).			Silent	SNP	ENST00000309285.3	37	c.825C>T	CCDS2736.1																																																																																				0.567	XCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257322.2			23	7	0	0	0	0	23	7				
C3orf84	646498	broad.mit.edu	37	3	49227304	49227304	+	Intron	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:49227304G>T	ENST00000545770.2	-	2	228				C3orf84_ENST00000443990.1_5'UTR|C3orf84_ENST00000432035.2_Intron	NM_001080528.2	NP_001073997.2	H3BNL1	CC084_HUMAN	chromosome 3 open reading frame 84																		CCTGTCTGTAGGGGAAAGATC	0.522																																						uc011bcj.1		NA																	0					0						c.(118-120)CTA>ATA		hypothetical LOC646498							180.0	177.0	178.0					3																	49227304		1931	4129	6060	SO:0001627	intron_variant	646498							g.chr3:49227304G>T		CCDS58831.1	3p21.31	2013-06-21			ENSG00000236980	ENSG00000236980			44666	protein-coding gene	gene with protein product							Standard	NM_001080528		Approved			H3BNL1	OTTHUMG00000156816	ENST00000545770.2:c.141+153C>A	3.37:g.49227304G>T			Somatic					p.L40I	NM_001080528	NP_001073997	WXS	Illumina HiSeq	Unspecified				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.00221)|KIRC - Kidney renal clear cell carcinoma(197;0.00247)	1	124	-									Missense_Mutation	SNP	ENST00000545770.2	37	c.118C>A	CCDS58831.1																																																																																				0.522	C3orf84-002	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345986.2			118	35	1	0	1.45e-55	2.16e-55	118	35				
ABHD14A	25864	broad.mit.edu	37	3	52011936	52011936	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:52011936T>C	ENST00000273596.3	+	2	187	c.119T>C	c.(118-120)cTg>cCg	p.L40P	ABHD14B_ENST00000483233.1_Intron|ACY1_ENST00000458031.2_5'UTR|ABHD14A-ACY1_ENST00000463937.1_Missense_Mutation_p.L40P|ABHD14A_ENST00000491470.1_Missense_Mutation_p.L40P	NM_015407.4	NP_056222.2	Q9BUJ0	ABHEA_HUMAN	abhydrolase domain containing 14A	40						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|stomach(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CTGCTGGGCCTGAGTCTGCTG	0.612																																						uc003dco.2		NA																	0					0						c.(118-120)CTG>CCG		abhydrolase domain containing 14A							97.0	105.0	102.0					3																	52011936		2203	4300	6503	SO:0001583	missense	25864					cytoplasm|integral to membrane	hydrolase activity	g.chr3:52011936T>C	AY358201	CCDS2843.1	3p21.1	2011-02-14			ENSG00000248487	ENSG00000248487		"""Abhydrolase domain containing"""	24538	protein-coding gene	gene with protein product							Standard	NM_015407		Approved	DKFZP564O243, DORZ1	uc003dco.3	Q9BUJ0	OTTHUMG00000157818	ENST00000273596.3:c.119T>C	3.37:g.52011936T>C	ENSP00000273596:p.Leu40Pro		Somatic				ABHD14B_uc003dcn.2_Intron|ABHD14A_uc010hlz.2_Missense_Mutation_p.L40P|ACY1_uc011bea.1_5'UTR	p.L40P	NM_015407	NP_056222	WXS	Illumina HiSeq	Unspecified	Q9BUJ0	ABHEA_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	2	229	+			40			Helical; Signal-anchor for type II membrane protein; (Potential).		Q6UXU8|Q9Y3T7	Missense_Mutation	SNP	ENST00000273596.3	37	c.119T>C	CCDS2843.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.618502	0.66787	.	.	ENSG00000248487;ENSG00000248487;ENSG00000248487;ENSG00000248487;ENSG00000114786	ENST00000497864;ENST00000494478;ENST00000273596;ENST00000491470;ENST00000463937	T;T;T;T;T	0.80393	0.82;0.7;0.82;0.53;-1.37	5.82	5.82	0.92795	.	0.341554	0.24965	N	0.034189	D	0.85630	0.5741	L	0.59436	1.845	0.44946	D	0.997961	D;D	0.64830	0.994;0.97	P;P	0.60173	0.87;0.754	D	0.86836	0.2014	10	0.87932	D	0	-4.4912	12.5732	0.56349	0.0:0.0:0.0:1.0	.	40;40	C9JMV9;Q9BUJ0	.;ABHEA_HUMAN	P	105;35;40;40;40	ENSP00000418242:L105P;ENSP00000420475:L35P;ENSP00000273596:L40P;ENSP00000418824:L40P;ENSP00000420487:L40P	ENSP00000273596:L40P	L	+	2	0	RP11-155D18.11;ABHD14A	51986976	1.000000	0.71417	0.996000	0.52242	0.542000	0.35054	4.845000	0.62853	2.234000	0.73211	0.533000	0.62120	CTG		0.612	ABHD14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349689.1	NM_015407		4	202	0	0	0	0	4	202				
LMOD3	56203	broad.mit.edu	37	3	69168975	69168975	+	Silent	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:69168975T>C	ENST00000420581.2	-	2	710	c.531A>G	c.(529-531)gcA>gcG	p.A177A	LMOD3_ENST00000475434.1_Silent_p.A177A|LMOD3_ENST00000489031.1_Silent_p.A177A	NM_198271.3	NP_938012.2	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	177	Glu-rich.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)	13		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)		TTTGTTCCTTTGCTTTGCCTT	0.418																																						uc003dns.2		NA																	0				ovary(1)	1						c.(529-531)GCA>GCG		leiomodin 3 (fetal)							126.0	114.0	118.0					3																	69168975		2016	4175	6191	SO:0001819	synonymous_variant	56203					cytoplasm|cytoskeleton	tropomyosin binding	g.chr3:69168975T>C	AK096900	CCDS46862.1	3p14.1	2003-03-07			ENSG00000163380	ENSG00000163380			6649	protein-coding gene	gene with protein product							Standard	NM_198271		Approved		uc003dns.2	Q0VAK6	OTTHUMG00000158774	ENST00000420581.2:c.531A>G	3.37:g.69168975T>C			Somatic				LMOD3_uc003dnt.2_Silent_p.A177A	p.A177A	NM_198271	NP_938012	WXS	Illumina HiSeq	Unspecified	Q0VAK6	LMOD3_HUMAN		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)	2	740	-		Lung NSC(201;0.0193)|Prostate(884;0.174)	177			Glu-rich.		B4DT85|Q0JTT2|Q5JPG6|Q8IUK4|Q96LS4	Silent	SNP	ENST00000420581.2	37	c.531A>G	CCDS46862.1																																																																																				0.418	LMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352138.1	XM_067529		10	5	0	0	0	0	10	5				
CADM2	253559	broad.mit.edu	37	3	85851229	85851229	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:85851229G>T	ENST00000407528.2	+	2	156	c.94G>T	c.(94-96)Gta>Tta	p.V32L	CADM2_ENST00000383699.3_Missense_Mutation_p.V41L|CADM2-AS2_ENST00000467225.1_RNA|CADM2_ENST00000405615.2_Missense_Mutation_p.V34L	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	32	Ig-like V-type.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		AACACAGAATGTAACCGTTGT	0.403																																						uc003dqj.2		NA																	0				ovary(1)|lung(1)|kidney(1)|skin(1)	4						c.(94-96)GTA>TTA		immunoglobulin superfamily, member 4D							102.0	88.0	93.0					3																	85851229		2203	4300	6503	SO:0001583	missense	253559				adherens junction organization|cell junction assembly	integral to membrane|plasma membrane		g.chr3:85851229G>T	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.94G>T	3.37:g.85851229G>T	ENSP00000384575:p.Val32Leu		Somatic				CADM2_uc003dqk.2_Missense_Mutation_p.V41L|CADM2_uc003dql.2_Missense_Mutation_p.V34L	p.V32L	NM_153184	NP_694854	WXS	Illumina HiSeq	Unspecified	Q8N3J6	CADM2_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)	2	720	+		Lung NSC(201;0.0148)	32			Ig-like V-type.|Extracellular (Potential).		G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	37	c.94G>T	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449829	0.63290	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	T;T;T	0.66460	-0.21;-0.21;-0.21	5.08	5.08	0.68730	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.277838	0.34088	N	0.004264	T	0.60418	0.2267	L	0.39514	1.22	0.58432	D	0.999999	B;B;B	0.20887	0.009;0.003;0.049	B;B;B	0.15484	0.005;0.002;0.013	T	0.55982	-0.8054	10	0.37606	T	0.19	.	18.8367	0.92165	0.0:0.0:1.0:0.0	.	34;41;32	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	L	41;32;34	ENSP00000373200:V41L;ENSP00000384575:V32L;ENSP00000384193:V34L	ENSP00000373200:V41L	V	+	1	0	CADM2	85933919	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	9.420000	0.97426	2.519000	0.84933	0.544000	0.68410	GTA		0.403	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184		53	10	1	0	1.47e-25	2.02e-25	53	10				
PROS1	5627	broad.mit.edu	37	3	93615489	93615489	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:93615489A>T	ENST00000394236.3	-	9	1212	c.896T>A	c.(895-897)tTa>tAa	p.L299*	PROS1_ENST00000407433.1_Nonsense_Mutation_p.L168*	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	299	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	CAAGTAAAGTAATTCATACTT	0.358																																						uc003drb.3		NA																	0				large_intestine(1)	1						c.(895-897)TTA>TAA		protein S, alpha preproprotein	Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)						80.0	88.0	85.0					3																	93615489		2202	4300	6502	SO:0001587	stop_gained	5627				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity	g.chr3:93615489A>T		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.896T>A	3.37:g.93615489A>T	ENSP00000377783:p.Leu299*		Somatic				PROS1_uc010hoo.2_Nonsense_Mutation_p.L168*|PROS1_uc003dqz.3_Nonsense_Mutation_p.L168*	p.L299*	NM_000313	NP_000304	WXS	Illumina HiSeq	Unspecified	P07225	PROS_HUMAN			9	1237	-			299			Laminin G-like 1.		A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Nonsense_Mutation	SNP	ENST00000394236.3	37	c.896T>A	CCDS2923.1	.	.	.	.	.	.	.	.	.	.	A	37	6.241244	0.97403	.	.	ENSG00000184500	ENST00000394236;ENST00000407433	.	.	.	4.04	4.04	0.47022	.	0.066149	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.6888	0.51503	1.0:0.0:0.0:0.0	.	.	.	.	X	299;168	.	ENSP00000377783:L299X	L	-	2	0	PROS1	95098179	1.000000	0.71417	0.999000	0.59377	0.537000	0.34900	6.840000	0.75369	1.703000	0.51240	0.254000	0.18369	TTA		0.358	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313		79	242	0	0	0	0	79	242				
ST3GAL6	10402	broad.mit.edu	37	3	98507004	98507004	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:98507004C>G	ENST00000483910.1	+	7	845	c.556C>G	c.(556-558)Ctc>Gtc	p.L186V	ST3GAL6_ENST00000394162.1_Missense_Mutation_p.L186V|ST3GAL6_ENST00000265261.6_Missense_Mutation_p.L68V|ST3GAL6_ENST00000462152.1_3'UTR	NM_001271146.1	NP_001258075.1	Q9Y274	SIA10_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 6	186					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|cellular response to interleukin-6 (GO:0071354)|glycolipid metabolic process (GO:0006664)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,3-sialyltransferase activity (GO:0052798)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(1)	19						GACAGTGATTCTCACTGCTTT	0.383																																						uc003dsz.2		NA																	0				ovary(1)	1						c.(556-558)CTC>GTC		alpha2,3-sialyltransferase VI							104.0	98.0	100.0					3																	98507004		2203	4300	6503	SO:0001583	missense	10402				amino sugar metabolic process|glycolipid metabolic process|protein glycosylation|protein lipoylation	integral to Golgi membrane	sialyltransferase activity	g.chr3:98507004C>G	AF119391	CCDS2933.1, CCDS59452.1, CCDS74968.1	3q12.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000064225	ENSG00000064225		"""Sialyltransferases"""	18080	protein-coding gene	gene with protein product		607156	"""sialyltransferase 10 (alpha-2,3-sialyltransferase VI)"""	SIAT10		10206952	Standard	NM_006100		Approved	ST3GALVI	uc010hpd.4	Q9Y274	OTTHUMG00000159047	ENST00000483910.1:c.556C>G	3.37:g.98507004C>G	ENSP00000417376:p.Leu186Val		Somatic				ST3GAL6_uc003dsy.2_Missense_Mutation_p.L100V|ST3GAL6_uc003dta.2_Missense_Mutation_p.L68V|ST3GAL6_uc003dtb.2_Missense_Mutation_p.L42V|ST3GAL6_uc003dtc.2_Missense_Mutation_p.L186V|ST3GAL6_uc010hpd.2_Missense_Mutation_p.L239V	p.L186V	NM_006100	NP_006091	WXS	Illumina HiSeq	Unspecified	Q9Y274	SIA10_HUMAN			7	792	+			186			Lumenal (Potential).		B2RCH2|B3KMI1|D3DN39|F8W6U0	Missense_Mutation	SNP	ENST00000483910.1	37	c.556C>G	CCDS2933.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.691780	0.48097	.	.	ENSG00000064225	ENST00000483910;ENST00000265261;ENST00000497008;ENST00000486334;ENST00000394162;ENST00000485391;ENST00000492254;ENST00000485145	T;T;T;T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36;1.36;1.36;1.36	4.84	4.84	0.62591	.	0.099447	0.43579	D	0.000541	T	0.51890	0.1701	M	0.82323	2.585	0.42926	D	0.994304	P;D;B	0.54047	0.955;0.964;0.349	P;P;B	0.49226	0.472;0.603;0.256	T	0.61816	-0.6985	10	0.66056	D	0.02	-37.5002	15.8184	0.78621	0.0:1.0:0.0:0.0	.	209;68;186	C9J480;F8W6U0;Q9Y274	.;.;SIA10_HUMAN	V	186;68;154;186;186;154;209;100	ENSP00000417376:L186V;ENSP00000265261:L68V;ENSP00000417584:L154V;ENSP00000418896:L186V;ENSP00000377717:L186V;ENSP00000418650:L154V;ENSP00000417201:L209V;ENSP00000419202:L100V	ENSP00000265261:L68V	L	+	1	0	ST3GAL6	99989694	1.000000	0.71417	0.884000	0.34674	0.264000	0.26372	1.926000	0.40084	2.671000	0.90904	0.563000	0.77884	CTC		0.383	ST3GAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353013.2	NM_006100		50	124	0	0	0	0	50	124				
IMPG2	50939	broad.mit.edu	37	3	100962535	100962535	+	Silent	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:100962535C>A	ENST00000193391.7	-	13	2827	c.2640G>T	c.(2638-2640)gtG>gtT	p.V880V		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	880					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	TGGGCCAAGCCACACTAACCA	0.458																																						uc003duq.1		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(2638-2640)GTG>GTT		interphotoreceptor matrix proteoglycan 2							151.0	136.0	141.0					3																	100962535		2203	4300	6503	SO:0001819	synonymous_variant	50939				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity	g.chr3:100962535C>A	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.2640G>T	3.37:g.100962535C>A			Somatic				IMPG2_uc011bhe.1_Silent_p.V743V	p.V880V	NM_016247	NP_057331	WXS	Illumina HiSeq	Unspecified	Q9BZV3	IMPG2_HUMAN			13	2843	-			880			Extracellular (Potential).		A8MWT5|Q9UKD4|Q9UKK5	Silent	SNP	ENST00000193391.7	37	c.2640G>T	CCDS2940.1																																																																																				0.458	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3			69	41	1	0	5.45e-27	7.55e-27	69	41				
MYH15	22989	broad.mit.edu	37	3	108189618	108189618	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:108189618C>T	ENST00000273353.3	-	14	1426	c.1370G>A	c.(1369-1371)aGg>aAg	p.R457K		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	457	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						ATCCAGGGCCCTGTTGATCCG	0.458																																						uc003dxa.1		NA																	0				ovary(5)|central_nervous_system(2)	7						c.(1369-1371)AGG>AAG		myosin, heavy polypeptide 15							95.0	90.0	91.0					3																	108189618		1987	4140	6127	SO:0001583	missense	22989					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr3:108189618C>T	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.1370G>A	3.37:g.108189618C>T	ENSP00000273353:p.Arg457Lys		Somatic					p.R457K	NM_014981	NP_055796	WXS	Illumina HiSeq	Unspecified	Q9Y2K3	MYH15_HUMAN			14	1427	-			457			Myosin head-like.			Missense_Mutation	SNP	ENST00000273353.3	37	c.1370G>A	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	C	13.49	2.252726	0.39797	.	.	ENSG00000144821	ENST00000273353	D	0.86432	-2.12	5.77	0.147	0.14838	Myosin head, motor domain (2);	.	.	.	.	T	0.69984	0.3172	N	0.05619	-0.005	0.09310	N	1	B	0.11235	0.004	B	0.18871	0.023	T	0.55866	-0.8073	9	0.23302	T	0.38	.	5.4089	0.16336	0.0:0.3221:0.1481:0.5298	.	457	Q9Y2K3	MYH15_HUMAN	K	457	ENSP00000273353:R457K	ENSP00000273353:R457K	R	-	2	0	MYH15	109672308	0.609000	0.26975	0.002000	0.10522	0.987000	0.75469	0.370000	0.20433	0.231000	0.21079	0.650000	0.86243	AGG		0.458	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		27	53	0	0	0	0	27	53				
MORC1	27136	broad.mit.edu	37	3	108813861	108813861	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:108813861C>A	ENST00000483760.1	-	7	521	c.478G>T	c.(478-480)Gat>Tat	p.D160Y	MORC1_ENST00000232603.5_Missense_Mutation_p.D160Y					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						TTCTGGGGATCATCTGTGACA	0.313																																						uc003dxl.2		NA																	0				ovary(3)|skin(3)|breast(2)	8						c.(478-480)GAT>TAT		MORC family CW-type zinc finger 1							49.0	52.0	51.0					3																	108813861		2202	4299	6501	SO:0001583	missense	27136				cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding	g.chr3:108813861C>A	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.478G>T	3.37:g.108813861C>A	ENSP00000417282:p.Asp160Tyr		Somatic				MORC1_uc011bhn.1_Missense_Mutation_p.D160Y	p.D160Y	NM_014429	NP_055244	WXS	Illumina HiSeq	Unspecified	Q86VD1	MORC1_HUMAN			7	565	-			160						Missense_Mutation	SNP	ENST00000483760.1	37	c.478G>T		.	.	.	.	.	.	.	.	.	.	C	15.34	2.805658	0.50315	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.06849	3.25;3.26	5.43	5.43	0.79202	ATPase-like, ATP-binding domain (1);	0.000000	0.38272	N	0.001754	T	0.17959	0.0431	L	0.36672	1.1	0.40821	D	0.983504	D;D	0.89917	1.0;0.98	D;P	0.79784	0.993;0.793	T	0.00254	-1.1874	10	0.87932	D	0	-20.3924	10.0315	0.42103	0.0:0.9112:0.0:0.0888	.	160;160	E7ERX1;Q86VD1	.;MORC1_HUMAN	Y	160	ENSP00000232603:D160Y;ENSP00000417282:D160Y	ENSP00000232603:D160Y	D	-	1	0	MORC1	110296551	0.997000	0.39634	0.996000	0.52242	0.273000	0.26683	1.280000	0.33202	2.810000	0.96702	0.650000	0.86243	GAT		0.313	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1			24	89	1	0	7.93e-12	9.59e-12	24	89				
GTF2E1	2960	broad.mit.edu	37	3	120489717	120489717	+	Silent	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:120489717G>T	ENST00000283875.5	+	3	684	c.591G>T	c.(589-591)gtG>gtT	p.V197V		NM_005513.2	NP_005504.2	P29083	T2EA_HUMAN	general transcription factor IIE, polypeptide 1, alpha 56kDa	197					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)	22				GBM - Glioblastoma multiforme(114;0.159)		CAGAGGATGTGAACTTGGCCT	0.443																																						uc003edz.3		NA																	0				ovary(1)	1						c.(589-591)GTG>GTT		general transcription factor IIE, polypeptide 1,							250.0	243.0	245.0					3																	120489717		2203	4300	6503	SO:0001819	synonymous_variant	2960				interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding|zinc ion binding	g.chr3:120489717G>T	S67859	CCDS3002.1	3q21-q24	2010-03-23	2002-08-29		ENSG00000153767	ENSG00000153767		"""General transcription factors"""	4650	protein-coding gene	gene with protein product		189962	"""general transcription factor IIE, polypeptide 1 (alpha subunit, 56kD)"""			1454543, 8162052	Standard	NM_005513		Approved	TFIIE-A, FE	uc003edz.4	P29083	OTTHUMG00000159667	ENST00000283875.5:c.591G>T	3.37:g.120489717G>T			Somatic					p.V197V	NM_005513	NP_005504	WXS	Illumina HiSeq	Unspecified	P29083	T2EA_HUMAN		GBM - Glioblastoma multiforme(114;0.159)	3	705	+			197					Q16103	Silent	SNP	ENST00000283875.5	37	c.591G>T	CCDS3002.1																																																																																				0.443	GTF2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356770.1	NM_005513		157	467	1	0	3.12e-78	4.69e-78	157	467				
HEG1	57493	broad.mit.edu	37	3	124738111	124738111	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:124738111C>A	ENST00000311127.4	-	5	1650	c.1583G>T	c.(1582-1584)cGt>cTt	p.R528L	HEG1_ENST00000477536.1_5'UTR	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	528	Ser-rich.				cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						CTCACTCGAACGTTCTCCACG	0.458																																						uc003ehs.3		NA																	0				ovary(2)	2						c.(1582-1584)CGT>CTT		HEG homolog 1 precursor							75.0	74.0	74.0					3																	124738111		2002	4190	6192	SO:0001583	missense	57493					extracellular region|integral to membrane	calcium ion binding	g.chr3:124738111C>A	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.1583G>T	3.37:g.124738111C>A	ENSP00000311502:p.Arg528Leu		Somatic				HEG1_uc011bke.1_Missense_Mutation_p.R528L	p.R528L	NM_020733	NP_065784	WXS	Illumina HiSeq	Unspecified	Q9ULI3	HEG1_HUMAN			5	1651	-			528			Extracellular (Potential).|Ser-rich.		Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	ENST00000311127.4	37	c.1583G>T	CCDS46898.1	.	.	.	.	.	.	.	.	.	.	C	10.09	1.253894	0.22965	.	.	ENSG00000173706	ENST00000311127	D	0.88124	-2.34	5.13	-1.33	0.09172	.	.	.	.	.	T	0.81074	0.4747	L	0.44542	1.39	0.09310	N	1	P;P	0.47841	0.901;0.649	P;B	0.46543	0.52;0.321	T	0.69694	-0.5076	9	0.25106	T	0.35	.	5.1057	0.14783	0.0:0.3555:0.1666:0.4779	.	528;528	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	L	528	ENSP00000311502:R528L	ENSP00000311502:R528L	R	-	2	0	HEG1	126220801	0.001000	0.12720	0.001000	0.08648	0.974000	0.67602	-0.383000	0.07398	-0.141000	0.11374	0.650000	0.86243	CGT		0.458	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386		3	91	1	0	0.00909568	0.00950257	3	91				
KIAA1257	57501	broad.mit.edu	37	3	128712028	128712028	+	Silent	SNP	C	C	T	rs200889481	byFrequency	TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:128712028C>T	ENST00000265068.5	-	2	287	c.120G>A	c.(118-120)aaG>aaA	p.K40K	KIAA1257_ENST00000511438.1_Silent_p.K40K|KIAA1257_ENST00000515659.1_5'Flank|KIAA1257_ENST00000510149.1_Intron	NM_020741.2	NP_065792.1	Q9ULG3	K1257_HUMAN	KIAA1257	40										breast(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(2)	14						GGGCCCTGGCCTTGGCCTTCA	0.612																																						uc003elj.3		NA																	0					0						c.(118-120)AAG>AAA		hypothetical protein LOC57501							63.0	73.0	69.0					3																	128712028		2160	4261	6421	SO:0001819	synonymous_variant	57501							g.chr3:128712028C>T	AB033083	CCDS46905.1	3q21.3	2011-11-07			ENSG00000114656	ENSG00000114656			29231	protein-coding gene	gene with protein product						10574462	Standard	NM_020741		Approved		uc003elj.4	Q9ULG3	OTTHUMG00000159946	ENST00000265068.5:c.120G>A	3.37:g.128712028C>T			Somatic				KIAA1257_uc003elg.1_Silent_p.K40K|KIAA1257_uc003eli.3_5'Flank	p.K40K	NM_020741	NP_065792	WXS	Illumina HiSeq	Unspecified	Q9ULG3	K1257_HUMAN			2	316	-			40					Q8IXY7|Q8N5T4	Silent	SNP	ENST00000265068.5	37	c.120G>A	CCDS46905.1																																																																																				0.612	KIAA1257-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000358430.1	NM_020741		5	166	0	0	0	0	5	166				
NPHP3	27031	broad.mit.edu	37	3	132408077	132408077	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:132408077C>T	ENST00000337331.5	-	20	2810	c.2724G>A	c.(2722-2724)tgG>tgA	p.W908*	NPHP3_ENST00000326682.8_3'UTR	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	908					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CAACAAACTGCCAATAACTCA	0.383																																						uc003epe.1		NA																	0				ovary(1)	1						c.(2722-2724)TGG>TGA		nephrocystin 3							106.0	102.0	103.0					3																	132408077		2203	4300	6503	SO:0001587	stop_gained	27031				maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding	g.chr3:132408077C>T	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.2724G>A	3.37:g.132408077C>T	ENSP00000338766:p.Trp908*		Somatic				NPHP3_uc003epd.1_Nonsense_Mutation_p.W150*	p.W908*	NM_153240	NP_694972	WXS	Illumina HiSeq	Unspecified	Q7Z494	NPHP3_HUMAN			20	2801	-			908			TPR 2.		Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Nonsense_Mutation	SNP	ENST00000337331.5	37	c.2724G>A	CCDS3078.1	.	.	.	.	.	.	.	.	.	.	C	41	9.125498	0.99073	.	.	ENSG00000113971	ENST00000393144;ENST00000337331	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.89	20.3932	0.98965	0.0:1.0:0.0:0.0	.	.	.	.	X	188;908	.	ENSP00000338766:W908X	W	-	3	0	NPHP3	133890767	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.298000	0.78815	2.824000	0.97209	0.655000	0.94253	TGG		0.383	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240		76	166	0	0	0	0	76	166				
PRR23C	389152	broad.mit.edu	37	3	138763109	138763109	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:138763109C>T	ENST00000413199.1	-	1	625	c.354G>A	c.(352-354)tgG>tgA	p.W118*	PRR23C_ENST00000502927.2_Nonsense_Mutation_p.W118*|MRPS22_ENST00000495075.1_Intron	NM_001134657.1	NP_001128129.1	Q6ZRP0	PR23C_HUMAN	proline rich 23C	118										breast(2)|lung(7)|skin(2)	11						GGCCGGCAGACCAGTCGCCCT	0.637																																						uc011bmt.1		NA																	0				skin(1)	1						c.(352-354)TGG>TGA		proline rich 23C							35.0	35.0	35.0					3																	138763109		692	1591	2283	SO:0001587	stop_gained	389152							g.chr3:138763109C>T		CCDS46924.1	3q22.3	2014-06-03				ENSG00000233701			37173	protein-coding gene	gene with protein product							Standard	NM_001134657		Approved	FLJ46210	uc011bmt.1	Q6ZRP0		ENST00000413199.1:c.354G>A	3.37:g.138763109C>T	ENSP00000396648:p.Trp118*		Somatic					p.W118*	NM_001134657	NP_001128129	WXS	Illumina HiSeq	Unspecified	Q6ZRP0	PR23C_HUMAN			1	626	-			118						Nonsense_Mutation	SNP	ENST00000413199.1	37	c.354G>A	CCDS46924.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703311	0.68501	.	.	ENSG00000233701	ENST00000413199;ENST00000502927	.	.	.	3.28	-6.55	0.01854	.	3.176910	0.01150	N	0.006388	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	1.1812	0.01845	0.305:0.1897:0.3276:0.1776	.	.	.	.	X	118	.	ENSP00000396648:W118X	W	-	3	0	PRR23C	140245799	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.097000	0.03349	-2.401000	0.00578	-0.519000	0.04390	TGG		0.637	PRR23C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361502.1	NM_001134657		6	24	0	0	0	0	6	24				
HLTF	6596	broad.mit.edu	37	3	148778569	148778569	+	Missense_Mutation	SNP	T	T	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:148778569T>G	ENST00000310053.5	-	11	1430	c.1237A>C	c.(1237-1239)Aaa>Caa	p.K413Q	HLTF_ENST00000392912.2_Missense_Mutation_p.K413Q|HLTF_ENST00000494055.1_Missense_Mutation_p.K413Q|HLTF_ENST00000465259.1_Missense_Mutation_p.K413Q	NM_003071.3|NM_139048.2	NP_003062.2|NP_620636.1	Q14527	HLTF_HUMAN	helicase-like transcription factor	413					chromatin modification (GO:0016568)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			ATGTTACCTTTCATTTTCTGC	0.299																																						uc003ewq.1		NA																	0				ovary(1)	1						c.(1237-1239)AAA>CAA		helicase-like transcription factor							115.0	113.0	114.0					3																	148778569		2203	4295	6498	SO:0001583	missense	6596				chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding	g.chr3:148778569T>G	L34673	CCDS33875.1	3q25.1-q26.1	2006-11-09	2006-11-09	2006-11-09	ENSG00000071794	ENSG00000071794		"""RING-type (C3HC4) zinc fingers"""	11099	protein-coding gene	gene with protein product		603257	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3"""	SNF2L3, SMARCA3		7558014	Standard	NM_139048		Approved	HIP116A, HLTF1, RNF80	uc003ewr.1	Q14527	OTTHUMG00000159534	ENST00000310053.5:c.1237A>C	3.37:g.148778569T>G	ENSP00000308944:p.Lys413Gln		Somatic				HLTF_uc003ewr.1_Missense_Mutation_p.K413Q|HLTF_uc003ews.1_Missense_Mutation_p.K413Q|HLTF_uc010hve.1_Missense_Mutation_p.K413Q	p.K413Q	NM_139048	NP_620636	WXS	Illumina HiSeq	Unspecified	Q14527	HLTF_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		11	1455	-			413					D3DNH3|Q14536|Q16051|Q7KYJ6|Q86YA5|Q92652|Q96KM9	Missense_Mutation	SNP	ENST00000310053.5	37	c.1237A>C	CCDS33875.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.988433	0.74589	.	.	ENSG00000071794	ENST00000465259;ENST00000310053;ENST00000392912;ENST00000494055;ENST00000416117	D;D;D;D	0.90069	-2.61;-2.6;-2.6;-2.6	6.07	6.07	0.98685	DEAD-like helicase (1);	.	.	.	.	D	0.92267	0.7547	M	0.73598	2.24	0.38668	D	0.952242	D;D;D	0.67145	0.996;0.996;0.996	P;D;P	0.64321	0.852;0.924;0.852	D	0.90525	0.4491	9	0.11182	T	0.66	.	13.0268	0.58819	0.0:0.0:0.0:1.0	.	413;413;413	Q59GQ7;A8K5B6;Q14527	.;.;HLTF_HUMAN	Q	413;413;413;413;410	ENSP00000420745:K413Q;ENSP00000308944:K413Q;ENSP00000376644:K413Q;ENSP00000420429:K413Q	ENSP00000308944:K413Q	K	-	1	0	HLTF	150261259	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	4.072000	0.57563	2.330000	0.79161	0.477000	0.44152	AAA		0.299	HLTF-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356064.1			38	69	0	0	0	0	38	69				
HLTF	6596	broad.mit.edu	37	3	148792018	148792018	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:148792018C>A	ENST00000310053.5	-	4	706	c.513G>T	c.(511-513)ttG>ttT	p.L171F	HLTF_ENST00000392912.2_Missense_Mutation_p.L171F|HLTF_ENST00000494055.1_Missense_Mutation_p.L171F|HLTF_ENST00000465259.1_Missense_Mutation_p.L171F	NM_003071.3|NM_139048.2	NP_003062.2|NP_620636.1	Q14527	HLTF_HUMAN	helicase-like transcription factor	171					chromatin modification (GO:0016568)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GTGCAGGACCCAATTTAAATC	0.338																																						uc003ewq.1		NA																	0				ovary(1)	1						c.(511-513)TTG>TTT		helicase-like transcription factor							90.0	88.0	89.0					3																	148792018		2203	4300	6503	SO:0001583	missense	6596				chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding	g.chr3:148792018C>A	L34673	CCDS33875.1	3q25.1-q26.1	2006-11-09	2006-11-09	2006-11-09	ENSG00000071794	ENSG00000071794		"""RING-type (C3HC4) zinc fingers"""	11099	protein-coding gene	gene with protein product		603257	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3"""	SNF2L3, SMARCA3		7558014	Standard	NM_139048		Approved	HIP116A, HLTF1, RNF80	uc003ewr.1	Q14527	OTTHUMG00000159534	ENST00000310053.5:c.513G>T	3.37:g.148792018C>A	ENSP00000308944:p.Leu171Phe		Somatic				HLTF_uc003ewr.1_Missense_Mutation_p.L171F|HLTF_uc003ews.1_Missense_Mutation_p.L171F|HLTF_uc010hve.1_Missense_Mutation_p.L171F	p.L171F	NM_139048	NP_620636	WXS	Illumina HiSeq	Unspecified	Q14527	HLTF_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		4	731	-			171					D3DNH3|Q14536|Q16051|Q7KYJ6|Q86YA5|Q92652|Q96KM9	Missense_Mutation	SNP	ENST00000310053.5	37	c.513G>T	CCDS33875.1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.532110	0.45073	.	.	ENSG00000071794	ENST00000465259;ENST00000310053;ENST00000392912;ENST00000494055;ENST00000416117;ENST00000392913	D;D;D;D	0.90900	-2.75;-2.75;-2.75;-2.75	5.41	5.41	0.78517	.	.	.	.	.	D	0.90672	0.7074	L	0.34521	1.04	0.52099	D	0.999941	D;B;B	0.65815	0.995;0.006;0.006	D;B;B	0.67548	0.952;0.012;0.012	D	0.90176	0.4239	9	0.72032	D	0.01	-2.0811	7.2595	0.26195	0.1702:0.7447:0.0:0.0851	.	171;171;171	Q59GQ7;A8K5B6;Q14527	.;.;HLTF_HUMAN	F	171;171;171;171;168;168	ENSP00000420745:L171F;ENSP00000308944:L171F;ENSP00000376644:L171F;ENSP00000420429:L171F	ENSP00000308944:L171F	L	-	3	2	HLTF	150274708	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.234000	0.43035	2.550000	0.86006	0.555000	0.69702	TTG		0.338	HLTF-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356064.1			21	100	1	0	4.35e-09	5.08e-09	21	100				
GPR149	344758	broad.mit.edu	37	3	154138918	154138918	+	Silent	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:154138918T>C	ENST00000389740.2	-	3	1632	c.1533A>G	c.(1531-1533)ccA>ccG	p.P511P		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	511					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GTCTTCTTTCTGGCCCTTCAG	0.408																																						uc003faa.2		NA																	0				ovary(6)	6						c.(1531-1533)CCA>CCG		G protein-coupled receptor 149							133.0	122.0	126.0					3																	154138918		1842	4079	5921	SO:0001819	synonymous_variant	344758					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr3:154138918T>C	AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.1533A>G	3.37:g.154138918T>C			Somatic					p.P511P	NM_001038705	NP_001033794	WXS	Illumina HiSeq	Unspecified	Q86SP6	GP149_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)		3	1633	-			511			Cytoplasmic (Potential).			Silent	SNP	ENST00000389740.2	37	c.1533A>G	CCDS43162.1																																																																																				0.408	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	XM_293580		79	163	0	0	0	0	79	163				
IQCJ	654502	broad.mit.edu	37	3	158983064	158983064	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:158983064G>A	ENST00000451172.1	+	5	457	c.352G>A	c.(352-354)Ggg>Agg	p.G118R	IQCJ-SCHIP1_ENST00000485419.1_Intron|IQCJ-SCHIP1_ENST00000467442.1_Intron|IQCJ_ENST00000482126.1_Missense_Mutation_p.G91R|IQCJ-SCHIP1_ENST00000476809.1_Intron	NM_001042705.2	NP_001036170.1	Q1A5X6	IQCJ_HUMAN	IQ motif containing J	118										cervix(1)|endometrium(2)|large_intestine(2)|lung(10)	15			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			GCAGTCACCTGGGGACAAGTT	0.493																																						uc003fcp.1		NA																	0					0						c.(352-354)GGG>AGG		IQ motif containing J isoform CaMBPv1							147.0	145.0	145.0					3																	158983064		1919	4135	6054	SO:0001583	missense	654502							g.chr3:158983064G>A	DQ309553, DQ309554	CCDS46946.1, CCDS46947.1, CCDS56290.1	3q25.32	2011-03-24			ENSG00000214216	ENSG00000214216			32406	protein-coding gene	gene with protein product		611622				17045569	Standard	NM_001042705		Approved			Q1A5X6	OTTHUMG00000166440	ENST00000451172.1:c.352G>A	3.37:g.158983064G>A	ENSP00000402153:p.Gly118Arg		Somatic				SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|IQCJ_uc010hvy.1_Missense_Mutation_p.G91R	p.G118R	NM_001042705	NP_001036170	WXS	Illumina HiSeq	Unspecified	Q1A5X6	IQCJ_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)		5	457	+			118					B7ZMM2|B9EH97|Q1A5X5	Missense_Mutation	SNP	ENST00000451172.1	37	c.352G>A	CCDS46946.1	.	.	.	.	.	.	.	.	.	.	G	5.446	0.267393	0.10294	.	.	ENSG00000214216	ENST00000451172;ENST00000482126	.	.	.	1.97	-3.94	0.04130	.	1.066170	0.07750	U	0.948375	T	0.16896	0.0406	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.15809	-1.0424	9	0.87932	D	0	.	0.2902	0.00257	0.3734:0.1493:0.177:0.3003	.	91;118	B7ZMM2;Q1A5X6	.;IQCJ_HUMAN	R	118;91	.	ENSP00000402153:G118R	G	+	1	0	IQCJ	160465758	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.316000	0.08071	-2.533000	0.00490	-1.154000	0.01816	GGG		0.493	IQCJ-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352395.1	NM_001042705.1		215	150	0	0	0	0	215	150				
SI	6476	broad.mit.edu	37	3	164737396	164737396	+	Silent	SNP	G	G	T	rs150297357	byFrequency	TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:164737396G>T	ENST00000264382.3	-	28	3479	c.3417C>A	c.(3415-3417)ccC>ccA	p.P1139P		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1139	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CTACACCAGGGGGTTGGTCTC	0.443										HNSCC(35;0.089)																												uc003fei.2		NA																	0				ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(3415-3417)CCC>CCA		sucrase-isomaltase	Acarbose(DB00284)						125.0	116.0	119.0					3																	164737396		2203	4300	6503	SO:0001819	synonymous_variant	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164737396G>T	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3417C>A	3.37:g.164737396G>T		HNSCC(35;0.089)	Somatic					p.P1139P	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			28	3479	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	1139			Sucrase.|Lumenal.		A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	ENST00000264382.3	37	c.3417C>A	CCDS3196.1																																																																																				0.443	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		82	76	1	0	1.02e-41	1.49e-41	82	76				
SI	6476	broad.mit.edu	37	3	164739083	164739083	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:164739083T>C	ENST00000264382.3	-	27	3250	c.3188A>G	c.(3187-3189)tAt>tGt	p.Y1063C		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1063	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TTCCACATCATAAAGTCTGTC	0.353										HNSCC(35;0.089)																												uc003fei.2		NA																	0				ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(3187-3189)TAT>TGT		sucrase-isomaltase	Acarbose(DB00284)						194.0	195.0	195.0					3																	164739083		2203	4300	6503	SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164739083T>C	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3188A>G	3.37:g.164739083T>C	ENSP00000264382:p.Tyr1063Cys	HNSCC(35;0.089)	Somatic					p.Y1063C	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			27	3250	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	1063			Sucrase.|Lumenal.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	c.3188A>G	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	T	19.68	3.873210	0.72180	.	.	ENSG00000090402	ENST00000264382	T	0.03124	4.04	4.58	4.58	0.56647	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	T	0.25531	0.0621	M	0.94101	3.495	0.58432	D	0.999992	D	0.89917	1.0	D	0.91635	0.999	T	0.24119	-1.0169	10	0.87932	D	0	.	14.1202	0.65182	0.0:0.0:0.0:1.0	.	1063	P14410	SUIS_HUMAN	C	1063	ENSP00000264382:Y1063C	ENSP00000264382:Y1063C	Y	-	2	0	SI	166221777	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.927000	0.75840	1.927000	0.55829	0.477000	0.44152	TAT		0.353	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		142	330	0	0	0	0	142	330				
EIF5A2	56648	broad.mit.edu	37	3	170624851	170624851	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:170624851C>T	ENST00000295822.2	-	3	382	c.197G>A	c.(196-198)gGc>gAc	p.G66D	EIF5A2_ENST00000487522.1_Missense_Mutation_p.G66D|EIF5A2_ENST00000460117.1_Intron|EIF5A2_ENST00000474096.1_Missense_Mutation_p.G66D	NM_020390.5	NP_065123.1	Q9GZV4	IF5A2_HUMAN	eukaryotic translation initiation factor 5A2	66					cellular protein metabolic process (GO:0044267)|mRNA transport (GO:0051028)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|polyamine homeostasis (GO:0010509)|positive regulation of cell proliferation (GO:0008284)|positive regulation of translational elongation (GO:0045901)|positive regulation of translational termination (GO:0045905)|post-translational protein modification (GO:0043687)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)|translational frameshifting (GO:0006452)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)	ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	3	all_cancers(22;1.61e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;9.8e-16)|Lung(28;4.28e-15)			ATATTTTTTGCCCGTGAAAAT	0.343																																						uc003fhd.2		NA																	0					0						c.(196-198)GGC>GAC		eIF-5A2 protein							84.0	84.0	84.0					3																	170624851		2203	4299	6502	SO:0001583	missense	56648				mRNA transport|peptidyl-lysine modification to hypusine|polyamine homeostasis|positive regulation of cell proliferation|positive regulation of translational elongation|positive regulation of translational termination|post-translational protein modification|protein transport|spermatogenesis|translational frameshifting|transmembrane transport	cytosol|endoplasmic reticulum membrane|nuclear pore	protein binding|ribosome binding|translation elongation factor activity	g.chr3:170624851C>T	AF293386	CCDS3214.1	3q26.2	2008-05-15			ENSG00000163577	ENSG00000163577			3301	protein-coding gene	gene with protein product		605782					Standard	NM_020390		Approved		uc003fhd.3	Q9GZV4	OTTHUMG00000158958	ENST00000295822.2:c.197G>A	3.37:g.170624851C>T	ENSP00000295822:p.Gly66Asp		Somatic					p.G66D	NM_020390	NP_065123	WXS	Illumina HiSeq	Unspecified	Q9GZV4	IF5A2_HUMAN	LUSC - Lung squamous cell carcinoma(14;9.8e-16)|Lung(28;4.28e-15)		3	327	-	all_cancers(22;1.61e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		66					B2R4V5	Missense_Mutation	SNP	ENST00000295822.2	37	c.197G>A	CCDS3214.1	.	.	.	.	.	.	.	.	.	.	C	18.96	3.733865	0.69189	.	.	ENSG00000163577	ENST00000295822;ENST00000487522;ENST00000474096;ENST00000474417	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.58	5.58	0.84498	Translation protein SH3-like (1);Translation protein SH3-like, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.63803	0.2542	M	0.91717	3.235	0.58432	D	0.999999	D	0.54047	0.964	B	0.43916	0.436	T	0.75391	-0.3334	10	0.72032	D	0.01	-21.2456	19.5675	0.95401	0.0:1.0:0.0:0.0	.	66	Q9GZV4	IF5A2_HUMAN	D	66;66;66;47	ENSP00000295822:G66D;ENSP00000418305:G66D;ENSP00000418370:G66D;ENSP00000417133:G47D	ENSP00000295822:G66D	G	-	2	0	EIF5A2	172107545	0.788000	0.28762	1.000000	0.80357	0.988000	0.76386	2.793000	0.47845	2.640000	0.89533	0.561000	0.74099	GGC		0.343	EIF5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352681.1			4	132	0	0	0	0	4	132				
MFN1	55669	broad.mit.edu	37	3	179095131	179095131	+	Splice_Site	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:179095131G>A	ENST00000471841.1	+	12	1350		c.e12-1		MFN1_ENST00000280653.7_Splice_Site|MFN1_ENST00000263969.5_Splice_Site	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1						mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			CATATTTTCAGGTTTCATGTG	0.239																																						uc003fjs.2		NA																	0				ovary(2)|large_intestine(1)	3						c.e12-1		mitofusin 1							67.0	69.0	68.0					3																	179095131		2201	4292	6493	SO:0001630	splice_region_variant	55669				mitochondrial fusion	integral to membrane|mitochondrial outer membrane	GTP binding|GTPase activity	g.chr3:179095131G>A	AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.1225-1G>A	3.37:g.179095131G>A			Somatic				MFN1_uc010hxb.2_Splice_Site|MFN1_uc003fjt.2_Splice_Site_p.V437_splice|MFN1_uc010hxc.2_Splice_Site_p.V262_splice	p.V409_splice	NM_033540	NP_284941	WXS	Illumina HiSeq	Unspecified	Q8IWA4	MFN1_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)		12	1351	+	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)							B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Splice_Site	SNP	ENST00000471841.1	37	c.1225_splice	CCDS3228.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087907	0.76642	.	.	ENSG00000171109	ENST00000471841;ENST00000280653;ENST00000539169;ENST00000263969;ENST00000474903	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0286	0.92946	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MFN1	180577825	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.476000	0.97823	2.495000	0.84180	0.591000	0.81541	.		0.239	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348654.2	NM_017927	Intron	44	101	0	0	0	0	44	101				
CHRD	8646	broad.mit.edu	37	3	184099067	184099067	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:184099067C>G	ENST00000204604.1	+	3	543	c.297C>G	c.(295-297)tgC>tgG	p.C99W	CHRD_ENST00000545352.1_5'Flank|CHRD_ENST00000450923.1_Missense_Mutation_p.C99W|CHRD_ENST00000348986.3_Missense_Mutation_p.C99W|CHRD_ENST00000482805.1_3'UTR|EIF2B5_ENST00000444495.1_Intron	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	99	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGGTCAGCTGCAAGAACATCA	0.647																																						uc003fov.2		NA																	0				skin(2)|ovary(1)	3						c.(295-297)TGC>TGG		chordin precursor							19.0	24.0	22.0					3																	184099067		2201	4297	6498	SO:0001583	missense	8646				BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding	g.chr3:184099067C>G	AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.297C>G	3.37:g.184099067C>G	ENSP00000204604:p.Cys99Trp		Somatic				CHRD_uc003fow.2_5'UTR|CHRD_uc003fox.2_Missense_Mutation_p.C99W|CHRD_uc003foy.2_5'UTR|CHRD_uc010hyc.2_5'UTR|CHRD_uc011brr.1_5'Flank	p.C99W	NM_003741	NP_003732	WXS	Illumina HiSeq	Unspecified	Q9H2X0	CHRD_HUMAN	Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		3	543	+	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		99			VWFC 1.		O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	ENST00000204604.1	37	c.297C>G	CCDS3266.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.152596	0.78001	.	.	ENSG00000090539	ENST00000204604;ENST00000450923;ENST00000348986	D;D;D	0.92199	-2.99;-2.99;-2.99	5.18	5.18	0.71444	von Willebrand factor, type C (3);	0.000000	0.85682	D	0.000000	D	0.96408	0.8828	M	0.85542	2.76	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.99	D	0.97039	0.9756	10	0.87932	D	0	-13.7347	17.2696	0.87097	0.0:1.0:0.0:0.0	.	99;99	E7ESX1;Q9H2X0	.;CHRD_HUMAN	W	99	ENSP00000204604:C99W;ENSP00000408972:C99W;ENSP00000334036:C99W	ENSP00000204604:C99W	C	+	3	2	CHRD	185581761	1.000000	0.71417	1.000000	0.80357	0.560000	0.35617	1.147000	0.31602	2.413000	0.81919	0.561000	0.74099	TGC		0.647	CHRD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280432.1	NM_003741		21	43	0	0	0	0	21	43				
DNAJB11	51726	broad.mit.edu	37	3	186299209	186299209	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:186299209G>T	ENST00000439351.1	+	6	1435	c.506G>T	c.(505-507)tGc>tTc	p.C169F	DNAJB11_ENST00000265028.3_Missense_Mutation_p.C169F			Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	169					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|mRNA modification (GO:0016556)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|urinary_tract(2)	15	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		AAACGGAAGTGCAATTGTCGG	0.517																																						uc003fqi.2		NA																	0				ovary(1)|lung(1)	2						c.(505-507)TGC>TTC		DnaJ (Hsp40) homolog, subfamily B, member 11							98.0	93.0	95.0					3																	186299209		2203	4300	6503	SO:0001583	missense	51726				protein folding	endoplasmic reticulum lumen	heat shock protein binding	g.chr3:186299209G>T	AB028859	CCDS3277.1	3q27	2011-09-02			ENSG00000090520	ENSG00000090520		"""Heat shock proteins / DNAJ (HSP40)"""	14889	protein-coding gene	gene with protein product		611341				10827079, 11147971	Standard	NM_016306		Approved	EDJ, HEDJ, ERdj3	uc003fqi.3	Q9UBS4	OTTHUMG00000156614	ENST00000439351.1:c.506G>T	3.37:g.186299209G>T	ENSP00000414398:p.Cys169Phe		Somatic					p.C169F	NM_016306	NP_057390	WXS	Illumina HiSeq	Unspecified	Q9UBS4	DJB11_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)	5	726	+	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		169	C->S: Drastic loss of interaction with denatured substrates.				Q542Y5|Q542Y9|Q6IAQ8|Q96JC6	Missense_Mutation	SNP	ENST00000439351.1	37	c.506G>T	CCDS3277.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.795567	0.90453	.	.	ENSG00000090520	ENST00000439351;ENST00000265028	T;T	0.72167	-0.63;-0.63	5.85	5.85	0.93711	HSP40/DnaJ peptide-binding (1);	0.000000	0.85682	D	0.000000	D	0.91928	0.7444	H	0.99650	4.68	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95172	0.8291	10	0.87932	D	0	-10.4572	17.6588	0.88185	0.0:0.0:1.0:0.0	.	169	Q9UBS4	DJB11_HUMAN	F	169	ENSP00000414398:C169F;ENSP00000265028:C169F	ENSP00000265028:C169F	C	+	2	0	DNAJB11	187781903	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.869000	0.99810	2.753000	0.94483	0.655000	0.94253	TGC		0.517	DNAJB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344779.1			55	145	1	0	5.82e-19	7.62e-19	55	145				
GUF1	60558	broad.mit.edu	37	4	44688653	44688653	+	Silent	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:44688653A>G	ENST00000281543.5	+	8	1055	c.861A>G	c.(859-861)gtA>gtG	p.V287V	GUF1_ENST00000506793.1_3'UTR	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)											breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						ATAAAATTGTATCTGCACATA	0.368																																						uc003gww.3		NA																	0				upper_aerodigestive_tract(1)	1						c.(859-861)GTA>GTG		GUF1 GTPase homolog							136.0	135.0	135.0					4																	44688653		2203	4299	6502	SO:0001819	synonymous_variant	60558				translation	mitochondrial inner membrane	GTP binding|GTPase activity	g.chr4:44688653A>G		CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.861A>G	4.37:g.44688653A>G			Somatic				GUF1_uc010ifz.1_RNA	p.V287V	NM_021927	NP_068746	WXS	Illumina HiSeq	Unspecified	Q8N442	GUF1_HUMAN			8	1068	+			287						Silent	SNP	ENST00000281543.5	37	c.861A>G	CCDS3468.1																																																																																				0.368	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250469.3	NM_021927		89	38	0	0	0	0	89	38				
KIAA1211	57482	broad.mit.edu	37	4	57173804	57173804	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:57173804T>A	ENST00000504228.1	+	3	329	c.224T>A	c.(223-225)cTg>cAg	p.L75Q	KIAA1211_ENST00000541073.1_Missense_Mutation_p.L68Q|KIAA1211_ENST00000264229.6_Missense_Mutation_p.L75Q			Q6ZU35	K1211_HUMAN	KIAA1211	75										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					GATCTGTTCCTGACCAGTCCC	0.493																																						uc003hbk.2		NA																	0				ovary(1)|skin(1)	2						c.(223-225)CTG>CAG		hypothetical protein LOC57482							89.0	90.0	90.0					4																	57173804		1995	4157	6152	SO:0001583	missense	57482							g.chr4:57173804T>A	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.224T>A	4.37:g.57173804T>A	ENSP00000423366:p.Leu75Gln		Somatic				KIAA1211_uc010iha.2_Missense_Mutation_p.L68Q|KIAA1211_uc011bzz.1_5'Flank|KIAA1211_uc003hbl.2_5'Flank|KIAA1211_uc003hbm.1_5'Flank	p.L75Q	NM_020722	NP_065773	WXS	Illumina HiSeq	Unspecified	Q6ZU35	K1211_HUMAN			5	615	+	Glioma(25;0.08)|all_neural(26;0.101)		75					Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	37	c.224T>A	CCDS43230.1	.	.	.	.	.	.	.	.	.	.	T	12.34	1.908676	0.33721	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073	T;T;T	0.15718	2.43;2.43;2.4	5.74	0.185	0.15096	.	.	.	.	.	T	0.27524	0.0676	M	0.65975	2.015	0.09310	N	0.999995	D;D	0.63880	0.993;0.993	P;P	0.59487	0.858;0.804	T	0.14839	-1.0458	9	0.72032	D	0.01	-9.8137	1.8378	0.03143	0.1234:0.1369:0.2561:0.4836	.	68;75	F5H1N7;Q6ZU35	.;K1211_HUMAN	Q	75;75;68	ENSP00000264229:L75Q;ENSP00000423366:L75Q;ENSP00000444006:L68Q	ENSP00000264229:L75Q	L	+	2	0	KIAA1211	56868561	0.020000	0.18652	0.233000	0.24025	0.634000	0.38068	0.279000	0.18771	0.101000	0.17610	-0.326000	0.08463	CTG		0.493	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722		36	38	0	0	0	0	36	38				
TECRL	253017	broad.mit.edu	37	4	65175550	65175550	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:65175550C>G	ENST00000381210.3	-	6	761	c.651G>C	c.(649-651)ttG>ttC	p.L217F	TECRL_ENST00000513125.1_5'UTR|TECRL_ENST00000507440.1_Missense_Mutation_p.L217F	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	217					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						TCACCATTATCAAATTTTTCA	0.338																																						uc003hcv.2		NA																	0					0						c.(649-651)TTG>TTC		steroid 5 alpha-reductase 2-like 2							98.0	104.0	102.0					4																	65175550		2203	4300	6503	SO:0001583	missense	253017				lipid metabolic process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors	g.chr4:65175550C>G	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.651G>C	4.37:g.65175550C>G	ENSP00000370607:p.Leu217Phe		Somatic				TECRL_uc003hcw.2_Missense_Mutation_p.L217F	p.L217F	NM_001010874	NP_001010874	WXS	Illumina HiSeq	Unspecified	Q5HYJ1	TECRL_HUMAN			6	760	-			217			Helical; (Potential).			Missense_Mutation	SNP	ENST00000381210.3	37	c.651G>C	CCDS33990.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975499	0.34848	.	.	ENSG00000205678	ENST00000507440;ENST00000381210	T;T	0.32753	1.44;1.44	5.11	3.37	0.38596	3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (1);	0.142736	0.44688	D	0.000439	T	0.47930	0.1472	M	0.85099	2.735	0.39762	D	0.972033	P;D	0.54772	0.944;0.968	P;P	0.54629	0.646;0.757	T	0.54860	-0.8230	10	0.66056	D	0.02	-11.3337	8.1023	0.30865	0.0:0.8132:0.0:0.1868	.	217;217	Q6IN47;Q5HYJ1	.;TECRL_HUMAN	F	217	ENSP00000426043:L217F;ENSP00000370607:L217F	ENSP00000370607:L217F	L	-	3	2	TECRL	64858145	1.000000	0.71417	0.996000	0.52242	0.011000	0.07611	2.676000	0.46883	1.144000	0.42321	0.555000	0.69702	TTG		0.338	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874		85	139	0	0	0	0	85	139				
UGT2B10	7365	broad.mit.edu	37	4	69682013	69682013	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:69682013G>T	ENST00000265403.7	+	1	303	c.276G>T	c.(274-276)ttG>ttT	p.L92F	UGT2B10_ENST00000458688.2_Missense_Mutation_p.L92F	NM_001075.4	NP_001066.1	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B10	92					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(3)|kidney(4)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	29						TCATGCAATTGGTTAAGAGAT	0.313																																					Melanoma(133;755 1763 25578 26334 46021)	uc003hee.2		NA																	0				skin(3)|ovary(2)	5						c.(274-276)TTG>TTT		UDP glucuronosyltransferase 2B10 isoform 1							72.0	79.0	76.0					4																	69682013		2191	4290	6481	SO:0001583	missense	7365				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:69682013G>T	X63359	CCDS75135.1, CCDS75136.1	4q13.3	2008-02-05	2005-07-20			ENSG00000109181		"""UDP glucuronosyltransferases"""	12544	protein-coding gene	gene with protein product		600070	"""UDP glycosyltransferase 2 family, polypeptide B10"""			8333863	Standard	NM_001075		Approved		uc003hee.3	P36537		ENST00000265403.7:c.276G>T	4.37:g.69682013G>T	ENSP00000265403:p.Leu92Phe		Somatic				UGT2B10_uc011cam.1_Missense_Mutation_p.L92F	p.L92F	NM_001075	NP_001066	WXS	Illumina HiSeq	Unspecified	P36537	UDB10_HUMAN			1	301	+			92					A8K9M3|B4DPP1|Q14CR8	Missense_Mutation	SNP	ENST00000265403.7	37	c.276G>T		.	.	.	.	.	.	.	.	.	.	g	0.017	-1.488775	0.01018	.	.	ENSG00000109181	ENST00000265403;ENST00000458688	T;T	0.60171	0.21;3.21	2.42	0.371	0.16168	.	25.311900	0.01016	U	0.003910	T	0.34279	0.0892	N	0.12182	0.205	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.15052	0.008;0.012	T	0.29941	-0.9995	10	0.02654	T	1	.	4.6296	0.12495	0.0:0.2142:0.3517:0.434	.	92;92	B4DPP1;P36537	.;UDB10_HUMAN	F	92	ENSP00000265403:L92F;ENSP00000413420:L92F	ENSP00000265403:L92F	L	+	3	2	UGT2B10	69716602	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.106000	0.10890	-0.220000	0.09988	0.184000	0.17185	TTG		0.313	UGT2B10-001	KNOWN	non_canonical_polymorphism|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365169.1	NM_001075		41	60	1	0	2.27e-22	3.05e-22	41	60				
CSN1S1	1446	broad.mit.edu	37	4	70804897	70804897	+	Missense_Mutation	SNP	A	A	G	rs370575111		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:70804897A>G	ENST00000246891.4	+	10	296	c.247A>G	c.(247-249)Atg>Gtg	p.M83V	CSN1S1_ENST00000507763.1_Missense_Mutation_p.M82V|CSN1S1_ENST00000505782.1_Missense_Mutation_p.M75V|CSN1S1_ENST00000444405.3_Missense_Mutation_p.M82V|CSN1S1_ENST00000507772.1_Missense_Mutation_p.M83V	NM_001890.1	NP_001881.1	P47710	CASA1_HUMAN	casein alpha s1	83						extracellular region (GO:0005576)|extracellular space (GO:0005615)	transporter activity (GO:0005215)			lung(5)|prostate(1)|upper_aerodigestive_tract(1)	7						CTTTTAGAAGATGGAATCCAG	0.328																																						uc003hep.1		NA																	0					0						c.(247-249)ATG>GTG		casein alpha s1 isoform 1		A	VAL/MET,VAL/MET	1,3591		0,1,1795	86.0	85.0	85.0		244,247	-7.0	0.0	4		85	0,8116		0,0,4058	no	missense,missense	CSN1S1	NM_001025104.1,NM_001890.1	21,21	0,1,5853	GG,GA,AA		0.0,0.0278,0.0085	benign,benign	82/177,83/186	70804897	1,11707	1796	4058	5854	SO:0001583	missense	1446					extracellular region	protein binding|transporter activity	g.chr4:70804897A>G	X78416	CCDS47067.1, CCDS54769.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000126545	ENSG00000126545			2445	protein-coding gene	gene with protein product		115450	"""casein, alpha"""	CASA, CSN1		9050925, 7619062	Standard	NM_001890		Approved		uc003hep.1	P47710	OTTHUMG00000160843	ENST00000246891.4:c.247A>G	4.37:g.70804897A>G	ENSP00000246891:p.Met83Val		Somatic				CSN1S1_uc003heq.1_Missense_Mutation_p.M82V|CSN1S1_uc003her.1_Missense_Mutation_p.M83V	p.M83V	NM_001890	NP_001881	WXS	Illumina HiSeq	Unspecified	P47710	CASA1_HUMAN			10	296	+			83					A1A510|A1A511|E9PB60|Q4PNR5	Missense_Mutation	SNP	ENST00000246891.4	37	c.247A>G	CCDS47067.1	.	.	.	.	.	.	.	.	.	.	A	2.423	-0.332672	0.05314	2.78E-4	0.0	ENSG00000126545	ENST00000246891;ENST00000444405;ENST00000354865;ENST00000507763;ENST00000507772;ENST00000505782;ENST00000510936	T;T;T;T;T;T	0.44881	0.98;0.97;0.97;0.97;0.91;0.92	4.99	-6.97	0.01616	.	2.946310	0.00937	N	0.002797	T	0.23330	0.0564	N	0.24115	0.695	0.09310	N	1.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.10636	-1.0621	9	0.41790	T	0.15	0.8596	1.9028	0.03271	0.2148:0.2411:0.0822:0.4619	.	83;82;83	E9PDQ1;E9PB60;P47710	.;.;CASA1_HUMAN	V	83;82;75;82;83;75;2	ENSP00000246891:M83V;ENSP00000413157:M82V;ENSP00000422611:M82V;ENSP00000427490:M83V;ENSP00000426684:M75V;ENSP00000421314:M2V	ENSP00000246891:M83V	M	+	1	0	CSN1S1	70839486	0.005000	0.15991	0.000000	0.03702	0.001000	0.01503	-0.229000	0.09098	-0.846000	0.04174	-0.403000	0.06358	ATG		0.328	CSN1S1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362629.1			50	73	0	0	0	0	50	73				
ADAMTS3	9508	broad.mit.edu	37	4	73164099	73164099	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:73164099C>G	ENST00000286657.4	-	18	2521	c.2485G>C	c.(2485-2487)Gac>Cac	p.D829H		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	829	Spacer.				collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GGTACAGAGTCTTCATGGATG	0.403																																					NSCLC(168;1941 2048 2918 13048 43078)	uc003hgk.1		NA																	0				ovary(1)|lung(1)	2						c.(2485-2487)GAC>CAC		ADAM metallopeptidase with thrombospondin type 1							171.0	150.0	157.0					4																	73164099		2203	4299	6502	SO:0001583	missense	9508				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding	g.chr4:73164099C>G	AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.2485G>C	4.37:g.73164099C>G	ENSP00000286657:p.Asp829His		Somatic				ADAMTS3_uc003hgl.2_Missense_Mutation_p.D170H	p.D829H	NM_014243	NP_055058	WXS	Illumina HiSeq	Unspecified	O15072	ATS3_HUMAN	Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		18	2522	-			829			Spacer.		A1L3U9|Q9BXZ8	Missense_Mutation	SNP	ENST00000286657.4	37	c.2485G>C	CCDS3553.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.671698	0.88348	.	.	ENSG00000156140	ENST00000286657	T	0.63096	-0.02	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.82208	0.4987	M	0.87456	2.885	0.80722	D	1	D	0.69078	0.997	D	0.65443	0.935	D	0.84491	0.0611	10	0.72032	D	0.01	.	19.919	0.97077	0.0:1.0:0.0:0.0	.	829	O15072	ATS3_HUMAN	H	829	ENSP00000286657:D829H	ENSP00000286657:D829H	D	-	1	0	ADAMTS3	73382963	1.000000	0.71417	1.000000	0.80357	0.667000	0.39255	7.398000	0.79919	2.707000	0.92482	0.655000	0.94253	GAC		0.403	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2			84	121	0	0	0	0	84	121				
ALB	213	broad.mit.edu	37	4	74285323	74285324	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:74285323_74285324GG>TT	ENST00000503124.1	+	11	1509_1510	c.1302_1303GG>TT	c.(1300-1305)aaGGct>aaTTct	p.434_435KA>NS	ALB_ENST00000401494.3_Missense_Mutation_p.469_470KA>NS|ALB_ENST00000509063.1_Missense_Mutation_p.584_585KA>NS|ALB_ENST00000295897.4_Missense_Mutation_p.584_585KA>NS|ALB_ENST00000415165.2_Missense_Mutation_p.392_393KA>NS|ALB_ENST00000505649.1_3'UTR			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGTGCTGCAAGGCTGACGATAA	0.441																																						uc003hgs.3		NA																	0				ovary(3)|skin(3)	6						c.(1750-1755)AAGGCT>AATTCT		albumin preproprotein	Acenocoumarol(DB01418)|Acitretin(DB00459)|Alfentanil(DB00802)|Aluminium(DB01370)|Auranofin(DB00995)|Bismuth(DB01402)|Captopril(DB01197)|Carboplatin(DB00958)|Cefalotin(DB00456)|Cefazolin(DB01327)|Cefonicid(DB01328)|Cefoperazone(DB01329)|Chlorpheniramine(DB01114)|Chlorpromazine(DB00477)|Ciprofloxacin(DB00537)|Clonazepam(DB01068)|Cloxacillin(DB01147)|Cytarabine(DB00987)|Dantrolene(DB01219)|Diclofenac(DB00586)|Diflunisal(DB00861)|Digitoxin(DB01396)|Estrone(DB00655)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Flurbiprofen(DB00712)|Gadobenate Dimeglumine(DB00743)|Gatifloxacin(DB01044)|Gliclazide(DB01120)|Halothane(DB01159)|Human Serum Albumin(DB00062)|Hyaluronidase(DB00070)|Ibuprofen(DB01050)|Insulin-detemir(DB01307)|Insulin-glargine(DB01308)|Iodipamide(DB04711)|Ketoprofen(DB01009)|Levamisole(DB00848)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Mefenamic acid(DB00784)|Mephenytoin(DB00532)|Methotrexate(DB00563)|Nortriptyline(DB00540)|Oxazepam(DB00842)|Paclitaxel(DB01229)|Phenprocoumon(DB00946)|Probenecid(DB01032)|Propofol(DB00818)|Pyridoxine(DB00165)|Salicyclic acid(DB00936)|Saquinavir(DB01232)|Serum albumin(DB00096)|Serum albumin iodonated(DB00064)|Sodium lauryl sulfate(DB00815)|Sucralfate(DB00364)|Sulfamethizole(DB00576)|Sulindac(DB00605)|Suprofen(DB00870)|Testosterone(DB00624)|Xanthophyll(DB00137)																																			SO:0001583	missense	213				bile acid and bile salt transport|bile acid metabolic process|cellular response to starvation|hemolysis by symbiont of host erythrocytes|lipoprotein metabolic process|maintenance of mitochondrion location|negative regulation of apoptosis|platelet activation|platelet degranulation|sodium-independent organic anion transport|transmembrane transport	extracellular space|platelet alpha granule lumen|protein complex	antioxidant activity|chaperone binding|copper ion binding|DNA binding|drug binding|fatty acid binding|pyridoxal phosphate binding|toxin binding	g.chr4:74285323_74285324GG>TT	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	Exception_encountered	4.37:g.74285323_74285324delinsTT	ENSP00000421027:p.K434_A435delinsNS		Somatic				ALB_uc003hgw.3_Missense_Mutation_p.392_393KA>NS|ALB_uc011cbe.1_Missense_Mutation_p.263_264KA>NS|ALB_uc003hgt.3_Missense_Mutation_p.584_585KA>NS|ALB_uc010iii.2_Missense_Mutation_p.469_470KA>NS|ALB_uc003hgu.3_Missense_Mutation_p.434_435KA>NS|ALB_uc003hgv.3_Missense_Mutation_p.263_264KA>NS|ALB_uc011cbf.1_Missense_Mutation_p.474_475KA>NS|ALB_uc010iij.2_RNA|ALB_uc003hgx.3_Missense_Mutation_p.263_264KA>NS	p.584_585KA>NS	NM_000477	NP_000468	WXS	Illumina HiSeq	Unspecified	P02768	ALBU_HUMAN	Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		13	1825_1826	+	Breast(15;0.00102)		584_585			Albumin 3.		B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	DNP	ENST00000503124.1	37	c.1752_1753GG>TT																																																																																					0.441	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477		63	133	0	0	0	0	63	133				
NAA11	84779	broad.mit.edu	37	4	80246866	80246866	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:80246866C>T	ENST00000286794.4	-	1	338	c.166G>A	c.(166-168)Gtt>Att	p.V56I	NAA11_ENST00000513733.1_5'Flank	NM_032693.2	NP_116082.1	Q9BSU3	NAA11_HUMAN	N(alpha)-acetyltransferase 11, NatA catalytic subunit	56	Interaction with NAA15. {ECO:0000250}.|N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				N-terminal protein amino acid acetylation (GO:0006474)	NatA complex (GO:0031415)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|skin(2)	23						TTGGCCAGAACATAGCCCACA	0.532																																						uc003hlt.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(166-168)GTT>ATT		alpha-N-acetyltransferase 1B							134.0	134.0	134.0					4																	80246866		2187	4291	6478	SO:0001583	missense	84779					cytoplasm|nucleus	peptide alpha-N-acetyltransferase activity|protein binding	g.chr4:80246866C>T		CCDS47084.1	4q21.23	2010-05-07	2010-01-14	2010-01-14		ENSG00000156269	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	28125	protein-coding gene	gene with protein product			"""ARD1 homolog B (S. cerevisiae)"""	ARD1B		16638120, 19660095	Standard	NM_032693		Approved	ARD2, hARD2	uc003hlt.4	Q9BSU3		ENST00000286794.4:c.166G>A	4.37:g.80246866C>T	ENSP00000286794:p.Val56Ile		Somatic					p.V56I	NM_032693	NP_116082	WXS	Illumina HiSeq	Unspecified	Q9BSU3	NAA11_HUMAN			1	306	-			56			Interaction with NAA15 (By similarity).|N-acetyltransferase.		Q66K19|Q6P479	Missense_Mutation	SNP	ENST00000286794.4	37	c.166G>A	CCDS47084.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669496	0.47677	.	.	ENSG00000156269	ENST00000286794	T	0.21031	2.03	5.04	3.33	0.38152	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	U	0.000000	T	0.24160	0.0585	L	0.46157	1.445	0.58432	D	0.999999	B	0.31989	0.35	B	0.44163	0.443	T	0.04191	-1.0970	9	.	.	.	-23.968	7.8859	0.29651	0.0:0.8142:0.0:0.1858	.	56	Q9BSU3	NAA11_HUMAN	I	56	ENSP00000286794:V56I	.	V	-	1	0	NAA11	80465890	0.993000	0.37304	0.919000	0.36401	0.137000	0.21094	2.517000	0.45529	0.846000	0.35142	0.563000	0.77884	GTT		0.532	NAA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362922.1			65	134	0	0	0	0	65	134				
ANTXR2	118429	broad.mit.edu	37	4	80898813	80898813	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:80898813C>T	ENST00000307333.7	-	16	1392	c.1390G>A	c.(1390-1392)Gac>Aac	p.D464N	ANTXR2_ENST00000403729.2_Missense_Mutation_p.D464N|ANTXR2_ENST00000404191.1_Missense_Mutation_p.D387N|ANTXR2_ENST00000346652.6_Missense_Mutation_p.D361N	NM_001145794.1	NP_001139266.1	P58335	ANTR2_HUMAN	anthrax toxin receptor 2	464					reproductive process (GO:0022414)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	13						GAAACCCGGTCATACTGCCGC	0.448									Juvenile Hyaline Fibromatosis																													uc003hlz.3		NA																	0				ovary(1)	1						c.(1390-1392)GAC>AAC		anthrax toxin receptor 2 isoform 2							63.0	56.0	58.0					4																	80898813		1865	4106	5971	SO:0001583	missense	118429	Juvenile_Hyaline_Fibromatosis	Familial Cancer Database	incl. Infantile Systemic Hyalinosis		endoplasmic reticulum membrane|extracellular region|integral to membrane|plasma membrane	metal ion binding|protein binding|receptor activity	g.chr4:80898813C>T	AY040326	CCDS47085.1, CCDS47086.1, CCDS68733.1	4q21.3	2004-01-15			ENSG00000163297	ENSG00000163297			21732	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 2"""	608041				11683410, 12700348	Standard	NM_058172		Approved	CMG2, CMG-2, FLJ31074	uc003hlz.4	P58335	OTTHUMG00000151982	ENST00000307333.7:c.1390G>A	4.37:g.80898813C>T	ENSP00000306185:p.Asp464Asn		Somatic				ANTXR2_uc003hly.3_Missense_Mutation_p.D464N|ANTXR2_uc003hlx.1_RNA|ANTXR2_uc010ijn.2_Missense_Mutation_p.D361N	p.D464N	NM_001145794	NP_001139266	WXS	Illumina HiSeq	Unspecified	P58335	ANTR2_HUMAN			16	2153	-			464			Cytoplasmic (Potential).		Q4W5H6|Q59E98|Q5JPE9|Q86UI1|Q8N4J8|Q8NB13|Q96NC7	Missense_Mutation	SNP	ENST00000307333.7	37	c.1390G>A	CCDS47086.1	.	.	.	.	.	.	.	.	.	.	C	32	5.169557	0.94768	.	.	ENSG00000163297	ENST00000403729;ENST00000404191;ENST00000346652;ENST00000307333	D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84	5.83	5.83	0.93111	Anthrax toxin receptor, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.92479	0.7612	M	0.76170	2.325	0.80722	D	1	P;D;D	0.89917	0.888;1.0;1.0	P;D;D	0.97110	0.594;1.0;1.0	D	0.92556	0.6054	10	0.72032	D	0.01	-21.8124	19.1152	0.93336	0.0:1.0:0.0:0.0	.	361;464;464	P58335-2;P58335;P58335-4	.;ANTR2_HUMAN;.	N	464;387;361;464	ENSP00000385575:D464N;ENSP00000384028:D387N;ENSP00000314883:D361N;ENSP00000306185:D464N	ENSP00000306185:D464N	D	-	1	0	ANTXR2	81117837	1.000000	0.71417	0.875000	0.34327	0.771000	0.43674	7.439000	0.80444	2.775000	0.95449	0.585000	0.79938	GAC		0.448	ANTXR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324663.1	NM_058172		6	8	0	0	0	0	6	8				
ENOPH1	58478	broad.mit.edu	37	4	83375980	83375980	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:83375980G>A	ENST00000273920.3	+	4	763	c.495G>A	c.(493-495)ggG>ggA	p.G165G	ENOPH1_ENST00000509635.1_Silent_p.G77G	NM_021204.3	NP_067027.1			enolase-phosphatase 1											central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|skin(1)	13						TGTTATTCGGGCATTCTACGG	0.418																																						uc003hmv.2		NA																	0					0						c.(493-495)GGG>GGA		enolase-phosphatase 1							255.0	233.0	240.0					4																	83375980		2203	4300	6503	SO:0001819	synonymous_variant	58478				L-methionine salvage from methylthioadenosine	cytoplasm|nucleus	2,3-diketo-5-methylthiopentyl-1-phosphate enolase activity|2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase activity|acireductone synthase activity|magnesium ion binding|phosphoglycolate phosphatase activity	g.chr4:83375980G>A		CCDS3594.1, CCDS75154.1	4q21.3	2013-05-29			ENSG00000145293	ENSG00000145293	3.1.3.77		24599	protein-coding gene	gene with protein product	"""Enolase-phosphatase E1"", ""acireductone synthase"""					15843022	Standard	XM_005263168		Approved	MASA, E1, mtnC	uc003hmv.3	Q9UHY7	OTTHUMG00000130295	ENST00000273920.3:c.495G>A	4.37:g.83375980G>A			Somatic				ENOPH1_uc003hmw.2_Silent_p.G77G|ENOPH1_uc003hmx.2_Silent_p.G19G	p.G165G	NM_021204	NP_067027	WXS	Illumina HiSeq	Unspecified	Q9UHY7	ENOPH_HUMAN			4	752	+			165						Silent	SNP	ENST00000273920.3	37	c.495G>A	CCDS3594.1																																																																																				0.418	ENOPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252638.2	NM_021204		5	214	0	0	0	0	5	214				
GPRIN3	285513	broad.mit.edu	37	4	90170272	90170272	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:90170272G>T	ENST00000609438.1	-	2	1508	c.990C>A	c.(988-990)agC>agA	p.S330R	GPRIN3_ENST00000333209.4_Missense_Mutation_p.S330R	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	330										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		AGACGGATCTGCTCTCGACAC	0.537																																						uc003hsm.1		NA																	0				ovary(3)	3						c.(988-990)AGC>AGA		G protein-regulated inducer of neurite outgrowth							89.0	82.0	85.0					4																	90170272		2203	4300	6503	SO:0001583	missense	285513							g.chr4:90170272G>T	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.990C>A	4.37:g.90170272G>T	ENSP00000476603:p.Ser330Arg		Somatic					p.S330R	NM_198281	NP_938022	WXS	Illumina HiSeq	Unspecified	Q6ZVF9	GRIN3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)	2	1509	-		Hepatocellular(203;0.114)	330					Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	37	c.990C>A	CCDS34030.1	.	.	.	.	.	.	.	.	.	.	G	18.85	3.710575	0.68730	.	.	ENSG00000185477	ENST00000333209	T	0.21932	1.98	5.65	3.79	0.43588	.	0.000000	0.40469	N	0.001088	T	0.33030	0.0849	L	0.32530	0.975	0.39230	D	0.963661	D	0.89917	1.0	D	0.97110	1.0	T	0.18840	-1.0324	10	0.87932	D	0	-20.6018	11.3273	0.49456	0.1589:0.0:0.8411:0.0	.	330	Q6ZVF9	GRIN3_HUMAN	R	330	ENSP00000328672:S330R	ENSP00000328672:S330R	S	-	3	2	GPRIN3	90389295	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	1.136000	0.31467	1.630000	0.50440	0.655000	0.94253	AGC		0.537	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281		53	100	1	0	1.44e-25	1.98e-25	53	100				
DKK2	27123	broad.mit.edu	37	4	107845325	107845325	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:107845325C>A	ENST00000285311.3	-	4	1271	c.566G>T	c.(565-567)tGc>tTc	p.C189F	DKK2_ENST00000513208.1_Missense_Mutation_p.C89F|DKK2_ENST00000510463.1_Missense_Mutation_p.C143F	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	189	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		CCCTTCAATGCAGTCTGATGA	0.453																																						uc003hyi.2		NA																	0				ovary(3)|lung(1)|skin(1)	5						c.(565-567)TGC>TTC		dickkopf homolog 2 precursor							101.0	95.0	97.0					4																	107845325		2203	4300	6503	SO:0001583	missense	27123				multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space		g.chr4:107845325C>A	AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.566G>T	4.37:g.107845325C>A	ENSP00000285311:p.Cys189Phe		Somatic				DKK2_uc003hyj.1_3'UTR	p.C189F	NM_014421	NP_055236	WXS	Illumina HiSeq	Unspecified	Q9UBU2	DKK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)	4	1271	-		Hepatocellular(203;0.217)	189			DKK-type Cys-2.		A0AVE9|B2R6S7|Q9UIU3	Missense_Mutation	SNP	ENST00000285311.3	37	c.566G>T	CCDS3675.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.435363	0.83885	.	.	ENSG00000155011	ENST00000285311;ENST00000513208;ENST00000510463	D;T;T	0.81739	-1.53;-0.61;-1.14	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.90807	0.7113	M	0.82823	2.61	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	D	0.91523	0.5236	10	0.87932	D	0	-6.328	19.6876	0.95986	0.0:1.0:0.0:0.0	.	189	Q9UBU2	DKK2_HUMAN	F	189;89;143	ENSP00000285311:C189F;ENSP00000421255:C89F;ENSP00000423797:C143F	ENSP00000285311:C189F	C	-	2	0	DKK2	108064774	1.000000	0.71417	0.997000	0.53966	0.879000	0.50718	7.487000	0.81328	2.657000	0.90304	0.585000	0.79938	TGC		0.453	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253959.4			51	76	1	0	4e-15	5.06e-15	51	76				
DKK2	27123	broad.mit.edu	37	4	107845853	107845853	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:107845853G>A	ENST00000285311.3	-	3	1083	c.378C>T	c.(376-378)atC>atT	p.I126I	DKK2_ENST00000513208.1_Silent_p.I26I|DKK2_ENST00000510463.1_Silent_p.I80I	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	126	DKK-type Cys-1.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		CTGGGATACAGATGCCTGGAG	0.403																																						uc003hyi.2		NA																	0				ovary(3)|lung(1)|skin(1)	5						c.(376-378)ATC>ATT		dickkopf homolog 2 precursor							183.0	178.0	180.0					4																	107845853		2203	4300	6503	SO:0001819	synonymous_variant	27123				multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space		g.chr4:107845853G>A	AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.378C>T	4.37:g.107845853G>A			Somatic				DKK2_uc010ilw.1_RNA|DKK2_uc003hyj.1_Silent_p.I126I	p.I126I	NM_014421	NP_055236	WXS	Illumina HiSeq	Unspecified	Q9UBU2	DKK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)	3	1083	-		Hepatocellular(203;0.217)	126			DKK-type Cys-1.		A0AVE9|B2R6S7|Q9UIU3	Silent	SNP	ENST00000285311.3	37	c.378C>T	CCDS3675.1																																																																																				0.403	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253959.4			81	102	0	0	0	0	81	102				
CASP6	839	broad.mit.edu	37	4	110610524	110610524	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:110610524G>C	ENST00000265164.2	-	7	921	c.844C>G	c.(844-846)Cta>Gta	p.L282V	CASP6_ENST00000352981.3_Missense_Mutation_p.L193V|AC004067.5_ENST00000608733.1_RNA|CASP6_ENST00000510324.1_5'UTR	NM_001226.3	NP_001217.2	P55212	CASP6_HUMAN	caspase 6, apoptosis-related cysteine peptidase	282					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|epithelial cell differentiation (GO:0030855)|proteolysis (GO:0006508)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	8		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000171)		TTTTTAGTTAGCATTGAGGCA	0.413																																						uc003hzn.1		NA																	0				ovary(1)|breast(1)	2						c.(844-846)CTA>GTA		caspase 6 isoform alpha preproprotein							71.0	78.0	75.0					4																	110610524		2203	4300	6503	SO:0001583	missense	839				cellular component disassembly involved in apoptosis|induction of apoptosis|proteolysis	cytosol|nucleoplasm	cysteine-type endopeptidase activity|protein binding	g.chr4:110610524G>C	U20536	CCDS3684.1, CCDS3685.1	4q25	2008-02-05	2005-08-17		ENSG00000138794	ENSG00000138794		"""Caspases"""	1507	protein-coding gene	gene with protein product		601532	"""caspase 6, apoptosis-related cysteine protease"""			8780721, 7796396	Standard	XM_005263271		Approved	MCH2	uc003hzn.1	P55212	OTTHUMG00000131914	ENST00000265164.2:c.844C>G	4.37:g.110610524G>C	ENSP00000265164:p.Leu282Val		Somatic				CASP6_uc003hzo.1_Missense_Mutation_p.L193V	p.L282V	NM_001226	NP_001217	WXS	Illumina HiSeq	Unspecified	P55212	CASP6_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000171)	7	922	-		Hepatocellular(203;0.217)	282					Q9BQE7	Missense_Mutation	SNP	ENST00000265164.2	37	c.844C>G	CCDS3684.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.956346	0.73902	.	.	ENSG00000138794	ENST00000352981;ENST00000265164	T;T	0.64991	-0.13;2.94	6.17	5.34	0.76211	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (2);	0.000000	0.85682	D	0.000000	D	0.85435	0.5696	H	0.98133	4.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.995;1.0	D	0.88806	0.3288	10	0.87932	D	0	.	9.9274	0.41501	0.1897:0.0:0.8103:0.0	.	193;282	P55212-2;P55212	.;CASP6_HUMAN	V	193;282	ENSP00000285333:L193V;ENSP00000265164:L282V	ENSP00000265164:L282V	L	-	1	2	CASP6	110829973	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.106000	0.41835	1.633000	0.50488	0.655000	0.94253	CTA		0.413	CASP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254866.1	NM_001226		85	114	0	0	0	0	85	114				
ENPEP	2028	broad.mit.edu	37	4	111431455	111431455	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:111431455G>T	ENST00000265162.5	+	6	1591	c.1249G>T	c.(1249-1251)Gga>Tga	p.G417*	RP11-380D23.1_ENST00000503998.1_RNA	NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	417					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		GCTAAATGAAGGATTTGCTTC	0.373																																						uc003iab.3		NA																	0				skin(3)|ovary(1)|breast(1)	5						c.(1249-1251)GGA>TGA		glutamyl aminopeptidase	L-Glutamic Acid(DB00142)						231.0	234.0	233.0					4																	111431455		2203	4300	6503	SO:0001587	stop_gained	2028				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding	g.chr4:111431455G>T	L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.1249G>T	4.37:g.111431455G>T	ENSP00000265162:p.Gly417*		Somatic					p.G417*	NM_001977	NP_001968	WXS	Illumina HiSeq	Unspecified	Q07075	AMPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	6	1591	+		Hepatocellular(203;0.217)	417			Extracellular (Potential).		Q504U2	Nonsense_Mutation	SNP	ENST00000265162.5	37	c.1249G>T	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	G	43	9.943344	0.99300	.	.	ENSG00000138792	ENST00000265162	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.1557	0.93509	0.0:0.0:1.0:0.0	.	.	.	.	X	417	.	ENSP00000265162:G417X	G	+	1	0	ENPEP	111650904	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.810000	0.99221	2.522000	0.85027	0.650000	0.86243	GGA		0.373	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2			54	80	1	0	1.14e-29	1.58e-29	54	80				
ANK2	287	broad.mit.edu	37	4	114277866	114277866	+	Missense_Mutation	SNP	A	A	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:114277866A>T	ENST00000357077.4	+	38	8145	c.8092A>T	c.(8092-8094)Agc>Tgc	p.S2698C	ANK2_ENST00000506722.1_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.S2665C|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2698					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ACTTCCATCAAGCATGGACTC	0.443																																						uc003ibe.3		NA																	0				central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(8092-8094)AGC>TGC		ankyrin 2 isoform 1							103.0	105.0	104.0					4																	114277866		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114277866A>T	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.8092A>T	4.37:g.114277866A>T	ENSP00000349588:p.Ser2698Cys		Somatic				ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Translation_Start_Site|ANK2_uc011cgb.1_Missense_Mutation_p.S2713C	p.S2698C	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	8192	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	2665					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.8092A>T	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.948699	0.73787	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.69561	-0.39;-0.41	5.86	2.14	0.27477	.	0.301186	0.28914	N	0.013727	T	0.70386	0.3218	M	0.62723	1.935	0.80722	D	1	B;D	0.67145	0.009;0.996	B;P	0.59288	0.007;0.855	T	0.66662	-0.5867	9	.	.	.	.	5.8856	0.18880	0.6979:0.0:0.175:0.1271	.	2665;2698	Q01484;Q01484-4	ANK2_HUMAN;.	C	2698;2665	ENSP00000349588:S2698C;ENSP00000264366:S2665C	.	S	+	1	0	ANK2	114497315	1.000000	0.71417	0.986000	0.45419	0.978000	0.69477	3.336000	0.52113	0.459000	0.27016	-0.327000	0.08410	AGC		0.443	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		60	91	0	0	0	0	60	91				
C4orf3	401152	broad.mit.edu	37	4	120221511	120221511	+	Silent	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:120221511G>C	ENST00000504110.1	-	1	565	c.180C>G	c.(178-180)ctC>ctG	p.L60L	C4orf3_ENST00000399075.4_Silent_p.L193L	NM_001001701.3	NP_001001701.2	Q8WVX3	CD003_HUMAN	chromosome 4 open reading frame 3	60						integral component of membrane (GO:0016021)		p.L193L(1)		breast(1)|large_intestine(1)|lung(4)	6						AATACACAAAGAGAAACACCA	0.488																																						uc003icv.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(178-180)CTC>CTG		hypothetical protein LOC401152							150.0	148.0	149.0					4																	120221511		1939	4135	6074	SO:0001819	synonymous_variant	401152					integral to membrane		g.chr4:120221511G>C		CCDS43266.1, CCDS54798.1	4q26	2012-02-24			ENSG00000164096	ENSG00000164096			19225	protein-coding gene	gene with protein product	"""HCV F-transactivated protein 1"""						Standard	NM_001001701		Approved		uc021xrf.1	Q8WVX3	OTTHUMG00000161333	ENST00000504110.1:c.180C>G	4.37:g.120221511G>C			Somatic					p.L60L	NM_001001701	NP_001001701	WXS	Illumina HiSeq	Unspecified	Q8WVX3	CD003_HUMAN			1	458	-			60			Helical; (Potential).		Q6J203	Silent	SNP	ENST00000504110.1	37	c.180C>G	CCDS43266.1																																																																																				0.488	C4orf3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364576.3	NM_001001701		75	64	0	0	0	0	75	64				
PCDH10	57575	broad.mit.edu	37	4	134076163	134076163	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:134076163C>A	ENST00000264360.5	+	3	3608	c.2782C>A	c.(2782-2784)Cgt>Agt	p.R928S		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	928					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R928S(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TGCCACCAACCGTGCCCAGTC	0.423																																						uc003iha.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2782-2784)CGT>AGT		protocadherin 10 isoform 1 precursor							125.0	122.0	123.0					4																	134076163		2203	4300	6503	SO:0001583	missense	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134076163C>A	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2782C>A	4.37:g.134076163C>A	ENSP00000264360:p.Arg928Ser		Somatic					p.R928S	NM_032961	NP_116586	WXS	Illumina HiSeq	Unspecified	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	3	3608	+			928			Cytoplasmic (Potential).		Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	c.2782C>A	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.285688	0.80803	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.55234	0.53	6.07	6.07	0.98685	.	0.000000	0.42964	D	0.000622	T	0.59824	0.2222	N	0.19112	0.55	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	T	0.52487	-0.8569	10	0.20046	T	0.44	.	20.2544	0.98414	0.0:1.0:0.0:0.0	.	928	Q9P2E7	PCD10_HUMAN	S	928	ENSP00000264360:R928S	ENSP00000264360:R928S	R	+	1	0	PCDH10	134295613	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.294000	0.78760	2.885000	0.99019	0.655000	0.94253	CGT		0.423	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		28	45	1	0	5.46e-16	6.98e-16	28	45				
DCHS2	54798	broad.mit.edu	37	4	155241774	155241774	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:155241774C>A	ENST00000357232.4	-	14	3411	c.3412G>T	c.(3412-3414)Gct>Tct	p.A1138S		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1138	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ACATTCACAGCCTGATCAGAT	0.458																																						uc003inw.2		NA																	0				ovary(3)|pancreas(1)	4						c.(3412-3414)GCT>TCT		dachsous 2 isoform 1							222.0	222.0	222.0					4																	155241774		2203	4300	6503	SO:0001583	missense	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155241774C>A	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.3412G>T	4.37:g.155241774C>A	ENSP00000349768:p.Ala1138Ser		Somatic					p.A1138S	NM_017639	NP_060109	WXS	Illumina HiSeq	Unspecified	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	14	3412	-	all_hematologic(180;0.208)	Renal(120;0.0854)	1138			Cadherin 9.		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	c.3412G>T	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.966349	0.74131	.	.	ENSG00000197410	ENST00000357232	T	0.60171	0.21	5.59	5.59	0.84812	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000004	T	0.71953	0.3401	M	0.62088	1.915	0.80722	D	1	D	0.67145	0.996	D	0.67725	0.953	T	0.73241	-0.4045	10	0.59425	D	0.04	.	14.8258	0.70110	0.0:0.9289:0.0:0.071	.	1138	Q6V1P9	PCD23_HUMAN	S	1138	ENSP00000349768:A1138S	ENSP00000349768:A1138S	A	-	1	0	DCHS2	155461224	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	4.670000	0.61583	2.636000	0.89361	0.563000	0.77884	GCT		0.458	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		100	139	1	0	9.45e-43	1.38e-42	100	139				
NPY5R	4889	broad.mit.edu	37	4	164272139	164272139	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:164272139A>G	ENST00000515560.1	+	4	2236	c.714A>G	c.(712-714)atA>atG	p.I238M	NPY5R_ENST00000338566.3_Missense_Mutation_p.I238M|NPY5R_ENST00000506953.1_Missense_Mutation_p.I238M			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	238					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				GCAGAAGTATAAGCTGTGGAT	0.368																																					Melanoma(139;1287 1774 9781 19750 25599)	uc003iqn.2		NA																	0				lung(6)|skin(1)	7						c.(712-714)ATA>ATG		neuropeptide Y receptor Y5							63.0	62.0	62.0					4																	164272139		2203	4300	6503	SO:0001583	missense	4889				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane		g.chr4:164272139A>G	BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.714A>G	4.37:g.164272139A>G	ENSP00000423917:p.Ile238Met		Somatic					p.I238M	NM_006174	NP_006165	WXS	Illumina HiSeq	Unspecified	Q15761	NPY5R_HUMAN			4	896	+	all_hematologic(180;0.166)	Prostate(90;0.109)	238			Cytoplasmic (Potential).		Q6GTR7|Q92916	Missense_Mutation	SNP	ENST00000515560.1	37	c.714A>G	CCDS3804.1	.	.	.	.	.	.	.	.	.	.	A	9.921	1.212144	0.22289	.	.	ENSG00000164129	ENST00000338566;ENST00000515560;ENST00000506953	T;T;T	0.41065	1.01;1.01;1.01	4.79	-2.86	0.05717	GPCR, rhodopsin-like superfamily (1);	0.366747	0.21041	N	0.081179	T	0.28732	0.0712	L	0.45137	1.4	0.26752	N	0.970183	B	0.18741	0.03	B	0.25759	0.063	T	0.23691	-1.0181	10	0.72032	D	0.01	.	5.2667	0.15603	0.3018:0.5095:0.0747:0.114	.	238	Q15761	NPY5R_HUMAN	M	238	ENSP00000339377:I238M;ENSP00000423917:I238M;ENSP00000423474:I238M	ENSP00000339377:I238M	I	+	3	3	NPY5R	164491589	0.983000	0.35010	0.438000	0.26821	0.187000	0.23431	0.169000	0.16641	-0.191000	0.10448	0.533000	0.62120	ATA		0.368	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364633.1	NM_006174		58	90	0	0	0	0	58	90				
GALNTL6	442117	broad.mit.edu	37	4	172735864	172735864	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:172735864C>G	ENST00000506823.1	+	2	790	c.133C>G	c.(133-135)Cag>Gag	p.Q45E	GALNTL6_ENST00000511251.1_Missense_Mutation_p.Q45E	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	45					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.Q45K(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						GCCCGGGGAGCAGCAGGTAAG	0.547																																						uc003isv.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)|skin(1)	4						c.(133-135)CAG>GAG		N-acetylgalactosaminyltransferase-like 6							68.0	68.0	68.0					4																	172735864		2203	4300	6503	SO:0001583	missense	442117					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr4:172735864C>G		CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.133C>G	4.37:g.172735864C>G	ENSP00000423313:p.Gln45Glu		Somatic					p.Q45E	NM_001034845	NP_001030017	WXS	Illumina HiSeq	Unspecified	Q49A17	GLTL6_HUMAN			2	869	+			45			Lumenal (Potential).		Q2L4S6	Missense_Mutation	SNP	ENST00000506823.1	37	c.133C>G	CCDS34104.1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.467905	0.26335	.	.	ENSG00000174473	ENST00000511251;ENST00000506823;ENST00000404275	T	0.55052	0.54	5.9	5.9	0.94986	.	.	.	.	.	T	0.31040	0.0784	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.23904	-1.0175	9	0.02654	T	1	.	17.4282	0.87532	0.0:1.0:0.0:0.0	.	45	Q49A17	GLTL6_HUMAN	E	45	ENSP00000423313:Q45E	ENSP00000385382:Q45E	Q	+	1	0	GALNTL6	172972439	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	4.839000	0.62810	2.793000	0.96121	0.563000	0.77884	CAG		0.547	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845		17	48	0	0	0	0	17	48				
GALNTL6	442117	broad.mit.edu	37	4	173150916	173150916	+	Splice_Site	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr4:173150916G>T	ENST00000506823.1	+	3	904		c.e3+1		GALNTL6_ENST00000508122.1_Splice_Site	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6						protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						ATGCGCTCAGGTATGAAGCTC	0.448																																						uc003isv.2		NA																	0				breast(2)|ovary(1)|skin(1)	4						c.e3+1		N-acetylgalactosaminyltransferase-like 6							94.0	80.0	84.0					4																	173150916		2203	4300	6503	SO:0001630	splice_region_variant	442117					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr4:173150916G>T		CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.247+1G>T	4.37:g.173150916G>T			Somatic					p.G83_splice	NM_001034845	NP_001030017	WXS	Illumina HiSeq	Unspecified	Q49A17	GLTL6_HUMAN			3	983	+								Q2L4S6	Splice_Site	SNP	ENST00000506823.1	37	c.247_splice	CCDS34104.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284151	0.80803	.	.	ENSG00000174473	ENST00000506823;ENST00000404275;ENST00000508122	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1614	0.89709	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GALNTL6	173387491	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.727000	0.84838	2.612000	0.88384	0.655000	0.94253	.		0.448	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845	Intron	16	17	1	0	4.75e-09	5.53e-09	16	17				
DNAH5	1767	broad.mit.edu	37	5	13735961	13735961	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr5:13735961G>A	ENST00000265104.4	-	67	11640	c.11536C>T	c.(11536-11538)Cag>Tag	p.Q3846*		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3846					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CCCAGAAACTGGCGAAGCGAA	0.468									Kartagener syndrome																													uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(11536-11538)CAG>TAG		dynein, axonemal, heavy chain 5							133.0	124.0	127.0					5																	13735961		2203	4300	6503	SO:0001587	stop_gained	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13735961G>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.11536C>T	5.37:g.13735961G>A	ENSP00000265104:p.Gln3846*		Somatic				DNAH5_uc003jfc.2_Nonsense_Mutation_p.Q14*	p.Q3846*	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			67	11578	-	Lung NSC(4;0.00476)		3846					Q92860|Q96L74|Q9H5S7|Q9HCG9	Nonsense_Mutation	SNP	ENST00000265104.4	37	c.11536C>T	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	54	21.943439	0.99944	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.9658	0.97266	0.0:0.0:1.0:0.0	.	.	.	.	X	3846	.	ENSP00000265104:Q3846X	Q	-	1	0	DNAH5	13788961	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	9.807000	0.99171	2.721000	0.93114	0.591000	0.81541	CAG		0.468	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		65	173	0	0	0	0	65	173				
CDH10	1008	broad.mit.edu	37	5	24537586	24537586	+	Silent	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr5:24537586C>T	ENST00000264463.4	-	3	936	c.429G>A	c.(427-429)gaG>gaA	p.E143E		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	143	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		CAAACTCTGACTCTGGCTCTA	0.418										HNSCC(23;0.051)																												uc003jgr.1		NA																	0				ovary(6)|pancreas(4)|breast(2)	12						c.(427-429)GAG>GAA		cadherin 10, type 2 preproprotein							154.0	148.0	150.0					5																	24537586		2203	4300	6503	SO:0001819	synonymous_variant	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24537586C>T	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.429G>A	5.37:g.24537586C>T		HNSCC(23;0.051)	Somatic				CDH10_uc011cnu.1_RNA	p.E143E	NM_006727	NP_006718	WXS	Illumina HiSeq	Unspecified	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	3	761	-			143			Cadherin 1.|Extracellular (Potential).		Q9ULB3	Silent	SNP	ENST00000264463.4	37	c.429G>A	CCDS3892.1																																																																																				0.418	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		94	123	0	0	0	0	94	123				
CDH9	1007	broad.mit.edu	37	5	26885967	26885967	+	Silent	SNP	T	T	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr5:26885967T>C	ENST00000231021.4	-	11	1810	c.1638A>G	c.(1636-1638)acA>acG	p.T546T		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	546	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TGATTCCTGCTGTATTATCTG	0.308																																					Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	0				ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(1636-1638)ACA>ACG		cadherin 9, type 2 preproprotein							54.0	57.0	56.0					5																	26885967		2203	4300	6503	SO:0001819	synonymous_variant	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26885967T>C	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1638A>G	5.37:g.26885967T>C			Somatic				CDH9_uc011cnv.1_Silent_p.T139T	p.T546T	NM_016279	NP_057363	WXS	Illumina HiSeq	Unspecified	Q9ULB4	CADH9_HUMAN			11	1807	-			546			Extracellular (Potential).|Cadherin 5.		Q3B7I5	Silent	SNP	ENST00000231021.4	37	c.1638A>G	CCDS3893.1																																																																																				0.308	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		37	78	0	0	0	0	37	78				
FYB	2533	broad.mit.edu	37	5	39153579	39153579	+	Silent	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr5:39153579G>C	ENST00000351578.6	-	3	1453	c.1263C>G	c.(1261-1263)ccC>ccG	p.P421P	FYB_ENST00000512982.1_Silent_p.P421P|FYB_ENST00000515010.1_Silent_p.P421P|FYB_ENST00000505428.1_Silent_p.P421P|FYB_ENST00000540520.1_Silent_p.P431P	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	421	Interaction with SKAP1.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			TAATGTTTCTGGGAGGTAGGC	0.488																																						uc003jls.2		NA																	0				ovary(2)	2						c.(1261-1263)CCC>CCG		FYN binding protein (FYB-120/130) isoform 2							291.0	298.0	296.0					5																	39153579		2025	4174	6199	SO:0001819	synonymous_variant	2533				cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding	g.chr5:39153579G>C	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1263C>G	5.37:g.39153579G>C			Somatic				FYB_uc003jlt.2_Silent_p.P421P|FYB_uc003jlu.2_Silent_p.P421P|FYB_uc011cpl.1_Silent_p.P431P	p.P421P	NM_199335	NP_955367	WXS	Illumina HiSeq	Unspecified	O15117	FYB_HUMAN	Epithelial(62;0.235)		2	1330	-	all_lung(31;0.000343)		421			Interaction with SKAP1.		A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Silent	SNP	ENST00000351578.6	37	c.1263C>G	CCDS47200.1																																																																																				0.488	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465		115	184	0	0	0	0	115	184				
MROH2B	133558	broad.mit.edu	37	5	41048516	41048516	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr5:41048516C>G	ENST00000399564.4	-	16	2044	c.1594G>C	c.(1594-1596)Ggg>Cgg	p.G532R	MROH2B_ENST00000506092.2_Missense_Mutation_p.G87R	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	532																	TTCAAAAGCCCTATTGCACCA	0.458																																						uc003jmj.3		NA																	0				ovary(6)|central_nervous_system(2)	8						c.(1594-1596)GGG>CGG		HEAT repeat family member 7B2							108.0	100.0	102.0					5																	41048516		1881	4104	5985	SO:0001583	missense	133558						binding	g.chr5:41048516C>G		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1594G>C	5.37:g.41048516C>G	ENSP00000382476:p.Gly532Arg		Somatic				HEATR7B2_uc003jmi.3_Missense_Mutation_p.G87R	p.G532R	NM_173489	NP_775760	WXS	Illumina HiSeq	Unspecified	Q7Z745	HTRB2_HUMAN			16	2084	-			532			HEAT 6.		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	c.1594G>C	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	C	8.802	0.933228	0.18131	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.05855	3.38;3.38	4.87	4.0	0.46444	Armadillo-type fold (1);	0.348277	0.24967	N	0.034166	T	0.04227	0.0117	L	0.27053	0.805	0.40703	D	0.9825	P	0.35793	0.521	B	0.35510	0.204	T	0.40646	-0.9552	10	0.07990	T	0.79	.	8.9057	0.35521	0.0:0.9:0.0:0.1	.	532	Q7Z745	HTRB2_HUMAN	R	87;236;532	ENSP00000441504:G87R;ENSP00000382476:G532R	ENSP00000296803:G236R	G	-	1	0	HEATR7B2	41084273	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	1.953000	0.40352	1.409000	0.46915	0.655000	0.94253	GGG		0.458	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		45	63	0	0	0	0	45	63				
C6	729	broad.mit.edu	37	5	41201815	41201815	+	Splice_Site	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr5:41201815G>C	ENST00000263413.3	-	3	409	c.145C>G	c.(145-147)Caa>Gaa	p.Q49E	C6_ENST00000337836.5_Splice_Site_p.Q49E	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	49	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				ACTACTATTTGTCTGTAACCA	0.363																																						uc003jmk.2		NA																	0				ovary(3)|central_nervous_system(2)|skin(2)	7						c.(145-147)CAA>GAA		complement component 6 precursor							85.0	86.0	86.0					5																	41201815		2203	4300	6503	SO:0001630	splice_region_variant	729				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding	g.chr5:41201815G>C	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.144-1C>G	5.37:g.41201815G>C			Somatic				C6_uc003jml.1_Missense_Mutation_p.Q49E	p.Q49E	NM_000065	NP_000056	WXS	Illumina HiSeq	Unspecified	P13671	CO6_HUMAN			3	355	-		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)	49			TSP type-1 1.			Missense_Mutation	SNP	ENST00000263413.3	37	c.145C>G	CCDS3936.1	.	.	.	.	.	.	.	.	.	.	G	2.793	-0.250834	0.05867	.	.	ENSG00000039537	ENST00000337836;ENST00000263413;ENST00000417809	T;T;T	0.51574	0.7;0.7;0.7	5.92	4.13	0.48395	.	0.876304	0.10452	N	0.672953	T	0.36276	0.0961	N	0.25647	0.755	0.09310	N	0.999998	B	0.26445	0.149	B	0.34590	0.186	T	0.38436	-0.9661	10	0.13470	T	0.59	-0.0048	8.3115	0.32073	0.0718:0.0:0.6524:0.2758	.	49	P13671	CO6_HUMAN	E	49	ENSP00000338861:Q49E;ENSP00000263413:Q49E;ENSP00000396565:Q49E	ENSP00000263413:Q49E	Q	-	1	0	C6	41237572	0.998000	0.40836	0.193000	0.23327	0.828000	0.46876	1.389000	0.34453	0.829000	0.34733	0.655000	0.94253	CAA		0.363	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		Missense_Mutation	51	79	0	0	0	0	51	79				
HCN1	348980	broad.mit.edu	37	5	45396681	45396681	+	Silent	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr5:45396681G>T	ENST00000303230.4	-	4	1200	c.1143C>A	c.(1141-1143)gtC>gtA	p.V381V		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	381					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						AGGTGGCCCCGACGATCATGC	0.507																																						uc003jok.2		NA																	0				ovary(1)	1						c.(1141-1143)GTC>GTA		hyperpolarization activated cyclic							90.0	76.0	81.0					5																	45396681		2203	4300	6503	SO:0001819	synonymous_variant	348980					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity	g.chr5:45396681G>T	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1143C>A	5.37:g.45396681G>T			Somatic					p.V381V	NM_021072	NP_066550	WXS	Illumina HiSeq	Unspecified	O60741	HCN1_HUMAN			4	1168	-			381			Helical; Name=Segment S6; (Potential).			Silent	SNP	ENST00000303230.4	37	c.1143C>A	CCDS3952.1																																																																																				0.507	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072		43	63	1	0	1.32e-16	1.7e-16	43	63				
RAB3C	115827	broad.mit.edu	37	5	58147124	58147124	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr5:58147124G>A	ENST00000282878.4	+	5	799	c.630G>A	c.(628-630)caG>caA	p.Q210Q	CTD-2176I21.2_ENST00000510198.1_RNA	NM_138453.2	NP_612462.1	Q96E17	RAB3C_HUMAN	RAB3C, member RAS oncogene family	210					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)	21		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)		CTGCAAAGCAGAACACGAGAC	0.532																																						uc003jrp.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(628-630)CAG>CAA		RAB3C, member RAS oncogene family							123.0	105.0	111.0					5																	58147124		2203	4300	6503	SO:0001819	synonymous_variant	115827				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding	g.chr5:58147124G>A	AY026936	CCDS3976.1	5q13	2008-02-05			ENSG00000152932	ENSG00000152932		"""RAB, member RAS oncogene"""	30269	protein-coding gene	gene with protein product		612829				12296628	Standard	NM_138453		Approved		uc003jrp.3	Q96E17	OTTHUMG00000097053	ENST00000282878.4:c.630G>A	5.37:g.58147124G>A			Somatic					p.Q210Q	NM_138453	NP_612462	WXS	Illumina HiSeq	Unspecified	Q96E17	RAB3C_HUMAN		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)	5	727	+		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)	210						Silent	SNP	ENST00000282878.4	37	c.630G>A	CCDS3976.1																																																																																				0.532	RAB3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214156.2	NM_138453		90	24	0	0	0	0	90	24				
PCDHA6	56142	broad.mit.edu	37	5	140209242	140209242	+	Silent	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr5:140209242G>T	ENST00000529310.1	+	1	1680	c.1566G>T	c.(1564-1566)ccG>ccT	p.P522P	PCDHA6_ENST00000527624.1_Silent_p.P522P|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	522	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCTGCAGCCGCTGGACCACG	0.682																																						uc003lho.2		NA																	0				haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						c.(1564-1566)CCG>CCT		protocadherin alpha 6 isoform 1 precursor							68.0	79.0	75.0					5																	140209242		2202	4291	6493	SO:0001819	synonymous_variant	56142				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140209242G>T	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1566G>T	5.37:g.140209242G>T			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Silent_p.P522P|PCDHA6_uc011dab.1_Silent_p.P522P	p.P522P	NM_018909	NP_061732	WXS	Illumina HiSeq	Unspecified	Q9UN73	PCDA6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1593	+			522			Cadherin 5.|Extracellular (Potential).		O75283|Q9NRT8	Silent	SNP	ENST00000529310.1	37	c.1566G>T	CCDS47281.1																																																																																				0.682	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909		139	26	1	0	9.63e-85	1.45e-84	139	26				
PCDHA13	56136	broad.mit.edu	37	5	140262387	140262387	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr5:140262387C>G	ENST00000289272.2	+	1	534	c.534C>G	c.(532-534)ttC>ttG	p.F178L	PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.F178L|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA12_ENST00000398631.2_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	178	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGATTATTTCACTTTGGACG	0.433																																					Melanoma(147;1739 1852 5500 27947 37288)	uc003lif.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(532-534)TTC>TTG		protocadherin alpha 13 isoform 1 precursor							91.0	89.0	90.0					5																	140262387		2203	4300	6503	SO:0001583	missense	56136				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140262387C>G	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.534C>G	5.37:g.140262387C>G	ENSP00000289272:p.Phe178Leu		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.F178L|PCDHA13_uc003lid.2_Missense_Mutation_p.F178L	p.F178L	NM_018904	NP_061727	WXS	Illumina HiSeq	Unspecified	Q9Y5I0	PCDAD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	534	+			178			Extracellular (Potential).|Cadherin 2.		O75277	Missense_Mutation	SNP	ENST00000289272.2	37	c.534C>G	CCDS4240.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.158122	0.38119	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.70749	-0.51;-0.51	5.49	0.815	0.18763	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.87981	0.6315	H	0.97611	4.04	0.19945	N	0.999942	D;D;D	0.89917	0.991;1.0;0.972	P;D;D	0.79108	0.908;0.992;0.909	T	0.77827	-0.2443	9	0.87932	D	0	.	9.842	0.41004	0.0:0.4789:0.0:0.5211	.	178;178;178	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	L	178	ENSP00000386821:F178L;ENSP00000289272:F178L	ENSP00000289272:F178L	F	+	3	2	PCDHA13	140242571	0.003000	0.15002	0.051000	0.19133	0.548000	0.35241	-0.043000	0.12043	-0.157000	0.11059	-0.339000	0.08088	TTC		0.433	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904		118	21	0	0	0	0	118	21				
PCDHB6	56130	broad.mit.edu	37	5	140531709	140531709	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr5:140531709C>A	ENST00000231136.1	+	1	1871	c.1871C>A	c.(1870-1872)aCc>aAc	p.T624N	PCDHB6_ENST00000543635.1_Missense_Mutation_p.T488N	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	624	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGGTGCGCACCGCCAGGCTG	0.687																																						uc003lir.2		NA																	0				skin(1)	1						c.(1870-1872)ACC>AAC		protocadherin beta 6 precursor							28.0	30.0	29.0					5																	140531709		2056	4103	6159	SO:0001583	missense	56130				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140531709C>A	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1871C>A	5.37:g.140531709C>A	ENSP00000231136:p.Thr624Asn		Somatic				PCDHB6_uc011dah.1_Missense_Mutation_p.T488N	p.T624N	NM_018939	NP_061762	WXS	Illumina HiSeq	Unspecified	Q9Y5E3	PCDB6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1871	+			624			Cadherin 6.|Extracellular (Potential).		B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	c.1871C>A	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.184318	0.38609	.	.	ENSG00000113211	ENST00000543635;ENST00000231136	T;T	0.57273	0.41;0.41	4.51	4.51	0.55191	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.74390	0.3710	M	0.92367	3.3	0.35698	D	0.815358	D	0.76494	0.999	D	0.78314	0.991	T	0.81961	-0.0693	9	0.87932	D	0	.	6.269	0.20943	0.2391:0.6668:0.0:0.0941	.	624	Q9Y5E3	PCDB6_HUMAN	N	488;624	ENSP00000438466:T488N;ENSP00000231136:T624N	ENSP00000231136:T624N	T	+	2	0	PCDHB6	140511893	0.002000	0.14202	0.918000	0.36340	0.233000	0.25261	0.834000	0.27518	2.223000	0.72356	0.556000	0.70494	ACC		0.687	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939		55	8	1	0	5.99e-33	8.45e-33	55	8				
GABRG2	2566	broad.mit.edu	37	5	161524815	161524815	+	Missense_Mutation	SNP	A	A	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr5:161524815A>T	ENST00000361925.4	+	4	719	c.499A>T	c.(499-501)Aac>Tac	p.N167Y	GABRG2_ENST00000414552.2_Missense_Mutation_p.N167Y|GABRG2_ENST00000356592.3_Missense_Mutation_p.N167Y|GABRG2_ENST00000393933.4_Missense_Mutation_p.N72Y			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	167					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CACCACCCCCAACAGGATGCT	0.423																																						uc003lyz.3		NA																	0				ovary(4)|skin(1)	5						c.(499-501)AAC>TAC		gamma-aminobutyric acid A receptor, gamma 2							96.0	96.0	96.0					5																	161524815		2203	4300	6503	SO:0001583	missense	2566				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding	g.chr5:161524815A>T		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.499A>T	5.37:g.161524815A>T	ENSP00000354651:p.Asn167Tyr		Somatic				GABRG2_uc010jjc.2_Missense_Mutation_p.N167Y|GABRG2_uc003lyy.3_Missense_Mutation_p.N167Y|GABRG2_uc011dej.1_Missense_Mutation_p.N72Y	p.N167Y	NM_000816	NP_000807	WXS	Illumina HiSeq	Unspecified	P18507	GBRG2_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	4	857	+	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	167			Extracellular (Probable).		F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	37	c.499A>T	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	a	19.99	3.928744	0.73327	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933;ENST00000522053	T;T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4;-1.4	5.82	4.66	0.58398	Neurotransmitter-gated ion-channel ligand-binding (3);	0.041871	0.85682	D	0.000000	D	0.92044	0.7479	H	0.94925	3.6	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.87578	0.984;0.998;0.997	D	0.93421	0.6777	10	0.87932	D	0	.	13.3442	0.60561	0.8681:0.1319:0.0:0.0	.	167;167;167	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	Y	167;167;167;72;72	ENSP00000349000:N167Y;ENSP00000410732:N167Y;ENSP00000354651:N167Y;ENSP00000377510:N72Y;ENSP00000430182:N72Y	ENSP00000349000:N167Y	N	+	1	0	GABRG2	161457393	1.000000	0.71417	0.989000	0.46669	0.913000	0.54294	9.168000	0.94781	1.036000	0.39998	-0.363000	0.07495	AAC		0.423	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1			136	17	0	0	0	0	136	17				
ATXN1	6310	broad.mit.edu	37	6	16327496	16327496	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:16327496C>T	ENST00000244769.4	-	8	1982	c.1046G>A	c.(1045-1047)gGc>gAc	p.G349D	ATXN1_ENST00000436367.1_Missense_Mutation_p.G349D	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	349					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				AACCGACTTGCCGCCTGCCTT	0.677																																						uc003nbt.2		NA																	0				skin(3)|central_nervous_system(1)	4						c.(1045-1047)GGC>GAC		ataxin 1							54.0	62.0	60.0					6																	16327496		2203	4300	6503	SO:0001583	missense	6310				cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association	g.chr6:16327496C>T	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.1046G>A	6.37:g.16327496C>T	ENSP00000244769:p.Gly349Asp		Somatic				ATXN1_uc010jpi.2_Missense_Mutation_p.G349D|ATXN1_uc010jpj.1_Intron	p.G349D	NM_000332	NP_000323	WXS	Illumina HiSeq	Unspecified	P54253	ATX1_HUMAN			8	2017	-	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)	349					Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	c.1046G>A	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	C	8.522	0.869044	0.17322	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.77229	-1.08;-1.08	4.82	3.91	0.45181	.	1.289370	0.04904	N	0.451797	T	0.46678	0.1405	L	0.34521	1.04	0.24583	N	0.993863	B	0.28713	0.22	B	0.19148	0.024	T	0.37572	-0.9700	10	0.33141	T	0.24	-4.03	4.3687	0.11237	0.0:0.5879:0.2039:0.2081	.	349	P54253	ATX1_HUMAN	D	349	ENSP00000244769:G349D;ENSP00000416360:G349D	ENSP00000244769:G349D	G	-	2	0	ATXN1	16435475	0.961000	0.32948	0.769000	0.31535	0.384000	0.30261	2.695000	0.47043	2.209000	0.71365	0.561000	0.74099	GGC		0.677	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332		4	146	0	0	0	0	4	146				
OR14J1	442191	broad.mit.edu	37	6	29274690	29274690	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:29274690C>A	ENST00000377160.2	+	1	288	c.224C>A	c.(223-225)aCa>aAa	p.T75K		NM_030946.1	NP_112208.1	Q9UGF5	O14J1_HUMAN	olfactory receptor, family 14, subfamily J, member 1	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(2)	17						ATCTCTGTCACAGTCCCCCAG	0.453																																						uc011dln.1		NA																	0				ovary(1)	1						c.(223-225)ACA>AAA		olfactory receptor, family 5, subfamily U member							270.0	301.0	290.0					6																	29274690		1511	2709	4220	SO:0001583	missense	442191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29274690C>A		CCDS34362.1	6p21.3	2012-08-09	2008-04-02	2008-04-02	ENSG00000204695	ENSG00000204695		"""GPCR / Class A : Olfactory receptors"""	13971	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily U, member 1"""	OR5U1			Standard	NM_030946		Approved	hs6M1-28	uc011dln.2	Q9UGF5	OTTHUMG00000031184	ENST00000377160.2:c.224C>A	6.37:g.29274690C>A	ENSP00000366365:p.Thr75Lys		Somatic					p.T75K	NM_030946	NP_112208	WXS	Illumina HiSeq	Unspecified	Q9UGF5	O14J1_HUMAN			1	224	+			75			Extracellular (Potential).		A2BEC2|B0V078|Q5ST27	Missense_Mutation	SNP	ENST00000377160.2	37	c.224C>A	CCDS34362.1	.	.	.	.	.	.	.	.	.	.	C	15.35	2.807934	0.50421	.	.	ENSG00000204695	ENST00000377160	T	0.00902	5.56	4.86	4.86	0.63082	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000295	T	0.04952	0.0133	H	0.97783	4.075	0.09310	N	1	D	0.76494	0.999	D	0.71656	0.974	T	0.37526	-0.9702	10	0.87932	D	0	.	9.01	0.36135	0.0:0.8348:0.0:0.1652	.	75	Q9UGF5	O14J1_HUMAN	K	75	ENSP00000366365:T75K	ENSP00000366365:T75K	T	+	2	0	OR14J1	29382669	0.000000	0.05858	0.515000	0.27774	0.625000	0.37756	-0.233000	0.09041	2.680000	0.91292	0.650000	0.86243	ACA		0.453	OR14J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076362.2			277	73	1	0	5.25e-114	7.98e-114	277	73				
TREML2	79865	broad.mit.edu	37	6	41162312	41162312	+	Silent	SNP	G	G	A	rs141822677	byFrequency	TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:41162312G>A	ENST00000483722.1	-	3	821	c.636C>T	c.(634-636)acC>acT	p.T212T		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	212					T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.T271T(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					TGGGAGACGCGGTCACTGTCT	0.627													G|||	11	0.00219649	0.0083	0.0	5008	,	,		17182	0.0		0.0	False		,,,				2504	0.0					uc010jxm.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(634-636)ACC>ACT		triggering receptor expressed on myeloid		G		21,4385	28.1+/-56.4	0,21,2182	114.0	98.0	103.0		636	-4.4	0.0	6	dbSNP_134	103	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	TREML2	NM_024807.2		0,23,6480	AA,AG,GG		0.0233,0.4766,0.1768		212/322	41162312	23,12983	2203	4300	6503	SO:0001819	synonymous_variant	79865				T cell activation	cell surface|integral to membrane|plasma membrane	protein binding|receptor activity	g.chr6:41162312G>A	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.636C>T	6.37:g.41162312G>A			Somatic					p.T212T	NM_024807	NP_079083	WXS	Illumina HiSeq	Unspecified	Q5T2D2	TRML2_HUMAN			3	815	-	Ovarian(28;0.0418)|Colorectal(47;0.196)		212			Extracellular (Potential).		Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Silent	SNP	ENST00000483722.1	37	c.636C>T	CCDS4853.2																																																																																				0.627	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807		24	33	0	0	0	0	24	33				
RCAN2	10231	broad.mit.edu	37	6	46191030	46191030	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:46191030A>G	ENST00000330430.6	-	4	630	c.442T>C	c.(442-444)Tat>Cat	p.Y148H	RCAN2_ENST00000405162.1_Missense_Mutation_p.Y194H|RCAN2_ENST00000371374.1_Missense_Mutation_p.Y194H|RCAN2_ENST00000306764.7_Missense_Mutation_p.Y194H	NM_005822.3	NP_005813.2	Q14206	RCAN2_HUMAN	regulator of calcineurin 2	148					calcineurin-NFAT signaling cascade (GO:0033173)|locomotion involved in locomotory behavior (GO:0031987)|response to oxidative stress (GO:0006979)|short-term memory (GO:0007614)		nucleotide binding (GO:0000166)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	8						TGGAGCTCATACTTCTCTCCT	0.502																																						uc003oyb.1		NA																	0					0						c.(442-444)TAT>CAT		Down syndrome critical region gene 1-like 1							117.0	120.0	119.0					6																	46191030		1917	4121	6038	SO:0001583	missense	10231				calcium-mediated signaling|central nervous system development		nucleotide binding|protein phosphatase 2B binding	g.chr6:46191030A>G	D83407	CCDS43469.1, CCDS59023.1	6p12.3	2008-10-31	2007-06-26	2007-06-26	ENSG00000172348	ENSG00000172348			3041	protein-coding gene	gene with protein product		604876	"""Down syndrome critical region gene 1-like 1"""	DSCR1L1		8662924	Standard	NM_001251973		Approved	ZAKI-4	uc003oyc.2	Q14206	OTTHUMG00000014782	ENST00000330430.6:c.442T>C	6.37:g.46191030A>G	ENSP00000329454:p.Tyr148His		Somatic				RCAN2_uc003oyc.1_Missense_Mutation_p.Y194H|RCAN2_uc003oyd.1_Missense_Mutation_p.Y194H	p.Y148H	NM_005822	NP_005813	WXS	Illumina HiSeq	Unspecified	Q14206	RCAN2_HUMAN			4	757	-			148					A6ND07|B3KR46|Q5VWF7|Q5VWF8|Q8N116	Missense_Mutation	SNP	ENST00000330430.6	37	c.442T>C	CCDS43469.1	.	.	.	.	.	.	.	.	.	.	A	11.99	1.804029	0.31869	.	.	ENSG00000172348	ENST00000330430;ENST00000371374;ENST00000306764;ENST00000405162	.	.	.	5.5	5.5	0.81552	.	0.147981	0.46758	D	0.000263	T	0.50463	0.1617	N	0.16307	0.4	0.51233	D	0.999916	D;D	0.59767	0.986;0.963	P;P	0.62885	0.908;0.58	T	0.62186	-0.6907	9	0.87932	D	0	-10.6675	14.7787	0.69749	1.0:0.0:0.0:0.0	.	194;148	Q14206-2;Q14206	.;RCAN2_HUMAN	H	148;194;194;194	.	ENSP00000305223:Y194H	Y	-	1	0	RCAN2	46298989	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.962000	0.93254	2.085000	0.62840	0.533000	0.62120	TAT		0.502	RCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040782.1			84	113	0	0	0	0	84	113				
GPR116	221395	broad.mit.edu	37	6	46856179	46856179	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:46856179G>T	ENST00000283296.7	-	4	509	c.221C>A	c.(220-222)gCa>gAa	p.A74E	GPR116_ENST00000265417.7_Missense_Mutation_p.A74E|GPR116_ENST00000362015.4_Missense_Mutation_p.A74E|GPR116_ENST00000456426.2_Missense_Mutation_p.A74E|GPR116_ENST00000478711.1_5'Flank	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	74					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			CAGGAAGGATGCATTTTCAAA	0.398																																					NSCLC(59;410 1274 8751 36715 50546)	uc003oyo.3		NA																	0				central_nervous_system(1)|skin(1)	2						c.(220-222)GCA>GAA		G-protein coupled receptor 116 precursor							161.0	149.0	153.0					6																	46856179		2203	4300	6503	SO:0001583	missense	221395				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:46856179G>T	AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.221C>A	6.37:g.46856179G>T	ENSP00000283296:p.Ala74Glu		Somatic				GPR116_uc003oyp.3_Missense_Mutation_p.A74E|GPR116_uc003oyq.3_Missense_Mutation_p.A74E|GPR116_uc003oyr.2_Missense_Mutation_p.A74E	p.A74E	NM_001098518	NP_001091988	WXS	Illumina HiSeq	Unspecified	Q8IZF2	GP116_HUMAN	Lung(136;0.192)		4	510	-			74			Extracellular (Potential).		O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	ENST00000283296.7	37	c.221C>A	CCDS4919.1	.	.	.	.	.	.	.	.	.	.	G	13.10	2.135749	0.37728	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000265417	T;T;T;T	0.27557	1.69;2.07;1.66;1.69	5.66	2.06	0.26882	.	0.736452	0.12516	N	0.462060	T	0.11367	0.0277	M	0.62723	1.935	0.09310	N	1	P;B;P	0.42827	0.791;0.176;0.791	B;B;B	0.38428	0.273;0.037;0.273	T	0.15665	-1.0429	10	0.41790	T	0.15	-2.1396	3.9541	0.09382	0.2509:0.0:0.578:0.1711	.	74;74;74	A8K0D8;Q8IZF2-3;Q8IZF2	.;.;GP116_HUMAN	E	74	ENSP00000283296:A74E;ENSP00000354563:A74E;ENSP00000412866:A74E;ENSP00000265417:A74E	ENSP00000265417:A74E	A	-	2	0	GPR116	46964138	0.295000	0.24389	0.172000	0.22920	0.666000	0.39218	1.535000	0.36061	0.161000	0.19458	0.655000	0.94253	GCA		0.398	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234		53	86	1	0	1.08e-33	1.54e-33	53	86				
TFAP2D	83741	broad.mit.edu	37	6	50740375	50740375	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:50740375T>A	ENST00000008391.3	+	8	1385	c.1157T>A	c.(1156-1158)tTt>tAt	p.F386Y		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					ACTCATGGCTTTGGGACTCCG	0.403																																						uc003paf.2		NA																	0				ovary(6)|breast(1)	7						c.(1156-1158)TTT>TAT		transcription factor AP-2 beta-like 1							53.0	53.0	53.0					6																	50740375		2203	4300	6503	SO:0001583	missense	83741						DNA binding|sequence-specific DNA binding transcription factor activity	g.chr6:50740375T>A	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.1157T>A	6.37:g.50740375T>A	ENSP00000008391:p.Phe386Tyr		Somatic				TFAP2D_uc011dwt.1_RNA	p.F386Y	NM_172238	NP_758438	WXS	Illumina HiSeq	Unspecified	Q7Z6R9	AP2D_HUMAN			8	1669	+	Lung NSC(77;0.0334)		386			H-S-H (helix-span-helix), dimerization.			Missense_Mutation	SNP	ENST00000008391.3	37	c.1157T>A	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.368253	0.82463	.	.	ENSG00000008197	ENST00000008391	D	0.97906	-4.6	5.46	5.46	0.80206	Transcription factor AP-2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98991	0.9656	M	0.93808	3.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99667	1.0995	10	0.87932	D	0	-19.2996	15.5329	0.75977	0.0:0.0:0.0:1.0	.	386	Q7Z6R9	AP2D_HUMAN	Y	386	ENSP00000008391:F386Y	ENSP00000008391:F386Y	F	+	2	0	TFAP2D	50848334	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.698000	0.84413	2.083000	0.62718	0.383000	0.25322	TTT		0.403	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238		43	53	0	0	0	0	43	53				
PKHD1	5314	broad.mit.edu	37	6	51897833	51897833	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:51897833A>G	ENST00000371117.3	-	29	3634	c.3359T>C	c.(3358-3360)aTa>aCa	p.I1120T	PKHD1_ENST00000340994.4_Missense_Mutation_p.I1120T	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1120	IPT/TIG 6; atypical.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TTTACCTGCTATATTGCTTAT	0.363																																						uc003pah.1		NA																	0				lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44						c.(3358-3360)ATA>ACA		fibrocystin isoform 1							125.0	124.0	124.0					6																	51897833		2203	4300	6503	SO:0001583	missense	5314				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity	g.chr6:51897833A>G	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.3359T>C	6.37:g.51897833A>G	ENSP00000360158:p.Ile1120Thr		Somatic				PKHD1_uc003pai.2_Missense_Mutation_p.I1120T	p.I1120T	NM_138694	NP_619639	WXS	Illumina HiSeq	Unspecified	P08F94	PKHD1_HUMAN			29	3635	-	Lung NSC(77;0.0605)		1120			Extracellular (Potential).|IPT/TIG 6; atypical.		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	c.3359T>C	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	A	10.74	1.436013	0.25813	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.86694	-1.95;-2.16	5.99	4.86	0.63082	Cell surface receptor IPT/TIG (1);	0.585786	0.17947	N	0.156652	T	0.70272	0.3205	L	0.42245	1.32	0.32283	N	0.567336	B;B	0.14438	0.01;0.006	B;B	0.08055	0.003;0.003	T	0.64896	-0.6299	10	0.42905	T	0.14	.	7.0031	0.24821	0.8127:0.0:0.1873:0.0	.	1120;1120	P08F94-2;P08F94	.;PKHD1_HUMAN	T	1120	ENSP00000360158:I1120T;ENSP00000341097:I1120T	ENSP00000341097:I1120T	I	-	2	0	PKHD1	52005792	0.997000	0.39634	0.966000	0.40874	0.885000	0.51271	2.468000	0.45102	2.292000	0.77174	0.482000	0.46254	ATA		0.363	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		52	76	0	0	0	0	52	76				
PKHD1	5314	broad.mit.edu	37	6	51947243	51947243	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:51947243G>A	ENST00000371117.3	-	4	503	c.228C>T	c.(226-228)ccC>ccT	p.P76P	PKHD1_ENST00000340994.4_Silent_p.P76P	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	76	IPT/TIG 1; atypical.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AGACGTCACAGGGAACACTCC	0.502																																						uc003pah.1		NA																	0				lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44						c.(226-228)CCC>CCT		fibrocystin isoform 1							171.0	176.0	174.0					6																	51947243		2203	4300	6503	SO:0001819	synonymous_variant	5314				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity	g.chr6:51947243G>A	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.228C>T	6.37:g.51947243G>A			Somatic				PKHD1_uc003pai.2_Silent_p.P76P	p.P76P	NM_138694	NP_619639	WXS	Illumina HiSeq	Unspecified	P08F94	PKHD1_HUMAN			4	504	-	Lung NSC(77;0.0605)		76			Extracellular (Potential).|IPT/TIG 1; atypical.		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	37	c.228C>T	CCDS4935.1																																																																																				0.502	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		94	139	0	0	0	0	94	139				
ZNF451	26036	broad.mit.edu	37	6	57017082	57017082	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:57017082G>T	ENST00000370706.4	+	12	3060	c.2816G>T	c.(2815-2817)gGa>gTa	p.G939V	RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|ZNF451_ENST00000357489.3_Missense_Mutation_p.G891V|RP11-203B9.4_ENST00000586432.1_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.G939V|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	939					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			AACAGGATTGGATGCTTCTTC	0.353																																						uc003pdm.1		NA																	0				ovary(1)|pancreas(1)	2						c.(2815-2817)GGA>GTA		zinc finger protein 451 isoform 1							135.0	129.0	131.0					6																	57017082		2203	4300	6503	SO:0001583	missense	26036				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:57017082G>T	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.2816G>T	6.37:g.57017082G>T	ENSP00000359740:p.Gly939Val		Somatic				ZNF451_uc003pdl.2_Missense_Mutation_p.G939V|ZNF451_uc003pdn.1_Missense_Mutation_p.G891V|uc003pdq.1_Intron	p.G939V	NM_001031623	NP_001026794	WXS	Illumina HiSeq	Unspecified	Q9Y4E5	ZN451_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)		12	3040	+	Lung NSC(77;0.145)		939					Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	ENST00000370706.4	37	c.2816G>T	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.538313	0.85917	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	T;T;T	0.08458	3.09;3.09;3.09	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.24624	0.0597	M	0.76002	2.32	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.996	T	0.01242	-1.1408	10	0.87932	D	0	-16.3654	19.5384	0.95264	0.0:0.0:1.0:0.0	.	891;939;939	Q9Y4E5-2;Q9Y4E5;E9PH99	.;ZN451_HUMAN;.	V	939;891;939	ENSP00000359740:G939V;ENSP00000350083:G891V;ENSP00000421645:G939V	ENSP00000350083:G891V	G	+	2	0	ZNF451	57125041	1.000000	0.71417	0.988000	0.46212	0.999000	0.98932	6.722000	0.74735	2.687000	0.91594	0.655000	0.94253	GGA		0.353	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555		58	99	1	0	2.76e-25	3.78e-25	58	99				
PRIM2	5558	broad.mit.edu	37	6	57472415	57472415	+	3'UTR	SNP	A	A	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:57472415A>T	ENST00000389488.2	+	0	1291				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GCAGTCATACAAGATCTCTCC	0.433																																						uc003pdx.2		NA																	0					0						c.(1204-1206)AAG>TAG		DNA primase polypeptide 2							191.0	177.0	182.0					6																	57472415		2015	4196	6211	SO:0001624	3_prime_UTR_variant	5558				DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding	g.chr6:57472415A>T		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1288A>T	6.37:g.57472415A>T			Somatic					p.K402*	NM_000947	NP_000938	WXS	Illumina HiSeq	Unspecified	P49643	PRI2_HUMAN		Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)	13	1291	+			402					Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Nonsense_Mutation	SNP	ENST00000389488.2	37	c.1204A>T																																																																																					0.433	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000043468.3	NM_000947		8	75	0	0	0	0	8	75				
FHL5	9457	broad.mit.edu	37	6	97052714	97052714	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:97052714C>G	ENST00000326771.2	+	4	628	c.248C>G	c.(247-249)gCc>gGc	p.A83G	FHL5_ENST00000541107.1_Missense_Mutation_p.A83G	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	83	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		CCTTTTGCTGCCAAGGATGAG	0.507																																						uc003pos.1		NA																	0				ovary(2)	2						c.(247-249)GCC>GGC		activator of cAMP-responsive element modulator							120.0	111.0	114.0					6																	97052714		2203	4300	6503	SO:0001583	missense	9457					nucleus	zinc ion binding	g.chr6:97052714C>G	AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.248C>G	6.37:g.97052714C>G	ENSP00000326022:p.Ala83Gly		Somatic				FHL5_uc003pot.1_Missense_Mutation_p.A83G	p.A83G	NM_020482	NP_065228	WXS	Illumina HiSeq	Unspecified	Q5TD97	FHL5_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0948)	4	653	+		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)	83			LIM zinc-binding 1.		B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Missense_Mutation	SNP	ENST00000326771.2	37	c.248C>G	CCDS5035.1	.	.	.	.	.	.	.	.	.	.	C	33	5.217197	0.95104	.	.	ENSG00000112214	ENST00000541107;ENST00000326771;ENST00000450218	D;D;D	0.87729	-2.29;-2.29;-2.29	5.36	5.36	0.76844	Zinc finger, LIM-type (4);	0.000000	0.45126	D	0.000393	D	0.87787	0.6265	L	0.52573	1.65	0.80722	D	1	D	0.52996	0.957	P	0.53146	0.719	D	0.88357	0.2985	10	0.62326	D	0.03	.	19.4358	0.94794	0.0:1.0:0.0:0.0	.	83	Q5TD97	FHL5_HUMAN	G	83	ENSP00000442357:A83G;ENSP00000326022:A83G;ENSP00000396390:A83G	ENSP00000326022:A83G	A	+	2	0	FHL5	97159435	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.891000	0.63185	2.663000	0.90544	0.655000	0.94253	GCC		0.507	FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041559.1	NM_020482		63	40	0	0	0	0	63	40				
FRK	2444	broad.mit.edu	37	6	116381174	116381174	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:116381174G>A	ENST00000606080.1	-	1	747	c.301C>T	c.(301-303)Cct>Tct	p.P101S		NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	101	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	TAGTTAGAAGGAATATAGCCT	0.468																																						uc003pwi.1		NA																	0				ovary(3)|lung(3)	6						c.(301-303)CCT>TCT		fyn-related kinase							135.0	141.0	139.0					6																	116381174		2203	4300	6503	SO:0001583	missense	2444				negative regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr6:116381174G>A	U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.301C>T	6.37:g.116381174G>A	ENSP00000476145:p.Pro101Ser		Somatic					p.P101S	NM_002031	NP_002022	WXS	Illumina HiSeq	Unspecified	P42685	FRK_HUMAN		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	1	748	-		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)	101			SH3.		B4DY49|Q13128|Q9NTR5	Missense_Mutation	SNP	ENST00000606080.1	37	c.301C>T	CCDS5103.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.524102	0.85600	.	.	ENSG00000111816	ENST00000368626	D	0.81821	-1.54	4.74	4.74	0.60224	Src homology-3 domain (4);	0.000000	0.64402	D	0.000013	D	0.90383	0.6990	M	0.89658	3.05	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91973	0.5588	10	0.87932	D	0	.	16.4432	0.83908	0.0:0.0:1.0:0.0	.	101	P42685	FRK_HUMAN	S	101	ENSP00000357615:P101S	ENSP00000357615:P101S	P	-	1	0	FRK	116487867	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.658000	0.83755	2.604000	0.88044	0.655000	0.94253	CCT		0.468	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041924.2	NM_002031		124	54	0	0	0	0	124	54				
ENPP3	5169	broad.mit.edu	37	6	132004203	132004203	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:132004203G>T	ENST00000414305.1	+	13	1349	c.1021G>T	c.(1021-1023)Gcc>Tcc	p.A341S	ENPP3_ENST00000358229.5_Missense_Mutation_p.A341S|ENPP3_ENST00000427148.2_3'UTR|ENPP3_ENST00000357639.3_Missense_Mutation_p.A341S			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	341	Phosphodiesterase.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		GGTAATTAAAGCCTTACAGGT	0.378																																						uc003qcu.3		NA																	0				ovary(3)|skin(1)	4						c.(1021-1023)GCC>TCC		ectonucleotide pyrophosphatase/phosphodiesterase							164.0	156.0	159.0					6																	132004203		2203	4300	6503	SO:0001583	missense	5169				immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity	g.chr6:132004203G>T	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.1021G>T	6.37:g.132004203G>T	ENSP00000406261:p.Ala341Ser		Somatic				ENPP3_uc010kfo.1_RNA|ENPP3_uc010kfp.1_RNA|ENPP3_uc010kfq.2_RNA|ENPP3_uc003qcv.2_Missense_Mutation_p.A341S	p.A341S	NM_005021	NP_005012	WXS	Illumina HiSeq	Unspecified	O14638	ENPP3_HUMAN		GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)	13	1368	+	Breast(56;0.0753)		341			Extracellular (Potential).|Phosphodiesterase.		Q5JTL3	Missense_Mutation	SNP	ENST00000414305.1	37	c.1021G>T	CCDS5148.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.144023	0.77888	.	.	ENSG00000154269	ENST00000414305;ENST00000357639;ENST00000358229	T;T;T	0.74632	-0.86;-0.86;-0.86	5.5	4.63	0.57726	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.277119	0.30969	N	0.008514	T	0.66366	0.2782	L	0.60455	1.87	0.80722	D	1	P	0.45396	0.857	P	0.50049	0.629	T	0.67313	-0.5702	10	0.36615	T	0.2	-8.5217	7.7918	0.29125	0.0829:0.0:0.7539:0.1633	.	341	O14638	ENPP3_HUMAN	S	341	ENSP00000406261:A341S;ENSP00000350265:A341S;ENSP00000350964:A341S	ENSP00000350265:A341S	A	+	1	0	ENPP3	132045896	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	3.126000	0.50477	2.599000	0.87857	0.650000	0.86243	GCC		0.378	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2			69	32	1	0	2.05e-36	2.95e-36	69	32				
MAP3K5	4217	broad.mit.edu	37	6	137015389	137015389	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:137015389C>T	ENST00000359015.4	-	7	1502	c.1142G>A	c.(1141-1143)aGc>aAc	p.S381N		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	381					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TTGTCCTTCGCTTTGCACCAT	0.388																																						uc003qhc.2		NA																	0				ovary(2)|skin(2)|lung(1)	5						c.(1141-1143)AGC>AAC		mitogen-activated protein kinase kinase kinase							101.0	88.0	92.0					6																	137015389		2203	4300	6503	SO:0001583	missense	4217				activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding	g.chr6:137015389C>T	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.1142G>A	6.37:g.137015389C>T	ENSP00000351908:p.Ser381Asn		Somatic				MAP3K5_uc011edk.1_Missense_Mutation_p.S226N|MAP3K5_uc010kgw.1_Missense_Mutation_p.S381N	p.S381N	NM_005923	NP_005914	WXS	Illumina HiSeq	Unspecified	Q99683	M3K5_HUMAN		GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)	7	1503	-	Colorectal(23;0.24)		381					A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	ENST00000359015.4	37	c.1142G>A	CCDS5179.1	.	.	.	.	.	.	.	.	.	.	C	10.74	1.434014	0.25813	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.09817	2.94	5.57	2.85	0.33270	.	0.458983	0.27455	N	0.019297	T	0.03178	0.0093	L	0.46157	1.445	0.09310	N	0.999999	B;B;B	0.17852	0.024;0.001;0.0	B;B;B	0.29077	0.098;0.002;0.002	T	0.43589	-0.9382	10	0.30078	T	0.28	.	5.2113	0.15318	0.1328:0.5654:0.0:0.3018	.	461;226;381	Q59GL6;B4DF67;Q99683	.;.;M3K5_HUMAN	N	381;461	ENSP00000351908:S381N	ENSP00000351908:S381N	S	-	2	0	MAP3K5	137057082	0.000000	0.05858	0.992000	0.48379	0.909000	0.53808	0.192000	0.17096	0.403000	0.25479	0.591000	0.81541	AGC		0.388	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1			56	253	0	0	0	0	56	253				
KIAA1244	57221	broad.mit.edu	37	6	138550985	138550985	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:138550985C>A	ENST00000251691.4	+	5	582	c.416C>A	c.(415-417)gCg>gAg	p.A139E		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		CTGAAGATCGCGGAGGTGAGT	0.483																																						uc003qhu.2		NA																	0				ovary(1)|skin(1)	2						c.(415-417)GCG>GAG		brefeldin A-inhibited guanine							190.0	157.0	168.0					6																	138550985		2203	4300	6503	SO:0001583	missense	57221				regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity	g.chr6:138550985C>A	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.416C>A	6.37:g.138550985C>A	ENSP00000251691:p.Ala139Glu		Somatic					p.A139E	NM_020340	NP_065073	WXS	Illumina HiSeq	Unspecified	Q5TH69	BIG3_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)	5	416	+	Breast(32;0.135)		139						Missense_Mutation	SNP	ENST00000251691.4	37	c.416C>A	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	C	19.58	3.854679	0.71719	.	.	ENSG00000112379	ENST00000251691	T	0.05139	3.49	5.89	5.89	0.94794	.	0.456089	0.24147	N	0.041112	T	0.08179	0.0204	L	0.43152	1.355	0.80722	D	1	D	0.61080	0.989	P	0.49999	0.628	T	0.08289	-1.0729	10	0.56958	D	0.05	-28.6063	20.2562	0.98421	0.0:1.0:0.0:0.0	.	139	Q5TH69	BIG3_HUMAN	E	139	ENSP00000251691:A139E	ENSP00000251691:A139E	A	+	2	0	KIAA1244	138592678	1.000000	0.71417	0.972000	0.41901	0.698000	0.40448	7.093000	0.76937	2.797000	0.96272	0.563000	0.77884	GCG		0.483	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340		237	40	1	0	2.7e-108	4.1e-108	237	40				
LATS1	9113	broad.mit.edu	37	6	149997417	149997417	+	Silent	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:149997417T>A	ENST00000543571.1	-	7	3409	c.2862A>T	c.(2860-2862)acA>acT	p.T954T	LATS1_ENST00000542747.1_5'UTR|LATS1_ENST00000253339.5_Silent_p.T954T	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		TTTCTAATGGTGTTTGTGCCA	0.353																																						uc003qmu.1		NA																	0				lung(5)|central_nervous_system(1)	6						c.(2860-2862)ACA>ACT		LATS homolog 1							146.0	124.0	132.0					6																	149997417		2203	4300	6503	SO:0001819	synonymous_variant	9113				cell division|cytoplasmic sequestering of protein|G2/M transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|positive regulation of peptidyl-serine phosphorylation|regulation of actin filament polymerization|sister chromatid segregation	microtubule organizing center|spindle pole	ATP binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity	g.chr6:149997417T>A	AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.2862A>T	6.37:g.149997417T>A			Somatic				LATS1_uc010kif.1_Silent_p.T849T|LATS1_uc003qmv.1_Silent_p.T954T	p.T954T	NM_004690	NP_004681	WXS	Illumina HiSeq	Unspecified	O95835	LATS1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)	7	3410	-		Ovarian(120;0.0164)	954			Protein kinase.			Silent	SNP	ENST00000543571.1	37	c.2862A>T	CCDS34551.1																																																																																				0.353	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690		36	51	0	0	0	0	36	51				
SYNE1	23345	broad.mit.edu	37	6	152464762	152464762	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:152464762C>T	ENST00000367255.5	-	138	25716	c.25115G>A	c.(25114-25116)gGc>gAc	p.G8372D	SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000356820.4_Missense_Mutation_p.G2896D|SYNE1_ENST00000423061.1_Missense_Mutation_p.G8324D|SYNE1_ENST00000354674.4_Missense_Mutation_p.G550D|SYNE1_ENST00000265368.4_Missense_Mutation_p.G8372D|SYNE1_ENST00000341594.5_Missense_Mutation_p.G7984D|SYNE1_ENST00000539504.1_Missense_Mutation_p.G527D|SYNE1_ENST00000448038.1_Missense_Mutation_p.G8324D	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8372					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ACTTACGTAGCCTTTGTAGCT	0.507										HNSCC(10;0.0054)																												uc010kiw.2		NA																	0				central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(25114-25116)GGC>GAC		spectrin repeat containing, nuclear envelope 1							163.0	147.0	152.0					6																	152464762		2203	4300	6503	SO:0001583	missense	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152464762C>T	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.25115G>A	6.37:g.152464762C>T	ENSP00000356224:p.Gly8372Asp	HNSCC(10;0.0054)	Somatic				SYNE1_uc010kiv.2_Missense_Mutation_p.G2896D|SYNE1_uc003qos.3_Missense_Mutation_p.G2896D|SYNE1_uc003qot.3_Missense_Mutation_p.G8324D|SYNE1_uc003qou.3_Missense_Mutation_p.G8372D|SYNE1_uc003qop.3_Missense_Mutation_p.G557D|SYNE1_uc011eez.1_Missense_Mutation_p.G574D|SYNE1_uc003qoq.3_Missense_Mutation_p.G574D|SYNE1_uc003qor.3_Missense_Mutation_p.G1295D	p.G8372D	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	138	25717	-		Ovarian(120;0.0955)	8372			Potential.|Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	c.25115G>A	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	33	5.220057	0.95139	.	.	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	T;T;T;T;T;T;T;T;T;T	0.56941	0.53;4.65;1.48;0.58;0.43;0.58;0.67;2.57;1.68;4.69	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000010	T	0.63920	0.2552	L	0.55743	1.74	0.80722	D	1	D;D;D;D;P	0.89917	1.0;1.0;1.0;1.0;0.791	D;D;D;D;B	0.97110	1.0;1.0;1.0;1.0;0.313	T	0.54029	-0.8354	10	0.30854	T	0.27	.	20.5596	0.99324	0.0:1.0:0.0:0.0	.	8372;8372;8324;8324;574	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	D	8372;527;1018;8324;8372;8324;7984;2896;557;552;1317;550	ENSP00000356224:G8372D;ENSP00000441052:G527D;ENSP00000356226:G1018D;ENSP00000396024:G8324D;ENSP00000265368:G8372D;ENSP00000390975:G8324D;ENSP00000341887:G7984D;ENSP00000349276:G2896D;ENSP00000356220:G1317D;ENSP00000346701:G550D	ENSP00000265368:G8372D	G	-	2	0	SYNE1	152506455	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.180000	0.77674	2.868000	0.98415	0.555000	0.69702	GGC		0.507	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		93	159	0	0	0	0	93	159				
MYCT1	80177	broad.mit.edu	37	6	153043007	153043007	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:153043007C>G	ENST00000367245.5	+	2	335	c.327C>G	c.(325-327)agC>agG	p.S109R	MYCT1_ENST00000529453.1_Intron	NM_025107.2	NP_079383.2	Q8N699	MYCT1_HUMAN	myc target 1	109						nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	20		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		GGAGTTCAAGCAGGAGATCTA	0.517																																						uc003qpd.3		NA																	0				ovary(1)	1						c.(325-327)AGC>AGG		myc target 1							149.0	136.0	140.0					6																	153043007		2203	4300	6503	SO:0001583	missense	80177					nucleus		g.chr6:153043007C>G	AF527367	CCDS5239.1	6q25.1	2008-02-05			ENSG00000120279	ENSG00000120279			23172	protein-coding gene	gene with protein product						12477932	Standard	NM_025107		Approved	MTLC, FLJ21269	uc003qpc.4	Q8N699	OTTHUMG00000015850	ENST00000367245.5:c.327C>G	6.37:g.153043007C>G	ENSP00000356214:p.Ser109Arg		Somatic				MYCT1_uc010kjc.1_Intron|MYCT1_uc003qpc.3_Missense_Mutation_p.S109R	p.S109R	NM_025107	NP_079383	WXS	Illumina HiSeq	Unspecified	Q8N699	MYCT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)	2	335	+		Ovarian(120;0.0654)	109			Bipartite nuclear localization signal (Potential).		Q8N396|Q8TBE8|Q9H763	Missense_Mutation	SNP	ENST00000367245.5	37	c.327C>G	CCDS5239.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.54|12.54	1.967810|1.967810	0.34754|0.34754	.|.	.|.	ENSG00000120279|ENSG00000120279	ENST00000532295|ENST00000367245	.|T	.|0.30448	.|1.53	5.77|5.77	0.243|0.243	0.15503|0.15503	.|.	.|0.626145	.|0.16561	.|N	.|0.209044	T|T	0.09730|0.09730	0.0239|0.0239	L|L	0.57536|0.57536	1.79|1.79	0.09310|0.09310	N|N	1|1	.|B	.|0.18610	.|0.029	.|B	.|0.15484	.|0.013	T|T	0.31420|0.31420	-0.9944|-0.9944	5|10	.|0.28530	.|T	.|0.3	-4.292|-4.292	6.0118|6.0118	0.19580|0.19580	0.1167:0.4413:0.0:0.442|0.1167:0.4413:0.0:0.442	.|.	.|109	.|Q8N699	.|MYCT1_HUMAN	G|R	90|109	.|ENSP00000356214:S109R	.|ENSP00000356214:S109R	A|S	+|+	2|3	0|2	MYCT1|MYCT1	153084700|153084700	0.143000|0.143000	0.22626|0.22626	0.001000|0.001000	0.08648|0.08648	0.972000|0.972000	0.66771|0.66771	0.581000|0.581000	0.23819|0.23819	-0.001000|-0.001000	0.14495|0.14495	-0.241000|-0.241000	0.12123|0.12123	GCA|AGC		0.517	MYCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042750.2	NM_025107		84	103	0	0	0	0	84	103				
FRMD1	79981	broad.mit.edu	37	6	168464322	168464322	+	Silent	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr6:168464322G>T	ENST00000283309.6	-	6	827	c.763C>A	c.(763-765)Cgg>Agg	p.R255R	FRMD1_ENST00000440994.2_Silent_p.R187R|FRMD1_ENST00000432403.1_5'UTR|FRMD1_ENST00000537786.1_Silent_p.R26R	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	255	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		TCCTCCAGCCGGCAGGCCTCC	0.667																																					GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)	uc003qwo.3		NA																	0				ovary(1)	1						c.(763-765)CGG>AGG		FERM domain containing 1 isoform 1							70.0	60.0	63.0					6																	168464322		2203	4300	6503	SO:0001819	synonymous_variant	79981					cytoskeleton	binding	g.chr6:168464322G>T		CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.763C>A	6.37:g.168464322G>T			Somatic				FRMD1_uc003qwm.3_Silent_p.R26R|FRMD1_uc011egs.1_Silent_p.R26R|FRMD1_uc011egt.1_Silent_p.R167R|FRMD1_uc003qwn.3_Silent_p.R187R	p.R255R	NM_024919	NP_079195	WXS	Illumina HiSeq	Unspecified	Q8N878	FRMD1_HUMAN		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)	6	828	-		Breast(66;1.07e-05)|Ovarian(120;0.0728)	255			FERM.		B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Silent	SNP	ENST00000283309.6	37	c.763C>A	CCDS5306.1																																																																																				0.667	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362513.2	NM_024919		27	56	1	0	2.49e-11	2.99e-11	27	56				
INTS1	26173	broad.mit.edu	37	7	1539130	1539130	+	Missense_Mutation	SNP	C	C	T	rs370002614		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr7:1539130C>T	ENST00000404767.3	-	6	908	c.823G>A	c.(823-825)Gtt>Att	p.V275I	INTS1_ENST00000389470.4_Missense_Mutation_p.V403I|INTS1_ENST00000493531.1_5'Flank	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	275					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		TCGCCCGCAACGCGGCCCGCC	0.682																																						uc003skn.2		NA																	0					0						c.(823-825)GTT>ATT		integrator complex subunit 1			ILE/VAL	1,3911		0,1,1955	30.0	35.0	34.0		823	-5.1	0.0	7		34	0,8262		0,0,4131	no	missense	INTS1	NM_001080453.2	29	0,1,6086	TT,TC,CC		0.0,0.0256,0.0082	benign	275/2191	1539130	1,12173	1956	4131	6087	SO:0001583	missense	26173				snRNA processing	integral to membrane|integrator complex|nuclear membrane		g.chr7:1539130C>T	AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.823G>A	7.37:g.1539130C>T	ENSP00000385722:p.Val275Ile		Somatic				INTS1_uc003skq.2_Missense_Mutation_p.V275I	p.V275I	NM_001080453	NP_001073922	WXS	Illumina HiSeq	Unspecified	Q8N201	INT1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)	6	924	-		Ovarian(82;0.0253)	275					A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	ENST00000404767.3	37	c.823G>A	CCDS47526.1	.	.	.	.	.	.	.	.	.	.	C	10.89	1.479889	0.26511	2.56E-4	0.0	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.42900	0.99;0.96	4.14	-5.08	0.02929	.	0.641119	0.16864	N	0.196392	T	0.19685	0.0473	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.001;0.004	B;B	0.08055	0.003;0.003	T	0.07712	-1.0758	10	0.34782	T	0.22	.	13.8858	0.63708	0.0:0.5987:0.0:0.4013	.	403;275	A4D212;Q8N201	.;INT1_HUMAN	I	275;403	ENSP00000385722:V275I;ENSP00000374121:V403I	ENSP00000374121:V403I	V	-	1	0	INTS1	1505656	0.025000	0.19082	0.000000	0.03702	0.001000	0.01503	-0.502000	0.06390	-1.033000	0.03299	-0.291000	0.09656	GTT		0.682	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323683.1			6	23	0	0	0	0	6	23				
MACC1	346389	broad.mit.edu	37	7	20198179	20198179	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr7:20198179A>G	ENST00000400331.5	-	5	2113	c.1805T>C	c.(1804-1806)cTc>cCc	p.L602P	MACC1_ENST00000332878.4_Missense_Mutation_p.L602P|MACC1_ENST00000589011.1_Missense_Mutation_p.L602P	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	602	SH3.				positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						CTTACCTCTGAGGACTCCTAC	0.393																																						uc003sus.3		NA																	0				ovary(2)|skin(1)	3						c.(1804-1806)CTC>CCC		putative binding protein 7a5							172.0	170.0	170.0					7																	20198179		2203	4300	6503	SO:0001583	missense	346389				positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity	g.chr7:20198179A>G		CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.1805T>C	7.37:g.20198179A>G	ENSP00000383185:p.Leu602Pro		Somatic				MACC1_uc010kug.2_Missense_Mutation_p.L602P	p.L602P	NM_182762	NP_877439	WXS	Illumina HiSeq	Unspecified	Q6ZN28	MACC1_HUMAN			5	2114	-			602			SH3.		A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	37	c.1805T>C	CCDS5369.1	.	.	.	.	.	.	.	.	.	.	A	15.53	2.860271	0.51482	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.08546	3.08;3.08	5.75	4.55	0.56014	Src homology-3 domain (1);Variant SH3 (1);	0.056281	0.64402	D	0.000001	T	0.24661	0.0598	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.00419	-1.1751	10	0.52906	T	0.07	-9.0615	12.2337	0.54503	0.8728:0.0:0.0:0.1272	.	602	Q6ZN28	MACC1_HUMAN	P	602	ENSP00000383185:L602P;ENSP00000328410:L602P	ENSP00000328410:L602P	L	-	2	0	MACC1	20164704	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.411000	0.52672	2.188000	0.69820	0.533000	0.62120	CTC		0.393	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762		453	52	0	0	0	0	453	52				
KLHL7	55975	broad.mit.edu	37	7	23163426	23163426	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr7:23163426C>G	ENST00000339077.5	+	2	394	c.151C>G	c.(151-153)Cag>Gag	p.Q51E	KLHL7_ENST00000322231.7_Missense_Mutation_p.Q29E|KLHL7_ENST00000539124.1_Intron|KLHL7_ENST00000322275.5_Missense_Mutation_p.Q51E|KLHL7_ENST00000542558.1_Intron|KLHL7_ENST00000545771.1_Missense_Mutation_p.Q29E|KLHL7_ENST00000479288.1_Intron|KLHL7_ENST00000409689.1_Missense_Mutation_p.Q3E|KLHL7_ENST00000410047.1_Missense_Mutation_p.Q29E|KLHL7_ENST00000545443.1_Missense_Mutation_p.Q29E	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	51	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CCTCATGGTCCAGGAAAGAAA	0.363																																						uc003svs.3		NA																	0					0						c.(151-153)CAG>GAG		kelch-like 7 isoform 1							156.0	139.0	145.0					7																	23163426		2203	4300	6503	SO:0001583	missense	55975					Golgi apparatus|nucleolus|plasma membrane		g.chr7:23163426C>G		CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.151C>G	7.37:g.23163426C>G	ENSP00000343273:p.Gln51Glu		Somatic				KLHL7_uc003svr.3_Missense_Mutation_p.Q29E|KLHL7_uc011jys.1_Intron|KLHL7_uc011jyt.1_Intron|KLHL7_uc003svt.2_Missense_Mutation_p.Q3E|KLHL7_uc003svp.2_Missense_Mutation_p.Q29E|KLHL7_uc003svq.2_Missense_Mutation_p.Q51E|KLHL7_uc011jyu.1_Missense_Mutation_p.Q29E	p.Q51E	NM_001031710	NP_001026880	WXS	Illumina HiSeq	Unspecified	Q8IXQ5	KLHL7_HUMAN			2	444	+			51			BTB.		A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Missense_Mutation	SNP	ENST00000339077.5	37	c.151C>G	CCDS34609.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.116937	0.37339	.	.	ENSG00000122550	ENST00000538858;ENST00000536369;ENST00000322231;ENST00000339077;ENST00000322275;ENST00000409689;ENST00000410047;ENST00000545771;ENST00000545443	T;T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	5.46	5.46	0.80206	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.53110	0.1776	N	0.00686	-1.255	0.80722	D	1	D;B;B;D;D	0.58268	0.982;0.0;0.0;0.982;0.982	D;B;B;D;D	0.70227	0.968;0.002;0.0;0.968;0.968	T	0.59627	-0.7419	10	0.06099	T	0.92	.	19.6805	0.95960	0.0:1.0:0.0:0.0	.	29;51;29;51;29	F5GYE2;Q8IXQ5;Q8IXQ5-2;Q8IXQ5-3;Q8IXQ5-4	.;KLHL7_HUMAN;.;.;.	E	51;51;29;51;51;3;29;29;29	ENSP00000322958:Q29E;ENSP00000343273:Q51E;ENSP00000323270:Q51E;ENSP00000386263:Q3E;ENSP00000386999:Q29E;ENSP00000446445:Q29E;ENSP00000442366:Q29E	ENSP00000322958:Q29E	Q	+	1	0	KLHL7	23129951	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.282000	0.65615	2.724000	0.93272	0.563000	0.77884	CAG		0.363	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326860.3	NM_018846		105	12	0	0	0	0	105	12				
ELMO1	9844	broad.mit.edu	37	7	37355565	37355565	+	Splice_Site	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr7:37355565C>T	ENST00000310758.4	-	3	726		c.e3-1		ELMO1_ENST00000442504.1_Splice_Site|ELMO1_ENST00000448602.1_Splice_Site	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1						actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GTGGTTTTTTCTGCAAAATAA	0.284																																						uc003tfk.1		NA																	0				ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						c.e3-1		engulfment and cell motility 1 isoform 1							125.0	138.0	133.0					7																	37355565		2202	4299	6501	SO:0001630	splice_region_variant	9844				actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding	g.chr7:37355565C>T	AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.79-1G>A	7.37:g.37355565C>T			Somatic				ELMO1_uc010kxg.1_Splice_Site_p.K27_splice	p.K27_splice	NM_014800	NP_055615	WXS	Illumina HiSeq	Unspecified	Q92556	ELMO1_HUMAN			3	386	-								A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Splice_Site	SNP	ENST00000310758.4	37	c.79_splice	CCDS5449.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.290476	0.59976	.	.	ENSG00000155849	ENST00000310758;ENST00000442504;ENST00000448602;ENST00000455119;ENST00000455879;ENST00000453399;ENST00000445322	.	.	.	4.91	4.03	0.46877	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4879	0.50365	0.0:0.9156:0.0:0.0844	.	.	.	.	.	-1	.	.	.	-	.	.	ELMO1	37322090	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.396000	0.66297	1.436000	0.47453	0.655000	0.94253	.		0.284	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442	Intron	353	54	0	0	0	0	353	54				
EPDR1	54749	broad.mit.edu	37	7	37960496	37960496	+	5'UTR	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr7:37960496C>A	ENST00000199448.4	+	0	334				EPDR1_ENST00000559325.1_Silent_p.A105A|EPDR1_ENST00000425345.1_5'Flank|EPDR1_ENST00000476620.1_Intron|EPDR1_ENST00000423717.1_5'UTR	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1						cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						GCCTCAGCGCCCCCTTGGGCT	0.721																																						uc003tfp.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(313-315)GCC>GCA		ependymin related protein 1 precursor							15.0	21.0	19.0					7																	37960496		2189	4282	6471	SO:0001623	5_prime_UTR_variant	54749				cell-matrix adhesion	extracellular region	calcium ion binding	g.chr7:37960496C>A	BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.-46C>A	7.37:g.37960496C>A			Somatic				EPDR1_uc003tfq.2_Silent_p.A105A|EPDR1_uc010kxh.2_5'Flank	p.A105A	NM_017549	NP_060019	WXS	Illumina HiSeq	Unspecified	Q9UM22	EPDR1_HUMAN			1	334	+			Error:Variant_position_missing_in_Q9UM22_after_alignment					A8K4C0|C9JYS3|Q06BL0|Q99M77	Silent	SNP	ENST00000199448.4	37	c.315C>A	CCDS5454.2																																																																																				0.721	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220037.3	NM_017549		40	5	1	0	3.86e-21	5.15e-21	40	5				
CCDC132	55610	broad.mit.edu	37	7	92902042	92902042	+	Silent	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr7:92902042A>G	ENST00000305866.5	+	11	926	c.798A>G	c.(796-798)acA>acG	p.T266T	CCDC132_ENST00000251739.5_Silent_p.T266T|CCDC132_ENST00000317751.6_5'UTR|CCDC132_ENST00000544910.1_Silent_p.T236T|CCDC132_ENST00000535481.1_Intron|CCDC132_ENST00000541136.1_Silent_p.T77T	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	266						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			TTGGAAAAACACAGGTTTGTT	0.333																																						uc003umo.2		NA																	0					0						c.(796-798)ACA>ACG		coiled-coil domain containing 132 isoform a							67.0	64.0	65.0					7																	92902042		2203	4298	6501	SO:0001819	synonymous_variant	55610							g.chr7:92902042A>G	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.798A>G	7.37:g.92902042A>G			Somatic				CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Silent_p.T236T|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Intron|CCDC132_uc003umn.2_Silent_p.T266T	p.T266T	NM_017667	NP_060137	WXS	Illumina HiSeq	Unspecified	Q96JG6	CC132_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		11	926	+	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		266					B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Silent	SNP	ENST00000305866.5	37	c.798A>G	CCDS43617.1	.	.	.	.	.	.	.	.	.	.	A	10.38	1.335533	0.24253	.	.	ENSG00000004766	ENST00000458707	.	.	.	5.64	3.18	0.36537	.	.	.	.	.	T	0.57695	0.2071	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54125	-0.8340	4	.	.	.	0.4301	8.7228	0.34452	0.7992:0.1308:0.0699:0.0	.	.	.	.	R	53	.	.	H	+	2	0	CCDC132	92739978	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.689000	0.46993	2.285000	0.76669	0.528000	0.53228	CAC		0.333	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667		24	53	0	0	0	0	24	53				
PPP1R9A	55607	broad.mit.edu	37	7	94740679	94740679	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr7:94740679C>A	ENST00000433881.1	+	3	2036	c.1504C>A	c.(1504-1506)Ctt>Att	p.L502I	PPP1R9A_ENST00000340694.4_Missense_Mutation_p.L502I|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.L502I|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.L502I|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.L502I|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.L502I			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	502	Interacts with protein phosphatase 1. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			AAAGCTGGAACTTTTCCCAGT	0.388										HNSCC(28;0.073)																												uc003unp.2		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						c.(1504-1506)CTT>ATT		protein phosphatase 1, regulatory (inhibitor)							68.0	69.0	69.0					7																	94740679		2203	4300	6503	SO:0001583	missense	55607					cell junction|synapse|synaptosome	actin binding	g.chr7:94740679C>A	AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.1504C>A	7.37:g.94740679C>A	ENSP00000398870:p.Leu502Ile	HNSCC(28;0.073)	Somatic				PPP1R9A_uc010lfj.2_Missense_Mutation_p.L502I|PPP1R9A_uc011kif.1_Missense_Mutation_p.L502I|PPP1R9A_uc003unq.2_Missense_Mutation_p.L502I|PPP1R9A_uc011kig.1_Missense_Mutation_p.L502I	p.L502I	NM_017650	NP_060120	WXS	Illumina HiSeq	Unspecified	Q9ULJ8	NEB1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)		3	1786	+	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		502			Interacts with protein phosphatase 1 (By similarity).		A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	ENST00000433881.1	37	c.1504C>A	CCDS34683.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.044541	0.55110	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	T;T;T;T;T;T	0.38887	1.11;1.11;1.11;1.11;1.11;1.11	4.98	4.98	0.66077	PDZ/DHR/GLGF (1);	0.062767	0.64402	D	0.000007	T	0.55752	0.1940	L	0.49126	1.545	0.80722	D	1	B;P;B;D;B	0.57257	0.008;0.539;0.027;0.979;0.009	B;P;B;D;B	0.70016	0.117;0.658;0.261;0.967;0.056	T	0.52320	-0.8591	10	0.48119	T	0.1	.	12.2016	0.54328	0.0:0.9222:0.0:0.0778	.	502;502;502;502;502	B7ZLX4;F8W7J9;E9PDX1;E9PCK6;Q9ULJ8	.;.;.;.;NEB1_HUMAN	I	502	ENSP00000405514:L502I;ENSP00000344524:L502I;ENSP00000411342:L502I;ENSP00000398870:L502I;ENSP00000289495:L502I;ENSP00000402893:L502I	ENSP00000289495:L502I	L	+	1	0	PPP1R9A	94578615	1.000000	0.71417	1.000000	0.80357	0.007000	0.05969	5.883000	0.69721	2.755000	0.94549	0.650000	0.86243	CTT		0.388	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340662.1	NM_001166160		26	51	1	0	7.44e-23	1e-22	26	51				
LAMB4	22798	broad.mit.edu	37	7	107669526	107669526	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr7:107669526A>G	ENST00000388781.3	-	33	5191	c.5108T>C	c.(5107-5109)tTg>tCg	p.L1703S	LAMB4_ENST00000388780.3_Missense_Mutation_p.L1703S|LAMB4_ENST00000483484.1_5'UTR|LAMB4_ENST00000205386.4_Missense_Mutation_p.L1703S	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1703	Domain I.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						ATCTCCAGCCAATTTTTCTGC	0.363																																						uc010ljo.1		NA																	0				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						c.(5107-5109)TTG>TCG		laminin, beta 4 precursor							189.0	174.0	179.0					7																	107669526		2203	4300	6503	SO:0001583	missense	22798				cell adhesion	basement membrane		g.chr7:107669526A>G	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.5108T>C	7.37:g.107669526A>G	ENSP00000373433:p.Leu1703Ser		Somatic				LAMB4_uc003vey.2_Missense_Mutation_p.L1703S|LAMB4_uc010ljp.1_Missense_Mutation_p.L672S	p.L1703S	NM_007356	NP_031382	WXS	Illumina HiSeq	Unspecified	A4D0S4	LAMB4_HUMAN			33	5192	-			1703			Potential.|Domain I.		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	c.5108T>C	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	A	17.31	3.357476	0.61293	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000422975;ENST00000388780	T;T;T;T	0.77358	0.44;0.44;-1.09;0.7	4.54	4.54	0.55810	.	0.000000	0.33650	N	0.004698	D	0.82637	0.5080	L	0.42245	1.32	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.96	D	0.84155	0.0425	10	0.87932	D	0	.	11.5059	0.50466	1.0:0.0:0.0:0.0	.	1703;1703	A4D0S4-3;A4D0S4	.;LAMB4_HUMAN	S	1703;1703;729;1703	ENSP00000205386:L1703S;ENSP00000373433:L1703S;ENSP00000416562:L729S;ENSP00000373432:L1703S	ENSP00000205386:L1703S	L	-	2	0	LAMB4	107456762	0.804000	0.28969	0.391000	0.26233	0.944000	0.59088	1.468000	0.35332	1.909000	0.55274	0.533000	0.62120	TTG		0.363	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857		48	21	0	0	0	0	48	21				
FLNC	2318	broad.mit.edu	37	7	128478683	128478683	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr7:128478683G>C	ENST00000325888.8	+	8	1498	c.1237G>C	c.(1237-1239)Gtg>Ctg	p.V413L	FLNC_ENST00000346177.6_Missense_Mutation_p.V413L	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	413					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TGTTGCTGTGGTGATCGTGGA	0.657																																						uc003vnz.3		NA																	0				breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						c.(1237-1239)GTG>CTG		gamma filamin isoform a							68.0	83.0	78.0					7																	128478683		2161	4246	6407	SO:0001583	missense	2318				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding	g.chr7:128478683G>C	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.1237G>C	7.37:g.128478683G>C	ENSP00000327145:p.Val413Leu		Somatic				FLNC_uc003voa.3_Missense_Mutation_p.V413L	p.V413L	NM_001458	NP_001449	WXS	Illumina HiSeq	Unspecified	Q14315	FLNC_HUMAN			8	1446	+			413			Filamin 2.		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	c.1237G>C	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.119289	0.56505	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.84442	-1.85;-1.85	5.43	5.43	0.79202	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.186651	0.40640	N	0.001056	D	0.86130	0.5859	M	0.73962	2.25	0.37519	D	0.917473	B;B	0.25169	0.093;0.119	B;B	0.35899	0.109;0.213	D	0.85995	0.1491	10	0.52906	T	0.07	.	11.3055	0.49332	0.0839:0.0:0.9161:0.0	.	413;413	Q14315-2;Q14315	.;FLNC_HUMAN	L	413	ENSP00000327145:V413L;ENSP00000344002:V413L	ENSP00000327145:V413L	V	+	1	0	FLNC	128265919	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	1.724000	0.38064	2.532000	0.85374	0.561000	0.74099	GTG		0.657	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3			56	27	0	0	0	0	56	27				
AHCYL2	23382	broad.mit.edu	37	7	129045020	129045020	+	Missense_Mutation	SNP	A	A	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr7:129045020A>T	ENST00000325006.3	+	8	1162	c.1108A>T	c.(1108-1110)Aac>Tac	p.N370Y	AHCYL2_ENST00000474594.1_Missense_Mutation_p.N267Y|RNU7-16P_ENST00000516471.1_RNA|AHCYL2_ENST00000446212.1_Missense_Mutation_p.N268Y|AHCYL2_ENST00000490911.1_Missense_Mutation_p.N267Y|AHCYL2_ENST00000531335.2_Missense_Mutation_p.N289Y|AHCYL2_ENST00000446544.2_Missense_Mutation_p.N369Y	NM_001130720.2|NM_015328.3	NP_001124192.1|NP_056143.1	Q96HN2	SAHH3_HUMAN	adenosylhomocysteinase-like 2	370					one-carbon metabolic process (GO:0006730)		adenosylhomocysteinase activity (GO:0004013)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	22						GAAATTTGACAACCTCTACTG	0.423																																					Pancreas(160;1736 1964 29875 40941 45605)	uc011kov.1		NA																	0				ovary(2)	2						c.(1108-1110)AAC>TAC		S-adenosylhomocysteine hydrolase-like 2 isoform							200.0	193.0	195.0					7																	129045020		2203	4300	6503	SO:0001583	missense	23382				one-carbon metabolic process		adenosylhomocysteinase activity	g.chr7:129045020A>T	AB020635	CCDS5812.1, CCDS47706.1, CCDS47707.1, CCDS47708.1, CCDS47707.2	7q32.1	2009-06-12	2009-06-12		ENSG00000158467	ENSG00000158467			22204	protein-coding gene	gene with protein product			"""S-adenosylhomocysteine hydrolase-like 2"""				Standard	NM_001130720		Approved	KIAA0828	uc011kov.2	Q96HN2	OTTHUMG00000157677	ENST00000325006.3:c.1108A>T	7.37:g.129045020A>T	ENSP00000315931:p.Asn370Tyr		Somatic				AHCYL2_uc003vot.2_Missense_Mutation_p.N369Y|AHCYL2_uc003vov.2_Missense_Mutation_p.N267Y|AHCYL2_uc011kow.1_Missense_Mutation_p.N268Y|AHCYL2_uc011kox.1_Missense_Mutation_p.N267Y	p.N370Y	NM_015328	NP_056143	WXS	Illumina HiSeq	Unspecified	Q96HN2	SAHH3_HUMAN			8	1162	+			370				NAD (By similarity).	B4DIZ5|D9N155|O94917	Missense_Mutation	SNP	ENST00000325006.3	37	c.1108A>T	CCDS5812.1	.	.	.	.	.	.	.	.	.	.	A	27.3	4.819564	0.90873	.	.	ENSG00000158467	ENST00000325006;ENST00000446544;ENST00000531335;ENST00000474594;ENST00000446212;ENST00000490911	D;D;T;T;T;T	0.81659	-1.52;-1.52;-1.49;-1.47;-1.47;-1.47	5.82	5.82	0.92795	S-adenosyl-L-homocysteine hydrolase, NAD binding (1);	0.000000	0.85682	D	0.000000	D	0.93641	0.7969	H	0.98525	4.255	0.58432	D	0.999996	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.76575	0.98;0.98;0.988;0.98;0.98	D	0.95720	0.8765	10	0.87932	D	0	-24.4542	14.1334	0.65270	1.0:0.0:0.0:0.0	.	267;268;370;267;369	B4DIZ5;D7UEQ7;Q96HN2;D9N155;Q96HN2-2	.;.;SAHH3_HUMAN;.;.	Y	370;369;289;267;268;267	ENSP00000315931:N370Y;ENSP00000413639:N369Y;ENSP00000431787:N289Y;ENSP00000420459:N267Y;ENSP00000405267:N268Y;ENSP00000420801:N267Y	ENSP00000315931:N370Y	N	+	1	0	AHCYL2	128832256	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.977000	0.93446	2.234000	0.73211	0.533000	0.62120	AAC		0.423	AHCYL2-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354065.1			109	47	0	0	0	0	109	47				
OR2F2	135948	broad.mit.edu	37	7	143633045	143633045	+	Silent	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr7:143633045G>T	ENST00000408955.2	+	1	787	c.720G>T	c.(718-720)acG>acT	p.T240T		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					CCTTCCACACGTGTGCCTCTC	0.517																																						uc011ktv.1		NA																	0				ovary(3)|skin(1)	4						c.(718-720)ACG>ACT		olfactory receptor, family 2, subfamily F,							145.0	135.0	138.0					7																	143633045		2203	4300	6503	SO:0001819	synonymous_variant	135948				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143633045G>T		CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.720G>T	7.37:g.143633045G>T			Somatic					p.T240T	NM_001004685	NP_001004685	WXS	Illumina HiSeq	Unspecified	O95006	OR2F2_HUMAN			1	720	+	Melanoma(164;0.0903)		240			Helical; Name=6; (Potential).		A4D2G0|Q6IFP8	Silent	SNP	ENST00000408955.2	37	c.720G>T	CCDS43666.1																																																																																				0.517	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349570.1			46	26	1	0	1.76e-25	2.42e-25	46	26				
CNTNAP2	26047	broad.mit.edu	37	7	146741062	146741062	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr7:146741062G>A	ENST00000361727.3	+	4	982	c.466G>A	c.(466-468)Gcc>Acc	p.A156T		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	156	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TCCGATTATTGCCCGCTATGT	0.428										HNSCC(39;0.1)																												uc003weu.1		NA																	0				ovary(9)|central_nervous_system(1)|pancreas(1)	11						c.(466-468)GCC>ACC		cell recognition molecule Caspr2 precursor							188.0	163.0	172.0					7																	146741062		2203	4300	6503	SO:0001583	missense	26047				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	g.chr7:146741062G>A	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.466G>A	7.37:g.146741062G>A	ENSP00000354778:p.Ala156Thr	HNSCC(39;0.1)	Somatic					p.A156T	NM_014141	NP_054860	WXS	Illumina HiSeq	Unspecified	Q9UHC6	CNTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		4	982	+	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	156			F5/8 type C.|Extracellular (Potential).		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	c.466G>A	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228386	0.58777	.	.	ENSG00000174469	ENST00000361727	D	0.99014	-5.33	5.47	5.47	0.80525	Concanavalin A-like lectin/glucanase (1);Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.53938	D	0.000046	D	0.98614	0.9536	L	0.43152	1.355	0.80722	D	1	D	0.60575	0.988	P	0.59761	0.863	D	0.99289	1.0898	10	0.44086	T	0.13	.	17.8968	0.88891	0.0:0.0:1.0:0.0	.	156	Q9UHC6	CNTP2_HUMAN	T	156	ENSP00000354778:A156T	ENSP00000354778:A156T	A	+	1	0	CNTNAP2	146371995	1.000000	0.71417	0.952000	0.39060	0.073000	0.16967	6.661000	0.74422	2.568000	0.86640	0.462000	0.41574	GCC		0.428	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			62	37	0	0	0	0	62	37				
CSMD1	64478	broad.mit.edu	37	8	2832134	2832134	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr8:2832134C>T	ENST00000520002.1	-	57	9137	c.8582G>A	c.(8581-8583)gGa>gAa	p.G2861E	CSMD1_ENST00000602723.1_Missense_Mutation_p.G2803E|CSMD1_ENST00000400186.3_Missense_Mutation_p.G2803E|CSMD1_ENST00000542608.1_Missense_Mutation_p.G2802E|CSMD1_ENST00000602557.1_Missense_Mutation_p.G2861E|CSMD1_ENST00000537824.1_Missense_Mutation_p.G2860E			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2861	Sushi 21. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CCCTGGGTGTCCACACGATAT	0.498																																						uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(8581-8583)GGA>GAA		CUB and Sushi multiple domains 1 precursor							31.0	33.0	33.0					8																	2832134		1938	4130	6068	SO:0001583	missense	64478					integral to membrane		g.chr8:2832134C>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8582G>A	8.37:g.2832134C>T	ENSP00000430733:p.Gly2861Glu		Somatic				CSMD1_uc011kwj.1_Missense_Mutation_p.G2190E|CSMD1_uc010lrg.2_Missense_Mutation_p.G871E	p.G2861E	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	56	8972	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2861			Sushi 21.|Extracellular (Potential).		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.8582G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.53|15.53	2.860713|2.860713	0.51482|0.51482	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	T;T;T;T|.	0.65364|.	-0.15;-0.15;-0.15;-0.15|.	5.81|5.81	5.81|5.81	0.92471|0.92471	Complement control module (2);Sushi/SCR/CCP (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.82038|.	0.4950|.	M|M	0.80028|0.80028	2.48|2.48	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;0.996;1.0|.	D;D;D|.	0.85130|.	0.99;0.982;0.997|.	T|.	0.81444|.	-0.0930|.	10|.	0.87932|.	D|.	0|.	.|.	20.0784|20.0784	0.97758|0.97758	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2861;2861;2802|.	E5RIG2;Q96PZ7;F5H2I8|.	.;CSMD1_HUMAN;.|.	E|X	2803;2861;2722;2860;2802|2277	ENSP00000383047:G2803E;ENSP00000430733:G2861E;ENSP00000441462:G2860E;ENSP00000446243:G2802E|.	ENSP00000320445:G2722E|.	G|W	-|-	2|3	0|0	CSMD1|CSMD1	2819541|2819541	1.000000|1.000000	0.71417|0.71417	0.639000|0.639000	0.29394|0.29394	0.020000|0.020000	0.10135|0.10135	3.817000|3.817000	0.55668|0.55668	2.736000|2.736000	0.93811|0.93811	0.655000|0.655000	0.94253|0.94253	GGA|TGG		0.498	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		6	20	0	0	0	0	6	20				
OPRK1	4986	broad.mit.edu	37	8	54163409	54163409	+	Silent	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr8:54163409C>G	ENST00000265572.3	-	2	486	c.189G>C	c.(187-189)acG>acC	p.T63T	OPRK1_ENST00000520287.1_Silent_p.T63T	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	63					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	AGTAGACCGCCGTGATGATGA	0.692																																						uc003xrh.1		NA																	0				ovary(1)|skin(1)	2						c.(187-189)ACG>ACC		opioid receptor, kappa 1	Buprenorphine(DB00921)|Butorphanol(DB00611)|Cocaine(DB00907)|Codeine(DB00318)|Dezocine(DB01209)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Meperidine(DB00454)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Tramadol(DB00193)						42.0	33.0	36.0					8																	54163409		2203	4298	6501	SO:0001819	synonymous_variant	4986				behavior|immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception|synaptic transmission|viral genome replication	integral to plasma membrane	kappa-opioid receptor activity|protein binding	g.chr8:54163409C>G		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.189G>C	8.37:g.54163409C>G			Somatic				OPRK1_uc003xri.1_Silent_p.T63T|OPRK1_uc010lyc.1_5'UTR	p.T63T	NM_000912	NP_000903	WXS	Illumina HiSeq	Unspecified	P41145	OPRK_HUMAN			1	564	-		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)	63			Helical; Name=1; (Potential).		E5RHC9|Q499G4	Silent	SNP	ENST00000265572.3	37	c.189G>C	CCDS6152.1																																																																																				0.692	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1			27	10	0	0	0	0	27	10				
JPH1	56704	broad.mit.edu	37	8	75227756	75227756	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr8:75227756C>G	ENST00000342232.4	-	2	519	c.479G>C	c.(478-480)cGt>cCt	p.R160P		NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	160					calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			CAGCGAGGTACGCAGCGGTGA	0.731																																						uc003yae.2		NA																	0				ovary(1)	1						c.(478-480)CGT>CCT		junctophilin 1							16.0	16.0	16.0					8																	75227756		2118	4130	6248	SO:0001583	missense	56704				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional membrane complex|junctional sarcoplasmic reticulum membrane|plasma membrane		g.chr8:75227756C>G	AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.479G>C	8.37:g.75227756C>G	ENSP00000344488:p.Arg160Pro		Somatic				JPH1_uc003yaf.2_Missense_Mutation_p.R160P|JPH1_uc003yag.1_Missense_Mutation_p.R24P	p.R160P	NM_020647	NP_065698	WXS	Illumina HiSeq	Unspecified	Q9HDC5	JPH1_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)		2	519	-	Breast(64;0.00576)		160			Cytoplasmic (Potential).		B2RTZ0	Missense_Mutation	SNP	ENST00000342232.4	37	c.479G>C	CCDS6217.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.595052	0.86953	.	.	ENSG00000104369	ENST00000342232	T	0.65364	-0.15	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.80369	0.4610	M	0.82517	2.595	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.82629	-0.0363	10	0.48119	T	0.1	.	17.1887	0.86873	0.0:1.0:0.0:0.0	.	160	Q9HDC5	JPH1_HUMAN	P	160	ENSP00000344488:R160P	ENSP00000344488:R160P	R	-	2	0	JPH1	75390311	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	7.546000	0.82137	2.273000	0.75805	0.563000	0.77884	CGT		0.731	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379102.1			16	7	0	0	0	0	16	7				
ZFHX4	79776	broad.mit.edu	37	8	77775753	77775753	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr8:77775753C>G	ENST00000521891.2	+	11	10251	c.9803C>G	c.(9802-9804)cCt>cGt	p.P3268R	ZFHX4_ENST00000518282.1_Missense_Mutation_p.P3242R|ZFHX4_ENST00000455469.2_Missense_Mutation_p.P3223R|ZFHX4_ENST00000050961.6_Missense_Mutation_p.P3219R	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3219					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TACTTTATCCCTGGGTTTGCT	0.493										HNSCC(33;0.089)																												uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(9667-9669)CCT>CGT		zinc finger homeodomain 4							149.0	140.0	143.0					8																	77775753		1898	4131	6029	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77775753C>G		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9803C>G	8.37:g.77775753C>G	ENSP00000430497:p.Pro3268Arg	HNSCC(33;0.089)	Somatic					p.P3223R	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		11	10055	+			3219					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.9668C>G	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380634	0.42207	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.68479	-0.33;-0.25;-0.24;-0.28	4.69	4.69	0.59074	.	0.000000	0.42172	U	0.000743	T	0.81361	0.4806	M	0.76574	2.34	0.80722	D	1	D	0.71674	0.998	D	0.69142	0.962	D	0.83942	0.0312	10	0.87932	D	0	.	18.171	0.89745	0.0:1.0:0.0:0.0	.	3223	Q86UP3-4	.	R	3268;3252;3223;3219;3242	ENSP00000430497:P3268R;ENSP00000399605:P3223R;ENSP00000050961:P3219R;ENSP00000430848:P3242R	ENSP00000050961:P3219R	P	+	2	0	ZFHX4	77938308	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.563000	0.82314	2.594000	0.87642	0.655000	0.94253	CCT		0.493	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		66	31	0	0	0	0	66	31				
VPS13B	157680	broad.mit.edu	37	8	100146859	100146859	+	Splice_Site	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr8:100146859G>T	ENST00000358544.2	+	9	1317		c.e9-1		VPS13B_ENST00000355155.1_Splice_Site|VPS13B_ENST00000395996.1_Splice_Site|VPS13B_ENST00000357162.2_Splice_Site	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)						protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ATATTTCTTAGCTCACAGAAA	0.279																																					Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	0				ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.e9-1		vacuolar protein sorting 13B isoform 5							48.0	54.0	52.0					8																	100146859		2202	4280	6482	SO:0001630	splice_region_variant	157680				protein transport			g.chr8:100146859G>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.1207-1G>T	8.37:g.100146859G>T			Somatic				VPS13B_uc003yiw.2_Splice_Site_p.L403_splice|VPS13B_uc003yit.2_Splice_Site_p.L403_splice|VPS13B_uc003yiu.1_Splice_Site_p.L403_splice|VPS13B_uc003yix.1_5'Flank	p.L403_splice	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		9	1318	+	Breast(36;3.73e-07)							C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Splice_Site	SNP	ENST00000358544.2	37	c.1207_splice	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.113117	0.77210	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2043	0.93723	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	VPS13B	100216035	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.894000	0.92506	2.607000	0.88179	0.484000	0.47621	.		0.279	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	Intron	21	44	1	0	1.96e-10	2.33e-10	21	44				
YWHAZ	7534	broad.mit.edu	37	8	101936241	101936241	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr8:101936241C>A	ENST00000395957.2	-	6	961	c.620G>T	c.(619-621)aGt>aTt	p.S207I	YWHAZ_ENST00000353245.3_Missense_Mutation_p.S207I|YWHAZ_ENST00000395948.2_Missense_Mutation_p.S130I|YWHAZ_ENST00000395951.3_Missense_Mutation_p.S207I|YWHAZ_ENST00000395956.3_Missense_Mutation_p.S207I|YWHAZ_ENST00000419477.2_Missense_Mutation_p.S207I|YWHAZ_ENST00000522542.1_Missense_Mutation_p.S132I|YWHAZ_ENST00000395953.2_Missense_Mutation_p.S207I|YWHAZ_ENST00000457309.1_Missense_Mutation_p.S207I|YWHAZ_ENST00000521309.1_Missense_Mutation_p.S87I|YWHAZ_ENST00000395958.2_Missense_Mutation_p.S207I|YWHAZ_ENST00000522819.1_Missense_Mutation_p.S87I			P63104	1433Z_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta	207					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|gene expression (GO:0010467)|histamine secretion by mast cell (GO:0002553)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|platelet activation (GO:0030168)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting to mitochondrion (GO:0006626)|response to drug (GO:0042493)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mast cell granule (GO:0042629)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|transcription factor binding (GO:0008134)			large_intestine(1)|lung(2)	3	all_cancers(14;7.43e-06)|all_epithelial(15;2.77e-08)|Lung NSC(17;6.08e-05)|all_lung(17;0.000197)		Epithelial(11;2.79e-11)|all cancers(13;5.45e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.75e-05)			TGACTCTTCACTTAATGTATC	0.333																																						uc011lhe.1		NA																	0					0						c.(619-621)AGT>ATT		tyrosine 3/tryptophan 5 -monooxygenase	Ginkgo biloba(DB01381)						148.0	143.0	145.0					8																	101936241		2203	4299	6502	SO:0001583	missense	7534				anti-apoptosis|mRNA metabolic process|platelet activation|signal transduction	cytosol|melanosome	transcription factor binding	g.chr8:101936241C>A	U28964	CCDS6290.1	8q22.3	2013-12-03	2013-12-03		ENSG00000164924	ENSG00000164924			12855	protein-coding gene	gene with protein product	"""14-3-3 zeta"", ""14-3-3 delta"""	601288	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, delta polypeptide"", ""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide"""	YWHAD		8617504, 7890696	Standard	NM_003406		Approved	KCIP-1, 14-3-3-zeta	uc010mbr.2	P63104	OTTHUMG00000134291	ENST00000395957.2:c.620G>T	8.37:g.101936241C>A	ENSP00000379287:p.Ser207Ile		Somatic				YWHAZ_uc003yjv.2_Missense_Mutation_p.S207I|YWHAZ_uc011lhf.1_Missense_Mutation_p.S207I|YWHAZ_uc003yjw.2_Missense_Mutation_p.S207I|YWHAZ_uc010mbq.2_Missense_Mutation_p.S130I|YWHAZ_uc011lhg.1_Missense_Mutation_p.S87I|YWHAZ_uc010mbr.2_Missense_Mutation_p.S207I|YWHAZ_uc003yjx.2_Missense_Mutation_p.S207I|YWHAZ_uc003yjy.2_Missense_Mutation_p.S207I	p.S207I	NM_001135702	NP_001129174	WXS	Illumina HiSeq	Unspecified	P63104	1433Z_HUMAN	Epithelial(11;2.79e-11)|all cancers(13;5.45e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.75e-05)		5	797	-	all_cancers(14;7.43e-06)|all_epithelial(15;2.77e-08)|Lung NSC(17;6.08e-05)|all_lung(17;0.000197)		207					A8K1N0|B7Z465|P29213|P29312|Q32P43|Q5XJ08|Q6GPI2|Q6IN74|Q6NUR9|Q6P3U9|Q86V33	Missense_Mutation	SNP	ENST00000395957.2	37	c.620G>T	CCDS6290.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180687	0.57800	.	.	ENSG00000164924	ENST00000395957;ENST00000457309;ENST00000395958;ENST00000395956;ENST00000353245;ENST00000522542;ENST00000521309;ENST00000517797;ENST00000522819;ENST00000395953;ENST00000395948;ENST00000395951;ENST00000419477;ENST00000521607	T;T;T;T;T;T;T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83	5.34	5.34	0.76211	14-3-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.57681	0.2070	M	0.83774	2.66	0.58432	D	0.999995	P;P	0.39181	0.663;0.663	B;B	0.39185	0.293;0.293	T	0.66468	-0.5916	10	0.87932	D	0	.	19.42	0.94716	0.0:1.0:0.0:0.0	.	207;207	D0PNI1;P63104	.;1433Z_HUMAN	I	207;207;207;207;207;132;87;130;87;207;130;207;207;215	ENSP00000379287:S207I;ENSP00000398599:S207I;ENSP00000379288:S207I;ENSP00000379286:S207I;ENSP00000309503:S207I;ENSP00000430072:S132I;ENSP00000429623:S87I;ENSP00000428775:S87I;ENSP00000379283:S207I;ENSP00000379278:S130I;ENSP00000379281:S207I;ENSP00000395114:S207I;ENSP00000430058:S215I	ENSP00000309503:S207I	S	-	2	0	YWHAZ	102005417	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.188000	0.50958	2.673000	0.90976	0.650000	0.86243	AGT		0.333	YWHAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259017.2	NM_145690		92	114	1	0	8.93e-32	1.26e-31	92	114				
PKHD1L1	93035	broad.mit.edu	37	8	110468491	110468491	+	Splice_Site	SNP	G	G	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr8:110468491G>C	ENST00000378402.5	+	46	6979	c.6875G>C	c.(6874-6876)gGt>gCt	p.G2292A		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2292	G8 1. {ECO:0000255|PROSITE- ProRule:PRU00817}.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTGGTTCTAGGTGTGCCTGTT	0.373										HNSCC(38;0.096)																												uc003yne.2		NA																	0				ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(6874-6876)GGT>GCT		fibrocystin L precursor							98.0	100.0	99.0					8																	110468491		1935	4153	6088	SO:0001630	splice_region_variant	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110468491G>C	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.6875-1G>C	8.37:g.110468491G>C		HNSCC(38;0.096)	Somatic					p.G2292A	NM_177531	NP_803875	WXS	Illumina HiSeq	Unspecified	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		46	6979	+			2292			Extracellular (Potential).|G8 1.		Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	c.6875G>C	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	18.49	3.634468	0.67130	.	.	ENSG00000205038	ENST00000378402	D	0.96041	-3.89	5.94	5.94	0.96194	G8 domain (2);	0.000000	0.85682	D	0.000000	D	0.98438	0.9480	H	0.95328	3.655	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99198	1.0872	9	.	.	.	.	15.8524	0.78943	0.0:0.0:1.0:0.0	.	2292	Q86WI1	PKHL1_HUMAN	A	2292	ENSP00000367655:G2292A	.	G	+	2	0	PKHD1L1	110537667	1.000000	0.71417	1.000000	0.80357	0.221000	0.24807	7.729000	0.84864	2.821000	0.97095	0.484000	0.47621	GGT		0.373	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	Missense_Mutation	12	43	0	0	0	0	12	43				
PKHD1L1	93035	broad.mit.edu	37	8	110509268	110509268	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr8:110509268C>A	ENST00000378402.5	+	64	10552	c.10448C>A	c.(10447-10449)aCa>aAa	p.T3483K		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3483					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ACCATTTGGACATGCTGGGAT	0.338										HNSCC(38;0.096)																												uc003yne.2		NA																	0				ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(10447-10449)ACA>AAA		fibrocystin L precursor							134.0	127.0	129.0					8																	110509268		1828	4088	5916	SO:0001583	missense	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110509268C>A	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.10448C>A	8.37:g.110509268C>A	ENSP00000367655:p.Thr3483Lys	HNSCC(38;0.096)	Somatic					p.T3483K	NM_177531	NP_803875	WXS	Illumina HiSeq	Unspecified	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		64	10552	+			3483			PbH1 8.|Extracellular (Potential).		Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	c.10448C>A	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	2.420	-0.333325	0.05278	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	T;T	0.80214	-1.35;-1.35	5.8	1.58	0.23477	Pectin lyase fold/virulence factor (1);	0.667806	0.14508	N	0.315336	T	0.39655	0.1086	N	0.00377	-1.585	0.20975	N	0.999811	B	0.02656	0.0	B	0.06405	0.002	T	0.40590	-0.9555	10	0.13853	T	0.58	.	1.3649	0.02199	0.3465:0.3561:0.1262:0.1712	.	3483	Q86WI1	PKHL1_HUMAN	K	3483;411	ENSP00000367655:T3483K;ENSP00000437376:T411K	ENSP00000367655:T3483K	T	+	2	0	PKHD1L1	110578444	0.942000	0.31987	0.855000	0.33649	0.995000	0.86356	0.128000	0.15810	0.370000	0.24538	0.650000	0.86243	ACA		0.338	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		56	137	1	0	4.26e-23	5.75e-23	56	137				
MYC	4609	broad.mit.edu	37	8	128753024	128753024	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr8:128753024G>T	ENST00000377970.2	+	3	1695	c.1185G>T	c.(1183-1185)caG>caT	p.Q395H	MYC_ENST00000524013.1_Missense_Mutation_p.Q394H	NM_002467.4	NP_002458	P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	380	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.Q380Q(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	TGCGTGACCAGATCCCGGAGT	0.517		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""																																	uc003ysi.2		3		Dom	yes		8	8q24.12-q24.13	4609	A|T	v-myc myelocytomatosis viral oncogene homolog (avian)			"""L, E"""	IGK@|BCL5|BCL7A |BTG1|TRA@|IGH@		Burkitt lymphoma| amplified in other cancers|B-CLL		1	Substitution - coding silent(1)	p.Q380Q(1)	lung(1)	lung(3)|ovary(1)|central_nervous_system(1)|pancreas(1)	6						c.(1183-1185)CAG>CAT		myc proto-oncogene protein							115.0	128.0	124.0					8																	128753024		2203	4300	6503	SO:0001583	missense	4609				branching involved in ureteric bud morphogenesis|cell cycle arrest|cell proliferation|cellular iron ion homeostasis|positive regulation of metanephric cap mesenchymal cell proliferation|positive regulation of transcription, DNA-dependent|regulation of telomere maintenance|regulation of transcription from RNA polymerase II promoter|response to drug	nucleolus|nucleoplasm	E-box binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr8:128753024G>T		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000377970.2:c.1185G>T	8.37:g.128753024G>T	ENSP00000367207:p.Gln395His		Somatic					p.Q395H	NM_002467	NP_002458	WXS	Illumina HiSeq	Unspecified	P01106	MYC_HUMAN	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	3	1710	+	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	380			Helix-loop-helix motif.		A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000377970.2	37	c.1185G>T	CCDS6359.2	.	.	.	.	.	.	.	.	.	.	G	17.42	3.385805	0.61956	.	.	ENSG00000136997	ENST00000377970;ENST00000524013;ENST00000454617	D;D	0.97772	-4.53;-4.53	5.39	4.52	0.55395	Helix-loop-helix DNA-binding (5);	0.165646	0.56097	D	0.000040	D	0.93867	0.8038	L	0.27975	0.815	0.80722	D	1	B	0.22080	0.064	B	0.28553	0.091	D	0.89868	0.4021	10	0.07325	T	0.83	-23.3281	13.3948	0.60846	0.076:0.0:0.924:0.0	.	380	P01106	MYC_HUMAN	H	395;394;361	ENSP00000367207:Q395H;ENSP00000430235:Q394H	ENSP00000367207:Q395H	Q	+	3	2	MYC	128822206	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.256000	0.51492	1.273000	0.44346	-0.143000	0.13931	CAG		0.517	MYC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250277.3			94	314	1	0	2.77e-59	4.12e-59	94	314				
BAI1	575	broad.mit.edu	37	8	143558514	143558514	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr8:143558514G>A	ENST00000517894.1	+	5	1991	c.1097G>A	c.(1096-1098)tGc>tAc	p.C366Y	BAI1_ENST00000323289.5_Missense_Mutation_p.C366Y			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	366	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TGGAGCGTGTGCTCCAGCACC	0.716																																						uc003ywm.2		NA																	0				lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8						c.(1096-1098)TGC>TAC		brain-specific angiogenesis inhibitor 1							14.0	19.0	18.0					8																	143558514		2063	4187	6250	SO:0001583	missense	575				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding	g.chr8:143558514G>A	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1097G>A	8.37:g.143558514G>A	ENSP00000430945:p.Cys366Tyr		Somatic					p.C366Y	NM_001702	NP_001693	WXS	Illumina HiSeq	Unspecified	O14514	BAI1_HUMAN			4	1280	+	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)		366			Extracellular (Potential).|TSP type-1 2.			Missense_Mutation	SNP	ENST00000517894.1	37	c.1097G>A		.	.	.	.	.	.	.	.	.	.	G	26.3	4.727617	0.89390	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	D;D	0.98585	-5.01;-5.01	4.42	4.42	0.53409	.	0.000000	0.85682	U	0.000000	D	0.99429	0.9798	H	0.98738	4.315	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98019	1.0370	10	0.87932	D	0	.	16.3614	0.83269	0.0:0.0:1.0:0.0	.	366	E9PBK0	.	Y	366	ENSP00000430945:C366Y;ENSP00000313046:C366Y	ENSP00000313046:C366Y	C	+	2	0	BAI1	143555516	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.397000	0.73239	2.141000	0.66446	0.462000	0.41574	TGC		0.716	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702		11	24	0	0	0	0	11	24				
FBXL6	26233	broad.mit.edu	37	8	145579649	145579649	+	Missense_Mutation	SNP	C	C	T	rs201941787		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr8:145579649C>T	ENST00000331890.5	-	8	1515	c.1451G>A	c.(1450-1452)cGg>cAg	p.R484Q	TMEM249_ENST00000531225.1_5'Flank|FBXL6_ENST00000526524.1_Intron|SLC52A2_ENST00000527078.1_5'Flank|SLC52A2_ENST00000329994.2_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|TMEM249_ENST00000398633.3_5'Flank|FBXL6_ENST00000455319.2_Missense_Mutation_p.R478Q|SLC52A2_ENST00000530047.1_5'Flank|SLC52A2_ENST00000532887.1_5'Flank	NM_012162.2	NP_036294.2	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6	484					protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)		ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|lung(3)|ovary(1)	5	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			TGGTGTGACCCGGGTGCCCCT	0.632																																						uc003zcb.2		NA																	0				ovary(1)|lung(1)	2						c.(1450-1452)CGG>CAG		F-box and leucine-rich repeat protein 6 isoform		C	GLN/ARG,GLN/ARG	0,4406		0,0,2203	76.0	74.0	74.0		1451,1433	1.3	0.7	8		74	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	FBXL6	NM_012162.1,NM_024555.3	43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	484/540,478/534	145579649	1,13005	2203	4300	6503	SO:0001583	missense	26233				proteolysis		ubiquitin-protein ligase activity	g.chr8:145579649C>T	AF174592	CCDS6422.1, CCDS47942.1	8q24.3	2011-06-09			ENSG00000182325	ENSG00000182325		"""F-boxes / Leucine-rich repeats"""	13603	protein-coding gene	gene with protein product		609076				10531035, 10531037	Standard	NM_012162		Approved	FBL6	uc003zcb.3	Q8N531	OTTHUMG00000165169	ENST00000331890.5:c.1451G>A	8.37:g.145579649C>T	ENSP00000330098:p.Arg484Gln		Somatic				C8ORFK29_uc011llb.1_5'Flank|C8ORFK29_uc010mfw.2_5'Flank|C8ORFK29_uc003zby.3_5'Flank|FBXL6_uc003zbz.2_Missense_Mutation_p.R211Q|FBXL6_uc003zca.2_Missense_Mutation_p.R478Q|FBXL6_uc010mfx.2_Missense_Mutation_p.R245Q|GPR172A_uc003zcc.1_5'Flank|GPR172A_uc003zcd.1_5'Flank|GPR172A_uc003zce.1_5'Flank|GPR172A_uc010mfy.1_5'Flank|GPR172A_uc003zcf.1_5'Flank|GPR172A_uc011llc.1_5'Flank	p.R484Q	NM_012162	NP_036294	WXS	Illumina HiSeq	Unspecified	Q8N531	FBXL6_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)		8	1476	-	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		484			LRR 11.		Q53G43|Q9H5W9|Q9UKC7	Missense_Mutation	SNP	ENST00000331890.5	37	c.1451G>A	CCDS6422.1	.	.	.	.	.	.	.	.	.	.	C	10.67	1.415189	0.25552	0.0	1.16E-4	ENSG00000182325	ENST00000455319;ENST00000331890	T;T	0.79141	-1.24;-1.24	4.64	1.26	0.21427	.	0.169230	0.36519	N	0.002551	T	0.56046	0.1959	N	0.25890	0.77	0.22693	N	0.998847	P;P	0.50272	0.89;0.933	B;B	0.40009	0.168;0.316	T	0.51608	-0.8684	10	0.16896	T	0.51	-4.2103	4.5463	0.12083	0.1814:0.6016:0.0:0.217	.	484;478	Q8N531;Q8N531-2	FBXL6_HUMAN;.	Q	478;484	ENSP00000403873:R478Q;ENSP00000330098:R484Q	ENSP00000330098:R484Q	R	-	2	0	FBXL6	145550457	0.623000	0.27094	0.675000	0.29917	0.480000	0.33159	0.233000	0.17911	0.388000	0.25054	0.563000	0.77884	CGG		0.632	FBXL6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382413.1	NM_024555		10	255	0	0	0	0	10	255				
FAM122A	116224	broad.mit.edu	37	9	71395259	71395259	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr9:71395259G>T	ENST00000394264.3	+	1	296	c.179G>T	c.(178-180)cGg>cTg	p.R60L	PIP5K1B_ENST00000265382.3_Intron|PIP5K1B_ENST00000541509.1_Intron	NM_138333.3	NP_612206.3	Q96E09	F122A_HUMAN	family with sequence similarity 122A	60										endometrium(1)|lung(2)	3						AGCGCCAGGCGGAACAGCACA	0.697																																						uc004agw.1		NA																	0					0						c.(178-180)CGG>CTG		hypothetical protein LOC116224							26.0	31.0	29.0					9																	71395259		2195	4287	6482	SO:0001583	missense	116224							g.chr9:71395259G>T	AK126379	CCDS6623.1	9q21.13	2011-02-10	2006-07-11	2006-07-11	ENSG00000187866	ENSG00000187866			23490	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 42"""	C9orf42		12477932	Standard	NM_138333		Approved	MGC17347	uc004agw.1	Q96E09	OTTHUMG00000019971	ENST00000394264.3:c.179G>T	9.37:g.71395259G>T	ENSP00000377807:p.Arg60Leu		Somatic				PIP5K1B_uc004agu.2_Intron|PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	p.R60L	NM_138333	NP_612206	WXS	Illumina HiSeq	Unspecified	Q96E09	F122A_HUMAN			1	296	+			60						Missense_Mutation	SNP	ENST00000394264.3	37	c.179G>T	CCDS6623.1	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665300	0.67700	.	.	ENSG00000187866	ENST00000394264;ENST00000377279	T	0.57907	0.37	4.73	2.88	0.33553	.	0.000000	0.85682	D	0.000000	T	0.69878	0.3160	M	0.86178	2.8	0.36978	D	0.894141	D	0.67145	0.996	D	0.76575	0.988	T	0.75510	-0.3292	10	0.87932	D	0	-11.1318	6.8471	0.23994	0.2035:0.0:0.7965:0.0	.	60	Q96E09	F122A_HUMAN	L	60	ENSP00000377807:R60L	ENSP00000366492:R60L	R	+	2	0	FAM122A	70585079	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.889000	0.75627	1.370000	0.46153	0.563000	0.77884	CGG		0.697	FAM122A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052556.1	NM_138333		77	11	1	0	1.36e-49	2.01e-49	77	11				
CCDC180	100499483	broad.mit.edu	37	9	100079416	100079416	+	Missense_Mutation	SNP	A	A	C			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr9:100079416A>C	ENST00000357054.1	+	23	2349	c.1414A>C	c.(1414-1416)Acc>Ccc	p.T472P	CCDC180_ENST00000375202.2_Missense_Mutation_p.T333P|CCDC180_ENST00000395220.1_Missense_Mutation_p.T472P|CCDC180_ENST00000411667.2_Missense_Mutation_p.T330P|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000529487.1_Missense_Mutation_p.T333P			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	472						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GATGGAGTCCACCCTGCAGCA	0.602																																						uc011lut.1		NA																	0				ovary(4)|large_intestine(2)|skin(1)	7						c.(1414-1416)ACC>CCC		hypothetical protein LOC57653							67.0	64.0	65.0					9																	100079416		2203	4300	6503	SO:0001583	missense	57653							g.chr9:100079416A>C	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.1414A>C	9.37:g.100079416A>C	ENSP00000349562:p.Thr472Pro		Somatic				KIAA1529_uc004axe.1_Missense_Mutation_p.T472P|KIAA1529_uc004axg.1_Missense_Mutation_p.T333P|KIAA1529_uc011lus.1_Missense_Mutation_p.T290P|KIAA1529_uc010msm.1_RNA|KIAA1529_uc004axf.2_Missense_Mutation_p.T333P|KIAA1529_uc011luv.1_Missense_Mutation_p.T330P	p.T472P	NM_020893	NP_065944	WXS	Illumina HiSeq	Unspecified					21	2187	+		Acute lymphoblastic leukemia(62;0.154)						Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	37	c.1414A>C		.	.	.	.	.	.	.	.	.	.	A	15.27	2.785115	0.49997	.	.	ENSG00000197816	ENST00000357054;ENST00000395220;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9	5.28	1.7	0.24286	.	0.618657	0.16922	N	0.194046	T	0.35219	0.0924	L	0.57536	1.79	0.26353	N	0.977179	D;P;D;P	0.59357	0.985;0.95;0.971;0.95	P;P;P;P	0.58454	0.775;0.735;0.839;0.735	T	0.10590	-1.0623	10	0.30854	T	0.27	-2.4279	7.2256	0.26014	0.7811:0.0:0.2189:0.0	.	330;472;333;472	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	P	472;472;333;330;356;333	ENSP00000349562:T472P;ENSP00000378646:T472P;ENSP00000364348:T333P;ENSP00000414000:T330P;ENSP00000434727:T333P	ENSP00000349562:T472P	T	+	1	0	C9orf174	99119237	0.213000	0.23551	0.974000	0.42286	0.986000	0.74619	0.748000	0.26305	0.431000	0.26258	0.460000	0.39030	ACC		0.602	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893		10	124	0	0	0	0	10	124				
RNF20	56254	broad.mit.edu	37	9	104319794	104319794	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr9:104319794G>A	ENST00000389120.3	+	16	2388	c.2298G>A	c.(2296-2298)gaG>gaA	p.E766E		NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	766					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		TCATGTCAGAGCGTATCAAGT	0.453																																						uc004bbn.2		NA																	0				ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8						c.(2296-2298)GAG>GAA		ring finger protein 20							124.0	113.0	116.0					9																	104319794		2203	4300	6503	SO:0001819	synonymous_variant	56254				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr9:104319794G>A	AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.2298G>A	9.37:g.104319794G>A			Somatic					p.E766E	NM_019592	NP_062538	WXS	Illumina HiSeq	Unspecified	Q5VTR2	BRE1A_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)	16	2388	+		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)	766			Potential.		A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Silent	SNP	ENST00000389120.3	37	c.2298G>A	CCDS35084.1																																																																																				0.453	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592		77	13	0	0	0	0	77	13				
SLC44A1	23446	broad.mit.edu	37	9	108136948	108136948	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr9:108136948C>G	ENST00000374720.3	+	13	1811	c.1564C>G	c.(1564-1566)Ctg>Gtg	p.L522V	SLC44A1_ENST00000343170.7_Missense_Mutation_p.L314V|SLC44A1_ENST00000374724.1_Missense_Mutation_p.L522V|SLC44A1_ENST00000374723.1_Missense_Mutation_p.L522V	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	522					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	CTTTGTCATTCTGGTGGAGAA	0.418																																						uc004bcn.2		NA																	0				breast(3)|ovary(1)	4						c.(1564-1566)CTG>GTG		CDW92 antigen	Choline(DB00122)						184.0	162.0	170.0					9																	108136948		2203	4300	6503	SO:0001583	missense	23446					integral to membrane|mitochondrial outer membrane|plasma membrane	choline transmembrane transporter activity	g.chr9:108136948C>G	AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.1564C>G	9.37:g.108136948C>G	ENSP00000363852:p.Leu522Val		Somatic				SLC44A1_uc010mtk.1_Missense_Mutation_p.L522V|SLC44A1_uc004bco.1_Missense_Mutation_p.L314V	p.L522V	NM_080546	NP_536856	WXS	Illumina HiSeq	Unspecified	Q8WWI5	CTL1_HUMAN			13	1785	+			522			Mitochondrial intermembrane (Potential).		A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Missense_Mutation	SNP	ENST00000374720.3	37	c.1564C>G	CCDS6763.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.959722	0.74016	.	.	ENSG00000070214	ENST00000374723;ENST00000374720;ENST00000374724;ENST00000343170	T;T;T;T	0.26660	1.72;1.72;1.72;1.72	5.7	2.65	0.31530	.	0.064482	0.64402	D	0.000005	T	0.38665	0.1049	M	0.85542	2.76	0.44515	D	0.997462	P;P;P	0.46578	0.729;0.729;0.88	P;P;P	0.49226	0.603;0.603;0.453	T	0.34625	-0.9821	10	0.48119	T	0.1	-8.5829	8.4858	0.33071	0.1244:0.7404:0.0:0.1352	.	522;522;522	Q8WWI5-3;Q8WWI5-2;Q8WWI5	.;.;CTL1_HUMAN	V	522;522;522;314	ENSP00000363855:L522V;ENSP00000363852:L522V;ENSP00000363856:L522V;ENSP00000341856:L314V	ENSP00000341856:L314V	L	+	1	2	SLC44A1	107176769	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.370000	0.44240	1.403000	0.46800	0.655000	0.94253	CTG		0.418	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053500.1	NM_080546		100	135	0	0	0	0	100	135				
FKBP15	23307	broad.mit.edu	37	9	115983487	115983487	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr9:115983487G>A	ENST00000238256.3	-	1	154	c.37C>T	c.(37-39)Ctc>Ttc	p.L13F	SLC31A1_ENST00000374212.4_5'Flank|SLC31A1_ENST00000374210.6_5'Flank	NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	13					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						CTCGGCGAGAGGAAATCGGTG	0.627																																						uc004bgs.2		NA																	0				ovary(3)	3						c.(37-39)CTC>TTC		FK506 binding protein 15, 133kDa							32.0	40.0	37.0					9																	115983487		1986	4168	6154	SO:0001583	missense	23307				endocytosis|protein folding	axon|early endosome	actin binding	g.chr9:115983487G>A	AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.37C>T	9.37:g.115983487G>A	ENSP00000238256:p.Leu13Phe		Somatic				FKBP15_uc010muu.1_Missense_Mutation_p.L77F|SLC31A1_uc004bgu.2_5'Flank|SLC31A1_uc004bgv.3_5'Flank|FKBP15_uc011lxd.1_5'UTR|FKBP15_uc010mut.1_5'UTR|FKBP15_uc004bgt.2_Missense_Mutation_p.L13F	p.L13F	NM_015258	NP_056073	WXS	Illumina HiSeq	Unspecified	Q5T1M5	FKB15_HUMAN			1	155	-			13					Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Missense_Mutation	SNP	ENST00000238256.3	37	c.37C>T	CCDS48007.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.334240	0.81801	.	.	ENSG00000119321	ENST00000446284;ENST00000238256;ENST00000414250	T;T;T	0.37235	1.63;1.64;1.21	5.35	5.35	0.76521	.	.	.	.	.	T	0.50120	0.1597	L	0.59436	1.845	0.43942	D	0.9966	D;D;D	0.57571	0.98;0.959;0.966	P;P;P	0.56700	0.804;0.79;0.641	T	0.47812	-0.9088	9	0.59425	D	0.04	-10.5901	14.4328	0.67261	0.0:0.0:1.0:0.0	.	13;13;13	Q5T1M5-2;Q5T1M5-3;Q5T1M5	.;.;FKB15_HUMAN	F	38;13;38	ENSP00000416158:L38F;ENSP00000238256:L13F;ENSP00000415733:L38F	ENSP00000238256:L13F	L	-	1	0	FKBP15	115023308	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	3.120000	0.50430	2.780000	0.95670	0.655000	0.94253	CTC		0.627	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015258		25	5	0	0	0	0	25	5				
OR1J2	26740	broad.mit.edu	37	9	125273992	125273992	+	Silent	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr9:125273992C>A	ENST00000335302.5	+	1	912	c.912C>A	c.(910-912)ctC>ctA	p.L304L		NM_054107.1	NP_473448.1	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J, member 2	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(7)|stomach(1)	26						TTGGGAAACTCTTCAGTAGAG	0.383																																						uc004bmj.1		NA																	0				skin(3)|pancreas(1)|breast(1)	5						c.(910-912)CTC>CTA		olfactory receptor, family 1, subfamily J,							57.0	60.0	59.0					9																	125273992		2203	4300	6503	SO:0001819	synonymous_variant	26740				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125273992C>A		CCDS35121.1	9q33.2	2013-09-20			ENSG00000197233	ENSG00000197233		"""GPCR / Class A : Olfactory receptors"""	8209	protein-coding gene	gene with protein product				OR1J3, OR1J5			Standard	XM_005251920		Approved	OST044	uc011lyv.2	Q8NGS2	OTTHUMG00000020604	ENST00000335302.5:c.912C>A	9.37:g.125273992C>A			Somatic				OR1J2_uc011lyv.1_Silent_p.L304L	p.L304L	NM_054107	NP_473448	WXS	Illumina HiSeq	Unspecified	Q8NGS2	OR1J2_HUMAN			4	1767	+			304			Cytoplasmic (Potential).		A3KFL9|Q6IF14|Q96R90|Q9NZP1	Silent	SNP	ENST00000335302.5	37	c.912C>A	CCDS35121.1																																																																																				0.383	OR1J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053932.1			93	21	1	0	3.59e-34	5.13e-34	93	21				
OR1L4	254973	broad.mit.edu	37	9	125486583	125486583	+	Silent	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr9:125486583C>T	ENST00000259466.1	+	1	315	c.315C>T	c.(313-315)ttC>ttT	p.F105F		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	105						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F105F(1)		breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						TGTACTTCTTCATGGCATTTG	0.473																																						uc004bmu.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(313-315)TTC>TTT		olfactory receptor, family 1, subfamily L,							156.0	143.0	147.0					9																	125486583		2203	4300	6503	SO:0001819	synonymous_variant	254973				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125486583C>T		CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.315C>T	9.37:g.125486583C>T			Somatic					p.F105F	NM_001005235	NP_001005235	WXS	Illumina HiSeq	Unspecified	Q8NGR5	OR1L4_HUMAN			1	315	+			105			Helical; Name=3; (Potential).		Q6IFN0|Q96R81	Silent	SNP	ENST00000259466.1	37	c.315C>T	CCDS35129.1																																																																																				0.473	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053951.1			4	219	0	0	0	0	4	219				
BARHL1	56751	broad.mit.edu	37	9	135464656	135464656	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr9:135464656T>A	ENST00000263610.2	+	3	1344	c.731T>A	c.(730-732)cTg>cAg	p.L244Q	BARHL1_ENST00000542090.1_Missense_Mutation_p.L244Q	NM_020064.3	NP_064448.1	Q9BZE3	BARH1_HUMAN	BarH-like homeobox 1	244					midbrain development (GO:0030901)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(1)|large_intestine(2)|lung(2)|skin(3)	8				OV - Ovarian serous cystadenocarcinoma(145;1.79e-06)|Epithelial(140;3.12e-05)		TTGGAGCTGCTGGCGGAGGCA	0.632																																						uc004cbp.1		NA																	0					0						c.(730-732)CTG>CAG		BarH-like homeobox 1							66.0	73.0	71.0					9																	135464656		2198	4289	6487	SO:0001583	missense	56751					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr9:135464656T>A	AJ237816	CCDS6950.1	9q34.13	2011-06-20	2007-07-09		ENSG00000125492	ENSG00000125492		"""Homeoboxes / ANTP class : NKL subclass"""	953	protein-coding gene	gene with protein product		605211	"""BarH (Drosophila)-like 1"""				Standard	NM_020064		Approved		uc004cbp.1	Q9BZE3	OTTHUMG00000020839	ENST00000263610.2:c.731T>A	9.37:g.135464656T>A	ENSP00000263610:p.Leu244Gln		Somatic					p.L244Q	NM_020064	NP_064448	WXS	Illumina HiSeq	Unspecified	Q9BZE3	BARH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.79e-06)|Epithelial(140;3.12e-05)	3	923	+			244					Q5T6V2|Q9NY88	Missense_Mutation	SNP	ENST00000263610.2	37	c.731T>A	CCDS6950.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.816831	0.90790	.	.	ENSG00000125492	ENST00000263610;ENST00000542090	D;D	0.92858	-3.12;-3.12	4.93	4.93	0.64822	Homeodomain-like (1);	0.000000	0.64402	D	0.000012	D	0.94850	0.8336	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.95277	0.8382	10	0.87932	D	0	.	13.5521	0.61738	0.0:0.0:0.0:1.0	.	244	Q9BZE3	BARH1_HUMAN	Q	244	ENSP00000263610:L244Q;ENSP00000444704:L244Q	ENSP00000263610:L244Q	L	+	2	0	BARHL1	134454477	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.645000	0.83430	2.067000	0.61834	0.533000	0.62120	CTG		0.632	BARHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054789.2			178	22	0	0	0	0	178	22				
DBH	1621	broad.mit.edu	37	9	136505046	136505046	+	Missense_Mutation	SNP	C	C	A	rs78929918		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr9:136505046C>A	ENST00000393056.2	+	2	430	c.418C>A	c.(418-420)Cca>Aca	p.P140T		NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	140	DOMON. {ECO:0000255|PROSITE- ProRule:PRU00246}.				behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)			central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	GCAGAGGACCCCAGAAGGCCT	0.617																																						uc004cel.2		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(418-420)CCA>ACA		dopamine beta hydroxylase precursor	Dopamine(DB00988)|Vitamin C(DB00126)						52.0	44.0	47.0					9																	136505046		2203	4300	6503	SO:0001583	missense	1621				hormone biosynthetic process	chromaffin granule lumen|chromaffin granule membrane|extracellular region|integral to membrane|membrane fraction|soluble fraction|transport vesicle membrane	dopamine beta-monooxygenase activity|L-ascorbic acid binding	g.chr9:136505046C>A	X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.418C>A	9.37:g.136505046C>A	ENSP00000376776:p.Pro140Thr		Somatic					p.P140T	NM_000787	NP_000778	WXS	Illumina HiSeq	Unspecified	P09172	DOPO_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	2	427	+			140			DOMON.|Intragranular (Potential).		Q5T381|Q96AG2	Missense_Mutation	SNP	ENST00000393056.2	37	c.418C>A	CCDS6977.2	.	.	.	.	.	.	.	.	.	.	C	0.077	-1.190297	0.01607	.	.	ENSG00000123454	ENST00000393056	T	0.76060	-0.99	4.89	2.61	0.31194	DOMON domain (3);	0.438848	0.26400	N	0.024585	T	0.62171	0.2406	L	0.41824	1.3	0.09310	N	1	B	0.17465	0.022	B	0.17979	0.02	T	0.44065	-0.9352	10	0.14252	T	0.57	-30.5302	12.2363	0.54518	0.0:0.8281:0.0:0.1719	.	140	P09172	DOPO_HUMAN	T	140	ENSP00000376776:P140T	ENSP00000376776:P140T	P	+	1	0	DBH	135494867	0.000000	0.05858	0.002000	0.10522	0.051000	0.14879	0.204000	0.17335	1.012000	0.39366	0.561000	0.74099	CCA		0.617	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054929.2	NM_000787		26	8	1	0	4.88e-14	6.08e-14	26	8				
NOTCH1	4851	broad.mit.edu	37	9	139412204	139412204	+	Splice_Site	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr9:139412204C>A	ENST00000277541.6	-	8	1516	c.1441G>T	c.(1441-1443)Ggc>Tgc	p.G481C	MIR4673_ENST00000584777.1_RNA	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	481	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G481S(2)		breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GCCGACGCACCGGGCATGCAG	0.667			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																												uc004chz.2		NA		Dom	yes		9	9q34.3	4851	T|Mis|O	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""			L	TRB@		T-ALL		2	Substitution - Missense(2)		upper_aerodigestive_tract(2)	haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856						c.(1441-1443)GGC>TGC		notch1 preproprotein							43.0	47.0	46.0					9																	139412204		2065	4192	6257	SO:0001630	splice_region_variant	4851				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	g.chr9:139412204C>A	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1441+1G>T	9.37:g.139412204C>A		HNSCC(8;0.001)	Somatic					p.G481C	NM_017617	NP_060087	WXS	Illumina HiSeq	Unspecified	P46531	NOTC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)	8	1441	-	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)	481			Extracellular (Potential).|EGF-like 12; calcium-binding (Potential).		Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	c.1441G>T	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.459143	0.84317	.	.	ENSG00000148400	ENST00000277541	D	0.83335	-1.71	4.47	4.47	0.54385	EGF-like region, conserved site (2);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.95758	0.8620	H	0.99881	4.885	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98274	1.0505	9	.	.	.	.	16.0962	0.81127	0.0:1.0:0.0:0.0	.	481	P46531	NOTC1_HUMAN	C	481	ENSP00000277541:G481C	.	G	-	1	0	NOTCH1	138532025	1.000000	0.71417	0.142000	0.22268	0.012000	0.07955	7.319000	0.79040	2.029000	0.59856	0.462000	0.41574	GGC		0.667	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	Missense_Mutation	48	14	1	0	1.07e-20	1.43e-20	48	14				
ASMT	438	broad.mit.edu	37	X	1748783	1748783	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chrX:1748783G>A	ENST00000381229.4	+	5	549	c.513G>A	c.(511-513)gtG>gtA	p.V171V	ASMT_ENST00000509780.1_Intron|ASMT_ENST00000381233.3_Silent_p.V171V|ASMT_ENST00000381241.3_Silent_p.V171V			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase	171			V -> M (functional polymorphism that nearly abolishes enzyme activity; dbSNP:rs121918820). {ECO:0000269|PubMed:21251267}.		cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	GGAGAAGCGTGCTGACCGCCT	0.552																																						uc004cqd.2		NA																	0				skin(1)	1						c.(511-513)GTG>GTA		acetylserotonin O-methyltransferase							436.0	346.0	377.0					X																	1748783		2203	4296	6499	SO:0001819	synonymous_variant	438				melatonin biosynthetic process|translation	cytosol	acetylserotonin O-methyltransferase activity|S-methyltransferase activity	g.chrX:1748783G>A	M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.513G>A	X.37:g.1748783G>A			Somatic				ASMT_uc010ncy.2_Silent_p.V171V|ASMT_uc004cqe.2_Silent_p.V171V	p.V171V	NM_004043	NP_004034	WXS	Illumina HiSeq	Unspecified	P46597	HIOM_HUMAN			6	658	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	171					B2RC33|Q16598|Q5JQ72|Q5JQ73	Silent	SNP	ENST00000381229.4	37	c.513G>A																																																																																					0.552	ASMT-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000055612.1	NM_004043		110	156	0	0	0	0	110	156				
FRMPD4	9758	broad.mit.edu	37	X	12736646	12736646	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chrX:12736646C>T	ENST00000380682.1	+	16	4207	c.3701C>T	c.(3700-3702)cCc>cTc	p.P1234L		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1234					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						TGTGCCACACCCGTGGAGTCG	0.597																																						uc004cuz.1		NA																	0				central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						c.(3700-3702)CCC>CTC		FERM and PDZ domain containing 4							55.0	59.0	58.0					X																	12736646		2202	4300	6502	SO:0001583	missense	9758				positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding	g.chrX:12736646C>T	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.3701C>T	X.37:g.12736646C>T	ENSP00000370057:p.Pro1234Leu		Somatic				FRMPD4_uc011mij.1_Missense_Mutation_p.P1226L	p.P1234L	NM_014728	NP_055543	WXS	Illumina HiSeq	Unspecified	Q14CM0	FRPD4_HUMAN			16	4207	+			1234					A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	c.3701C>T	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.501380	0.64298	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.23754	1.89	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.52980	0.1768	M	0.72118	2.19	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.56631	-0.7947	10	0.87932	D	0	-11.1062	18.4115	0.90552	0.0:1.0:0.0:0.0	.	1226;1234	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	L	1234;1225;1223	ENSP00000370057:P1234L	ENSP00000304583:P1223L	P	+	2	0	FRMPD4	12646567	1.000000	0.71417	0.763000	0.31416	0.689000	0.40095	7.319000	0.79040	2.289000	0.77006	0.600000	0.82982	CCC		0.597	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712		92	23	0	0	0	0	92	23				
SCML2	10389	broad.mit.edu	37	X	18338540	18338540	+	Splice_Site	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chrX:18338540C>G	ENST00000251900.4	-	6	557	c.398G>C	c.(397-399)gGg>gCg	p.G133A		NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	133					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					CATCTGGTACCCTGTTTTATA	0.353																																					Esophageal Squamous(100;1252 1965 19021 35517)	uc004cyl.2		NA																	0					0						c.(397-399)GGG>GCG		sex comb on midleg-like 2							60.0	54.0	56.0					X																	18338540		2203	4300	6503	SO:0001630	splice_region_variant	10389				anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:18338540C>G	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.398-1G>C	X.37:g.18338540C>G			Somatic				SCML2_uc004cyk.3_RNA|SCML2_uc010nfd.1_Missense_Mutation_p.G133A|SCML2_uc011miz.1_Missense_Mutation_p.G67A	p.G133A	NM_006089	NP_006080	WXS	Illumina HiSeq	Unspecified	Q9UQR0	SCML2_HUMAN			6	555	-	Hepatocellular(33;0.183)		133					Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Missense_Mutation	SNP	ENST00000251900.4	37	c.398G>C	CCDS14185.1	.	.	.	.	.	.	.	.	.	.	C	17.88	3.496890	0.64186	.	.	ENSG00000102098	ENST00000251900;ENST00000442000	T	0.37915	1.17	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.63721	0.2535	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.67288	-0.5708	10	0.49607	T	0.09	.	17.8213	0.88651	0.0:1.0:0.0:0.0	.	101;133	B4DZR9;Q9UQR0	.;SCML2_HUMAN	A	133;101	ENSP00000251900:G133A	ENSP00000251900:G133A	G	-	2	0	SCML2	18248461	1.000000	0.71417	0.326000	0.25389	0.430000	0.31655	7.487000	0.81328	2.140000	0.66376	0.600000	0.82982	GGG		0.353	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055941.1	NM_006089	Missense_Mutation	56	10	0	0	0	0	56	10				
FAM47B	170062	broad.mit.edu	37	X	34962248	34962248	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chrX:34962248C>A	ENST00000329357.5	+	1	1336	c.1300C>A	c.(1300-1302)Cat>Aat	p.H434N		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	434										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						CGGAGCGTCCCATCTAAAAGA	0.517																																						uc004ddi.1		NA																	0				ovary(3)|breast(1)	4						c.(1300-1302)CAT>AAT		hypothetical protein LOC170062							89.0	80.0	83.0					X																	34962248		2202	4300	6502	SO:0001583	missense	170062							g.chrX:34962248C>A	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1300C>A	X.37:g.34962248C>A	ENSP00000328307:p.His434Asn		Somatic					p.H434N	NM_152631	NP_689844	WXS	Illumina HiSeq	Unspecified	Q8NA70	FA47B_HUMAN			1	1318	+			434					Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	c.1300C>A	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	C	7.470	0.646524	0.14451	.	.	ENSG00000189132	ENST00000329357	T	0.13089	2.62	1.02	-2.04	0.07343	.	.	.	.	.	T	0.12178	0.0296	L	0.45422	1.42	0.09310	N	1	D	0.53619	0.961	P	0.50440	0.641	T	0.11155	-1.0599	9	0.19590	T	0.45	.	1.5569	0.02586	0.3056:0.2909:0.0:0.4035	.	434	Q8NA70	FA47B_HUMAN	N	434	ENSP00000328307:H434N	ENSP00000328307:H434N	H	+	1	0	FAM47B	34872169	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	-0.184000	0.09698	-1.073000	0.03137	0.292000	0.19580	CAT		0.517	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		44	14	1	0	8.21e-20	1.08e-19	44	14				
DGKK	139189	broad.mit.edu	37	X	50121610	50121610	+	RNA	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chrX:50121610C>T	ENST00000376025.2	-	0	3001							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					GTTGATGATACGGGACATTGC	0.542																																						uc010njr.1		NA																	0				ovary(1)|kidney(1)	2						c.(2941-2943)CGT>CAT		diacylglycerol kinase kappa							100.0	89.0	93.0					X																	50121610		2056	4172	6228			139189				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chrX:50121610C>T	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50121610C>T			Somatic					p.R981H	NM_001013742	NP_001013764	WXS	Illumina HiSeq	Unspecified	Q5KSL6	DGKK_HUMAN			21	3002	-	Ovarian(276;0.236)		981					B2RP91	Missense_Mutation	SNP	ENST00000376025.2	37	c.2942G>A																																																																																					0.542	DGKK-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000368187.1	NM_001013742		10	5	0	0	0	0	10	5				
DGKK	139189	broad.mit.edu	37	X	50127734	50127734	+	RNA	SNP	C	C	G			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chrX:50127734C>G	ENST00000376025.2	-	0	2495							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					GTGGGCTTGTCTGGTTAATAT	0.388																																						uc010njr.1		NA																	0				ovary(1)|kidney(1)	2						c.(2434-2436)CAG>CAC		diacylglycerol kinase kappa							147.0	139.0	142.0					X																	50127734		1874	4082	5956			139189				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chrX:50127734C>G	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50127734C>G			Somatic					p.Q812H	NM_001013742	NP_001013764	WXS	Illumina HiSeq	Unspecified	Q5KSL6	DGKK_HUMAN			16	2496	-	Ovarian(276;0.236)		812					B2RP91	Missense_Mutation	SNP	ENST00000376025.2	37	c.2436G>C																																																																																					0.388	DGKK-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000368187.1	NM_001013742		113	25	0	0	0	0	113	25				
ATP7A	538	broad.mit.edu	37	X	77294477	77294477	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chrX:77294477G>T	ENST00000341514.6	+	18	3810	c.3655G>T	c.(3655-3657)Gat>Tat	p.D1219Y	ATP7A_ENST00000350425.4_Missense_Mutation_p.D222Y|ATP7A_ENST00000343533.5_Missense_Mutation_p.D1141Y	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	1219					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	AGTAGCAGTTGATGGTAAGGT	0.323																																						uc004ecx.3		NA																	0					0						c.(3655-3657)GAT>TAT		ATPase, Cu++ transporting, alpha polypeptide							128.0	115.0	119.0					X																	77294477		2203	4300	6503	SO:0001583	missense	538				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity	g.chrX:77294477G>T	L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.3655G>T	X.37:g.77294477G>T	ENSP00000345728:p.Asp1219Tyr		Somatic					p.D1219Y	NM_000052	NP_000043	WXS	Illumina HiSeq	Unspecified	Q04656	ATP7A_HUMAN			18	3815	+			1219			Cytoplasmic (Potential).		B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	37	c.3655G>T	CCDS35339.1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.674778	0.67928	.	.	ENSG00000165240	ENST00000343533;ENST00000350425;ENST00000341514	D;D;D	0.97303	-4.33;-4.33;-4.33	4.57	4.57	0.56435	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.188846	0.46758	D	0.000268	D	0.98807	0.9598	M	0.93375	3.41	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.99821	1.1047	10	0.87932	D	0	-1.4889	16.667	0.85255	0.0:0.0:1.0:0.0	.	1219	Q04656	ATP7A_HUMAN	Y	1141;222;1219	ENSP00000343026:D1141Y;ENSP00000343678:D222Y;ENSP00000345728:D1219Y	ENSP00000345728:D1219Y	D	+	1	0	ATP7A	77181133	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.845000	0.86875	1.847000	0.53656	0.544000	0.68410	GAT		0.323	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052		62	18	1	0	2.34e-45	3.44e-45	62	18				
POU3F4	5456	broad.mit.edu	37	X	82763828	82763828	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chrX:82763828C>A	ENST00000373200.2	+	1	560	c.496C>A	c.(496-498)Ctc>Atc	p.L166I	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	166					cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						GCACCCGGTGCTCCGAGAGCC	0.647																																						uc004eeg.2		NA																	0				ovary(1)	1						c.(496-498)CTC>ATC		POU domain, class 3, transcription factor 4							16.0	17.0	17.0					X																	82763828		2203	4298	6501	SO:0001583	missense	5456				sensory perception of sound	nucleus	sequence-specific DNA binding transcription factor activity	g.chrX:82763828C>A	X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.496C>A	X.37:g.82763828C>A	ENSP00000362296:p.Leu166Ile		Somatic					p.L166I	NM_000307	NP_000298	WXS	Illumina HiSeq	Unspecified	P49335	PO3F4_HUMAN			1	560	+			166					B2RC71|Q5H9G9|Q99410	Missense_Mutation	SNP	ENST00000373200.2	37	c.496C>A	CCDS14450.1	.	.	.	.	.	.	.	.	.	.	C	13.52	2.263176	0.39995	.	.	ENSG00000196767	ENST00000373200	D	0.86097	-2.07	5.31	5.31	0.75309	.	0.073915	0.56097	D	0.000035	T	0.79713	0.4493	L	0.34521	1.04	0.58432	D	0.999999	B	0.32338	0.365	B	0.32090	0.14	T	0.77027	-0.2740	10	0.30078	T	0.28	.	17.9142	0.88944	0.0:1.0:0.0:0.0	.	166	P49335	PO3F4_HUMAN	I	166	ENSP00000362296:L166I	ENSP00000362296:L166I	L	+	1	0	POU3F4	82650484	1.000000	0.71417	0.959000	0.39883	0.577000	0.36160	5.140000	0.64807	2.357000	0.79964	0.525000	0.51046	CTC		0.647	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307		6	1	1	0	0.00307968	0.00325998	6	1				
GPRASP2	114928	broad.mit.edu	37	X	101970808	101970808	+	Silent	SNP	G	G	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chrX:101970808G>A	ENST00000535209.1	+	4	1842	c.1011G>A	c.(1009-1011)caG>caA	p.Q337Q	GPRASP2_ENST00000332262.5_Silent_p.Q337Q|GPRASP2_ENST00000543253.1_Silent_p.Q337Q			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	337						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						TCTATAAGCAGTCCTGGGTTT	0.458																																						uc004ejk.2		NA																	0				ovary(1)	1						c.(1009-1011)CAG>CAA		G protein-coupled receptor associated sorting							104.0	100.0	102.0					X																	101970808		2203	4300	6503	SO:0001819	synonymous_variant	114928					cytoplasm	protein binding	g.chrX:101970808G>A	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.1011G>A	X.37:g.101970808G>A			Somatic				GPRASP2_uc004ejl.2_Silent_p.Q337Q|GPRASP2_uc004ejm.2_Silent_p.Q337Q|GPRASP2_uc011mrp.1_5'Flank	p.Q337Q	NM_138437	NP_612446	WXS	Illumina HiSeq	Unspecified	Q96D09	GASP2_HUMAN			4	2345	+			337					D3DXA0|Q8NAB4	Silent	SNP	ENST00000535209.1	37	c.1011G>A	CCDS14501.1																																																																																				0.458	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437		71	19	0	0	0	0	71	19				
COL4A5	1287	broad.mit.edu	37	X	107930715	107930715	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chrX:107930715C>T	ENST00000361603.2	+	47	4545	c.4301C>T	c.(4300-4302)aCc>aTc	p.T1434I	COL4A5_ENST00000328300.6_Missense_Mutation_p.T1440I	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1434	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GAAATAGGTACCCGTGGTTTG	0.443									Alport syndrome with Diffuse Leiomyomatosis																													uc004enz.1		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(4318-4320)ACC>ATC		type IV collagen alpha 5 isoform 2 precursor							144.0	125.0	131.0					X																	107930715		2203	4300	6503	SO:0001583	missense	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107930715C>T	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4301C>T	X.37:g.107930715C>T	ENSP00000354505:p.Thr1434Ile		Somatic				COL4A5_uc011mso.1_Missense_Mutation_p.T1437I|COL4A5_uc011msp.1_Missense_Mutation_p.T116I	p.T1440I	NM_033380	NP_203699	WXS	Illumina HiSeq	Unspecified	P29400	CO4A5_HUMAN			48	4521	+			1434			Triple-helical region.		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	c.4319C>T	CCDS14543.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.27|11.27	1.588454|1.588454	0.28357|0.28357	.|.	.|.	ENSG00000188153|ENSG00000188153	ENST00000515658|ENST00000328300;ENST00000361603;ENST00000508186	.|D;D	.|0.91295	.|-2.82;-2.82	5.58|5.58	1.64|1.64	0.23874|0.23874	.|.	.|0.993501	.|0.08184	.|N	.|0.984930	D|D	0.86648|0.86648	0.5983|0.5983	N|N	0.12443|0.12443	0.215|0.215	0.09310|0.09310	N|N	1|1	.|P;P	.|0.45569	.|0.861;0.861	.|P;P	.|0.56563	.|0.801;0.801	T|T	0.76427|0.76427	-0.2963|-0.2963	5|10	.|0.33940	.|T	.|0.23	.|.	4.6831|4.6831	0.12745|0.12745	0.1069:0.5207:0.2273:0.1451|0.1069:0.5207:0.2273:0.1451	.|.	.|1437;1434	.|E7EVY4;P29400	.|.;CO4A5_HUMAN	S|I	39|1440;1434;1440	.|ENSP00000331902:T1440I;ENSP00000354505:T1434I	.|ENSP00000331902:T1440I	P|T	+|+	1|2	0|0	COL4A5|COL4A5	107817371|107817371	0.000000|0.000000	0.05858|0.05858	0.171000|0.171000	0.22900|0.22900	0.289000|0.289000	0.27227|0.27227	0.179000|0.179000	0.16840|0.16840	0.527000|0.527000	0.28560|0.28560	0.600000|0.600000	0.82982|0.82982	CCC|ACC		0.443	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			99	25	0	0	0	0	99	25				
CD40LG	959	broad.mit.edu	37	X	135741549	135741549	+	Missense_Mutation	SNP	C	C	A	rs193922136		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chrX:135741549C>A	ENST00000370629.2	+	5	817	c.761C>A	c.(760-762)aCg>aAg	p.T254K	CD40LG_ENST00000370628.2_Missense_Mutation_p.T233K	NM_000074.2	NP_000065.1	P29965	CD40L_HUMAN	CD40 ligand	254			T -> M (in HIGM1). {ECO:0000269|PubMed:9150729, ECO:0000269|PubMed:9746782}.		B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|immunoglobulin secretion (GO:0048305)|inflammatory response (GO:0006954)|isotype switching (GO:0045190)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of apoptotic process (GO:0043066)|platelet activation (GO:0030168)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of interleukin-12 production (GO:0032735)|regulation of immune response (GO:0050776)|regulation of immunoglobulin secretion (GO:0051023)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	CD40 receptor binding (GO:0005174)			endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|skin(1)|stomach(1)	26	Acute lymphoblastic leukemia(192;0.000127)					ACTGGCTTCACGTCCTTTGGC	0.507									Immune Deficiency with Hyper-IgM																													uc004faa.2		NA																	0				skin(1)	1	GRCh37	CM960264	CD40LG	M		c.(760-762)ACG>AAG		CD40 ligand	Atorvastatin(DB01076)						112.0	95.0	100.0					X																	135741549		2203	4300	6503	SO:0001583	missense	959	Immune_Deficiency_with_Hyper-IgM	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	anti-apoptosis|B cell proliferation|inflammatory response|isotype switching|leukocyte cell-cell adhesion|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of interleukin-12 production	extracellular space|integral to plasma membrane|soluble fraction	CD40 receptor binding|cytokine activity|tumor necrosis factor receptor binding	g.chrX:135741549C>A	X67878	CCDS14659.1	Xq26	2014-09-17	2008-08-01	2005-01-14	ENSG00000102245	ENSG00000102245		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11935	protein-coding gene	gene with protein product	"""CD40 antigen ligand"", ""tumor necrosis factor (ligand) superfamily member 5"", ""T-B cell-activating molecule"", ""TNF-related activation protein"", ""hyper-IgM syndrome"""	300386	"""tumor necrosis factor (ligand) superfamily, member 5 (hyper-IgM syndrome)"""	HIGM1, IMD3, TNFSF5		1427881, 7678782	Standard	NM_000074		Approved	CD40L, TRAP, gp39, hCD40L, CD154	uc004faa.3	P29965	OTTHUMG00000022512	ENST00000370629.2:c.761C>A	X.37:g.135741549C>A	ENSP00000359663:p.Thr254Lys		Somatic				CD40LG_uc010nsd.2_Missense_Mutation_p.T233K	p.T254K	NM_000074	NP_000065	WXS	Illumina HiSeq	Unspecified	P29965	CD40L_HUMAN			5	833	+	Acute lymphoblastic leukemia(192;0.000127)		254		T -> M (in HIGM1).	Extracellular (Potential).			Missense_Mutation	SNP	ENST00000370629.2	37	c.761C>A	CCDS14659.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.239547	0.79800	.	.	ENSG00000102245	ENST00000370629;ENST00000370628	D;D	0.99150	-5.49;-5.49	5.46	5.46	0.80206	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.055142	0.64402	D	0.000001	D	0.99180	0.9716	M	0.72353	2.195	0.38931	D	0.957951	D;D	0.89917	1.0;1.0	D;D	0.87578	0.989;0.998	D	0.99936	1.1362	10	0.87932	D	0	-12.444	17.9229	0.88973	0.0:1.0:0.0:0.0	.	233;254	Q3L8U2;P29965	.;CD40L_HUMAN	K	254;233	ENSP00000359663:T254K;ENSP00000359662:T233K	ENSP00000359662:T233K	T	+	2	0	CD40LG	135569215	0.996000	0.38824	0.913000	0.36048	0.904000	0.53231	3.754000	0.55189	2.273000	0.75805	0.594000	0.82650	ACG		0.507	CD40LG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058501.1	NM_000074		66	15	1	0	9.5e-31	1.33e-30	66	15				
MAGEC1	9947	broad.mit.edu	37	X	140993927	140993927	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chrX:140993927T>A	ENST00000285879.4	+	4	1023	c.737T>A	c.(736-738)cTg>cAg	p.L246Q	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	246										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TCCACTTTACTGAGTCTTTTC	0.498										HNSCC(15;0.026)																												uc004fbt.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(736-738)CTG>CAG		melanoma antigen family C, 1							70.0	57.0	61.0					X																	140993927		2172	4110	6282	SO:0001583	missense	9947						protein binding	g.chrX:140993927T>A	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.737T>A	X.37:g.140993927T>A	ENSP00000285879:p.Leu246Gln	HNSCC(15;0.026)	Somatic				MAGEC1_uc010nsl.1_Intron	p.L246Q	NM_005462	NP_005453	WXS	Illumina HiSeq	Unspecified	O60732	MAGC1_HUMAN			4	1023	+	Acute lymphoblastic leukemia(192;6.56e-05)		246					A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	c.737T>A	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	t	7.709	0.694704	0.15039	.	.	ENSG00000155495	ENST00000285879;ENST00000370511;ENST00000370510	T;T	0.14516	3.52;2.5	.	.	.	.	.	.	.	.	T	0.10680	0.0261	N	0.08118	0	0.80722	D	1	P	0.51240	0.943	P	0.55011	0.766	T	0.29731	-1.0002	8	0.87932	D	0	.	4.4859	0.11790	0.0:7.0E-4:0.0:0.9993	.	246	O60732	MAGC1_HUMAN	Q	246;48;47	ENSP00000285879:L246Q;ENSP00000359542:L48Q	ENSP00000285879:L246Q	L	+	2	0	MAGEC1	140821593	0.001000	0.12720	0.127000	0.21898	0.127000	0.20565	-0.228000	0.09114	0.046000	0.15833	0.046000	0.15203	CTG		0.498	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		207	38	0	0	0	0	207	38				
GRIK4	2900	broad.mit.edu	37	11	120690619	120690620	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr11:120690619_120690620insA	ENST00000527524.2	+	6	788_789	c.501_502insA	c.(502-504)aaafs	p.K168fs	GRIK4_ENST00000438375.2_Frame_Shift_Ins_p.K168fs	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	168					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		TCATCTGTGCCAAAGCAGAATG	0.569																																						uc001pxn.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(499-504)GCCAAAfs		glutamate receptor KA1 precursor	L-Glutamic Acid(DB00142)																																			SO:0001589	frameshift_variant	2900				glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr11:120690619_120690620insA	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.504dupA	11.37:g.120690622_120690622dupA	ENSP00000435648:p.Lys168fs		Somatic				GRIK4_uc009zav.1_Frame_Shift_Ins_p.A167fs|GRIK4_uc009zaw.1_Frame_Shift_Ins_p.A167fs|GRIK4_uc009zax.1_Frame_Shift_Ins_p.A167fs	p.A167fs	NM_014619	NP_055434	WXS	Illumina HiSeq	Unspecified	Q16099	GRIK4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	6	788_789	+		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)	167_168			Extracellular (Potential).		A8K9L1	Frame_Shift_Ins	INS	ENST00000527524.2	37	c.501_502insA	CCDS8433.1																																																																																				0.569	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619		111	70	NA	NA	NA	NA	111	70	---	---	---	---
KMT2D	8085	broad.mit.edu	37	12	49445506	49445506	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr12:49445506delA	ENST00000301067.7	-	10	1959	c.1960delT	c.(1960-1962)tccfs	p.S654fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	654	15 X 5 AA repeats of S/P-P-P-E/P-E/A.|Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GGCAGGGGGGATAGGCGCGAT	0.637																																						uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		0				kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(1960-1962)TCCfs		myeloid/lymphoid or mixed-lineage leukemia 2							40.0	45.0	44.0					12																	49445506		2105	4211	6316	SO:0001589	frameshift_variant	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49445506delA	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.1960delT	12.37:g.49445506delA	ENSP00000301067:p.Ser654fs	HNSCC(34;0.089)	Somatic					p.S654fs	NM_003482	NP_003473	WXS	Illumina HiSeq	Unspecified	O14686	MLL2_HUMAN			10	1960	-			654			15 X 5 AA repeats of S/P-P-P-E/P-E/A.|Pro-rich.		O14687	Frame_Shift_Del	DEL	ENST00000301067.7	37	c.1960delT	CCDS44873.1																																																																																				0.637	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			31	52	NA	NA	NA	NA	31	52	---	---	---	---
SUPT20H	55578	broad.mit.edu	37	13	37619383	37619383	+	Splice_Site	DEL	C	C	-			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr13:37619383delC	ENST00000350612.6	-	6	513		c.e6+1		SUPT20H_ENST00000360252.4_Splice_Site|SUPT20H_ENST00000475892.1_Splice_Site|SUPT20H_ENST00000464744.1_Splice_Site|SUPT20H_ENST00000542180.1_Splice_Site|SUPT20H_ENST00000470359.2_Splice_Site|SUPT20H_ENST00000356185.3_Splice_Site	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)						autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										GAGGGTCTTACCTGATCCGTT	0.413																																						uc001uwg.2		NA																	0					0						c.e6+1		family with sequence similarity 48, member A							92.0	90.0	91.0					13																	37619383		2203	4300	6503	SO:0001630	splice_region_variant	55578				autophagy|gastrulation	SAGA-type complex	protein binding	g.chr13:37619383delC	AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.292+1G>-	13.37:g.37619383delC			Somatic				FAM48A_uc010abt.2_Splice_Site_p.D99_splice|FAM48A_uc001uwh.2_Splice_Site_p.D99_splice|FAM48A_uc001uwi.2_Splice_Site_p.D98_splice|FAM48A_uc001uwj.2_Splice_Site_p.D99_splice|FAM48A_uc001uwk.2_Splice_Site_p.D98_splice|FAM48A_uc010tes.1_Splice_Site_p.D86_splice|FAM48A_uc001uwl.1_Splice_Site_p.D98_splice	p.D98_splice	NM_001014286	NP_001014308	WXS	Illumina HiSeq	Unspecified	Q8NEM7	FA48A_HUMAN		all cancers(112;6.06e-07)|Epithelial(112;1.87e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00794)|BRCA - Breast invasive adenocarcinoma(63;0.0128)|GBM - Glioblastoma multiforme(144;0.0477)	6	540	-		Lung NSC(96;2.09e-06)|Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.0959)						E7ER46|Q71RF3|Q9Y6A6	Splice_Site	DEL	ENST00000350612.6	37	c.292_splice	CCDS31959.1																																																																																				0.413	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354766.1	NM_017569	Intron	22	41	NA	NA	NA	NA	22	41	---	---	---	---
LILRB2	10288	broad.mit.edu	37	19	54782747	54782747	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr19:54782747delC	ENST00000391749.4	-	6	1146	c.875delG	c.(874-876)ggcfs	p.G292fs	LILRB2_ENST00000391748.1_Frame_Shift_Del_p.G292fs|LILRB2_ENST00000314446.5_Frame_Shift_Del_p.G292fs|LILRB2_ENST00000434421.1_Frame_Shift_Del_p.G176fs|LILRB2_ENST00000471216.1_5'Flank|LILRB2_ENST00000391746.1_Frame_Shift_Del_p.G292fs	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	292	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCTGTACTGGCCCCCGTAGGA	0.677																																						uc002qfb.2		NA																	0				skin(1)	1						c.(874-876)GGCfs		leukocyte immunoglobulin-like receptor,							36.0	36.0	36.0					19																	54782747		2203	4291	6494	SO:0001589	frameshift_variant	10288				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity	g.chr19:54782747delC	AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.875delG	19.37:g.54782747delC	ENSP00000375629:p.Gly292fs		Somatic				LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Frame_Shift_Del_p.G292fs|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Frame_Shift_Del_p.G292fs|LILRB2_uc010yet.1_Frame_Shift_Del_p.G176fs|LILRB2_uc010yeu.1_RNA	p.G292fs	NM_005874	NP_005865	WXS	Illumina HiSeq	Unspecified	Q8N423	LIRB2_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	6	1141	-	Ovarian(34;0.19)		292			Extracellular (Potential).|Ig-like C2-type 3.		A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Frame_Shift_Del	DEL	ENST00000391749.4	37	c.875delG	CCDS12886.1																																																																																				0.677	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1			47	50	NA	NA	NA	NA	47	50	---	---	---	---
THADA	63892	broad.mit.edu	37	2	43801749	43801751	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:43801749_43801751delCAT	ENST00000405006.4	-	11	1804_1806	c.1453_1455delATG	c.(1453-1455)atgdel	p.M485del	THADA_ENST00000403856.1_In_Frame_Del_p.M485del|THADA_ENST00000405975.2_In_Frame_Del_p.M485del|THADA_ENST00000415080.2_In_Frame_Del_p.M195del|THADA_ENST00000404790.1_In_Frame_Del_p.M485del|THADA_ENST00000402360.2_In_Frame_Del_p.M485del|THADA_ENST00000330266.7_In_Frame_Del_p.M195del	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	485										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				ACTGGTCTCCCATCACCTCTAAG	0.394																																						uc002rsw.3		NA																	0				ovary(2)|skin(1)	3						c.(1453-1455)ATGdel		thyroid adenoma associated																																				SO:0001651	inframe_deletion	63892						binding	g.chr2:43801749_43801751delCAT	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.1453_1455delATG	2.37:g.43801749_43801751delCAT	ENSP00000385995:p.Met485del		Somatic				THADA_uc002rsx.3_In_Frame_Del_p.M485del|THADA_uc002rsy.3_RNA|THADA_uc010fas.1_RNA|THADA_uc002rsz.2_In_Frame_Del_p.M195del|THADA_uc002rta.2_In_Frame_Del_p.M195del|THADA_uc002rtb.1_In_Frame_Del_p.M485del|THADA_uc002rtc.3_In_Frame_Del_p.M485del|THADA_uc002rtd.2_In_Frame_Del_p.M485del	p.M485del	NM_001083953	NP_001077422	WXS	Illumina HiSeq	Unspecified	Q6YHU6	THADA_HUMAN			11	1805_1807	-		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)	485					A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	In_Frame_Del	DEL	ENST00000405006.4	37	c.1453_1455delATG	CCDS46268.1																																																																																				0.394	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065		8	189	NA	NA	NA	NA	8	189	---	---	---	---
SPHKAP	80309	broad.mit.edu	37	2	228883596	228883596	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr2:228883596delG	ENST00000392056.3	-	7	2020	c.1974delC	c.(1972-1974)tgcfs	p.C658fs	SPHKAP_ENST00000344657.5_Frame_Shift_Del_p.C658fs	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	658						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CATTTTCTGAGCACAGGGTCT	0.433																																						uc002vpq.2		NA																	0				skin(5)|ovary(4)|lung(1)	10						c.(1972-1974)TGCfs		sphingosine kinase type 1-interacting protein							164.0	151.0	155.0					2																	228883596		2203	4300	6503	SO:0001589	frameshift_variant	80309					cytoplasm	protein binding	g.chr2:228883596delG		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1974delC	2.37:g.228883596delG	ENSP00000375909:p.Cys658fs		Somatic				SPHKAP_uc002vpp.2_Frame_Shift_Del_p.C658fs|SPHKAP_uc010zlx.1_Frame_Shift_Del_p.C658fs	p.C658fs	NM_001142644	NP_001136116	WXS	Illumina HiSeq	Unspecified	Q2M3C7	SPKAP_HUMAN		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	7	2021	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	658					Q68DA3|Q68DR8|Q9C0I5	Frame_Shift_Del	DEL	ENST00000392056.3	37	c.1974delC	CCDS46537.1																																																																																				0.433	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623		107	51	NA	NA	NA	NA	107	51	---	---	---	---
SLC24A3	57419	broad.mit.edu	37	20	19566110	19566110	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr20:19566110delG	ENST00000328041.6	+	6	731	c.534delG	c.(532-534)gtgfs	p.V178fs		NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3	178					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						AAGGCGATGTGGGAGTTGGCA	0.547																																						uc002wrl.2		NA																	0				ovary(1)	1						c.(532-534)GTGfs		solute carrier family 24							283.0	249.0	260.0					20																	19566110		2203	4300	6503	SO:0001589	frameshift_variant	57419					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity	g.chr20:19566110delG	AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.534delG	20.37:g.19566110delG	ENSP00000333519:p.Val178fs		Somatic					p.V178fs	NM_020689	NP_065740	WXS	Illumina HiSeq	Unspecified	Q9HC58	NCKX3_HUMAN			6	731	+			178			Extracellular (Potential).|Alpha-1.		B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	Frame_Shift_Del	DEL	ENST00000328041.6	37	c.534delG	CCDS13140.1																																																																																				0.547	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078207.4	NM_020689		21	174	NA	NA	NA	NA	21	174	---	---	---	---
GPR128	84873	broad.mit.edu	37	3	100349575	100349576	+	Frame_Shift_Ins	INS	-	-	TT	rs146877111		TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:100349575_100349576insTT	ENST00000273352.3	+	3	524_525	c.256_257insTT	c.(256-258)atgfs	p.M86fs		NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	86					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						TAGTACCTATATGGGTTTTACT	0.317																																					Pancreas(87;185 1975 7223 18722)	uc003duc.2		NA																	0				ovary(3)|skin(1)	4						c.(256-258)ATGfs		G protein-coupled receptor 128 precursor																																				SO:0001589	frameshift_variant	84873				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr3:100349575_100349576insTT	AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	Exception_encountered	3.37:g.100349575_100349576insTT	ENSP00000273352:p.Met86fs		Somatic					p.M86fs	NM_032787	NP_116176	WXS	Illumina HiSeq	Unspecified	Q96K78	GP128_HUMAN			3	524_525	+			86			Extracellular (Potential).		Q14D94|Q86SQ2	Frame_Shift_Ins	INS	ENST00000273352.3	37	c.256_257insTT	CCDS2938.1																																																																																				0.317	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353236.1			33	120	NA	NA	NA	NA	33	120	---	---	---	---
TRAT1	50852	broad.mit.edu	37	3	108572466	108572466	+	Splice_Site	DEL	G	G	-			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:108572466delG	ENST00000295756.6	+	6	533		c.e6-1		TRAT1_ENST00000426646.1_Splice_Site	NM_016388.2	NP_057472.2	Q6PIZ9	TRAT1_HUMAN	T cell receptor associated transmembrane adaptor 1						cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of receptor recycling (GO:0001920)|negative regulation of transport (GO:0051051)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell receptor signaling pathway (GO:0050862)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(3)	28						CTTTCTTTTAGGCAACCAATG	0.403																																						uc003dxi.1		NA																	0				skin(1)	1						c.e6-1		T-cell receptor interacting molecule							112.0	109.0	110.0					3																	108572466		2203	4300	6503	SO:0001630	splice_region_variant	50852				cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity	g.chr3:108572466delG	AJ240084	CCDS33813.1	3q13	2005-05-04	2005-05-04	2005-05-04	ENSG00000163519	ENSG00000163519			30698	protein-coding gene	gene with protein product		604962	"""T cell receptor interacting molecule"""	TCRIM		10663578, 9687533	Standard	NM_016388		Approved	HSPC062, TRIM	uc003dxi.1	Q6PIZ9	OTTHUMG00000159198	ENST00000295756.6:c.304-1G>-	3.37:g.108572466delG			Somatic				TRAT1_uc010hpx.1_Splice_Site_p.A65_splice	p.A102_splice	NM_016388	NP_057472	WXS	Illumina HiSeq	Unspecified	Q6PIZ9	TRAT1_HUMAN			6	448	+								Q9NZX5	Splice_Site	DEL	ENST00000295756.6	37	c.304_splice	CCDS33813.1																																																																																				0.403	TRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353794.1	NM_016388	Intron	50	215	NA	NA	NA	NA	50	215	---	---	---	---
PLXND1	23129	broad.mit.edu	37	3	129293227	129293227	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BA-4076-01A-01D-1434-08	TCGA-BA-4076-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	93dda6a6-907d-4dc2-9391-36dd09c767c6	d6c21ecb-1cb2-45fd-84c0-186287708883	g.chr3:129293227delC	ENST00000324093.4	-	12	2815	c.2637delG	c.(2635-2637)gggfs	p.G879fs	PLXND1_ENST00000393239.1_Frame_Shift_Del_p.G879fs	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	879					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						GCTGCAGAGGCCCCCGCAGGC	0.687																																					Ovarian(97;366 1484 3738 22084 39045)	uc003emx.2		NA																	0				large_intestine(1)	1						c.(2635-2637)GGGfs		plexin D1 precursor							14.0	17.0	16.0					3																	129293227		2196	4290	6486	SO:0001589	frameshift_variant	23129				axon guidance	integral to membrane|intracellular|plasma membrane		g.chr3:129293227delC	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.2637delG	3.37:g.129293227delC	ENSP00000317128:p.Gly879fs		Somatic					p.G879fs	NM_015103	NP_055918	WXS	Illumina HiSeq	Unspecified	Q9Y4D7	PLXD1_HUMAN			12	2737	-			879			Extracellular (Potential).		A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Frame_Shift_Del	DEL	ENST00000324093.4	37	c.2637delG	CCDS33854.1																																																																																				0.687	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103		10	25	NA	NA	NA	NA	10	25	---	---	---	---
